| Previous changeset 6:3be0e0a858fe (2011-11-08) Next changeset 8:a89fec682254 (2011-12-08) |
|
Commit message:
refactor |
|
added:
gmap.xml gmap_build.xml gsnap.xml iit_store.xml snpindex.xml |
|
removed:
gmap/gmap.xml gmap/gmap_build.xml gmap/gsnap.xml gmap/iit_store.xml gmap/snpindex.xml |
| b |
| diff -r 3be0e0a858fe -r 561503a442f0 gmap.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/gmap.xml Tue Nov 08 13:26:41 2011 -0600 |
| [ |
| b'@@ -0,0 +1,442 @@\n+<tool id="gmap" name="GMAP" version="2.0.0">\n+ <description>Genomic Mapping and Alignment Program for mRNA and EST sequences</description>\n+ <requirements>\n+ <requirement type="binary">gmap</requirement>\n+ <!-- proposed tag for added datatype dependencies -->\n+ <requirement type="datatype">gmapdb</requirement>\n+ <requirement type="datatype">gmap_annotation</requirement>\n+ <requirement type="datatype">gmap_splicesites</requirement>\n+ <requirement type="datatype">gmap_introns</requirement>\n+ <requirement type="datatype">gmap_snps</requirement>\n+ </requirements>\n+ <version_string>gmap --version</version_string>\n+ <command>\n+ #import os,os.path\n+ gmap\n+ --nthreads=4 --ordered\n+ #if $refGenomeSource.genomeSource == "history":\n+ --gseg=$refGenomeSource.ownFile\n+ #elif $refGenomeSource.genomeSource == "gmapdb":\n+ #set $gmapdb = $os.listdir($refGenomeSource.gmapdb.extra_files_path)[0]\n+ --dir=$refGenomeSource.gmapdb.extra_files_path --db=$gmapdb\n+ #if $refGenomeSource.kmer != None and len($refGenomeSource.kmer.__str__) == 2:\n+ --kmer=$refGenomeSource.kmer\n+ #end if\n+ #else:\n+ --dir=$os.path.dirname($refGenomeSource.gmapindex.value) --db=$os.path.basename($refGenomeSource.gmapindex.value)\n+ #if $refGenomeSource.kmer != None and len($refGenomeSource.kmer.__str__) == 2:\n+ --kmer=$refGenomeSource.kmer\n+ #end if\n+ #end if\n+ #if $result.format == "summary":\n+ --summary\n+ #elif $result.format == "align":\n+ --align\n+ #elif $result.format == "continuous":\n+ --continuous\n+ #elif $result.format == "continuous-by-exon":\n+ --continuous-by-exon\n+ #elif $result.format == "compress":\n+ --compress\n+ #elif $result.format == "exons_dna":\n+ --exons=cdna\n+ #elif $result.format == "exons_gen":\n+ --exons=genomic\n+ #elif $result.format == "protein_dna":\n+ --protein_dna\n+ #elif $result.format == "protein_gen":\n+ --protein_gen\n+ #elif $result.format == "sam":\n+ --format=$result.sam_paired_read\n+ $result.no_sam_headers \n+ #if len($result.noncanonical_splices.__str__) > 0\n+ --noncanonical-splices=$result.noncanonical_splices\n+ #end if\n+ #if len($result.read_group_id.__str__) > 0\n+ --read-group-id=$result.read_group_id\n+ #end if\n+ #if len($result.read_group_name.__str__) > 0\n+ --read-group-name=$result.read_group_name\n+ #end if\n+ #if len($result.read_group_library.__str__) > 0\n+ --read-group-library=$result.read_group_library\n+ #end if\n+ #if len($result.read_group_platform.__str__) > 0\n+ --read-group-platform=$result.read_group_platform\n+ #end if\n+ #elif $result.format != "gmap":\n+ --format=$result.format\n+ #end if\n+ #if $computation.options == "advanced":\n+ $computation.nosplicing\n+ $computation.cross_species\n+ --min-intronlength=$computation.min_intronlength\n+ --intronlength=$computation.intronlength\n+ --localsplicedist=$computation.localsplicedist\n+ --totallength=$computation.totallength\n+ --trimendexons=$computation.trimendexons\n+ --direction=$computation.direction\n+ --canonical-mode=$computation.canonical\n+ --prunelevel=$computation.prunelevel\n+ --allow-close-indels=$computation.allow_close_indels\n+ --microexon-spliceprob=$computation.microexon_spliceprob\n+ #if int($computation.chimera_margin) >= 0:\n+ --chimera-margin=$computation.chimera_margin\n+ #end if\n+ #end if\n+ #if $advanced.options == "used":\n+ #if int($advanced.npaths) >= 0:\n+ --npaths=$advanced.npaths\n+ #end if\n+ #if int($advanced.chimera_overlap) > 0:\n+ --chimera_overlap=$advanced.chimera_overlap\n+ #end if\n+ $advanced.protein\n+ $advanced.tolerant\n+ $advanced.nolengths\n+ $advanced.invertmode\n+ #if int($advanced.introngap) > 0:\n+ --introngap=$advance'..b'="result[\'format\']" value="gff3_match_cdna" format="gff3"/>\n+ <when input="result[\'format\']" value="gff3_match_est" format="gff3"/>\n+ <when input="result[\'format\']" value="sam" format="sam"/>\n+ <when input="result[\'format\']" value="splicesites" format="gmap_splicesites"/>\n+ <when input="result[\'format\']" value="introns" format="gmap_introns"/>\n+ <when input="result[\'format\']" value="map_genes" format="gmap_annotation"/>\n+ <when input="result[\'format\']" value="map_exons" format="gmap_annotation"/>\n+ </change_format>\n+ </data>\n+ <data format="txt" name="nomapping" label="${tool.name} on ${on_string} nomapping.${result.format}" from_work_dir="gmap_out.nomapping">\n+ <filter>(split_output == True)</filter>\n+ <change_format>\n+ <when input="result[\'format\']" value="gff3_gene" format="gff3"/>\n+ <when input="result[\'format\']" value="gff3_match_cdna" format="gff3"/>\n+ <when input="result[\'format\']" value="gff3_match_est" format="gff3"/>\n+ <when input="result[\'format\']" value="sam" format="sam"/>\n+ <when input="result[\'format\']" value="splicesites" format="gmap_splicesites"/>\n+ <when input="result[\'format\']" value="introns" format="gmap_introns"/>\n+ <when input="result[\'format\']" value="map_genes" format="gmap_annotation"/>\n+ <when input="result[\'format\']" value="map_exons" format="gmap_annotation"/>\n+ </change_format>\n+ </data>\n+ <data format="txt" name="mult" label="${tool.name} on ${on_string} mult.${result.format}" from_work_dir="gmap_out.mult">\n+ <filter>(split_output == True)</filter>\n+ <change_format>\n+ <when input="result[\'format\']" value="gff3_gene" format="gff3"/>\n+ <when input="result[\'format\']" value="gff3_match_cdna" format="gff3"/>\n+ <when input="result[\'format\']" value="gff3_match_est" format="gff3"/>\n+ <when input="result[\'format\']" value="sam" format="sam"/>\n+ <when input="result[\'format\']" value="splicesites" format="gmap_splicesites"/>\n+ <when input="result[\'format\']" value="introns" format="gmap_introns"/>\n+ <when input="result[\'format\']" value="map_genes" format="gmap_annotation"/>\n+ <when input="result[\'format\']" value="map_exons" format="gmap_annotation"/>\n+ </change_format>\n+ </data>\n+ </outputs>\n+ <tests>\n+ </tests> \n+\n+ <help>\n+\n+**What it does**\n+\n+GMAP_ (Genomic Mapping and Alignment Program) The functionality provided by gmap allows a user to: (1) map and align a single cDNA interactively against a large genome in about a second, without the startup time of several minutes typically needed by existing mapping programs; (2) switch arbitrarily among different genomes, without the need for a preloaded server dedicated to each genome; (3) run the program on computers with as little as 128 MB of RAM (random access memory); (4) perform high-throughput batch processing of cDNAs by using memory mapping and multithreading when appropriate memory and hardware are available; (5) generate accurate gene models, even in the presence of substantial polymorphisms and sequence errors; (6) locate splice sites accurately without the use of probabilistic splice site models, allowing generalized use of the program across species; (7) detect statistically significant microexons and incorporate them into the alignment; and (8) handle mapping and alignment tasks on genomes having alternate assemblies, linkage groups or strains. It is developed by Thomas D. Wu of Genentech, Inc. \n+\n+Publication_ citation: Thomas D. Wu, Colin K. Watanabe Bioinformatics 2005 21(9):1859-1875; doi:10.1093/bioinformatics/bti310\n+\n+.. _GMAP: http://research-pub.gene.com/gmap/\n+.. _Publication: http://bioinformatics.oxfordjournals.org/cgi/content/full/21/9/1859\n+\n+------\n+\n+**Know what you are doing**\n+\n+.. class:: warningmark\n+\n+You will want to read the README_\n+\n+.. _README: http://research-pub.gene.com/gmap/src/README\n+\n+ </help>\n+</tool>\n+\n' |
| b |
| diff -r 3be0e0a858fe -r 561503a442f0 gmap/gmap.xml --- a/gmap/gmap.xml Tue Nov 08 13:22:34 2011 -0600 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 |
| [ |
