Galaxy tool preview

FastQC (version 1.0.0)
Two fields per line separated by a TAB: name DNA_sequence. For example: Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA

What it does

FastQC is a product of Bioinformatics Group at the Babraham Institute. FastQC aims to provide a simple way to do some quality control checks on raw sequence data coming from high throughput sequencing pipelines. It provides a modular set of analyses which you can use to give a quick impression of whether your data has any problems of which you should be aware before doing any further analysis.

The main functions of FastQC are:

- Import of data from BAM, SAM or FastQ files (any variant)
- Provding a quick overview to tell you in which areas there may be problems
- Summary graphs and tables to quickly assess your data
- Export of results to an HTML based permanent report
- Offline operation to allow automated generation of reports without running the interactive application

Input format

Any fastq file, for example:

@HWI-EAS91_1_30788AAXX:7:21:1542:1758
GTCAATTGTACTGGTCAATACTAAAAGAATAGGATCGCTCCTAGCATCTGGAGTCTCTATCACCTGAGCCCA
+HWI-EAS91_1_30788AAXX:7:21:1542:1758
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh`hfhhVZSWehR

Contaminants format

An optional contaminant file (otherwise FastQC will use the default):

# This file contains a list of potential contaminants which are
# frequently found in high throughput sequencing reactions.  These
# are mostly sequences of adapters / primers used in the various
# sequencing chemistries.
#
# You can add more sequences to the file by putting one line per entry
# and specifying a name[tab]sequence.  If the contaminant you add is
# likely to be of use to others please consider sending it to the FastQ
# authors, either via a bug report at www.bioinformatics.bbsrc.ac.uk/bugzilla/
# or by directly emailing simon.andrews@bbsrc.ac.uk so other users of
# the program can benefit.
Illumina Single End Apapter 1   ACACTCTTTCCCTACACGACGCTGTTCCATCT
Illumina Single End Apapter 2   CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT
Illumina Single End PCR Primer 1        AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
Illumina Single End PCR Primer 2        CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT
Illumina Single End Sequencing Primer   ACACTCTTTCCCTACACGACGCTCTTCCGATCT

Outputs

An HTML file with links to:

- fastqc_report.html
- summary.txt
- fastqc_data.txt