changeset 0:c375489bbcb0 draft

planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/workflows/metavisitor_2_workflows commit ecf95caa7d5e9ab001a75cbf5fb306e7ecd3def3
author artbio
date Sun, 21 Jul 2019 19:22:52 -0400
parents
children 6396f06de8a9
files Galaxy-Workflow-Metavisitor__Spades_test_in_Use_Case_2-2.ga Galaxy-Workflow-Metavisitor__Trinity_test_in_Use_Case_2-2.ga Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_1-1.ga Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_1-2.ga Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_1-3.ga Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_1-4.ga Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_2-1.ga Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_2-2.ga Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_3-1.ga Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_3-2.ga Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_3-3.ga Galaxy-Workflow-Metavisitor__Workflow_for_nucleic_vir2_generation.ga Galaxy-Workflow-Metavisitor__Workflow_for_nucleic_vir2_generation_and_test.ga Galaxy-Workflow-Metavisitor__Workflow_for_proteic_vir2_generation.ga Galaxy-Workflow-Metavisitor__Workflow_for_proteic_vir2_generation_and_test.ga Galaxy-Workflow-Metavisitor__Workflow_for_remapping_in_Use_Cases_1-1,2,3.ga Galaxy-Workflow-Metavisitor__Workflow_for_remapping_in_Use_Cases_2-1,2.ga Galaxy-Workflow-Metavisitor__Workflow_for_small_RNA_profiling_of_contigs.ga repository_dependencies.xml
diffstat 19 files changed, 11637 insertions(+), 0 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/Galaxy-Workflow-Metavisitor__Spades_test_in_Use_Case_2-2.ga	Sun Jul 21 19:22:52 2019 -0400
@@ -0,0 +1,558 @@
+{
+    "a_galaxy_workflow": "true", 
+    "uuid": "4eeec630-2c47-43fc-a0c0-1c42f7b24bcd", 
+    "tags": [], 
+    "format-version": "0.1", 
+    "version": 2, 
+    "steps": {
+        "1": {
+            "tool_id": null, 
+            "errors": null, 
+            "uuid": "ba008c06-f14c-4096-8e67-aaadc5f4da7f", 
+            "tool_version": null, 
+            "outputs": [], 
+            "workflow_outputs": [
+                {
+                    "output_name": "output", 
+                    "uuid": "bfdbc10f-dec4-4545-b356-0b85e6171b1d", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": null, 
+            "input_connections": {}, 
+            "inputs": [], 
+            "position": {
+                "top": 538.5, 
+                "left": 1479.5
+            }, 
+            "tool_state": "{}", 
+            "label": "Protein Blast database", 
+            "type": "data_input", 
+            "id": 1, 
+            "name": "Input dataset"
+        }, 
+        "0": {
+            "tool_id": null, 
+            "errors": null, 
+            "uuid": "c51fc830-0dbc-45e9-ac2a-11ba565237a2", 
+            "tool_version": null, 
+            "outputs": [], 
+            "workflow_outputs": [
+                {
+                    "output_name": "output", 
+                    "uuid": "4622ab31-8367-4919-8b83-e7ec39ea1b32", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": null, 
+            "input_connections": {}, 
+            "inputs": [], 
+            "position": {
+                "top": 269.5, 
+                "left": 200
+            }, 
+            "tool_state": "{\"collection_type\": \"list\"}", 
+            "label": "Fastq read files", 
+            "type": "data_collection_input", 
+            "id": 0, 
+            "name": "Input dataset collection"
+        }, 
+        "3": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", 
+            "errors": null, 
+            "uuid": "b6115894-4559-4388-8a64-4e7f909ab90c", 
+            "tool_version": "1.4.1", 
+            "outputs": [
+                {
+                    "type": "input", 
+                    "name": "paired_output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "list_output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "out_file1"
+                }, 
+                {
+                    "type": "_sniff_", 
+                    "name": "paired_out_file"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionpaired_out_file": {
+                    "output_name": "paired_out_file", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionpaired_output": {
+                    "output_name": "paired_output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionout_file1": {
+                    "output_name": "out_file1", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionlist_output": {
+                    "output_name": "list_output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", 
+            "input_connections": {
+                "global_condition|inputs": {
+                    "output_name": "output_unaligned_reads_l", 
+                    "id": 2
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "global_condition", 
+                    "description": "runtime parameter for tool Concatenate multiple datasets"
+                }
+            ], 
+            "position": {
+                "top": 276.5, 
+                "left": 782
+            }, 
+            "tool_state": "{\"dataset_names\": \"\\\"false\\\"\", \"headers\": \"\\\"0\\\"\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"global_condition\": \"{\\\"__current_case__\\\": 0, \\\"input_type\\\": \\\"singles\\\", \\\"inputs\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\"}", 
+            "label": null, 
+            "type": "tool", 
+            "id": 3, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "55cf9d9defd1", 
+                "name": "concatenate_multiple_datasets", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Concatenate multiple datasets"
+        }, 
+        "2": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.3.4.3", 
+            "errors": null, 
+            "uuid": "23f680f2-4891-4bea-a920-700ef1e95149", 
+            "tool_version": "2.3.4.3", 
+            "outputs": [
+                {
+                    "type": "fastqsanger", 
+                    "name": "output_unaligned_reads_l"
+                }, 
+                {
+                    "type": "fastqsanger", 
+                    "name": "output_aligned_reads_l"
+                }, 
+                {
+                    "type": "fastqsanger", 
+                    "name": "output_aligned_reads_r"
+                }, 
+                {
+                    "type": "fastqsanger", 
+                    "name": "output_unaligned_reads_r"
+                }, 
+                {
+                    "type": "bam", 
+                    "name": "output"
+                }, 
+                {
+                    "type": "txt", 
+                    "name": "mapping_stats"
+                }
+            ], 
+            "post_job_actions": {
+                "DeleteIntermediatesActionoutput_unaligned_reads_l": {
+                    "output_name": "output_unaligned_reads_l", 
+                    "action_type": "DeleteIntermediatesAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionoutput_unaligned_reads_r": {
+                    "output_name": "output_unaligned_reads_r", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionoutput": {
+                    "output_name": "output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionoutput_aligned_reads_l": {
+                    "output_name": "output_aligned_reads_l", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionmapping_stats": {
+                    "output_name": "mapping_stats", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionoutput_aligned_reads_r": {
+                    "output_name": "output_aligned_reads_r", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionoutput_unaligned_reads_l": {
+                    "output_name": "output_unaligned_reads_l", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "Get non-host reads", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.3.4.3", 
+            "input_connections": {
+                "library|input_1": {
+                    "output_name": "output", 
+                    "id": 0
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "library", 
+                    "description": "runtime parameter for tool Bowtie2"
+                }
+            ], 
+            "position": {
+                "top": 302.5, 
+                "left": 477
+            }, 
+            "tool_state": "{\"sam_options\": \"{\\\"__current_case__\\\": 1, \\\"sam_options_selector\\\": \\\"no\\\"}\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"library\": \"{\\\"__current_case__\\\": 0, \\\"aligned_file\\\": \\\"false\\\", \\\"input_1\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"type\\\": \\\"single\\\", \\\"unaligned_file\\\": \\\"true\\\"}\", \"reference_genome\": \"{\\\"__current_case__\\\": 0, \\\"index\\\": \\\"AgamP4\\\", \\\"source\\\": \\\"indexed\\\"}\", \"rg\": \"{\\\"__current_case__\\\": 3, \\\"rg_selector\\\": \\\"do_not_set\\\"}\", \"save_mapping_stats\": \"\\\"false\\\"\", \"analysis_type\": \"{\\\"__current_case__\\\": 1, \\\"alignment_options\\\": {\\\"__current_case__\\\": 1, \\\"alignment_options_selector\\\": \\\"no\\\"}, \\\"analysis_type_selector\\\": \\\"full\\\", \\\"effort_options\\\": {\\\"__current_case__\\\": 1, \\\"effort_options_selector\\\": \\\"no\\\"}, \\\"input_options\\\": {\\\"__current_case__\\\": 0, \\\"input_options_selector\\\": \\\"yes\\\", \\\"int_quals\\\": \\\"false\\\", \\\"qupto\\\": \\\"100000000\\\", \\\"qv_encoding\\\": \\\"--phred33\\\", \\\"skip\\\": \\\"0\\\", \\\"solexa_quals\\\": \\\"false\\\", \\\"trim3\\\": \\\"20\\\", \\\"trim5\\\": \\\"0\\\"}, \\\"other_options\\\": {\\\"__current_case__\\\": 1, \\\"other_options_selector\\\": \\\"no\\\"}, \\\"reporting_options\\\": {\\\"__current_case__\\\": 1, \\\"k\\\": \\\"1\\\", \\\"reporting_options_selector\\\": \\\"k\\\"}, \\\"scoring_options\\\": {\\\"__current_case__\\\": 1, \\\"scoring_options_selector\\\": \\\"no\\\"}}\"}", 
+            "label": "Align to host", 
+            "type": "tool", 
+            "id": 2, 
+            "tool_shed_repository": {
+                "owner": "devteam", 
+                "changeset_revision": "017aba02828d", 
+                "name": "bowtie2", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Bowtie2"
+        }, 
+        "5": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/fasta_filter_by_length/fasta_filter_by_length/1.1", 
+            "errors": null, 
+            "uuid": "71675030-b426-4e72-ac38-3dcb5c50f420", 
+            "tool_version": "1.1", 
+            "outputs": [
+                {
+                    "type": "fasta", 
+                    "name": "output"
+                }
+            ], 
+            "post_job_actions": {}, 
+            "workflow_outputs": [
+                {
+                    "output_name": "output", 
+                    "uuid": "719383b2-64cc-4aaf-abe5-deeb362fffa3", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/fasta_filter_by_length/fasta_filter_by_length/1.1", 
+            "input_connections": {
+                "input": {
+                    "output_name": "out_contigs", 
+                    "id": 4
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "input", 
+                    "description": "runtime parameter for tool Filter sequences by length"
+                }
+            ], 
+            "position": {
+                "top": 316.5, 
+                "left": 1482.5
+            }, 
+            "tool_state": "{\"__page__\": null, \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"max_length\": \"\\\"0\\\"\", \"min_length\": \"\\\"5000\\\"\"}", 
+            "label": "Get contigs >5kb", 
+            "type": "tool", 
+            "id": 5, 
+            "tool_shed_repository": {
+                "owner": "devteam", 
+                "changeset_revision": "2fd6033d0e9c", 
+                "name": "fasta_filter_by_length", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Filter sequences by length"
+        }, 
+        "4": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/nml/spades/spades/3.12.0+galaxy1", 
+            "errors": null, 
+            "uuid": "b32de930-c74c-4836-b127-0ca17f064df5", 
+            "tool_version": "3.12.0+galaxy1", 
+            "outputs": [
+                {
+                    "type": "tabular", 
+                    "name": "out_contig_stats"
+                }, 
+                {
+                    "type": "tabular", 
+                    "name": "out_scaffold_stats"
+                }, 
+                {
+                    "type": "fasta", 
+                    "name": "out_contigs"
+                }, 
+                {
+                    "type": "fasta", 
+                    "name": "out_scaffolds"
+                }, 
+                {
+                    "type": "txt", 
+                    "name": "out_log"
+                }, 
+                {
+                    "type": "txt", 
+                    "name": "contig_graph"
+                }, 
+                {
+                    "type": "txt", 
+                    "name": "scaffold_graph"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionout_contig_stats": {
+                    "output_name": "out_contig_stats", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionout_log": {
+                    "output_name": "out_log", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionout_scaffolds": {
+                    "output_name": "out_scaffolds", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionout_contigs": {
+                    "output_name": "out_contigs", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionout_scaffold_stats": {
+                    "output_name": "out_scaffold_stats", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "scaffold_graph", 
+                    "uuid": "783ef468-ee48-47dd-bcdc-a68c346935b5", 
+                    "label": null
+                }, 
+                {
+                    "output_name": "contig_graph", 
+                    "uuid": "d40dcf64-77ce-45ad-b8d1-f29bfd15daf2", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/nml/spades/spades/3.12.0+galaxy1", 
+            "input_connections": {
+                "libraries_0|files_0|file_type|unpaired_reads": {
+                    "output_name": "out_file1", 
+                    "id": 3
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "pacbio_reads", 
+                    "description": "runtime parameter for tool SPAdes"
+                }, 
+                {
+                    "name": "nanopore_reads", 
+                    "description": "runtime parameter for tool SPAdes"
+                }, 
+                {
+                    "name": "trusted_contigs", 
+                    "description": "runtime parameter for tool SPAdes"
+                }, 
+                {
+                    "name": "untrusted_contigs", 
+                    "description": "runtime parameter for tool SPAdes"
+                }, 
+                {
+                    "name": "sanger_reads", 
+                    "description": "runtime parameter for tool SPAdes"
+                }
+            ], 
+            "position": {
+                "top": 306.5, 
+                "left": 1093.5
+            }, 
+            "tool_state": "{\"pacbio_reads\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"libraries\": \"[{\\\"__index__\\\": 0, \\\"files\\\": [{\\\"__index__\\\": 0, \\\"file_type\\\": {\\\"__current_case__\\\": 3, \\\"type\\\": \\\"unpaired\\\", \\\"unpaired_reads\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}}], \\\"lib_type\\\": \\\"paired_end\\\", \\\"orientation\\\": \\\"fr\\\"}]\", \"iontorrent\": \"\\\"false\\\"\", \"cov\": \"{\\\"__current_case__\\\": 2, \\\"state\\\": \\\"auto\\\"}\", \"__page__\": null, \"nanopore_reads\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"trusted_contigs\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"untrusted_contigs\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"kmer_choice\": \"{\\\"__current_case__\\\": 1, \\\"auto_kmer_choice\\\": \\\"true\\\"}\", \"scaffold_graph_out\": \"\\\"true\\\"\", \"onlyassembler\": \"\\\"true\\\"\", \"__rerun_remap_job_id__\": null, \"sanger_reads\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"sc\": \"\\\"false\\\"\", \"careful\": \"\\\"false\\\"\", \"contig_graph_out\": \"\\\"true\\\"\"}", 
+            "label": "Assemble contigs using SPADES", 
+            "type": "tool", 
+            "id": 4, 
+            "tool_shed_repository": {
+                "owner": "nml", 
+                "changeset_revision": "b8d633fbf5f5", 
+                "name": "spades", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "SPAdes"
+        }, 
+        "7": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/blastparser_and_hits/BlastParser_and_hits/2.6.1", 
+            "errors": null, 
+            "uuid": "f281973f-fc95-4393-881f-353a8709c55b", 
+            "tool_version": "2.6.1", 
+            "outputs": [
+                {
+                    "type": "tabular", 
+                    "name": "tabularOutput"
+                }, 
+                {
+                    "type": "fasta", 
+                    "name": "fastaOutput"
+                }, 
+                {
+                    "type": "fasta", 
+                    "name": "al_sequences"
+                }, 
+                {
+                    "type": "fasta", 
+                    "name": "un_sequences"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActional_sequences": {
+                    "output_name": "al_sequences", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "RenameDatasetActiontabularOutput": {
+                    "output_name": "tabularOutput", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Assembled contigs matching vir2"
+                    }
+                }, 
+                "HideDatasetActionun_sequences": {
+                    "output_name": "un_sequences", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionfastaOutput": {
+                    "output_name": "fastaOutput", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "tabularOutput", 
+                    "uuid": "b99946a8-3be2-456e-ba2a-89a2fd893287", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/blastparser_and_hits/BlastParser_and_hits/2.6.1", 
+            "input_connections": {
+                "blast": {
+                    "output_name": "output1", 
+                    "id": 6
+                }, 
+                "sequences": {
+                    "output_name": "output", 
+                    "id": 5
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "blast", 
+                    "description": "runtime parameter for tool Parse blast output and compile hits"
+                }, 
+                {
+                    "name": "sequences", 
+                    "description": "runtime parameter for tool Parse blast output and compile hits"
+                }
+            ], 
+            "position": {
+                "top": 347, 
+                "left": 2136
+            }, 
+            "tool_state": "{\"__page__\": null, \"flanking\": \"\\\"5\\\"\", \"additional_filters\": \"{\\\"__current_case__\\\": 0, \\\"use_filters\\\": \\\"no\\\"}\", \"__rerun_remap_job_id__\": null, \"mode\": \"\\\"verbose\\\"\", \"sequences\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"blast\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", 
+            "label": null, 
+            "type": "tool", 
+            "id": 7, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "b4c9c085d709", 
+                "name": "blastparser_and_hits", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Parse blast output and compile hits"
+        }, 
+        "6": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastx_wrapper/0.3.1", 
+            "errors": null, 
+            "uuid": "80f46de2-9775-4658-88e2-ebe915185e2f", 
+            "tool_version": "0.3.1", 
+            "outputs": [
+                {
+                    "type": "tabular", 
+                    "name": "output1"
+                }
+            ], 
+            "post_job_actions": {}, 
+            "workflow_outputs": [
+                {
+                    "output_name": "output1", 
+                    "uuid": "37874627-1583-40e3-9d59-96c0ffa3d5c5", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastx_wrapper/0.3.1", 
+            "input_connections": {
+                "query": {
+                    "output_name": "output", 
+                    "id": 5
+                }, 
+                "db_opts|histdb": {
+                    "output_name": "output", 
+                    "id": 1
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "db_opts", 
+                    "description": "runtime parameter for tool NCBI BLAST+ blastx"
+                }, 
+                {
+                    "name": "query", 
+                    "description": "runtime parameter for tool NCBI BLAST+ blastx"
+                }
+            ], 
+            "position": {
+                "top": 460.5, 
+                "left": 1763
+            }, 
+            "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"__current_case__\\\": 2, \\\"ext_cols\\\": [\\\"slen\\\"], \\\"ids_cols\\\": null, \\\"misc_cols\\\": null, \\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"tax_cols\\\": null}\", \"adv_opts\": \"{\\\"__current_case__\\\": 0, \\\"adv_opts_selector\\\": \\\"basic\\\"}\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"db_opts\": \"{\\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\", \\\"db_opts_selector\\\": \\\"histdb\\\", \\\"histdb\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"subject\\\": \\\"\\\"}\", \"query_gencode\": \"\\\"1\\\"\", \"blast_type\": \"\\\"blastx\\\"\", \"query\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", 
+            "label": "Blastx vs vir2", 
+            "type": "tool", 
+            "id": 6, 
+            "tool_shed_repository": {
+                "owner": "devteam", 
+                "changeset_revision": "e25d3acf6e68", 
+                "name": "ncbi_blast_plus", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "NCBI BLAST+ blastx"
+        }
+    }, 
+    "annotation": "", 
+    "name": "Metavisitor: Spades test in Use Case 2-2"
+}
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/Galaxy-Workflow-Metavisitor__Trinity_test_in_Use_Case_2-2.ga	Sun Jul 21 19:22:52 2019 -0400
@@ -0,0 +1,601 @@
+{
+    "a_galaxy_workflow": "true", 
+    "uuid": "bcf798d6-3f03-40bd-acc6-74b00ce4f28b", 
+    "tags": [], 
+    "format-version": "0.1", 
+    "version": 3, 
+    "steps": {
+        "1": {
+            "tool_id": null, 
+            "errors": null, 
+            "uuid": "5561c9ef-2dbd-49e0-a11f-f023c88ed10d", 
+            "tool_version": null, 
+            "outputs": [], 
+            "workflow_outputs": [
+                {
+                    "output_name": "output", 
+                    "uuid": "3aba6c38-d7f8-491b-90f4-5dbbb4b89ef1", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": null, 
+            "input_connections": {}, 
+            "inputs": [], 
+            "position": {
+                "top": 639.5, 
+                "left": 2657
+            }, 
+            "tool_state": "{}", 
+            "label": "Protein Blast database", 
+            "type": "data_input", 
+            "id": 1, 
+            "name": "Input dataset"
+        }, 
+        "0": {
+            "tool_id": null, 
+            "errors": null, 
+            "uuid": "0d87966a-b55d-4640-b836-974f9d10c803", 
+            "tool_version": null, 
+            "outputs": [], 
+            "workflow_outputs": [
+                {
+                    "output_name": "output", 
+                    "uuid": "fd9eb437-3aab-45c5-aed8-c65a0449c090", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": null, 
+            "input_connections": {}, 
+            "inputs": [], 
+            "position": {
+                "top": 282.5, 
+                "left": 200
+            }, 
+            "tool_state": "{\"collection_type\": \"list\"}", 
+            "label": "Fastq read files", 
+            "type": "data_collection_input", 
+            "id": 0, 
+            "name": "Input dataset collection"
+        }, 
+        "3": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", 
+            "errors": null, 
+            "uuid": "d89e8d50-3199-4276-9a1d-d654c73aad6a", 
+            "tool_version": "1.4.1", 
+            "outputs": [
+                {
+                    "type": "input", 
+                    "name": "paired_output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "list_output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "out_file1"
+                }, 
+                {
+                    "type": "_sniff_", 
+                    "name": "paired_out_file"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionpaired_out_file": {
+                    "output_name": "paired_out_file", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionlist_output": {
+                    "output_name": "list_output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionout_file1": {
+                    "output_name": "out_file1", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionpaired_output": {
+                    "output_name": "paired_output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", 
+            "input_connections": {
+                "global_condition|inputs": {
+                    "output_name": "output_unaligned_reads_l", 
+                    "id": 2
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "global_condition", 
+                    "description": "runtime parameter for tool Concatenate multiple datasets"
+                }
+            ], 
+            "position": {
+                "top": 489.5, 
+                "left": 1104
+            }, 
+            "tool_state": "{\"dataset_names\": \"\\\"false\\\"\", \"headers\": \"\\\"0\\\"\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"global_condition\": \"{\\\"__current_case__\\\": 0, \\\"input_type\\\": \\\"singles\\\", \\\"inputs\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\"}", 
+            "label": null, 
+            "type": "tool", 
+            "id": 3, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "55cf9d9defd1", 
+                "name": "concatenate_multiple_datasets", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Concatenate multiple datasets"
+        }, 
+        "2": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.3.4.3", 
+            "errors": null, 
+            "uuid": "39957bf7-f0bc-4e5d-80fa-39f00b156f8d", 
+            "tool_version": "2.3.4.3", 
+            "outputs": [
+                {
+                    "type": "fastqsanger", 
+                    "name": "output_unaligned_reads_l"
+                }, 
+                {
+                    "type": "fastqsanger", 
+                    "name": "output_aligned_reads_l"
+                }, 
+                {
+                    "type": "fastqsanger", 
+                    "name": "output_aligned_reads_r"
+                }, 
+                {
+                    "type": "fastqsanger", 
+                    "name": "output_unaligned_reads_r"
+                }, 
+                {
+                    "type": "bam", 
+                    "name": "output"
+                }, 
+                {
+                    "type": "txt", 
+                    "name": "mapping_stats"
+                }
+            ], 
+            "post_job_actions": {
+                "DeleteIntermediatesActionoutput_unaligned_reads_l": {
+                    "output_name": "output_unaligned_reads_l", 
+                    "action_type": "DeleteIntermediatesAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionoutput_unaligned_reads_r": {
+                    "output_name": "output_unaligned_reads_r", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionoutput": {
+                    "output_name": "output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionoutput_aligned_reads_l": {
+                    "output_name": "output_aligned_reads_l", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionmapping_stats": {
+                    "output_name": "mapping_stats", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionoutput_aligned_reads_r": {
+                    "output_name": "output_aligned_reads_r", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionoutput_unaligned_reads_l": {
+                    "output_name": "output_unaligned_reads_l", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "Get non-host reads", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.3.4.3", 
+            "input_connections": {
+                "library|input_1": {
+                    "output_name": "output", 
+                    "id": 0
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "library", 
+                    "description": "runtime parameter for tool Bowtie2"
+                }
+            ], 
+            "position": {
+                "top": 337.5, 
+                "left": 492
+            }, 
+            "tool_state": "{\"sam_options\": \"{\\\"__current_case__\\\": 1, \\\"sam_options_selector\\\": \\\"no\\\"}\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"library\": \"{\\\"__current_case__\\\": 0, \\\"aligned_file\\\": \\\"false\\\", \\\"input_1\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"type\\\": \\\"single\\\", \\\"unaligned_file\\\": \\\"true\\\"}\", \"reference_genome\": \"{\\\"__current_case__\\\": 0, \\\"index\\\": \\\"AgamP4\\\", \\\"source\\\": \\\"indexed\\\"}\", \"rg\": \"{\\\"__current_case__\\\": 3, \\\"rg_selector\\\": \\\"do_not_set\\\"}\", \"save_mapping_stats\": \"\\\"false\\\"\", \"analysis_type\": \"{\\\"__current_case__\\\": 1, \\\"alignment_options\\\": {\\\"__current_case__\\\": 1, \\\"alignment_options_selector\\\": \\\"no\\\"}, \\\"analysis_type_selector\\\": \\\"full\\\", \\\"effort_options\\\": {\\\"__current_case__\\\": 1, \\\"effort_options_selector\\\": \\\"no\\\"}, \\\"input_options\\\": {\\\"__current_case__\\\": 0, \\\"input_options_selector\\\": \\\"yes\\\", \\\"int_quals\\\": \\\"false\\\", \\\"qupto\\\": \\\"100000000\\\", \\\"qv_encoding\\\": \\\"--phred33\\\", \\\"skip\\\": \\\"0\\\", \\\"solexa_quals\\\": \\\"false\\\", \\\"trim3\\\": \\\"20\\\", \\\"trim5\\\": \\\"0\\\"}, \\\"other_options\\\": {\\\"__current_case__\\\": 1, \\\"other_options_selector\\\": \\\"no\\\"}, \\\"reporting_options\\\": {\\\"__current_case__\\\": 1, \\\"k\\\": \\\"1\\\", \\\"reporting_options_selector\\\": \\\"k\\\"}, \\\"scoring_options\\\": {\\\"__current_case__\\\": 1, \\\"scoring_options_selector\\\": \\\"no\\\"}}\"}", 
+            "label": "Align to host", 
+            "type": "tool", 
+            "id": 2, 
+            "tool_shed_repository": {
+                "owner": "devteam", 
+                "changeset_revision": "017aba02828d", 
+                "name": "bowtie2", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Bowtie2"
+        }, 
+        "5": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/trinity/trinity/2.8.4", 
+            "errors": null, 
+            "uuid": "1e362bf2-2d86-4ffb-9942-e9e3c23f48a7", 
+            "tool_version": "2.8.4", 
+            "outputs": [
+                {
+                    "type": "fasta", 
+                    "name": "assembled_transcripts"
+                }, 
+                {
+                    "type": "tabular", 
+                    "name": "gene_to_trans"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionassembled_transcripts": {
+                    "output_name": "assembled_transcripts", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActiongene_to_trans": {
+                    "output_name": "gene_to_trans", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "RenameDatasetActionassembled_transcripts": {
+                    "output_name": "assembled_transcripts", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Assembled contigs"
+                    }
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/trinity/trinity/2.8.4", 
+            "input_connections": {
+                "pool|inputs|input": {
+                    "output_name": "output", 
+                    "id": 4
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "additional_params", 
+                    "description": "runtime parameter for tool Trinity"
+                }
+            ], 
+            "position": {
+                "top": 536.5, 
+                "left": 2014
+            }, 
+            "tool_state": "{\"__page__\": null, \"__rerun_remap_job_id__\": null, \"norm\": \"\\\"false\\\"\", \"additional_params\": \"{\\\"guided\\\": {\\\"__current_case__\\\": 0, \\\"is_guided\\\": \\\"no\\\"}, \\\"long_reads\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"min_contig_length\\\": \\\"200\\\", \\\"min_kmer_cov\\\": \\\"1\\\"}\", \"pool\": \"{\\\"__current_case__\\\": 0, \\\"inputs\\\": {\\\"__current_case__\\\": 0, \\\"input\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"paired_or_single\\\": \\\"single\\\", \\\"strand\\\": {\\\"__current_case__\\\": 0, \\\"is_strand_specific\\\": \\\"false\\\"}}, \\\"pool_mode\\\": \\\"Yes\\\"}\"}", 
+            "label": "Assemble contigs using trinity", 
+            "type": "tool", 
+            "id": 5, 
+            "tool_shed_repository": {
+                "owner": "iuc", 
+                "changeset_revision": "c9cfec002f71", 
+                "name": "trinity", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Trinity"
+        }, 
+        "4": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/sequence_format_converter/sequence_format_converter/2.1.1", 
+            "errors": null, 
+            "uuid": "aacca937-880e-4827-bf4c-4aa64ff166f2", 
+            "tool_version": "2.1.1", 
+            "outputs": [
+                {
+                    "type": "fasta", 
+                    "name": "output"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionoutput": {
+                    "output_name": "output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/sequence_format_converter/sequence_format_converter/2.1.1", 
+            "input_connections": {
+                "input": {
+                    "output_name": "out_file1", 
+                    "id": 3
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "input", 
+                    "description": "runtime parameter for tool sequence_format_converter"
+                }
+            ], 
+            "position": {
+                "top": 524, 
+                "left": 1621.5
+            }, 
+            "tool_state": "{\"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"output_format\": \"\\\"fastaw\\\"\", \"__rerun_remap_job_id__\": null, \"__page__\": null}", 
+            "label": "Collapse reads", 
+            "type": "tool", 
+            "id": 4, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "f1d59113125a", 
+                "name": "sequence_format_converter", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "sequence_format_converter"
+        }, 
+        "7": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/fasta_filter_by_length/fasta_filter_by_length/1.1", 
+            "errors": null, 
+            "uuid": "e08901b6-223f-4452-a02d-78bc87a25304", 
+            "tool_version": "1.1", 
+            "outputs": [
+                {
+                    "type": "fasta", 
+                    "name": "output"
+                }
+            ], 
+            "post_job_actions": {}, 
+            "workflow_outputs": [
+                {
+                    "output_name": "output", 
+                    "uuid": "f028d8bf-a8e1-413f-a476-474257bf90ee", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/fasta_filter_by_length/fasta_filter_by_length/1.1", 
+            "input_connections": {
+                "input": {
+                    "output_name": "out_file1", 
+                    "id": 6
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "input", 
+                    "description": "runtime parameter for tool Filter sequences by length"
+                }
+            ], 
+            "position": {
+                "top": 408.5, 
+                "left": 2600
+            }, 
+            "tool_state": "{\"__page__\": null, \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"max_length\": \"\\\"0\\\"\", \"min_length\": \"\\\"5000\\\"\"}", 
+            "label": "Get contigs >5kb", 
+            "type": "tool", 
+            "id": 7, 
+            "tool_shed_repository": {
+                "owner": "devteam", 
+                "changeset_revision": "2fd6033d0e9c", 
+                "name": "fasta_filter_by_length", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Filter sequences by length"
+        }, 
+        "6": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/galaxyp/regex_find_replace/regex1/1.0.0", 
+            "errors": null, 
+            "uuid": "bdacf00f-3b5a-43b4-9dbf-2da4e87f8277", 
+            "tool_version": "1.0.0", 
+            "outputs": [
+                {
+                    "type": "input", 
+                    "name": "out_file1"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionout_file1": {
+                    "output_name": "out_file1", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/galaxyp/regex_find_replace/regex1/1.0.0", 
+            "input_connections": {
+                "input": {
+                    "output_name": "assembled_transcripts", 
+                    "id": 5
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "input", 
+                    "description": "runtime parameter for tool Regex Find And Replace"
+                }
+            ], 
+            "position": {
+                "top": 448.5, 
+                "left": 2325
+            }, 
+            "tool_state": "{\"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"checks\": \"[{\\\"__index__\\\": 0, \\\"pattern\\\": \\\">(.+) len=(\\\\\\\\d+) .+\\\", \\\"replacement\\\": \\\">\\\\\\\\1_len=\\\\\\\\2\\\"}]\", \"__page__\": null}", 
+            "label": "Change header format", 
+            "type": "tool", 
+            "id": 6, 
+            "tool_shed_repository": {
+                "owner": "galaxyp", 
+                "changeset_revision": "209b7c5ee9d7", 
+                "name": "regex_find_replace", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Regex Find And Replace"
+        }, 
+        "9": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/blastparser_and_hits/BlastParser_and_hits/2.6.1", 
+            "errors": null, 
+            "uuid": "e1e734ea-a9a9-41e0-aab4-685ccf3458b8", 
+            "tool_version": "2.6.1", 
+            "outputs": [
+                {
+                    "type": "tabular", 
+                    "name": "tabularOutput"
+                }, 
+                {
+                    "type": "fasta", 
+                    "name": "fastaOutput"
+                }, 
+                {
+                    "type": "fasta", 
+                    "name": "al_sequences"
+                }, 
+                {
+                    "type": "fasta", 
+                    "name": "un_sequences"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActional_sequences": {
+                    "output_name": "al_sequences", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "RenameDatasetActiontabularOutput": {
+                    "output_name": "tabularOutput", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Contigs matching vir2"
+                    }
+                }, 
+                "HideDatasetActionun_sequences": {
+                    "output_name": "un_sequences", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionfastaOutput": {
+                    "output_name": "fastaOutput", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "tabularOutput", 
+                    "uuid": "7e041eb9-86ad-4068-8f90-45e6b3e1a07e", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/blastparser_and_hits/BlastParser_and_hits/2.6.1", 
+            "input_connections": {
+                "blast": {
+                    "output_name": "output1", 
+                    "id": 8
+                }, 
+                "sequences": {
+                    "output_name": "output", 
+                    "id": 7
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "blast", 
+                    "description": "runtime parameter for tool Parse blast output and compile hits"
+                }, 
+                {
+                    "name": "sequences", 
+                    "description": "runtime parameter for tool Parse blast output and compile hits"
+                }
+            ], 
+            "position": {
+                "top": 331, 
+                "left": 3236
+            }, 
+            "tool_state": "{\"__page__\": null, \"flanking\": \"\\\"5\\\"\", \"additional_filters\": \"{\\\"__current_case__\\\": 0, \\\"use_filters\\\": \\\"no\\\"}\", \"__rerun_remap_job_id__\": null, \"mode\": \"\\\"verbose\\\"\", \"sequences\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"blast\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", 
+            "label": null, 
+            "type": "tool", 
+            "id": 9, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "b4c9c085d709", 
+                "name": "blastparser_and_hits", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Parse blast output and compile hits"
+        }, 
+        "8": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastx_wrapper/0.3.1", 
+            "errors": null, 
+            "uuid": "28cebda9-cd67-4c80-8a87-3a2a415326d9", 
+            "tool_version": "0.3.1", 
+            "outputs": [
+                {
+                    "type": "tabular", 
+                    "name": "output1"
+                }
+            ], 
+            "post_job_actions": {}, 
+            "workflow_outputs": [
+                {
+                    "output_name": "output1", 
+                    "uuid": "2a6f63d6-4915-4475-a5a1-a39b5b7b6993", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastx_wrapper/0.3.1", 
+            "input_connections": {
+                "query": {
+                    "output_name": "output", 
+                    "id": 7
+                }, 
+                "db_opts|histdb": {
+                    "output_name": "output", 
+                    "id": 1
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "db_opts", 
+                    "description": "runtime parameter for tool NCBI BLAST+ blastx"
+                }, 
+                {
+                    "name": "query", 
+                    "description": "runtime parameter for tool NCBI BLAST+ blastx"
+                }
+            ], 
+            "position": {
+                "top": 508.5, 
+                "left": 2908.5
+            }, 
+            "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"__current_case__\\\": 2, \\\"ext_cols\\\": [\\\"slen\\\"], \\\"ids_cols\\\": null, \\\"misc_cols\\\": null, \\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"tax_cols\\\": null}\", \"adv_opts\": \"{\\\"__current_case__\\\": 0, \\\"adv_opts_selector\\\": \\\"basic\\\"}\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"db_opts\": \"{\\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\", \\\"db_opts_selector\\\": \\\"histdb\\\", \\\"histdb\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"subject\\\": \\\"\\\"}\", \"query_gencode\": \"\\\"1\\\"\", \"blast_type\": \"\\\"blastx\\\"\", \"query\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", 
+            "label": "Blastx vs vir2", 
+            "type": "tool", 
+            "id": 8, 
+            "tool_shed_repository": {
+                "owner": "devteam", 
+                "changeset_revision": "e25d3acf6e68", 
+                "name": "ncbi_blast_plus", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "NCBI BLAST+ blastx"
+        }
+    }, 
+    "annotation": "", 
+    "name": "Metavisitor: Trinity test in Use Case 2-2"
+}
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_1-1.ga	Sun Jul 21 19:22:52 2019 -0400
@@ -0,0 +1,981 @@
+{
+    "a_galaxy_workflow": "true", 
+    "uuid": "1187ab6d-a4f6-4ee7-817c-d12db902fed7", 
+    "tags": [], 
+    "format-version": "0.1", 
+    "version": 3, 
+    "steps": {
+        "11": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/cap3/cap3/2.0.0", 
+            "errors": null, 
+            "uuid": "bd3f2dd0-b170-433d-b1e8-2b0f303006a7", 
+            "tool_version": "2.0.0", 
+            "outputs": [
+                {
+                    "type": "fasta", 
+                    "name": "contigsandsinglets"
+                }, 
+                {
+                    "type": "txt", 
+                    "name": "cap3stdout"
+                }, 
+                {
+                    "type": "fasta", 
+                    "name": "contigs"
+                }, 
+                {
+                    "type": "txt", 
+                    "name": "contigsqual"
+                }, 
+                {
+                    "type": "txt", 
+                    "name": "contigslink"
+                }, 
+                {
+                    "type": "txt", 
+                    "name": "ace"
+                }, 
+                {
+                    "type": "txt", 
+                    "name": "info"
+                }, 
+                {
+                    "type": "txt", 
+                    "name": "singlets"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActioninfo": {
+                    "output_name": "info", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActioncontigsqual": {
+                    "output_name": "contigsqual", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "RenameDatasetActioncontigsandsinglets": {
+                    "output_name": "contigsandsinglets", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "CAP3 assembled contigs"
+                    }
+                }, 
+                "HideDatasetActioncontigslink": {
+                    "output_name": "contigslink", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActioncontigs": {
+                    "output_name": "contigs", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActioncap3stdout": {
+                    "output_name": "cap3stdout", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionsinglets": {
+                    "output_name": "singlets", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionace": {
+                    "output_name": "ace", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "contigsandsinglets", 
+                    "uuid": "e2dff9ee-9235-4087-9a51-30b5b9974537", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/cap3/cap3/2.0.0", 
+            "input_connections": {
+                "inputSequences": {
+                    "output_name": "fastaOutput", 
+                    "id": 10
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "inputSequences", 
+                    "description": "runtime parameter for tool cap3"
+                }
+            ], 
+            "position": {
+                "top": 633, 
+                "left": 2061.5
+            }, 
+            "tool_state": "{\"overlapidentity\": \"\\\"90\\\"\", \"inputSequences\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"overlaplength\": \"\\\"40\\\"\", \"__page__\": null}", 
+            "label": "CAP3 to re-assembe contigs", 
+            "type": "tool", 
+            "id": 11, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "d76a0d8a9eac", 
+                "name": "cap3", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "cap3"
+        }, 
+        "10": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/blastparser_and_hits/BlastParser_and_hits/2.6.1", 
+            "errors": null, 
+            "uuid": "bac749b9-96e4-4a92-baac-cd160c09f9ec", 
+            "tool_version": "2.6.1", 
+            "outputs": [
+                {
+                    "type": "tabular", 
+                    "name": "tabularOutput"
+                }, 
+                {
+                    "type": "fasta", 
+                    "name": "fastaOutput"
+                }, 
+                {
+                    "type": "fasta", 
+                    "name": "al_sequences"
+                }, 
+                {
+                    "type": "fasta", 
+                    "name": "un_sequences"
+                }
+            ], 
+            "post_job_actions": {
+                "RenameDatasetActionfastaOutput": {
+                    "output_name": "fastaOutput", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Assembled contigs hitting viral database"
+                    }
+                }, 
+                "HideDatasetActional_sequences": {
+                    "output_name": "al_sequences", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionun_sequences": {
+                    "output_name": "un_sequences", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "tabularOutput", 
+                    "uuid": "f858a698-d9dd-4cc2-a047-6664b0519271", 
+                    "label": null
+                }, 
+                {
+                    "output_name": "fastaOutput", 
+                    "uuid": "d9c341c8-d826-4633-a6a5-9462677092d8", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/blastparser_and_hits/BlastParser_and_hits/2.6.1", 
+            "input_connections": {
+                "blast": {
+                    "output_name": "output1", 
+                    "id": 9
+                }, 
+                "sequences": {
+                    "output_name": "transcripts", 
+                    "id": 8
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "blast", 
+                    "description": "runtime parameter for tool Parse blast output and compile hits"
+                }, 
+                {
+                    "name": "sequences", 
+                    "description": "runtime parameter for tool Parse blast output and compile hits"
+                }
+            ], 
+            "position": {
+                "top": 404, 
+                "left": 1740
