Mercurial > repos > artbio > metavisitor_2_workflows
view Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_1-4.ga @ 1:6396f06de8a9 draft default tip
planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/workflows/metavisitor_2_workflows commit 46881c948d0ad16e8c687657648402eeb5a886fb
author | artbio |
---|---|
date | Wed, 21 Aug 2019 06:30:46 -0400 |
parents | c375489bbcb0 |
children |
line wrap: on
line source
{ "a_galaxy_workflow": "true", "uuid": "c87376ff-1e6d-47a3-ad9a-2defc67e5f7d", "tags": [], "format-version": "0.1", "version": 2, "steps": { "1": { "tool_id": null, "errors": null, "uuid": "462eb78f-9844-42d6-8087-19f2e1e801ca", "tool_version": null, "outputs": [], "workflow_outputs": [ { "output_name": "output", "uuid": "6bd2d24e-e12f-41fe-9308-631cc6718143", "label": null } ], "annotation": "", "content_id": null, "input_connections": {}, "inputs": [], "position": { "top": 799.9833374023438, "left": 1109.9666748046875 }, "tool_state": "{}", "label": "viral nucleotide BLAST database (V2)", "type": "data_input", "id": 1, "name": "Input dataset" }, "0": { "tool_id": null, "errors": null, "uuid": "aa5c2a9c-0f52-4884-9f1c-74432b24af61", "tool_version": null, "outputs": [], "workflow_outputs": [ { "output_name": "output", "uuid": "b5da90b2-1c4f-4646-8c70-fc9952f6cb94", "label": null } ], "annotation": "", "content_id": null, "input_connections": {}, "inputs": [], "position": { "top": 597, "left": 298 }, "tool_state": "{\"collection_type\": \"list\"}", "label": null, "type": "data_collection_input", "id": 0, "name": "Input dataset collection" }, "3": { "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", "errors": null, "uuid": "31d99ab7-8eb2-458c-82bd-b8c90e8689a5", "tool_version": "1.4.1", "outputs": [ { "type": "input", "name": "paired_output" }, { "type": "input", "name": "list_output" }, { "type": "input", "name": "out_file1" }, { "type": "_sniff_", "name": "paired_out_file" } ], "post_job_actions": { "HideDatasetActionpaired_out_file": { "output_name": "paired_out_file", "action_type": "HideDatasetAction", "action_arguments": {} }, "HideDatasetActionout_file1": { "output_name": "out_file1", "action_type": "HideDatasetAction", "action_arguments": {} }, "HideDatasetActionlist_output": { "output_name": "list_output", "action_type": "HideDatasetAction", "action_arguments": {} }, "HideDatasetActionpaired_output": { "output_name": "paired_output", "action_type": "HideDatasetAction", "action_arguments": {} } }, "workflow_outputs": [], "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", "input_connections": { "global_condition|inputs": { "output_name": "output", "id": 2 } }, "inputs": [ { "name": "global_condition", "description": "runtime parameter for tool Concatenate multiple datasets" } ], "position": { "top": 539.5, "left": 568 }, "tool_state": "{\"dataset_names\": \"\\\"false\\\"\", \"headers\": \"\\\"0\\\"\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"global_condition\": \"{\\\"__current_case__\\\": 0, \\\"input_type\\\": \\\"singles\\\", \\\"inputs\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\"}", "label": null, "type": "tool", "id": 3, "tool_shed_repository": { "owner": "artbio", "changeset_revision": "55cf9d9defd1", "name": "concatenate_multiple_datasets", "tool_shed": "toolshed.g2.bx.psu.edu" }, "name": "Concatenate multiple datasets" }, "2": { "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/yac_clipper/yac/2.3.0", "errors": null, "uuid": "41212793-f400-4bd6-9827-c083025f3e01", "tool_version": "2.3.0", "outputs": [ { "type": "input", "name": "output" } ], "post_job_actions": { "RenameDatasetActionoutput": { "output_name": "output", "action_type": "RenameDatasetAction", "action_arguments": { "newname": "#{input} clipped" } } }, "workflow_outputs": [ { "output_name": "output", "uuid": "2f70387c-80f0-47d5-86ac-ec54a6349f0d", "label": null } ], "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/yac_clipper/yac/2.3.0", "input_connections": { "input": { "output_name": "output", "id": 0 } }, "inputs": [ { "name": "input", "description": "runtime parameter for tool Clip adapter" } ], "position": { "top": 782, "left": 429.5 }, "tool_state": "{\"out_format\": \"\\\"fasta\\\"\", \"__page__\": null, \"min\": \"\\\"18\\\"\", \"max\": \"\\\"30\\\"\", \"__rerun_remap_job_id__\": null, \"clip_source\": \"{\\\"__current_case__\\\": 0, \\\"clip_sequence\\\": \\\"CTGTAGGCACCATCAATCGT\\\", \\\"clip_source_list\\\": \\\"prebuilt\\\"}\", \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"Nmode\": \"\\\"reject\\\"\"}", "label": null, "type": "tool", "id": 