Mercurial > repos > artbio > metavisitor_2_workflows
diff Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_1-1.ga @ 0:c375489bbcb0 draft
planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/workflows/metavisitor_2_workflows commit ecf95caa7d5e9ab001a75cbf5fb306e7ecd3def3
author | artbio |
---|---|
date | Sun, 21 Jul 2019 19:22:52 -0400 |
parents | |
children |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_1-1.ga Sun Jul 21 19:22:52 2019 -0400 @@ -0,0 +1,981 @@ +{ + "a_galaxy_workflow": "true", + "uuid": "1187ab6d-a4f6-4ee7-817c-d12db902fed7", + "tags": [], + "format-version": "0.1", + "version": 3, + "steps": { + "11": { + "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/cap3/cap3/2.0.0", + "errors": null, + "uuid": "bd3f2dd0-b170-433d-b1e8-2b0f303006a7", + "tool_version": "2.0.0", + "outputs": [ + { + "type": "fasta", + "name": "contigsandsinglets" + }, + { + "type": "txt", + "name": "cap3stdout" + }, + { + "type": "fasta", + "name": "contigs" + }, + { + "type": "txt", + "name": "contigsqual" + }, + { + "type": "txt", + "name": "contigslink" + }, + { + "type": "txt", + "name": "ace" + }, + { + "type": "txt", + "name": "info" + }, + { + "type": "txt", + "name": "singlets" + } + ], + "post_job_actions": { + "HideDatasetActioninfo": { + "output_name": "info", + "action_type": "HideDatasetAction", + "action_arguments": {} + }, + "HideDatasetActioncontigsqual": { + "output_name": "contigsqual", + "action_type": "HideDatasetAction", + "action_arguments": {} + }, + "RenameDatasetActioncontigsandsinglets": { + "output_name": "contigsandsinglets", + "action_type": "RenameDatasetAction", + "action_arguments": { + "newname": "CAP3 assembled contigs" + } + }, + "HideDatasetActioncontigslink": { + "output_name": "contigslink", + "action_type": "HideDatasetAction", + "action_arguments": {} + }, + "HideDatasetActioncontigs": { + "output_name": "contigs", + "action_type": "HideDatasetAction", + "action_arguments": {} + }, + "HideDatasetActioncap3stdout": { + "output_name": "cap3stdout", + "action_type": "HideDatasetAction", + "action_arguments": {} + }, + "HideDatasetActionsinglets": { + "output_name": "singlets", + "action_type": "HideDatasetAction", + "action_arguments": {} + }, + "HideDatasetActionace": { + "output_name": "ace", + "action_type": "HideDatasetAction", + "action_arguments": {} + } + }, + "workflow_outputs": [ + { + "output_name": "contigsandsinglets", + "uuid": "e2dff9ee-9235-4087-9a51-30b5b9974537", + "label": null + } + ], + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/cap3/cap3/2.0.0", + "input_connections": { + "inputSequences": { + "output_name": "fastaOutput", + "id": 10 + } + }, + "inputs": [ + { + "name": "inputSequences", + "description": "runtime parameter for tool cap3" + } + ], + "position": { + "top": 633, + "left": 2061.5 + }, + "tool_state": "{\"overlapidentity\": \"\\\"90\\\"\", \"inputSequences\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"overlaplength\": \"\\\"40\\\"\", \"__page__\": null}", + "label": "CAP3 to re-assembe contigs", + "type": "tool", + "id": 11, + "tool_shed_repository": { + "owner": "artbio", + "changeset_revision": "d76a0d8a9eac", + "name": "cap3", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "name": "cap3" + }, + "10": { + "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/blastparser_and_hits/BlastParser_and_hits/2.6.1", + "errors": null, + "uuid": "bac749b9-96e4-4a92-baac-cd160c09f9ec", + "tool_version": "2.6.1", + "outputs": [ + { + "type": "tabular", + "name": "tabularOutput" + }, + { + "type": "fasta", + "name": "fastaOutput" + }, + { + "type": "fasta", + "name": "al_sequences" + }, + { + "type": "fasta", + "name": "un_sequences" + } + ], + "post_job_actions": { + "RenameDatasetActionfastaOutput": { + "output_name": "fastaOutput", + "action_type": "RenameDatasetAction", + "action_arguments": { + "newname": "Assembled