Next changeset 1:cf59a9ae0efe (2013-12-01) |
Commit message:
Migrated tool version 0.1 from old tool shed archive to new tool shed repository |
added:
rgclustal/README rgclustal/rgClustal_testin.fasta rgclustal/rgClustal_testout.fasta rgclustal/rgClustal_testout.log rgclustal/rgClustalw.xml |
b |
diff -r 000000000000 -r 8888e4e3f169 rgclustal/README --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/rgclustal/README Tue Jun 07 17:05:43 2011 -0400 |
b |
@@ -0,0 +1,49 @@ +This is a wrapper for ClustalW. + +This tool allows you to align multiple sequences in Galaxy, using ClustalW2_ with mostly default options which should work reasonably well for many alignments. +DNA or protein sequences can be aligned. The input file must be a fasta file in your current history. + +The alignments will appear as a clustal format file or optionally, as phylip or fasta format files in your history and a text log will be output to your history +showing the output Clustalw would normally write to standard output. + +If Clustal format is chosen, you have the option of adding basepair counts to the output + +A subsequence of the alignment can be output by setting the Output complete parameter to "Partial" and defining the offset and end of the subsequence to be output + +**Installation** + +Make sure clustalw2 is available on the path for all your nodes + +Move the test data files to your galaxy root test-data +Move the xml file to a subdirectory of your tools folder (eg rgenetics/) and then add a line in your tool_conf.xml to point there. +Run +sh run_functional_tests.sh -id clustalw +to make sure the tests work + +then restart Galaxy and you should be good to go. + +**Attribution** + +Clustal attribution and associated documentation are available at http://www.clustal.org + +An implementation of a Galaxy Clustal wrapper was written by Hans-Rudolf Hotz in an email on the developer list - +http://lists.bx.psu.edu/pipermail/galaxy-dev/2010-November/003732.html + +This version by Ross Lazarus for the rgenetics project, builds on Hans-Rudolf's code, adding some additional controls and a log file. It also +deals with stderr so Cluastalw2 writing there doesn't cause the job to error out. That's encoded in the tail of the command line. + +**License** + +Assuming Hans-Rudolf is ok with a new license for this derived work, this version of his wrapper is LGPL like other rgenetics artefacts + +Written by Ross Lazarus for the Rgenetics project + +Copyright Ross Lazarus at gmail com 2011 + +All rights reserved. + +Released under the LGPL - see http://www.gnu.org/copyleft/lesser.html + + + + |
b |
diff -r 000000000000 -r 8888e4e3f169 rgclustal/rgClustal_testin.fasta --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/rgclustal/rgClustal_testin.fasta Tue Jun 07 17:05:43 2011 -0400 |
b |
@@ -0,0 +1,25 @@ +>c_briggsae-chrII(+)/43862-46313 +ATGAGCTTCCACAAAAGCATGAGCTTTCTCAGCTTCTGCCACATCAGCATTCAAATGATC +>c_remanei-Crem_Contig172(-)/123228-124941 +ATGAGCCTCTACAACCGCATGATTCTTTTCAGCCTCTGCCACGTCCGCATTCAAATGCTC +>c_brenneri-Cbre_Contig60(+)/627772-630087 +ATGAGCCTCCACAACAGCATGATTTTTCTCGGCTTCCGCCACATCCGCATTCAAATGATC +>c_elegans-II(+)/9706834-9708803 +ATGAGCCTCTACTACAGCATGATTCTTCTCAGCTTCTGCAACGTCAGCATTCAGATGATC +>c_briggsae-chrIfooI(+)/43862-46313 +CGCACAAATATGATGCACAAATCCACAACCTAAAGCATCTCCGATAACGTTGACCGAAGT +>c_remanei-Crem_Contig172foo(-)/123228-124941 +AGCACAAATGTAATGAACGAATCCGCATCCCAACGCATCGCCAATCACATTCACAGATGT +>c_brenneri-Cbre_Contig60gak(+)/627772-630087 +CGCACAAATGTAGTGGACAAATCCGCATCCCAAAGCGTCTCCGATAACATTTACCGAAGT +>c_elegans-II(+)more/9706834-9708803 +TGCACAAATGTGATGAACGAATCCACATCCCAATGCATCACCGATCACATTGACAGATGT +>c_briggsae-chrII(+)bar/43862-46313 +CCGGAGTCGATCCCTGAAT----------------------------------------- +>c_remanei-Crem_Contig172zot(-)/123228-124941 +ACGAAGTCGGTCCCTATAAGGTATGATTTTATATGA----TGTACCATAAGGAAATAGTC +>c_brenneri-Cbre_Contig60fee(+)/627772-630087 +ACGAAGTCGATCCCTGAAA---------TCAGATGAGCGGTTGACCA---GAGAACAACC +>c_elegans-II(+)meh/9706834-9708803 +ACGAAGTCGGTCCCTGAAC--AATTATTT----TGA----TATA---GAAAGAAACGGTA + |