+            }, 
+            "tool_state": "{\"__page__\": null, \"flanking\": \"\\\"5\\\"\", \"additional_filters\": \"{\\\"__current_case__\\\": 1, \\\"filter_maxScore\\\": \\\"0.0\\\", \\\"filter_meanScore\\\": \\\"0.0\\\", \\\"filter_relativeCov\\\": \\\"0.0\\\", \\\"filter_term_in\\\": \\\"Nora_virus\\\", \\\"filter_term_out\\\": \\\"JX220408.1\\\", \\\"use_filters\\\": \\\"yes\\\"}\", \"__rerun_remap_job_id__\": null, \"mode\": \"\\\"short\\\"\", \"sequences\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"blast\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", 
+            "label": "Get viral contigs", 
+            "type": "tool", 
+            "id": 10, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "b4c9c085d709", 
+                "name": "blastparser_and_hits", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Parse blast output and compile hits"
+        }, 
+        "13": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/blast_to_scaffold/blast2scaffold/1.0.0", 
+            "errors": null, 
+            "uuid": "7f0913f8-f7f9-4ba3-878c-9c502460331d", 
+            "tool_version": "1.0.0", 
+            "outputs": [
+                {
+                    "type": "fasta", 
+                    "name": "output"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionoutput": {
+                    "output_name": "output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "RenameDatasetActionoutput": {
+                    "output_name": "output", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "generated CDS"
+                    }
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "Generate CDS from aligned contigs", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/blast_to_scaffold/blast2scaffold/1.0.0", 
+            "input_connections": {
+                "guideSequence": {
+                    "output_name": "outfile", 
+                    "id": 2
+                }, 
+                "blast_tab": {
+                    "output_name": "output1", 
+                    "id": 12
+                }, 
+                "sequences": {
+                    "output_name": "contigsandsinglets", 
+                    "id": 11
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "guideSequence", 
+                    "description": "runtime parameter for tool blast_to_scaffold"
+                }, 
+                {
+                    "name": "blast_tab", 
+                    "description": "runtime parameter for tool blast_to_scaffold"
+                }, 
+                {
+                    "name": "sequences", 
+                    "description": "runtime parameter for tool blast_to_scaffold"
+                }
+            ], 
+            "position": {
+                "top": 669, 
+                "left": 2728.5
+            }, 
+            "tool_state": "{\"__page__\": null, \"guideSequence\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"blast_tab\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"sequences\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", 
+            "label": "Generate CDS", 
+            "type": "tool", 
+            "id": 13, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "7d96b28eec49", 
+                "name": "blast_to_scaffold", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "blast_to_scaffold"
+        }, 
+        "12": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.3.1", 
+            "errors": null, 
+            "uuid": "4f996123-d155-426a-ba26-e649c422431e", 
+            "tool_version": "0.3.1", 
+            "outputs": [
+                {
+                    "type": "tabular", 
+                    "name": "output1"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionoutput1": {
+                    "output_name": "output1", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "RenameDatasetActionoutput1": {
+                    "output_name": "output1", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Contigs aligned to ${ncbi_guide_ID}"
+                    }
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.3.1", 
+            "input_connections": {
+                "query": {
+                    "output_name": "contigsandsinglets", 
+                    "id": 11
+                }, 
+                "db_opts|histdb": {
+                    "output_name": "outfile", 
+                    "id": 4
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "db_opts", 
+                    "description": "runtime parameter for tool NCBI BLAST+ blastn"
+                }, 
+                {
+                    "name": "query", 
+                    "description": "runtime parameter for tool NCBI BLAST+ blastn"
+                }
+            ], 
+            "position": {
+                "top": 837, 
+                "left": 2402
+            }, 
+            "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"__current_case__\\\": 2, \\\"ext_cols\\\": [\\\"slen\\\"], \\\"ids_cols\\\": null, \\\"misc_cols\\\": null, \\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"tax_cols\\\": null}\", \"adv_opts\": \"{\\\"__current_case__\\\": 0, \\\"adv_opts_selector\\\": \\\"basic\\\"}\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"db_opts\": \"{\\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\", \\\"db_opts_selector\\\": \\\"histdb\\\", \\\"histdb\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"subject\\\": \\\"\\\"}\", \"blast_type\": \"\\\"blastn\\\"\", \"query\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", 
+            "label": "Blast contigs to specific virus database", 
+            "type": "tool", 
+            "id": 12, 
+            "tool_shed_repository": {
+                "owner": "devteam", 
+                "changeset_revision": "e25d3acf6e68", 
+                "name": "ncbi_blast_plus", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "NCBI BLAST+ blastn"
+        }, 
+        "14": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/galaxyp/regex_find_replace/regex1/1.0.0", 
+            "errors": null, 
+            "uuid": "c81173fb-317d-4c00-9da8-f0072b62a569", 
+            "tool_version": "1.0.0", 
+            "outputs": [
+                {
+                    "type": "input", 
+                    "name": "out_file1"
+                }
+            ], 
+            "post_job_actions": {
+                "ChangeDatatypeActionout_file1": {
+                    "output_name": "out_file1", 
+                    "action_type": "ChangeDatatypeAction", 
+                    "action_arguments": {
+                        "newtype": "fasta"
+                    }
+                }, 
+                "RenameDatasetActionout_file1": {
+                    "output_name": "out_file1", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Nora_MV_${ncbi_guide_ID}_guided"
+                    }
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "out_file1", 
+                    "uuid": "e202eeb0-f65c-4295-afe0-44a56634a452", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/galaxyp/regex_find_replace/regex1/1.0.0", 
+            "input_connections": {
+                "input": {
+                    "output_name": "output", 
+                    "id": 13
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "input", 
+                    "description": "runtime parameter for tool Regex Find And Replace"
+                }
+            ], 
+            "position": {
+                "top": 927, 
+                "left": 2971
+            }, 
+            "tool_state": "{\"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"checks\": \"[{\\\"__index__\\\": 0, \\\"pattern\\\": \\\">.+\\\", \\\"replacement\\\": \\\">Nora_MV\\\"}]\", \"__page__\": null}", 
+            "label": "Change CDS header", 
+            "type": "tool", 
+            "id": 14, 
+            "tool_shed_repository": {
+                "owner": "galaxyp", 
+                "changeset_revision": "209b7c5ee9d7", 
+                "name": "regex_find_replace", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Regex Find And Replace"
+        }, 
+        "1": {
+            "tool_id": null, 
+            "errors": null, 
+            "uuid": "462eb78f-9844-42d6-8087-19f2e1e801ca", 
+            "tool_version": null, 
+            "outputs": [], 
+            "workflow_outputs": [
+                {
+                    "output_name": "output", 
+                    "uuid": "6bd2d24e-e12f-41fe-9308-631cc6718143", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": null, 
+            "input_connections": {}, 
+            "inputs": [], 
+            "position": {
+                "top": 976.9833374023438, 
+                "left": 1205.9666748046875
+            }, 
+            "tool_state": "{}", 
+            "label": "viral nucleotide BLAST database (V2)", 
+            "type": "data_input", 
+            "id": 1, 
+            "name": "Input dataset"
+        }, 
+        "0": {
+            "tool_id": null, 
+            "errors": null, 
+            "uuid": "aa5c2a9c-0f52-4884-9f1c-74432b24af61", 
+            "tool_version": null, 
+            "outputs": [], 
+            "workflow_outputs": [
+                {
+                    "output_name": "output", 
+                    "uuid": "b5da90b2-1c4f-4646-8c70-fc9952f6cb94", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": null, 
+            "input_connections": {}, 
+            "inputs": [], 
+            "position": {
+                "top": 163, 
+                "left": 200
+            }, 
+            "tool_state": "{\"collection_type\": \"list\"}", 
+            "label": "Fastq files", 
+            "type": "data_collection_input", 
+            "id": 0, 
+            "name": "Input dataset collection"
+        }, 
+        "3": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/yac_clipper/yac/2.3.0", 
+            "errors": null, 
+            "uuid": "41212793-f400-4bd6-9827-c083025f3e01", 
+            "tool_version": "2.3.0", 
+            "outputs": [
+                {
+                    "type": "input", 
+                    "name": "output"
+                }
+            ], 
+            "post_job_actions": {
+                "RenameDatasetActionoutput": {
+                    "output_name": "output", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "#{input} clipped"
+                    }
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "output", 
+                    "uuid": "3939be31-c091-4dbe-86a7-fd05c01f9598", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/yac_clipper/yac/2.3.0", 
+            "input_connections": {
+                "input": {
+                    "output_name": "output", 
+                    "id": 0
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "input", 
+                    "description": "runtime parameter for tool Clip adapter"
+                }
+            ], 
+            "position": {
+                "top": 318, 
+                "left": 364.5
+            }, 
+            "tool_state": "{\"out_format\": \"\\\"fasta\\\"\", \"__page__\": null, \"min\": \"\\\"18\\\"\", \"max\": \"\\\"30\\\"\", \"__rerun_remap_job_id__\": null, \"clip_source\": \"{\\\"__current_case__\\\": 0, \\\"clip_sequence\\\": \\\"CTGTAGGCACCATCAATCGT\\\", \\\"clip_source_list\\\": \\\"prebuilt\\\"}\", \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"Nmode\": \"\\\"reject\\\"\"}", 
+            "label": null, 
+            "type": "tool", 
+            "id": 3, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "f7947c5a18b8", 
+                "name": "yac_clipper", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Clip adapter"
+        }, 
+        "2": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/2.3.0", 
+            "errors": null, 
+            "uuid": "13214523-9fb0-4e23-8cdf-f389331ba0c9", 
+            "tool_version": "2.3.0", 
+            "outputs": [
+                {
+                    "type": "fasta", 
+                    "name": "outfile"
+                }, 
+                {
+                    "type": "txt", 
+                    "name": "logfile"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionlogfile": {
+                    "output_name": "logfile", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "RenameDatasetActionoutfile": {
+                    "output_name": "outfile", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "${ncbi_guide_ID}"
+                    }
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "outfile", 
+                    "uuid": "9c9b23f2-66ae-4eeb-88f1-e4a0a8bd596b", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/2.3.0", 
+            "input_connections": {}, 
+            "inputs": [], 
+            "position": {
+                "top": 1043, 
+                "left": 1750
+            }, 
+            "tool_state": "{\"__page__\": null, \"__rerun_remap_job_id__\": null, \"queryString\": \"\\\"${ncbi_guide_ID}\\\"\", \"dbname\": \"\\\"nuccore\\\"\", \"dry_run\": \"\\\"false\\\"\"}", 
+            "label": null, 
+            "type": "tool", 
+            "id": 2, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "c667d0ee39f5", 
+                "name": "fetch_fasta_from_ncbi", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Retrieve FASTA from NCBI"
+        }, 
+        "5": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", 
+            "errors": null, 
+            "uuid": "02a6f0a8-8f83-4b0f-85ad-0370a5753a13", 
+            "tool_version": "1.4.1", 
+            "outputs": [
+                {
+                    "type": "input", 
+                    "name": "paired_output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "list_output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "out_file1"
+                }, 
+                {
+                    "type": "_sniff_", 
+                    "name": "paired_out_file"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionpaired_out_file": {
+                    "output_name": "paired_out_file", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "RenameDatasetActionout_file1": {
+                    "output_name": "out_file1", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "#{global_condition.inputs} concatenated"
+                    }
+                }, 
+                "HideDatasetActionpaired_output": {
+                    "output_name": "paired_output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionout_file1": {
+                    "output_name": "out_file1", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionlist_output": {
+                    "output_name": "list_output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", 
+            "input_connections": {
+                "global_condition|inputs": {
+                    "output_name": "output", 
+                    "id": 3
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "global_condition", 
+                    "description": "runtime parameter for tool Concatenate multiple datasets"
+                }
+            ], 
+            "position": {
+                "top": 492.5, 
+                "left": 474
+            }, 
+            "tool_state": "{\"dataset_names\": \"\\\"false\\\"\", \"headers\": \"\\\"0\\\"\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"global_condition\": \"{\\\"__current_case__\\\": 0, \\\"input_type\\\": \\\"singles\\\", \\\"inputs\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\"}", 
+            "label": "Concatenate read files", 
+            "type": "tool", 
+            "id": 5, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "55cf9d9defd1", 
+                "name": "concatenate_multiple_datasets", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Concatenate multiple datasets"
+        }, 
+        "4": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_makeblastdb/0.3.1", 
+            "errors": null, 
+            "uuid": "1a39e6e8-8079-4f7a-b4c2-2028e5dbc2dd", 
+            "tool_version": "0.3.1", 
+            "outputs": [
+                {
+                    "type": "data", 
+                    "name": "outfile"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionoutfile": {
+                    "output_name": "outfile", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "RenameDatasetActionoutfile": {
+                    "output_name": "outfile", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "#{input_file} blast database"
+                    }
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_makeblastdb/0.3.1", 
+            "input_connections": {
+                "input_file": {
+                    "output_name": "outfile", 
+                    "id": 2
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "mask_data_file", 
+                    "description": "runtime parameter for tool NCBI BLAST+ makeblastdb"
+                }, 
+                {
+                    "name": "input_file", 
+                    "description": "runtime parameter for tool NCBI BLAST+ makeblastdb"
+                }
+            ], 
+            "position": {
+                "top": 1060, 
+                "left": 2100.5
+            }, 
+            "tool_state": "{\"__page__\": null, \"mask_data_file\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"input_file\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"dbtype\": \"\\\"nucl\\\"\", \"__rerun_remap_job_id__\": null, \"hash_index\": \"\\\"true\\\"\", \"tax\": \"{\\\"__current_case__\\\": 0, \\\"taxselect\\\": \\\"\\\"}\", \"title\": \"\\\"Blastn candidate database\\\"\", \"parse_seqids\": \"\\\"false\\\"\"}", 
+            "label": "Make a blast database", 
+            "type": "tool", 
+            "id": 4, 
+            "tool_shed_repository": {
+                "owner": "devteam", 
+                "changeset_revision": "e25d3acf6e68", 
+                "name": "ncbi_blast_plus", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "NCBI BLAST+ makeblastdb"
+        }, 
+        "7": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1", 
+            "errors": null, 
+            "uuid": "62876927-ee09-4764-95eb-d86548fdce73", 
+            "tool_version": "2.1.1", 
+            "outputs": [
+                {
+                    "type": "tabular", 
+                    "name": "output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "aligned"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "unaligned"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionaligned": {
+                    "output_name": "aligned", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionoutput": {
+                    "output_name": "output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "RenameDatasetActionunaligned": {
+                    "output_name": "unaligned", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Non D. melanogaster sequences"
+                    }
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "unaligned", 
+                    "uuid": "608ff661-018b-44c2-b020-59b31c5ff2d4", 
+                    "label": null
+                }
+            ], 
+            "annotation": "Align reads to host (dm6) genome.\nThe unaligned reads will most likely have a viral source.", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1", 
+            "input_connections": {
+                "input": {
+                    "output_name": "output", 
+                    "id": 6
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "input", 
+                    "description": "runtime parameter for tool sR_bowtie"
+                }
+            ], 
+            "position": {
+                "top": 238, 
+                "left": 952
+            }, 
+            "tool_state": "{\"__page__\": null, \"output_format\": \"\\\"tabular\\\"\", \"v_mismatches\": \"\\\"2\\\"\", \"additional_fasta\": \"\\\"unal\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"refGenomeSource\": \"{\\\"__current_case__\\\": 0, \\\"genomeSource\\\": \\\"indexed\\\", \\\"index\\\": \\\"dm6\\\"}\", \"method\": \"\\\"k_option\\\"\"}", 
+            "label": "Get non-host sequences", 
+            "type": "tool", 
+            "id": 7, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "0281bb245635", 
+                "name": "sr_bowtie", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "sR_bowtie"
+        }, 
+        "6": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/sequence_format_converter/sequence_format_converter/2.1.1", 
+            "errors": null, 
+            "uuid": "e693b793-ae94-42c8-9f59-4b4b847aa4b1", 
+            "tool_version": "2.1.1", 
+            "outputs": [
+                {
+                    "type": "fasta", 
+                    "name": "output"
+                }
+            ], 
+            "post_job_actions": {
+                "RenameDatasetActionoutput": {
+                    "output_name": "output", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Initial Clipped sequences"
+                    }
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "output", 
+                    "uuid": "b81a3224-0d3e-4dec-996f-5fa3d525cabd", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/sequence_format_converter/sequence_format_converter/2.1.1", 
+            "input_connections": {
+                "input": {
+                    "output_name": "out_file1", 
+                    "id": 5
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "input", 
+                    "description": "runtime parameter for tool sequence_format_converter"
+                }
+            ], 
+            "position": {
+                "top": 621, 
+                "left": 787.5
+            }, 
+            "tool_state": "{\"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"output_format\": \"\\\"fastaw\\\"\", \"__rerun_remap_job_id__\": null, \"__page__\": null}", 
+            "label": "Change sequence format to weighted fasta", 
+            "type": "tool", 
+            "id": 6, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "f1d59113125a", 
+                "name": "sequence_format_converter", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "sequence_format_converter"
+        }, 
+        "9": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.3.1", 
+            "errors": null, 
+            "uuid": "37904c73-85c7-40e8-b1d5-e5f3d6a12135", 
+            "tool_version": "0.3.1", 
+            "outputs": [
+                {
+                    "type": "tabular", 
+                    "name": "output1"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionoutput1": {
+                    "output_name": "output1", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "Align the assembled transcripts to the viral database to filter out non-viral sequences.", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.3.1", 
+            "input_connections": {
+                "query": {
+                    "output_name": "transcripts", 
+                    "id": 8
+                }, 
+                "db_opts|histdb": {
+                    "output_name": "output", 
+                    "id": 1
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "db_opts", 
+                    "description": "runtime parameter for tool NCBI BLAST+ blastn"
+                }, 
+                {
+                    "name": "query", 
+                    "description": "runtime parameter for tool NCBI BLAST+ blastn"
+                }
+            ], 
+            "position": {
+                "top": 690, 
+                "left": 1455
+            }, 
+            "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"__current_case__\\\": 2, \\\"ext_cols\\\": [\\\"slen\\\"], \\\"ids_cols\\\": null, \\\"misc_cols\\\": null, \\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"tax_cols\\\": null}\", \"adv_opts\": \"{\\\"__current_case__\\\": 1, \\\"adv_optional_id_files_opts\\\": {\\\"__current_case__\\\": 0, \\\"adv_optional_id_files_opts_selector\\\": \\\"none\\\"}, \\\"adv_opts_selector\\\": \\\"advanced\\\", \\\"filter_query\\\": \\\"true\\\", \\\"gapextend\\\": \\\"\\\", \\\"gapopen\\\": \\\"\\\", \\\"identity_cutoff\\\": \\\"0.0\\\", \\\"max_hits\\\": \\\"5\\\", \\\"max_hsps\\\": \\\"\\\", \\\"parse_deflines\\\": \\\"false\\\", \\\"qcov_hsp_perc\\\": \\\"0.0\\\", \\\"strand\\\": \\\"-strand both\\\", \\\"ungapped\\\": \\\"false\\\", \\\"window_size\\\": \\\"\\\", \\\"word_size\\\": \\\"\\\"}\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"db_opts\": \"{\\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\", \\\"db_opts_selector\\\": \\\"histdb\\\", \\\"histdb\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"subject\\\": \\\"\\\"}\", \"blast_type\": \"\\\"blastn\\\"\", \"query\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", 
+            "label": "BLASTn contigs to the viral database", 
+            "type": "tool", 
+            "id": 9, 
+            "tool_shed_repository": {
+                "owner": "devteam", 
+                "changeset_revision": "e25d3acf6e68", 
+                "name": "ncbi_blast_plus", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "NCBI BLAST+ blastn"
+        }, 
+        "8": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/oases/oasesoptimiserv/1.2.2", 
+            "errors": null, 
+            "uuid": "04b99c48-2bf7-4842-b28e-c9085ffe40e9", 
+            "tool_version": "1.2.2", 
+            "outputs": [
+                {
+                    "type": "fasta", 
+                    "name": "transcripts"
+                }
+            ], 
+            "post_job_actions": {
+                "ChangeDatatypeActiontranscripts": {
+                    "output_name": "transcripts", 
+                    "action_type": "ChangeDatatypeAction", 
+                    "action_arguments": {
+                        "newtype": "fasta"
+                    }
+                }, 
+                "RenameDatasetActiontranscripts": {
+                    "output_name": "transcripts", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Oases Contigs"
+                    }
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "transcripts", 
+                    "uuid": "704bb7a9-199c-4028-a482-ebc60ab1d02e", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/oases/oasesoptimiserv/1.2.2", 
+            "input_connections": {
+                "inputs_0|input": {
+                    "output_name": "unaligned", 
+                    "id": 7
+                }
+            }, 
+            "inputs": [], 
+            "position": {
+                "top": 442, 
+                "left": 1287
+            }, 
+            "tool_state": "{\"__page__\": null, \"inputs\": \"[{\\\"__index__\\\": 0, \\\"input\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}]\", \"end_hash_length\": \"\\\"29\\\"\", \"__rerun_remap_job_id__\": null, \"start_hash_length\": \"\\\"13\\\"\"}", 
+            "label": "Assemble contigs", 
+            "type": "tool", 
+            "id": 8, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "f7dd852c8f4c", 
+                "name": "oases", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Oases_optimiser"
+        }
+    }, 
+    "annotation": "", 
+    "name": "Metavisitor: Workflow for Use Case 1-1"
+}
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_1-2.ga	Sun Jul 21 19:22:52 2019 -0400
@@ -0,0 +1,909 @@
+{
+    "a_galaxy_workflow": "true", 
+    "uuid": "ec837c44-317a-4ba7-823e-939b1e86c9eb", 
+    "tags": [], 
+    "format-version": "0.1", 
+    "version": 3, 
+    "steps": {
+        "11": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.3.1", 
+            "errors": null, 
+            "uuid": "4f996123-d155-426a-ba26-e649c422431e", 
+            "tool_version": "0.3.1", 
+            "outputs": [
+                {
+                    "type": "tabular", 
+                    "name": "output1"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionoutput1": {
+                    "output_name": "output1", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "RenameDatasetActionoutput1": {
+                    "output_name": "output1", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "CDS aligned to ${ncbi_guide_ID}"
+                    }
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.3.1", 
+            "input_connections": {
+                "query": {
+                    "output_name": "contigsandsinglets", 
+                    "id": 10
+                }, 
+                "db_opts|histdb": {
+                    "output_name": "outfile", 
+                    "id": 4
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "db_opts", 
+                    "description": "runtime parameter for tool NCBI BLAST+ blastn"
+                }, 
+                {
+                    "name": "query", 
+                    "description": "runtime parameter for tool NCBI BLAST+ blastn"
+                }
+            ], 
+            "position": {
+                "top": 824, 
+                "left": 2296
+            }, 
+            "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"__current_case__\\\": 2, \\\"ext_cols\\\": [\\\"slen\\\"], \\\"ids_cols\\\": null, \\\"misc_cols\\\": null, \\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"tax_cols\\\": null}\", \"adv_opts\": \"{\\\"__current_case__\\\": 0, \\\"adv_opts_selector\\\": \\\"basic\\\"}\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"db_opts\": \"{\\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\", \\\"db_opts_selector\\\": \\\"histdb\\\", \\\"histdb\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"subject\\\": \\\"\\\"}\", \"blast_type\": \"\\\"blastn\\\"\", \"query\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", 
+            "label": "BLAST contigs against specific virus", 
+            "type": "tool", 
+            "id": 11, 
+            "tool_shed_repository": {
+                "owner": "devteam", 
+                "changeset_revision": "e25d3acf6e68", 
+                "name": "ncbi_blast_plus", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "NCBI BLAST+ blastn"
+        }, 
+        "10": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/cap3/cap3/2.0.0", 
+            "errors": null, 
+            "uuid": "bd3f2dd0-b170-433d-b1e8-2b0f303006a7", 
+            "tool_version": "2.0.0", 
+            "outputs": [
+                {
+                    "type": "fasta", 
+                    "name": "contigsandsinglets"
+                }, 
+                {
+                    "type": "txt", 
+                    "name": "cap3stdout"
+                }, 
+                {
+                    "type": "fasta", 
+                    "name": "contigs"
+                }, 
+                {
+                    "type": "txt", 
+                    "name": "contigsqual"
+                }, 
+                {
+                    "type": "txt", 
+                    "name": "contigslink"
+                }, 
+                {
+                    "type": "txt", 
+                    "name": "ace"
+                }, 
+                {
+                    "type": "txt", 
+                    "name": "info"
+                }, 
+                {
+                    "type": "txt", 
+                    "name": "singlets"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActioncontigsqual": {
+                    "output_name": "contigsqual", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "RenameDatasetActioncontigsandsinglets": {
+                    "output_name": "contigsandsinglets", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "viral CDS"
+                    }
+                }, 
+                "HideDatasetActioncontigslink": {
+                    "output_name": "contigslink", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActioncontigs": {
+                    "output_name": "contigs", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionace": {
+                    "output_name": "ace", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionsinglets": {
+                    "output_name": "singlets", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActioncap3stdout": {
+                    "output_name": "cap3stdout", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActioninfo": {
+                    "output_name": "info", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "contigsandsinglets", 
+                    "uuid": "e2dff9ee-9235-4087-9a51-30b5b9974537", 
+                    "label": null
+                }
+            ], 
+            "annotation": "Group highly similar viral transcripts", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/cap3/cap3/2.0.0", 
+            "input_connections": {
+                "inputSequences": {
+                    "output_name": "fastaOutput", 
+                    "id": 9
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "inputSequences", 
+                    "description": "runtime parameter for tool cap3"
+                }
+            ], 
+            "position": {
+                "top": 593, 
+                "left": 1963.5
+            }, 
+            "tool_state": "{\"overlapidentity\": \"\\\"90\\\"\", \"inputSequences\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"overlaplength\": \"\\\"40\\\"\", \"__page__\": null}", 
+            "label": "Group similar contigs", 
+            "type": "tool", 
+            "id": 10, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "d76a0d8a9eac", 
+                "name": "cap3", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "cap3"
+        }, 
+        "13": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/galaxyp/regex_find_replace/regex1/1.0.0", 
+            "errors": null, 
+            "uuid": "c81173fb-317d-4c00-9da8-f0072b62a569", 
+            "tool_version": "1.0.0", 
+            "outputs": [
+                {
+                    "type": "input", 
+                    "name": "out_file1"
+                }
+            ], 
+            "post_job_actions": {
+                "ChangeDatatypeActionout_file1": {
+                    "output_name": "out_file1", 
+                    "action_type": "ChangeDatatypeAction", 
+                    "action_arguments": {
+                        "newtype": "fasta"
+                    }
+                }, 
+                "RenameDatasetActionout_file1": {
+                    "output_name": "out_file1", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Nora_raw_reads_${ncbi_guide_ID}_guided"
+                    }
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "out_file1", 
+                    "uuid": "e202eeb0-f65c-4295-afe0-44a56634a452", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/galaxyp/regex_find_replace/regex1/1.0.0", 
+            "input_connections": {
+                "input": {
+                    "output_name": "output", 
+                    "id": 12
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "input", 
+                    "description": "runtime parameter for tool Regex Find And Replace"
+                }
+            ], 
+            "position": {
+                "top": 914, 
+                "left": 2865
+            }, 
+            "tool_state": "{\"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"checks\": \"[{\\\"__index__\\\": 0, \\\"pattern\\\": \\\">.+\\\", \\\"replacement\\\": \\\">Nora_raw_reads\\\"}]\", \"__page__\": null}", 
+            "label": "Change header", 
+            "type": "tool", 
+            "id": 13, 
+            "tool_shed_repository": {
+                "owner": "galaxyp", 
+                "changeset_revision": "209b7c5ee9d7", 
+                "name": "regex_find_replace", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Regex Find And Replace"
+        }, 
+        "12": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/blast_to_scaffold/blast2scaffold/1.0.0", 
+            "errors": null, 
+            "uuid": "7f0913f8-f7f9-4ba3-878c-9c502460331d", 
+            "tool_version": "1.0.0", 
+            "outputs": [
+                {
+                    "type": "fasta", 
+                    "name": "output"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionoutput": {
+                    "output_name": "output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "RenameDatasetActionoutput": {
+                    "output_name": "output", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "viral CDS"
+                    }
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "Generate CDS from transcripts", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/blast_to_scaffold/blast2scaffold/1.0.0", 
+            "input_connections": {
+                "guideSequence": {
+                    "output_name": "outfile", 
+                    "id": 2
+                }, 
+                "blast_tab": {
+                    "output_name": "output1", 
+                    "id": 11
+                }, 
+                "sequences": {
+                    "output_name": "contigsandsinglets", 
+                    "id": 10
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "guideSequence", 
+                    "description": "runtime parameter for tool blast_to_scaffold"
+                }, 
+                {
+                    "name": "blast_tab", 
+                    "description": "runtime parameter for tool blast_to_scaffold"
+                }, 
+                {
+                    "name": "sequences", 
+                    "description": "runtime parameter for tool blast_to_scaffold"
+                }
+            ], 
+            "position": {
+                "top": 656, 
+                "left": 2622.5
+            }, 
+            "tool_state": "{\"__page__\": null, \"guideSequence\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"blast_tab\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"sequences\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", 
+            "label": "Generate CDS", 
+            "type": "tool", 
+            "id": 12, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "7d96b28eec49", 
+                "name": "blast_to_scaffold", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "blast_to_scaffold"
+        }, 
+        "1": {
+            "tool_id": null, 
+            "errors": null, 
+            "uuid": "462eb78f-9844-42d6-8087-19f2e1e801ca", 
+            "tool_version": null, 
+            "outputs": [], 
+            "workflow_outputs": [
+                {
+                    "output_name": "output", 
+                    "uuid": "6bd2d24e-e12f-41fe-9308-631cc6718143", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": null, 
+            "input_connections": {}, 
+            "inputs": [], 
+            "position": {
+                "top": 963.9833374023438, 
+                "left": 1099.9666748046875
+            }, 
+            "tool_state": "{}", 
+            "label": "viral nucleotide BLAST database (V2)", 
+            "type": "data_input", 
+            "id": 1, 
+            "name": "Input dataset"
+        }, 
+        "0": {
+            "tool_id": null, 
+            "errors": null, 
+            "uuid": "aa5c2a9c-0f52-4884-9f1c-74432b24af61", 
+            "tool_version": null, 
+            "outputs": [], 
+            "workflow_outputs": [
+                {
+                    "output_name": "output", 
+                    "uuid": "1b5f1e3d-c5d0-423d-a69f-8912a6f6dd6b", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": null, 
+            "input_connections": {}, 
+            "inputs": [], 
+            "position": {
+                "top": 215, 
+                "left": 200
+            }, 
+            "tool_state": "{\"collection_type\": \"list\"}", 
+            "label": "Fastq files", 
+            "type": "data_collection_input", 
+            "id": 0, 
+            "name": "Input dataset collection"
+        }, 
+        "3": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/yac_clipper/yac/2.3.0", 
+            "errors": null, 
+            "uuid": "41212793-f400-4bd6-9827-c083025f3e01", 
+            "tool_version": "2.3.0", 
+            "outputs": [
+                {
+                    "type": "input", 
+                    "name": "output"
+                }
+            ], 
+            "post_job_actions": {}, 
+            "workflow_outputs": [
+                {
+                    "output_name": "output", 
+                    "uuid": "daf5f2fc-bac8-4cb0-bca6-4d26da852236", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/yac_clipper/yac/2.3.0", 
+            "input_connections": {
+                "input": {
+                    "output_name": "output", 
+                    "id": 0
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "input", 
+                    "description": "runtime parameter for tool Clip adapter"
+                }
+            ], 
+            "position": {
+                "top": 324, 
+                "left": 400.5
+            }, 
+            "tool_state": "{\"out_format\": \"\\\"fasta\\\"\", \"__page__\": null, \"min\": \"\\\"18\\\"\", \"max\": \"\\\"30\\\"\", \"__rerun_remap_job_id__\": null, \"clip_source\": \"{\\\"__current_case__\\\": 0, \\\"clip_sequence\\\": \\\"CTGTAGGCACCATCAATCGT\\\", \\\"clip_source_list\\\": \\\"prebuilt\\\"}\", \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"Nmode\": \"\\\"reject\\\"\"}", 
+            "label": null, 
+            "type": "tool", 
+            "id": 3, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "f7947c5a18b8", 
+                "name": "yac_clipper", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Clip adapter"
+        }, 
+        "2": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/2.3.0", 
+            "errors": null, 
+            "uuid": "13214523-9fb0-4e23-8cdf-f389331ba0c9", 
+            "tool_version": "2.3.0", 
+            "outputs": [
+                {
+                    "type": "fasta", 
+                    "name": "outfile"
+                }, 
+                {
+                    "type": "txt", 
+                    "name": "logfile"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionlogfile": {
+                    "output_name": "logfile", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "outfile", 
+                    "uuid": "9c9b23f2-66ae-4eeb-88f1-e4a0a8bd596b", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/2.3.0", 
+            "input_connections": {}, 
+            "inputs": [], 
+            "position": {
+                "top": 956, 
+                "left": 1677
+            }, 
+            "tool_state": "{\"__page__\": null, \"__rerun_remap_job_id__\": null, \"queryString\": \"\\\"${ncbi_guide_ID}\\\"\", \"dbname\": \"\\\"nuccore\\\"\", \"dry_run\": \"\\\"false\\\"\"}", 
+            "label": null, 
+            "type": "tool", 
+            "id": 2, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "c667d0ee39f5", 
+                "name": "fetch_fasta_from_ncbi", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Retrieve FASTA from NCBI"
+        }, 
+        "5": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", 
+            "errors": null, 
+            "uuid": "06a0d0da-7415-4097-b0df-43c8dee1bc7a", 
+            "tool_version": "1.4.1", 
+            "outputs": [
+                {
+                    "type": "input", 
+                    "name": "paired_output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "list_output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "out_file1"
+                }, 
+                {
+                    "type": "_sniff_", 
+                    "name": "paired_out_file"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionout_file1": {
+                    "output_name": "out_file1", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionpaired_out_file": {
+                    "output_name": "paired_out_file", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionpaired_output": {
+                    "output_name": "paired_output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionlist_output": {
+                    "output_name": "list_output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "ChangeDatatypeActionout_file1": {
+                    "output_name": "out_file1", 
+                    "action_type": "ChangeDatatypeAction", 
+                    "action_arguments": {
+                        "newtype": "fasta"
+                    }
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", 
+            "input_connections": {
+                "global_condition|inputs": {
+                    "output_name": "output", 
+                    "id": 3
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "global_condition", 
+                    "description": "runtime parameter for tool Concatenate multiple datasets"
+                }
+            ], 
+            "position": {
+                "top": 518.5, 
+                "left": 562
+            }, 
+            "tool_state": "{\"dataset_names\": \"\\\"false\\\"\", \"headers\": \"\\\"0\\\"\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"global_condition\": \"{\\\"__current_case__\\\": 0, \\\"input_type\\\": \\\"singles\\\", \\\"inputs\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\"}", 
+            "label": "Concatenate read files", 
+            "type": "tool", 
+            "id": 5, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "55cf9d9defd1", 
+                "name": "concatenate_multiple_datasets", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Concatenate multiple datasets"
+        }, 
+        "4": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_makeblastdb/0.3.1", 
+            "errors": null, 
+            "uuid": "1a39e6e8-8079-4f7a-b4c2-2028e5dbc2dd", 
+            "tool_version": "0.3.1", 
+            "outputs": [
+                {
+                    "type": "data", 
+                    "name": "outfile"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionoutfile": {
+                    "output_name": "outfile", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "RenameDatasetActionoutfile": {
+                    "output_name": "outfile", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "#{input_file} blast database"
+                    }
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_makeblastdb/0.3.1", 
+            "input_connections": {
+                "input_file": {
+                    "output_name": "outfile", 
+                    "id": 2
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "mask_data_file", 
+                    "description": "runtime parameter for tool NCBI BLAST+ makeblastdb"
+                }, 
+                {
+                    "name": "input_file", 
+                    "description": "runtime parameter for tool NCBI BLAST+ makeblastdb"
+                }
+            ], 
+            "position": {
+                "top": 1047, 
+                "left": 1994.5
+            }, 
+            "tool_state": "{\"__page__\": null, \"mask_data_file\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"input_file\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"dbtype\": \"\\\"nucl\\\"\", \"__rerun_remap_job_id__\": null, \"hash_index\": \"\\\"true\\\"\", \"tax\": \"{\\\"__current_case__\\\": 0, \\\"taxselect\\\": \\\"\\\"}\", \"title\": \"\\\"Blastn candidate database\\\"\", \"parse_seqids\": \"\\\"false\\\"\"}", 
+            "label": null, 
+            "type": "tool", 
+            "id": 4, 
+            "tool_shed_repository": {
+                "owner": "devteam", 
+                "changeset_revision": "e25d3acf6e68", 
+                "name": "ncbi_blast_plus", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "NCBI BLAST+ makeblastdb"
+        }, 
+        "7": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/oases/oasesoptimiserv/1.2.2", 
+            "errors": null, 
+            "uuid": "04b99c48-2bf7-4842-b28e-c9085ffe40e9", 
+            "tool_version": "1.2.2", 
+            "outputs": [
+                {
+                    "type": "fasta", 
+                    "name": "transcripts"
+                }
+            ], 
+            "post_job_actions": {
+                "RenameDatasetActiontranscripts": {
+                    "output_name": "transcripts", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Oases Contigs"
+                    }
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "transcripts", 
+                    "uuid": "704bb7a9-199c-4028-a482-ebc60ab1d02e", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/oases/oasesoptimiserv/1.2.2", 
+            "input_connections": {
+                "inputs_0|input": {
+                    "output_name": "unaligned", 
+                    "id": 6
+                }
+            }, 
+            "inputs": [], 
+            "position": {
+                "top": 429, 
+                "left": 1181
+            }, 
+            "tool_state": "{\"__page__\": null, \"inputs\": \"[{\\\"__index__\\\": 0, \\\"input\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}]\", \"end_hash_length\": \"\\\"29\\\"\", \"__rerun_remap_job_id__\": null, \"start_hash_length\": \"\\\"13\\\"\"}", 
+            "label": "Assemble reads into contigs", 
+            "type": "tool", 
+            "id": 7, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "f7dd852c8f4c", 
+                "name": "oases", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Oases_optimiser"
+        }, 
+        "6": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1", 
+            "errors": null, 
+            "uuid": "2d4bdb6b-31ea-4a53-b902-51caceed1512", 
+            "tool_version": "2.1.1", 
+            "outputs": [
+                {
+                    "type": "tabular", 
+                    "name": "output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "aligned"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "unaligned"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionaligned": {
+                    "output_name": "aligned", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionoutput": {
+                    "output_name": "output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "RenameDatasetActionunaligned": {
