Galaxy tool preview

FastqMcf (version 1.0)
Default is to determine automatically

What it does

fastq-mcf attempts to:

Detect and remove sequencing adapters and primers Detect limited skewing at the ends of reads and clip Detect poor quality at the ends of reads and clip Detect N's, and remove from ends Remove reads with CASAVA 'Y' flag (purity filtering) Discard sequences that are too short after all of the above Keep multiple mate-reads in sync while doing all of the above

System Message: WARNING/2 (<string>, line 15)

Explicit markup ends without a blank line; unexpected unindent.

Input

Fasta file of adapter sequences, for example:

> Genomic_DNA_oligonucleotide_sequences_Adapters_F
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG
> Genomic_DNA_oligonucleotide_sequences_Adapters_R
ACACTCTTTCCCTACACGACGCTCTTCCGATCT
> Genomic_DNA_Sequencing_Primer
ACACTCTTTCCCTACACGACGCTCTTCCGATCT

Reads or Left-hand mates, for example:

@1539:931/1
ACTTCCCGCGCGTGAAGGCGCCGGCAAACGAGGCTCGGGAAGGGGCTCCCG
+1539:931/1
BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB

Right-hand mates, for example:

@1539:931/2
CGCCATTCCGAATCGTAGTTGTCGGCGTCTTCCAGTGCGGCAAGGCATCGT
+1539:931/2
WNUUZ\P^`BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB

Output

A log file

A trimmed fastq of the reads

A trimmed fastq of the mates