annotate fetchflank.xml @ 14:20dc70f85ff7 draft default tip

Uploaded

<tool id="fetchflank" name="Fetch bases flanking" version="1.0.0">
  <description> the STRs in the reads and output two fastq files in forward-forward orientation</description>
  <command interpreter="python">pair_fetch_DNA_ff.py  $microsat_in_read $Leftflanking $Rightflanking $qualitycutoff $lengthofbasetocheckquality  </command>

  <inputs>
    <param name="microsat_in_read" type="data" label="Select data of microsatellites in reads" />
    <param name="qualitycutoff" type="integer" value="20" label="Minimum quality score (Phred+33) for microsatellites and flanking regions" />
    <param name="lengthofbasetocheckquality" type="integer" value="20" label="Length of flanking regions that require quality screening" />        
  </inputs>
  <outputs>
    <data format="fastq" name="Leftflanking" />
    <data format="fastq" name="Rightflanking" />
  </outputs>
  <tests>
    <!-- Test data with valid values -->
    <test>
      <param name="microsat_in_read" value="samplefq.snoope"/>
      <param name="qualitycutoff" value="20"/>
      <param name="lengthofbasetocheckquality" value="20"/>
      <output name="Leftflanking" file="microsatellite_flanking_L.fastq"/>
      <output name="Rightflanking" file="microsatellite_flanking_R.fastq"/>
    </test>
    
  </tests>
  <help>


.. class:: infomark

**What it does**

This tool will fetch flanking regions around STRs from the reads output by "STR detection" step, screen for quality score at STRs and adjacent flanking regions, and output two fastq files containing flanking regions in forward-forward direction.

- This tool assumes that the quality score is Phred+33, such as Sanger fastq.
- Reads that have either left or right flanking regions shorter than the length of flanking regions that require quality screening will be removed.

**Citation**
When you use this tool, please cite **Fungtammasan A, Ananda G, Hile SE, Su MS, Sun C, Harris R, Medvedev P, Eckert K, Makova KD. 2015. Accurate Typing of Short Tandem Repeats from Genome-wide Sequencing Data and its Applications, Genome Research**
 
**Input**

The input file needs to be in the same format as output from **STR detection** step. This format contains **length of repeat**, **length of left flanking region**, **length of right flanking region**, **repeat motif**, **hamming (editing) distance**, **read name**, **read sequence**, **read quality score**

**Output**

The output will be two fastq files. The first file contains left flanking bases. The second file contains right flanking bases.

**Example**

- Starting with this test input ::

	6	40	54	G	0	SRR345592.75000006 HS2000-192_107:1:63:5822:176818_1_per1_1	TACCCTCCTGTCTTCCCAGACTGATTTCTGTTCCTGCCCTggggggTTCTTGACTCCTCTGAATGGGTACGGGAGTGTGGACCTCAGGGAGGCCCCCTTG	GGGGGGGGGGGGGGGGGFGGGGGGGGGFEGGGGGGGGGGG?FFDFGGGGGG?FFFGGGGGDEGGEFFBEFCEEBD@BACB*?=99(/=5'6=4:CCC*AA
    

- If we want to get fastq files of flanking regions around the detected STRs with quality score of at least 20, the program will report these two fastq files ::

	@SRR345592.75000006 HS2000-192_107:1:63:5822:176818_1_per1_1
	TACCCTCCTGTCTTCCCAGACTGATTTCTGTTCCTGCCCT
	+SRR345592.75000006 HS2000-192_107:1:63:5822:176818_1_per1_1
	GGGGGGGGGGGGGGGGGFGGGGGGGGGFEGGGGGGGGGGG


	@SRR345592.75000006 HS2000-192_107:1:63:5822:176818_1_per1_1
	TTCTTGACTCCTCTGAATGGGTACGGGAGTGTGGACCTCAGGGAGGCCCCCTTG
	+SRR345592.75000006 HS2000-192_107:1:63:5822:176818_1_per1_1
	GGGGG?FFFGGGGGDEGGEFFBEFCEEBD@BACB*?=99(/=5'6=4:CCC*AA
  


</help>
</tool>