+                    "output_name": "unaligned", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Non D. melanogaster sequences"
+                    }
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "unaligned", 
+                    "uuid": "b01c79d3-2252-4625-ba1c-288edd89d842", 
+                    "label": null
+                }
+            ], 
+            "annotation": "Remove reads tat align to host (dm6)", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1", 
+            "input_connections": {
+                "input": {
+                    "output_name": "out_file1", 
+                    "id": 5
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "input", 
+                    "description": "runtime parameter for tool sR_bowtie"
+                }
+            ], 
+            "position": {
+                "top": 322.5, 
+                "left": 864.5
+            }, 
+            "tool_state": "{\"__page__\": null, \"output_format\": \"\\\"tabular\\\"\", \"v_mismatches\": \"\\\"2\\\"\", \"additional_fasta\": \"\\\"unal\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"refGenomeSource\": \"{\\\"__current_case__\\\": 0, \\\"genomeSource\\\": \\\"indexed\\\", \\\"index\\\": \\\"dm6\\\"}\", \"method\": \"\\\"k_option\\\"\"}", 
+            "label": "Align to host", 
+            "type": "tool", 
+            "id": 6, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "0281bb245635", 
+                "name": "sr_bowtie", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "sR_bowtie"
+        }, 
+        "9": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/blastparser_and_hits/BlastParser_and_hits/2.6.1", 
+            "errors": null, 
+            "uuid": "32436393-ca05-40be-afd9-451f9cd11e62", 
+            "tool_version": "2.6.1", 
+            "outputs": [
+                {
+                    "type": "tabular", 
+                    "name": "tabularOutput"
+                }, 
+                {
+                    "type": "fasta", 
+                    "name": "fastaOutput"
+                }, 
+                {
+                    "type": "fasta", 
+                    "name": "al_sequences"
+                }, 
+                {
+                    "type": "fasta", 
+                    "name": "un_sequences"
+                }
+            ], 
+            "post_job_actions": {
+                "RenameDatasetActionfastaOutput": {
+                    "output_name": "fastaOutput", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "viral contigs"
+                    }
+                }, 
+                "HideDatasetActional_sequences": {
+                    "output_name": "al_sequences", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionun_sequences": {
+                    "output_name": "un_sequences", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "tabularOutput", 
+                    "uuid": "fd3bc90d-8222-4e61-871a-ec291d0a1555", 
+                    "label": null
+                }, 
+                {
+                    "output_name": "fastaOutput", 
+                    "uuid": "7b4b468c-d761-405a-a46e-fc25fb784b1d", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/blastparser_and_hits/BlastParser_and_hits/2.6.1", 
+            "input_connections": {
+                "blast": {
+                    "output_name": "output1", 
+                    "id": 8
+                }, 
+                "sequences": {
+                    "output_name": "transcripts", 
+                    "id": 7
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "blast", 
+                    "description": "runtime parameter for tool Parse blast output and compile hits"
+                }, 
+                {
+                    "name": "sequences", 
+                    "description": "runtime parameter for tool Parse blast output and compile hits"
+                }
+            ], 
+            "position": {
+                "top": 413, 
+                "left": 1640
+            }, 
+            "tool_state": "{\"__page__\": null, \"flanking\": \"\\\"5\\\"\", \"additional_filters\": \"{\\\"__current_case__\\\": 1, \\\"filter_maxScore\\\": \\\"0.0\\\", \\\"filter_meanScore\\\": \\\"0.0\\\", \\\"filter_relativeCov\\\": \\\"0.0\\\", \\\"filter_term_in\\\": \\\"Nora_virus\\\", \\\"filter_term_out\\\": \\\"JX220408.1\\\", \\\"use_filters\\\": \\\"yes\\\"}\", \"__rerun_remap_job_id__\": null, \"mode\": \"\\\"short\\\"\", \"sequences\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"blast\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", 
+            "label": null, 
+            "type": "tool", 
+            "id": 9, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "b4c9c085d709", 
+                "name": "blastparser_and_hits", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Parse blast output and compile hits"
+        }, 
+        "8": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.3.1", 
+            "errors": null, 
+            "uuid": "37904c73-85c7-40e8-b1d5-e5f3d6a12135", 
+            "tool_version": "0.3.1", 
+            "outputs": [
+                {
+                    "type": "tabular", 
+                    "name": "output1"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionoutput1": {
+                    "output_name": "output1", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "RenameDatasetActionoutput1": {
+                    "output_name": "output1", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Blast transcripts to vir2"
+                    }
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "Align transcripts to viral database to get viral transcripts", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.3.1", 
+            "input_connections": {
+                "query": {
+                    "output_name": "transcripts", 
+                    "id": 7
+                }, 
+                "db_opts|histdb": {
+                    "output_name": "output", 
+                    "id": 1
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "db_opts", 
+                    "description": "runtime parameter for tool NCBI BLAST+ blastn"
+                }, 
+                {
+                    "name": "query", 
+                    "description": "runtime parameter for tool NCBI BLAST+ blastn"
+                }
+            ], 
+            "position": {
+                "top": 677, 
+                "left": 1349
+            }, 
+            "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"__current_case__\\\": 2, \\\"ext_cols\\\": [\\\"slen\\\"], \\\"ids_cols\\\": null, \\\"misc_cols\\\": null, \\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"tax_cols\\\": null}\", \"adv_opts\": \"{\\\"__current_case__\\\": 1, \\\"adv_optional_id_files_opts\\\": {\\\"__current_case__\\\": 0, \\\"adv_optional_id_files_opts_selector\\\": \\\"none\\\"}, \\\"adv_opts_selector\\\": \\\"advanced\\\", \\\"filter_query\\\": \\\"true\\\", \\\"gapextend\\\": \\\"\\\", \\\"gapopen\\\": \\\"\\\", \\\"identity_cutoff\\\": \\\"0.0\\\", \\\"max_hits\\\": \\\"5\\\", \\\"max_hsps\\\": \\\"\\\", \\\"parse_deflines\\\": \\\"false\\\", \\\"qcov_hsp_perc\\\": \\\"0.0\\\", \\\"strand\\\": \\\"-strand both\\\", \\\"ungapped\\\": \\\"false\\\", \\\"window_size\\\": \\\"\\\", \\\"word_size\\\": \\\"\\\"}\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"db_opts\": \"{\\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\", \\\"db_opts_selector\\\": \\\"histdb\\\", \\\"histdb\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"subject\\\": \\\"\\\"}\", \"blast_type\": \"\\\"blastn\\\"\", \"query\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", 
+            "label": "Align to viral database", 
+            "type": "tool", 
+            "id": 8, 
+            "tool_shed_repository": {
+                "owner": "devteam", 
+                "changeset_revision": "e25d3acf6e68", 
+                "name": "ncbi_blast_plus", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "NCBI BLAST+ blastn"
+        }
+    }, 
+    "annotation": "", 
+    "name": "Metavisitor: Workflow for Use Case 1-2"
+}
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_1-3.ga	Sun Jul 21 19:22:52 2019 -0400
@@ -0,0 +1,1096 @@
+{
+    "a_galaxy_workflow": "true", 
+    "uuid": "432e01a8-9010-4d08-a47b-79cfad2dfd2c", 
+    "tags": [], 
+    "format-version": "0.1", 
+    "version": 3, 
+    "steps": {
+        "11": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/blastparser_and_hits/BlastParser_and_hits/2.6.1", 
+            "errors": null, 
+            "uuid": "534549e3-fa4d-458a-9eeb-92c9ae7a1961", 
+            "tool_version": null, 
+            "outputs": [
+                {
+                    "type": "tabular", 
+                    "name": "tabularOutput"
+                }, 
+                {
+                    "type": "fasta", 
+                    "name": "fastaOutput"
+                }, 
+                {
+                    "type": "fasta", 
+                    "name": "al_sequences"
+                }, 
+                {
+                    "type": "fasta", 
+                    "name": "un_sequences"
+                }
+            ], 
+            "post_job_actions": {
+                "RenameDatasetActionfastaOutput": {
+                    "output_name": "fastaOutput", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Viral contigs"
+                    }
+                }, 
+                "HideDatasetActional_sequences": {
+                    "output_name": "al_sequences", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionun_sequences": {
+                    "output_name": "un_sequences", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "tabularOutput", 
+                    "uuid": "78f44029-743a-42da-a769-58bb4cf84dba", 
+                    "label": null
+                }, 
+                {
+                    "output_name": "fastaOutput", 
+                    "uuid": "eec4d361-f330-465a-b609-204296cb06e1", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/blastparser_and_hits/BlastParser_and_hits/2.6.1", 
+            "input_connections": {
+                "blast": {
+                    "output_name": "output1", 
+                    "id": 10
+                }, 
+                "sequences": {
+                    "output_name": "transcripts", 
+                    "id": 9
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "blast", 
+                    "description": "runtime parameter for tool Parse blast output and compile hits"
+                }, 
+                {
+                    "name": "sequences", 
+                    "description": "runtime parameter for tool Parse blast output and compile hits"
+                }
+            ], 
+            "position": {
+                "top": 504.5, 
+                "left": 1667
+            }, 
+            "tool_state": "{\"__page__\": null, \"flanking\": \"\\\"5\\\"\", \"additional_filters\": \"{\\\"__current_case__\\\": 1, \\\"filter_maxScore\\\": \\\"0.0\\\", \\\"filter_meanScore\\\": \\\"0.0\\\", \\\"filter_relativeCov\\\": \\\"0.0\\\", \\\"filter_term_in\\\": \\\"Nora_virus\\\", \\\"filter_term_out\\\": \\\"JX220408.1\\\", \\\"use_filters\\\": \\\"yes\\\"}\", \"__rerun_remap_job_id__\": null, \"mode\": \"\\\"short\\\"\", \"sequences\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"blast\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", 
+            "label": null, 
+            "type": "tool", 
+            "id": 11, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "b4c9c085d709", 
+                "name": "blastparser_and_hits", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Parse blast output and compile hits"
+        }, 
+        "10": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.3.1", 
+            "errors": null, 
+            "uuid": "2f0cc6fe-a330-43ed-a8dc-270fe4171758", 
+            "tool_version": null, 
+            "outputs": [
+                {
+                    "type": "tabular", 
+                    "name": "output1"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionoutput1": {
+                    "output_name": "output1", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "RenameDatasetActionoutput1": {
+                    "output_name": "output1", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Blast contigs to vir2 output"
+                    }
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.3.1", 
+            "input_connections": {
+                "query": {
+                    "output_name": "transcripts", 
+                    "id": 9
+                }, 
+                "db_opts|histdb": {
+                    "output_name": "output", 
+                    "id": 1
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "db_opts", 
+                    "description": "runtime parameter for tool NCBI BLAST+ blastn"
+                }, 
+                {
+                    "name": "query", 
+                    "description": "runtime parameter for tool NCBI BLAST+ blastn"
+                }
+            ], 
+            "position": {
+                "top": 733, 
+                "left": 1350
+            }, 
+            "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"__current_case__\\\": 2, \\\"ext_cols\\\": [\\\"slen\\\"], \\\"ids_cols\\\": null, \\\"misc_cols\\\": null, \\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"tax_cols\\\": null}\", \"adv_opts\": \"{\\\"__current_case__\\\": 1, \\\"adv_optional_id_files_opts\\\": {\\\"__current_case__\\\": 0, \\\"adv_optional_id_files_opts_selector\\\": \\\"none\\\"}, \\\"adv_opts_selector\\\": \\\"advanced\\\", \\\"filter_query\\\": \\\"true\\\", \\\"gapextend\\\": \\\"\\\", \\\"gapopen\\\": \\\"\\\", \\\"identity_cutoff\\\": \\\"0.0\\\", \\\"max_hits\\\": \\\"5\\\", \\\"max_hsps\\\": \\\"\\\", \\\"parse_deflines\\\": \\\"false\\\", \\\"qcov_hsp_perc\\\": \\\"0.0\\\", \\\"strand\\\": \\\"-strand both\\\", \\\"ungapped\\\": \\\"false\\\", \\\"window_size\\\": \\\"\\\", \\\"word_size\\\": \\\"\\\"}\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"db_opts\": \"{\\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\", \\\"db_opts_selector\\\": \\\"histdb\\\", \\\"histdb\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"subject\\\": \\\"\\\"}\", \"blast_type\": \"\\\"blastn\\\"\", \"query\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", 
+            "label": "Blast contigs to vir2", 
+            "type": "tool", 
+            "id": 10, 
+            "tool_shed_repository": {
+                "owner": "devteam", 
+                "changeset_revision": "e25d3acf6e68", 
+                "name": "ncbi_blast_plus", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "NCBI BLAST+ blastn"
+        }, 
+        "13": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.3.1", 
+            "errors": null, 
+            "uuid": "1d4ae58b-4424-40e6-8d5d-08a24369bc7b", 
+            "tool_version": null, 
+            "outputs": [
+                {
+                    "type": "tabular", 
+                    "name": "output1"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionoutput1": {
+                    "output_name": "output1", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "RenameDatasetActionoutput1": {
+                    "output_name": "output1", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Blast contigs to ${ncbi_guide_ID}"
+                    }
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.3.1", 
+            "input_connections": {
+                "query": {
+                    "output_name": "contigsandsinglets", 
+                    "id": 12
+                }, 
+                "db_opts|histdb": {
+                    "output_name": "outfile", 
+                    "id": 4
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "db_opts", 
+                    "description": "runtime parameter for tool NCBI BLAST+ blastn"
+                }, 
+                {
+                    "name": "query", 
+                    "description": "runtime parameter for tool NCBI BLAST+ blastn"
+                }
+            ], 
+            "position": {
+                "top": 880, 
+                "left": 2297
+            }, 
+            "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"__current_case__\\\": 2, \\\"ext_cols\\\": [\\\"slen\\\"], \\\"ids_cols\\\": null, \\\"misc_cols\\\": null, \\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"tax_cols\\\": null}\", \"adv_opts\": \"{\\\"__current_case__\\\": 0, \\\"adv_opts_selector\\\": \\\"basic\\\"}\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"db_opts\": \"{\\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\", \\\"db_opts_selector\\\": \\\"histdb\\\", \\\"histdb\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"subject\\\": \\\"\\\"}\", \"blast_type\": \"\\\"blastn\\\"\", \"query\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", 
+            "label": "Blast contigs to virus", 
+            "type": "tool", 
+            "id": 13, 
+            "tool_shed_repository": {
+                "owner": "devteam", 
+                "changeset_revision": "e25d3acf6e68", 
+                "name": "ncbi_blast_plus", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "NCBI BLAST+ blastn"
+        }, 
+        "12": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/cap3/cap3/2.0.0", 
+            "errors": null, 
+            "uuid": "56df8d31-5958-414f-b50a-963109030a9f", 
+            "tool_version": null, 
+            "outputs": [
+                {
+                    "type": "fasta", 
+                    "name": "contigsandsinglets"
+                }, 
+                {
+                    "type": "txt", 
+                    "name": "cap3stdout"
+                }, 
+                {
+                    "type": "fasta", 
+                    "name": "contigs"
+                }, 
+                {
+                    "type": "txt", 
+                    "name": "contigsqual"
+                }, 
+                {
+                    "type": "txt", 
+                    "name": "contigslink"
+                }, 
+                {
+                    "type": "txt", 
+                    "name": "ace"
+                }, 
+                {
+                    "type": "txt", 
+                    "name": "info"
+                }, 
+                {
+                    "type": "txt", 
+                    "name": "singlets"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActioninfo": {
+                    "output_name": "info", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActioncontigsqual": {
+                    "output_name": "contigsqual", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "RenameDatasetActioncontigsandsinglets": {
+                    "output_name": "contigsandsinglets", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "re-assembled contigs"
+                    }
+                }, 
+                "HideDatasetActioncontigs": {
+                    "output_name": "contigs", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActioncap3stdout": {
+                    "output_name": "cap3stdout", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionsinglets": {
+                    "output_name": "singlets", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActioncontigslink": {
+                    "output_name": "contigslink", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionace": {
+                    "output_name": "ace", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "contigsandsinglets", 
+                    "uuid": "5935d433-8109-4c6c-ac29-2d37c13a51cf", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/cap3/cap3/2.0.0", 
+            "input_connections": {
+                "inputSequences": {
+                    "output_name": "fastaOutput", 
+                    "id": 11
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "inputSequences", 
+                    "description": "runtime parameter for tool cap3"
+                }
+            ], 
+            "position": {
+                "top": 632, 
+                "left": 1977.5
+            }, 
+            "tool_state": "{\"overlapidentity\": \"\\\"90\\\"\", \"inputSequences\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"overlaplength\": \"\\\"40\\\"\", \"__page__\": null}", 
+            "label": "CAP3 to re-assemble contigs", 
+            "type": "tool", 
+            "id": 12, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "d76a0d8a9eac", 
+                "name": "cap3", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "cap3"
+        }, 
+        "15": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/galaxyp/regex_find_replace/regex1/1.0.0", 
+            "errors": null, 
+            "uuid": "cfa23469-58e0-470e-b718-ca9a7c973a6a", 
+            "tool_version": null, 
+            "outputs": [
+                {
+                    "type": "input", 
+                    "name": "out_file1"
+                }
+            ], 
+            "post_job_actions": {
+                "ChangeDatatypeActionout_file1": {
+                    "output_name": "out_file1", 
+                    "action_type": "ChangeDatatypeAction", 
+                    "action_arguments": {
+                        "newtype": "fasta"
+                    }
+                }, 
+                "RenameDatasetActionout_file1": {
+                    "output_name": "out_file1", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Nora_Median-Norm-reads_${ncbi_guide_ID}_guided"
+                    }
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "out_file1", 
+                    "uuid": "b08895c2-7c70-4bc9-b17a-4481166279bf", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/galaxyp/regex_find_replace/regex1/1.0.0", 
+            "input_connections": {
+                "input": {
+                    "output_name": "output", 
+                    "id": 14
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "input", 
+                    "description": "runtime parameter for tool Regex Find And Replace"
+                }
+            ], 
+            "position": {
+                "top": 970, 
+                "left": 2866
+            }, 
+            "tool_state": "{\"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"checks\": \"[{\\\"__index__\\\": 0, \\\"pattern\\\": \\\">.+\\\", \\\"replacement\\\": \\\">Nora_Median-Norm-reads\\\"}]\", \"__page__\": null}", 
+            "label": "Change header", 
+            "type": "tool", 
+            "id": 15, 
+            "tool_shed_repository": {
+                "owner": "galaxyp", 
+                "changeset_revision": "209b7c5ee9d7", 
+                "name": "regex_find_replace", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Regex Find And Replace"
+        }, 
+        "14": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/blast_to_scaffold/blast2scaffold/1.0.0", 
+            "errors": null, 
+            "uuid": "9d6c926b-8106-40b4-8396-587c7e446061", 
+            "tool_version": null, 
+            "outputs": [
+                {
+                    "type": "fasta", 
+                    "name": "output"
+                }
+            ], 
+            "post_job_actions": {
+                "RenameDatasetActionoutput": {
+                    "output_name": "output", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Viral CDS"
+                    }
+                }, 
+                "HideDatasetActionoutput": {
+                    "output_name": "output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/blast_to_scaffold/blast2scaffold/1.0.0", 
+            "input_connections": {
+                "guideSequence": {
+                    "output_name": "outfile", 
+                    "id": 2
+                }, 
+                "blast_tab": {
+                    "output_name": "output1", 
+                    "id": 13
+                }, 
+                "sequences": {
+                    "output_name": "contigsandsinglets", 
+                    "id": 12
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "guideSequence", 
+                    "description": "runtime parameter for tool blast_to_scaffold"
+                }, 
+                {
+                    "name": "blast_tab", 
+                    "description": "runtime parameter for tool blast_to_scaffold"
+                }, 
+                {
+                    "name": "sequences", 
+                    "description": "runtime parameter for tool blast_to_scaffold"
+                }
+            ], 
+            "position": {
+                "top": 712, 
+                "left": 2623.5
+            }, 
+            "tool_state": "{\"__page__\": null, \"guideSequence\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"blast_tab\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"sequences\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", 
+            "label": "Generate CDS from contigs", 
+            "type": "tool", 
+            "id": 14, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "7d96b28eec49", 
+                "name": "blast_to_scaffold", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "blast_to_scaffold"
+        }, 
+        "1": {
+            "tool_id": null, 
+            "errors": null, 
+            "uuid": "68cba64d-21d7-4c09-913d-4c60f3795f79", 
+            "tool_version": null, 
+            "outputs": [], 
+            "workflow_outputs": [
+                {
+                    "output_name": "output", 
+                    "uuid": "df1e8958-4add-4e17-bba7-895109f90a44", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": null, 
+            "input_connections": {}, 
+            "inputs": [], 
+            "position": {
+                "top": 1019.9833374023438, 
+                "left": 1100.9666748046875
+            }, 
+            "tool_state": "{}", 
+            "label": "viral nucleotide BLAST database (V2)", 
+            "type": "data_input", 
+            "id": 1, 
+            "name": "Input dataset"
+        }, 
+        "0": {
+            "tool_id": null, 
+            "errors": null, 
+            "uuid": "4990feb7-8714-4396-b3d6-0257dde2a990", 
+            "tool_version": null, 
+            "outputs": [], 
+            "workflow_outputs": [
+                {
+                    "output_name": "output", 
+                    "uuid": "5c8ddaaf-cd52-43c6-a5ac-db5e6e3e6178", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": null, 
+            "input_connections": {}, 
+            "inputs": [], 
+            "position": {
+                "top": 271, 
+                "left": 201
+            }, 
+            "tool_state": "{\"collection_type\": \"list\"}", 
+            "label": "Fastq files", 
+            "type": "data_collection_input", 
+            "id": 0, 
+            "name": "Input dataset collection"
+        }, 
+        "3": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/yac_clipper/yac/2.3.0", 
+            "errors": null, 
+            "uuid": "8b5672f2-2fc7-4699-b575-8fe1c4bc29d5", 
+            "tool_version": null, 
+            "outputs": [
+                {
+                    "type": "input", 
+                    "name": "output"
+                }
+            ], 
+            "post_job_actions": {}, 
+            "workflow_outputs": [
+                {
+                    "output_name": "output", 
+                    "uuid": "93edc567-2024-4a3b-9e72-11e4c959cc7b", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/yac_clipper/yac/2.3.0", 
+            "input_connections": {
+                "input": {
+                    "output_name": "output", 
+                    "id": 0
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "input", 
+                    "description": "runtime parameter for tool Clip adapter"
+                }
+            ], 
+            "position": {
+                "top": 387, 
+                "left": 380.5
+            }, 
+            "tool_state": "{\"out_format\": \"\\\"fasta\\\"\", \"__page__\": null, \"min\": \"\\\"18\\\"\", \"max\": \"\\\"30\\\"\", \"__rerun_remap_job_id__\": null, \"clip_source\": \"{\\\"__current_case__\\\": 0, \\\"clip_sequence\\\": \\\"CTGTAGGCACCATCAATCGT\\\", \\\"clip_source_list\\\": \\\"prebuilt\\\"}\", \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"Nmode\": \"\\\"reject\\\"\"}", 
+            "label": null, 
+            "type": "tool", 
+            "id": 3, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "f7947c5a18b8", 
+                "name": "yac_clipper", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Clip adapter"
+        }, 
+        "2": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/2.3.0", 
+            "errors": null, 
+            "uuid": "89405cc9-34dc-4f78-898e-b0c3dffaff7e", 
+            "tool_version": null, 
+            "outputs": [
+                {
+                    "type": "fasta", 
+                    "name": "outfile"
+                }, 
+                {
+                    "type": "txt", 
+                    "name": "logfile"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionlogfile": {
+                    "output_name": "logfile", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "outfile", 
+                    "uuid": "38b83b38-d72f-4ca9-9265-48f345b1a7db", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/2.3.0", 
+            "input_connections": {}, 
+            "inputs": [], 
+            "position": {
+                "top": 1012, 
+                "left": 1678
+            }, 
+            "tool_state": "{\"__page__\": null, \"__rerun_remap_job_id__\": null, \"queryString\": \"\\\"${ncbi_guide_ID}\\\"\", \"dbname\": \"\\\"nuccore\\\"\", \"dry_run\": \"\\\"false\\\"\"}", 
+            "label": null, 
+            "type": "tool", 
+            "id": 2, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "c667d0ee39f5", 
+                "name": "fetch_fasta_from_ncbi", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Retrieve FASTA from NCBI"
+        }, 
+        "5": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", 
+            "errors": null, 
+            "uuid": "a82a17e4-dce3-4634-81fd-ee68b15ecebb", 
+            "tool_version": null, 
+            "outputs": [
+                {
+                    "type": "input", 
+                    "name": "paired_output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "list_output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "out_file1"
+                }, 
+                {
+                    "type": "_sniff_", 
+                    "name": "paired_out_file"
+                }
+            ], 
+            "post_job_actions": {
+                "ChangeDatatypeActionout_file1": {
+                    "output_name": "out_file1", 
+                    "action_type": "ChangeDatatypeAction", 
+                    "action_arguments": {
+                        "newtype": "fasta"
+                    }
+                }, 
+                "HideDatasetActionpaired_out_file": {
+                    "output_name": "paired_out_file", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionpaired_output": {
+                    "output_name": "paired_output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionout_file1": {
+                    "output_name": "out_file1", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionlist_output": {
+                    "output_name": "list_output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", 
+            "input_connections": {
+                "global_condition|inputs": {
+                    "output_name": "output", 
+                    "id": 3
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "global_condition", 
+                    "description": "runtime parameter for tool Concatenate multiple datasets"
+                }
+            ], 
+            "position": {
+                "top": 526.5, 
+                "left": 461
+            }, 
+            "tool_state": "{\"dataset_names\": \"\\\"false\\\"\", \"headers\": \"\\\"0\\\"\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"global_condition\": \"{\\\"__current_case__\\\": 0, \\\"input_type\\\": \\\"singles\\\", \\\"inputs\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\"}", 
+            "label": "Concatenate read files", 
+            "type": "tool", 
+            "id": 5, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "55cf9d9defd1", 
+                "name": "concatenate_multiple_datasets", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Concatenate multiple datasets"
+        }, 
+        "4": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_makeblastdb/0.3.1", 
+            "errors": null, 
+            "uuid": "b4ebabff-c96a-47d6-adac-152a789e8aae", 
+            "tool_version": null, 
+            "outputs": [
+                {
+                    "type": "data", 
+                    "name": "outfile"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionoutfile": {
+                    "output_name": "outfile", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "RenameDatasetActionoutfile": {
+                    "output_name": "outfile", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "#{input_file} blast database"
+                    }
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_makeblastdb/0.3.1", 
+            "input_connections": {
+                "input_file": {
+                    "output_name": "outfile", 
+                    "id": 2
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "mask_data_file", 
+                    "description": "runtime parameter for tool NCBI BLAST+ makeblastdb"
+                }, 
+                {
+                    "name": "input_file", 
+                    "description": "runtime parameter for tool NCBI BLAST+ makeblastdb"
+                }
+            ], 
+            "position": {
+                "top": 1103, 
+                "left": 1995.5
+            }, 
+            "tool_state": "{\"__page__\": null, \"mask_data_file\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"input_file\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"dbtype\": \"\\\"nucl\\\"\", \"__rerun_remap_job_id__\": null, \"hash_index\": \"\\\"true\\\"\", \"tax\": \"{\\\"__current_case__\\\": 0, \\\"taxselect\\\": \\\"\\\"}\", \"title\": \"\\\"Blastn candidate database\\\"\", \"parse_seqids\": \"\\\"false\\\"\"}", 
+            "label": null, 
+            "type": "tool", 
+            "id": 4, 
+            "tool_shed_repository": {
+                "owner": "devteam", 
+                "changeset_revision": "e25d3acf6e68", 
+                "name": "ncbi_blast_plus", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "NCBI BLAST+ makeblastdb"
+        }, 
+        "7": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", 
+            "errors": null, 
+            "uuid": "d629ec7d-cd30-4a3f-96b6-e80cfeb879e7", 
+            "tool_version": null, 
+            "outputs": [
+                {
+                    "type": "input", 
+                    "name": "paired_output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "list_output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "out_file1"
+                }, 
+                {
+                    "type": "_sniff_", 
+                    "name": "paired_out_file"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionpaired_out_file": {
+                    "output_name": "paired_out_file", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionpaired_output": {
+                    "output_name": "paired_output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionlist_output": {
+                    "output_name": "list_output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionout_file1": {
+                    "output_name": "out_file1", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "ChangeDatatypeActionout_file1": {
+                    "output_name": "out_file1", 
+                    "action_type": "ChangeDatatypeAction", 
+                    "action_arguments": {
+                        "newtype": "fasta"
+                    }
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", 
+            "input_connections": {
+                "global_condition|inputs": {
+                    "output_name": "sequences", 
+                    "id": 6
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "global_condition", 
+                    "description": "runtime parameter for tool Concatenate multiple datasets"
+                }
+            ], 
+            "position": {
+                "top": 662.5, 
+                "left": 901
+            }, 
+            "tool_state": "{\"dataset_names\": \"\\\"false\\\"\", \"headers\": \"\\\"0\\\"\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"global_condition\": \"{\\\"__current_case__\\\": 0, \\\"input_type\\\": \\\"singles\\\", \\\"inputs\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\"}", 
+            "label": null, 
+            "type": "tool", 
+            "id": 7, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "55cf9d9defd1", 
+                "name": "concatenate_multiple_datasets", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Concatenate multiple datasets"
+        }, 
+        "6": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/khmer_normalize_by_median/khmer_normalize_by_median/3.0.0a1.0", 
+            "errors": null, 
+            "uuid": "0346546e-1850-45af-9434-e4dd04aacfa4", 
+            "tool_version": null, 
+            "outputs": [
+                {
+                    "type": "input", 
+                    "name": "sequences"
+                }, 
+                {
+                    "type": "oxlicg", 
+                    "name": "countgraph"
+                }, 
+                {
+                    "type": "txt", 
+                    "name": "report"
+                }
+            ], 
+            "post_job_actions": {
+                "ChangeDatatypeActionreport": {
+                    "output_name": "report", 
+                    "action_type": "ChangeDatatypeAction", 
+                    "action_arguments": {
+                        "newtype": "txt"
+                    }
+                }, 
+                "HideDatasetActioncountgraph": {
+                    "output_name": "countgraph", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionreport": {
+                    "output_name": "report", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "ChangeDatatypeActionsequences": {
+                    "output_name": "sequences", 
+                    "action_type": "ChangeDatatypeAction", 
+                    "action_arguments": {
+                        "newtype": "fasta"
+                    }
+                }, 
+                "ChangeDatatypeActioncountgraph": {
+                    "output_name": "countgraph", 
+                    "action_type": "ChangeDatatypeAction", 
+                    "action_arguments": {
+                        "newtype": "oxlicg"
+                    }
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "sequences", 
+                    "uuid": "a2012bb4-0789-4ed4-978e-96ec206a5913", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/khmer_normalize_by_median/khmer_normalize_by_median/3.0.0a1.0", 
+            "input_connections": {
+                "inputs": {
+                    "output_name": "out_file1", 
+                    "id": 5
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "inputs", 
+                    "description": "runtime parameter for tool Normalize By Median"
+                }, 
+                {
+                    "name": "countgraph_to_load", 
+                    "description": "runtime parameter for tool Normalize By Median"
+                }, 
+                {
+                    "name": "unpaired_reads_filename", 
+                    "description": "runtime parameter for tool Normalize By Median"
+                }
+            ], 
+            "position": {
+                "top": 744.5, 
+                "left": 579
+            }, 
+            "tool_state": "{\"force_single_switch\": \"\\\"true\\\"\", \"inputs\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"save_countgraph\": \"\\\"false\\\"\", \"parameters\": \"{\\\"__current_case__\\\": 0, \\\"tablesize\\\": \\\"2e9\\\", \\\"type\\\": \\\"simple\\\"}\", \"cutoff\": \"\\\"20\\\"\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"paired_switch\": \"\\\"false\\\"\", \"countgraph_to_load\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"unpaired_reads_filename\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", 
+            "label": "Remove redundant reads", 
+            "type": "tool", 
+            "id": 6, 
+            "tool_shed_repository": {
+                "owner": "iuc", 
+                "changeset_revision": "bfd859f04a89", 
+                "name": "khmer_normalize_by_median", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Normalize By Median"
+        }, 
+        "9": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/oases/oasesoptimiserv/1.2.2", 
+            "errors": null, 
+            "uuid": "05794519-ba8f-4817-8c33-ce1c4452f557", 
+            "tool_version": null, 
+            "outputs": [
+                {
+                    "type": "fasta", 
+                    "name": "transcripts"
+                }
+            ], 
+            "post_job_actions": {
+                "ChangeDatatypeActiontranscripts": {
+                    "output_name": "transcripts", 
+                    "action_type": "ChangeDatatypeAction", 
+                    "action_arguments": {
+                        "newtype": "fasta"
+                    }
+                }, 
+                "RenameDatasetActiontranscripts": {
+                    "output_name": "transcripts", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Oases Contigs"
+                    }
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "transcripts", 
+                    "uuid": "90fcc558-0d52-44ac-a7b0-85da6914cb8f", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/oases/oasesoptimiserv/1.2.2", 
+            "input_connections": {
+                "inputs_0|input": {
+                    "output_name": "unaligned", 
+                    "id": 8
+                }
+            }, 
+            "inputs": [], 
+            "position": {
+                "top": 512, 
+                "left": 1259
+            }, 
+            "tool_state": "{\"__page__\": null, \"inputs\": \"[{\\\"__index__\\\": 0, \\\"input\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}]\", \"end_hash_length\": \"\\\"29\\\"\", \"__rerun_remap_job_id__\": null, \"start_hash_length\": \"\\\"13\\\"\"}", 
+            "label": "Assemble contigs", 
+            "type": "tool", 
+            "id": 9, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "f7dd852c8f4c", 
+                "name": "oases", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Oases_optimiser"
+        }, 
+        "8": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1", 
+            "errors": null, 
+            "uuid": "f08e7884-ca1f-4674-b0b4-157c65748103", 
+            "tool_version": null, 
+            "outputs": [
+                {
+                    "type": "tabular", 
+                    "name": "output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "aligned"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "unaligned"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionoutput": {
+                    "output_name": "output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionaligned": {
+                    "output_name": "aligned", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "RenameDatasetActionunaligned": {
+                    "output_name": "unaligned", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Non D. melanogaster sequences"
+                    }
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "unaligned", 
+                    "uuid": "115bf016-344b-473f-a108-ac88267c3790", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1", 
+            "input_connections": {
+                "input": {
+                    "output_name": "out_file1", 
+                    "id": 7
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "input", 
+                    "description": "runtime parameter for tool sR_bowtie"
+                }
+            ], 
+            "position": {
+                "top": 424, 
+                "left": 949
+            }, 
+            "tool_state": "{\"__page__\": null, \"output_format\": \"\\\"tabular\\\"\", \"v_mismatches\": \"\\\"2\\\"\", \"additional_fasta\": \"\\\"unal\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"refGenomeSource\": \"{\\\"__current_case__\\\": 0, \\\"genomeSource\\\": \\\"indexed\\\", \\\"index\\\": \\\"dm6\\\"}\", \"method\": \"\\\"k_option\\\"\"}", 
+            "label": "Align reads to host", 
+            "type": "tool", 
+            "id": 8, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "0281bb245635", 
+                "name": "sr_bowtie", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "sR_bowtie"
+        }
+    }, 
+    "annotation": "", 
+    "name": "Metavisitor: Workflow for Use Case 1-3"
+}
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_1-4.ga	Sun Jul 21 19:22:52 2019 -0400
@@ -0,0 +1,538 @@
+{
+    "a_galaxy_workflow": "true", 
+    "uuid": "c87376ff-1e6d-47a3-ad9a-2defc67e5f7d", 
+    "tags": [], 
+    "format-version": "0.1", 
+    "version": 2, 
+    "steps": {
+        "1": {
+            "tool_id": null, 
+            "errors": null, 
+            "uuid": "462eb78f-9844-42d6-8087-19f2e1e801ca", 
+            "tool_version": null, 
+            "outputs": [], 
+            "workflow_outputs": [
+                {
+                    "output_name": "output", 
+                    "uuid": "6bd2d24e-e12f-41fe-9308-631cc6718143", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": null, 
+            "input_connections": {}, 
+            "inputs": [], 
+            "position": {
+                "top": 799.9833374023438, 
+                "left": 1109.9666748046875
+            }, 
+            "tool_state": "{}", 
+            "label": "viral nucleotide BLAST database (V2)", 
+            "type": "data_input", 
+            "id": 1, 
+            "name": "Input dataset"
+        }, 
+        "0": {
+            "tool_id": null, 
+            "errors": null, 
+            "uuid": "aa5c2a9c-0f52-4884-9f1c-74432b24af61", 
+            "tool_version": null, 
+            "outputs": [], 
+            "workflow_outputs": [
+                {
+                    "output_name": "output", 
+                    "uuid": "b5da90b2-1c4f-4646-8c70-fc9952f6cb94", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": null, 
+            "input_connections": {}, 
+            "inputs": [], 
+            "position": {
+                "top": 597, 
+                "left": 298
+            }, 
+            "tool_state": "{\"collection_type\": \"list\"}", 
+            "label": null, 
+            "type": "data_collection_input", 
+            "id": 0, 
+            "name": "Input dataset collection"
+        }, 
+        "3": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", 
+            "errors": null, 
+            "uuid": "31d99ab7-8eb2-458c-82bd-b8c90e8689a5", 
+            "tool_version": "1.4.1", 
+            "outputs": [
+                {
+                    "type": "input", 
+                    "name": "paired_output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "list_output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "out_file1"
+                }, 
+                {
+                    "type": "_sniff_", 
+                    "name": "paired_out_file"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionpaired_out_file": {
+                    "output_name": "paired_out_file", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionout_file1": {
+                    "output_name": "out_file1", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionlist_output": {
+                    "output_name": "list_output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionpaired_output": {
+                    "output_name": "paired_output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", 
+            "input_connections": {
+                "global_condition|inputs": {
+                    "output_name": "output", 
+                    "id": 2
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "global_condition", 
+                    "description": "runtime parameter for tool Concatenate multiple datasets"
+                }
+            ], 
+            "position": {
+                "top": 539.5, 
+                "left": 568
+            }, 
+            "tool_state": "{\"dataset_names\": \"\\\"false\\\"\", \"headers\": \"\\\"0\\\"\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"global_condition\": \"{\\\"__current_case__\\\": 0, \\\"input_type\\\": \\\"singles\\\", \\\"inputs\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\"}", 
+            "label": null, 
+            "type": "tool", 
+            "id": 3, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "55cf9d9defd1", 
+                "name": "concatenate_multiple_datasets", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Concatenate multiple datasets"
+        }, 
+        "2": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/yac_clipper/yac/2.3.0", 
+            "errors": null, 
+            "uuid": "41212793-f400-4bd6-9827-c083025f3e01", 
+            "tool_version": "2.3.0", 
+            "outputs": [
+                {
+                    "type": "input", 
+                    "name": "output"
+                }
+            ], 
+            "post_job_actions": {
+                "RenameDatasetActionoutput": {
+                    "output_name": "output", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "#{input} clipped"
+                    }