| b'@@ -1,442 +0,0 @@\n-<tool id="gmap" name="GMAP" version="2.0.0">\n- <description>Genomic Mapping and Alignment Program for mRNA and EST sequences</description>\n- <requirements>\n- <requirement type="binary">gmap</requirement>\n- <!-- proposed tag for added datatype dependencies -->\n- <requirement type="datatype">gmapdb</requirement>\n- <requirement type="datatype">gmap_annotation</requirement>\n- <requirement type="datatype">gmap_splicesites</requirement>\n- <requirement type="datatype">gmap_introns</requirement>\n- <requirement type="datatype">gmap_snps</requirement>\n- </requirements>\n- <version_string>gmap --version</version_string>\n- <command>\n- #import os,os.path\n- gmap\n- --nthreads=4 --ordered\n- #if $refGenomeSource.genomeSource == "history":\n- --gseg=$refGenomeSource.ownFile\n- #elif $refGenomeSource.genomeSource == "gmapdb":\n- #set $gmapdb = $os.listdir($refGenomeSource.gmapdb.extra_files_path)[0]\n- --dir=$refGenomeSource.gmapdb.extra_files_path --db=$gmapdb\n- #if $refGenomeSource.kmer != None and len($refGenomeSource.kmer.__str__) == 2:\n- --kmer=$refGenomeSource.kmer\n- #end if\n- #else:\n- --dir=$os.path.dirname($refGenomeSource.gmapindex.value) --db=$os.path.basename($refGenomeSource.gmapindex.value)\n- #if $refGenomeSource.kmer != None and len($refGenomeSource.kmer.__str__) == 2:\n- --kmer=$refGenomeSource.kmer\n- #end if\n- #end if\n- #if $result.format == "summary":\n- --summary\n- #elif $result.format == "align":\n- --align\n- #elif $result.format == "continuous":\n- --continuous\n- #elif $result.format == "continuous-by-exon":\n- --continuous-by-exon\n- #elif $result.format == "compress":\n- --compress\n- #elif $result.format == "exons_dna":\n- --exons=cdna\n- #elif $result.format == "exons_gen":\n- --exons=genomic\n- #elif $result.format == "protein_dna":\n- --protein_dna\n- #elif $result.format == "protein_gen":\n- --protein_gen\n- #elif $result.format == "sam":\n- --format=$result.sam_paired_read\n- $result.no_sam_headers \n- #if len($result.noncanonical_splices.__str__) > 0\n- --noncanonical-splices=$result.noncanonical_splices\n- #end if\n- #if len($result.read_group_id.__str__) > 0\n- --read-group-id=$result.read_group_id\n- #end if\n- #if len($result.read_group_name.__str__) > 0\n- --read-group-name=$result.read_group_name\n- #end if\n- #if len($result.read_group_library.__str__) > 0\n- --read-group-library=$result.read_group_library\n- #end if\n- #if len($result.read_group_platform.__str__) > 0\n- --read-group-platform=$result.read_group_platform\n- #end if\n- #elif $result.format != "gmap":\n- --format=$result.format\n- #end if\n- #if $computation.options == "advanced":\n- $computation.nosplicing\n- $computation.cross_species\n- --min-intronlength=$computation.min_intronlength\n- --intronlength=$computation.intronlength\n- --localsplicedist=$computation.localsplicedist\n- --totallength=$computation.totallength\n- --trimendexons=$computation.trimendexons\n- --direction=$computation.direction\n- --canonical-mode=$computation.canonical\n- --prunelevel=$computation.prunelevel\n- --allow-close-indels=$computation.allow_close_indels\n- --microexon-spliceprob=$computation.microexon_spliceprob\n- #if int($computation.chimera_margin) >= 0:\n- --chimera-margin=$computation.chimera_margin\n- #end if\n- #end if\n- #if $advanced.options == "used":\n- #if int($advanced.npaths) >= 0:\n- --npaths=$advanced.npaths\n- #end if\n- #if int($advanced.chimera_overlap) > 0:\n- --chimera_overlap=$advanced.chimera_overlap\n- #end if\n- $advanced.protein\n- $advanced.tolerant\n- $advanced.nolengths\n- $advanced.invertmode\n- #if int($advanced.introngap) > 0:\n- --introngap=$advance'..b'="result[\'format\']" value="gff3_match_cdna" format="gff3"/>\n- <when input="result[\'format\']" value="gff3_match_est" format="gff3"/>\n- <when input="result[\'format\']" value="sam" format="sam"/>\n- <when input="result[\'format\']" value="splicesites" format="gmap_splicesites"/>\n- <when input="result[\'format\']" value="introns" format="gmap_introns"/>\n- <when input="result[\'format\']" value="map_genes" format="gmap_annotation"/>\n- <when input="result[\'format\']" value="map_exons" format="gmap_annotation"/>\n- </change_format>\n- </data>\n- <data format="txt" name="nomapping" label="${tool.name} on ${on_string} nomapping.${result.format}" from_work_dir="gmap_out.nomapping">\n- <filter>(split_output == True)</filter>\n- <change_format>\n- <when input="result[\'format\']" value="gff3_gene" format="gff3"/>\n- <when input="result[\'format\']" value="gff3_match_cdna" format="gff3"/>\n- <when input="result[\'format\']" value="gff3_match_est" format="gff3"/>\n- <when input="result[\'format\']" value="sam" format="sam"/>\n- <when input="result[\'format\']" value="splicesites" format="gmap_splicesites"/>\n- <when input="result[\'format\']" value="introns" format="gmap_introns"/>\n- <when input="result[\'format\']" value="map_genes" format="gmap_annotation"/>\n- <when input="result[\'format\']" value="map_exons" format="gmap_annotation"/>\n- </change_format>\n- </data>\n- <data format="txt" name="mult" label="${tool.name} on ${on_string} mult.${result.format}" from_work_dir="gmap_out.mult">\n- <filter>(split_output == True)</filter>\n- <change_format>\n- <when input="result[\'format\']" value="gff3_gene" format="gff3"/>\n- <when input="result[\'format\']" value="gff3_match_cdna" format="gff3"/>\n- <when input="result[\'format\']" value="gff3_match_est" format="gff3"/>\n- <when input="result[\'format\']" value="sam" format="sam"/>\n- <when input="result[\'format\']" value="splicesites" format="gmap_splicesites"/>\n- <when input="result[\'format\']" value="introns" format="gmap_introns"/>\n- <when input="result[\'format\']" value="map_genes" format="gmap_annotation"/>\n- <when input="result[\'format\']" value="map_exons" format="gmap_annotation"/>\n- </change_format>\n- </data>\n- </outputs>\n- <tests>\n- </tests> \n-\n- <help>\n-\n-**What it does**\n-\n-GMAP_ (Genomic Mapping and Alignment Program) The functionality provided by gmap allows a user to: (1) map and align a single cDNA interactively against a large genome in about a second, without the startup time of several minutes typically needed by existing mapping programs; (2) switch arbitrarily among different genomes, without the need for a preloaded server dedicated to each genome; (3) run the program on computers with as little as 128 MB of RAM (random access memory); (4) perform high-throughput batch processing of cDNAs by using memory mapping and multithreading when appropriate memory and hardware are available; (5) generate accurate gene models, even in the presence of substantial polymorphisms and sequence errors; (6) locate splice sites accurately without the use of probabilistic splice site models, allowing generalized use of the program across species; (7) detect statistically significant microexons and incorporate them into the alignment; and (8) handle mapping and alignment tasks on genomes having alternate assemblies, linkage groups or strains. It is developed by Thomas D. Wu of Genentech, Inc. \n-\n-Publication_ citation: Thomas D. Wu, Colin K. Watanabe Bioinformatics 2005 21(9):1859-1875; doi:10.1093/bioinformatics/bti310\n-\n-.. _GMAP: http://research-pub.gene.com/gmap/\n-.. _Publication: http://bioinformatics.oxfordjournals.org/cgi/content/full/21/9/1859\n-\n-------\n-\n-**Know what you are doing**\n-\n-.. class:: warningmark\n-\n-You will want to read the README_\n-\n-.. _README: http://research-pub.gene.com/gmap/src/README\n-\n- </help>\n-</tool>\n-\n' |
| b |
| diff -r 3be0e0a858fe -r 561503a442f0 gmap/gmap_build.xml --- a/gmap/gmap_build.xml Tue Nov 08 13:22:34 2011 -0600 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 |
| b |
| b'@@ -1,177 +0,0 @@\n-<tool id="gmap_build" name="GMAP Build" version="2.0.0">\n- <description>a database genome index for GMAP and GSNAP</description>\n- <requirements>\n- <requirement type="binary">gmap_build</requirement>\n- <!-- proposed tag for added datatype dependencies -->\n- <requirement type="datatype">gmapdb</requirement>\n- <requirement type="datatype">gmap_snps</requirement>\n- </requirements>\n- <version_string>gmap --version</version_string>\n- <command interpreter="command"> /bin/bash $shscript 2>1 1> $output </command>\n- <inputs>\n- <!-- Name for this gmapdb -->\n- <param name="refname" type="text" label="Name you want to give this gmap database" help="">\n- <validator type="empty_field" message="A database name is required."/>\n- </param>\n- <!-- Input data -->\n- <repeat name="inputs" title="Reference Sequence" min="1">\n- <param name="input" type="data" format="fasta" label="reference sequence fasta" />\n- </repeat>\n-\n- <param name="kmer" type="select" multiple="true" force_select="true" label="kmer size" help="">\n- <option value="12">12</option>\n- <option value="13">13</option>\n- <option value="14">14</option>\n- <option value="15" selected="true">15</option>\n- </param> \n- <param name="cmetindex" type="boolean" checked="true" truevalue="yes" falsevalue="no" label="Create cmetindex to process reads from bisulfite-treated DNA"/>\n- <param name="atoiindex" type="boolean" checked="true" truevalue="yes" falsevalue="no" label="Create atoiindex to process reads under RNA-editing tolerance"/>\n- <conditional name="splicesite">\n- <param name="splice_source" type="select" label="Add splice and intron info from" >\n- <option value="none"></option>\n- <option value="refGeneTable">refGenes table from UCSC table browser</option>\n- <option value="gtf">GTF</option>\n- <option value="gff3">GFF3</option>\n- </param>\n- <when value="none"/>\n- <when value="refGeneTable">\n- <param name="refGenes" type="data" format="tabular" optional="true" label="UCSC refGenes table" help="Example: ftp://hgdownload.cse.ucsc.edu/goldenPath/hg18/database/refGene.txt.gz" />\n- <param name="col_skip" type="integer" value="1" label="Columns to skip before the id/name column (default 1)" \n- help="Note that alignment tracks in UCSC sometimes have an extra column on the left.">\n- <validator type="in_range" message="The number of colmumns to skip must >= 0." min="0."