contigs hitting viral database" + } + }, + "HideDatasetActional_sequences": { + "output_name": "al_sequences", + "action_type": "HideDatasetAction", + "action_arguments": {} + }, + "HideDatasetActionun_sequences": { + "output_name": "un_sequences", + "action_type": "HideDatasetAction", + "action_arguments": {} + } + }, + "workflow_outputs": [ + { + "output_name": "tabularOutput", + "uuid": "f858a698-d9dd-4cc2-a047-6664b0519271", + "label": null + }, + { + "output_name": "fastaOutput", + "uuid": "d9c341c8-d826-4633-a6a5-9462677092d8", + "label": null + } + ], + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/blastparser_and_hits/BlastParser_and_hits/2.6.1", + "input_connections": { + "blast": { + "output_name": "output1", + "id": 9 + }, + "sequences": { + "output_name": "transcripts", + "id": 8 + } + }, + "inputs": [ + { + "name": "blast", + "description": "runtime parameter for tool Parse blast output and compile hits" + }, + { + "name": "sequences", + "description": "runtime parameter for tool Parse blast output and compile hits" + } + ], + "position": { + "top": 404, + "left": 1740 + }, + "tool_state": "{\"__page__\": null, \"flanking\": \"\\\"5\\\"\", \"additional_filters\": \"{\\\"__current_case__\\\": 1, \\\"filter_maxScore\\\": \\\"0.0\\\", \\\"filter_meanScore\\\": \\\"0.0\\\", \\\"filter_relativeCov\\\": \\\"0.0\\\", \\\"filter_term_in\\\": \\\"Nora_virus\\\", \\\"filter_term_out\\\": \\\"JX220408.1\\\", \\\"use_filters\\\": \\\"yes\\\"}\", \"__rerun_remap_job_id__\": null, \"mode\": \"\\\"short\\\"\", \"sequences\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"blast\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", + "label": "Get viral contigs", + "type": "tool", + "id": 10, + "tool_shed_repository": { + "owner": "artbio", + "changeset_revision": "b4c9c085d709", + "name": "blastparser_and_hits", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "name": "Parse blast output and compile hits" + }, + "13": { + "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/blast_to_scaffold/blast2scaffold/1.0.0", + "errors": null, + "uuid": "7f0913f8-f7f9-4ba3-878c-9c502460331d", + "tool_version": "1.0.0", + "outputs": [ + { + "type": "fasta", + "name": "output" + } + ], + "post_job_actions": { + "HideDatasetActionoutput": { + "output_name": "output", + "action_type": "HideDatasetAction", + "action_arguments": {} + }, + "RenameDatasetActionoutput": { + "output_name": "output", + "action_type": "RenameDatasetAction", + "action_arguments": { + "newname": "generated CDS" + } + } + }, + "workflow_outputs": [], + "annotation": "Generate CDS from aligned contigs", + "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/blast_to_scaffold/blast2scaffold/1.0.0", + "input_connections": { + "guideSequence": { + "output_name": "outfile", + "id": 2 + }, + "blast_tab": { + "output_name": "output1", + "id": 12 + }, + "sequences": { + "output_name": "contigsandsinglets", + "id": 11 + } + }, + "inputs": [ + { + "name": "guideSequence", + "description": "runtime parameter for tool blast_to_scaffold" + }, + { + "name": "blast_tab", + "description": "runtime parameter for tool blast_to_scaffold" + }, + { + "name": "sequences", + "description": "runtime parameter for tool blast_to_scaffold" + } + ], + "position": { + "top": 669, + "left": 2728.5 + }, + "tool_state": "{\"__page__\": null, \"guideSequence\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"blast_tab\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"sequences\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", + "label": "Generate CDS", + "type": "tool", + "id": 