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "output", 
+                    "uuid": "2f70387c-80f0-47d5-86ac-ec54a6349f0d", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/yac_clipper/yac/2.3.0", 
+            "input_connections": {
+                "input": {
+                    "output_name": "output", 
+                    "id": 0
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "input", 
+                    "description": "runtime parameter for tool Clip adapter"
+                }
+            ], 
+            "position": {
+                "top": 782, 
+                "left": 429.5
+            }, 
+            "tool_state": "{\"out_format\": \"\\\"fasta\\\"\", \"__page__\": null, \"min\": \"\\\"18\\\"\", \"max\": \"\\\"30\\\"\", \"__rerun_remap_job_id__\": null, \"clip_source\": \"{\\\"__current_case__\\\": 0, \\\"clip_sequence\\\": \\\"CTGTAGGCACCATCAATCGT\\\", \\\"clip_source_list\\\": \\\"prebuilt\\\"}\", \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"Nmode\": \"\\\"reject\\\"\"}", 
+            "label": null, 
+            "type": "tool", 
+            "id": 2, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "f7947c5a18b8", 
+                "name": "yac_clipper", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Clip adapter"
+        }, 
+        "5": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1", 
+            "errors": null, 
+            "uuid": "0094651e-e2dc-4932-87eb-9f1292b85bbf", 
+            "tool_version": "2.1.1", 
+            "outputs": [
+                {
+                    "type": "tabular", 
+                    "name": "output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "aligned"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "unaligned"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionaligned": {
+                    "output_name": "aligned", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionoutput": {
+                    "output_name": "output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "RenameDatasetActionunaligned": {
+                    "output_name": "unaligned", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Non D. melanogaster sequences"
+                    }
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "unaligned", 
+                    "uuid": "5fdb9817-061d-438b-8605-95b63d290655", 
+                    "label": null
+                }
+            ], 
+            "annotation": "Get non-host reads", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1", 
+            "input_connections": {
+                "input": {
+                    "output_name": "output", 
+                    "id": 4
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "input", 
+                    "description": "runtime parameter for tool sR_bowtie"
+                }
+            ], 
+            "position": {
+                "top": 574, 
+                "left": 876
+            }, 
+            "tool_state": "{\"__page__\": null, \"output_format\": \"\\\"tabular\\\"\", \"v_mismatches\": \"\\\"2\\\"\", \"additional_fasta\": \"\\\"unal\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"refGenomeSource\": \"{\\\"__current_case__\\\": 0, \\\"genomeSource\\\": \\\"indexed\\\", \\\"index\\\": \\\"dm6\\\"}\", \"method\": \"\\\"k_option\\\"\"}", 
+            "label": "Align to host genome", 
+            "type": "tool", 
+            "id": 5, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "0281bb245635", 
+                "name": "sr_bowtie", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "sR_bowtie"
+        }, 
+        "4": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/sequence_format_converter/sequence_format_converter/2.1.1", 
+            "errors": null, 
+            "uuid": "a82646ef-d5fe-4e6b-b294-19005c9973e4", 
+            "tool_version": "2.1.1", 
+            "outputs": [
+                {
+                    "type": "fasta", 
+                    "name": "output"
+                }
+            ], 
+            "post_job_actions": {
+                "RenameDatasetActionoutput": {
+                    "output_name": "output", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Initial Clipped sequences"
+                    }
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "output", 
+                    "uuid": "a2474d73-a111-4675-b236-df907b7dbf1a", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/sequence_format_converter/sequence_format_converter/2.1.1", 
+            "input_connections": {
+                "input": {
+                    "output_name": "out_file1", 
+                    "id": 3
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "input", 
+                    "description": "runtime parameter for tool sequence_format_converter"
+                }
+            ], 
+            "position": {
+                "top": 804, 
+                "left": 720.5
+            }, 
+            "tool_state": "{\"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"output_format\": \"\\\"fastaw\\\"\", \"__rerun_remap_job_id__\": null, \"__page__\": null}", 
+            "label": "Collapse reads", 
+            "type": "tool", 
+            "id": 4, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "f1d59113125a", 
+                "name": "sequence_format_converter", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "sequence_format_converter"
+        }, 
+        "7": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.3.1", 
+            "errors": null, 
+            "uuid": "37904c73-85c7-40e8-b1d5-e5f3d6a12135", 
+            "tool_version": "0.3.1", 
+            "outputs": [
+                {
+                    "type": "tabular", 
+                    "name": "output1"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionoutput1": {
+                    "output_name": "output1", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.3.1", 
+            "input_connections": {
+                "query": {
+                    "output_name": "transcripts", 
+                    "id": 6
+                }, 
+                "db_opts|histdb": {
+                    "output_name": "output", 
+                    "id": 1
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "db_opts", 
+                    "description": "runtime parameter for tool NCBI BLAST+ blastn"
+                }, 
+                {
+                    "name": "query", 
+                    "description": "runtime parameter for tool NCBI BLAST+ blastn"
+                }
+            ], 
+            "position": {
+                "top": 782, 
+                "left": 1340
+            }, 
+            "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"__current_case__\\\": 2, \\\"ext_cols\\\": [\\\"slen\\\"], \\\"ids_cols\\\": null, \\\"misc_cols\\\": null, \\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"tax_cols\\\": null}\", \"adv_opts\": \"{\\\"__current_case__\\\": 1, \\\"adv_optional_id_files_opts\\\": {\\\"__current_case__\\\": 0, \\\"adv_optional_id_files_opts_selector\\\": \\\"none\\\"}, \\\"adv_opts_selector\\\": \\\"advanced\\\", \\\"filter_query\\\": \\\"true\\\", \\\"gapextend\\\": \\\"\\\", \\\"gapopen\\\": \\\"\\\", \\\"identity_cutoff\\\": \\\"0.0\\\", \\\"max_hits\\\": \\\"5\\\", \\\"max_hsps\\\": \\\"\\\", \\\"parse_deflines\\\": \\\"false\\\", \\\"qcov_hsp_perc\\\": \\\"0.0\\\", \\\"strand\\\": \\\"-strand both\\\", \\\"ungapped\\\": \\\"false\\\", \\\"window_size\\\": \\\"\\\", \\\"word_size\\\": \\\"\\\"}\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"db_opts\": \"{\\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\", \\\"db_opts_selector\\\": \\\"histdb\\\", \\\"histdb\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"subject\\\": \\\"\\\"}\", \"blast_type\": \"\\\"blastn\\\"\", \"query\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", 
+            "label": "Blast assembled reads to vir2", 
+            "type": "tool", 
+            "id": 7, 
+            "tool_shed_repository": {
+                "owner": "devteam", 
+                "changeset_revision": "e25d3acf6e68", 
+                "name": "ncbi_blast_plus", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "NCBI BLAST+ blastn"
+        }, 
+        "6": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/oases/oasesoptimiserv/1.2.2", 
+            "errors": null, 
+            "uuid": "04b99c48-2bf7-4842-b28e-c9085ffe40e9", 
+            "tool_version": "1.2.2", 
+            "outputs": [
+                {
+                    "type": "fasta", 
+                    "name": "transcripts"
+                }
+            ], 
+            "post_job_actions": {
+                "ChangeDatatypeActiontranscripts": {
+                    "output_name": "transcripts", 
+                    "action_type": "ChangeDatatypeAction", 
+                    "action_arguments": {
+                        "newtype": "fasta"
+                    }
+                }, 
+                "RenameDatasetActiontranscripts": {
+                    "output_name": "transcripts", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Oases Contigs"
+                    }
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "transcripts", 
+                    "uuid": "704bb7a9-199c-4028-a482-ebc60ab1d02e", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/oases/oasesoptimiserv/1.2.2", 
+            "input_connections": {
+                "inputs_0|input": {
+                    "output_name": "unaligned", 
+                    "id": 5
+                }
+            }, 
+            "inputs": [], 
+            "position": {
+                "top": 623, 
+                "left": 1167
+            }, 
+            "tool_state": "{\"__page__\": null, \"inputs\": \"[{\\\"__index__\\\": 0, \\\"input\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}]\", \"end_hash_length\": \"\\\"29\\\"\", \"__rerun_remap_job_id__\": null, \"start_hash_length\": \"\\\"13\\\"\"}", 
+            "label": "Assemble reads", 
+            "type": "tool", 
+            "id": 6, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "f7dd852c8f4c", 
+                "name": "oases", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Oases_optimiser"
+        }, 
+        "8": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/blastparser_and_hits/BlastParser_and_hits/2.6.1", 
+            "errors": null, 
+            "uuid": "bbbbec1e-cc46-4b89-aa5c-3213562ae405", 
+            "tool_version": "2.6.1", 
+            "outputs": [
+                {
+                    "type": "tabular", 
+                    "name": "tabularOutput"
+                }, 
+                {
+                    "type": "fasta", 
+                    "name": "fastaOutput"
+                }, 
+                {
+                    "type": "fasta", 
+                    "name": "al_sequences"
+                }, 
+                {
+                    "type": "fasta", 
+                    "name": "un_sequences"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActional_sequences": {
+                    "output_name": "al_sequences", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "RenameDatasetActiontabularOutput": {
+                    "output_name": "tabularOutput", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Blastn assembled reads vs vir2"
+                    }
+                }, 
+                "HideDatasetActionun_sequences": {
+                    "output_name": "un_sequences", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionfastaOutput": {
+                    "output_name": "fastaOutput", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "tabularOutput", 
+                    "uuid": "f73c0a89-1b19-4dd5-843f-3c7c68d13338", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/blastparser_and_hits/BlastParser_and_hits/2.6.1", 
+            "input_connections": {
+                "blast": {
+                    "output_name": "output1", 
+                    "id": 7
+                }, 
+                "sequences": {
+                    "output_name": "transcripts", 
+                    "id": 6
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "blast", 
+                    "description": "runtime parameter for tool Parse blast output and compile hits"
+                }, 
+                {
+                    "name": "sequences", 
+                    "description": "runtime parameter for tool Parse blast output and compile hits"
+                }
+            ], 
+            "position": {
+                "top": 579, 
+                "left": 1652
+            }, 
+            "tool_state": "{\"__page__\": null, \"flanking\": \"\\\"5\\\"\", \"additional_filters\": \"{\\\"__current_case__\\\": 0, \\\"use_filters\\\": \\\"no\\\"}\", \"__rerun_remap_job_id__\": null, \"mode\": \"\\\"short\\\"\", \"sequences\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"blast\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", 
+            "label": null, 
+            "type": "tool", 
+            "id": 8, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "b4c9c085d709", 
+                "name": "blastparser_and_hits", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Parse blast output and compile hits"
+        }
+    }, 
+    "annotation": "", 
+    "name": "Metavisitor: Workflow for Use Case 1-4"
+}
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_2-1.ga	Sun Jul 21 19:22:52 2019 -0400
@@ -0,0 +1,1315 @@
+{
+    "a_galaxy_workflow": "true", 
+    "uuid": "1a62d2ab-f807-4210-a42b-787a997a7c68", 
+    "tags": [], 
+    "format-version": "0.1", 
+    "version": 2, 
+    "steps": {
+        "11": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1", 
+            "errors": null, 
+            "uuid": "25858b99-1fc3-420e-b26a-c26284f326b4", 
+            "tool_version": "2.1.1", 
+            "outputs": [
+                {
+                    "type": "tabular", 
+                    "name": "output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "aligned"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "unaligned"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionunaligned": {
+                    "output_name": "unaligned", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionoutput": {
+                    "output_name": "output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionaligned": {
+                    "output_name": "aligned", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "RenameDatasetActionunaligned": {
+                    "output_name": "unaligned", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Unaligned PhiX174"
+                    }
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "Get non PhiX174 rteads", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1", 
+            "input_connections": {
+                "input": {
+                    "output_name": "unaligned", 
+                    "id": 10
+                }, 
+                "refGenomeSource|ownFile": {
+                    "output_name": "output", 
+                    "id": 2
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "input", 
+                    "description": "runtime parameter for tool sR_bowtie"
+                }, 
+                {
+                    "name": "refGenomeSource", 
+                    "description": "runtime parameter for tool sR_bowtie"
+                }
+            ], 
+            "position": {
+                "top": 621, 
+                "left": 1390
+            }, 
+            "tool_state": "{\"__page__\": null, \"output_format\": \"\\\"tabular\\\"\", \"v_mismatches\": \"\\\"2\\\"\", \"additional_fasta\": \"\\\"unal\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"refGenomeSource\": \"{\\\"__current_case__\\\": 1, \\\"genomeSource\\\": \\\"history\\\", \\\"ownFile\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\", \"method\": \"\\\"k_option\\\"\"}", 
+            "label": "Align to PhiX174", 
+            "type": "tool", 
+            "id": 11, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "0281bb245635", 
+                "name": "sr_bowtie", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "sR_bowtie"
+        }, 
+        "10": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1", 
+            "errors": null, 
+            "uuid": "1be6a79b-2f76-4ed7-b646-333b32cf4f1c", 
+            "tool_version": "2.1.1", 
+            "outputs": [
+                {
+                    "type": "tabular", 
+                    "name": "output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "aligned"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "unaligned"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionunaligned": {
+                    "output_name": "unaligned", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionaligned": {
+                    "output_name": "aligned", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionoutput": {
+                    "output_name": "output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "RenameDatasetActionunaligned": {
+                    "output_name": "unaligned", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "unmatched Plasmodium Berghei"
+                    }
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "Get non P. berghei reads", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1", 
+            "input_connections": {
+                "input": {
+                    "output_name": "unaligned", 
+                    "id": 9
+                }, 
+                "refGenomeSource|ownFile": {
+                    "output_name": "output", 
+                    "id": 1
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "input", 
+                    "description": "runtime parameter for tool sR_bowtie"
+                }, 
+                {
+                    "name": "refGenomeSource", 
+                    "description": "runtime parameter for tool sR_bowtie"
+                }
+            ], 
+            "position": {
+                "top": 422, 
+                "left": 1387
+            }, 
+            "tool_state": "{\"__page__\": null, \"output_format\": \"\\\"tabular\\\"\", \"v_mismatches\": \"\\\"2\\\"\", \"additional_fasta\": \"\\\"unal\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"refGenomeSource\": \"{\\\"__current_case__\\\": 1, \\\"genomeSource\\\": \\\"history\\\", \\\"ownFile\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\", \"method\": \"\\\"k_option\\\"\"}", 
+            "label": "Align to P. berghei", 
+            "type": "tool", 
+            "id": 10, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "0281bb245635", 
+                "name": "sr_bowtie", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "sR_bowtie"
+        }, 
+        "13": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastx_wrapper/0.3.1", 
+            "errors": null, 
+            "uuid": "ef6dcb1b-f0e2-4b08-8cca-db32d4a2a46b", 
+            "tool_version": "0.3.1", 
+            "outputs": [
+                {
+                    "type": "tabular", 
+                    "name": "output1"
+                }
+            ], 
+            "post_job_actions": {}, 
+            "workflow_outputs": [
+                {
+                    "output_name": "output1", 
+                    "uuid": "1b6bd5a4-2f7b-45ff-8688-00d88bcf34ab", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastx_wrapper/0.3.1", 
+            "input_connections": {
+                "query": {
+                    "output_name": "transcripts", 
+                    "id": 12
+                }, 
+                "db_opts|histdb": {
+                    "output_name": "output", 
+                    "id": 3
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "db_opts", 
+                    "description": "runtime parameter for tool NCBI BLAST+ blastx"
+                }, 
+                {
+                    "name": "query", 
+                    "description": "runtime parameter for tool NCBI BLAST+ blastx"
+                }
+            ], 
+            "position": {
+                "top": 512, 
+                "left": 2011.5
+            }, 
+            "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"__current_case__\\\": 2, \\\"ext_cols\\\": [\\\"slen\\\"], \\\"ids_cols\\\": null, \\\"misc_cols\\\": null, \\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"tax_cols\\\": null}\", \"adv_opts\": \"{\\\"__current_case__\\\": 0, \\\"adv_opts_selector\\\": \\\"basic\\\"}\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"db_opts\": \"{\\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\", \\\"db_opts_selector\\\": \\\"histdb\\\", \\\"histdb\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"subject\\\": \\\"\\\"}\", \"query_gencode\": \"\\\"1\\\"\", \"blast_type\": \"\\\"blastx\\\"\", \"query\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", 
+            "label": "Blast contigs to vir2", 
+            "type": "tool", 
+            "id": 13, 
+            "tool_shed_repository": {
+                "owner": "devteam", 
+                "changeset_revision": "e25d3acf6e68", 
+                "name": "ncbi_blast_plus", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "NCBI BLAST+ blastx"
+        }, 
+        "12": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/oases/oasesoptimiserv/1.2.2", 
+            "errors": null, 
+            "uuid": "57290980-ede3-434e-a4ae-0f4b0c8c7fb6", 
+            "tool_version": "1.2.2", 
+            "outputs": [
+                {
+                    "type": "fasta", 
+                    "name": "transcripts"
+                }
+            ], 
+            "post_job_actions": {
+                "RenameDatasetActiontranscripts": {
+                    "output_name": "transcripts", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Oases Contigs"
+                    }
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "transcripts", 
+                    "uuid": "c9e506a0-bff1-45e3-832b-d281202405d0", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/oases/oasesoptimiserv/1.2.2", 
+            "input_connections": {
+                "inputs_0|input": {
+                    "output_name": "unaligned", 
+                    "id": 11
+                }
+            }, 
+            "inputs": [], 
+            "position": {
+                "top": 371, 
+                "left": 1807
+            }, 
+            "tool_state": "{\"__page__\": null, \"inputs\": \"[{\\\"__index__\\\": 0, \\\"input\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}]\", \"end_hash_length\": \"\\\"29\\\"\", \"__rerun_remap_job_id__\": null, \"start_hash_length\": \"\\\"13\\\"\"}", 
+            "label": "Assemble contigs", 
+            "type": "tool", 
+            "id": 12, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "f7dd852c8f4c", 
+                "name": "oases", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Oases_optimiser"
+        }, 
+        "15": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/cherry_pick_fasta/cherry_pick_fasta/1.0.0", 
+            "errors": null, 
+            "uuid": "e7bd9226-a562-4b93-822b-6611d816d419", 
+            "tool_version": "1.0.0", 
+            "outputs": [
+                {
+                    "type": "fasta", 
+                    "name": "output"
+                }
+            ], 
+            "post_job_actions": {
+                "RenameDatasetActionoutput": {
+                    "output_name": "output", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Assembled contigs matching Drosophila C virus"
+                    }
+                }, 
+                "HideDatasetActionoutput": {
+                    "output_name": "output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/cherry_pick_fasta/cherry_pick_fasta/1.0.0", 
+            "input_connections": {
+                "input": {
+                    "output_name": "fastaOutput", 
+                    "id": 14
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "input", 
+                    "description": "runtime parameter for tool Pick Fasta sequences"
+                }
+            ], 
+            "position": {
+                "top": 406, 
+                "left": 2656
+            }, 
+            "tool_state": "{\"__page__\": null, \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"query\": \"\\\"Drosophila_C_virus\\\"\"}", 
+            "label": "Get contigs matching Drosophila C virus", 
+            "type": "tool", 
+            "id": 15, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "e3aee4ba49c6", 
+                "name": "cherry_pick_fasta", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Pick Fasta sequences"
+        }, 
+        "14": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/blastparser_and_hits/BlastParser_and_hits/2.6.1", 
+            "errors": null, 
+            "uuid": "01cac8bc-ae6e-4eb8-9141-a797ed27bd92", 
+            "tool_version": "2.6.1", 
+            "outputs": [
+                {
+                    "type": "tabular", 
+                    "name": "tabularOutput"
+                }, 
+                {
+                    "type": "fasta", 
+                    "name": "fastaOutput"
+                }, 
+                {
+                    "type": "fasta", 
+                    "name": "al_sequences"
+                }, 
+                {
+                    "type": "fasta", 
+                    "name": "un_sequences"
+                }
+            ], 
+            "post_job_actions": {
+                "RenameDatasetActionfastaOutput": {
+                    "output_name": "fastaOutput", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Assembled contigs matching vir2 sequences"
+                    }
+                }, 
+                "HideDatasetActional_sequences": {
+                    "output_name": "al_sequences", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "RenameDatasetActiontabularOutput": {
+                    "output_name": "tabularOutput", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Assembled contigs matching vir2"
+                    }
+                }, 
+                "HideDatasetActionun_sequences": {
+                    "output_name": "un_sequences", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "tabularOutput", 
+                    "uuid": "379b9ff3-82b2-4bef-8642-7b7b0de22038", 
+                    "label": null
+                }, 
+                {
+                    "output_name": "fastaOutput", 
+                    "uuid": "ca0040e2-0505-4223-a642-f80239d3c151", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/blastparser_and_hits/BlastParser_and_hits/2.6.1", 
+            "input_connections": {
+                "blast": {
+                    "output_name": "output1", 
+                    "id": 13
+                }, 
+                "sequences": {
+                    "output_name": "transcripts", 
+                    "id": 12
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "blast", 
+                    "description": "runtime parameter for tool Parse blast output and compile hits"
+                }, 
+                {
+                    "name": "sequences", 
+                    "description": "runtime parameter for tool Parse blast output and compile hits"
+                }
+            ], 
+            "position": {
+                "top": 285, 
+                "left": 2298
+            }, 
+            "tool_state": "{\"__page__\": null, \"flanking\": \"\\\"5\\\"\", \"additional_filters\": \"{\\\"__current_case__\\\": 0, \\\"use_filters\\\": \\\"no\\\"}\", \"__rerun_remap_job_id__\": null, \"mode\": \"\\\"verbose\\\"\", \"sequences\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"blast\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", 
+            "label": null, 
+            "type": "tool", 
+            "id": 14, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "b4c9c085d709", 
+                "name": "blastparser_and_hits", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Parse blast output and compile hits"
+        }, 
+        "17": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", 
+            "errors": null, 
+            "uuid": "81a62b71-206d-4352-a892-cbd02eb44dd4", 
+            "tool_version": "1.4.1", 
+            "outputs": [
+                {
+                    "type": "input", 
+                    "name": "paired_output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "list_output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "out_file1"
+                }, 
+                {
+                    "type": "_sniff_", 
+                    "name": "paired_out_file"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionpaired_out_file": {
+                    "output_name": "paired_out_file", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionlist_output": {
+                    "output_name": "list_output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionout_file1": {
+                    "output_name": "out_file1", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionpaired_output": {
+                    "output_name": "paired_output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", 
+            "input_connections": {
+                "global_condition|inputs": [
+                    {
+                        "output_name": "output", 
+                        "id": 16
+                    }, 
+                    {
+                        "output_name": "output", 
+                        "id": 15
+                    }
+                ]
+            }, 
+            "inputs": [
+                {
+                    "name": "global_condition", 
+                    "description": "runtime parameter for tool Concatenate multiple datasets"
+                }
+            ], 
+            "position": {
+                "top": 447.5, 
+                "left": 2918
+            }, 
+            "tool_state": "{\"dataset_names\": \"\\\"false\\\"\", \"headers\": \"\\\"0\\\"\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"global_condition\": \"{\\\"__current_case__\\\": 0, \\\"input_type\\\": \\\"singles\\\", \\\"inputs\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\"}", 
+            "label": "Concatenate contigs files", 
+            "type": "tool", 
+            "id": 17, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "55cf9d9defd1", 
+                "name": "concatenate_multiple_datasets", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Concatenate multiple datasets"
+        }, 
+        "16": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/cherry_pick_fasta/cherry_pick_fasta/1.0.0", 
+            "errors": null, 
+            "uuid": "7353e15c-42b9-4c68-baa4-5cab9aca3538", 
+            "tool_version": "1.0.0", 
+            "outputs": [
+                {
+                    "type": "fasta", 
+                    "name": "output"
+                }
+            ], 
+            "post_job_actions": {
+                "RenameDatasetActionoutput": {
+                    "output_name": "output", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Assemble contigs matching cricket paralysis virus"
+                    }
+                }, 
+                "HideDatasetActionoutput": {
+                    "output_name": "output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/cherry_pick_fasta/cherry_pick_fasta/1.0.0", 
+            "input_connections": {
+                "input": {
+                    "output_name": "fastaOutput", 
+                    "id": 14
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "input", 
+                    "description": "runtime parameter for tool Pick Fasta sequences"
+                }
+            ], 
+            "position": {
+                "top": 541, 
+                "left": 2644
+            }, 
+            "tool_state": "{\"__page__\": null, \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"query\": \"\\\"Cricket_paralysis_virus\\\"\"}", 
+            "label": "Get contigs matching Cricket paralysis virus", 
+            "type": "tool", 
+            "id": 16, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "e3aee4ba49c6", 
+                "name": "cherry_pick_fasta", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Pick Fasta sequences"
+        }, 
+        "19": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_tblastx_wrapper/0.3.1", 
+            "errors": null, 
+            "uuid": "dfa7c520-7165-4160-bff8-007b7f8ed955", 
+            "tool_version": "0.3.1", 
+            "outputs": [
+                {
+                    "type": "tabular", 
+                    "name": "output1"
+                }
+            ], 
+            "post_job_actions": {
+                "RenameDatasetActionoutput1": {
+                    "output_name": "output1", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Contigs aligned to DCV"
+                    }
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "output1", 
+                    "uuid": "6ad6e088-d0ea-4d43-a697-27c0fb44b2bb", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_tblastx_wrapper/0.3.1", 
+            "input_connections": {
+                "query": {
+                    "output_name": "contigsandsinglets", 
+                    "id": 18
+                }, 
+                "db_opts|histdb": {
+                    "output_name": "outfile", 
+                    "id": 6
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "db_opts", 
+                    "description": "runtime parameter for tool NCBI BLAST+ tblastx"
+                }, 
+                {
+                    "name": "query", 
+                    "description": "runtime parameter for tool NCBI BLAST+ tblastx"
+                }
+            ], 
+            "position": {
+                "top": 619, 
+                "left": 3514.5
+            }, 
+            "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"__page__\": null, \"adv_opts\": \"{\\\"__current_case__\\\": 0, \\\"adv_opts_selector\\\": \\\"basic\\\"}\", \"__rerun_remap_job_id__\": null, \"db_opts\": \"{\\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\", \\\"db_opts_selector\\\": \\\"histdb\\\", \\\"histdb\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"subject\\\": \\\"\\\"}\", \"query_gencode\": \"\\\"1\\\"\", \"output\": \"{\\\"__current_case__\\\": 2, \\\"ext_cols\\\": [\\\"slen\\\"], \\\"ids_cols\\\": null, \\\"misc_cols\\\": null, \\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"tax_cols\\\": null}\", \"query\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", 
+            "label": "Align contigs against DCV using tblastx", 
+            "type": "tool", 
+            "id": 19, 
+            "tool_shed_repository": {
+                "owner": "devteam", 
+                "changeset_revision": "e25d3acf6e68", 
+                "name": "ncbi_blast_plus", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "NCBI BLAST+ tblastx"
+        }, 
+        "18": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/cap3/cap3/2.0.0", 
+            "errors": null, 
+            "uuid": "778af1ac-bb54-4ae0-b2c9-5c7ffcc932c2", 
+            "tool_version": "2.0.0", 
+            "outputs": [
+                {
+                    "type": "fasta", 
+                    "name": "contigsandsinglets"
+                }, 
+                {
+                    "type": "txt", 
+                    "name": "cap3stdout"
+                }, 
+                {
+                    "type": "fasta", 
+                    "name": "contigs"
+                }, 
+                {
+                    "type": "txt", 
+                    "name": "contigsqual"
+                }, 
+                {
+                    "type": "txt", 
+                    "name": "contigslink"
+                }, 
+                {
+                    "type": "txt", 
+                    "name": "ace"
+                }, 
+                {
+                    "type": "txt", 
+                    "name": "info"
+                }, 
+                {
+                    "type": "txt", 
+                    "name": "singlets"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActioninfo": {
+                    "output_name": "info", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActioncontigsqual": {
+                    "output_name": "contigsqual", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "RenameDatasetActioncontigsandsinglets": {
+                    "output_name": "contigsandsinglets", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "assemblies of Dicistroviridae hits"
+                    }
+                }, 
+                "HideDatasetActioncontigs": {
+                    "output_name": "contigs", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActioncap3stdout": {
+                    "output_name": "cap3stdout", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionsinglets": {
+                    "output_name": "singlets", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActioncontigslink": {
+                    "output_name": "contigslink", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionace": {
+                    "output_name": "ace", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "contigsandsinglets", 
+                    "uuid": "3485aa67-6e70-4446-a886-25bb06d98fc7", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/cap3/cap3/2.0.0", 
+            "input_connections": {
+                "inputSequences": {
+                    "output_name": "out_file1", 
+                    "id": 17
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "inputSequences", 
+                    "description": "runtime parameter for tool cap3"
+                }
+            ], 
+            "position": {
+                "top": 328, 
+                "left": 3250.5
+            }, 
+            "tool_state": "{\"overlapidentity\": \"\\\"90\\\"\", \"inputSequences\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"overlaplength\": \"\\\"40\\\"\", \"__page__\": null}", 
+            "label": "CAP3 to re-assemble contigs", 
+            "type": "tool", 
+            "id": 18, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "d76a0d8a9eac", 
+                "name": "cap3", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "cap3"
+        }, 
+        "20": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/blast_to_scaffold/blast2scaffold/1.0.0", 
+            "errors": null, 
+            "uuid": "dd641374-9364-423e-b49f-c6d112e87aa8", 
+            "tool_version": "1.0.0", 
+            "outputs": [
+                {
+                    "type": "fasta", 
+                    "name": "output"
+                }
+            ], 
+            "post_job_actions": {
+                "RenameDatasetActionoutput": {
+                    "output_name": "output", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "New AnCV sequences in DCV scaffold"
+                    }
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "output", 
+                    "uuid": "137eae2b-cdc9-494e-9b71-a6214ba981ed", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/blast_to_scaffold/blast2scaffold/1.0.0", 
+            "input_connections": {
+                "guideSequence": {
+                    "output_name": "outfile", 
+                    "id": 4
+                }, 
+                "blast_tab": {
+                    "output_name": "output1", 
+                    "id": 19
+                }, 
+                "sequences": {
+                    "output_name": "contigsandsinglets", 
+                    "id": 18
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "guideSequence", 
+                    "description": "runtime parameter for tool blast_to_scaffold"
+                }, 
+                {
+                    "name": "blast_tab", 
+                    "description": "runtime parameter for tool blast_to_scaffold"
+                }, 
+                {
+                    "name": "sequences", 
+                    "description": "runtime parameter for tool blast_to_scaffold"
+                }
+            ], 
+            "position": {
+                "top": 360, 
+                "left": 3774
+            }, 
+            "tool_state": "{\"__page__\": null, \"guideSequence\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"blast_tab\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"sequences\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", 
+            "label": "Get final assembly", 
+            "type": "tool", 
+            "id": 20, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "7d96b28eec49", 
+                "name": "blast_to_scaffold", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "blast_to_scaffold"
+        }, 
+        "1": {
+            "tool_id": null, 
+            "errors": null, 
+            "uuid": "759418aa-16fd-4b22-9c6a-d513526203a7", 
+            "tool_version": null, 
+            "outputs": [], 
+            "workflow_outputs": [
+                {
+                    "output_name": "output", 
+                    "uuid": "8504188c-22d9-4645-bd81-96cc125ab1fc", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": null, 
+            "input_connections": {}, 
+            "inputs": [], 
+            "position": {
+                "top": 609.5, 
+                "left": 913.5
+            }, 
+            "tool_state": "{}", 
+            "label": "P. berghei genome", 
+            "type": "data_input", 
+            "id": 1, 
+            "name": "Input dataset"
+        }, 
+        "0": {
+            "tool_id": null, 
+            "errors": null, 
+            "uuid": "2db48841-d4b7-44b4-bef4-6bdd06fa4e24", 
+            "tool_version": null, 
+            "outputs": [], 
+            "workflow_outputs": [
+                {
+                    "output_name": "output", 
+                    "uuid": "024edd74-8ef9-4ecb-9bfc-be6d87d3012c", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": null, 
+            "input_connections": {}, 
+            "inputs": [], 
+            "position": {
+                "top": 472, 
+                "left": 185
+            }, 
+            "tool_state": "{\"collection_type\": \"list\"}", 
+            "label": "Fastq files", 
+            "type": "data_collection_input", 
+            "id": 0, 
+            "name": "Input dataset collection"
+        }, 
+        "3": {
+            "tool_id": null, 
+            "errors": null, 
+            "uuid": "1e4e8a20-e5ee-4e0d-ae6a-9a08bea449a1", 
+            "tool_version": null, 
+            "outputs": [], 
+            "workflow_outputs": [
+                {
+                    "output_name": "output", 
+                    "uuid": "cdfff80b-df8f-4fa6-8829-dace10a9fc41", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": null, 
+            "input_connections": {}, 
+            "inputs": [], 
+            "position": {
+                "top": 584, 
+                "left": 1801
+            }, 
+            "tool_state": "{}", 
+            "label": "Blast Protein database", 
+            "type": "data_input", 
+            "id": 3, 
+            "name": "Input dataset"
+        }, 
+        "2": {
+            "tool_id": null, 
+            "errors": null, 
+            "uuid": "44533213-217f-4ddf-8f2e-c6de65c259fc", 
+            "tool_version": null, 
+            "outputs": [], 
+            "workflow_outputs": [
+                {
+                    "output_name": "output", 
+                    "uuid": "fdc452f9-6764-423a-8f17-4b174b22b030", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": null, 
+            "input_connections": {}, 
+            "inputs": [], 
+            "position": {
+                "top": 708.5, 
+                "left": 916.5
+            }, 
+            "tool_state": "{}", 
+            "label": "PhiX174", 
+            "type": "data_input", 
+            "id": 2, 
+            "name": "Input dataset"
+        }, 
+        "5": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/yac_clipper/yac/2.3.0", 
+            "errors": null, 
+            "uuid": "b903129d-dba4-4db9-be57-5d18a58d93ad", 
+            "tool_version": "2.3.0", 
+            "outputs": [
+                {
+                    "type": "input", 
+                    "name": "output"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionoutput": {
+                    "output_name": "output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/yac_clipper/yac/2.3.0", 
+            "input_connections": {
+                "input": {
+                    "output_name": "output", 
+                    "id": 0
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "input", 
+                    "description": "runtime parameter for tool Clip adapter"
+                }
+            ], 
+            "position": {
+                "top": 522, 
+                "left": 441
+            }, 
+            "tool_state": "{\"out_format\": \"\\\"fasta\\\"\", \"__page__\": null, \"min\": \"\\\"18\\\"\", \"max\": \"\\\"50\\\"\", \"__rerun_remap_job_id__\": null, \"clip_source\": \"{\\\"__current_case__\\\": 0, \\\"clip_sequence\\\": \\\"TGGAATTCTCGGGTGCCAAG\\\", \\\"clip_source_list\\\": \\\"prebuilt\\\"}\", \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"Nmode\": \"\\\"accept\\\"\"}", 
+            "label": null, 
+            "type": "tool", 
+            "id": 5, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "f7947c5a18b8", 
+                "name": "yac_clipper", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Clip adapter"
+        }, 
+        "4": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/2.3.0", 
+            "errors": null, 
+            "uuid": "b2c1cc64-4e2f-4b9b-b979-5b7d4991cd3a", 
+            "tool_version": "2.3.0", 
+            "outputs": [
+                {
+                    "type": "fasta", 
+                    "name": "outfile"
+                }, 
+                {
+                    "type": "txt", 
+                    "name": "logfile"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionoutfile": {
+                    "output_name": "outfile", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionlogfile": {
+                    "output_name": "logfile", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "RenameDatasetActionoutfile": {
+                    "output_name": "outfile", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "DCV NC_001834.1 Guide"
+                    }
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/2.3.0", 
+            "input_connections": {}, 
+            "inputs": [], 
+            "position": {
+                "top": 727, 
+                "left": 2950.5
+            }, 
+            "tool_state": "{\"__page__\": null, \"__rerun_remap_job_id__\": null, \"queryString\": \"\\\"NC_001834.1\\\"\", \"dbname\": \"\\\"nuccore\\\"\", \"dry_run\": \"\\\"false\\\"\"}", 
+            "label": "Get DCV genome NC_001834.1 sequence", 
+            "type": "tool", 
+            "id": 4, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "c667d0ee39f5", 
+                "name": "fetch_fasta_from_ncbi", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Retrieve FASTA from NCBI"
+        }, 
+        "7": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", 
+            "errors": null, 
+            "uuid": "b34e15aa-633d-46bd-96d8-546f0be2a1a1", 
+            "tool_version": "1.4.1", 
+            "outputs": [
+                {
+                    "type": "input", 
+                    "name": "paired_output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "list_output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "out_file1"
+                }, 
+                {
+                    "type": "_sniff_", 
+                    "name": "paired_out_file"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionpaired_out_file": {
+                    "output_name": "paired_out_file", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "RenameDatasetActionout_file1": {
+                    "output_name": "out_file1", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "#{global_condition.inputs} concatenated"
+                    }
+                }, 
+                "HideDatasetActionpaired_output": {
+                    "output_name": "paired_output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionout_file1": {
+                    "output_name": "out_file1", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionlist_output": {
+                    "output_name": "list_output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", 
+            "input_connections": {
+                "global_condition|inputs": {
+                    "output_name": "output", 
+                    "id": 5
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "global_condition", 
+                    "description": "runtime parameter for tool Concatenate multiple datasets"
+                }
+            ], 
+            "position": {
+                "top": 407.5, 
+                "left": 684
+            }, 
+            "tool_state": "{\"dataset_names\": \"\\\"false\\\"\", \"headers\": \"\\\"0\\\"\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"global_condition\": \"{\\\"__current_case__\\\": 0, \\\"input_type\\\": \\\"singles\\\", \\\"inputs\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\"}", 
+            "label": "Concatenate read files", 
+            "type": "tool", 
+            "id": 7, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "55cf9d9defd1", 
+                "name": "concatenate_multiple_datasets", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Concatenate multiple datasets"
+        }, 
+        "6": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_makeblastdb/0.3.1", 
+            "errors": null, 
+            "uuid": "c0104040-d2d4-48e7-9a59-c6aa4c9674b5", 
+            "tool_version": "0.3.1", 
+            "outputs": [
+                {
+                    "type": "data", 
+                    "name": "outfile"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionoutfile": {