/>\n- </param>\n- \n- </when>\n- <when value="gtf">\n- <param name="gtfGenes" type="data" format="gtf" optional="true" label="Genes as GTF" help="" />\n- </when>\n- <when value="gff3">\n- <param name="gff3Genes" type="data" format="gff3" optional="true" label="Genes in GFF3 format" help="" />\n- </when>\n- </conditional> \n- <conditional name="dbsnp">\n- <param name="snp_source" type="select" label="Add SNP info from" >\n- <option value="none"></option>\n- <option value="snpTable">UCSC SNP Table</option>\n- <option value="snpFile">GMAP SNP File</option>\n- </param>\n- <when value="none"/>\n- <when value="snpTable">\n- <param name="snps" type="data" format="tabular" optional="true" label="UCSC SNPs table" help="Example: ftp://hgdownload.cse.ucsc.edu/goldenPath/hg18/database/snp130.txt.gz" />\n- <param name="snpsex" type="data" format="tabular" optional="true" label="UCSC SNP Exceptions table" help="Example: ftp://hgdownload.cse.ucsc.edu/goldenPath/hg18/database/snp130Exceptions.txt.gz" />\n- <param name="weight" type="select" label="Include SNPs with at least Confidence Level" help="">\n- <option value="1" selected="true">1 (High)</option>\n- <option value="2">2 (Medium)</option>\n- <option value="3">3 (All)</option>\n- </param>\n- </when>\n- <when value="snpFile">\n- <param name="snps" type="data" format="gmap_'..b' to the possible nucleotides on the plus strand of the genome. \n- If the one of these two letters does not match the allele in the reference\n- sequence, that SNP will be ignored in subsequent processing as a probable error.\n- The N stands for any other allele." />\n- </when>\n- </conditional> \n- </inputs>\n- <outputs>\n- <!--\n- <data format="txt" name="log" label="${tool.name} on ${on_string}: log"/>\n- -->\n- <data format="gmapdb" name="output" label="${tool.name} on ${on_string} gmapdb ${refname}" />\n- </outputs>\n- <configfiles>\n- <configfile name="shscript">\n-#!/bin/bash\n-#set $ds = chr(36)\n-#set $gt = chr(62)\n-#set $lt = chr(60)\n-#set $ad = chr(38)\n-## #set $ref_files = \'\'\n-## #for $i in $inputs:\n- ## #set $ref_files = $ref_files $i.input\n-## #end for\n-## echo $ref_files\n-#import os.path\n-#set $gmapdb = $output.extra_files_path\n-#set $mapsdir = $os.path.join($os.path.join($gmapdb,str($refname)), str($refname) + \'.maps\')\n-mkdir -p $gmapdb\n-## export GMAPDB required for cmetindex and atoiindex\n-export GMAPDB=$gmapdb\n-#for $k in $kmer.__str__.split(\',\'):\n-gmap_build -D $gmapdb -d $refname -s numeric-alpha -k $k #for i in $inputs# ${i.input}#end for#\n-#end for\n-get-genome -D $gmapdb -d \'?\' | sed \'s/^Available .*/gmap db: /\' \n-echo "kmers: " $kmer \n-#if $splicesite.splice_source == \'refGeneTable\':\n-#if $splicesite.refGenes.__str__ != \'None\':\n-cat $splicesite.refGenes | psl_splicesites -s $splicesite.col_skip | iit_store -o $os.path.join($mapsdir,\'splicesites\')\n-cat $splicesite.refGenes | psl_introns -s $splicesite.col_skip | iit_store -o $os.path.join($mapsdir,\'introns\')\n-#end if\n-#elif $splicesite.splice_source == \'gtf\':\n-#if $splicesite.gtfGenes.__str__ != \'None\':\n-cat $splicesite.gtfGenes | gtf_splicesites | iit_store -o $os.path.join($mapsdir,\'splicesites\')\n-cat $splicesite.gtfGenes | gtf_introns | iit_store -o $os.path.join($mapsdir,\'introns\')\n-#end if\n-#elif $splicesite.splice_source == \'gff3\':\n-#if $splicesite.gff3Genes.__str__ != \'None\':\n-cat $splicesite.gff3Genes | gff3_splicesites | iit_store -o $os.path.join($mapsdir,\'splicesites\')\n-cat $splicesite.gff3Genes | gff3_introns | iit_store -o $os.path.join($mapsdir,\'introns\')\n-#end if\n-#end if\n-#if $dbsnp.snp_source != \'none\' and $dbsnp.snps.__str__ != \'None\':\n-#if $dbsnp.snp_source == \'snpTable\':\n-#if $dbsnp.snpsex.__str__ != \'None\':\n-cat $dbsnp.snps | dbsnp_iit -w $dbsnp.weight -e $dbsnp.snpsex | iit_store -o $os.path.join($mapsdir,\'snps\')\n-#else:\n-cat $dbsnp.snps | dbsnp_iit -w $dbsnp.weight | iit_store -o $os.path.join($mapsdir,\'snps\')\n-#end if\n-#else:\n-cat $dbsnp.snps | iit_store -o $os.path.join($mapsdir,\'snps\')\n-#end if\n-snpindex -d $refname -v snps\n-echo "snpindex" -d $refname -v snps\n-#end if\n-#if $cmetindex.__str__ == \'yes\':\n-cmetindex -d $refname\n-echo "cmetindex" -d $refname\n-#end if\n-#if $atoiindex.__str__ == \'yes\':\n-atoiindex -d $refname\n-echo "atoiindex" -d $refname\n-#end if\n-get-genome -D $gmapdb -d $refname -m \'?\' | sed \'s/^Available maps .*/maps: /\' \n- </configfile>\n- </configfiles>\n-\n- <tests>\n- </tests> \n-\n- <help>\n-\n-\n-**GMAP Build**\n-\n-GMAP Build creates an index of a genomic sequence for mapping and alignment using GMAP_ (Genomic Mapping and Alignment Program for mRNA and EST sequences) and GSNAP_ (Genomic Short-read Nucleotide Alignment Program). (GMAP Build uses GMSP commands: gmap_build, iit_store, psl_splicesites, psl_introns, gtf_splicesites, gtf_introns, gff3_splicesites, gff3_introns, dbsnp_iit, snpindex, cmetindex, and atoiindex.)\n-\n-You will want to read the README_\n-\n-Publication_ citation: Thomas D. Wu, Colin K. Watanabe Bioinformatics 2005 21(9):1859-1875; doi:10.1093/bioinformatics/bti310\n-\n-.. _GMAP: http://research-pub.gene.com/gmap/\n-.. _GSNAP: http://research-pub.gene.com/gmap/\n-.. _README: http://research-pub.gene.com/gmap/src/README\n-.. _Publication: http://bioinformatics.oxfordjournals.org/cgi/content/full/21/9/1859\n-\n-\n- </help>\n-</tool>\n-\n' |
| b |
| diff -r 3be0e0a858fe -r 561503a442f0 gmap/gsnap.xml --- a/gmap/gsnap.xml Tue Nov 08 13:22:34 2011 -0600 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 |
| [ |
| b'@@ -1,834 +0,0 @@\n-<tool id="gsnap" name="GSNAP" version="2.0.0">\n- <description>Genomic Short-read Nucleotide Alignment Program</description>\n- <requirements>\n- <requirement type="binary">gsnap</requirement>\n- <!-- proposed tag for added datatype dependencies -->\n- <requirement type="datatype">gmapdb</requirement>\n- <requirement type="datatype">gmapsnpindex</requirement>\n- <requirement type="datatype">splicesites.iit</requirement>\n- <requirement type="datatype">introns.iit</requirement>\n- </requirements>\n- <version_string>gsnap --version</version_string>\n- <command>\n- #import os.path, re\n- gsnap\n- --nthreads="4" --ordered\n- #if $refGenomeSource.genomeSource == "gmapdb":\n- #set $gmapdb = $os.listdir($refGenomeSource.gmapdb.extra_files_path)[0]\n- --dir=$refGenomeSource.gmapdb.extra_files_path --db=$refGenomeSource.gmapdb.metadata.db_name\n- #else:\n- --dir=$os.path.dirname($refGenomeSource.gmapindex.value) --db=$os.path.basename($refGenomeSource.gmapindex.value)\n- #end if\n- #if $refGenomeSource.kmer != None and len($refGenomeSource.kmer.__str__) == 2:\n- --kmer=$refGenomeSource.kmer\n- #end if\n- #if $refGenomeSource.use_splicing.src == \'gmapdb\':\n- #if $refGenomeSource.use_splicing.splicemap != None and len($refGenomeSource.use_splicing.splicemap.__str__) > 0:\n- -s $refGenomeSource.use_splicing.splicemap.value\n- #end if\n- #elif $refGenomeSource.use_splicing.src == \'history\':\n- #if $refGenomeSource.use_splicing.splicemap != None and len($refGenomeSource.use_splicing.splicemap.__str__) > 0:\n- -S $os.path.dirname($refGenomeSource.use_splicing.splicemap) -s $os.path.basename($refGenomeSource.use_splicing.splicemap)\n- #end if\n- #end if\n- #if $refGenomeSource.use_snps.src == \'gmapdb\':\n- #if $refGenomeSource.use_snps.snpindex != None and len($refGenomeSource.use_snps.snpindex.__str__) > 0:\n- -v $refGenomeSource.use_snps.snpindex.value\n- #end if\n- #elif $refGenomeSource.use_snps.src == \'history\':\n- #if $refGenomeSource.use_snps.snpindex != None and len($refGenomeSource.use_snps.snpindex.__str__) > 0:\n- -V $refGenomeSource.use_snps.snpindex.extra_files_path -v $refGenomeSource.use_snps.snpindex.metadata.snps_name\n- #end if\n- #end if\n- #if $refGenomeSource.mode.__str__ != \'\':\n- --mode=$refGenomeSource.mode\n- #end if\n- #if $mapq_unique_score.__str__ != \'\':\n- --mapq-unique-score=$mapq_unique_score\n- #end if\n- #if $computation.options == "advanced":\n- #if $computation.max_mismatches.__str__ != \'\':\n- --max-mismatches=$computation.max_mismatches\n- #end if\n- $computation.query_unk_mismatch\n- $computation.genome_unk_mismatch\n- #if $computation.terminal_threshold.__str__ != \'\':\n- --terminal-threshold=$computation.terminal_threshold\n- #end if\n- #if $computation.indel_penalty.__str__ != \'\':\n- --indel-penalty=$computation.indel_penalty\n- #end if\n- #if $computation.indel_endlength.__str__ != \'\':\n- --indel-endlength=$computation.indel_endlength\n- #end if\n- #if $computation.max_middle_insertions.__str__ != \'\':\n- --max-middle-insertions=$computation.max_middle_insertions\n- #end if\n- #if $computation.max_middle_deletions.__str__ != \'\':\n- --max-middle-deletions=$computation.max_middle_deletions\n- #end if\n- #if $computation.max_end_insertions.__str__ != \'\':\n- --max-end-insertions=$computation.max_end_insertions\n- #end if\n- #if $computation.max_end_deletions.__str__ != \'\':\n- --max-end-deletions=$computation.max_end_deletions\n- #end if\n- #if $computation.suboptimal_levels.__str__ != \'\':\n- --suboptimal-levels=$computation.suboptimal_levels\n- #end if\n- #if $computation.adapter_strip.__str__ != \'\':\n- --adapter-strip=$computation.adapter_strip\n- #end if\n- #if $computation.trim_mismatch_score.'..b'value="sam" format="sam"/>\n- <when input="result[\'format\']" value="gsnap" format="gsnap"/>\n- </change_format>\n- </data>\n-\n- <data format="fastq" name="nomapping_fq" label="${tool.name} on ${on_string} nomapping.fq" from_work_dir="gsnap_out.nomapping.fq">\n- <filter>(results[\'split_output\'] == \'yes\' and seq[\'format\'] == \'fastq\' and seq[\'paired\'][\'ispaired\'] == False)</filter>\n- </data>\n-\n- <data format="fastq" name="nomapping_1_fq" label="${tool.name} on ${on_string} nomapping.1.fq" from_work_dir="gsnap_out.nomapping.1.fq">\n- <filter>(results[\'split_output\'] == \'yes\' and seq[\'format\'] == \'fastq\' and seq[\'paired\'][\'ispaired\'] == True)</filter>\n- </data>\n-\n- <data format="fastq" name="nomapping_2_fq" label="${tool.name} on ${on_string} nomapping.2.fq" from_work_dir="gsnap_out.nomapping.2.fq">\n- <filter>(results[\'split_output\'] == \'yes\' and seq[\'format\'] == \'fastq\' and seq[\'paired\'][\'ispaired\'] == True)</filter>\n- </data>\n-\n- <!