2, "tool_shed_repository": { "owner": "artbio", "changeset_revision": "f7947c5a18b8", "name": "yac_clipper", "tool_shed": "toolshed.g2.bx.psu.edu" }, "name": "Clip adapter" }, "5": { "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1", "errors": null, "uuid": "0094651e-e2dc-4932-87eb-9f1292b85bbf", "tool_version": "2.1.1", "outputs": [ { "type": "tabular", "name": "output" }, { "type": "input", "name": "aligned" }, { "type": "input", "name": "unaligned" } ], "post_job_actions": { "HideDatasetActionaligned": { "output_name": "aligned", "action_type": "HideDatasetAction", "action_arguments": {} }, "HideDatasetActionoutput": { "output_name": "output", "action_type": "HideDatasetAction", "action_arguments": {} }, "RenameDatasetActionunaligned": { "output_name": "unaligned", "action_type": "RenameDatasetAction", "action_arguments": { "newname": "Non D. melanogaster sequences" } } }, "workflow_outputs": [ { "output_name": "unaligned", "uuid": "5fdb9817-061d-438b-8605-95b63d290655", "label": null } ], "annotation": "Get non-host reads", "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1", "input_connections": { "input": { "output_name": "output", "id": 4 } }, "inputs": [ { "name": "input", "description": "runtime parameter for tool sR_bowtie" } ], "position": { "top": 574, "left": 876 }, "tool_state": "{\"__page__\": null, \"output_format\": \"\\\"tabular\\\"\", \"v_mismatches\": \"\\\"2\\\"\", \"additional_fasta\": \"\\\"unal\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"refGenomeSource\": \"{\\\"__current_case__\\\": 0, \\\"genomeSource\\\": \\\"indexed\\\", \\\"index\\\": \\\"dm6\\\"}\", \"method\": \"\\\"k_option\\\"\"}", "label": "Align to host genome", "type": "tool", "id": 5, "tool_shed_repository": { "owner": "artbio", "changeset_revision": "0281bb245635", "name": "sr_bowtie", "tool_shed": "toolshed.g2.bx.psu.edu" }, "name": "sR_bowtie" }, "4": { "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/sequence_format_converter/sequence_format_converter/2.1.1", "errors": null, "uuid": "a82646ef-d5fe-4e6b-b294-19005c9973e4", "tool_version": "2.1.1", "outputs": [ { "type": "fasta", "name": "output" } ], "post_job_actions": { "RenameDatasetActionoutput": { "output_name": "output", "action_type": "RenameDatasetAction", "action_arguments": { "newname": "Initial Clipped sequences" } } }, "workflow_outputs": [ { "output_name": "output", "uuid": "a2474d73-a111-4675-b236-df907b7dbf1a", "label": null } ], "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/sequence_format_converter/sequence_format_converter/2.1.1", "input_connections": { "input": { "output_name": "out_file1", "id": 3 } }, "inputs": [ { "name": "input", "description": "runtime parameter for tool sequence_format_converter" } ], "position": { "top": 804, "left": 720.5 }, "tool_state": "{\"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"output_format\": \"\\\"fastaw\\\"\", \"__rerun_remap_job_id__\": null, \"__page__\": null}", "label": "Collapse reads", "type": "tool", "id": 4, "tool_shed_repository": { "owner": "artbio", "changeset_revision": "f1d59113125a", "name": "sequence_format_converter", "tool_shed": "toolshed.g2.bx.psu.edu" }, "name": "sequence_format_converter" }, "7": { "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.3.1", "errors": null, "uuid": "37904c73-85c7-40e8-b1d5-e5f3d6a12135", "tool_version": "0.3.1", "outputs": [ { "type": "tabular", "name": "output1" } ], "post_job_actions": { "HideDatasetActionoutput1": { "output_name": "output1", "action_type": "HideDatasetAction", "action_arguments": {} } }, "workflow_outputs": [], "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.3.1", "input_connections": { "query": { "output_name": "transcripts", "id": 6 }, "db_opts|histdb": { "output_name": "output", "id": 1 } }, "inputs": [ { "name": "db_opts", "description": "runtime parameter for tool NCBI BLAST+ blastn" }, { "name": "query", "description": "runtime parameter for tool NCBI BLAST+ blastn" } ], "position": { "top": 782, "left": 1340 }, "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"__current_case__\\\": 2, \\\"ext_cols\\\": [\\\"slen\\\"], \\\"ids_cols\\\": null, \\\"misc_cols\\\": null, \\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"tax_cols\\\": null}\", \"adv_opts\": \"{\\\"__current_case__\\\": 1, \\\"adv_optional_id_files_opts\\\": {\\\"__current_case__\\\": 0, \\\"adv_optional_id_files_opts_selector\\\": \\\"none\\\"}, \\\"adv_opts_selector\\\": \\\"advanced\\\", \\\"filter_query\\\": \\\"true\\\", \\\"gapextend\\\": \\\"\\\", \\\"gapopen\\\": \\\"\\\", \\\"identity_cutoff\\\": \\\"0.0\\\", \\\"max_hits\\\": \\\"5\\\", \\\"max_hsps\\\": \\\"\\\", \\\"parse_deflines\\\": \\\"false\\\", \\\"qcov_hsp_perc\\\": \\\"0.0\\\", \\\"strand\\\": \\\"-strand