+                    "output_name": "outfile", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_makeblastdb/0.3.1", 
+            "input_connections": {
+                "input_file": {
+                    "output_name": "outfile", 
+                    "id": 4
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "mask_data_file", 
+                    "description": "runtime parameter for tool NCBI BLAST+ makeblastdb"
+                }, 
+                {
+                    "name": "input_file", 
+                    "description": "runtime parameter for tool NCBI BLAST+ makeblastdb"
+                }
+            ], 
+            "position": {
+                "top": 781, 
+                "left": 3222
+            }, 
+            "tool_state": "{\"__page__\": null, \"mask_data_file\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"input_file\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"dbtype\": \"\\\"nucl\\\"\", \"__rerun_remap_job_id__\": null, \"hash_index\": \"\\\"true\\\"\", \"tax\": \"{\\\"__current_case__\\\": 0, \\\"taxselect\\\": \\\"\\\"}\", \"title\": \"\\\"DCV NC_001834.1\\\"\", \"parse_seqids\": \"\\\"false\\\"\"}", 
+            "label": "Blast databse of DCV", 
+            "type": "tool", 
+            "id": 6, 
+            "tool_shed_repository": {
+                "owner": "devteam", 
+                "changeset_revision": "e25d3acf6e68", 
+                "name": "ncbi_blast_plus", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "NCBI BLAST+ makeblastdb"
+        }, 
+        "9": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1", 
+            "errors": null, 
+            "uuid": "51ff0b44-2940-4592-ac62-cc1374d0f17c", 
+            "tool_version": "2.1.1", 
+            "outputs": [
+                {
+                    "type": "tabular", 
+                    "name": "output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "aligned"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "unaligned"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionaligned": {
+                    "output_name": "aligned", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionoutput": {
+                    "output_name": "output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "RenameDatasetActionunaligned": {
+                    "output_name": "unaligned", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Non A. gambiae sequences"
+                    }
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "unaligned", 
+                    "uuid": "71b068ac-3ff4-4d1e-9646-d44b4acb6235", 
+                    "label": null
+                }
+            ], 
+            "annotation": "Get non A. gambiae reads", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1", 
+            "input_connections": {
+                "input": {
+                    "output_name": "output", 
+                    "id": 8
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "input", 
+                    "description": "runtime parameter for tool sR_bowtie"
+                }
+            ], 
+            "position": {
+                "top": 259, 
+                "left": 1388
+            }, 
+            "tool_state": "{\"__page__\": null, \"output_format\": \"\\\"tabular\\\"\", \"v_mismatches\": \"\\\"2\\\"\", \"additional_fasta\": \"\\\"unal\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"refGenomeSource\": \"{\\\"__current_case__\\\": 0, \\\"genomeSource\\\": \\\"indexed\\\", \\\"index\\\": \\\"AgamP4\\\"}\", \"method\": \"\\\"k_option\\\"\"}", 
+            "label": "Align to A. gambiae", 
+            "type": "tool", 
+            "id": 9, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "0281bb245635", 
+                "name": "sr_bowtie", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "sR_bowtie"
+        }, 
+        "8": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/sequence_format_converter/sequence_format_converter/2.1.1", 
+            "errors": null, 
+            "uuid": "de629b33-1300-4a78-ad2a-a645996f5aa5", 
+            "tool_version": "2.1.1", 
+            "outputs": [
+                {
+                    "type": "fasta", 
+                    "name": "output"
+                }
+            ], 
+            "post_job_actions": {
+                "RenameDatasetActionoutput": {
+                    "output_name": "output", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Initial Clipped sequences"
+                    }
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "output", 
+                    "uuid": "828446e9-d62e-42e4-ada9-ad6bcb281469", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/sequence_format_converter/sequence_format_converter/2.1.1", 
+            "input_connections": {
+                "input": {
+                    "output_name": "out_file1", 
+                    "id": 7
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "input", 
+                    "description": "runtime parameter for tool sequence_format_converter"
+                }
+            ], 
+            "position": {
+                "top": 452, 
+                "left": 996.5
+            }, 
+            "tool_state": "{\"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"output_format\": \"\\\"fastaw\\\"\", \"__rerun_remap_job_id__\": null, \"__page__\": null}", 
+            "label": "Collapse reads", 
+            "type": "tool", 
+            "id": 8, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "f1d59113125a", 
+                "name": "sequence_format_converter", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "sequence_format_converter"
+        }
+    }, 
+    "annotation": "", 
+    "name": "Metavisitor: Workflow for Use Case 2-1"
+}
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_2-2.ga	Sun Jul 21 19:22:52 2019 -0400
@@ -0,0 +1,531 @@
+{
+    "a_galaxy_workflow": "true", 
+    "uuid": "a103dc7c-38de-4e79-87b4-d635d5bff5eb", 
+    "tags": [], 
+    "format-version": "0.1", 
+    "version": 2, 
+    "steps": {
+        "1": {
+            "tool_id": null, 
+            "errors": null, 
+            "uuid": "2bec777f-eabe-49db-a14f-1e90fd9bbc1a", 
+            "tool_version": null, 
+            "outputs": [], 
+            "workflow_outputs": [
+                {
+                    "output_name": "output", 
+                    "uuid": "86382086-00c5-4a59-a828-cbf9bb194f77", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": null, 
+            "input_connections": {}, 
+            "inputs": [], 
+            "position": {
+                "top": 757, 
+                "left": 1683.5
+            }, 
+            "tool_state": "{}", 
+            "label": "Protein Blast database", 
+            "type": "data_input", 
+            "id": 1, 
+            "name": "Input dataset"
+        }, 
+        "0": {
+            "tool_id": null, 
+            "errors": null, 
+            "uuid": "3877f2c8-e908-41eb-b4ae-b918cdd202d6", 
+            "tool_version": null, 
+            "outputs": [], 
+            "workflow_outputs": [
+                {
+                    "output_name": "output", 
+                    "uuid": "1fbb92d6-741f-41ff-a73b-b7097851e709", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": null, 
+            "input_connections": {}, 
+            "inputs": [], 
+            "position": {
+                "top": 501, 
+                "left": 123.5
+            }, 
+            "tool_state": "{\"collection_type\": \"list\"}", 
+            "label": "Fastq red files", 
+            "type": "data_collection_input", 
+            "id": 0, 
+            "name": "Input dataset collection"
+        }, 
+        "3": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/sequence_format_converter/sequence_format_converter/2.1.1", 
+            "errors": null, 
+            "uuid": "a490eea5-f036-4011-9f21-20cb9c11616a", 
+            "tool_version": "2.1.1", 
+            "outputs": [
+                {
+                    "type": "fasta", 
+                    "name": "output"
+                }
+            ], 
+            "post_job_actions": {}, 
+            "workflow_outputs": [
+                {
+                    "output_name": "output", 
+                    "uuid": "9bdd628f-225b-40c8-bf3f-d2380666aa18", 
+                    "label": null
+                }
+            ], 
+            "annotation": "Group identical reads", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/sequence_format_converter/sequence_format_converter/2.1.1", 
+            "input_connections": {
+                "input": {
+                    "output_name": "output_unaligned_reads_l", 
+                    "id": 2
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "input", 
+                    "description": "runtime parameter for tool sequence_format_converter"
+                }
+            ], 
+            "position": {
+                "top": 627, 
+                "left": 654.5
+            }, 
+            "tool_state": "{\"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"output_format\": \"\\\"fastaw\\\"\", \"__rerun_remap_job_id__\": null, \"__page__\": null}", 
+            "label": "Collapse reads", 
+            "type": "tool", 
+            "id": 3, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "f1d59113125a", 
+                "name": "sequence_format_converter", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "sequence_format_converter"
+        }, 
+        "2": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.3.4.3", 
+            "errors": null, 
+            "uuid": "e957e1b6-7774-42ca-a23d-7170ac59795b", 
+            "tool_version": "2.3.4.3", 
+            "outputs": [
+                {
+                    "type": "fastqsanger", 
+                    "name": "output_unaligned_reads_l"
+                }, 
+                {
+                    "type": "fastqsanger", 
+                    "name": "output_aligned_reads_l"
+                }, 
+                {
+                    "type": "fastqsanger", 
+                    "name": "output_aligned_reads_r"
+                }, 
+                {
+                    "type": "fastqsanger", 
+                    "name": "output_unaligned_reads_r"
+                }, 
+                {
+                    "type": "bam", 
+                    "name": "output"
+                }, 
+                {
+                    "type": "txt", 
+                    "name": "mapping_stats"
+                }
+            ], 
+            "post_job_actions": {
+                "DeleteIntermediatesActionoutput_unaligned_reads_l": {
+                    "output_name": "output_unaligned_reads_l", 
+                    "action_type": "DeleteIntermediatesAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionoutput_unaligned_reads_r": {
+                    "output_name": "output_unaligned_reads_r", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionoutput": {
+                    "output_name": "output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionoutput_aligned_reads_l": {
+                    "output_name": "output_aligned_reads_l", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionmapping_stats": {
+                    "output_name": "mapping_stats", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionoutput_aligned_reads_r": {
+                    "output_name": "output_aligned_reads_r", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionoutput_unaligned_reads_l": {
+                    "output_name": "output_unaligned_reads_l", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "Get non-host reads", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.3.4.3", 
+            "input_connections": {
+                "library|input_1": {
+                    "output_name": "output", 
+                    "id": 0
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "library", 
+                    "description": "runtime parameter for tool Bowtie2"
+                }
+            ], 
+            "position": {
+                "top": 605, 
+                "left": 338.5
+            }, 
+            "tool_state": "{\"sam_options\": \"{\\\"__current_case__\\\": 1, \\\"sam_options_selector\\\": \\\"no\\\"}\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"library\": \"{\\\"__current_case__\\\": 0, \\\"aligned_file\\\": \\\"false\\\", \\\"input_1\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"type\\\": \\\"single\\\", \\\"unaligned_file\\\": \\\"true\\\"}\", \"reference_genome\": \"{\\\"__current_case__\\\": 0, \\\"index\\\": \\\"AgamP4\\\", \\\"source\\\": \\\"indexed\\\"}\", \"rg\": \"{\\\"__current_case__\\\": 3, \\\"rg_selector\\\": \\\"do_not_set\\\"}\", \"save_mapping_stats\": \"\\\"false\\\"\", \"analysis_type\": \"{\\\"__current_case__\\\": 1, \\\"alignment_options\\\": {\\\"__current_case__\\\": 1, \\\"alignment_options_selector\\\": \\\"no\\\"}, \\\"analysis_type_selector\\\": \\\"full\\\", \\\"effort_options\\\": {\\\"__current_case__\\\": 1, \\\"effort_options_selector\\\": \\\"no\\\"}, \\\"input_options\\\": {\\\"__current_case__\\\": 0, \\\"input_options_selector\\\": \\\"yes\\\", \\\"int_quals\\\": \\\"false\\\", \\\"qupto\\\": \\\"100000000\\\", \\\"qv_encoding\\\": \\\"--phred33\\\", \\\"skip\\\": \\\"0\\\", \\\"solexa_quals\\\": \\\"false\\\", \\\"trim3\\\": \\\"20\\\", \\\"trim5\\\": \\\"0\\\"}, \\\"other_options\\\": {\\\"__current_case__\\\": 1, \\\"other_options_selector\\\": \\\"no\\\"}, \\\"reporting_options\\\": {\\\"__current_case__\\\": 1, \\\"k\\\": \\\"1\\\", \\\"reporting_options_selector\\\": \\\"k\\\"}, \\\"scoring_options\\\": {\\\"__current_case__\\\": 1, \\\"scoring_options_selector\\\": \\\"no\\\"}}\"}", 
+            "label": "Align to host", 
+            "type": "tool", 
+            "id": 2, 
+            "tool_shed_repository": {
+                "owner": "devteam", 
+                "changeset_revision": "017aba02828d", 
+                "name": "bowtie2", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Bowtie2"
+        }, 
+        "5": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/oases/oasesoptimiserv/1.2.2", 
+            "errors": null, 
+            "uuid": "0229202f-8884-4e6f-aa11-ddf76f8101cd", 
+            "tool_version": "1.2.2", 
+            "outputs": [
+                {
+                    "type": "fasta", 
+                    "name": "transcripts"
+                }
+            ], 
+            "post_job_actions": {}, 
+            "workflow_outputs": [
+                {
+                    "output_name": "transcripts", 
+                    "uuid": "284094e8-fb0d-43f4-8447-03e3e873f20e", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/oases/oasesoptimiserv/1.2.2", 
+            "input_connections": {
+                "inputs_0|input": {
+                    "output_name": "out_file1", 
+                    "id": 4
+                }
+            }, 
+            "inputs": [], 
+            "position": {
+                "top": 550, 
+                "left": 1339.5
+            }, 
+            "tool_state": "{\"__page__\": null, \"inputs\": \"[{\\\"__index__\\\": 0, \\\"input\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}]\", \"end_hash_length\": \"\\\"69\\\"\", \"__rerun_remap_job_id__\": null, \"start_hash_length\": \"\\\"25\\\"\"}", 
+            "label": "Assemble reads", 
+            "type": "tool", 
+            "id": 5, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "f7dd852c8f4c", 
+                "name": "oases", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Oases_optimiser"
+        }, 
+        "4": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", 
+            "errors": null, 
+            "uuid": "733e8b93-1402-4f53-9677-c092e223114f", 
+            "tool_version": "1.4.1", 
+            "outputs": [
+                {
+                    "type": "input", 
+                    "name": "paired_output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "list_output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "out_file1"
+                }, 
+                {
+                    "type": "_sniff_", 
+                    "name": "paired_out_file"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionpaired_out_file": {
+                    "output_name": "paired_out_file", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionpaired_output": {
+                    "output_name": "paired_output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionout_file1": {
+                    "output_name": "out_file1", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionlist_output": {
+                    "output_name": "list_output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", 
+            "input_connections": {
+                "global_condition|inputs": {
+                    "output_name": "output", 
+                    "id": 3
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "global_condition", 
+                    "description": "runtime parameter for tool Concatenate multiple datasets"
+                }
+            ], 
+            "position": {
+                "top": 593.5, 
+                "left": 973
+            }, 
+            "tool_state": "{\"dataset_names\": \"\\\"false\\\"\", \"headers\": \"\\\"0\\\"\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"global_condition\": \"{\\\"__current_case__\\\": 0, \\\"input_type\\\": \\\"singles\\\", \\\"inputs\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\"}", 
+            "label": null, 
+            "type": "tool", 
+            "id": 4, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "55cf9d9defd1", 
+                "name": "concatenate_multiple_datasets", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Concatenate multiple datasets"
+        }, 
+        "7": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastx_wrapper/0.3.1", 
+            "errors": null, 
+            "uuid": "6f2acd5d-8da3-4abc-b2af-1c001ef50b01", 
+            "tool_version": "0.3.1", 
+            "outputs": [
+                {
+                    "type": "tabular", 
+                    "name": "output1"
+                }
+            ], 
+            "post_job_actions": {}, 
+            "workflow_outputs": [
+                {
+                    "output_name": "output1", 
+                    "uuid": "1790814e-28a4-4b66-ac57-4a2087c004af", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastx_wrapper/0.3.1", 
+            "input_connections": {
+                "query": {
+                    "output_name": "output", 
+                    "id": 6
+                }, 
+                "db_opts|histdb": {
+                    "output_name": "output", 
+                    "id": 1
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "db_opts", 
+                    "description": "runtime parameter for tool NCBI BLAST+ blastx"
+                }, 
+                {
+                    "name": "query", 
+                    "description": "runtime parameter for tool NCBI BLAST+ blastx"
+                }
+            ], 
+            "position": {
+                "top": 744, 
+                "left": 1928
+            }, 
+            "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"__current_case__\\\": 2, \\\"ext_cols\\\": [\\\"slen\\\"], \\\"ids_cols\\\": null, \\\"misc_cols\\\": null, \\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"tax_cols\\\": null}\", \"adv_opts\": \"{\\\"__current_case__\\\": 0, \\\"adv_opts_selector\\\": \\\"basic\\\"}\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"db_opts\": \"{\\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\", \\\"db_opts_selector\\\": \\\"histdb\\\", \\\"histdb\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"subject\\\": \\\"\\\"}\", \"query_gencode\": \"\\\"1\\\"\", \"blast_type\": \"\\\"blastx\\\"\", \"query\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", 
+            "label": "Blastx against vir2", 
+            "type": "tool", 
+            "id": 7, 
+            "tool_shed_repository": {
+                "owner": "devteam", 
+                "changeset_revision": "e25d3acf6e68", 
+                "name": "ncbi_blast_plus", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "NCBI BLAST+ blastx"
+        }, 
+        "6": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/fasta_filter_by_length/fasta_filter_by_length/1.1", 
+            "errors": null, 
+            "uuid": "5315f3b8-f61f-4ee4-b285-83b0aebd6e3f", 
+            "tool_version": "1.1", 
+            "outputs": [
+                {
+                    "type": "fasta", 
+                    "name": "output"
+                }
+            ], 
+            "post_job_actions": {}, 
+            "workflow_outputs": [
+                {
+                    "output_name": "output", 
+                    "uuid": "e74ad0d5-3894-430e-a93d-60f95c224080", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/fasta_filter_by_length/fasta_filter_by_length/1.1", 
+            "input_connections": {
+                "input": {
+                    "output_name": "transcripts", 
+                    "id": 5
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "input", 
+                    "description": "runtime parameter for tool Filter sequences by length"
+                }
+            ], 
+            "position": {
+                "top": 505, 
+                "left": 1715.5
+            }, 
+            "tool_state": "{\"__page__\": null, \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"max_length\": \"\\\"0\\\"\", \"min_length\": \"\\\"5000\\\"\"}", 
+            "label": "Get contigs with length >5kb", 
+            "type": "tool", 
+            "id": 6, 
+            "tool_shed_repository": {
+                "owner": "devteam", 
+                "changeset_revision": "2fd6033d0e9c", 
+                "name": "fasta_filter_by_length", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Filter sequences by length"
+        }, 
+        "8": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/blastparser_and_hits/BlastParser_and_hits/2.6.1", 
+            "errors": null, 
+            "uuid": "e9c2503f-9eb2-4aca-85d1-ec4b2a72a9fa", 
+            "tool_version": "2.6.1", 
+            "outputs": [
+                {
+                    "type": "tabular", 
+                    "name": "tabularOutput"
+                }, 
+                {
+                    "type": "fasta", 
+                    "name": "fastaOutput"
+                }, 
+                {
+                    "type": "fasta", 
+                    "name": "al_sequences"
+                }, 
+                {
+                    "type": "fasta", 
+                    "name": "un_sequences"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActional_sequences": {
+                    "output_name": "al_sequences", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "RenameDatasetActiontabularOutput": {
+                    "output_name": "tabularOutput", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Contigs matching proteic vir2"
+                    }
+                }, 
+                "HideDatasetActionun_sequences": {
+                    "output_name": "un_sequences", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionfastaOutput": {
+                    "output_name": "fastaOutput", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "tabularOutput", 
+                    "uuid": "b9aa78fe-d523-488c-b6bb-78ea3ad49ef8", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/blastparser_and_hits/BlastParser_and_hits/2.6.1", 
+            "input_connections": {
+                "blast": {
+                    "output_name": "output1", 
+                    "id": 7
+                }, 
+                "sequences": {
+                    "output_name": "output", 
+                    "id": 6
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "blast", 
+                    "description": "runtime parameter for tool Parse blast output and compile hits"
+                }, 
+                {
+                    "name": "sequences", 
+                    "description": "runtime parameter for tool Parse blast output and compile hits"
+                }
+            ], 
+            "position": {
+                "top": 584, 
+                "left": 2288
+            }, 
+            "tool_state": "{\"__page__\": null, \"flanking\": \"\\\"5\\\"\", \"additional_filters\": \"{\\\"__current_case__\\\": 0, \\\"use_filters\\\": \\\"no\\\"}\", \"__rerun_remap_job_id__\": null, \"mode\": \"\\\"verbose\\\"\", \"sequences\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"blast\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", 
+            "label": null, 
+            "type": "tool", 
+            "id": 8, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "b4c9c085d709", 
+                "name": "blastparser_and_hits", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Parse blast output and compile hits"
+        }
+    }, 
+    "annotation": "", 
+    "name": "Metavisitor: Workflow for Use Case 2-2"
+}
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_3-1.ga	Sun Jul 21 19:22:52 2019 -0400
@@ -0,0 +1,651 @@
+{
+    "a_galaxy_workflow": "true", 
+    "uuid": "9c4c1ab5-46f6-4710-b2fc-b75b8c85969f", 
+    "tags": [], 
+    "format-version": "0.1", 
+    "version": 2, 
+    "steps": {
+        "10": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", 
+            "errors": null, 
+            "uuid": "ea3e06f4-1e82-4682-b7c9-f9d93039f499", 
+            "tool_version": "1.4.1", 
+            "outputs": [
+                {
+                    "type": "input", 
+                    "name": "paired_output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "list_output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "out_file1"
+                }, 
+                {
+                    "type": "_sniff_", 
+                    "name": "paired_out_file"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionpaired_out_file": {
+                    "output_name": "paired_out_file", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "RenameDatasetActionout_file1": {
+                    "output_name": "out_file1", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Virus identification by patient"
+                    }
+                }, 
+                "HideDatasetActionpaired_output": {
+                    "output_name": "paired_output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionlist_output": {
+                    "output_name": "list_output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "out_file1", 
+                    "uuid": "ee68f86c-3aeb-43fe-8ea8-388d0cf3c087", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", 
+            "input_connections": {
+                "global_condition|inputs": {
+                    "output_name": "output", 
+                    "id": 9
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "global_condition", 
+                    "description": "runtime parameter for tool Concatenate multiple datasets"
+                }
+            ], 
+            "position": {
+                "top": 824.5, 
+                "left": 2785
+            }, 
+            "tool_state": "{\"dataset_names\": \"\\\"false\\\"\", \"headers\": \"\\\"0\\\"\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"global_condition\": \"{\\\"__current_case__\\\": 0, \\\"input_type\\\": \\\"singles\\\", \\\"inputs\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\"}", 
+            "label": "Concatenate results", 
+            "type": "tool", 
+            "id": 10, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "55cf9d9defd1", 
+                "name": "concatenate_multiple_datasets", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Concatenate multiple datasets"
+        }, 
+        "1": {
+            "tool_id": null, 
+            "errors": null, 
+            "uuid": "1c4765be-38dc-4145-97b7-8a096d4c62ce", 
+            "tool_version": null, 
+            "outputs": [], 
+            "workflow_outputs": [
+                {
+                    "output_name": "output", 
+                    "uuid": "f6e3688c-95b3-457e-9e73-a409268ca7f4", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": null, 
+            "input_connections": {}, 
+            "inputs": [], 
+            "position": {
+                "top": 1089, 
+                "left": 1504.5
+            }, 
+            "tool_state": "{}", 
+            "label": "Nucleotide Viral Blast Database", 
+            "type": "data_input", 
+            "id": 1, 
+            "name": "Input dataset"
+        }, 
+        "0": {
+            "tool_id": null, 
+            "errors": null, 
+            "uuid": "117e0a3f-4359-48b0-9d1e-33137a028108", 
+            "tool_version": null, 
+            "outputs": [], 
+            "workflow_outputs": [
+                {
+                    "output_name": "output", 
+                    "uuid": "bbe39275-4291-4e94-bb4b-b7729c060dd5", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": null, 
+            "input_connections": {}, 
+            "inputs": [], 
+            "position": {
+                "top": 290, 
+                "left": 200
+            }, 
+            "tool_state": "{\"collection_type\": \"list\"}", 
+            "label": "Fever Patient Sequences collection", 
+            "type": "data_collection_input", 
+            "id": 0, 
+            "name": "Input dataset collection"
+        }, 
+        "3": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/sequence_format_converter/sequence_format_converter/2.1.1", 
+            "errors": null, 
+            "uuid": "1bb222cc-9325-4c1b-9320-e607b9763076", 
+            "tool_version": "2.1.1", 
+            "outputs": [
+                {
+                    "type": "fasta", 
+                    "name": "output"
+                }
+            ], 
+            "post_job_actions": {
+                "RenameDatasetActionoutput": {
+                    "output_name": "output", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "reduced input dataset"
+                    }
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "output", 
+                    "uuid": "39739e46-d281-4452-a94b-22e291d21fd3", 
+                    "label": null
+                }
+            ], 
+            "annotation": "Convert sequences to weighted fasta", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/sequence_format_converter/sequence_format_converter/2.1.1", 
+            "input_connections": {
+                "input": {
+                    "output_name": "output", 
+                    "id": 2
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "input", 
+                    "description": "runtime parameter for tool sequence_format_converter"
+                }
+            ], 
+            "position": {
+                "top": 400, 
+                "left": 872.5
+            }, 
+            "tool_state": "{\"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"output_format\": \"\\\"fastaw\\\"\", \"__rerun_remap_job_id__\": null, \"__page__\": null}", 
+            "label": null, 
+            "type": "tool", 
+            "id": 3, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "f1d59113125a", 
+                "name": "sequence_format_converter", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "sequence_format_converter"
+        }, 
+        "2": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/fastx_trimmer/cshl_fastx_trimmer/1.0.2", 
+            "errors": null, 
+            "uuid": "7991f9f1-4b12-418c-9043-b4f7cc398b0a", 
+            "tool_version": "1.0.2", 
+            "outputs": [
+                {
+                    "type": "input", 
+                    "name": "output"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionoutput": {
+                    "output_name": "output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "Trim sequences to 27 bp", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/fastx_trimmer/cshl_fastx_trimmer/1.0.2", 
+            "input_connections": {
+                "input": {
+                    "output_name": "output", 
+                    "id": 0
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "input", 
+                    "description": "runtime parameter for tool Trim sequences"
+                }
+            ], 
+            "position": {
+                "top": 295, 
+                "left": 545.5
+            }, 
+            "tool_state": "{\"__page__\": null, \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"last\": \"\\\"27\\\"\", \"first\": \"\\\"1\\\"\"}", 
+            "label": null, 
+            "type": "tool", 
+            "id": 2, 
+            "tool_shed_repository": {
+                "owner": "devteam", 
+                "changeset_revision": "547e8d00f11c", 
+                "name": "fastx_trimmer", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Trim sequences"
+        }, 
+        "5": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1", 
+            "errors": null, 
+            "uuid": "27d04345-a89c-4e05-982a-51d3104b2f68", 
+            "tool_version": "2.1.1", 
+            "outputs": [
+                {
+                    "type": "tabular", 
+                    "name": "output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "aligned"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "unaligned"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionunaligned": {
+                    "output_name": "unaligned", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionaligned": {
+                    "output_name": "aligned", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionoutput": {
+                    "output_name": "output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "DeleteIntermediatesActionoutput": {
+                    "output_name": "output", 
+                    "action_type": "DeleteIntermediatesAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "Get viral sequences", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1", 
+            "input_connections": {
+                "input": {
+                    "output_name": "unaligned", 
+                    "id": 4
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "input", 
+                    "description": "runtime parameter for tool sR_bowtie"
+                }
+            ], 
+            "position": {
+                "top": 731, 
+                "left": 1516
+            }, 
+            "tool_state": "{\"__page__\": null, \"output_format\": \"\\\"tabular\\\"\", \"v_mismatches\": \"\\\"2\\\"\", \"additional_fasta\": \"\\\"al\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"refGenomeSource\": \"{\\\"__current_case__\\\": 0, \\\"genomeSource\\\": \\\"indexed\\\", \\\"index\\\": \\\"vir2\\\"}\", \"method\": \"\\\"k_option\\\"\"}", 
+            "label": "Align to vir2 database", 
+            "type": "tool", 
+            "id": 5, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "0281bb245635", 
+                "name": "sr_bowtie", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "sR_bowtie"
+        }, 
+        "4": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1", 
+            "errors": null, 
+            "uuid": "e3d516bc-8e83-458b-97b9-393a1738e188", 
+            "tool_version": "2.1.1", 
+            "outputs": [
+                {
+                    "type": "tabular", 
+                    "name": "output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "aligned"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "unaligned"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionunaligned": {
+                    "output_name": "unaligned", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionaligned": {
+                    "output_name": "aligned", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionoutput": {
+                    "output_name": "output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "DeleteIntermediatesActionoutput": {
+                    "output_name": "output", 
+                    "action_type": "DeleteIntermediatesAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "Keep non-host sequences only", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1", 
+            "input_connections": {
+                "input": {
+                    "output_name": "output", 
+                    "id": 3
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "input", 
+                    "description": "runtime parameter for tool sR_bowtie"
+                }
+            ], 
+            "position": {
+                "top": 562, 
+                "left": 1214
+            }, 
+            "tool_state": "{\"__page__\": null, \"output_format\": \"\\\"tabular\\\"\", \"v_mismatches\": \"\\\"2\\\"\", \"additional_fasta\": \"\\\"unal\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"refGenomeSource\": \"{\\\"__current_case__\\\": 0, \\\"genomeSource\\\": \\\"indexed\\\", \\\"index\\\": \\\"hg19\\\"}\", \"method\": \"\\\"k_option\\\"\"}", 
+            "label": "Align sequences to host", 
+            "type": "tool", 
+            "id": 4, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "0281bb245635", 
+                "name": "sr_bowtie", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "sR_bowtie"
+        }, 
+        "7": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.3.1", 
+            "errors": null, 
+            "uuid": "5b032185-46b7-41f4-8a57-b925c2375cad", 
+            "tool_version": "0.3.1", 
+            "outputs": [
+                {
+                    "type": "tabular", 
+                    "name": "output1"
+                }
+            ], 
+            "post_job_actions": {
+                "RenameDatasetActionoutput1": {
+                    "output_name": "output1", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "blastN of oases contigs"
+                    }
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "output1", 
+                    "uuid": "a9241993-92d7-4fbb-a76a-bbc99b4b8f55", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.3.1", 
+            "input_connections": {
+                "query": {
+                    "output_name": "transcripts", 
+                    "id": 6
+                }, 
+                "db_opts|histdb": {
+                    "output_name": "output", 
+                    "id": 1
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "db_opts", 
+                    "description": "runtime parameter for tool NCBI BLAST+ blastn"
+                }, 
+                {
+                    "name": "query", 
+                    "description": "runtime parameter for tool NCBI BLAST+ blastn"
+                }
+            ], 
+            "position": {
+                "top": 1028, 
+                "left": 2051
+            }, 
+            "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"__current_case__\\\": 2, \\\"ext_cols\\\": [\\\"slen\\\"], \\\"ids_cols\\\": null, \\\"misc_cols\\\": null, \\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"tax_cols\\\": null}\", \"adv_opts\": \"{\\\"__current_case__\\\": 0, \\\"adv_opts_selector\\\": \\\"basic\\\"}\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"db_opts\": \"{\\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\", \\\"db_opts_selector\\\": \\\"histdb\\\", \\\"histdb\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"subject\\\": \\\"\\\"}\", \"blast_type\": \"\\\"blastn\\\"\", \"query\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", 
+            "label": "Blast contigs against vir2", 
+            "type": "tool", 
+            "id": 7, 
+            "tool_shed_repository": {
+                "owner": "devteam", 
+                "changeset_revision": "e25d3acf6e68", 
+                "name": "ncbi_blast_plus", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "NCBI BLAST+ blastn"
+        }, 
+        "6": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/oases/oasesoptimiserv/1.2.2", 
+            "errors": null, 
+            "uuid": "2daf2a34-f108-4112-8b71-41590697cd8f", 
+            "tool_version": "1.2.2", 
+            "outputs": [
+                {
+                    "type": "fasta", 
+                    "name": "transcripts"
+                }
+            ], 
+            "post_job_actions": {
+                "RenameDatasetActiontranscripts": {
+                    "output_name": "transcripts", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Oases viral contigs"
+                    }
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "transcripts", 
+                    "uuid": "36a70a8b-19ea-44bc-8c97-cfa1b4516bb2", 
+                    "label": null
+                }
+            ], 
+            "annotation": "Use Oases to assemble transcripts from the sequences aligning to vir2", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/oases/oasesoptimiserv/1.2.2", 
+            "input_connections": {
+                "inputs_0|input": {
+                    "output_name": "aligned", 
+                    "id": 5
+                }
+            }, 
+            "inputs": [], 
+            "position": {
+                "top": 851, 
+                "left": 1831.5
+            }, 
+            "tool_state": "{\"__page__\": null, \"inputs\": \"[{\\\"__index__\\\": 0, \\\"input\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}]\", \"end_hash_length\": \"\\\"27\\\"\", \"__rerun_remap_job_id__\": null, \"start_hash_length\": \"\\\"11\\\"\"}", 
+            "label": "Assemble viral contigs", 
+            "type": "tool", 
+            "id": 6, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "f7dd852c8f4c", 
+                "name": "oases", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Oases_optimiser"
+        }, 
+        "9": {
+            "tool_id": "__FILTER_FAILED_DATASETS__", 
+            "errors": null, 
+            "uuid": "76439020-63b1-4f39-8bee-119268816ad3", 
+            "tool_version": "1.0.0", 
+            "outputs": [
+                {
+                    "type": "input", 
+                    "name": "output"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionoutput": {
+                    "output_name": "output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "", 
+            "content_id": "__FILTER_FAILED_DATASETS__", 
+            "input_connections": {
+                "input": {
+                    "output_name": "tabularOutput", 
+                    "id": 8
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "input", 
+                    "description": "runtime parameter for tool Filter failed"
+                }
+            ], 
+            "position": {
+                "top": 999.5, 
+                "left": 2611.5
+            }, 
+            "tool_state": "{\"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"__page__\": null}", 
+            "label": null, 
+            "type": "tool", 
+            "id": 9, 
+            "name": "Filter failed"
+        }, 
+        "8": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/blastparser_and_hits/BlastParser_and_hits/2.6.1", 
+            "errors": null, 
+            "uuid": "baa57b95-c498-4afe-98ec-e7a50df81195", 
+            "tool_version": "2.6.1", 
+            "outputs": [
+                {
+                    "type": "tabular", 
+                    "name": "tabularOutput"
+                }, 
+                {
+                    "type": "fasta", 
+                    "name": "fastaOutput"
+                }, 
+                {
+                    "type": "fasta", 
+                    "name": "al_sequences"
+                }, 
+                {
+                    "type": "fasta", 
+                    "name": "un_sequences"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActional_sequences": {
+                    "output_name": "al_sequences", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "RenameDatasetActiontabularOutput": {
+                    "output_name": "tabularOutput", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Viral identification"
+                    }
+                }, 
+                "HideDatasetActionun_sequences": {
+                    "output_name": "un_sequences", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionfastaOutput": {
+                    "output_name": "fastaOutput", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "tabularOutput", 
+                    "uuid": "d3602ec6-86ee-4b7a-b640-c79ddb4091f0", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/blastparser_and_hits/BlastParser_and_hits/2.6.1", 
+            "input_connections": {
+                "blast": {
+                    "output_name": "output1", 
+                    "id": 7
+                }, 
+                "sequences": {
+                    "output_name": "transcripts", 
+                    "id": 6
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "blast", 
+                    "description": "runtime parameter for tool Parse blast output and compile hits"
+                }, 
+                {
+                    "name": "sequences", 
+                    "description": "runtime parameter for tool Parse blast output and compile hits"
+                }
+            ], 
+            "position": {
+                "top": 751, 
+                "left": 2347
+            }, 
+            "tool_state": "{\"__page__\": null, \"flanking\": \"\\\"5\\\"\", \"additional_filters\": \"{\\\"__current_case__\\\": 0, \\\"use_filters\\\": \\\"no\\\"}\", \"__rerun_remap_job_id__\": null, \"mode\": \"\\\"verbose\\\"\", \"sequences\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"blast\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", 
+            "label": "Get annotated contigs", 
+            "type": "tool", 
+            "id": 8, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "b4c9c085d709", 
+                "name": "blastparser_and_hits", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Parse blast output and compile hits"
+        }
+    }, 
+    "annotation": "", 
+    "name": "Metavisitor: Workflow for Use Case 3-1"
+}
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_3-2.ga	Sun Jul 21 19:22:52 2019 -0400
@@ -0,0 +1,575 @@
+{
+    "a_galaxy_workflow": "true", 
+    "uuid": "74ab8fbf-6238-4f5e-b77f-0dcb98c430b0", 
+    "tags": [], 
+    "format-version": "0.1", 
+    "version": 1, 
+    "steps": {
+        "11": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", 
+            "errors": null, 
+            "uuid": "48234ff1-4c46-44bd-b541-a2e86d8594f1", 
+            "tool_version": "1.4.1", 
+            "outputs": [
+                {
+                    "type": "input", 
+                    "name": "out_file1"
+                }
+            ], 
+            "post_job_actions": {
+                "RenameDatasetActionout_file1": {
+                    "output_name": "out_file1", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Virus identification by patient"
+                    }
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "out_file1", 
+                    "uuid": "6fb75e1f-83d0-432d-9138-9bd99e735bcb", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", 
+            "input_connections": {
+                "global_condition|inputs": {
+                    "output_name": "output", 
+                    "id": 10
+                }
+            }, 
+            "inputs": [], 
+            "position": {
+                "top": 366.5, 
+                "left": 2618
+            }, 
+            "tool_state": "{\"dataset_names\": \"\\\"false\\\"\", \"headers\": \"\\\"0\\\"\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"global_condition\": \"{\\\"__current_case__\\\": 0, \\\"input_type\\\": \\\"singles\\\", \\\"inputs\\\": {\\\"__class__\\\": \\\"ConnectedValue\\\"}}\"}", 
+            "label": "Concatenate results", 
+            "type": "tool", 
+            "id": 11, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "55cf9d9defd1", 
+                "name": "concatenate_multiple_datasets", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Concatenate multiple datasets"
+        }, 
+        "10": {
+            "tool_id": "__FILTER_FAILED_DATASETS__", 
+            "errors": null, 
+            "uuid": "239c73f9-f0c7-4797-831a-170b41a0880a", 
+            "tool_version": "1.0.0", 
+            "outputs": [
+                {
+                    "type": "input", 
+                    "name": "output"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionoutput": {
+                    "output_name": "output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "", 
+            "content_id": "__FILTER_FAILED_DATASETS__", 
+            "input_connections": {
+                "input": {
+                    "output_name": "tabularOutput", 
+                    "id": 9
+                }
+            }, 
+            "inputs": [], 
+            "position": {
+                "top": 325.29998779296875, 
+                "left": 2376.800048828125
+            }, 
+            "tool_state": "{\"input\": \"{\\\"__class__\\\": \\\"ConnectedValue\\\"}\", \"__rerun_remap_job_id__\": null, \"__page__\": null}", 
+            "label": null, 
+            "type": "tool", 
+            "id": 10, 
+            "name": "Filter failed"
+        }, 
+        "1": {
+            "tool_id": null, 
+            "errors": null, 
+            "uuid": "a71a2de8-e3d1-41d7-88b1-15a4badddbd1", 
+            "tool_version": null, 
+            "outputs": [], 
+            "workflow_outputs": [
+                {
+                    "output_name": "output", 
+                    "uuid": "879d9586-4960-4a9a-811a-539861b1bb5c", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": null, 
+            "input_connections": {}, 
+            "inputs": [], 
+            "position": {
+                "top": 481.5, 
+                "left": 1438.5
+            }, 
+            "tool_state": "{}", 
+            "label": "Nucleotide Viral BLAST database", 
+            "type": "data_input", 
+            "id": 1, 