-- Will problay need wrapper code to generate composite datatype for goby alignment\n- <data format="gobyalignment" name="goby_alignment" label="${tool.name} on ${on_string} uniq.${result.format}" from_work_dir="gsnap_out.nomapping">\n- <filter>result[\'format\'] == \'goby\'</filter>\n- </data>\n- -->\n-\n- </outputs>\n- <tests>\n- </tests> \n-\n- <help>\n-\n-**What it does**\n-\n-GSNAP_ (Genomic Short-read Nucleotide Alignment Program) is a short read aligner which can align both single- and paired-end reads as short as 14nt and of arbitrarily long length. It can detect short- and long-distance splicing, including interchromosomal splicing, in individual reads, using probabilistic models or a database of known splice sites. Our program also permits SNP-tolerant alignment to a reference space of all possible combinations of major and minor alleles, and can align reads from bisulfite-treated DNA for the study of methylation state. It is developed by Thomas D. Wu of Genentech, Inc. \n-Publication_ citation: Thomas D. Wu, Serban Nacu "Fast and SNP-tolerant detection of complex variants and splicing in short reads. Bioinformatics. 2010 Apr 1;26(7):873-81. Epub 2010 Feb 10.\n-\n-.. _GSNAP: http://research-pub.gene.com/gmap/\n-.. _Publication: http://bioinformatics.oupjournals.org/cgi/content/full/26/7/873\n-http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2844994/?tool=pubmed\n-\n-------\n-\n-**Know what you are doing**\n-\n-.. class:: warningmark\n-\n-You will want to read the README_\n-\n-.. _README: http://research-pub.gene.com/gmap/src/README\n-\n-------\n-\n-**Input formats**\n-\n-Input to GSNAP should be either in FASTQ or FASTA format. \n-\n-The FASTQ input may include quality scores, which will then be included in SAM\n-output, if that output format is selected. \n-\n-For FASTA format, you should include one line per read (or end of a\n-paired-end read). The same FASTA file can have a mixture of\n-single-end and paired-end reads of varying lengths, if desired.\n-\n-Single-end reads:\n-\n-Each FASTA entry should contain one short read per line, like this\n-\n->Header information\n-AAAACATTCTCCTCCGCATAAGCCTGCGTCAGATTA\n-\n-Each short read can have a different length. However, the entire read\n-needs to be on a single line, and may not wrap around multiple lines.\n-If it extends to a second line, GSNAP will think that the read is\n-paired-end.\n-\n-\n-Paired-end reads:\n-\n-Each FASTA entry should contain two short reads, one per line, like\n-this\n-\n->Header information\n-AAAACATTCTCCTCCGCATAAGCCTAGTAGATTA\n-GGCGTAGGTAGAAGTAGAGGTTAAGGCGCGTCAG\n-\n-By default, the program assumes that the second end is in the reverse\n-complement direction compared with the first end. If they are in the\n-same direction, you may need to use the --circular-input (or -c) flag.\n-\n-( The Galaxy tool: "FASTA Width formatter" can be used to reformat fasta files to have single line sequences. )\n-\n-------\n-\n-**Output formats in GSNAP**\n-\n-SAM output format\n-\n-Default GSNAP format\n- See the README_\n-\n-\n-\n-\n- </help>\n-</tool>\n-\n' |
| b |
| diff -r 3be0e0a858fe -r 561503a442f0 gmap/iit_store.xml --- a/gmap/iit_store.xml Tue Nov 08 13:22:34 2011 -0600 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 |
| [ |
| b'@@ -1,188 +0,0 @@\n-<tool id="gmap_iit_store" name="GMAP IIT" version="2.0.0">\n- <description>Create a map store for known genes or SNPs</description>\n- <requirements>\n- <requirement type="binary">iit_store</requirement>\n- <!-- proposed tag for added datatype dependencies -->\n- <requirement type="datatype">gmap_annotation</requirement>\n- <requirement type="datatype">gmap_snps</requirement>\n- <requirement type="datatype">iit</requirement>\n- <requirement type="datatype">splicesites.iit</requirement>\n- <requirement type="datatype">introns.iit</requirement>\n- <requirement type="datatype">snps.iit</requirement>\n- </requirements>\n- <version_string>iit_store --version</version_string>\n- <command interpreter="command"> /bin/bash $shscript 2> $log </command>\n- <inputs>\n- <!-- Input data -->\n- <conditional name="map">\n- <param name="type" type="select" label="Make map for" >\n- <option value="genes">Introns and Splice sites</option>\n- <option value="snps">SNPs</option>\n- <option value="gmap">GMAP Annotation</option>\n- </param>\n- <when value="genes">\n- <conditional name="src">\n- <param name="src_format" type="select" label="Add splice and intron info from" >\n- <option value="refGeneTable">refGenes table from UCSC table browser</option>\n- <option value="gtf">GTF</option>\n- <option value="gff3">GFF3</option>\n- </param>\n- <when value="refGeneTable">\n- <param name="genes" type="data" format="tabular" label="UCSC refGenes table" help="Example: ftp://hgdownload.cse.ucsc.edu/goldenPath/hg18/database/refGene.txt.gz" />\n- <param name="col_skip" type="integer" value="1" label="Columns to skip before the id/name column (default 1)" \n- help="Note that alignment tracks in UCSC sometimes have an extra column on the left.">\n- <validator type="in_range" message="The number of colmumns to skip must >= 0." min="0."/>\n- </param>\n- </when>\n- <when value="gtf">\n- <param name="genes" type="data" format="gtf" label="Genes as GTF" help="" />\n- </when>\n- <when value="gff3">\n- <param name="genes" type="data" format="gff3" label="Genes in GFF3 format" help="" />\n- </when>\n- </conditional> \n- <param name="maps" type="select" display="checkboxes" multiple="true" force_select="true" label="Add splice and intron info from" >\n- <option value="splicesites" selected="true">splicesites.iit</option>\n- <option value="introns" selected="false">introns.iit</option>\n- </param>\n- </when>\n- <when value="snps">\n- <conditional name="src">\n- <param name="src_format" type="select" label="Add SNP info from" >\n- <option value="snpTable">UCSC SNP Table</option>\n- <option value="snpFile">GMAP SNP File</option>\n- </param>\n- <when value="snpTable">\n- <param name="snps" type="data" format="tabular" label="UCSC SNPs table" help="Example: ftp://hgdownload.cse.ucsc.edu/goldenPath/hg18/database/snp130.txt.gz" />\n- <param name="snpsex" type="data" format="tabular" optional="true" label="UCSC SNP Exceptions table" help="Example: ftp://hgdownload.cse.ucsc.edu/goldenPath/hg18/database/snp130Exceptions.txt.gz" />\n- <param name="weight" type="select" label="Include SNPs with at least Confidence Level" help="">\n- <option value="1" selected="true">1 (High)</option>\n- <option value="2">2 (Medium)</option>\n- <option value="3">3 (All)</option>\n- </param>\n- </when>\n- <when value="snpFile">\n- <param name="snps" type="data" format="gmap_snps" optional="true" label="GMAP SNPs file" \n- help="Format (3 columns):<B>\n- <br>>rs62211261 21:14379270 CG\n- <b'..b'- <br> chr:position\n- <br> chr:startposition..endposition\n- <br>The term chr:position is equivalent to chr:position..position. \n- <br>If you want to indicate that the interval is on the minus strand or reverse direction, then endposition may be less than startposition. \n- " />\n- </when>\n- </conditional> \n- </inputs>\n- <outputs>\n- <data format="txt" name="log" label="${tool.name} on ${on_string}: log"/>\n- <data format="splicesites.iit" name="splicesites_iit" label="${tool.name} on ${on_string} splicesites.iit">\n- <filter>(map[\'type\'] == \'genes\' and \'splicesites\' in map[\'maps\'])</filter>\n- </data>\n- <data format="introns.iit" name="introns_iit" label="${tool.name} on ${on_string} introns.iit">\n- <filter>(map[\'type\'] == \'genes\' and \'introns\' in map[\'maps\'])</filter>\n- </data>\n- <data format="snps.iit" name="snps_iit" label="${tool.name} on ${on_string} snps.iit">\n- <filter>(map[\'type\'] == \'snps\')</filter>\n- </data>\n- <data format="iit" name="map_iit" label="${tool.name} on ${on_string} map.iit">\n- <filter>(map[\'type\'] == \'gmap\')</filter>\n- </data>\n- </outputs>\n- <configfiles>\n- <configfile name="shscript">\n-#!/bin/bash\n-#set $catcmd = \'gzcat -f\'\n-#set $catcmd = \'cat\'\n-#set $ds = chr(36)\n-#set $gt = chr(62)\n-#set $lt = chr(60)\n-#set $ad = chr(38)\n-#set $ep = chr(33)\n-#set $toerr = \'\'.join([$gt,$ad,\'2\'])\n-#import os.path\n-#if $map.type == \'genes\':\n-if [ $ep -e $map.src.genes ]; then echo "$map.src.genes does not exist" $toerr; exit 1; fi\n-if [ $ep -s $map.src.genes ]; then echo "$map.src.genes is empty" $toerr; exit 2; fi\n- #if $map.src.src_format == \'refGeneTable\':\n- #if \'splicesites\' in [ $map.maps.__str__ ]:\n- $catcmd $map.src.genes | psl_splicesites -s $map.src.col_skip | iit_store -o $splicesites_iit\n- #end if\n- #if \'introns\' in [ $map.maps.__str__ ]:\n- $catcmd $map.src.genes | psl_introns -s $map.src.col_skip | iit_store -o $introns_iit\n- #end if\n- #elif $map.src.src_format == \'gtf\':\n- #if \'splicesites\' in [ $map.maps.__str__ ]:\n- $catcmd $map.src.genes | gtf_splicesites | iit_store -o $splicesites_iit\n- #end if\n- #if \'introns\' in [ $map.maps.__str__ ]:\n- $catcmd $map.src.genes | gtf_introns | iit_store -o $introns_iit\n- #end if\n- #elif $map.src.src_format == \'gff3\':\n- #if \'splicesites\' in [ $map.maps.