IMPORTANT. Only works for BLAT standard or pslx output formats (hint: to output pslx format, add -out=pslx in the command).

What it does

The tool will generate a table of 6 columns as following:

• 1st column: chromosome id.
• 2nd column: chromosome location.
• 3rd column: the nucleotide from reference genome at the chromosome location (2nd column).
• 4th column: total coverage of the reads (number of reads that were mapped to the chromosome location).
• 5th column: percentage of reads that support nucleotide A at this location.
• 6th column: percentage of reads that support nucleotide T at this location.
• 7th column: percentage of reads that support nucleotide C at this location.
• 8th column: percentage of reads that support nucleotide G at this location.

Example

• The BLAT pslx results look like the following (tab separated with sequence at the end):

  30      0       0       0       0       0       0       0       +       seq0    30      0       30      chr     4639675 4549207 4549237 1       30,     0,      4549207,        cggacagcgccgccaccaacaaagccacca, cggacagcgccgccaccaacaaagccacca,
  30      0       0       0       0       0       0       0       +       seq1    30      0       30      chr     4639675 614777  614807  1       30,     0,      614777,         aaaacaccggatgctccggcgctggcagat, aaaacaccggatgctccggcgctggcagat,
  28      1       0       0       0       0       0       0       +       seq2    30      0       29      chr     4639675 3289283 3289312 1       29,     0,      3289283,        tttgcttttagtacaccggattcagaacc,  tttgctttcagtacaccggattcagaacc,
  30      0       0       0       0       0       0       0       +       seq4    30      0       30      chr     4639675 2665584 2665614 1       30,     0,      2665584,        cacgctacgtgcgcccccgcccagaaggcg, cacgctacgtgcgcccccgcccagaaggcg,
  
  The 14th column is the chromosome id, and the 16th and 17th columns shows the reads were mapped to chromosome start and end locations.
  

• The report showed overall coverage of reads on each chromosome location (partial result):

  +-------+----------+------+------+--------+------+--------+------+
  | title | location | ref. | cov. |   A    |  T   |   C    |  G   |
  +-------+----------+------+------+--------+------+--------+------+
  |   chr |   614777 |  A   |  1   | A(100) | T(0) |   C(0) | G(0) |
  |   chr |   614778 |  A   |  1   | A(100) | T(0) |   C(0) | G(0) |
  |   chr |   614779 |  A   |  1   | A(100) | T(0) |   C(0) | G(0) |
  +-------+----------+------+------+--------+------+--------+------+
  

Reference

BLAT: Kent, W James, BLAT--the BLAST-like alignment tool. (2002) Genome Research:12(4) 656-664.