13, + "tool_shed_repository": { + "owner": "artbio", + "changeset_revision": "7d96b28eec49", + "name": "blast_to_scaffold", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "name": "blast_to_scaffold" + }, + "12": { + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.3.1", + "errors": null, + "uuid": "4f996123-d155-426a-ba26-e649c422431e", + "tool_version": "0.3.1", + "outputs": [ + { + "type": "tabular", + "name": "output1" + } + ], + "post_job_actions": { + "HideDatasetActionoutput1": { + "output_name": "output1", + "action_type": "HideDatasetAction", + "action_arguments": {} + }, + "RenameDatasetActionoutput1": { + "output_name": "output1", + "action_type": "RenameDatasetAction", + "action_arguments": { + "newname": "Contigs aligned to ${ncbi_guide_ID}" + } + } + }, + "workflow_outputs": [], + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.3.1", + "input_connections": { + "query": { + "output_name": "contigsandsinglets", + "id": 11 + }, + "db_opts|histdb": { + "output_name": "outfile", + "id": 4 + } + }, + "inputs": [ + { + "name": "db_opts", + "description": "runtime parameter for tool NCBI BLAST+ blastn" + }, + { + "name": "query", + "description": "runtime parameter for tool NCBI BLAST+ blastn" + } + ], + "position": { + "top": 837, + "left": 2402 + }, + "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"__current_case__\\\": 2, \\\"ext_cols\\\": [\\\"slen\\\"], \\\"ids_cols\\\": null, \\\"misc_cols\\\": null, \\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"tax_cols\\\": null}\", \"adv_opts\": \"{\\\"__current_case__\\\": 0, \\\"adv_opts_selector\\\": \\\"basic\\\"}\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"db_opts\": \"{\\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\", \\\"db_opts_selector\\\": \\\"histdb\\\", \\\"histdb\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"subject\\\": \\\"\\\"}\", \"blast_type\": \"\\\"blastn\\\"\", \"query\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", + "label": "Blast contigs to specific virus database", + "type": "tool", + "id": 12, + "tool_shed_repository": { + "owner": "devteam", + "changeset_revision": "e25d3acf6e68", + "name": "ncbi_blast_plus", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "name": "NCBI BLAST+ blastn" + }, + "14": { + "tool_id": "toolshed.g2.bx.psu.edu/repos/galaxyp/regex_find_replace/regex1/1.0.0", + "errors": null, + "uuid": "c81173fb-317d-4c00-9da8-f0072b62a569", + "tool_version": "1.0.0", + "outputs": [ + { + "type": "input", + "name": "out_file1" + } + ], + "post_job_actions": { + "ChangeDatatypeActionout_file1": { + "output_name": "out_file1", + "action_type": "ChangeDatatypeAction", + "action_arguments": { + "newtype": "fasta" + } + }, + "RenameDatasetActionout_file1": { + "output_name": "out_file1", + "action_type": "RenameDatasetAction", + "action_arguments": { + "newname": "Nora_MV_${ncbi_guide_ID}_guided" + } + } + }, + "workflow_outputs": [ + { + "output_name": "out_file1", + "uuid": "e202eeb0-f65c-4295-afe0-44a56634a452", + "label": null + } + ], + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/galaxyp/regex_find_replace/regex1/1.0.0", + "input_connections": { + "input": { + "output_name": "output", + "id": 13 + } + }, + "inputs": [ + { + "name": "input", + "description": "runtime parameter for tool Regex Find And Replace" + } + ], + "position": { + "top": 927, + "left": 2971 + }, + "tool_state": "{\"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"checks\": \"[{\\\"__index__\\\": 0, \\\"pattern\\\": \\\">.