# HG changeset patch
# User artbio
# Date 1526489950 14400
# Node ID 401afd3c52206c9ca71a21c9e265fb8023e45979

planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/justgzip commit cb119427c41b729c90572c410f717282ad9cb8a7

diff -r 000000000000 -r 401afd3c5220 gzip.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/gzip.xml	Wed May 16 12:59:10 2018 -0400
@@ -0,0 +1,49 @@
+<tool id="justgzip" name="Gzip sequence datasets" version="0.1.0">
+  <description></description>
+  <stdio>
+      <exit_code range="1:" level="fatal" description="Tool exception" />
+  </stdio>
+  <command detect_errors="exit_code"><![CDATA[  
+gzip -ck '${input1}' >  $output
+  ]]></command>
+  <inputs>
+      <param format="fastq" name="input1" type="data" label="Input file" help="file to compress" />
+      <param name="datatype" type="select" label="Input file datatype" help="Input file datatype" >
+          <option value="sanger" >fastqsanger </option>
+          <option value="illumina" >fastqillumina </option>
+          <option value="fastq" selected="true" >fastq </option>
+      </param>
+  </inputs>
+  <outputs>
+
+   <data name="output" format="fastq.gz" label="$input1.name " >
+   <change_format>
+       <when input="datatype" value="sanger" format="fastqsanger.gz" />
+       <when input="datatype" value="illumina" format="fastqillumina.gz" />
+   </change_format>
+   </data>
+  </outputs>
+  <tests>
+      <test>
+          <param name="input1" value="file1" ftype="fastq" />
+          <param name="datatype" value="fastq" />
+          <output name="output" file="file1.gz" decompress="True" ftype="fastq.gz"/>
+      </test>
+      <test>
+          <param name="input1" value="file1" ftype="fastqsanger" />
+          <param name="datatype" value="sanger" />
+          <output name="output" file="file1.gz" decompress="True" ftype="fastqsanger.gz" />
+      </test>   
+
+  </tests>
+  <help>
+
+.. class:: infomark
+
+**What it does**
+
+Just **gzip** fastq, fastqillumina and fastqsanger datasets.
+    
+  </help>
+</tool>
+
diff -r 000000000000 -r 401afd3c5220 test-data/file1
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/file1	Wed May 16 12:59:10 2018 -0400
@@ -0,0 +1,8 @@
+@1831_573_1004/1
+AATACTTTCGGCGCCCTAAACCAGCTCACTGGGG
++
+><C&&9952+C>5<.?<79,=42<292:<(9/-7
+@1831_573_1050/1
+TTTATGGGTATGGCCGCTCACAGGCCAGCGGCCT
++
+;@@17?@=>7??@A8?==@4A?A4)&+.'&+'1,
\ No newline at end of file
diff -r 000000000000 -r 401afd3c5220 test-data/file1.gz
Binary file test-data/file1.gz has changed