Galaxy |

NuPoP (version 0.1)

DNA sequence:

The FASTA file contains DNA sequence.

Maximum length of Linker (bp):

An integer for the maximum allowable linker DNA length. Typical values are between 100 and 500.

Order of Markov model:

An integer 1 or 4, represents the first or fourth order Markov chain.

Linker length distribution update times:

An integer 0-5. If a sequence is shorter than 200K, this option is coerced as ”0” as sequence may be not long enough to provide meaningful estimate of the distribution.

Species:

Select species according to the source sequence. If your intented species is not listed, choose a species on the list that is evolutionary closest to the one under prediction.

Output format:

See about format section.

What it does

NuPoP is a software tool for Nucleosome Positioning Prediction. For more information on NuPoP and the methods, please refer to here

Example

DNA sequence in FASTA format:

>CHR1
CCCTAAACCCTAAACCCTAAACCCTAAACCTCTGAATCCTTAATCCCTAAATCCCTAAAT
CTTTAAATCCTACATCCATGAATCCCTAAATACCTAATTCCCTAAACCCGAAACCGGTTT
CTCTGGTTGAAAATCATTGTGTATATAATGATAATTTTATCGTTTTTATGTAATTGCTTA
TTGTTGTGTGTAGATTTTTTAAAAATATCATTTGAGGTCAATACAAATCCTATTTCTTGT
GGTTTTCTTTCCTTCACTTAGCTATGGATGGTTTATCTTCATTTGTTATATTGGATACAA

Prediction result in text format:

Chromosome/Contig = CHR1
Position  P-start Occup  N/L  Affinity
1  0.000   0.000   0    2.843
2  0.032   0.032   0    2.839
3  0.840   0.872   1    2.815
4  0.001   0.872   1    2.814

or in Wiggle fixedStep format:

track type=wiggle_0 name="Nucleosome_Position_Prediction" description="Genome source Homo sapiens"
fixedStep chrom=CHR1 start=1 step=1 span=1
0.000
0.032
0.872
0.872

About formats

FASTA format A sequence in FASTA format begins with a single-line description, followed by lines of sequence data. The description line is distinguished from the sequence data by a greater-than (">") symbol in the first column. The token until the first space or the end of the line is used as identifier for the sequence. The remainer of the description line will be ignored.

Prediction result format The prediction results including nucleosome occupancy score, Viterbi prediction and nucleosome affinity score with the corresponding position in the genome sequence.

Wiggle fixedStep format The data is introduced by a line beginning with the keyword "fixedStep", and the arguments "chrom", "start", "step" and "span". The arguments are indicating the chromosome on which the features are located, starting position of the first feature, the spacing between each feature and the width of each feature in base pair respectively.