__str__ ]:\n- $catcmd $map.src.genes | gff3_splicesites | iit_store -o $splicesites_iit\n- #end if\n- #if \'introns\' in [ $map.maps.__str__ ]:\n- $catcmd $map.src.genes | gff3_introns | iit_store -o $introns_iit\n- #end if\n- #end if\n-#elif $map.type == \'snps\':\n-if [ $ep -s $map.src.snps ]; then echo "$map.src.snps is empty" $toerr; exit 2; fi\n- #if $map.src.snpsex.__str__ != \'None\':\n- $catcmd $map.src.snps | dbsnp_iit -w $map.src.weight -e $map.src.snpsex | iit_store -o $snps_iit\n- #else:\n- $catcmd $map.src.snps | dbsnp_iit -w $map.src.weight | iit_store -o $snps_iit \n- #end if\n-#else:\n- $catcmd $map.src.snps | iit_store -o $map_iit \n-#end if\n- </configfile>\n- </configfiles>\n-\n- <tests>\n- </tests> \n-\n- <help>\n-\n-\n-**iit_store**\n-\n-GMAP IIT creates an Interval Index Tree map of known splice sites, introns, or SNPs (it uses iit_store described in the GMAP documentation). The maps can be used in GMAP_ (Genomic Mapping and Alignment Program for mRNA and EST sequences) and GSNAP_ (Genomic Short-read Nucleotide Alignment Program). Maps are typically used for known splice sites, introns, or SNPs. \n-\n-You will want to read the README_\n-\n-Publication_ citation: Thomas D. Wu, Colin K. Watanabe Bioinformatics 2005 21(9):1859-1875; doi:10.1093/bioinformatics/bti310\n-\n-.. _GMAP: http://research-pub.gene.com/gmap/\n-.. _GSNAP: http://research-pub.gene.com/gmap/\n-.. _README: http://research-pub.gene.com/gmap/src/README\n-.. _Publication: http://bioinformatics.oxfordjournals.org/cgi/content/full/21/9/1859\n-\n-\n-**inputs**\n-\n- </help>\n-</tool>\n-\n' |
| b |
| diff -r 3be0e0a858fe -r 561503a442f0 gmap/snpindex.xml --- a/gmap/snpindex.xml Tue Nov 08 13:22:34 2011 -0600 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 |
| [ |
| @@ -1,141 +0,0 @@ -<tool id="gmap_snpindex" name="GMAP SNP Index" version="2.0.0"> - <description>build index files for known SNPs</description> - <requirements> - <requirement type="binary">snpindex</requirement> - <!-- proposed tag for added datatype dependencies --> - <requirement type="datatype">gmapsnpindex</requirement> - <requirement type="datatype">gmapdb</requirement> - <requirement type="datatype">gmap_snps</requirement> - <requirement type="datatype">snps.iit</requirement> - </requirements> - <version_string>snpindex --version</version_string> - <command interpreter="command"> /bin/bash $shscript 2>1 1> $output </command> - <inputs> - <conditional name="refGenomeSource"> - <param name="genomeSource" type="select" label="Will you map to a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options"> - <option value="indexed">Use a built-in index</option> - <option value="gmapdb">Use gmapdb from the history</option> - </param> - <when value="indexed"> - <param name="gmapindex" type="select" label="Select a reference genome" help="if your genome of interest is not listed - contact Galaxy team"> - <options from_file="gmap_indices.loc"> - <column name="uid" index="0" /> - <column name="dbkey" index="1" /> - <column name="name" index="2" /> - <column name="kmers" index="3" /> - <column name="maps" index="4" /> - <column name="snps" index="5" /> - <column name="value" index="6" /> - </options> - </param> - </when> - <when value="gmapdb"> - <param name="gmapdb" type="data" format="gmapdb" metadata_name="dbkey" label="Select a gmapdb" - help="A GMAP database built with GMAP Build"/> - </when> - </conditional> - <conditional name="dbsnp"> - <param name="snp_source" type="select" label="Add SNP info from" > - <option value="snpTable">UCSC SNP Table</option> - <option value="snpFile">GMAP SNP File</option> - <option value="snpIIT">"GMAP SNPs map from GMAP iit store</option> - </param> - <when value="snpTable"> - <param name="snps" type="data" format="tabular" label="UCSC SNPs table" help="Example: ftp://hgdownload.cse.ucsc.edu/goldenPath/hg18/database/snp130.txt.gz" /> - <param name="snpsex" type="data" format="tabular" optional="true" label="UCSC SNP Exceptions table" help="Example: ftp://hgdownload.cse.ucsc.edu/goldenPath/hg18/database/snp130Exceptions.txt.gz" /> - <param name="weight" type="select" label="Include SNPs with at least Confidence Level" help=""> - <option value="1" selected="true">1 (High)</option> - <option value="2">2 (Medium)</option> - <option value="3">3 (All)</option> - </param> - </when> - <when value="snpFile"> - <param name="snps" type="data" format="gmap_snps" label="GMAP SNPs file" - help="Format (3 columns): - <br>>rs62211261 21:14379270 CG - <br>>rs62211262 21:14379281 CG - <br>Each line must start with a > character, then be followed by an - identifier (which may have duplicates). Then there should be the - chromosomal coordinate of the SNP. (Coordinates are all 1-based, so - the first character of a chromosome is number 1.) Finally, there - should be the two possible alleles: ( AC AG AT CG CT GT or AN CN GN TN) - <br>These alleles must correspond to the possible nucleotides on the plus strand of the genome. - If the one of these two letters does not match the allele in the reference - sequence, that SNP will be ignored in subsequent processing as a probable error. - The N stands for any other allele." /> - </when> - <when value="snpIIT"> - <param name="snpIIT" type="data" format="snps.iit" label="GMAP SNPs map" help="Created by: GMAP iit store" /> - </when> - </conditional> - <param name="snps_name" type="text" value="snps" label="Name for this SNP index" help="no white space characters"> - </param> - </inputs> - <outputs> - <!-- - <data format="txt" name="log" label="${tool.name} on ${on_string}: log"/> - --> - <data format="gmapsnpindex" name="output" label="${tool.name} on ${on_string} snpindex" /> - </outputs> - <configfiles> - <configfile name="shscript"> -#!/bin/bash -#set $ds = chr(36) -#set $gt = chr(62) -#set $lt = chr(60) -#set $ad = chr(38) -#import os.path -#if $refGenomeSource.genomeSource == "gmapdb": -#set $gmapdb = $refGenomeSource.gmapdb.extra_files_path -#set $refname = $refGenomeSource.gmapdb.metadata.db_name -#else: -#set $gmapdb = $os.path.dirname($refGenomeSource.gmapindex.value) -$refname = $os.path.basename($refGenomeSource.gmapindex.value) -#end if -#set $gmapsnpdir = $output.extra_files_path -mkdir -p $gmapsnpdir -#set $snpsname = $snps_name.__str__ -#set $snpsiit = '.'.join([$snpsname,'iit']) -#set $pathsnps = $os.path.join($gmapsnpdir,$snpsname) -#set $pathsnpsiit = $os.path.join($gmapsnpdir,$snpsiit) -#if $dbsnp.snp_source != 'none' and $dbsnp.snps.__str__ != 'None': -#if $dbsnp.snp_source == 'snpTable': -#if $dbsnp.snpsex.__str__ != 'None': -cat $dbsnp.snps | dbsnp_iit -w $dbsnp.weight -e $dbsnp.snpsex | iit_store -o $pathsnps -#else: -cat $dbsnp.snps | dbsnp_iit -w $dbsnp.weight | iit_store -o $pathsnps -#end if -#elif $dbsnp.snp_source == 'snpFile': -cat $dbsnp.snps | iit_store -o $pathsnps -#elif $dbsnp.snp_source == 'snpIIT': -cat $dbsnp.snps > $pathsnpsiit -#end if -snpindex -D $gmapdb -d $refname -V $output.extra_files_path -v $snpsname $pathsnpsiit -echo snpindex -D $gmapdb -d $refname -V $output.extra_files_path -v $snpsname $pathsnpsiit -#end if - </configfile> - </configfiles> - - <tests> - </tests> - - <help> - - -**GMAP SNP Index** - -GMAP SNP Index (snpindex in the GMAP documentaion) creates an index for known SNPs allowing for SNP tolerant mapping and alignment when using GMAP_ (Genomic Mapping and Alignment Program for mRNA and EST sequences) and GSNAP_ (Genomic Short-read Nucleotide Alignment Program). - -You will want to read the README_ - -Publication_ citation: Thomas D. Wu, Colin K. Watanabe Bioinformatics 2005 21(9):1859-1875; doi:10.1093/bioinformatics/bti310 - -.. _GMAP: http://research-pub.gene.com/gmap/ -.. _GSNAP: http://research-pub.gene.com/gmap/ -.. _README: http://research-pub.gene.com/gmap/src/README -.. _Publication: http://bioinformatics.oxfordjournals.org/cgi/content/full/21/9/1859 - - - </help> -</tool> - |
| b |
| diff -r 3be0e0a858fe -r 561503a442f0 gmap_build.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/gmap_build.xml Tue Nov 08 13:26:41 2011 -0600 |
| b |
