Mercurial > repos > devteam > fastq_paired_end_joiner

<tool id="fastq_paired_end_joiner" name="FASTQ joiner" version="2.0.1">
  <description>on paired end reads</description>
  <requirements>
    <requirement type="package" version="1.0.1">galaxy_sequence_utils</requirement>
  </requirements>
  <command interpreter="python">fastq_paired_end_joiner.py '$input1_file' '${input1_file.extension[len( 'fastq' ):]}' '$input2_file' '${input2_file.extension[len( 'fastq' ):]}' '$output_file' '$style' '${paste_sequence}'</command>
  <inputs>
    <param name="input1_file" type="data" format="fastqsanger,fastqcssanger" label="Left-hand Reads" />
    <param name="input2_file" type="data" format="fastqsanger,fastqcssanger" label="Right-hand Reads" />
    <param name="style" type="select" label="FASTQ Header Style">
      <option value="old" selected="true">old</option>
      <option value="new">new</option>
    </param>
    <param name="paste_sequence" type="text" label="Bases to insert between joined reads" value="" help="Values are in Base-space and quality scores of maximal value will be used"/>
  </inputs>
  <outputs>
    <data name="output_file" format="input" />
  </outputs>
  <tests>
    <test>
      <param name="input1_file" value="split_pair_reads_1.fastqsanger" ftype="fastqsanger" />
      <param name="input2_file" value="split_pair_reads_2.fastqsanger" ftype="fastqsanger" />
      <output name="output_file" file="3.fastqsanger" />
    </test>
  </tests>
  <help>
**What it does**

This tool joins paired end FASTQ reads from two separate files into a
single read in one file.  The join is performed using sequence
identifiers, allowing the two files to contain differing ordering.  If
a sequence identifier does not appear in both files, it is excluded
from the output.

-----

**Input formats**

Both old and new (from recent Illumina software) style FASTQ headers
are supported.  The following example uses the "old" style.

Left-hand Read::

    @HWI-EAS91_1_30788AAXX:7:21:1542:1758/1
    GTCAATTGTACTGGTCAATACTAAAAGAATAGGATC
    +HWI-EAS91_1_30788AAXX:7:21:1542:1758/1
    hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh

Right-hand Read::

    @HWI-EAS91_1_30788AAXX:7:21:1542:1758/2
    GCTCCTAGCATCTGGAGTCTCTATCACCTGAGCCCA
    +HWI-EAS91_1_30788AAXX:7:21:1542:1758/2
    hhhhhhhhhhhhhhhhhhhhhhhh`hfhhVZSWehR

-----

**Output**

A multiple-fastq file, for example::

    @HWI-EAS91_1_30788AAXX:7:21:1542:1758
    GTCAATTGTACTGGTCAATACTAAAAGAATAGGATCGCTCCTAGCATCTGGAGTCTCTATCACCTGAGCCCA
    +HWI-EAS91_1_30788AAXX:7:21:1542:1758
    hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh`hfhhVZSWehR

------

**The "new" style**

Recent Illumina FASTQ headers are structured as follows::

  @COORDS FLAGS
  COORDS = INSTRUMENT:RUN_#:FLOWCELL_ID:LANE:TILE:X:Y
  FLAGS = READ:IS_FILTERED:CONTROL_NUMBER:INDEX_SEQUENCE

where the whitespace character between COORDS and FLAGS can be either
a space or a tab.

------

**Credits**

This is an extended version (adds support for "new" style FASTQ headers)
of D. Blankenberg's fastq joiner:

`Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. &lt;http://www.ncbi.nlm.nih.gov/pubmed/20562416&gt;`_

New style header support added by Simone Leo &lt;simone.leo@crs4.it&gt;
  </help>

  <citations>
    <citation type="doi">10.1093/bioinformatics/btq281</citation>
  </citations>

</tool>
author	devteam
date	Wed, 16 Dec 2015 14:30:33 -0500
parents	41ab1243e8f9
children	080a058abf1e