+\\\", \\\"replacement\\\": \\\">Nora_MV\\\"}]\", \"__page__\": null}", + "label": "Change CDS header", + "type": "tool", + "id": 14, + "tool_shed_repository": { + "owner": "galaxyp", + "changeset_revision": "209b7c5ee9d7", + "name": "regex_find_replace", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "name": "Regex Find And Replace" + }, + "1": { + "tool_id": null, + "errors": null, + "uuid": "462eb78f-9844-42d6-8087-19f2e1e801ca", + "tool_version": null, + "outputs": [], + "workflow_outputs": [ + { + "output_name": "output", + "uuid": "6bd2d24e-e12f-41fe-9308-631cc6718143", + "label": null + } + ], + "annotation": "", + "content_id": null, + "input_connections": {}, + "inputs": [], + "position": { + "top": 976.9833374023438, + "left": 1205.9666748046875 + }, + "tool_state": "{}", + "label": "viral nucleotide BLAST database (V2)", + "type": "data_input", + "id": 1, + "name": "Input dataset" + }, + "0": { + "tool_id": null, + "errors": null, + "uuid": "aa5c2a9c-0f52-4884-9f1c-74432b24af61", + "tool_version": null, + "outputs": [], + "workflow_outputs": [ + { + "output_name": "output", + "uuid": "b5da90b2-1c4f-4646-8c70-fc9952f6cb94", + "label": null + } + ], + "annotation": "", + "content_id": null, + "input_connections": {}, + "inputs": [], + "position": { + "top": 163, + "left": 200 + }, + "tool_state": "{\"collection_type\": \"list\"}", + "label": "Fastq files", + "type": "data_collection_input", + "id": 0, + "name": "Input dataset collection" + }, + "3": { + "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/yac_clipper/yac/2.3.0", + "errors": null, + "uuid": "41212793-f400-4bd6-9827-c083025f3e01", + "tool_version": "2.3.0", + "outputs": [ + { + "type": "input", + "name": "output" + } + ], + "post_job_actions": { + "RenameDatasetActionoutput": { + "output_name": "output", + "action_type": "RenameDatasetAction", + "action_arguments": { + "newname": "#{input} clipped" + } + } + }, + "workflow_outputs": [ + { + "output_name": "output", + "uuid": "3939be31-c091-4dbe-86a7-fd05c01f9598", + "label": null + } + ], + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/yac_clipper/yac/2.3.0", + "input_connections": { + "input": { + "output_name": "output", + "id": 0 + } + }, + "inputs": [ + { + "name": "input", + "description": "runtime parameter for tool Clip adapter" + } + ], + "position": { + "top": 318, + "left": 364.5 + }, + "tool_state": "{\"out_format\": \"\\\"fasta\\\"\", \"__page__\": null, \"min\": \"\\\"18\\\"\", \"max\": \"\\\"30\\\"\", \"__rerun_remap_job_id__\": null, \"clip_source\": \"{\\\"__current_case__\\\": 0, \\\"clip_sequence\\\": \\\"CTGTAGGCACCATCAATCGT\\\", \\\"clip_source_list\\\": \\\"prebuilt\\\"}\", \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"Nmode\": \"\\\"reject\\\"\"}", + "label": null, + "type": "tool", + "id": 3, + "tool_shed_repository": { + "owner": "artbio", + "changeset_revision": "f7947c5a18b8", + "name": "yac_clipper", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "name": "Clip adapter" + }, + "2": { + "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/2.3.0", + "errors": null, + "uuid": "13214523-9fb0-4e23-8cdf-f389331ba0c9", + "tool_version": "2.3.0", + "outputs": [ + { + "type": "fasta", + "name": "outfile" + }, + { + "type": "txt", + "name": "logfile" + } + ], + "post_job_actions": { + "HideDatasetActionlogfile": { + "output_name": "logfile", + "action_type": "HideDatasetAction", + "action_arguments": {} + }, + "RenameDatasetActionoutfile": { + "output_name": "outfile", + "action_type": "RenameDatasetAction", + "action_arguments": { + "newname": "${ncbi_guide_ID}" + } + } + }, + "workflow_outputs": [ + { + "output_name": "outfile", + "uuid": "9c9b23f2-66ae-4eeb-88f1-e4a0a8bd596b", + "label": null + } + ], + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/2.3.0", + "input_connections": {}, + "inputs": [], + "position": { + "top": 1043, + "left": 1750 + }, + "tool_state": "{\"__page__\": null, \"__rerun_remap_job_id__\": null, \"queryString\": \"\\\"${ncbi_guide_ID}\\\"\", \"dbname\": \"\\\"nuccore\\\"\", \"dry_run\": \"\\\"false\\\"\"}", + "label": null, + "type": "tool", + "id": 2, + "tool_shed_repository": { + "owner": "artbio", + "changeset_revision": "c667d0ee39f5", + "name": "fetch_fasta_from_ncbi", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "name": "Retrieve