| b'@@ -0,0 +1,177 @@\n+<tool id="gmap_build" name="GMAP Build" version="2.0.0">\n+ <description>a database genome index for GMAP and GSNAP</description>\n+ <requirements>\n+ <requirement type="binary">gmap_build</requirement>\n+ <!-- proposed tag for added datatype dependencies -->\n+ <requirement type="datatype">gmapdb</requirement>\n+ <requirement type="datatype">gmap_snps</requirement>\n+ </requirements>\n+ <version_string>gmap --version</version_string>\n+ <command interpreter="command"> /bin/bash $shscript 2>1 1> $output </command>\n+ <inputs>\n+ <!-- Name for this gmapdb -->\n+ <param name="refname" type="text" label="Name you want to give this gmap database" help="">\n+ <validator type="empty_field" message="A database name is required."/>\n+ </param>\n+ <!-- Input data -->\n+ <repeat name="inputs" title="Reference Sequence" min="1">\n+ <param name="input" type="data" format="fasta" label="reference sequence fasta" />\n+ </repeat>\n+\n+ <param name="kmer" type="select" multiple="true" force_select="true" label="kmer size" help="">\n+ <option value="12">12</option>\n+ <option value="13">13</option>\n+ <option value="14">14</option>\n+ <option value="15" selected="true">15</option>\n+ </param> \n+ <param name="cmetindex" type="boolean" checked="true" truevalue="yes" falsevalue="no" label="Create cmetindex to process reads from bisulfite-treated DNA"/>\n+ <param name="atoiindex" type="boolean" checked="true" truevalue="yes" falsevalue="no" label="Create atoiindex to process reads under RNA-editing tolerance"/>\n+ <conditional name="splicesite">\n+ <param name="splice_source" type="select" label="Add splice and intron info from" >\n+ <option value="none"></option>\n+ <option value="refGeneTable">refGenes table from UCSC table browser</option>\n+ <option value="gtf">GTF</option>\n+ <option value="gff3">GFF3</option>\n+ </param>\n+ <when value="none"/>\n+ <when value="refGeneTable">\n+ <param name="refGenes" type="data" format="tabular" optional="true" label="UCSC refGenes table" help="Example: ftp://hgdownload.cse.ucsc.edu/goldenPath/hg18/database/refGene.txt.gz" />\n+ <param name="col_skip" type="integer" value="1" label="Columns to skip before the id/name column (default 1)" \n+ help="Note that alignment tracks in UCSC sometimes have an extra column on the left.">\n+ <validator type="in_range" message="The number of colmumns to skip must >= 0." min="0."/>\n+ </param>\n+ \n+ </when>\n+ <when value="gtf">\n+ <param name="gtfGenes" type="data" format="gtf" optional="true" label="Genes as GTF" help="" />\n+ </when>\n+ <when value="gff3">\n+ <param name="gff3Genes" type="data" format="gff3" optional="true" label="Genes in GFF3 format" help="" />\n+ </when>\n+ </conditional> \n+ <conditional name="dbsnp">\n+ <param name="snp_source" type="select" label="Add SNP info from" >\n+ <option value="none"></option>\n+ <option value="snpTable">UCSC SNP Table</option>\n+ <option value="snpFile">GMAP SNP File</option>\n+ </param>\n+ <when value="none"/>\n+ <when value="snpTable">\n+ <param name="snps" type="data" format="tabular" optional="true" label="UCSC SNPs table" help="Example: ftp://hgdownload.cse.ucsc.edu/goldenPath/hg18/database/snp130.txt.gz" />\n+ <param name="snpsex" type="data" format="tabular" optional="true" label="UCSC SNP Exceptions table" help="Example: ftp://hgdownload.cse.ucsc.edu/goldenPath/hg18/database/snp130Exceptions.txt.gz" />\n+ <param name="weight" type="select" label="Include SNPs with at least Confidence Level" help="">\n+ <option value="1" selected="true">1 (High)</option>\n+ <option value="2">2 (Medium)</option>\n+ <option value="3">3 (All)</option>\n+ </param>\n+ </when>\n+ <when value="snpFile">\n+ <param name="snps" type="data" format="gmap_'..b' to the possible nucleotides on the plus strand of the genome. \n+ If the one of these two letters does not match the allele in the reference\n+ sequence, that SNP will be ignored in subsequent processing as a probable error.\n+ The N stands for any other allele." />\n+ </when>\n+ </conditional> \n+ </inputs>\n+ <outputs>\n+ <!--\n+ <data format="txt" name="log" label="${tool.name} on ${on_string}: log"/>\n+ -->\n+ <data format="gmapdb" name="output" label="${tool.name} on ${on_string} gmapdb ${refname}" />\n+ </outputs>\n+ <configfiles>\n+ <configfile name="shscript">\n+#!/bin/bash\n+#set $ds = chr(36)\n+#set $gt = chr(62)\n+#set $lt = chr(60)\n+#set $ad = chr(38)\n+## #set $ref_files = \'\'\n+## #for $i in $inputs:\n+ ## #set $ref_files = $ref_files $i.input\n+## #end for\n+## echo $ref_files\n+#import os.path\n+#set $gmapdb = $output.extra_files_path\n+#set $mapsdir = $os.path.join($os.path.join($gmapdb,str($refname)), str($refname) + \'.maps\')\n+mkdir -p $gmapdb\n+## export GMAPDB required for cmetindex and atoiindex\n+export GMAPDB=$gmapdb\n+#for $k in $kmer.__str__.split(\',\'):\n+gmap_build -D $gmapdb -d $refname -s numeric-alpha -k $k #for i in $inputs# ${i.input}#end for#\n+#end for\n+get-genome -D $gmapdb -d \'?\' | sed \'s/^Available .*/gmap db: /\' \n+echo "kmers: " $kmer \n+#if $splicesite.splice_source == \'refGeneTable\':\n+#if $splicesite.refGenes.__str__ != \'None\':\n+cat $splicesite.refGenes | psl_splicesites -s $splicesite.col_skip | iit_store -o $os.path.join($mapsdir,\'splicesites\')\n+cat $splicesite.refGenes | psl_introns -s $splicesite.col_skip | iit_store -o $os.path.join($mapsdir,\'introns\')\n+#end if\n+#elif $splicesite.splice_source == \'gtf\':\n+#if $splicesite.gtfGenes.__str__ != \'None\':\n+cat $splicesite.gtfGenes | gtf_splicesites | iit_store -o $os.path.join($mapsdir,\'splicesites\')\n+cat $splicesite.gtfGenes | gtf_introns | iit_store -o $os.path.join($mapsdir,\'introns\')\n+#end if\n+#elif $splicesite.splice_source == \'gff3\':\n+#if $splicesite.gff3Genes.__str__ != \'None\':\n+cat $splicesite.gff3Genes | gff3_splicesites | iit_store -o $os.path.join($mapsdir,\'splicesites\')\n+cat $splicesite.gff3Genes | gff3_introns | iit_store -o $os.path.join($mapsdir,\'introns\')\n+#end if\n+#end if\n+#if $dbsnp.snp_source != \'none\' and $dbsnp.snps.__str__ != \'None\':\n+#if $dbsnp.snp_source == \'snpTable\':\n+#if $dbsnp.snpsex.__str__ != \'None\':\n+cat $dbsnp.snps | dbsnp_iit -w $dbsnp.weight -e $dbsnp.snpsex | iit_store -o $os.path.join($mapsdir,\'snps\')\n+#else:\n+cat $dbsnp.snps | dbsnp_iit -w $dbsnp.weight | iit_store -o $os.path.join($mapsdir,\'snps\')\n+#end if\n+#else:\n+cat $dbsnp.snps | iit_store -o $os.path.join($mapsdir,\'snps\')\n+#end if\n+snpindex -d $refname -v snps\n+echo "snpindex" -d $refname -v snps\n+#end if\n+#if $cmetindex.__str__ == \'yes\':\n+cmetindex -d $refname\n+echo "cmetindex" -d $refname\n+#end if\n+#if $atoiindex.__str__ == \'yes\':\n+atoiindex -d $refname\n+echo "atoiindex" -d $refname\n+#end if\n+get-genome -D $gmapdb -d $refname -m \'?\' | sed \'s/^Available maps .*/maps: /\' \n+ </configfile>\n+ </configfiles>\n+\n+ <tests>\n+ </tests> \n+\n+ <help>\n+\n+\n+**GMAP Build**\n+\n+GMAP Build creates an index of a genomic sequence for mapping and alignment using GMAP_ (Genomic Mapping and Alignment Program for mRNA and EST sequences) and GSNAP_ (Genomic Short-read Nucleotide Alignment Program). (GMAP Build uses GMSP commands: gmap_build, iit_store, psl_splicesites, psl_introns, gtf_splicesites, gtf_introns, gff3_splicesites, gff3_introns, dbsnp_iit, snpindex, cmetindex, and atoiindex.)\n+\n+You will want to read the README_\n+\n+Publication_ citation: Thomas D. Wu, Colin K. Watanabe Bioinformatics 2005 21(9):1859-1875; doi:10.1093/bioinformatics/bti310\n+\n+.. _GMAP: http://research-pub.gene.com/gmap/\n+.. _GSNAP: http://research-pub.gene.com/gmap/\n+.. _README: http://research-pub.gene.com/gmap/src/README\n+.. _Publication: http://bioinformatics.oxfordjournals.org/cgi/content/full/21/9/1859\n+\n+\n+ </help>\n+</tool>\n+\n' |
| b |
| diff -r 3be0e0a858fe -r 561503a442f0 gsnap.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/gsnap.xml Tue Nov 08 13:26:41 2011 -0600 |
| [ |
| b'@@ -0,0 +1,834 @@\n+<tool id="gsnap" name="GSNAP" version="2.0.0">\n+ <description>Genomic Short-read Nucleotide Alignment Program</description>\n+ <requirements>\n+ <requirement type="binary">gsnap</requirement>\n+ <!-- proposed tag for added datatype dependencies -->\n+ <requirement type="datatype">gmapdb</requirement>\n+ <requirement type="datatype">gmapsnpindex</requirement>\n+ <requirement type="datatype">splicesites.iit</requirement>\n+ <requirement type="datatype">introns.iit</requirement>\n+ </requirements>\n+ <version_string>gsnap --version</version_string>\n+ <command>\n+ #import os.path, re\n+ gsnap\n+ --nthreads="4" --ordered\n+ #if $refGenomeSource.genomeSource == "gmapdb":\n+ #set $gmapdb = $os.listdir($refGenomeSource.gmapdb.extra_files_path)[0]\n+ --dir=$refGenomeSource.gmapdb.extra_files_path --db=$refGenomeSource.gmapdb.metadata.db_name\n+ #else:\n+ --dir=$os.path.dirname($refGenomeSource.gmapindex.value) --db=$os.path.basename($refGenomeSource.gmapindex.value)\n+ #end if\n+ #if $refGenomeSource.kmer != None and len($refGenomeSource.kmer.__str__) == 2:\n+ --kmer=$refGenomeSource.kmer\n+ #end if\n+ #if $refGenomeSource.use_splicing.src == \'gmapdb\':\n+ #if $refGenomeSource.use_splicing.splicemap != None and len($refGenomeSource.use_splicing.splicemap.__str__) > 0:\n+ -s $refGenomeSource.use_splicing.splicemap.value\n+ #end if\n+ #elif $refGenomeSource.use_splicing.src == \'history\':\n+ #if $refGenomeSource.use_splicing.splicemap != None and len($refGenomeSource.use_splicing.splicemap.__str__) > 0:\n+ -S $os.path.dirname($refGenomeSource.use_splicing.splicemap) -s $os.path.basename($refGenomeSource.use_splicing.splicemap)\n+ #end if\n+ #end if\n+ #if $refGenomeSource.use_snps.src == \'gmapdb\':\n+ #if $refGenomeSource.use_snps.snpindex != None and len($refGenomeSource.use_snps.snpindex.__str__) > 0:\n+ -v $refGenomeSource.use_snps.snpindex.value\n+ #end if\n+ #elif $refGenomeSource.use_snps.src == \'history\':\n+ #if $refGenomeSource.use_snps.snpindex != None and len($refGenomeSource.use_snps.snpindex.__str__) > 0:\n+ -V $refGenomeSource.use_snps.snpindex.extra_files_path -v $refGenomeSource.use_snps.snpindex.metadata.snps_name\n+ #end if\n+ #end if\n+ #if $refGenomeSource.mode.__str__ != \'\':\n+ --mode=$refGenomeSource.mode\n+ #end if\n+ #if $mapq_unique_score.__str__ != \'\':\n+ --mapq-unique-score=$mapq_unique_score\n+ #end if\n+ #if $computation.options == "advanced":\n+ #if $computation.max_mismatches.__str__ != \'\':\n+ --max-mismatches=$computation.max_mismatches\n+ #end if\n+ $computation.query_unk_mismatch\n+ $computation.genome_unk_mismatch\n+ #if $computation.terminal_threshold.__str__ != \'\':\n+ --terminal-threshold=$computation.terminal_threshold\n+ #end if\n+ #if $computation.indel_penalty.__str__ != \'\':\n+ --indel-penalty=$computation.indel_penalty\n+ #end if\n+ #if $computation.indel_endlength.