both\\\", \\\"ungapped\\\": \\\"false\\\", \\\"window_size\\\": \\\"\\\", \\\"word_size\\\": \\\"\\\"}\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"db_opts\": \"{\\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\", \\\"db_opts_selector\\\": \\\"histdb\\\", \\\"histdb\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"subject\\\": \\\"\\\"}\", \"blast_type\": \"\\\"blastn\\\"\", \"query\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", "label": "Blast assembled reads to vir2", "type": "tool", "id": 7, "tool_shed_repository": { "owner": "devteam", "changeset_revision": "e25d3acf6e68", "name": "ncbi_blast_plus", "tool_shed": "toolshed.g2.bx.psu.edu" }, "name": "NCBI BLAST+ blastn" }, "6": { "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/oases/oasesoptimiserv/1.2.2", "errors": null, "uuid": "04b99c48-2bf7-4842-b28e-c9085ffe40e9", "tool_version": "1.2.2", "outputs": [ { "type": "fasta", "name": "transcripts" } ], "post_job_actions": { "ChangeDatatypeActiontranscripts": { "output_name": "transcripts", "action_type": "ChangeDatatypeAction", "action_arguments": { "newtype": "fasta" } }, "RenameDatasetActiontranscripts": { "output_name": "transcripts", "action_type": "RenameDatasetAction", "action_arguments": { "newname": "Oases Contigs" } } }, "workflow_outputs": [ { "output_name": "transcripts", "uuid": "704bb7a9-199c-4028-a482-ebc60ab1d02e", "label": null } ], "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/oases/oasesoptimiserv/1.2.2", "input_connections": { "inputs_0|input": { "output_name": "unaligned", "id": 5 } }, "inputs": [], "position": { "top": 623, "left": 1167 }, "tool_state": "{\"__page__\": null, \"inputs\": \"[{\\\"__index__\\\": 0, \\\"input\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}]\", \"end_hash_length\": \"\\\"29\\\"\", \"__rerun_remap_job_id__\": null, \"start_hash_length\": \"\\\"13\\\"\"}", "label": "Assemble reads", "type": "tool", "id": 6, "tool_shed_repository": { "owner": "artbio", "changeset_revision": "f7dd852c8f4c", "name": "oases", "tool_shed": "toolshed.g2.bx.psu.edu" }, "name": "Oases_optimiser" }, "8": { "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/blastparser_and_hits/BlastParser_and_hits/2.6.1", "errors": null, "uuid": "bbbbec1e-cc46-4b89-aa5c-3213562ae405", "tool_version": "2.6.1", "outputs": [ { "type": "tabular", "name": "tabularOutput" }, { "type": "fasta", "name": "fastaOutput" }, { "type": "fasta", "name": "al_sequences" }, { "type": "fasta", "name": "un_sequences" } ], "post_job_actions": { "HideDatasetActional_sequences": { "output_name": "al_sequences", "action_type": "HideDatasetAction", "action_arguments": {} }, "RenameDatasetActiontabularOutput": { "output_name": "tabularOutput", "action_type": "RenameDatasetAction", "action_arguments": { "newname": "Blastn assembled reads vs vir2" } }, "HideDatasetActionun_sequences": { "output_name": "un_sequences", "action_type": "HideDatasetAction", "action_arguments": {} }, "HideDatasetActionfastaOutput": { "output_name": "fastaOutput", "action_type": "HideDatasetAction", "action_arguments": {} } }, "workflow_outputs": [ { "output_name": "tabularOutput", "uuid": "f73c0a89-1b19-4dd5-843f-3c7c68d13338", "label": null } ], "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/blastparser_and_hits/BlastParser_and_hits/2.6.1", "input_connections": { "blast": { "output_name": "output1", "id": 7 }, "sequences": { "output_name": "transcripts", "id": 6 } }, "inputs": [ { "name": "blast", "description": "runtime parameter for tool Parse blast output and compile hits" }, { "name": "sequences", "description": "runtime parameter for tool Parse blast output and compile hits" } ], "position": { "top": 579, "left": 1652 }, "tool_state": "{\"__page__\": null, \"flanking\": \"\\\"5\\\"\", \"additional_filters\": \"{\\\"__current_case__\\\": 0, \\\"use_filters\\\": \\\"no\\\"}\", \"__rerun_remap_job_id__\": null, \"mode\": \"\\\"short\\\"\", \"sequences\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"blast\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", "label": null, "type": "tool", "id": 8, "tool_shed_repository": { "owner": "artbio", "changeset_revision": "b4c9c085d709", "name": "blastparser_and_hits", "tool_shed": "toolshed.g2.bx.psu.edu" }, "name": "Parse blast output and compile hits" } }, "annotation": "", "name": "Metavisitor: Workflow for Use Case 1-4" }