+            "name": "Input dataset"
+        }, 
+        "0": {
+            "tool_id": null, 
+            "errors": null, 
+            "uuid": "1924c0c0-f1b4-4f75-bb92-4d96915b53cf", 
+            "tool_version": null, 
+            "outputs": [], 
+            "workflow_outputs": [
+                {
+                    "output_name": "output", 
+                    "uuid": "43258759-e62d-4424-a07f-afb75295f111", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": null, 
+            "input_connections": {}, 
+            "inputs": [], 
+            "position": {
+                "top": 259.5, 
+                "left": 148
+            }, 
+            "tool_state": "{\"collection_type\": \"list\"}", 
+            "label": "Patient sequences collection", 
+            "type": "data_collection_input", 
+            "id": 0, 
+            "name": "Input dataset collection"
+        }, 
+        "3": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.3.4.3", 
+            "errors": null, 
+            "uuid": "4ff96083-3bd4-4341-9d99-932c345b6409", 
+            "tool_version": "2.3.4.3", 
+            "outputs": [
+                {
+                    "type": "fastqsanger", 
+                    "name": "output_aligned_reads_l"
+                }, 
+                {
+                    "type": "bam", 
+                    "name": "output"
+                }
+            ], 
+            "post_job_actions": {
+                "DeleteIntermediatesActionoutput_unaligned_reads_l": {
+                    "output_name": "output_unaligned_reads_l", 
+                    "action_type": "DeleteIntermediatesAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionoutput": {
+                    "output_name": "output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "output_aligned_reads_l", 
+                    "uuid": "d4dc6292-97be-4c48-b9ec-f07006511452", 
+                    "label": null
+                }
+            ], 
+            "annotation": "Get viral sequences", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.3.4.3", 
+            "input_connections": {
+                "library|input_1": {
+                    "output_name": "output_unaligned_reads_l", 
+                    "id": 2
+                }
+            }, 
+            "inputs": [], 
+            "position": {
+                "top": 297.5, 
+                "left": 784.5
+            }, 
+            "tool_state": "{\"sam_options\": \"{\\\"__current_case__\\\": 0, \\\"no_unal\\\": \\\"false\\\", \\\"omit_sec_seq\\\": \\\"false\\\", \\\"reorder\\\": \\\"false\\\", \\\"sam_no_qname_trunc\\\": \\\"false\\\", \\\"sam_opt\\\": \\\"true\\\", \\\"sam_options_selector\\\": \\\"yes\\\", \\\"soft_clipped_unmapped_tlen\\\": \\\"false\\\", \\\"xeq\\\": \\\"false\\\"}\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"library\": \"{\\\"__current_case__\\\": 0, \\\"aligned_file\\\": \\\"true\\\", \\\"input_1\\\": {\\\"__class__\\\": \\\"ConnectedValue\\\"}, \\\"type\\\": \\\"single\\\", \\\"unaligned_file\\\": \\\"false\\\"}\", \"reference_genome\": \"{\\\"__current_case__\\\": 0, \\\"index\\\": \\\"vir2\\\", \\\"source\\\": \\\"indexed\\\"}\", \"rg\": \"{\\\"__current_case__\\\": 3, \\\"rg_selector\\\": \\\"do_not_set\\\"}\", \"save_mapping_stats\": \"\\\"false\\\"\", \"analysis_type\": \"{\\\"__current_case__\\\": 1, \\\"alignment_options\\\": {\\\"__current_case__\\\": 1, \\\"alignment_options_selector\\\": \\\"no\\\"}, \\\"analysis_type_selector\\\": \\\"full\\\", \\\"effort_options\\\": {\\\"__current_case__\\\": 1, \\\"effort_options_selector\\\": \\\"no\\\"}, \\\"input_options\\\": {\\\"__current_case__\\\": 1, \\\"input_options_selector\\\": \\\"no\\\"}, \\\"other_options\\\": {\\\"__current_case__\\\": 1, \\\"other_options_selector\\\": \\\"no\\\"}, \\\"reporting_options\\\": {\\\"__current_case__\\\": 1, \\\"k\\\": \\\"1\\\", \\\"reporting_options_selector\\\": \\\"k\\\"}, \\\"scoring_options\\\": {\\\"__current_case__\\\": 1, \\\"scoring_options_selector\\\": \\\"no\\\"}}\"}", 
+            "label": "Align sequences to vir2", 
+            "type": "tool", 
+            "id": 3, 
+            "tool_shed_repository": {
+                "owner": "devteam", 
+                "changeset_revision": "017aba02828d", 
+                "name": "bowtie2", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Bowtie2"
+        }, 
+        "2": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.3.4.3", 
+            "errors": null, 
+            "uuid": "034fd13d-f81e-40d6-98d4-6de709bf45fc", 
+            "tool_version": "2.3.4.3", 
+            "outputs": [
+                {
+                    "type": "fastqsanger", 
+                    "name": "output_unaligned_reads_l"
+                }, 
+                {
+                    "type": "bam", 
+                    "name": "output"
+                }
+            ], 
+            "post_job_actions": {
+                "DeleteIntermediatesActionoutput_unaligned_reads_l": {
+                    "output_name": "output_unaligned_reads_l", 
+                    "action_type": "DeleteIntermediatesAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionoutput_unaligned_reads_l": {
+                    "output_name": "output_unaligned_reads_l", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionoutput": {
+                    "output_name": "output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "Keep non host sequences only", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.3.4.3", 
+            "input_connections": {
+                "library|input_1": {
+                    "output_name": "output", 
+                    "id": 0
+                }
+            }, 
+            "inputs": [], 
+            "position": {
+                "top": 309.5, 
+                "left": 439
+            }, 
+            "tool_state": "{\"sam_options\": \"{\\\"__current_case__\\\": 1, \\\"sam_options_selector\\\": \\\"no\\\"}\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"library\": \"{\\\"__current_case__\\\": 0, \\\"aligned_file\\\": \\\"false\\\", \\\"input_1\\\": {\\\"__class__\\\": \\\"ConnectedValue\\\"}, \\\"type\\\": \\\"single\\\", \\\"unaligned_file\\\": \\\"true\\\"}\", \"reference_genome\": \"{\\\"__current_case__\\\": 0, \\\"index\\\": \\\"hg19\\\", \\\"source\\\": \\\"indexed\\\"}\", \"rg\": \"{\\\"__current_case__\\\": 3, \\\"rg_selector\\\": \\\"do_not_set\\\"}\", \"save_mapping_stats\": \"\\\"false\\\"\", \"analysis_type\": \"{\\\"__current_case__\\\": 1, \\\"alignment_options\\\": {\\\"__current_case__\\\": 1, \\\"alignment_options_selector\\\": \\\"no\\\"}, \\\"analysis_type_selector\\\": \\\"full\\\", \\\"effort_options\\\": {\\\"__current_case__\\\": 1, \\\"effort_options_selector\\\": \\\"no\\\"}, \\\"input_options\\\": {\\\"__current_case__\\\": 1, \\\"input_options_selector\\\": \\\"no\\\"}, \\\"other_options\\\": {\\\"__current_case__\\\": 1, \\\"other_options_selector\\\": \\\"no\\\"}, \\\"reporting_options\\\": {\\\"__current_case__\\\": 1, \\\"k\\\": \\\"1\\\", \\\"reporting_options_selector\\\": \\\"k\\\"}, \\\"scoring_options\\\": {\\\"__current_case__\\\": 1, \\\"scoring_options_selector\\\": \\\"no\\\"}}\"}", 
+            "label": "Align sequences to host", 
+            "type": "tool", 
+            "id": 2, 
+            "tool_shed_repository": {
+                "owner": "devteam", 
+                "changeset_revision": "017aba02828d", 
+                "name": "bowtie2", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Bowtie2"
+        }, 
+        "5": {
+            "tool_id": "Grouping1", 
+            "errors": null, 
+            "uuid": "f8742151-efbe-478c-b946-b3af40f417a7", 
+            "tool_version": "2.1.2", 
+            "outputs": [
+                {
+                    "type": "tabular", 
+                    "name": "out_file1"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionout_file1": {
+                    "output_name": "out_file1", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "", 
+            "content_id": "Grouping1", 
+            "input_connections": {
+                "input1": {
+                    "output_name": "output", 
+                    "id": 3
+                }
+            }, 
+            "inputs": [], 
+            "position": {
+                "top": 607.5, 
+                "left": 1134.5
+            }, 
+            "tool_state": "{\"operations\": \"[{\\\"__index__\\\": 0, \\\"opcol\\\": \\\"1\\\", \\\"opdefault\\\": \\\"\\\", \\\"opround\\\": \\\"no\\\", \\\"optype\\\": \\\"length\\\"}]\", \"__page__\": null, \"input1\": \"{\\\"__class__\\\": \\\"ConnectedValue\\\"}\", \"ignorelines\": \"[\\\"64\\\"]\", \"groupcol\": \"\\\"3\\\"\", \"__rerun_remap_job_id__\": null, \"ignorecase\": \"\\\"false\\\"\"}", 
+            "label": null, 
+            "type": "tool", 
+            "id": 5, 
+            "name": "Group"
+        }, 
+        "4": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/sequence_format_converter/sequence_format_converter/2.1.1", 
+            "errors": null, 
+            "uuid": "5b5f1aaa-015a-42e6-a7e8-22fa6a4e7d9f", 
+            "tool_version": "2.1.1", 
+            "outputs": [
+                {
+                    "type": "fasta", 
+                    "name": "output"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionoutput": {
+                    "output_name": "output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/sequence_format_converter/sequence_format_converter/2.1.1", 
+            "input_connections": {
+                "input": {
+                    "output_name": "output_aligned_reads_l", 
+                    "id": 3
+                }
+            }, 
+            "inputs": [], 
+            "position": {
+                "top": 345, 
+                "left": 1109
+            }, 
+            "tool_state": "{\"input\": \"{\\\"__class__\\\": \\\"ConnectedValue\\\"}\", \"output_format\": \"\\\"fasta\\\"\", \"__rerun_remap_job_id__\": null, \"__page__\": null}", 
+            "label": "Convert to fasta format", 
+            "type": "tool", 
+            "id": 4, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "f1d59113125a", 
+                "name": "sequence_format_converter", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "sequence_format_converter"
+        }, 
+        "7": {
+            "tool_id": "sort1", 
+            "errors": null, 
+            "uuid": "c60c407c-0296-48f8-952d-486b04157983", 
+            "tool_version": "1.1.0", 
+            "outputs": [
+                {
+                    "type": "input", 
+                    "name": "out_file1"
+                }
+            ], 
+            "post_job_actions": {
+                "RenameDatasetActionout_file1": {
+                    "output_name": "out_file1", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "putative false negatives"
+                    }
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "out_file1", 
+                    "uuid": "1c48eb75-314b-4f01-9b9a-dabb3ce53c49", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "sort1", 
+            "input_connections": {
+                "input": {
+                    "output_name": "out_file1", 
+                    "id": 5
+                }
+            }, 
+            "inputs": [], 
+            "position": {
+                "top": 699.5, 
+                "left": 1410.5
+            }, 
+            "tool_state": "{\"__page__\": null, \"style\": \"\\\"gennum\\\"\", \"column\": \"\\\"2\\\"\", \"__rerun_remap_job_id__\": null, \"column_set\": \"[]\", \"input\": \"{\\\"__class__\\\": \\\"ConnectedValue\\\"}\", \"header_lines\": \"\\\"0\\\"\", \"order\": \"\\\"DESC\\\"\"}", 
+            "label": null, 
+            "type": "tool", 
+            "id": 7, 
+            "name": "Sort"
+        }, 
+        "6": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/oases/oasesoptimiserv/1.2.2", 
+            "errors": null, 
+            "uuid": "e400772b-94e6-481d-9861-b473d898c636", 
+            "tool_version": "1.2.2", 
+            "outputs": [
+                {
+                    "type": "fasta", 
+                    "name": "transcripts"
+                }
+            ], 
+            "post_job_actions": {}, 
+            "workflow_outputs": [
+                {
+                    "output_name": "transcripts", 
+                    "uuid": "d9349948-b6e6-44f8-ac47-c834e008a297", 
+                    "label": null
+                }
+            ], 
+            "annotation": "Assemble contigs using the sequences not matching host and aligning to vir2", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/oases/oasesoptimiserv/1.2.2", 
+            "input_connections": {
+                "inputs_0|input": {
+                    "output_name": "output", 
+                    "id": 4
+                }
+            }, 
+            "inputs": [], 
+            "position": {
+                "top": 292.5, 
+                "left": 1444.5
+            }, 
+            "tool_state": "{\"__page__\": null, \"inputs\": \"[{\\\"__index__\\\": 0, \\\"input\\\": {\\\"__class__\\\": \\\"ConnectedValue\\\"}}]\", \"end_hash_length\": \"\\\"69\\\"\", \"__rerun_remap_job_id__\": null, \"start_hash_length\": \"\\\"13\\\"\"}", 
+            "label": "Assemble viral contigs", 
+            "type": "tool", 
+            "id": 6, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "f7dd852c8f4c", 
+                "name": "oases", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Oases_optimiser"
+        }, 
+        "9": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/blastparser_and_hits/BlastParser_and_hits/2.6.1", 
+            "errors": null, 
+            "uuid": "544ebd8f-75dc-4f79-9be1-496a1fcb54ca", 
+            "tool_version": "2.6.1", 
+            "outputs": [
+                {
+                    "type": "tabular", 
+                    "name": "tabularOutput"
+                }, 
+                {
+                    "type": "fasta", 
+                    "name": "fastaOutput"
+                }, 
+                {
+                    "type": "fasta", 
+                    "name": "al_sequences"
+                }, 
+                {
+                    "type": "fasta", 
+                    "name": "un_sequences"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActional_sequences": {
+                    "output_name": "al_sequences", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "RenameDatasetActiontabularOutput": {
+                    "output_name": "tabularOutput", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Virus identification"
+                    }
+                }, 
+                "HideDatasetActionun_sequences": {
+                    "output_name": "un_sequences", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionfastaOutput": {
+                    "output_name": "fastaOutput", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "tabularOutput", 
+                    "uuid": "6ed90eb2-2cf8-4808-80f8-3496bdfea1ca", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/blastparser_and_hits/BlastParser_and_hits/2.6.1", 
+            "input_connections": {
+                "blast": {
+                    "output_name": "output1", 
+                    "id": 8
+                }, 
+                "sequences": {
+                    "output_name": "transcripts", 
+                    "id": 6
+                }
+            }, 
+            "inputs": [], 
+            "position": {
+                "top": 223, 
+                "left": 2046
+            }, 
+            "tool_state": "{\"__page__\": null, \"flanking\": \"\\\"5\\\"\", \"additional_filters\": \"{\\\"__current_case__\\\": 1, \\\"filter_maxScore\\\": \\\"0.0\\\", \\\"filter_meanScore\\\": \\\"0.0\\\", \\\"filter_relativeCov\\\": \\\"0.0\\\", \\\"filter_term_in\\\": \\\"\\\", \\\"filter_term_out\\\": \\\"Patent\\\", \\\"use_filters\\\": \\\"yes\\\"}\", \"__rerun_remap_job_id__\": null, \"mode\": \"\\\"short\\\"\", \"sequences\": \"{\\\"__class__\\\": \\\"ConnectedValue\\\"}\", \"blast\": \"{\\\"__class__\\\": \\\"ConnectedValue\\\"}\"}", 
+            "label": "Get annotated contigs", 
+            "type": "tool", 
+            "id": 9, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "b4c9c085d709", 
+                "name": "blastparser_and_hits", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Parse blast output and compile hits"
+        }, 
+        "8": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.3.1", 
+            "errors": null, 
+            "uuid": "23b38bcf-42a6-4465-92f2-cfe8c22dbc88", 
+            "tool_version": "0.3.1", 
+            "outputs": [
+                {
+                    "type": "tabular", 
+                    "name": "output1"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionoutput1": {
+                    "output_name": "output1", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.3.1", 
+            "input_connections": {
+                "query": {
+                    "output_name": "transcripts", 
+                    "id": 6
+                }, 
+                "db_opts|histdb": {
+                    "output_name": "output", 
+                    "id": 1
+                }
+            }, 
+            "inputs": [], 
+            "position": {
+                "top": 445.5, 
+                "left": 1695
+            }, 
+            "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"__current_case__\\\": 2, \\\"ext_cols\\\": [\\\"slen\\\"], \\\"ids_cols\\\": null, \\\"misc_cols\\\": null, \\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"tax_cols\\\": null}\", \"adv_opts\": \"{\\\"__current_case__\\\": 0, \\\"adv_opts_selector\\\": \\\"basic\\\"}\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"db_opts\": \"{\\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\", \\\"db_opts_selector\\\": \\\"histdb\\\", \\\"histdb\\\": {\\\"__class__\\\": \\\"ConnectedValue\\\"}, \\\"subject\\\": \\\"\\\"}\", \"blast_type\": \"\\\"blastn\\\"\", \"query\": \"{\\\"__class__\\\": \\\"ConnectedValue\\\"}\"}", 
+            "label": "Blastn against vir2", 
+            "type": "tool", 
+            "id": 8, 
+            "tool_shed_repository": {
+                "owner": "devteam", 
+                "changeset_revision": "e25d3acf6e68", 
+                "name": "ncbi_blast_plus", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "NCBI BLAST+ blastn"
+        }
+    }, 
+    "annotation": "", 
+    "name": "Metavisitor: Workflow for Use Case 3-2"
+}
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_3-3.ga	Sun Jul 21 19:22:52 2019 -0400
@@ -0,0 +1,877 @@
+{
+    "a_galaxy_workflow": "true", 
+    "uuid": "cfda03c1-3179-4cb6-b8a8-d84fef2605b5", 
+    "tags": [], 
+    "format-version": "0.1", 
+    "version": 3, 
+    "steps": {
+        "11": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.3.1", 
+            "errors": null, 
+            "uuid": "d0f02742-1a80-4727-8e99-0eeff6e5a9d4", 
+            "tool_version": "0.3.1", 
+            "outputs": [
+                {
+                    "type": "tabular", 
+                    "name": "output1"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionoutput1": {
+                    "output_name": "output1", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.3.1", 
+            "input_connections": {
+                "query": {
+                    "output_name": "fastaOutput", 
+                    "id": 9
+                }, 
+                "db_opts|histdb": {
+                    "output_name": "outfile", 
+                    "id": 4
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "db_opts", 
+                    "description": "runtime parameter for tool NCBI BLAST+ blastn"
+                }, 
+                {
+                    "name": "query", 
+                    "description": "runtime parameter for tool NCBI BLAST+ blastn"
+                }
+            ], 
+            "position": {
+                "top": 573.5, 
+                "left": 1908
+            }, 
+            "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"__current_case__\\\": 2, \\\"ext_cols\\\": [\\\"slen\\\"], \\\"ids_cols\\\": null, \\\"misc_cols\\\": null, \\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"tax_cols\\\": null}\", \"adv_opts\": \"{\\\"__current_case__\\\": 0, \\\"adv_opts_selector\\\": \\\"basic\\\"}\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"db_opts\": \"{\\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\", \\\"db_opts_selector\\\": \\\"histdb\\\", \\\"histdb\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"subject\\\": \\\"\\\"}\", \"blast_type\": \"\\\"blastn\\\"\", \"query\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", 
+            "label": "Blastn against reference virus", 
+            "type": "tool", 
+            "id": 11, 
+            "tool_shed_repository": {
+                "owner": "devteam", 
+                "changeset_revision": "e25d3acf6e68", 
+                "name": "ncbi_blast_plus", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "NCBI BLAST+ blastn"
+        }, 
+        "10": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", 
+            "errors": null, 
+            "uuid": "70bd7f8d-f58e-47b8-963b-c015480b9e7f", 
+            "tool_version": "1.4.1", 
+            "outputs": [
+                {
+                    "type": "input", 
+                    "name": "paired_output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "list_output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "out_file1"
+                }, 
+                {
+                    "type": "_sniff_", 
+                    "name": "paired_out_file"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionpaired_out_file": {
+                    "output_name": "paired_out_file", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "RenameDatasetActionout_file1": {
+                    "output_name": "out_file1", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Global report for ${target_virus}"
+                    }
+                }, 
+                "HideDatasetActionpaired_output": {
+                    "output_name": "paired_output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionlist_output": {
+                    "output_name": "list_output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "out_file1", 
+                    "uuid": "cd026d6f-c2a8-4b1d-9bee-5c90412f4219", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", 
+            "input_connections": {
+                "global_condition|inputs": {
+                    "output_name": "tabularOutput", 
+                    "id": 9
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "global_condition", 
+                    "description": "runtime parameter for tool Concatenate multiple datasets"
+                }
+            ], 
+            "position": {
+                "top": 375.5, 
+                "left": 1886
+            }, 
+            "tool_state": "{\"dataset_names\": \"\\\"false\\\"\", \"headers\": \"\\\"0\\\"\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"global_condition\": \"{\\\"__current_case__\\\": 0, \\\"input_type\\\": \\\"singles\\\", \\\"inputs\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\"}", 
+            "label": "Concatenate results", 
+            "type": "tool", 
+            "id": 10, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "55cf9d9defd1", 
+                "name": "concatenate_multiple_datasets", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Concatenate multiple datasets"
+        }, 
+        "13": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", 
+            "errors": null, 
+            "uuid": "3ff7bd53-c8ac-4b5f-97d2-fb52d8ee17d0", 
+            "tool_version": "1.4.1", 
+            "outputs": [
+                {
+                    "type": "input", 
+                    "name": "paired_output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "list_output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "out_file1"
+                }, 
+                {
+                    "type": "_sniff_", 
+                    "name": "paired_out_file"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionpaired_out_file": {
+                    "output_name": "paired_out_file", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "RenameDatasetActionout_file1": {
+                    "output_name": "out_file1", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Genome Reconstruction guided by ${reference_virus}"
+                    }
+                }, 
+                "HideDatasetActionpaired_output": {
+                    "output_name": "paired_output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionlist_output": {
+                    "output_name": "list_output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "out_file1", 
+                    "uuid": "ff6b2acb-6c1f-40a8-907d-8e060a832dea", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", 
+            "input_connections": {
+                "global_condition|inputs": {
+                    "output_name": "output", 
+                    "id": 12
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "global_condition", 
+                    "description": "runtime parameter for tool Concatenate multiple datasets"
+                }
+            ], 
+            "position": {
+                "top": 756.5, 
+                "left": 2565
+            }, 
+            "tool_state": "{\"dataset_names\": \"\\\"false\\\"\", \"headers\": \"\\\"0\\\"\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"global_condition\": \"{\\\"__current_case__\\\": 0, \\\"input_type\\\": \\\"singles\\\", \\\"inputs\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\"}", 
+            "label": "Genome", 
+            "type": "tool", 
+            "id": 13, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "55cf9d9defd1", 
+                "name": "concatenate_multiple_datasets", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Concatenate multiple datasets"
+        }, 
+        "12": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/blast_to_scaffold/blast2scaffold/1.0.0", 
+            "errors": null, 
+            "uuid": "df99e368-2ff9-4e2e-9bdf-dccc621e6e47", 
+            "tool_version": "1.0.0", 
+            "outputs": [
+                {
+                    "type": "fasta", 
+                    "name": "output"
+                }
+            ], 
+            "post_job_actions": {
+                "RenameDatasetActionoutput": {
+                    "output_name": "output", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Scaffolds"
+                    }
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "output", 
+                    "uuid": "7c49b9a3-6540-4770-a3cf-18416441a5af", 
+                    "label": null
+                }
+            ], 
+            "annotation": "Piece chromosomes together from contigs and blast results", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/blast_to_scaffold/blast2scaffold/1.0.0", 
+            "input_connections": {
+                "guideSequence": {
+                    "output_name": "outfile", 
+                    "id": 2
+                }, 
+                "blast_tab": {
+                    "output_name": "output1", 
+                    "id": 11
+                }, 
+                "sequences": {
+                    "output_name": "fastaOutput", 
+                    "id": 9
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "guideSequence", 
+                    "description": "runtime parameter for tool blast_to_scaffold"
+                }, 
+                {
+                    "name": "blast_tab", 
+                    "description": "runtime parameter for tool blast_to_scaffold"
+                }, 
+                {
+                    "name": "sequences", 
+                    "description": "runtime parameter for tool blast_to_scaffold"
+                }
+            ], 
+            "position": {
+                "top": 776.5, 
+                "left": 2179
+            }, 
+            "tool_state": "{\"__page__\": null, \"guideSequence\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"blast_tab\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"sequences\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", 
+            "label": "Scaffolding", 
+            "type": "tool", 
+            "id": 12, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "7d96b28eec49", 
+                "name": "blast_to_scaffold", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "blast_to_scaffold"
+        }, 
+        "1": {
+            "tool_id": null, 
+            "errors": null, 
+            "uuid": "30e4096f-0816-4c57-944c-5076821b5e11", 
+            "tool_version": null, 
+            "outputs": [], 
+            "workflow_outputs": [
+                {
+                    "output_name": "output", 
+                    "uuid": "d8f64c21-0dad-430d-b2cf-570a0093192f", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": null, 
+            "input_connections": {}, 
+            "inputs": [], 
+            "position": {
+                "top": 804, 
+                "left": 987.5
+            }, 
+            "tool_state": "{}", 
+            "label": "Nucleotide Viral Blast Database", 
+            "type": "data_input", 
+            "id": 1, 
+            "name": "Input dataset"
+        }, 
+        "0": {
+            "tool_id": null, 
+            "errors": null, 
+            "uuid": "b9f1fc8f-7b62-4dcf-bf19-169ddd64b7ed", 
+            "tool_version": null, 
+            "outputs": [], 
+            "workflow_outputs": [
+                {
+                    "output_name": "output", 
+                    "uuid": "e567b4b7-0d78-4491-907d-20c07ea4494c", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": null, 
+            "input_connections": {}, 
+            "inputs": [], 
+            "position": {
+                "top": 200, 
+                "left": 200
+            }, 
+            "tool_state": "{\"collection_type\": \"list\"}", 
+            "label": "Patient sequence collection", 
+            "type": "data_collection_input", 
+            "id": 0, 
+            "name": "Input dataset collection"
+        }, 
+        "3": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.3.4.3", 
+            "errors": null, 
+            "uuid": "4d9c2aaa-0ae3-4c56-b055-303ae68dd839", 
+            "tool_version": "2.3.4.3", 
+            "outputs": [
+                {
+                    "type": "fastqsanger", 
+                    "name": "output_unaligned_reads_l"
+                }, 
+                {
+                    "type": "fastqsanger", 
+                    "name": "output_aligned_reads_l"
+                }, 
+                {
+                    "type": "fastqsanger", 
+                    "name": "output_aligned_reads_r"
+                }, 
+                {
+                    "type": "fastqsanger", 
+                    "name": "output_unaligned_reads_r"
+                }, 
+                {
+                    "type": "bam", 
+                    "name": "output"
+                }, 
+                {
+                    "type": "txt", 
+                    "name": "mapping_stats"
+                }
+            ], 
+            "post_job_actions": {
+                "DeleteIntermediatesActionoutput_unaligned_reads_l": {
+                    "output_name": "output_unaligned_reads_l", 
+                    "action_type": "DeleteIntermediatesAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionoutput_unaligned_reads_r": {
+                    "output_name": "output_unaligned_reads_r", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionoutput": {
+                    "output_name": "output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionoutput_aligned_reads_l": {
+                    "output_name": "output_aligned_reads_l", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionmapping_stats": {
+                    "output_name": "mapping_stats", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionoutput_aligned_reads_r": {
+                    "output_name": "output_aligned_reads_r", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionoutput_unaligned_reads_l": {
+                    "output_name": "output_unaligned_reads_l", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "Get viral reads", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.3.4.3", 
+            "input_connections": {
+                "library|input_1": {
+                    "output_name": "output", 
+                    "id": 0
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "library", 
+                    "description": "runtime parameter for tool Bowtie2"
+                }
+            ], 
+            "position": {
+                "top": 209, 
+                "left": 472
+            }, 
+            "tool_state": "{\"sam_options\": \"{\\\"__current_case__\\\": 1, \\\"sam_options_selector\\\": \\\"no\\\"}\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"library\": \"{\\\"__current_case__\\\": 0, \\\"aligned_file\\\": \\\"true\\\", \\\"input_1\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"type\\\": \\\"single\\\", \\\"unaligned_file\\\": \\\"false\\\"}\", \"reference_genome\": \"{\\\"__current_case__\\\": 0, \\\"index\\\": \\\"vir2\\\", \\\"source\\\": \\\"indexed\\\"}\", \"rg\": \"{\\\"__current_case__\\\": 3, \\\"rg_selector\\\": \\\"do_not_set\\\"}\", \"save_mapping_stats\": \"\\\"false\\\"\", \"analysis_type\": \"{\\\"__current_case__\\\": 1, \\\"alignment_options\\\": {\\\"__current_case__\\\": 1, \\\"alignment_options_selector\\\": \\\"no\\\"}, \\\"analysis_type_selector\\\": \\\"full\\\", \\\"effort_options\\\": {\\\"__current_case__\\\": 1, \\\"effort_options_selector\\\": \\\"no\\\"}, \\\"input_options\\\": {\\\"__current_case__\\\": 1, \\\"input_options_selector\\\": \\\"no\\\"}, \\\"other_options\\\": {\\\"__current_case__\\\": 1, \\\"other_options_selector\\\": \\\"no\\\"}, \\\"reporting_options\\\": {\\\"__current_case__\\\": 1, \\\"k\\\": \\\"1\\\", \\\"reporting_options_selector\\\": \\\"k\\\"}, \\\"scoring_options\\\": {\\\"__current_case__\\\": 1, \\\"scoring_options_selector\\\": \\\"no\\\"}}\"}", 
+            "label": "Align sequences to vir2", 
+            "type": "tool", 
+            "id": 3, 
+            "tool_shed_repository": {
+                "owner": "devteam", 
+                "changeset_revision": "017aba02828d", 
+                "name": "bowtie2", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Bowtie2"
+        }, 
+        "2": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/2.3.0", 
+            "errors": null, 
+            "uuid": "990928c3-280a-44eb-900f-f57ae0a27d2e", 
+            "tool_version": "2.3.0", 
+            "outputs": [
+                {
+                    "type": "fasta", 
+                    "name": "outfile"
+                }, 
+                {
+                    "type": "txt", 
+                    "name": "logfile"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionoutfile": {
+                    "output_name": "outfile", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionlogfile": {
+                    "output_name": "logfile", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "RenameDatasetActionoutfile": {
+                    "output_name": "outfile", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "${reference_virus}"
+                    }
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/2.3.0", 
+            "input_connections": {}, 
+            "inputs": [], 
+            "position": {
+                "top": 961.5, 
+                "left": 1256.5
+            }, 
+            "tool_state": "{\"__page__\": null, \"__rerun_remap_job_id__\": null, \"queryString\": \"\\\"${reference_virus}\\\"\", \"dbname\": \"\\\"nuccore\\\"\", \"dry_run\": \"\\\"false\\\"\"}", 
+            "label": "Download reference virus sequences", 
+            "type": "tool", 
+            "id": 2, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "c667d0ee39f5", 
+                "name": "fetch_fasta_from_ncbi", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Retrieve FASTA from NCBI"
+        }, 
+        "5": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/trinity/trinity/2.8.4", 
+            "errors": null, 
+            "uuid": "8794054f-4773-4fac-9946-2b428db2ca7c", 
+            "tool_version": "2.8.4", 
+            "outputs": [
+                {
+                    "type": "fasta", 
+                    "name": "assembled_transcripts"
+                }, 
+                {
+                    "type": "tabular", 
+                    "name": "gene_to_trans"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionassembled_transcripts": {
+                    "output_name": "assembled_transcripts", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActiongene_to_trans": {
+                    "output_name": "gene_to_trans", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "RenameDatasetActionassembled_transcripts": {
+                    "output_name": "assembled_transcripts", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Assembled viral transcripts"
+                    }
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/trinity/trinity/2.8.4", 
+            "input_connections": {
+                "pool|inputs|input": {
+                    "output_name": "output_aligned_reads_l", 
+                    "id": 3
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "additional_params", 
+                    "description": "runtime parameter for tool Trinity"
+                }
+            ], 
+            "position": {
+                "top": 236.5, 
+                "left": 787.5
+            }, 
+            "tool_state": "{\"__page__\": null, \"__rerun_remap_job_id__\": null, \"norm\": \"\\\"true\\\"\", \"additional_params\": \"{\\\"guided\\\": {\\\"__current_case__\\\": 0, \\\"is_guided\\\": \\\"no\\\"}, \\\"long_reads\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"min_contig_length\\\": \\\"200\\\", \\\"min_kmer_cov\\\": \\\"1\\\"}\", \"pool\": \"{\\\"__current_case__\\\": 1, \\\"inputs\\\": {\\\"__current_case__\\\": 0, \\\"input\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"paired_or_single\\\": \\\"unmerged_single_collection\\\", \\\"strand\\\": {\\\"__current_case__\\\": 0, \\\"is_strand_specific\\\": \\\"false\\\"}}, \\\"pool_mode\\\": \\\"No\\\"}\"}", 
+            "label": "Assemble de-novo contigs", 
+            "type": "tool", 
+            "id": 5, 
+            "tool_shed_repository": {
+                "owner": "iuc", 
+                "changeset_revision": "c9cfec002f71", 
+                "name": "trinity", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Trinity"
+        }, 
+        "4": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_makeblastdb/0.3.1", 
+            "errors": null, 
+            "uuid": "ffd44a63-87cc-407f-a8fd-22ecebc86d7c", 
+            "tool_version": "0.3.1", 
+            "outputs": [
+                {
+                    "type": "data", 
+                    "name": "outfile"
+                }
+            ], 
+            "post_job_actions": {}, 
+            "workflow_outputs": [
+                {
+                    "output_name": "outfile", 
+                    "uuid": "3c4db7d1-60cc-4674-ae3a-ff71d29e6282", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_makeblastdb/0.3.1", 
+            "input_connections": {
+                "input_file": {
+                    "output_name": "outfile", 
+                    "id": 2
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "mask_data_file", 
+                    "description": "runtime parameter for tool NCBI BLAST+ makeblastdb"
+                }, 
+                {
+                    "name": "input_file", 
+                    "description": "runtime parameter for tool NCBI BLAST+ makeblastdb"
+                }
+            ], 
+            "position": {
+                "top": 804.5, 
+                "left": 1585
+            }, 
+            "tool_state": "{\"__page__\": null, \"mask_data_file\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"input_file\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"dbtype\": \"\\\"nucl\\\"\", \"__rerun_remap_job_id__\": null, \"hash_index\": \"\\\"true\\\"\", \"tax\": \"{\\\"__current_case__\\\": 0, \\\"taxselect\\\": \\\"\\\"}\", \"title\": \"\\\"reference virus blast nucleotide database\\\"\", \"parse_seqids\": \"\\\"false\\\"\"}", 
+            "label": null, 
+            "type": "tool", 
+            "id": 4, 
+            "tool_shed_repository": {
+                "owner": "devteam", 
+                "changeset_revision": "e25d3acf6e68", 
+                "name": "ncbi_blast_plus", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "NCBI BLAST+ makeblastdb"
+        }, 
+        "7": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/galaxyp/regex_find_replace/regex1/1.0.0", 
+            "errors": null, 
+            "uuid": "bbbe94b0-d9ac-4912-9f50-06b9ddffdd44", 
+            "tool_version": "1.0.0", 
+            "outputs": [
+                {
+                    "type": "input", 
+                    "name": "out_file1"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionout_file1": {
+                    "output_name": "out_file1", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/galaxyp/regex_find_replace/regex1/1.0.0", 
+            "input_connections": {
+                "input": {
+                    "output_name": "output", 
+                    "id": 6
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "input", 
+                    "description": "runtime parameter for tool Regex Find And Replace"
+                }
+            ], 
+            "position": {
+                "top": 491, 
+                "left": 1158.5
+            }, 
+            "tool_state": "{\"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"checks\": \"[{\\\"__index__\\\": 0, \\\"pattern\\\": \\\">(.+) len=.+\\\", \\\"replacement\\\": \\\">\\\\\\\\1\\\"}]\", \"__page__\": null}", 
+            "label": "Format header", 
+            "type": "tool", 
+            "id": 7, 
+            "tool_shed_repository": {
+                "owner": "galaxyp", 
+                "changeset_revision": "209b7c5ee9d7", 
+                "name": "regex_find_replace", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Regex Find And Replace"
+        }, 
+        "6": {
+            "tool_id": "__FILTER_FAILED_DATASETS__", 
+            "errors": null, 
+            "uuid": "7738d11d-42fb-44a9-a175-184152318422", 
+            "tool_version": "1.0.0", 
+            "outputs": [
+                {
+                    "type": "input", 
+                    "name": "output"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionoutput": {
+                    "output_name": "output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "", 
+            "content_id": "__FILTER_FAILED_DATASETS__", 
+            "input_connections": {
+                "input": {
+                    "output_name": "assembled_transcripts", 
+                    "id": 5
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "input", 
+                    "description": "runtime parameter for tool Filter failed"
+                }
+            ], 
+            "position": {
+                "top": 340, 
+                "left": 1110.5
+            }, 
+            "tool_state": "{\"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"__page__\": null}", 
+            "label": null, 
+            "type": "tool", 
+            "id": 6, 
+            "name": "Filter failed"
+        }, 
+        "9": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/blastparser_and_hits/BlastParser_and_hits/2.6.1", 
+            "errors": null, 
+            "uuid": "6846a128-1409-4534-8f4f-f386b864dc38", 
+            "tool_version": "2.6.1", 
+            "outputs": [
+                {
+                    "type": "tabular", 
+                    "name": "tabularOutput"
+                }, 
+                {
+                    "type": "fasta", 
+                    "name": "fastaOutput"
+                }, 
+                {
+                    "type": "fasta", 
+                    "name": "al_sequences"
+                }, 
+                {
+                    "type": "fasta", 
+                    "name": "un_sequences"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActional_sequences": {
+                    "output_name": "al_sequences", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionun_sequences": {
+                    "output_name": "un_sequences", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "tabularOutput", 
+                    "uuid": "459e0df1-94a8-4704-bde0-b90624aaeb0b", 
+                    "label": null
+                }, 
+                {
+                    "output_name": "fastaOutput", 
+                    "uuid": "6f2fc9ca-7c78-4e74-ada3-abda93e26477", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/blastparser_and_hits/BlastParser_and_hits/2.6.1", 
+            "input_connections": {
+                "blast": {
+                    "output_name": "output1", 
+                    "id": 8
+                }, 
+                "sequences": {
+                    "output_name": "out_file1", 
+                    "id": 7
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "blast", 
+                    "description": "runtime parameter for tool Parse blast output and compile hits"
+                }, 
+                {
+                    "name": "sequences", 
+                    "description": "runtime parameter for tool Parse blast output and compile hits"
+                }
+            ], 
+            "position": {
+                "top": 435, 
+                "left": 1500
+            }, 
+            "tool_state": "{\"__page__\": null, \"flanking\": \"\\\"0\\\"\", \"additional_filters\": \"{\\\"__current_case__\\\": 1, \\\"filter_maxScore\\\": \\\"0.0\\\", \\\"filter_meanScore\\\": \\\"100.0\\\", \\\"filter_relativeCov\\\": \\\"0.0\\\", \\\"filter_term_in\\\": \\\"${target_virus}\\\", \\\"filter_term_out\\\": \\\"Patent\\\", \\\"use_filters\\\": \\\"yes\\\"}\", \"__rerun_remap_job_id__\": null, \"mode\": \"\\\"short\\\"\", \"sequences\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"blast\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", 
+            "label": null, 
+            "type": "tool", 
+            "id": 9, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "b4c9c085d709", 
+                "name": "blastparser_and_hits", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Parse blast output and compile hits"
+        }, 
+        "8": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.3.1", 
+            "errors": null, 
+            "uuid": "f03fce77-a89c-42fd-b297-e001fbdb3105", 
+            "tool_version": "0.3.1", 
+            "outputs": [
+                {
+                    "type": "tabular", 
+                    "name": "output1"
+                }
+            ], 
+            "post_job_actions": {
+                "RenameDatasetActionoutput1": {
+                    "output_name": "output1", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "blastN of trinity contigs"
+                    }
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "output1", 
+                    "uuid": "62f022d6-1ef0-47ba-951d-377a35a4d339", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.3.1", 
+            "input_connections": {
+                "query": {
+                    "output_name": "out_file1", 
+                    "id": 7
+                }, 
+                "db_opts|histdb": {
+                    "output_name": "output", 
+                    "id": 1
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "db_opts", 
+                    "description": "runtime parameter for tool NCBI BLAST+ blastn"
+                }, 
+                {
+                    "name": "query", 
+                    "description": "runtime parameter for tool NCBI BLAST+ blastn"
+                }
+            ], 
+            "position": {
+                "top": 739, 
+                "left": 1201
+            }, 
+            "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"__current_case__\\\": 2, \\\"ext_cols\\\": [\\\"slen\\\"], \\\"ids_cols\\\": null, \\\"misc_cols\\\": null, \\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"tax_cols\\\": null}\", \"adv_opts\": \"{\\\"__current_case__\\\": 0, \\\"adv_opts_selector\\\": \\\"basic\\\"}\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"db_opts\": \"{\\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\", \\\"db_opts_selector\\\": \\\"histdb\\\", \\\"histdb\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"subject\\\": \\\"\\\"}\", \"blast_type\": \"\\\"blastn\\\"\", \"query\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", 
+            "label": "Blastn against vir2", 
+            "type": "tool", 
+            "id": 8, 
+            "tool_shed_repository": {
+                "owner": "devteam", 
+                "changeset_revision": "e25d3acf6e68", 
+                "name": "ncbi_blast_plus", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "NCBI BLAST+ blastn"
+        }
+    }, 
+    "annotation": "", 
+    "name": "Metavisitor: Workflow for Use Case 3-3"
+}
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/Galaxy-Workflow-Metavisitor__Workflow_for_nucleic_vir2_generation.ga	Sun Jul 21 19:22:52 2019 -0400
@@ -0,0 +1,318 @@
+{
+    "a_galaxy_workflow": "true", 
+    "uuid": "742e3aa8-0dc5-440d-8120-3b10f4e7308d", 
+    "tags": [], 
+    "format-version": "0.1", 
+    "version": 1, 
+    "steps": {
+        "1": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/2.3.0", 
+            "errors": null, 
+            "uuid": "25b4eea6-c049-4432-9ebb-5b7c7a17e24b", 
+            "tool_version": "2.3.0", 
+            "outputs": [
+                {
+                    "type": "fasta", 