__str__ != \'\':\n+ --indel-endlength=$computation.indel_endlength\n+ #end if\n+ #if $computation.max_middle_insertions.__str__ != \'\':\n+ --max-middle-insertions=$computation.max_middle_insertions\n+ #end if\n+ #if $computation.max_middle_deletions.__str__ != \'\':\n+ --max-middle-deletions=$computation.max_middle_deletions\n+ #end if\n+ #if $computation.max_end_insertions.__str__ != \'\':\n+ --max-end-insertions=$computation.max_end_insertions\n+ #end if\n+ #if $computation.max_end_deletions.__str__ != \'\':\n+ --max-end-deletions=$computation.max_end_deletions\n+ #end if\n+ #if $computation.suboptimal_levels.__str__ != \'\':\n+ --suboptimal-levels=$computation.suboptimal_levels\n+ #end if\n+ #if $computation.adapter_strip.__str__ != \'\':\n+ --adapter-strip=$computation.adapter_strip\n+ #end if\n+ #if $computation.trim_mismatch_score.'..b'value="sam" format="sam"/>\n+ <when input="result[\'format\']" value="gsnap" format="gsnap"/>\n+ </change_format>\n+ </data>\n+\n+ <data format="fastq" name="nomapping_fq" label="${tool.name} on ${on_string} nomapping.fq" from_work_dir="gsnap_out.nomapping.fq">\n+ <filter>(results[\'split_output\'] == \'yes\' and seq[\'format\'] == \'fastq\' and seq[\'paired\'][\'ispaired\'] == False)</filter>\n+ </data>\n+\n+ <data format="fastq" name="nomapping_1_fq" label="${tool.name} on ${on_string} nomapping.1.fq" from_work_dir="gsnap_out.nomapping.1.fq">\n+ <filter>(results[\'split_output\'] == \'yes\' and seq[\'format\'] == \'fastq\' and seq[\'paired\'][\'ispaired\'] == True)</filter>\n+ </data>\n+\n+ <data format="fastq" name="nomapping_2_fq" label="${tool.name} on ${on_string} nomapping.2.fq" from_work_dir="gsnap_out.nomapping.2.fq">\n+ <filter>(results[\'split_output\'] == \'yes\' and seq[\'format\'] == \'fastq\' and seq[\'paired\'][\'ispaired\'] == True)</filter>\n+ </data>\n+\n+ <!-- Will problay need wrapper code to generate composite datatype for goby alignment\n+ <data format="gobyalignment" name="goby_alignment" label="${tool.name} on ${on_string} uniq.${result.format}" from_work_dir="gsnap_out.nomapping">\n+ <filter>result[\'format\'] == \'goby\'</filter>\n+ </data>\n+ -->\n+\n+ </outputs>\n+ <tests>\n+ </tests> \n+\n+ <help>\n+\n+**What it does**\n+\n+GSNAP_ (Genomic Short-read Nucleotide Alignment Program) is a short read aligner which can align both single- and paired-end reads as short as 14nt and of arbitrarily long length. It can detect short- and long-distance splicing, including interchromosomal splicing, in individual reads, using probabilistic models or a database of known splice sites. Our program also permits SNP-tolerant alignment to a reference space of all possible combinations of major and minor alleles, and can align reads from bisulfite-treated DNA for the study of methylation state. It is developed by Thomas D. Wu of Genentech, Inc. \n+Publication_ citation: Thomas D. Wu, Serban Nacu "Fast and SNP-tolerant detection of complex variants and splicing in short reads. Bioinformatics. 2010 Apr 1;26(7):873-81. Epub 2010 Feb 10.\n+\n+.. _GSNAP: http://research-pub.gene.com/gmap/\n+.. _Publication: http://bioinformatics.oupjournals.org/cgi/content/full/26/7/873\n+http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2844994/?tool=pubmed\n+\n+------\n+\n+**Know what you are doing**\n+\n+.. class:: warningmark\n+\n+You will want to read the README_\n+\n+.. _README: http://research-pub.gene.com/gmap/src/README\n+\n+------\n+\n+**Input formats**\n+\n+Input to GSNAP should be either in FASTQ or FASTA format. \n+\n+The FASTQ input may include quality scores, which will then be included in SAM\n+output, if that output format is selected. \n+\n+For FASTA format, you should include one line per read (or end of a\n+paired-end read). The same FASTA file can have a mixture of\n+single-end and paired-end reads of varying lengths, if desired.\n+\n+Single-end reads:\n+\n+Each FASTA entry should contain one short read per line, like this\n+\n+>Header information\n+AAAACATTCTCCTCCGCATAAGCCTGCGTCAGATTA\n+\n+Each short read can have a different length. However, the entire read\n+needs to be on a single line, and may not wrap around multiple lines.\n+If it extends to a second line, GSNAP will think that the read is\n+paired-end.\n+\n+\n+Paired-end reads:\n+\n+Each FASTA entry should contain two short reads, one per line, like\n+this\n+\n+>Header information\n+AAAACATTCTCCTCCGCATAAGCCTAGTAGATTA\n+GGCGTAGGTAGAAGTAGAGGTTAAGGCGCGTCAG\n+\n+By default, the program assumes that the second end is in the reverse\n+complement direction compared with the first end. If they are in the\n+same direction, you may need to use the --circular-input (or -c) flag.\n+\n+( The Galaxy tool: "FASTA Width formatter" can be used to reformat fasta files to have single line sequences. )\n+\n+------\n+\n+**Output formats in GSNAP**\n+\n+SAM output format\n+\n+Default GSNAP format\n+ See the README_\n+\n+\n+\n+\n+ </help>\n+</tool>\n+\n' |
| b |
| diff -r 3be0e0a858fe -r 561503a442f0 iit_store.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/iit_store.xml Tue Nov 08 13:26:41 2011 -0600 |
| [ |
| b'@@ -0,0 +1,188 @@\n+<tool id="gmap_iit_store" name="GMAP IIT" version="2.0.0">\n+ <description>Create a map store for known genes or SNPs</description>\n+ <requirements>\n+ <requirement type="binary">iit_store</requirement>\n+ <!-- proposed tag for added datatype dependencies -->\n+ <requirement type="datatype">gmap_annotation</requirement>\n+ <requirement type="datatype">gmap_snps</requirement>\n+ <requirement type="datatype">iit</requirement>\n+ <requirement type="datatype">splicesites.iit</requirement>\n+ <requirement type="datatype">introns.iit</requirement>\n+ <requirement type="datatype">snps.iit</requirement>\n+ </requirements>\n+ <version_string>iit_store --version</version_string>\n+ <command interpreter="command"> /bin/bash $shscript 2> $log </command>\n+ <inputs>\n+ <!-- Input data -->\n+ <conditional name="map">\n+ <param name="type" type="select" label="Make map for" >\n+ <option value="genes">Introns and Splice sites</option>\n+ <option value="snps">SNPs</option>\n+ <option value="gmap">GMAP Annotation</option>\n+ </param>\n+ <when value="genes">\n+ <conditional name="src">\n+ <param name="src_format" type="select" label="Add splice and intron info from" >\n+ <option value="refGeneTable">refGenes table from UCSC table browser</option>\n+ <option value="gtf">GTF</option>\n+ <option value="gff3">GFF3</option>\n+ </param>\n+ <when value="refGeneTable">\n+ <param name="genes" type="data" format="tabular" label="UCSC refGenes table" help="Example: ftp://hgdownload.cse.ucsc.edu/goldenPath/hg18/database/refGene.txt.gz" />\n+ <param name="col_skip" type="integer" value="1" label="Columns to skip before the id/name column (default 1)" \n+ help="Note that alignment tracks in UCSC sometimes have an extra column on the left.">\n+ <validator type="in_range" message="The number of colmumns to skip must >= 0." min="0."/>\n+ </param>\n+ </when>\n+ <when value="gtf">\n+ <param name="genes" type="data" format="gtf" label="Genes as GTF" help="" />\n+ </when>\n+ <when value="gff3">\n+ <param name="genes" type="data" format="gff3" label="Genes in GFF3 format" help="" />\n+ </when>\n+ </conditional> \n+ <param name="maps" type="select" display="checkboxes" multiple="true" force_select="true" label="Add splice and intron info from" >\n+ <option value="splicesites" selected="true">splicesites.iit</option>\n+ <option value="introns" selected="false">introns.iit</option>\n+ </param>\n+ </when>\n+ <when value="snps">\n+ <conditional name="src">\n+ <param name="src_format" type="select" label="Add SNP info from" >\n+ <option value="snpTable">UCSC SNP Table</option>\n+ <option value="snpFile">GMAP SNP File</option>\n+ </param>\n+ <when value="snpTable">\n+ <param name="snps" type="data" format="tabular" label="UCSC SNPs table" help="Example: ftp://hgdownload.cse.ucsc.edu/goldenPath/hg18/database/snp130.txt.gz" />\n+ <param name="snpsex" type="data" format="tabular" optional="true" label="UCSC SNP Exceptions table" help="Example: ftp://hgdownload.cse.ucsc.edu/goldenPath/hg18/database/snp130Exceptions.txt.gz" />\n+ <param name="weight" type="select" label="Include SNPs with at least Confidence Level" help="">\n+ <option value="1" selected="true">1 (High)</option>\n+ <option value="2">2 (Medium)</option>\n+ <option value="3">3 (All)</option>\n+ </param>\n+ </when>\n+ <when value="snpFile">\n+ <param name="snps" type="data" format="gmap_snps" optional="true" label="GMAP SNPs file" \n+ help="Format (3 columns):<B>\n+ <br>>rs62211261 21:14379270 CG\n+ <b'..b'+ <br> chr:position\n+ <br> chr:startposition..endposition\n+ <br>The term chr:position is equivalent to chr:position..position. \n+ <br>If you want to indicate that the interval is on the minus strand or reverse direction, then endposition may be less than startposition. \n+ " />\n+ </when>\n+ </conditional> \n+ </inputs>\n+ <outputs>\n+ <data format="txt" name="log" label="${tool.name} on ${on_string}: log"/>\n+ <data format="splicesites.iit" name="splicesites_iit" label="${tool.name} on ${on_string} splicesites.iit">\n+ <filter>(map[\'type\'] == \'genes\' and \'splicesites\' in map[\'maps\'])</filter>\n+ </data>\n+ <data format="introns.iit" name="introns_iit" label="${tool.name} on ${on_string} introns.iit">\n+ <filter>(map[\'type\'] == \'genes\' and \'introns\' in map[\'maps\'])</filter>\n+ </data>\n+ <data format="snps.iit" name="snps_iit" label="${tool.name} on ${on_string} snps.iit">\n+ <filter>(map[\'type\'] == \'snps\')</filter>\n+ </data>\n+ <data format="iit" name="map_iit" label="${tool.name} on ${on_string} map.iit">\n+ <filter>(map[\'type\'] == \'gmap\')</filter>\n+ </data>\n+ </outputs>\n+ <configfiles>\n+ <configfile name="shscript">\n+#!