FASTA from NCBI" + }, + "5": { + "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", + "errors": null, + "uuid": "02a6f0a8-8f83-4b0f-85ad-0370a5753a13", + "tool_version": "1.4.1", + "outputs": [ + { + "type": "input", + "name": "paired_output" + }, + { + "type": "input", + "name": "list_output" + }, + { + "type": "input", + "name": "out_file1" + }, + { + "type": "_sniff_", + "name": "paired_out_file" + } + ], + "post_job_actions": { + "HideDatasetActionpaired_out_file": { + "output_name": "paired_out_file", + "action_type": "HideDatasetAction", + "action_arguments": {} + }, + "RenameDatasetActionout_file1": { + "output_name": "out_file1", + "action_type": "RenameDatasetAction", + "action_arguments": { + "newname": "#{global_condition.inputs} concatenated" + } + }, + "HideDatasetActionpaired_output": { + "output_name": "paired_output", + "action_type": "HideDatasetAction", + "action_arguments": {} + }, + "HideDatasetActionout_file1": { + "output_name": "out_file1", + "action_type": "HideDatasetAction", + "action_arguments": {} + }, + "HideDatasetActionlist_output": { + "output_name": "list_output", + "action_type": "HideDatasetAction", + "action_arguments": {} + } + }, + "workflow_outputs": [], + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", + "input_connections": { + "global_condition|inputs": { + "output_name": "output", + "id": 3 + } + }, + "inputs": [ + { + "name": "global_condition", + "description": "runtime parameter for tool Concatenate multiple datasets" + } + ], + "position": { + "top": 492.5, + "left": 474 + }, + "tool_state": "{\"dataset_names\": \"\\\"false\\\"\", \"headers\": \"\\\"0\\\"\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"global_condition\": \"{\\\"__current_case__\\\": 0, \\\"input_type\\\": \\\"singles\\\", \\\"inputs\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\"}", + "label": "Concatenate read files", + "type": "tool", + "id": 5, + "tool_shed_repository": { + "owner": "artbio", + "changeset_revision": "55cf9d9defd1", + "name": "concatenate_multiple_datasets", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "name": "Concatenate multiple datasets" + }, + "4": { + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_makeblastdb/0.3.1", + "errors": null, + "uuid": "1a39e6e8-8079-4f7a-b4c2-2028e5dbc2dd", + "tool_version": "0.3.1", + "outputs": [ + { + "type": "data", + "name": "outfile" + } + ], + "post_job_actions": { + "HideDatasetActionoutfile": { + "output_name": "outfile", + "action_type": "HideDatasetAction", + "action_arguments": {} + }, + "RenameDatasetActionoutfile": { + "output_name": "outfile", + "action_type": "RenameDatasetAction", + "action_arguments": { + "newname": "#{input_file} blast database" + } + } + }, + "workflow_outputs": [], + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_makeblastdb/0.3.1", + "input_connections": { + "input_file": { + "output_name": "outfile", + "id": 2 + } + }, + "inputs": [ + { + "name": "mask_data_file", + "description": "runtime parameter for tool NCBI BLAST+ makeblastdb" + }, + { + "name": "input_file", + "description": "runtime parameter for tool NCBI BLAST+ makeblastdb" + } + ], + "position": { + "top": 1060, + "left": 2100.5 + }, + "tool_state": "{\"__page__\": null, \"mask_data_file\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"input_file\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"dbtype\": \"\\\"nucl\\\"\", \"__rerun_remap_job_id__\": null, \"hash_index\": \"\\\"true\\\"\", \"tax\": \"{\\\"__current_case__\\\": 0, \\\"taxselect\\\": \\\"\\\"}\", \"title\": \"\\\"Blastn candidate database\\\"\", \"parse_seqids\": \"\\\"false\\\"\"}", + "label": "Make a blast database", + "type": "tool", + "id": 