+                    "name": "outfile"
+                }, 
+                {
+                    "type": "txt", 
+                    "name": "logfile"
+                }
+            ], 
+            "post_job_actions": {}, 
+            "workflow_outputs": [
+                {
+                    "output_name": "outfile", 
+                    "uuid": "b5b6d8a1-5d12-4df9-97e3-f82124301e24", 
+                    "label": null
+                }, 
+                {
+                    "output_name": "logfile", 
+                    "uuid": "8243ff90-8e45-4d12-b9d0-ea17ee0dd3c0", 
+                    "label": null
+                }
+            ], 
+            "annotation": "sequences > 10 000bp", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/2.3.0", 
+            "input_connections": {}, 
+            "inputs": [], 
+            "position": {
+                "top": 563, 
+                "left": 200
+            }, 
+            "tool_state": "{\"__page__\": null, \"__rerun_remap_job_id__\": null, \"queryString\": \"\\\"txid10239[Organism] NOT txid131567[Organism] NOT phage[All Fields] NOT patent[All Fields] NOT chimeric[Title] NOT vector[Title] NOT method[Title] NOT X174[All Fields] AND 10001:1300000[Sequence length]\\\"\", \"dbname\": \"\\\"nuccore\\\"\", \"dry_run\": \"\\\"false\\\"\"}", 
+            "label": "Get long sequences", 
+            "type": "tool", 
+            "id": 1, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "c667d0ee39f5", 
+                "name": "fetch_fasta_from_ncbi", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Retrieve FASTA from NCBI"
+        }, 
+        "0": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/2.3.0", 
+            "errors": null, 
+            "uuid": "9c3e474c-3e57-4378-a5cc-ef9c6b7b092a", 
+            "tool_version": "2.3.0", 
+            "outputs": [
+                {
+                    "type": "fasta", 
+                    "name": "outfile"
+                }, 
+                {
+                    "type": "txt", 
+                    "name": "logfile"
+                }
+            ], 
+            "post_job_actions": {}, 
+            "workflow_outputs": [
+                {
+                    "output_name": "outfile", 
+                    "uuid": "f1d297ff-bf05-41ac-b262-4901674827a2", 
+                    "label": null
+                }, 
+                {
+                    "output_name": "logfile", 
+                    "uuid": "b27a01c2-0d64-4aae-941d-946dd21e6bd2", 
+                    "label": null
+                }
+            ], 
+            "annotation": "sequences <= 10 000bp", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/2.3.0", 
+            "input_connections": {}, 
+            "inputs": [], 
+            "position": {
+                "top": 241, 
+                "left": 213
+            }, 
+            "tool_state": "{\"__page__\": null, \"__rerun_remap_job_id__\": null, \"queryString\": \"\\\"txid10239[Organism] NOT txid131567[Organism] NOT phage[All Fields] NOT patent[All Fields] NOT chimeric[Title] NOT vector[Title] NOT method[Title] NOT X174[All Fields] AND 301:10000[Sequence length]\\\"\", \"dbname\": \"\\\"nuccore\\\"\", \"dry_run\": \"\\\"false\\\"\"}", 
+            "label": "Get short sequences", 
+            "type": "tool", 
+            "id": 0, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "c667d0ee39f5", 
+                "name": "fetch_fasta_from_ncbi", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Retrieve FASTA from NCBI"
+        }, 
+        "3": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", 
+            "errors": null, 
+            "uuid": "94beda09-1785-4da8-84ec-70773fa6eddd", 
+            "tool_version": "1.4.1", 
+            "outputs": [
+                {
+                    "type": "input", 
+                    "name": "paired_output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "list_output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "out_file1"
+                }, 
+                {
+                    "type": "_sniff_", 
+                    "name": "paired_out_file"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionpaired_out_file": {
+                    "output_name": "paired_out_file", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "RenameDatasetActionout_file1": {
+                    "output_name": "out_file1", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Vir2"
+                    }
+                }, 
+                "HideDatasetActionpaired_output": {
+                    "output_name": "paired_output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionout_file1": {
+                    "output_name": "out_file1", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionlist_output": {
+                    "output_name": "list_output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", 
+            "input_connections": {
+                "global_condition|inputs": [
+                    {
+                        "output_name": "centroids", 
+                        "id": 2
+                    }, 
+                    {
+                        "output_name": "outfile", 
+                        "id": 1
+                    }
+                ]
+            }, 
+            "inputs": [
+                {
+                    "name": "global_condition", 
+                    "description": "runtime parameter for tool Concatenate multiple datasets"
+                }
+            ], 
+            "position": {
+                "top": 571.5, 
+                "left": 735
+            }, 
+            "tool_state": "{\"dataset_names\": \"\\\"false\\\"\", \"headers\": \"\\\"0\\\"\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"global_condition\": \"{\\\"__current_case__\\\": 0, \\\"input_type\\\": \\\"singles\\\", \\\"inputs\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\"}", 
+            "label": "Vir2", 
+            "type": "tool", 
+            "id": 3, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "55cf9d9defd1", 
+                "name": "concatenate_multiple_datasets", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Concatenate multiple datasets"
+        }, 
+        "2": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/vsearch/vsearch_clustering/2.8.3.0", 
+            "errors": null, 
+            "uuid": "6fddbef5-bc89-4574-a0cf-335aee053e4c", 
+            "tool_version": "2.8.3.0", 
+            "outputs": [
+                {
+                    "type": "fasta", 
+                    "name": "msaout"
+                }, 
+                {
+                    "type": "fasta", 
+                    "name": "consout"
+                }, 
+                {
+                    "type": "fasta", 
+                    "name": "centroids"
+                }, 
+                {
+                    "type": "fasta", 
+                    "name": "alnout"
+                }, 
+                {
+                    "type": "fasta", 
+                    "name": "notmatched"
+                }, 
+                {
+                    "type": "fasta", 
+                    "name": "matched"
+                }, 
+                {
+                    "type": "tabular", 
+                    "name": "blast6out"
+                }, 
+                {
+                    "type": "fasta", 
+                    "name": "fastapairs"
+                }, 
+                {
+                    "type": "tabular", 
+                    "name": "uc_outfile"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionfastapairs": {
+                    "output_name": "fastapairs", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionconsout": {
+                    "output_name": "consout", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionmsaout": {
+                    "output_name": "msaout", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionalnout": {
+                    "output_name": "alnout", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionblast6out": {
+                    "output_name": "blast6out", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionuc_outfile": {
+                    "output_name": "uc_outfile", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionnotmatched": {
+                    "output_name": "notmatched", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionmatched": {
+                    "output_name": "matched", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "centroids", 
+                    "uuid": "091f386f-32e1-4270-8754-9da84c187b82", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/vsearch/vsearch_clustering/2.8.3.0", 
+            "input_connections": {
+                "infile": {
+                    "output_name": "outfile", 
+                    "id": 0
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "infile", 
+                    "description": "runtime parameter for tool VSearch clustering"
+                }
+            ], 
+            "position": {
+                "top": 232, 
+                "left": 463.5
+            }, 
+            "tool_state": "{\"sizein\": \"\\\"false\\\"\", \"cons_truncate\": \"\\\"false\\\"\", \"__page__\": null, \"maxrejects\": \"\\\"32\\\"\", \"usersort\": \"\\\"false\\\"\", \"qmask\": \"\\\"dust\\\"\", \"iddef\": \"\\\"2\\\"\", \"__rerun_remap_job_id__\": null, \"clustering_mode\": \"{\\\"__current_case__\\\": 0, \\\"clustering_mode_select\\\": \\\"cluster_fast\\\"}\", \"id\": \"\\\"0.95\\\"\", \"sizeout\": \"\\\"false\\\"\", \"strand\": \"\\\"plus\\\"\", \"outputs\": \"[\\\"--centroids\\\"]\", \"maxaccepts\": \"\\\"1\\\"\", \"infile\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"uc\": \"\\\"false\\\"\"}", 
+            "label": "Get centroids", 
+            "type": "tool", 
+            "id": 2, 
+            "tool_shed_repository": {
+                "owner": "iuc", 
+                "changeset_revision": "b3c7199d8786", 
+                "name": "vsearch", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "VSearch clustering"
+        }
+    }, 
+    "annotation": "", 
+    "name": "Metavisitor: Workflow for nucleic vir2 generation"
+}
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/Galaxy-Workflow-Metavisitor__Workflow_for_nucleic_vir2_generation_and_test.ga	Sun Jul 21 19:22:52 2019 -0400
@@ -0,0 +1,799 @@
+{
+    "a_galaxy_workflow": "true", 
+    "uuid": "5fc55e4d-f7b4-4fb7-bca0-00551ceaebd4", 
+    "tags": [], 
+    "format-version": "0.1", 
+    "version": 1, 
+    "steps": {
+        "11": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/blast_unmatched/blast_unmatched/0.5.0", 
+            "errors": null, 
+            "uuid": "bb4c2955-a0a3-4e16-a4c8-49add3f6570d", 
+            "tool_version": "0.5.0", 
+            "outputs": [
+                {
+                    "type": "fasta", 
+                    "name": "output_file"
+                }
+            ], 
+            "post_job_actions": {
+                "RenameDatasetActionoutput_file": {
+                    "output_name": "output_file", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Sequences missed by all"
+                    }
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "output_file", 
+                    "uuid": "c7ed1b03-97ae-4859-9f3d-7b4c821ada08", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/blast_unmatched/blast_unmatched/0.5.0", 
+            "input_connections": {
+                "blast_file": {
+                    "output_name": "output1", 
+                    "id": 10
+                }, 
+                "fasta_file": {
+                    "output_name": "output_file", 
+                    "id": 9
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "blast_file", 
+                    "description": "runtime parameter for tool Blast Unmatched"
+                }, 
+                {
+                    "name": "fasta_file", 
+                    "description": "runtime parameter for tool Blast Unmatched"
+                }
+            ], 
+            "position": {
+                "top": 486, 
+                "left": 2208
+            }, 
+            "tool_state": "{\"blast_file\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"fasta_file\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"__page__\": null}", 
+            "label": "Getsequences missed by both vir2 and unclustered sequences", 
+            "type": "tool", 
+            "id": 11, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "fffdb903f2d1", 
+                "name": "blast_unmatched", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Blast Unmatched"
+        }, 
+        "10": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.3.1", 
+            "errors": null, 
+            "uuid": "68738682-27a0-4adc-b945-c4df49c48b72", 
+            "tool_version": "0.3.1", 
+            "outputs": [
+                {
+                    "type": "tabular", 
+                    "name": "output1"
+                }
+            ], 
+            "post_job_actions": {}, 
+            "workflow_outputs": [
+                {
+                    "output_name": "output1", 
+                    "uuid": "d0fabafb-7f8a-4119-8be6-4bed4e4cacd3", 
+                    "label": null
+                }
+            ], 
+            "annotation": "Mesure the loss of information due to clustering", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.3.1", 
+            "input_connections": {
+                "query": {
+                    "output_name": "output_file", 
+                    "id": 9
+                }, 
+                "db_opts|histdb": {
+                    "output_name": "outfile", 
+                    "id": 6
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "db_opts", 
+                    "description": "runtime parameter for tool NCBI BLAST+ blastn"
+                }, 
+                {
+                    "name": "query", 
+                    "description": "runtime parameter for tool NCBI BLAST+ blastn"
+                }
+            ], 
+            "position": {
+                "top": 281, 
+                "left": 1919
+            }, 
+            "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"__current_case__\\\": 2, \\\"ext_cols\\\": [\\\"slen\\\"], \\\"ids_cols\\\": null, \\\"misc_cols\\\": null, \\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"tax_cols\\\": null}\", \"adv_opts\": \"{\\\"__current_case__\\\": 0, \\\"adv_opts_selector\\\": \\\"basic\\\"}\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"db_opts\": \"{\\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\", \\\"db_opts_selector\\\": \\\"histdb\\\", \\\"histdb\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"subject\\\": \\\"\\\"}\", \"blast_type\": \"\\\"blastn\\\"\", \"query\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", 
+            "label": "Blast sequences missed by vir2 to unclustered viral sequences", 
+            "type": "tool", 
+            "id": 10, 
+            "tool_shed_repository": {
+                "owner": "devteam", 
+                "changeset_revision": "e25d3acf6e68", 
+                "name": "ncbi_blast_plus", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "NCBI BLAST+ blastn"
+        }, 
+        "1": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/2.3.0", 
+            "errors": null, 
+            "uuid": "25b4eea6-c049-4432-9ebb-5b7c7a17e24b", 
+            "tool_version": "2.3.0", 
+            "outputs": [
+                {
+                    "type": "fasta", 
+                    "name": "outfile"
+                }, 
+                {
+                    "type": "txt", 
+                    "name": "logfile"
+                }
+            ], 
+            "post_job_actions": {}, 
+            "workflow_outputs": [
+                {
+                    "output_name": "outfile", 
+                    "uuid": "a046f3a3-f2fb-48de-88f7-0bac53abbe08", 
+                    "label": null
+                }, 
+                {
+                    "output_name": "logfile", 
+                    "uuid": "022eff6b-7e3e-4152-8744-f43a5829bd88", 
+                    "label": null
+                }
+            ], 
+            "annotation": "sequences>10 000\npublished before 2017", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/2.3.0", 
+            "input_connections": {}, 
+            "inputs": [], 
+            "position": {
+                "top": 603, 
+                "left": 296
+            }, 
+            "tool_state": "{\"__page__\": null, \"__rerun_remap_job_id__\": null, \"queryString\": \"\\\"txid10239[Organism] NOT txid131567[Organism] NOT phage[All Fields] NOT patent[All Fields] NOT chimeric[Title] NOT vector[Title] NOT method[Title] NOT X174[All Fields] AND 10001:1300000[Sequence length] NOT 2017/09:2075[PDAT]\\\"\", \"dbname\": \"\\\"nuccore\\\"\", \"dry_run\": \"\\\"false\\\"\"}", 
+            "label": "Get long sequences", 
+            "type": "tool", 
+            "id": 1, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "c667d0ee39f5", 
+                "name": "fetch_fasta_from_ncbi", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Retrieve FASTA from NCBI"
+        }, 
+        "0": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/2.3.0", 
+            "errors": null, 
+            "uuid": "9c3e474c-3e57-4378-a5cc-ef9c6b7b092a", 
+            "tool_version": "2.3.0", 
+            "outputs": [
+                {
+                    "type": "fasta", 
+                    "name": "outfile"
+                }, 
+                {
+                    "type": "txt", 
+                    "name": "logfile"
+                }
+            ], 
+            "post_job_actions": {}, 
+            "workflow_outputs": [
+                {
+                    "output_name": "outfile", 
+                    "uuid": "250f8193-0366-417e-863e-62d75d511d56", 
+                    "label": null
+                }, 
+                {
+                    "output_name": "logfile", 
+                    "uuid": "2b4ab042-a734-4727-a9be-57b66a968488", 
+                    "label": null
+                }
+            ], 
+            "annotation": "sequences <= 10 000bp\npublished before 2017", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/2.3.0", 
+            "input_connections": {}, 
+            "inputs": [], 
+            "position": {
+                "top": 281, 
+                "left": 283
+            }, 
+            "tool_state": "{\"__page__\": null, \"__rerun_remap_job_id__\": null, \"queryString\": \"\\\"txid10239[Organism] NOT txid131567[Organism] NOT phage[All Fields] NOT patent[All Fields] NOT chimeric[Title] NOT vector[Title] NOT method[Title] NOT X174[All Fields] AND 301:10000[Sequence length] NOT 2017/09:2075[PDAT]\\\"\", \"dbname\": \"\\\"nuccore\\\"\", \"dry_run\": \"\\\"false\\\"\"}", 
+            "label": "Get short sequences", 
+            "type": "tool", 
+            "id": 0, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "c667d0ee39f5", 
+                "name": "fetch_fasta_from_ncbi", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Retrieve FASTA from NCBI"
+        }, 
+        "3": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/vsearch/vsearch_clustering/2.8.3.0", 
+            "errors": null, 
+            "uuid": "6fddbef5-bc89-4574-a0cf-335aee053e4c", 
+            "tool_version": "2.8.3.0", 
+            "outputs": [
+                {
+                    "type": "fasta", 
+                    "name": "msaout"
+                }, 
+                {
+                    "type": "fasta", 
+                    "name": "consout"
+                }, 
+                {
+                    "type": "fasta", 
+                    "name": "centroids"
+                }, 
+                {
+                    "type": "fasta", 
+                    "name": "alnout"
+                }, 
+                {
+                    "type": "fasta", 
+                    "name": "notmatched"
+                }, 
+                {
+                    "type": "fasta", 
+                    "name": "matched"
+                }, 
+                {
+                    "type": "tabular", 
+                    "name": "blast6out"
+                }, 
+                {
+                    "type": "fasta", 
+                    "name": "fastapairs"
+                }, 
+                {
+                    "type": "tabular", 
+                    "name": "uc_outfile"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionfastapairs": {
+                    "output_name": "fastapairs", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionconsout": {
+                    "output_name": "consout", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionmsaout": {
+                    "output_name": "msaout", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionalnout": {
+                    "output_name": "alnout", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionblast6out": {
+                    "output_name": "blast6out", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionuc_outfile": {
+                    "output_name": "uc_outfile", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionnotmatched": {
+                    "output_name": "notmatched", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionmatched": {
+                    "output_name": "matched", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "centroids", 
+                    "uuid": "88385aa5-5e7c-4e64-829c-f662d15f5efa", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/vsearch/vsearch_clustering/2.8.3.0", 
+            "input_connections": {
+                "infile": {
+                    "output_name": "outfile", 
+                    "id": 0
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "infile", 
+                    "description": "runtime parameter for tool VSearch clustering"
+                }
+            ], 
+            "position": {
+                "top": 273, 
+                "left": 559.5
+            }, 
+            "tool_state": "{\"sizein\": \"\\\"false\\\"\", \"cons_truncate\": \"\\\"false\\\"\", \"__page__\": null, \"maxrejects\": \"\\\"32\\\"\", \"usersort\": \"\\\"false\\\"\", \"qmask\": \"\\\"dust\\\"\", \"iddef\": \"\\\"2\\\"\", \"__rerun_remap_job_id__\": null, \"clustering_mode\": \"{\\\"__current_case__\\\": 0, \\\"clustering_mode_select\\\": \\\"cluster_fast\\\"}\", \"id\": \"\\\"0.95\\\"\", \"sizeout\": \"\\\"false\\\"\", \"strand\": \"\\\"plus\\\"\", \"outputs\": \"[\\\"--centroids\\\"]\", \"maxaccepts\": \"\\\"1\\\"\", \"infile\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"uc\": \"\\\"false\\\"\"}", 
+            "label": "Get centroids", 
+            "type": "tool", 
+            "id": 3, 
+            "tool_shed_repository": {
+                "owner": "iuc", 
+                "changeset_revision": "b3c7199d8786", 
+                "name": "vsearch", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "VSearch clustering"
+        }, 
+        "2": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/2.3.0", 
+            "errors": null, 
+            "uuid": "a2a812fb-1afb-405b-8b38-199c13f391c8", 
+            "tool_version": "2.3.0", 
+            "outputs": [
+                {
+                    "type": "fasta", 
+                    "name": "outfile"
+                }, 
+                {
+                    "type": "txt", 
+                    "name": "logfile"
+                }
+            ], 
+            "post_job_actions": {}, 
+            "workflow_outputs": [
+                {
+                    "output_name": "outfile", 
+                    "uuid": "02eb3d2c-24b0-4bbc-b695-f634673214a3", 
+                    "label": null
+                }, 
+                {
+                    "output_name": "logfile", 
+                    "uuid": "9ac269ab-44d2-4f6a-a287-d9122815965f", 
+                    "label": null
+                }
+            ], 
+            "annotation": "sequences published after 2017", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/2.3.0", 
+            "input_connections": {}, 
+            "inputs": [], 
+            "position": {
+                "top": 488, 
+                "left": 1185
+            }, 
+            "tool_state": "{\"__page__\": null, \"__rerun_remap_job_id__\": null, \"queryString\": \"\\\"txid10239[Organism] NOT txid131567[Organism] NOT phage[All Fields] NOT patent[All Fields] NOT chimeric[Title] NOT vector[Title] NOT method[Title] NOT X174[All Fields] AND 301:1300000[Sequence length] AND 2017/09:2018/02[PDAT]\\\"\", \"dbname\": \"\\\"nuccore\\\"\", \"dry_run\": \"\\\"false\\\"\"}", 
+            "label": "Get test sequences", 
+            "type": "tool", 
+            "id": 2, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "c667d0ee39f5", 
+                "name": "fetch_fasta_from_ncbi", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Retrieve FASTA from NCBI"
+        }, 
+        "5": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", 
+            "errors": null, 
+            "uuid": "51e49486-67e5-430c-884f-671a424ab2c7", 
+            "tool_version": "1.4.1", 
+            "outputs": [
+                {
+                    "type": "input", 
+                    "name": "paired_output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "list_output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "out_file1"
+                }, 
+                {
+                    "type": "_sniff_", 
+                    "name": "paired_out_file"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionpaired_out_file": {
+                    "output_name": "paired_out_file", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "RenameDatasetActionout_file1": {
+                    "output_name": "out_file1", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Vir2"
+                    }
+                }, 
+                "HideDatasetActionpaired_output": {
+                    "output_name": "paired_output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionout_file1": {
+                    "output_name": "out_file1", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionlist_output": {
+                    "output_name": "list_output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", 
+            "input_connections": {
+                "global_condition|inputs": {
+                    "output_name": "outfile", 
+                    "id": 1
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "global_condition", 
+                    "description": "runtime parameter for tool Concatenate multiple datasets"
+                }
+            ], 
+            "position": {
+                "top": 601.5, 
+                "left": 783
+            }, 
+            "tool_state": "{\"dataset_names\": \"\\\"false\\\"\", \"headers\": \"\\\"0\\\"\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"global_condition\": \"{\\\"__current_case__\\\": 0, \\\"input_type\\\": \\\"singles\\\", \\\"inputs\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\"}", 
+            "label": "Vir2", 
+            "type": "tool", 
+            "id": 5, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "55cf9d9defd1", 
+                "name": "concatenate_multiple_datasets", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Concatenate multiple datasets"
+        }, 
+        "4": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", 
+            "errors": null, 
+            "uuid": "c8435567-14ab-48a8-b217-7fed71ae87ef", 
+            "tool_version": "1.4.1", 
+            "outputs": [
+                {
+                    "type": "input", 
+                    "name": "paired_output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "list_output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "out_file1"
+                }, 
+                {
+                    "type": "_sniff_", 
+                    "name": "paired_out_file"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionpaired_out_file": {
+                    "output_name": "paired_out_file", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "RenameDatasetActionout_file1": {
+                    "output_name": "out_file1", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Unclustered viral sequences"
+                    }
+                }, 
+                "HideDatasetActionlist_output": {
+                    "output_name": "list_output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionout_file1": {
+                    "output_name": "out_file1", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionpaired_output": {
+                    "output_name": "paired_output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", 
+            "input_connections": {
+                "global_condition|inputs": [
+                    {
+                        "output_name": "outfile", 
+                        "id": 0
+                    }, 
+                    {
+                        "output_name": "outfile", 
+                        "id": 1
+                    }
+                ]
+            }, 
+            "inputs": [
+                {
+                    "name": "global_condition", 
+                    "description": "runtime parameter for tool Concatenate multiple datasets"
+                }
+            ], 
+            "position": {
+                "top": 249.5, 
+                "left": 888
+            }, 
+            "tool_state": "{\"dataset_names\": \"\\\"false\\\"\", \"headers\": \"\\\"0\\\"\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"global_condition\": \"{\\\"__current_case__\\\": 0, \\\"input_type\\\": \\\"singles\\\", \\\"inputs\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\"}", 
+            "label": "Unclustered viral sequences", 
+            "type": "tool", 
+            "id": 4, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "55cf9d9defd1", 
+                "name": "concatenate_multiple_datasets", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Concatenate multiple datasets"
+        }, 
+        "7": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_makeblastdb/0.3.1", 
+            "errors": null, 
+            "uuid": "1e14e648-40a7-4a4e-b343-98c4d7bb088b", 
+            "tool_version": "0.3.1", 
+            "outputs": [
+                {
+                    "type": "data", 
+                    "name": "outfile"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionoutfile": {
+                    "output_name": "outfile", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_makeblastdb/0.3.1", 
+            "input_connections": {
+                "input_file": {
+                    "output_name": "out_file1", 
+                    "id": 5
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "mask_data_file", 
+                    "description": "runtime parameter for tool NCBI BLAST+ makeblastdb"
+                }, 
+                {
+                    "name": "input_file", 
+                    "description": "runtime parameter for tool NCBI BLAST+ makeblastdb"
+                }
+            ], 
+            "position": {
+                "top": 645, 
+                "left": 1138
+            }, 
+            "tool_state": "{\"__page__\": null, \"mask_data_file\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"input_file\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"dbtype\": \"\\\"nucl\\\"\", \"__rerun_remap_job_id__\": null, \"hash_index\": \"\\\"true\\\"\", \"tax\": \"{\\\"__current_case__\\\": 0, \\\"taxselect\\\": \\\"\\\"}\", \"title\": \"\\\"vir2 blastdb\\\"\", \"parse_seqids\": \"\\\"false\\\"\"}", 
+            "label": "vir2 blastdb", 
+            "type": "tool", 
+            "id": 7, 
+            "tool_shed_repository": {
+                "owner": "devteam", 
+                "changeset_revision": "e25d3acf6e68", 
+                "name": "ncbi_blast_plus", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "NCBI BLAST+ makeblastdb"
+        }, 
+        "6": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_makeblastdb/0.3.1", 
+            "errors": null, 
+            "uuid": "f2e5e817-bee7-45e2-a28c-e99ee882c172", 
+            "tool_version": "0.3.1", 
+            "outputs": [
+                {
+                    "type": "data", 
+                    "name": "outfile"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionoutfile": {
+                    "output_name": "outfile", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_makeblastdb/0.3.1", 
+            "input_connections": {
+                "input_file": {
+                    "output_name": "out_file1", 
+                    "id": 4
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "mask_data_file", 
+                    "description": "runtime parameter for tool NCBI BLAST+ makeblastdb"
+                }, 
+                {
+                    "name": "input_file", 
+                    "description": "runtime parameter for tool NCBI BLAST+ makeblastdb"
+                }
+            ], 
+            "position": {
+                "top": 254, 
+                "left": 1341
+            }, 
+            "tool_state": "{\"__page__\": null, \"mask_data_file\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"input_file\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"dbtype\": \"\\\"nucl\\\"\", \"__rerun_remap_job_id__\": null, \"hash_index\": \"\\\"true\\\"\", \"tax\": \"{\\\"__current_case__\\\": 0, \\\"taxselect\\\": \\\"\\\"}\", \"title\": \"\\\"\\\"\", \"parse_seqids\": \"\\\"false\\\"\"}", 
+            "label": null, 
+            "type": "tool", 
+            "id": 6, 
+            "tool_shed_repository": {
+                "owner": "devteam", 
+                "changeset_revision": "e25d3acf6e68", 
+                "name": "ncbi_blast_plus", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "NCBI BLAST+ makeblastdb"
+        }, 
+        "9": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/blast_unmatched/blast_unmatched/0.5.0", 
+            "errors": null, 
+            "uuid": "0f9a007f-a745-4c95-b2d0-4f1ee836d8b1", 
+            "tool_version": "0.5.0", 
+            "outputs": [
+                {
+                    "type": "fasta", 
+                    "name": "output_file"
+                }
+            ], 
+            "post_job_actions": {
+                "RenameDatasetActionoutput_file": {
+                    "output_name": "output_file", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Sequences missed by vir2"
+                    }
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "output_file", 
+                    "uuid": "b5e71e9d-ef3b-4a33-a40c-1a5b00062e86", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/blast_unmatched/blast_unmatched/0.5.0", 
+            "input_connections": {
+                "blast_file": {
+                    "output_name": "output1", 
+                    "id": 8
+                }, 
+                "fasta_file": {
+                    "output_name": "outfile", 
+                    "id": 2
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "blast_file", 
+                    "description": "runtime parameter for tool Blast Unmatched"
+                }, 
+                {
+                    "name": "fasta_file", 
+                    "description": "runtime parameter for tool Blast Unmatched"
+                }
+            ], 
+            "position": {
+                "top": 495, 
+                "left": 1733
+            }, 
+            "tool_state": "{\"blast_file\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"fasta_file\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"__page__\": null}", 
+            "label": "Get sequences not matching vir2", 
+            "type": "tool", 
+            "id": 9, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "fffdb903f2d1", 
+                "name": "blast_unmatched", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Blast Unmatched"
+        }, 
+        "8": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.3.1", 
+            "errors": null, 
+            "uuid": "f10e16ec-5da8-460a-a1df-5a8a7c1e9e81", 
+            "tool_version": "0.3.1", 
+            "outputs": [
+                {
+                    "type": "tabular", 
+                    "name": "output1"
+                }
+            ], 
+            "post_job_actions": {}, 
+            "workflow_outputs": [
+                {
+                    "output_name": "output1", 
+                    "uuid": "3a3992d8-9154-4b35-a4bd-6874fa4c86d4", 
+                    "label": null
+                }
+            ], 
+            "annotation": "Check if there are sequences not matching vir2", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.3.1", 
+            "input_connections": {
+                "query": {
+                    "output_name": "outfile", 
+                    "id": 2
+                }, 
+                "db_opts|histdb": {
+                    "output_name": "outfile", 
+                    "id": 7
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "db_opts", 
+                    "description": "runtime parameter for tool NCBI BLAST+ blastn"
+                }, 
+                {
+                    "name": "query", 
+                    "description": "runtime parameter for tool NCBI BLAST+ blastn"
+                }
+            ], 
+            "position": {
+                "top": 662, 
+                "left": 1481
+            }, 
+            "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"__current_case__\\\": 2, \\\"ext_cols\\\": [\\\"slen\\\"], \\\"ids_cols\\\": null, \\\"misc_cols\\\": null, \\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"tax_cols\\\": null}\", \"adv_opts\": \"{\\\"__current_case__\\\": 0, \\\"adv_opts_selector\\\": \\\"basic\\\"}\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"db_opts\": \"{\\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\", \\\"db_opts_selector\\\": \\\"histdb\\\", \\\"histdb\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"subject\\\": \\\"\\\"}\", \"blast_type\": \"\\\"blastn\\\"\", \"query\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", 
+            "label": "Blast sequences against vir2", 
+            "type": "tool", 
+            "id": 8, 
+            "tool_shed_repository": {
+                "owner": "devteam", 
+                "changeset_revision": "e25d3acf6e68", 
+                "name": "ncbi_blast_plus", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "NCBI BLAST+ blastn"
+        }
+    }, 
+    "annotation": "", 
+    "name": "Metavisitor: Workflow for nucleic vir2 generation and test"
+}
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/Galaxy-Workflow-Metavisitor__Workflow_for_proteic_vir2_generation.ga	Sun Jul 21 19:22:52 2019 -0400
@@ -0,0 +1,67 @@
+{
+    "a_galaxy_workflow": "true", 
+    "uuid": "224bad2a-247c-492d-b0ab-7d4ca6241d90", 
+    "tags": [], 
+    "format-version": "0.1", 
+    "version": 0, 
+    "steps": {
+        "0": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/2.3.0", 
+            "errors": null, 
+            "uuid": "9c3e474c-3e57-4378-a5cc-ef9c6b7b092a", 
+            "tool_version": "2.3.0", 
+            "outputs": [
+                {
+                    "type": "fasta", 
+                    "name": "outfile"
+                }, 
+                {
+                    "type": "txt", 
+                    "name": "logfile"
+                }
+            ], 
+            "post_job_actions": {
+                "RenameDatasetActionoutfile": {
+                    "output_name": "outfile", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Vir2"
+                    }
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "outfile", 
+                    "uuid": "c65e9a65-8c83-4caa-930a-347711a3e030", 
+                    "label": null
+                }, 
+                {
+                    "output_name": "logfile", 
+                    "uuid": "990bc867-6319-4e49-825c-72093dbd7b14", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/2.3.0", 
+            "input_connections": {}, 
+            "inputs": [], 
+            "position": {
+                "top": 275, 
+                "left": 261
+            }, 
+            "tool_state": "{\"__page__\": null, \"__rerun_remap_job_id__\": null, \"queryString\": \"\\\"txid10239[Organism] NOT txid131567[Organism] NOT phage[All Fields] NOT patent[All Fields] NOT chimeric[Title] NOT vector[Title] NOT method[Title] NOT X174[All Fields] AND 30:9000[Sequence length]\\\"\", \"dbname\": \"\\\"protein\\\"\", \"dry_run\": \"\\\"false\\\"\"}", 
+            "label": "Vir2", 
+            "type": "tool", 
+            "id": 0, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "c667d0ee39f5", 
+                "name": "fetch_fasta_from_ncbi", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Retrieve FASTA from NCBI"
+        }
+    }, 
+    "annotation": "", 
+    "name": "Metavisitor: Workflow for proteic vir2 generation"
+}
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/Galaxy-Workflow-Metavisitor__Workflow_for_proteic_vir2_generation_and_test.ga	Sun Jul 21 19:22:52 2019 -0400
@@ -0,0 +1,282 @@
+{
+    "a_galaxy_workflow": "true", 
+    "uuid": "7dbf8006-41e0-4c27-8128-68a26d02eb2d", 
+    "tags": [], 
+    "format-version": "0.1", 
+    "version": 0, 
+    "steps": {
+        "1": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/2.3.0", 
+            "errors": null, 
+            "uuid": "a2a812fb-1afb-405b-8b38-199c13f391c8", 
+            "tool_version": "2.3.0", 
+            "outputs": [
+                {
+                    "type": "fasta", 
+                    "name": "outfile"
+                }, 
+                {
+                    "type": "txt", 
+                    "name": "logfile"
+                }
+            ], 
+            "post_job_actions": {}, 
+            "workflow_outputs": [
+                {
+                    "output_name": "outfile", 
+                    "uuid": "33788a2d-8f7e-4464-82d5-7a193b78868b", 
+                    "label": null
+                }, 
+                {
+                    "output_name": "logfile", 
+                    "uuid": "503c9589-3de1-4d51-99f0-a10d64c00f99", 
+                    "label": null
+                }
+            ], 
+            "annotation": "sequences published after 2017", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/2.3.0", 
+            "input_connections": {}, 
+            "inputs": [], 
+            "position": {
+                "top": 430, 
+                "left": 656
+            }, 
+            "tool_state": "{\"__page__\": null, \"__rerun_remap_job_id__\": null, \"queryString\": \"\\\"txid10239[Organism] NOT txid131567[Organism] NOT phage[All Fields] NOT patent[All Fields] NOT chimeric[Title] NOT vector[Title] NOT method[Title] NOT X174[All Fields] AND 30:9000[Sequence length] AND 2017/05:2018/01[PDAT]\\\"\", \"dbname\": \"\\\"protein\\\"\", \"dry_run\": \"\\\"false\\\"\"}", 
+            "label": "Get new sequences", 
+            "type": "tool", 
+            "id": 1, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "c667d0ee39f5", 
+                "name": "fetch_fasta_from_ncbi", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Retrieve FASTA from NCBI"
+        }, 
+        "0": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/2.3.0", 
+            "errors": null, 
+            "uuid": "9c3e474c-3e57-4378-a5cc-ef9c6b7b092a", 
+            "tool_version": "2.3.0", 
+            "outputs": [
+                {
+                    "type": "fasta", 
+                    "name": "outfile"
+                }, 
+                {
+                    "type": "txt", 
+                    "name": "logfile"
+                }
+            ], 
+            "post_job_actions": {}, 
+            "workflow_outputs": [
+                {
+                    "output_name": "outfile", 
+                    "uuid": "b4a1ece5-ebe0-4a87-9944-89608ed59557", 
+                    "label": null
+                }, 
+                {
+                    "output_name": "logfile", 
+                    "uuid": "cdc51f68-80a5-4e5e-bcd9-600b18cba73b", 
+                    "label": null
+                }
+            ], 
+            "annotation": "sequences published before 2017", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/2.3.0", 
+            "input_connections": {}, 
+            "inputs": [], 
+            "position": {
+                "top": 471, 
+                "left": 260
+            }, 
+            "tool_state": "{\"__page__\": null, \"__rerun_remap_job_id__\": null, \"queryString\": \"\\\"txid10239[Organism] NOT txid131567[Organism] NOT phage[All Fields] NOT patent[All Fields] NOT chimeric[Title] NOT vector[Title] NOT method[Title] NOT X174[All Fields] AND 30:9000[Sequence length] NOT 2017/09:2075[PDAT]\\\"\", \"dbname\": \"\\\"protein\\\"\", \"dry_run\": \"\\\"false\\\"\"}", 
+            "label": "Get old sequences", 
+            "type": "tool", 
+            "id": 0, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "c667d0ee39f5", 
+                "name": "fetch_fasta_from_ncbi", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Retrieve FASTA from NCBI"
+        }, 
+        "3": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.3.1", 
+            "errors": null, 
+            "uuid": "f10e16ec-5da8-460a-a1df-5a8a7c1e9e81", 
+            "tool_version": "0.3.1", 
+            "outputs": [
+                {
+                    "type": "tabular", 
+                    "name": "output1"
+                }
+            ], 
+            "post_job_actions": {}, 
+            "workflow_outputs": [
+                {
+                    "output_name": "output1", 
+                    "uuid": "3a3992d8-9154-4b35-a4bd-6874fa4c86d4", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.3.1", 
+            "input_connections": {
+                "query": {
+                    "output_name": "outfile", 
+                    "id": 1
+                }, 
+                "db_opts|histdb": {
+                    "output_name": "outfile", 
+                    "id": 2
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "db_opts", 
+                    "description": "runtime parameter for tool NCBI BLAST+ blastn"
+                }, 
+                {
+                    "name": "query", 
+                    "description": "runtime parameter for tool NCBI BLAST+ blastn"
+                }
+            ], 
+            "position": {
+                "top": 607, 
+                "left": 959
+            }, 
+            "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"__current_case__\\\": 2, \\\"ext_cols\\\": [\\\"slen\\\"], \\\"ids_cols\\\": null, \\\"misc_cols\\\": null, \\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"tax_cols\\\": null}\", \"adv_opts\": \"{\\\"__current_case__\\\": 0, \\\"adv_opts_selector\\\": \\\"basic\\\"}\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"db_opts\": \"{\\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\", \\\"db_opts_selector\\\": \\\"histdb\\\", \\\"histdb\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"subject\\\": \\\"\\\"}\", \"blast_type\": \"\\\"blastn\\\"\", \"query\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", 
+            "label": null, 
+            "type": "tool", 
+            "id": 3, 
+            "tool_shed_repository": {
+                "owner": "devteam", 
+                "changeset_revision": "e25d3acf6e68", 
+                "name": "ncbi_blast_plus", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "NCBI BLAST+ blastn"
+        }, 
+        "2": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_makeblastdb/0.3.1", 
+            "errors": null, 
+            "uuid": "1e14e648-40a7-4a4e-b343-98c4d7bb088b", 
+            "tool_version": "0.3.1", 
+            "outputs": [
+                {
+                    "type": "data", 
+                    "name": "outfile"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionoutfile": {
+                    "output_name": "outfile", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_makeblastdb/0.3.1", 
+            "input_connections": {
+                "input_file": {
+                    "output_name": "outfile", 
+                    "id": 0
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "mask_data_file", 
+                    "description": "runtime parameter for tool NCBI BLAST+ makeblastdb"
+                }, 
+                {
+                    "name": "input_file", 
+                    "description": "runtime parameter for tool NCBI BLAST+ makeblastdb"
+                }
+            ], 
+            "position": {
+                "top": 643, 
+                "left": 625
+            }, 
+            "tool_state": "{\"__page__\": null, \"mask_data_file\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"input_file\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"dbtype\": \"\\\"nucl\\\"\", \"__rerun_remap_job_id__\": null, \"hash_index\": \"\\\"true\\\"\", \"tax\": \"{\\\"__current_case__\\\": 0, \\\"taxselect\\\": \\\"\\\"}\", \"title\": \"\\\"vir2 blastdb\\\"\", \"parse_seqids\": \"\\\"false\\\"\"}", 
+            "label": "vir2 blastdb", 
+            "type": "tool", 
+            "id": 2, 
+            "tool_shed_repository": {
+                "owner": "devteam", 
+                "changeset_revision": "e25d3acf6e68", 
+                "name": "ncbi_blast_plus", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "NCBI BLAST+ makeblastdb"
+        }, 
+        "4": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/blast_unmatched/blast_unmatched/0.5.0", 
+            "errors": null, 
+            "uuid": "0f9a007f-a745-4c95-b2d0-4f1ee836d8b1", 
+            "tool_version": "0.5.0", 
+            "outputs": [
+                {
+                    "type": "fasta", 
+                    "name": "output_file"
+                }
+            ], 
+            "post_job_actions": {