/bin/bash\n+#set $catcmd = \'gzcat -f\'\n+#set $catcmd = \'cat\'\n+#set $ds = chr(36)\n+#set $gt = chr(62)\n+#set $lt = chr(60)\n+#set $ad = chr(38)\n+#set $ep = chr(33)\n+#set $toerr = \'\'.join([$gt,$ad,\'2\'])\n+#import os.path\n+#if $map.type == \'genes\':\n+if [ $ep -e $map.src.genes ]; then echo "$map.src.genes does not exist" $toerr; exit 1; fi\n+if [ $ep -s $map.src.genes ]; then echo "$map.src.genes is empty" $toerr; exit 2; fi\n+ #if $map.src.src_format == \'refGeneTable\':\n+ #if \'splicesites\' in [ $map.maps.__str__ ]:\n+ $catcmd $map.src.genes | psl_splicesites -s $map.src.col_skip | iit_store -o $splicesites_iit\n+ #end if\n+ #if \'introns\' in [ $map.maps.__str__ ]:\n+ $catcmd $map.src.genes | psl_introns -s $map.src.col_skip | iit_store -o $introns_iit\n+ #end if\n+ #elif $map.src.src_format == \'gtf\':\n+ #if \'splicesites\' in [ $map.maps.__str__ ]:\n+ $catcmd $map.src.genes | gtf_splicesites | iit_store -o $splicesites_iit\n+ #end if\n+ #if \'introns\' in [ $map.maps.__str__ ]:\n+ $catcmd $map.src.genes | gtf_introns | iit_store -o $introns_iit\n+ #end if\n+ #elif $map.src.src_format == \'gff3\':\n+ #if \'splicesites\' in [ $map.maps.__str__ ]:\n+ $catcmd $map.src.genes | gff3_splicesites | iit_store -o $splicesites_iit\n+ #end if\n+ #if \'introns\' in [ $map.maps.__str__ ]:\n+ $catcmd $map.src.genes | gff3_introns | iit_store -o $introns_iit\n+ #end if\n+ #end if\n+#elif $map.type == \'snps\':\n+if [ $ep -s $map.src.snps ]; then echo "$map.src.snps is empty" $toerr; exit 2; fi\n+ #if $map.src.snpsex.__str__ != \'None\':\n+ $catcmd $map.src.snps | dbsnp_iit -w $map.src.weight -e $map.src.snpsex | iit_store -o $snps_iit\n+ #else:\n+ $catcmd $map.src.snps | dbsnp_iit -w $map.src.weight | iit_store -o $snps_iit \n+ #end if\n+#else:\n+ $catcmd $map.src.snps | iit_store -o $map_iit \n+#end if\n+ </configfile>\n+ </configfiles>\n+\n+ <tests>\n+ </tests> \n+\n+ <help>\n+\n+\n+**iit_store**\n+\n+GMAP IIT creates an Interval Index Tree map of known splice sites, introns, or SNPs (it uses iit_store described in the GMAP documentation). The maps can be used in GMAP_ (Genomic Mapping and Alignment Program for mRNA and EST sequences) and GSNAP_ (Genomic Short-read Nucleotide Alignment Program). Maps are typically used for known splice sites, introns, or SNPs. \n+\n+You will want to read the README_\n+\n+Publication_ citation: Thomas D. Wu, Colin K. Watanabe Bioinformatics 2005 21(9):1859-1875; doi:10.1093/bioinformatics/bti310\n+\n+.. _GMAP: http://research-pub.gene.com/gmap/\n+.. _GSNAP: http://research-pub.gene.com/gmap/\n+.. _README: http://research-pub.gene.com/gmap/src/README\n+.. _Publication: http://bioinformatics.oxfordjournals.org/cgi/content/full/21/9/1859\n+\n+\n+**inputs**\n+\n+ </help>\n+</tool>\n+\n' |
| b |
| diff -r 3be0e0a858fe -r 561503a442f0 snpindex.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/snpindex.xml Tue Nov 08 13:26:41 2011 -0600 |
| [ |
| @@ -0,0 +1,141 @@ +<tool id="gmap_snpindex" name="GMAP SNP Index" version="2.0.0"> + <description>build index files for known SNPs</description> + <requirements> + <requirement type="binary">snpindex</requirement> + <!-- proposed tag for added datatype dependencies --> + <requirement type="datatype">gmapsnpindex</requirement> + <requirement type="datatype">gmapdb</requirement> + <requirement type="datatype">gmap_snps</requirement> + <requirement type="datatype">snps.iit</requirement> + </requirements> + <version_string>snpindex --version</version_string> + <command interpreter="command"> /bin/bash $shscript 2>1 1> $output </command> + <inputs> + <conditional name="refGenomeSource"> + <param name="genomeSource" type="select" label="Will you map to a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options"> + <option value="indexed">Use a built-in index</option> + <option value="gmapdb">Use gmapdb from the history</option> + </param> + <when value="indexed"> + <param name="gmapindex" type="select" label="Select a reference genome" help="if your genome of interest is not listed - contact Galaxy team"> + <options from_file="gmap_indices.loc"> + <column name="uid" index="0" /> + <column name="dbkey" index="1" /> + <column name="name" index="2" /> + <column name="kmers" index="3" /> + <column name="maps" index="4" /> + <column name="snps" index="5" /> + <column name="value" index="6" /> + </options> + </param> + </when> + <when value="gmapdb"> + <param name="gmapdb" type="data" format="gmapdb" metadata_name="dbkey" label="Select a gmapdb" + help="A GMAP database built with GMAP Build"/> + </when> + </conditional> + <conditional name="dbsnp"> + <param name="snp_source" type="select" label="Add SNP info from" > + <option value="snpTable">UCSC SNP Table</option> + <option value="snpFile">GMAP SNP File</option> + <option value="snpIIT">"GMAP SNPs map from GMAP iit store</option> + </param> + <when value="snpTable"> + <param name="snps" type="data" format="tabular" label="UCSC SNPs table" help="Example: ftp://hgdownload.cse.ucsc.edu/goldenPath/hg18/database/snp130.txt.gz" /> + <param name="snpsex" type="data" format="tabular" optional="true" label="UCSC SNP Exceptions table" help="Example: ftp://hgdownload.cse.ucsc.edu/goldenPath/hg18/database/snp130Exceptions.txt.gz" /> + <param name="weight" type="select" label="Include SNPs with at least Confidence Level" help=""> + <option value="1" selected="true">1 (High)</option> + <option value="2">2 (Medium)</option> + <option value="3">3 (All)</option> + </param> + </when> + <when value="snpFile"> + <param name="snps" type="data" format="gmap_snps" label="GMAP SNPs file" + help="Format (3 columns): + <br>>rs62211261 21:14379270 CG + <br>>rs62211262 21:14379281 CG + <br>Each line must start with a > character, then be followed by an + identifier (which may have duplicates). Then there should be the + chromosomal coordinate of the SNP. (Coordinates are all 1-based, so + the first character of a chromosome is number 1.) Finally, there + should be the two possible alleles: ( AC AG AT CG CT GT or AN CN GN TN) + <br>These alleles must correspond to the possible nucleotides on the plus strand of the genome. + If the one of these two letters does not match the allele in the reference + sequence, that SNP will be ignored in subsequent processing as a probable error. + The N stands for any other allele." /> + </when> + <when value="snpIIT"> + <param name="snpIIT" type="data" format="snps.iit" label="GMAP SNPs map" help="Created by: GMAP iit store" /> + </when> + </conditional> + <param name="snps_name" type="text" value="snps" label="Name for this SNP index" help="no white space characters"> + </param> + </inputs> + <outputs> + <!-- + <data format="txt" name="log" label="${tool.name} on ${on_string}: log"/> + --> + <data format="gmapsnpindex" name="output" label="${tool.name} on ${on_string} snpindex" /> + </outputs> + <configfiles> + <configfile name="shscript"> +#!/bin/bash +#set $ds = chr(36) +#set $gt = chr(62) +#set $lt = chr(60) +#set $ad = chr(38) +#import os.path +#if $refGenomeSource.genomeSource == "gmapdb": +#set $gmapdb = $refGenomeSource.gmapdb.extra_files_path +#set $refname = $refGenomeSource.gmapdb.metadata.db_name +#else: +#set $gmapdb = $os.path.dirname($refGenomeSource.gmapindex.value) +$refname = $os.path.basename($refGenomeSource.gmapindex.value) +#end if +#set $gmapsnpdir = $output.extra_files_path +mkdir -p $gmapsnpdir +#set $snpsname = $snps_name.__str__ +#set $snpsiit = '.'.join([$snpsname,'iit']) +#set $pathsnps = $os.path.join($gmapsnpdir,$snpsname) +#set $pathsnpsiit = $os.path.join($gmapsnpdir,$snpsiit) +#if $dbsnp.snp_source != 'none' and $dbsnp.snps.__str__ != 'None': +#if $dbsnp.snp_source == 'snpTable': +#if $dbsnp.snpsex.__str__ != 'None': +cat $dbsnp.snps | dbsnp_iit -w $dbsnp.weight -e $dbsnp.snpsex | iit_store -o $pathsnps +#else: +cat $dbsnp.snps | dbsnp_iit -w $dbsnp.weight | iit_store -o $pathsnps +#end if +#elif $dbsnp.snp_source == 'snpFile': +cat $dbsnp.snps | iit_store -o $pathsnps +#elif $dbsnp.snp_source == 'snpIIT': +cat $dbsnp.snps > $pathsnpsiit +#end if +snpindex -D $gmapdb -d $refname -V $output.extra_files_path -v $snpsname $pathsnpsiit +echo snpindex -D $gmapdb -d $refname -V $output.extra_files_path -v $snpsname $pathsnpsiit +#end if + </configfile> + </configfiles> + + <tests> + </tests> + + <help> + + +**GMAP SNP Index** + +GMAP SNP Index (snpindex in the GMAP documentaion) creates an index for known SNPs allowing for SNP tolerant mapping and alignment when using GMAP_ (Genomic Mapping and Alignment Program for mRNA and EST sequences) and GSNAP_ (Genomic Short-read Nucleotide Alignment Program). + +You will want to read the README_ + +Publication_ citation: Thomas D. Wu, Colin K. Watanabe Bioinformatics 2005 21(9):1859-1875; doi:10.1093/bioinformatics/bti310 + +.. _GMAP: http://research-pub.gene.com/gmap/ +.. _GSNAP: http://research-pub.gene.com/gmap/ +.. _README: http://research-pub.gene.com/gmap/src/README +.. _Publication: http://bioinformatics.oxfordjournals.org/cgi/content/full/21/9/1859 + + + </help> +</tool> + |