4, + "tool_shed_repository": { + "owner": "devteam", + "changeset_revision": "e25d3acf6e68", + "name": "ncbi_blast_plus", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "name": "NCBI BLAST+ makeblastdb" + }, + "7": { + "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1", + "errors": null, + "uuid": "62876927-ee09-4764-95eb-d86548fdce73", + "tool_version": "2.1.1", + "outputs": [ + { + "type": "tabular", + "name": "output" + }, + { + "type": "input", + "name": "aligned" + }, + { + "type": "input", + "name": "unaligned" + } + ], + "post_job_actions": { + "HideDatasetActionaligned": { + "output_name": "aligned", + "action_type": "HideDatasetAction", + "action_arguments": {} + }, + "HideDatasetActionoutput": { + "output_name": "output", + "action_type": "HideDatasetAction", + "action_arguments": {} + }, + "RenameDatasetActionunaligned": { + "output_name": "unaligned", + "action_type": "RenameDatasetAction", + "action_arguments": { + "newname": "Non D. melanogaster sequences" + } + } + }, + "workflow_outputs": [ + { + "output_name": "unaligned", + "uuid": "608ff661-018b-44c2-b020-59b31c5ff2d4", + "label": null + } + ], + "annotation": "Align reads to host (dm6) genome.\nThe unaligned reads will most likely have a viral source.", + "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1", + "input_connections": { + "input": { + "output_name": "output", + "id": 6 + } + }, + "inputs": [ + { + "name": "input", + "description": "runtime parameter for tool sR_bowtie" + } + ], + "position": { + "top": 238, + "left": 952 + }, + "tool_state": "{\"__page__\": null, \"output_format\": \"\\\"tabular\\\"\", \"v_mismatches\": \"\\\"2\\\"\", \"additional_fasta\": \"\\\"unal\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"refGenomeSource\": \"{\\\"__current_case__\\\": 0, \\\"genomeSource\\\": \\\"indexed\\\", \\\"index\\\": \\\"dm6\\\"}\", \"method\": \"\\\"k_option\\\"\"}", + "label": "Get non-host sequences", + "type": "tool", + "id": 7, + "tool_shed_repository": { + "owner": "artbio", + "changeset_revision": "0281bb245635", + "name": "sr_bowtie", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "name": "sR_bowtie" + }, + "6": { + "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/sequence_format_converter/sequence_format_converter/2.1.1", + "errors": null, + "uuid": "e693b793-ae94-42c8-9f59-4b4b847aa4b1", + "tool_version": "2.1.1", + "outputs": [ + { + "type": "fasta", + "name": "output" + } + ], + "post_job_actions": { + "RenameDatasetActionoutput": { + "output_name": "output", + "action_type": "RenameDatasetAction", + "action_arguments": { + "newname": "Initial Clipped sequences" + } + } + }, + "workflow_outputs": [ + { + "output_name": "output", + "uuid": "b81a3224-0d3e-4dec-996f-5fa3d525cabd", + "label": null + } + ], + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/sequence_format_converter/sequence_format_converter/2.1.1", + "input_connections": { + "input": { + "output_name": "out_file1", + "id": 5 + } + }, + "inputs": [ + { + "name": "input", + "description": "runtime parameter for tool sequence_format_converter" + } + ], + "position": { + "top": 621, + "left": 787.5 + }, + "tool_state": "{\"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"output_format\": \"\\\"fastaw\\\"\", \"__rerun_remap_job_id__\": null, \"__page__\": null}", + "label": "Change sequence format to weighted fasta", + "type": "tool", + "id": 6, + "tool_shed_repository": { + "owner": "artbio", + "changeset_revision": "f1d59113125a", + "name": "sequence_format_converter", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "name": "sequence_format_converter" + }, + "9": { + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.3.1", + "errors": null, + "uuid": "37904c73-85c7-40e8-b1d5-e5f3d6a12135", + "tool_version": "0.3.1", + "outputs": [ + { + "type": "tabular", + "name": "output1" + } + ], + "post_job_actions": { + "HideDatasetActionoutput1": { + "output_name": "output1", + "action_type": "HideDatasetAction", + "action_arguments": {} + } + }, + "workflow_outputs": [], + "annotation": "Align the assembled transcripts to the viral database to filter out non-viral sequences.", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.3.1", + "input_connections": { + "query": { + "output_name": "transcripts", + "id": 8 + }, + "db_opts|histdb": { + "output_name": "output", + "id": 1 + } + }, + "inputs": [ + { + "name": "db_opts", + "description": "runtime parameter for tool NCBI BLAST+ blastn" + }, + { + "name": "query", + "description": "runtime parameter for tool NCBI BLAST+ blastn" + } + ], + "position": { + "top": 690, + "left": 1455 + }, + "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"__current_case__\\\": 2, \\\"ext_cols\\\": [\\\"slen\\\"], \\\"ids_cols\\\": null, \\\"misc_cols\\\": null, \\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"tax_cols\\\": null}\", \"adv_opts\": \"{\\\"__current_case__\\\": 1, \\\"adv_optional_id_files_opts\\\": {\\\"__current_case__\\\": 0, \\\"adv_optional_id_files_opts_selector\\\": \\\"none\\\"}, \\\"adv_opts_selector\\\": \\\"advanced\\\", \\\"filter_query\\\": \\\"true\\\", \\\"gapextend\\\": \\\"\\\", \\\"gapopen\\\": \\\"\\\", \\\"identity_cutoff\\\": \\\"0.0\\\", \\\"max_hits\\\": \\\"5\\\", \\\"max_hsps\\\": \\\"\\\", \\\"parse_deflines\\\": \\\"false\\\", \\\"qcov_hsp_perc\\\": \\\"0.0\\\", \\\"strand\\\": \\\"-strand both\\\", \\\"ungapped\\\": \\\"false\\\", \\\"window_size\\\": \\\"\\\", \\\"word_size\\\": \\\"\\\"}\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"db_opts\": \"{\\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\", \\\"db_opts_selector\\\": \\\"histdb\\\", \\\"histdb\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"subject\\\": \\\"\\\"}\", \"blast_type\": \"\\\"blastn\\\"\", \"query\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", + "label": "BLASTn contigs to the viral database", + "type": "tool", + "id": 9, + "tool_shed_repository": { + "owner": "devteam", + "changeset_revision": "e25d3acf6e68", + "name": "ncbi_blast_plus", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "name": "NCBI BLAST+ blastn" + }, + "8": { + "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/oases/oasesoptimiserv/1.2.2", + "errors": null, + "uuid": "04b99c48-2bf7-4842-b28e-c9085ffe40e9", + "tool_version": "1.2.2", + "outputs": [ + { + "type": "fasta", + "name": "transcripts" + } + ], + "post_job_actions": { + "ChangeDatatypeActiontranscripts": { + "output_name": "transcripts", + "action_type": "ChangeDatatypeAction", + "action_arguments": { + "newtype": "fasta" + } + }, + "RenameDatasetActiontranscripts": { + "output_name": "transcripts", + "action_type": "RenameDatasetAction", + "action_arguments": { + "newname": "Oases Contigs" + } + } + }, + "workflow_outputs": [ + { + "output_name": "transcripts", + "uuid": "704bb7a9-199c-4028-a482-ebc60ab1d02e", + "label": null + } + ], + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/oases/oasesoptimiserv/1.2.2", + "input_connections": { + "inputs_0|input": { + "output_name": "unaligned", + "id": 7 + } + }, + "inputs": [], + "position": { + "top": 442, + "left": 1287 + }, + "tool_state": "{\"__page__\": null, \"inputs\": \"[{\\\"__index__\\\": 0, \\\"input\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}]\", \"end_hash_length\": \"\\\"29\\\"\", \"__rerun_remap_job_id__\": null, \"start_hash_length\": \"\\\"13\\\"\"}", + "label": "Assemble contigs", + "type": "tool", + "id": 8, + "tool_shed_repository": { + "owner": "artbio", + "changeset_revision": "f7dd852c8f4c", + "name": "oases", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "name": "Oases_optimiser" + } + }, + "annotation": "", + "name": "Metavisitor: Workflow for Use Case 1-1" +}