b |
diff -r 000000000000 -r 8888e4e3f169 rgclustal/rgClustal_testout.fasta --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/rgclustal/rgClustal_testout.fasta Tue Jun 07 17:05:43 2011 -0400 |
b |
@@ -0,0 +1,48 @@ +>c_briggsae-chrII_+_ +---ATGAGCTTCCACAAAAGCATGAGCTTT +CTCAGCTTCTGCCACATCAGCATTCAAATG +ATC +>c_brenneri-Cbre_Contig60_+_ +---ATGAGCCTCCACAACAGCATGATTTTT +CTCGGCTTCCGCCACATCCGCATTCAAATG +ATC +>c_remanei-Crem_Contig172_-_ +---ATGAGCCTCTACAACCGCATGATTCTT +TTCAGCCTCTGCCACGTCCGCATTCAAATG +CTC +>c_elegans-II_+_ +---ATGAGCCTCTACTACAGCATGATTCTT +CTCAGCTTCTGCAACGTCAGCATTCAGATG +ATC +>c_briggsae-chrII_+_bar +---CCGGAGTCGATCCCTGAAT-------- +------------------------------ +--- +>c_brenneri-Cbre_Contig60fee_+_ +---ACGAAGTCGATCCCTGAAA-------- +-TCAGATGAGCGGTTGACCA---GAGAACA +ACC +>c_remanei-Crem_Contig172zot_-_ +---ACGAAGTCGGTCCCTATAAGGTATGAT +TTTATATGA----TGTACCATAAGGAAATA +GTC +>c_elegans-II_+_meh +---ACGAAGTCGGTCCCTGAAC--AATTAT +TT----TGA----TATA---GAAAGAAACG +GTA +>c_briggsae-chrIfooI_+_ +CGCACAAATATGATGCACAAATCCACAACC +TAAAGCATCTCCGATAACGTTGACCGAAGT +--- +>c_brenneri-Cbre_Contig60gak_+_ +CGCACAAATGTAGTGGACAAATCCGCATCC +CAAAGCGTCTCCGATAACATTTACCGAAGT +--- +>c_remanei-Crem_Contig172foo_-_ +AGCACAAATGTAATGAACGAATCCGCATCC +CAACGCATCGCCAATCACATTCACAGATGT +--- +>c_elegans-II_+_more +TGCACAAATGTGATGAACGAATCCACATCC +CAATGCATCACCGATCACATTGACAGATGT +--- |
b |
diff -r 000000000000 -r 8888e4e3f169 rgclustal/rgClustal_testout.log --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/rgclustal/rgClustal_testout.log Tue Jun 07 17:05:43 2011 -0400 |
[ |
@@ -0,0 +1,112 @@ + + + + CLUSTAL 2.1 Multiple Sequence Alignments + + +Sequence type explicitly set to DNA +Sequence format is Pearson +Sequence 1: c_briggsae-chrII_+_/43862-46313 60 bp +Sequence 2: c_remanei-Crem_Contig172_-_/123228-124941 60 bp +Sequence 3: c_brenneri-Cbre_Contig60_+_/627772-630087 60 bp +Sequence 4: c_elegans-II_+_/9706834-9708803 60 bp +Sequence 5: c_briggsae-chrIfooI_+_/43862-46313 60 bp +Sequence 6: c_remanei-Crem_Contig172foo_-_/123228-124941 60 bp +Sequence 7: c_brenneri-Cbre_Contig60gak_+_/627772-630087 60 bp +Sequence 8: c_elegans-II_+_more/9706834-9708803 60 bp +Sequence 9: c_briggsae-chrII_+_bar/43862-46313 60 bp +Sequence 10: c_remanei-Crem_Contig172zot_-_/123228-124941 60 bp +Sequence 11: c_brenneri-Cbre_Contig60fee_+_/627772-630087 60 bp +Sequence 12: c_elegans-II_+_meh/9706834-9708803 60 bp +Start of Pairwise alignments +Aligning... + +Sequences (1:2) Aligned. Score: 80 +Sequences (1:3) Aligned. Score: 88 +Sequences (1:4) Aligned. Score: 83 +Sequences (1:5) Aligned. Score: 21 +Sequences (1:6) Aligned. Score: 20 +Sequences (1:7) Aligned. Score: 23 +Sequences (1:8) Aligned. Score: 18 +Sequences (1:9) Aligned. Score: 21 +Sequences (1:10) Aligned. Score: 16 +Sequences (1:11) Aligned. Score: 25 +Sequences (1:12) Aligned. Score: 10 +Sequences (2:3) Aligned. Score: 85 +Sequences (2:4) Aligned. Score: 86 +Sequences (2:5) Aligned. Score: 21 +Sequences (2:6) Aligned. Score: 20 +Sequences (2:7) Aligned. Score: 25 +Sequences (2:8) Aligned. Score: 20 +Sequences (2:9) Aligned. Score: 36 +Sequences (2:10) Aligned. Score: 16 +Sequences (2:11) Aligned. Score: 22 +Sequences (2:12) Aligned. Score: 17 +Sequences (3:4) Aligned. Score: 85 +Sequences (3:5) Aligned. Score: 13 +Sequences (3:6) Aligned. Score: 20 +Sequences (3:7) Aligned. Score: 25 +Sequences (3:8) Aligned. Score: 20 +Sequences (3:9) Aligned. Score: 36 +Sequences (3:10) Aligned. Score: 16 +Sequences (3:11) Aligned. Score: 18 +Sequences (3:12) Aligned. Score: 25 +Sequences (4:5) Aligned. Score: 13 +Sequences (4:6) Aligned. Score: 11 +Sequences (4:7) Aligned. Score: 20 +Sequences (4:8) Aligned. Score: 10 +Sequences (4:9) Aligned. Score: 31 +Sequences (4:10) Aligned. Score: 17 +Sequences (4:11) Aligned. Score: 29 +Sequences (4:12) Aligned. Score: 14 +Sequences (5:6) Aligned. Score: 73 +Sequences (5:7) Aligned. Score: 83 +Sequences (5:8) Aligned. Score: 80 +Sequences (5:9) Aligned. Score: 31 +Sequences (5:10) Aligned. Score: 14 +Sequences (5:11) Aligned. Score: 14 +Sequences (5:12) Aligned. Score: 12 +Sequences (6:7) Aligned. Score: 80 +Sequences (6:8) Aligned. Score: 88 +Sequences (6:9) Aligned. Score: 26 +Sequences (6:10) Aligned. Score: 16 +Sequences (6:11) Aligned. Score: 25 +Sequences (6:12) Aligned. Score: 12 +Sequences (7:8) Aligned. Score: 78 +Sequences (7:9) Aligned. Score: 31 +Sequences (7:10) Aligned. Score: 10 +Sequences (7:11) Aligned. Score: 12 +Sequences (7:12) Aligned. Score: 12 +Sequences (8:9) Aligned. Score: 31 +Sequences (8:10) Aligned. Score: 10 +Sequences (8:11) Aligned. Score: 14 +Sequences (8:12) Aligned. Score: 12 +Sequences (9:10) Aligned. Score: 63 +Sequences (9:11) Aligned. Score: 84 +Sequences (9:12) Aligned. Score: 78 +Sequences (10:11) Aligned. Score: 64 +Sequences (10:12) Aligned. Score: 76 +Sequences (11:12) Aligned. Score: 46 +Guide tree file created: [/share/shared/galaxy/database/files/002/dataset_2705.dnd] + +There are 11 groups +Start of Multiple Alignment + +Aligning... +Group 1: Sequences: 2 Score:1045 +Group 2: Sequences: 2 Score:1016 +Group 3: Sequences: 4 Score:1001 +Group 4: Sequences: 2 Score:313 +Group 5: Sequences: 2 Score:731 +Group 6: Sequences: 4 Score:516 +Group 7: Sequences: 8 Score:344 +Group 8: Sequences: 2 Score:1016 +Group 9: Sequences: 2 Score:1054 +Group 10: Sequences: 4 Score:945 +Group 11: Sequences: 12 Score:380 +Alignment Score 6283 +firstres = 1 lastres = 63 +FASTA file created! + +Fasta-Alignment file created [/share/shared/galaxy/database/files/002/dataset_2726.dat] + |
b |
diff -r 000000000000 -r 8888e4e3f169 rgclustal/rgClustalw.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/rgclustal/rgClustalw.xml Tue Jun 07 17:05:43 2011 -0400 |
b |
@@ -0,0 +1,125 @@ +<tool id="clustalw" name="ClustalW" version="0.1"> + <description>multiple sequence alignment program for DNA or proteins</description> + <command> + #if ($range.mode=="part") + clustalw2 -infile=$input -outfile=$output -OUTORDER=$out_order -RANGE=$range.seq_range_start,$range.seq_range_end + #elif ($range.mode=="complete") + clustalw2 -infile=$input -outfile=$output -OUTORDER=$out_order + #end if + #if ($outcontrol.outform=="clustal") + -SEQNOS=$outcontrol.out_seqnos + #end if + #if ($outcontrol.outform=="phylip") + -OUTPUT=PHYLIP + #end if + #if ($outcontrol.outform=="fasta") + -OUTPUT=FASTA + #end if + -TYPE=$dnarna 1>$outlog 2>&1 + </command> + <inputs> + <page> + <param format="fasta" name="input" type="data" label="Fasta File" /> + <param name="outname" label="Name for output files to make it easy to remember what you did" type="text" size="50" value="Clustal_run" /> + <param name="dnarna" type="select" label="Data Type"> + <option value="DNA" selected="True">DNA nucleotide sequences</option> + <option value="PROTEIN">Protein sequences</option> + </param> + <conditional name="outcontrol"> + <param name="outform" type="select" label="Output alignment format"> + <option value="clustal" selected="True">Native Clustal output format</option> + <option value="phylip">Phylip format</option> + <option value="fasta">Fasta format</option> + </param> + <when value="fasta" /> + <when value="phylip" /> + <when value="clustal"> + <param name="out_seqnos" type="select" label="Show residue numbers in clustal format output"> + <option value="ON">yes</option> + <option value="OFF" selected="true">no</option> + </param> + </when> + </conditional> + <param name="out_order" type="select" label="Output Order"> + <option value="ALIGNED">aligned</option> + <option value="INPUT">same order as input file</option> + </param> + + <conditional name="range"> + <param name="mode" type="select" label="Output complete alignment (or specify part to output)"> + <option value="complete">complete alignment</option> + <option value="part">only part of the alignment</option> + </param> + <when value="complete"> + </when> + <when value="part"> + <param name="seq_range_start" size="5" type="integer" value="1" label="start point" help="sequence range to write"> + </param> + <param name="seq_range_end" size="5" type="integer" value="99999" label="end point" > + </param> + </when> + </conditional> + </page> + </inputs> + <outputs> + <data format="clustal" name="output" label="${outname}_output.${outcontrol.outform}"> + <change_format> + <when input="outcontrol.outform" value="phylip" format="phylip" /> + <when input="outcontrol.outform" value="fasta" format="fasta" /> + </change_format> + </data> + <data format="txt" name="outlog" label="${outname}_clustal_log.txt"/> + </outputs> + <tests> + <test> + <param name="input" value="rgClustal_testin.fasta" /> + <param name = "outname" value="" /> + <param name = "outform" value="fasta" /> + <param name = "dnarna" value="DNA" /> + <param name = "mode" value="complete" /> + <param name = "out_order" value="ALIGNED" /> + <output name="output" file="rgClustal_testout.fasta" ftype="fasta" /> + <output name="output" file="rgClustal_testout.log" ftype="txt" lines_diff="5" /> + </test> + </tests> + <help> + +**Note** + +This tool allows you to run a multiple sequence alignment with ClustalW2 (see Clustsrc_) using the default options. + +For a tutorial introduction, see ClustalW2_ + +You can align DNA or protein sequences in the input file which should be multiple sequences to be aligned in a fasta file + +A log will be output to your history showing the output Clustal would normally write to standard output. + +The alignments will appear as a clustal format file or optionally, as phylip or fasta format files in your history. If you choose fasta as +the output format, you can create a 'Logo' image using the Sequence Logo tool. + +If Clustal format is chosen, you have the option of adding basepair counts to the output + +A subsequence of the alignment can be output by setting the Output complete parameter to "Partial" and defining the offset and end of the subsequence to be output + +---- + +**Attribution** + +Clustal attribution and associated documentation are available at Clustsrc_ + +The first iteration of this Galaxy wrapper was written by Hans-Rudolf Hotz - see Clustfirst_ + +It was modified by Ross Lazarus for the rgenetics project + +This wrapper is now LGPL + +.. _ClustalW2: http://www.ebi.ac.uk/2can/tutorials/protein/clustalw.html + +.. _Clustsrc: http://www.clustal.org + +.. _Clustfirst: http://lists.bx.psu.edu/pipermail/galaxy-dev/2010-November/003732.html + + </help> + +</tool> + |