+                "RenameDatasetActionoutput_file": {
+                    "output_name": "output_file", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Sequences missed by vir2"
+                    }
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "output_file", 
+                    "uuid": "b5e71e9d-ef3b-4a33-a40c-1a5b00062e86", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/blast_unmatched/blast_unmatched/0.5.0", 
+            "input_connections": {
+                "blast_file": {
+                    "output_name": "output1", 
+                    "id": 3
+                }, 
+                "fasta_file": {
+                    "output_name": "outfile", 
+                    "id": 1
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "blast_file", 
+                    "description": "runtime parameter for tool Blast Unmatched"
+                }, 
+                {
+                    "name": "fasta_file", 
+                    "description": "runtime parameter for tool Blast Unmatched"
+                }
+            ], 
+            "position": {
+                "top": 512, 
+                "left": 1256
+            }, 
+            "tool_state": "{\"blast_file\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"fasta_file\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"__page__\": null}", 
+            "label": "Get non matched sequences", 
+            "type": "tool", 
+            "id": 4, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "fffdb903f2d1", 
+                "name": "blast_unmatched", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Blast Unmatched"
+        }
+    }, 
+    "annotation": "", 
+    "name": "Metavisitor: Workflow for proteic vir2 generation and test"
+}
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/Galaxy-Workflow-Metavisitor__Workflow_for_remapping_in_Use_Cases_1-1,2,3.ga	Sun Jul 21 19:22:52 2019 -0400
@@ -0,0 +1,584 @@
+{
+    "a_galaxy_workflow": "true", 
+    "uuid": "64d78b22-76ae-49d2-a851-a9dcdca491b4", 
+    "tags": [], 
+    "format-version": "0.1", 
+    "version": 4, 
+    "steps": {
+        "1": {
+            "tool_id": null, 
+            "errors": null, 
+            "uuid": "e8e196c7-c854-4bd9-ace2-345a0d797090", 
+            "tool_version": null, 
+            "outputs": [], 
+            "workflow_outputs": [
+                {
+                    "output_name": "output", 
+                    "uuid": "46b1caea-3a7c-4663-b2e1-6536a346567a", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": null, 
+            "input_connections": {}, 
+            "inputs": [
+                {
+                    "name": "Nora Virus Genomes", 
+                    "description": ""
+                }
+            ], 
+            "position": {
+                "top": 474.5333251953125, 
+                "left": 634.5333251953125
+            }, 
+            "tool_state": "{\"collection_type\": \"list\", \"name\": \"Nora Virus Genomes\"}", 
+            "label": "Nora Virus Genomes", 
+            "type": "data_collection_input", 
+            "id": 1, 
+            "name": "Input dataset collection"
+        }, 
+        "0": {
+            "tool_id": null, 
+            "errors": null, 
+            "uuid": "ca202c6a-46b7-4f3a-a2ab-dbc781f331b7", 
+            "tool_version": null, 
+            "outputs": [], 
+            "workflow_outputs": [
+                {
+                    "output_name": "output", 
+                    "uuid": "19eaa717-5b9a-4b27-a1c4-a895fc673970", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": null, 
+            "input_connections": {}, 
+            "inputs": [
+                {
+                    "name": "Read fastq files", 
+                    "description": ""
+                }
+            ], 
+            "position": {
+                "top": 269.51666259765625, 
+                "left": 199.5333251953125
+            }, 
+            "tool_state": "{\"collection_type\": \"list\", \"name\": \"Read fastq files\"}", 
+            "label": "Read fastq files", 
+            "type": "data_collection_input", 
+            "id": 0, 
+            "name": "Input dataset collection"
+        }, 
+        "3": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", 
+            "errors": null, 
+            "uuid": "b0f07d5d-ce07-4fba-b8c6-9ad6502e0aa9", 
+            "tool_version": "1.4.1", 
+            "outputs": [
+                {
+                    "type": "input", 
+                    "name": "paired_output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "list_output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "out_file1"
+                }, 
+                {
+                    "type": "_sniff_", 
+                    "name": "paired_out_file"
+                }
+            ], 
+            "post_job_actions": {
+                "RenameDatasetActionout_file1": {
+                    "output_name": "out_file1", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Concatenated genome files"
+                    }
+                }, 
+                "HideDatasetActionpaired_output": {
+                    "output_name": "paired_output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionout_file1": {
+                    "output_name": "out_file1", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionlist_output": {
+                    "output_name": "list_output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "paired_out_file", 
+                    "uuid": "66775d63-ac73-47b2-a9a3-736247d43bed", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", 
+            "input_connections": {
+                "global_condition|inputs": {
+                    "output_name": "output", 
+                    "id": 1
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "global_condition", 
+                    "description": "runtime parameter for tool Concatenate multiple datasets"
+                }
+            ], 
+            "position": {
+                "top": 600.5, 
+                "left": 862
+            }, 
+            "tool_state": "{\"dataset_names\": \"\\\"false\\\"\", \"headers\": \"\\\"0\\\"\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"global_condition\": \"{\\\"__current_case__\\\": 0, \\\"input_type\\\": \\\"singles\\\", \\\"inputs\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\"}", 
+            "label": "Concatenat genome files", 
+            "type": "tool", 
+            "id": 3, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "55cf9d9defd1", 
+                "name": "concatenate_multiple_datasets", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Concatenate multiple datasets"
+        }, 
+        "2": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/yac_clipper/yac/2.3.0", 
+            "errors": null, 
+            "uuid": "afa187ce-544c-4287-8699-a9efe8ce45ab", 
+            "tool_version": "2.3.0", 
+            "outputs": [
+                {
+                    "type": "input", 
+                    "name": "output"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionoutput": {
+                    "output_name": "output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "RenameDatasetActionoutput": {
+                    "output_name": "output", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "#{input} clipped"
+                    }
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/yac_clipper/yac/2.3.0", 
+            "input_connections": {
+                "input": {
+                    "output_name": "output", 
+                    "id": 0
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "input", 
+                    "description": "runtime parameter for tool Clip adapter"
+                }
+            ], 
+            "position": {
+                "top": 414.5333251953125, 
+                "left": 384.51666259765625
+            }, 
+            "tool_state": "{\"out_format\": \"\\\"fasta\\\"\", \"__page__\": null, \"min\": \"\\\"18\\\"\", \"max\": \"\\\"30\\\"\", \"__rerun_remap_job_id__\": null, \"clip_source\": \"{\\\"__current_case__\\\": 0, \\\"clip_sequence\\\": \\\"CTGTAGGCACCATCAATCGT\\\", \\\"clip_source_list\\\": \\\"prebuilt\\\"}\", \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"Nmode\": \"\\\"reject\\\"\"}", 
+            "label": null, 
+            "type": "tool", 
+            "id": 2, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "f7947c5a18b8", 
+                "name": "yac_clipper", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Clip adapter"
+        }, 
+        "5": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1", 
+            "errors": null, 
+            "uuid": "41517d42-910e-416b-99a4-b307a58be294", 
+            "tool_version": "2.1.1", 
+            "outputs": [
+                {
+                    "type": "tabular", 
+                    "name": "output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "aligned"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "unaligned"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionunaligned": {
+                    "output_name": "unaligned", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionaligned": {
+                    "output_name": "aligned", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionoutput": {
+                    "output_name": "output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "Align reads to the different nora genomes to get some stats", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1", 
+            "input_connections": {
+                "input": {
+                    "output_name": "out_file1", 
+                    "id": 4
+                }, 
+                "refGenomeSource|ownFile": {
+                    "output_name": "output", 
+                    "id": 1
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "input", 
+                    "description": "runtime parameter for tool sR_bowtie"
+                }, 
+                {
+                    "name": "refGenomeSource", 
+                    "description": "runtime parameter for tool sR_bowtie"
+                }
+            ], 
+            "position": {
+                "top": 170, 
+                "left": 924
+            }, 
+            "tool_state": "{\"__page__\": null, \"output_format\": \"\\\"tabular\\\"\", \"v_mismatches\": \"\\\"0\\\"\", \"additional_fasta\": \"\\\"No\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"refGenomeSource\": \"{\\\"__current_case__\\\": 1, \\\"genomeSource\\\": \\\"history\\\", \\\"ownFile\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\", \"method\": \"\\\"multiple\\\"\"}", 
+            "label": "Align reads to Nora genomes", 
+            "type": "tool", 
+            "id": 5, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "0281bb245635", 
+                "name": "sr_bowtie", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "sR_bowtie"
+        }, 
+        "4": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", 
+            "errors": null, 
+            "uuid": "ed4ab4ea-bc94-4fb4-8300-93d842b10ba4", 
+            "tool_version": "1.4.1", 
+            "outputs": [
+                {
+                    "type": "input", 
+                    "name": "paired_output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "list_output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "out_file1"
+                }, 
+                {
+                    "type": "_sniff_", 
+                    "name": "paired_out_file"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionpaired_out_file": {
+                    "output_name": "paired_out_file", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "RenameDatasetActionout_file1": {
+                    "output_name": "out_file1", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "#{global_condition.inputs}"
+                    }
+                }, 
+                "HideDatasetActionpaired_output": {
+                    "output_name": "paired_output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionlist_output": {
+                    "output_name": "list_output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "out_file1", 
+                    "uuid": "7df3805f-edaa-4ab4-adf8-8e21f83b4e99", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", 
+            "input_connections": {
+                "global_condition|inputs": {
+                    "output_name": "output", 
+                    "id": 2
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "global_condition", 
+                    "description": "runtime parameter for tool Concatenate multiple datasets"
+                }
+            ], 
+            "position": {
+                "top": 214.5, 
+                "left": 584
+            }, 
+            "tool_state": "{\"dataset_names\": \"\\\"false\\\"\", \"headers\": \"\\\"0\\\"\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"global_condition\": \"{\\\"__current_case__\\\": 0, \\\"input_type\\\": \\\"singles\\\", \\\"inputs\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\"}", 
+            "label": "Concatenate read files", 
+            "type": "tool", 
+            "id": 4, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "55cf9d9defd1", 
+                "name": "concatenate_multiple_datasets", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Concatenate multiple datasets"
+        }, 
+        "7": {
+            "tool_id": "wc_gnu", 
+            "errors": null, 
+            "uuid": "c8a5c107-93fc-4e16-bd42-cd86efdbd79a", 
+            "tool_version": "1.0.0", 
+            "outputs": [
+                {
+                    "type": "tabular", 
+                    "name": "out_file1"
+                }
+            ], 
+            "post_job_actions": {
+                "RenameDatasetActionout_file1": {
+                    "output_name": "out_file1", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "nbre of remapped reads"
+                    }
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "out_file1", 
+                    "uuid": "b773db8b-eefc-4d13-8402-4f419883370b", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "wc_gnu", 
+            "input_connections": {
+                "input1": {
+                    "output_name": "output", 
+                    "id": 5
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "input1", 
+                    "description": "runtime parameter for tool Line/Word/Character count"
+                }
+            ], 
+            "position": {
+                "top": 308, 
+                "left": 1292.5
+            }, 
+            "tool_state": "{\"__page__\": null, \"include_header\": \"\\\"true\\\"\", \"input1\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"options\": \"[\\\"lines\\\"]\", \"__rerun_remap_job_id__\": null}", 
+            "label": null, 
+            "type": "tool", 
+            "id": 7, 
+            "name": "Line/Word/Character count"
+        }, 
+        "6": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1", 
+            "errors": null, 
+            "uuid": "60a797b5-2583-403f-89ed-da90913b6039", 
+            "tool_version": "2.1.1", 
+            "outputs": [
+                {
+                    "type": "tabular", 
+                    "name": "output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "aligned"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "unaligned"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionunaligned": {
+                    "output_name": "unaligned", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionoutput": {
+                    "output_name": "output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionaligned": {
+                    "output_name": "aligned", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1", 
+            "input_connections": {
+                "input": {
+                    "output_name": "out_file1", 
+                    "id": 4
+                }, 
+                "refGenomeSource|ownFile": {
+                    "output_name": "out_file1", 
+                    "id": 3
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "input", 
+                    "description": "runtime parameter for tool sR_bowtie"
+                }, 
+                {
+                    "name": "refGenomeSource", 
+                    "description": "runtime parameter for tool sR_bowtie"
+                }
+            ], 
+            "position": {
+                "top": 529, 
+                "left": 1285
+            }, 
+            "tool_state": "{\"__page__\": null, \"output_format\": \"\\\"bam\\\"\", \"v_mismatches\": \"\\\"0\\\"\", \"additional_fasta\": \"\\\"No\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"refGenomeSource\": \"{\\\"__current_case__\\\": 1, \\\"genomeSource\\\": \\\"history\\\", \\\"ownFile\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\", \"method\": \"\\\"a_option\\\"\"}", 
+            "label": "Align reads to genomes", 
+            "type": "tool", 
+            "id": 6, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "0281bb245635", 
+                "name": "sr_bowtie", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "sR_bowtie"
+        }, 
+        "8": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/small_rna_maps/small_rna_maps/2.14.0", 
+            "errors": null, 
+            "uuid": "42bcdda1-209a-43d2-a5aa-2c02d1665d07", 
+            "tool_version": "2.14.0", 
+            "outputs": [
+                {
+                    "type": "tabular", 
+                    "name": "output_tab"
+                }, 
+                {
+                    "type": "bed", 
+                    "name": "output_bed"
+                }, 
+                {
+                    "type": "tabular", 
+                    "name": "extra_output_tab"
+                }, 
+                {
+                    "type": "pdf", 
+                    "name": "output_pdf"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionextra_output_tab": {
+                    "output_name": "extra_output_tab", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionoutput_bed": {
+                    "output_name": "output_bed", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionoutput_tab": {
+                    "output_name": "output_tab", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "RenameDatasetActionoutput_pdf": {
+                    "output_name": "output_pdf", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Remapped reads visualization"
+                    }
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "output_pdf", 
+                    "uuid": "5f457235-12d7-4d76-8308-c7af651f6492", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/small_rna_maps/small_rna_maps/2.14.0", 
+            "input_connections": {
+                "inputs": {
+                    "output_name": "output", 
+                    "id": 6
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "inputs", 
+                    "description": "runtime parameter for tool small_rna_maps"
+                }
+            ], 
+            "position": {
+                "top": 577, 
+                "left": 1668.5
+            }, 
+            "tool_state": "{\"inputs\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"ylimits_cond\": \"{\\\"__current_case__\\\": 1, \\\"ylimits\\\": \\\"false\\\"}\", \"minsize\": \"\\\"18\\\"\", \"maxsize\": \"\\\"30\\\"\", \"normalization\": \"\\\"1\\\"\", \"plots_options\": \"{\\\"__current_case__\\\": 0, \\\"extra_plot\\\": \\\"Counts\\\", \\\"first_plot\\\": \\\"Size\\\", \\\"plots_options_selector\\\": \\\"two_plot\\\"}\"}", 
+            "label": "Visualize remapped reads", 
+            "type": "tool", 
+            "id": 8, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "14adf24603b6", 
+                "name": "small_rna_maps", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "small_rna_maps"
+        }
+    }, 
+    "annotation": "", 
+    "name": "Metavisitor: Workflow for remapping in Use Cases 1-1,2,3"
+}
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/Galaxy-Workflow-Metavisitor__Workflow_for_remapping_in_Use_Cases_2-1,2.ga	Sun Jul 21 19:22:52 2019 -0400
@@ -0,0 +1,478 @@
+{
+    "a_galaxy_workflow": "true", 
+    "uuid": "b7c51d51-7234-4834-b3d7-a3f1c514ce02", 
+    "tags": [], 
+    "format-version": "0.1", 
+    "version": 3, 
+    "steps": {
+        "1": {
+            "tool_id": null, 
+            "errors": null, 
+            "uuid": "5551b3da-5866-4474-8bc2-0f8dfea29902", 
+            "tool_version": null, 
+            "outputs": [], 
+            "workflow_outputs": [
+                {
+                    "output_name": "output", 
+                    "uuid": "b0f79ec9-f874-48d0-b665-2867dfbf76ac", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": null, 
+            "input_connections": {}, 
+            "inputs": [
+                {
+                    "name": "AnCV genome", 
+                    "description": ""
+                }
+            ], 
+            "position": {
+                "top": 395.98333740234375, 
+                "left": 595.9666748046875
+            }, 
+            "tool_state": "{\"name\": \"AnCV genome\"}", 
+            "label": "AnCV genome", 
+            "type": "data_input", 
+            "id": 1, 
+            "name": "Input dataset"
+        }, 
+        "0": {
+            "tool_id": null, 
+            "errors": null, 
+            "uuid": "35d6ef0f-98d0-439a-aef4-3d4d2c85e309", 
+            "tool_version": null, 
+            "outputs": [], 
+            "workflow_outputs": [
+                {
+                    "output_name": "output", 
+                    "uuid": "bb3f50ae-6b7e-413f-bc2f-e86b8df2296b", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": null, 
+            "input_connections": {}, 
+            "inputs": [
+                {
+                    "name": "Small Read fastq files", 
+                    "description": ""
+                }
+            ], 
+            "position": {
+                "top": 345.51666259765625, 
+                "left": 199.5333251953125
+            }, 
+            "tool_state": "{\"collection_type\": \"list\", \"name\": \"Small Read fastq files\"}", 
+            "label": "Small Read fastq files", 
+            "type": "data_collection_input", 
+            "id": 0, 
+            "name": "Input dataset collection"
+        }, 
+        "3": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", 
+            "errors": null, 
+            "uuid": "be271c94-4c7e-4370-bad0-bf4d714c51a7", 
+            "tool_version": "1.4.1", 
+            "outputs": [
+                {
+                    "type": "input", 
+                    "name": "paired_output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "list_output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "out_file1"
+                }, 
+                {
+                    "type": "_sniff_", 
+                    "name": "paired_out_file"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionpaired_out_file": {
+                    "output_name": "paired_out_file", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionlist_output": {
+                    "output_name": "list_output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionout_file1": {
+                    "output_name": "out_file1", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionpaired_output": {
+                    "output_name": "paired_output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", 
+            "input_connections": {
+                "global_condition|inputs": {
+                    "output_name": "output", 
+                    "id": 2
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "global_condition", 
+                    "description": "runtime parameter for tool Concatenate multiple datasets"
+                }
+            ], 
+            "position": {
+                "top": 156.5, 
+                "left": 521
+            }, 
+            "tool_state": "{\"dataset_names\": \"\\\"false\\\"\", \"headers\": \"\\\"0\\\"\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"global_condition\": \"{\\\"__current_case__\\\": 0, \\\"input_type\\\": \\\"singles\\\", \\\"inputs\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\"}", 
+            "label": null, 
+            "type": "tool", 
+            "id": 3, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "55cf9d9defd1", 
+                "name": "concatenate_multiple_datasets", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Concatenate multiple datasets"
+        }, 
+        "2": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/yac_clipper/yac/2.3.0", 
+            "errors": null, 
+            "uuid": "4d773707-d5ed-48c2-b9d2-334f32e2e1f7", 
+            "tool_version": "2.3.0", 
+            "outputs": [
+                {
+                    "type": "input", 
+                    "name": "output"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionoutput": {
+                    "output_name": "output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/yac_clipper/yac/2.3.0", 
+            "input_connections": {
+                "input": {
+                    "output_name": "output", 
+                    "id": 0
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "input", 
+                    "description": "runtime parameter for tool Clip adapter"
+                }
+            ], 
+            "position": {
+                "top": 462.5333251953125, 
+                "left": 387.51666259765625
+            }, 
+            "tool_state": "{\"out_format\": \"\\\"fasta\\\"\", \"__page__\": null, \"min\": \"\\\"18\\\"\", \"max\": \"\\\"30\\\"\", \"__rerun_remap_job_id__\": null, \"clip_source\": \"{\\\"__current_case__\\\": 0, \\\"clip_sequence\\\": \\\"TGGAATTCTCGGGTGCCAAG\\\", \\\"clip_source_list\\\": \\\"prebuilt\\\"}\", \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"Nmode\": \"\\\"reject\\\"\"}", 
+            "label": null, 
+            "type": "tool", 
+            "id": 2, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "f7947c5a18b8", 
+                "name": "yac_clipper", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Clip adapter"
+        }, 
+        "5": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1", 
+            "errors": null, 
+            "uuid": "91a11662-d2cc-410b-baf3-c684396a992f", 
+            "tool_version": "2.1.1", 
+            "outputs": [
+                {
+                    "type": "tabular", 
+                    "name": "output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "aligned"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "unaligned"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionunaligned": {
+                    "output_name": "unaligned", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionaligned": {
+                    "output_name": "aligned", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionoutput": {
+                    "output_name": "output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1", 
+            "input_connections": {
+                "input": {
+                    "output_name": "out_file1", 
+                    "id": 3
+                }, 
+                "refGenomeSource|ownFile": {
+                    "output_name": "output", 
+                    "id": 1
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "input", 
+                    "description": "runtime parameter for tool sR_bowtie"
+                }, 
+                {
+                    "name": "refGenomeSource", 
+                    "description": "runtime parameter for tool sR_bowtie"
+                }
+            ], 
+            "position": {
+                "top": 610, 
+                "left": 882
+            }, 
+            "tool_state": "{\"__page__\": null, \"output_format\": \"\\\"bam\\\"\", \"v_mismatches\": \"\\\"0\\\"\", \"additional_fasta\": \"\\\"No\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"refGenomeSource\": \"{\\\"__current_case__\\\": 1, \\\"genomeSource\\\": \\\"history\\\", \\\"ownFile\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\", \"method\": \"\\\"multiple\\\"\"}", 
+            "label": null, 
+            "type": "tool", 
+            "id": 5, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "0281bb245635", 
+                "name": "sr_bowtie", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "sR_bowtie"
+        }, 
+        "4": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1", 
+            "errors": null, 
+            "uuid": "89c2c404-f8dc-4a86-87a3-173b3757fa42", 
+            "tool_version": "2.1.1", 
+            "outputs": [
+                {
+                    "type": "tabular", 
+                    "name": "output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "aligned"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "unaligned"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionunaligned": {
+                    "output_name": "unaligned", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionoutput": {
+                    "output_name": "output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionaligned": {
+                    "output_name": "aligned", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1", 
+            "input_connections": {
+                "input": {
+                    "output_name": "out_file1", 
+                    "id": 3
+                }, 
+                "refGenomeSource|ownFile": {
+                    "output_name": "output", 
+                    "id": 1
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "input", 
+                    "description": "runtime parameter for tool sR_bowtie"
+                }, 
+                {
+                    "name": "refGenomeSource", 
+                    "description": "runtime parameter for tool sR_bowtie"
+                }
+            ], 
+            "position": {
+                "top": 185, 
+                "left": 875
+            }, 
+            "tool_state": "{\"__page__\": null, \"output_format\": \"\\\"tabular\\\"\", \"v_mismatches\": \"\\\"0\\\"\", \"additional_fasta\": \"\\\"No\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"refGenomeSource\": \"{\\\"__current_case__\\\": 1, \\\"genomeSource\\\": \\\"history\\\", \\\"ownFile\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\", \"method\": \"\\\"multiple\\\"\"}", 
+            "label": null, 
+            "type": "tool", 
+            "id": 4, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "0281bb245635", 
+                "name": "sr_bowtie", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "sR_bowtie"
+        }, 
+        "7": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/small_rna_maps/small_rna_maps/2.14.0", 
+            "errors": null, 
+            "uuid": "701a4814-5bb8-4d89-8b82-03f4a4bf613a", 
+            "tool_version": "2.14.0", 
+            "outputs": [
+                {
+                    "type": "tabular", 
+                    "name": "output_tab"
+                }, 
+                {
+                    "type": "bed", 
+                    "name": "output_bed"
+                }, 
+                {
+                    "type": "tabular", 
+                    "name": "extra_output_tab"
+                }, 
+                {
+                    "type": "pdf", 
+                    "name": "output_pdf"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionextra_output_tab": {
+                    "output_name": "extra_output_tab", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionoutput_tab": {
+                    "output_name": "output_tab", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "output_bed", 
+                    "uuid": "ff2d5b5c-4046-4365-8aee-c1af2a61adcb", 
+                    "label": null
+                }, 
+                {
+                    "output_name": "output_pdf", 
+                    "uuid": "2de820e3-5559-4411-93da-82d873980235", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/small_rna_maps/small_rna_maps/2.14.0", 
+            "input_connections": {
+                "inputs": {
+                    "output_name": "output", 
+                    "id": 5
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "inputs", 
+                    "description": "runtime parameter for tool small_rna_maps"
+                }
+            ], 
+            "position": {
+                "top": 654, 
+                "left": 1231.5
+            }, 
+            "tool_state": "{\"inputs\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"ylimits_cond\": \"{\\\"__current_case__\\\": 1, \\\"ylimits\\\": \\\"false\\\"}\", \"minsize\": \"\\\"18\\\"\", \"maxsize\": \"\\\"30\\\"\", \"normalization\": \"\\\"1\\\"\", \"plots_options\": \"{\\\"__current_case__\\\": 0, \\\"extra_plot\\\": \\\"Size\\\", \\\"first_plot\\\": \\\"Counts\\\", \\\"plots_options_selector\\\": \\\"two_plot\\\"}\"}", 
+            "label": null, 
+            "type": "tool", 
+            "id": 7, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "14adf24603b6", 
+                "name": "small_rna_maps", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "small_rna_maps"
+        }, 
+        "6": {
+            "tool_id": "wc_gnu", 
+            "errors": null, 
+            "uuid": "2af514d7-4b04-422b-95da-06bd475076aa", 
+            "tool_version": "1.0.0", 
+            "outputs": [
+                {
+                    "type": "tabular", 
+                    "name": "out_file1"
+                }
+            ], 
+            "post_job_actions": {
+                "RenameDatasetActionout_file1": {
+                    "output_name": "out_file1", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "nbre of remapped reads"
+                    }
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "out_file1", 
+                    "uuid": "8eb9cd5a-06a8-4fd4-a102-4ffc28c569a5", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "wc_gnu", 
+            "input_connections": {
+                "input1": {
+                    "output_name": "output", 
+                    "id": 4
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "input1", 
+                    "description": "runtime parameter for tool Line/Word/Character count"
+                }
+            ], 
+            "position": {
+                "top": 309, 
+                "left": 1211.5
+            }, 
+            "tool_state": "{\"__page__\": null, \"include_header\": \"\\\"true\\\"\", \"input1\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"options\": \"[\\\"lines\\\"]\", \"__rerun_remap_job_id__\": null}", 
+            "label": null, 
+            "type": "tool", 
+            "id": 6, 
+            "name": "Line/Word/Character count"
+        }
+    }, 
+    "annotation": "", 
+    "name": "Metavisitor: Workflow for remapping in Use Cases 2-1,2"
+}
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/Galaxy-Workflow-Metavisitor__Workflow_for_small_RNA_profiling_of_contigs.ga	Sun Jul 21 19:22:52 2019 -0400
@@ -0,0 +1,473 @@
+{
+    "a_galaxy_workflow": "true", 
+    "uuid": "691e3812-602f-4492-93f3-f1355698b197", 
+    "tags": [], 
+    "format-version": "0.1", 
+    "version": 1, 
+    "steps": {
+        "1": {
+            "tool_id": null, 
+            "errors": null, 
+            "uuid": "9b24b7ef-5eb5-4c87-9272-42f9f05e109f", 
+            "tool_version": null, 
+            "outputs": [], 
+            "workflow_outputs": [
+                {
+                    "output_name": "output", 
+                    "uuid": "aa452f52-79bc-4b65-b230-6bcd9badfb2f", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": null, 
+            "input_connections": {}, 
+            "inputs": [], 
+            "position": {
+                "top": 439, 
+                "left": 304
+            }, 
+            "tool_state": "{}", 
+            "label": "de novo assembled Oases contigs", 
+            "type": "data_input", 
+            "id": 1, 
+            "name": "Input dataset"
+        }, 
+        "0": {
+            "tool_id": null, 
+            "errors": null, 
+            "uuid": "ed07d831-9b23-4def-b883-f6fe24eb55a0", 
+            "tool_version": null, 
+            "outputs": [], 
+            "workflow_outputs": [
+                {
+                    "output_name": "output", 
+                    "uuid": "e73d1517-c1f3-4a7f-8fbd-e2297906ee1f", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": null, 
+            "input_connections": {}, 
+            "inputs": [], 
+            "position": {
+                "top": 289, 
+                "left": 271
+            }, 
+            "tool_state": "{\"collection_type\": \"list\"}", 
+            "label": "Input Dataset Collection of fastq reads", 
+            "type": "data_collection_input", 
+            "id": 0, 
+            "name": "Input dataset collection"
+        }, 
+        "3": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/fasta_filter_by_length/fasta_filter_by_length/1.1", 
+            "errors": null, 
+            "uuid": "88093ee6-2279-4398-8350-6c0e6f59720c", 
+            "tool_version": "1.1", 
+            "outputs": [
+                {
+                    "type": "fasta", 
+                    "name": "output"
+                }
+            ], 
+            "post_job_actions": {
+                "RenameDatasetActionoutput": {
+                    "output_name": "output", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Contig (>300 nt)"
+                    }
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "output", 
+                    "uuid": "7eaafc91-9c84-4307-bbff-6ad629170bdc", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/fasta_filter_by_length/fasta_filter_by_length/1.1", 
+            "input_connections": {
+                "input": {
+                    "output_name": "output", 
+                    "id": 1
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "input", 
+                    "description": "runtime parameter for tool Filter sequences by length"
+                }
+            ], 
+            "position": {
+                "top": 451, 
+                "left": 569
+            }, 
+            "tool_state": "{\"__page__\": null, \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"max_length\": \"\\\"0\\\"\", \"min_length\": \"\\\"300\\\"\"}", 
+            "label": null, 
+            "type": "tool", 
+            "id": 3, 
+            "tool_shed_repository": {
+                "owner": "devteam", 
+                "changeset_revision": "2fd6033d0e9c", 
+                "name": "fasta_filter_by_length", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Filter sequences by length"
+        }, 
+        "2": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/yac_clipper/yac/2.3.0", 
+            "errors": null, 
+            "uuid": "a07a6d78-bdd3-4092-b463-c0bd7f796efe", 
+            "tool_version": "2.3.0", 
+            "outputs": [
+                {
+                    "type": "input", 
+                    "name": "output"
+                }
+            ], 
+            "post_job_actions": {
+                "RenameDatasetActionoutput": {
+                    "output_name": "output", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Clipped reads"
+                    }
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "output", 
+                    "uuid": "890a91ad-07e6-421d-a40f-b75aff18f95b", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/yac_clipper/yac/2.3.0", 
+            "input_connections": {
+                "input": {
+                    "output_name": "output", 
+                    "id": 0
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "input", 
+                    "description": "runtime parameter for tool Clip adapter"
+                }
+            ], 
+            "position": {
+                "top": 294, 
+                "left": 587
+            }, 
+            "tool_state": "{\"out_format\": \"\\\"fasta\\\"\", \"__page__\": null, \"min\": \"\\\"18\\\"\", \"max\": \"\\\"30\\\"\", \"__rerun_remap_job_id__\": null, \"clip_source\": \"{\\\"__current_case__\\\": 0, \\\"clip_sequence\\\": \\\"TGGAATTCTCGGGTGCCAAG\\\", \\\"clip_source_list\\\": \\\"prebuilt\\\"}\", \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"Nmode\": \"\\\"reject\\\"\"}", 
+            "label": null, 
+            "type": "tool", 
+            "id": 2, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "f7947c5a18b8", 
+                "name": "yac_clipper", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Clip adapter"
+        }, 
+        "5": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/galaxyp/regex_find_replace/regex1/1.0.0", 
+            "errors": null, 
+            "uuid": "a069c8db-14ef-4708-89be-3a5d5a926498", 
+            "tool_version": "1.0.0", 
+            "outputs": [
+                {
+                    "type": "input", 
+                    "name": "out_file1"
+                }
+            ], 
+            "post_job_actions": {
+                "RenameDatasetActionout_file1": {
+                    "output_name": "out_file1", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "contig (>300t, simplified names)"
+                    }
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "out_file1", 
+                    "uuid": "fa095644-f7e0-4c44-a555-4d24f8fddc85", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/galaxyp/regex_find_replace/regex1/1.0.0", 
+            "input_connections": {
+                "input": {
+                    "output_name": "output", 
+                    "id": 3
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "input", 
+                    "description": "runtime parameter for tool Regex Find And Replace"
+                }
+            ], 
+            "position": {
+                "top": 443, 
+                "left": 842
+            }, 
+            "tool_state": "{\"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"checks\": \"[{\\\"__index__\\\": 0, \\\"pattern\\\": \\\"_Confidence_.+\\\", \\\"replacement\\\": \\\"\\\"}]\", \"__page__\": null}", 
+            "label": null, 
+            "type": "tool", 
+            "id": 5, 
+            "tool_shed_repository": {
+                "owner": "galaxyp", 
+                "changeset_revision": "209b7c5ee9d7", 
+                "name": "regex_find_replace", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Regex Find And Replace"
+        }, 
+        "4": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", 
+            "errors": null, 
+            "uuid": "a10d3b12-9018-4b96-9492-18e1b1e87a83", 
+            "tool_version": "1.4.1", 
+            "outputs": [
+                {
+                    "type": "input", 
+                    "name": "paired_output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "list_output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "out_file1"
+                }, 
+                {
+                    "type": "_sniff_", 
+                    "name": "paired_out_file"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionpaired_out_file": {
+                    "output_name": "paired_out_file", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "RenameDatasetActionout_file1": {
+                    "output_name": "out_file1", 
+                    "action_type": "RenameDatasetAction", 
+                    "action_arguments": {
+                        "newname": "Merged clipped reads"
+                    }
+                }, 
+                "HideDatasetActionpaired_output": {
+                    "output_name": "paired_output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionlist_output": {
+                    "output_name": "list_output", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "out_file1", 
+                    "uuid": "362a4d36-9fd9-4f68-a271-d068a245d307", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", 
+            "input_connections": {
+                "global_condition|inputs": {
+                    "output_name": "output", 
+                    "id": 2
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "global_condition", 
+                    "description": "runtime parameter for tool Concatenate multiple datasets"
+                }
+            ], 
+            "position": {
+                "top": 221.5, 
+                "left": 831
+            }, 
+            "tool_state": "{\"dataset_names\": \"\\\"false\\\"\", \"headers\": \"\\\"0\\\"\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"global_condition\": \"{\\\"__current_case__\\\": 0, \\\"input_type\\\": \\\"singles\\\", \\\"inputs\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\"}", 
+            "label": null, 
+            "type": "tool", 
+            "id": 4, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "55cf9d9defd1", 
+                "name": "concatenate_multiple_datasets", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "Concatenate multiple datasets"
+        }, 
+        "7": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/small_rna_maps/small_rna_maps/2.14.0", 
+            "errors": null, 
+            "uuid": "95dc4ba8-402f-4d64-b5e9-8706589bc7fc", 
+            "tool_version": "2.14.0", 
+            "outputs": [
+                {
+                    "type": "tabular", 
+                    "name": "output_tab"
+                }, 
+                {
+                    "type": "bed", 
+                    "name": "output_bed"
+                }, 
+                {
+                    "type": "tabular", 
+                    "name": "extra_output_tab"
+                }, 
+                {
+                    "type": "pdf", 
+                    "name": "output_pdf"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionextra_output_tab": {
+                    "output_name": "extra_output_tab", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionoutput_tab": {
+                    "output_name": "output_tab", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "output_bed", 
+                    "uuid": "cab2a668-47c6-4e86-aab6-22155d6a3e4d", 
+                    "label": null
+                }, 
+                {
+                    "output_name": "output_pdf", 
+                    "uuid": "9436b9c9-2dda-4649-8367-10e71d3a429e", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/small_rna_maps/small_rna_maps/2.14.0", 
+            "input_connections": {
+                "inputs": {
+                    "output_name": "output", 
+                    "id": 6
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "inputs", 
+                    "description": "runtime parameter for tool small_rna_maps"
+                }
+            ], 
+            "position": {
+                "top": 383, 
+                "left": 1496.5
+            }, 
+            "tool_state": "{\"inputs\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__page__\": null, \"series\": \"[{\\\"__index__\\\": 0, \\\"inputs\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"normalization\\\": \\\"1.0\\\"}]\", \"__rerun_remap_job_id__\": null, \"ylimits_cond\": \"{\\\"__current_case__\\\": 1, \\\"ylimits\\\": \\\"false\\\"}\", \"minsize\": \"\\\"18\\\"\", \"cluster\": \"\\\"0\\\"\", \"maxsize\": \"\\\"30\\\"\", \"normalization\": \"\\\"1\\\"\", \"plots_options\": \"{\\\"__current_case__\\\": 0, \\\"extra_plot\\\": \\\"Size\\\", \\\"first_plot\\\": \\\"Counts\\\", \\\"plots_options_selector\\\": \\\"two_plot\\\"}\"}", 
+            "label": null, 
+            "type": "tool", 
+            "id": 7, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "14adf24603b6", 
+                "name": "small_rna_maps", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "small_rna_maps"
+        }, 
+        "6": {
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1", 
+            "errors": null, 
+            "uuid": "7e4be478-ae45-4282-812c-e72dc15c3d2d", 
+            "tool_version": "2.1.1", 
+            "outputs": [
+                {
+                    "type": "tabular", 
+                    "name": "output"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "aligned"
+                }, 
+                {
+                    "type": "input", 
+                    "name": "unaligned"
+                }
+            ], 
+            "post_job_actions": {
+                "HideDatasetActionunaligned": {
+                    "output_name": "unaligned", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }, 
+                "HideDatasetActionaligned": {
+                    "output_name": "aligned", 
+                    "action_type": "HideDatasetAction", 
+                    "action_arguments": {}
+                }
+            }, 
+            "workflow_outputs": [
+                {
+                    "output_name": "output", 
+                    "uuid": "39529cb2-4ae9-4b89-bab0-9cb59f577046", 
+                    "label": null
+                }
+            ], 
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1", 
+            "input_connections": {
+                "input": {
+                    "output_name": "out_file1", 
+                    "id": 4
+                }, 
+                "refGenomeSource|ownFile": {
+                    "output_name": "out_file1", 
+                    "id": 5
+                }
+            }, 
+            "inputs": [
+                {
+                    "name": "input", 
+                    "description": "runtime parameter for tool sR_bowtie"
+                }, 
+                {
+                    "name": "refGenomeSource", 
+                    "description": "runtime parameter for tool sR_bowtie"
+                }
+            ], 
+            "position": {
+                "top": 368, 
+                "left": 1164
+            }, 
+            "tool_state": "{\"__page__\": null, \"output_format\": \"\\\"tabular\\\"\", \"v_mismatches\": \"\\\"0\\\"\", \"additional_fasta\": \"\\\"No\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"refGenomeSource\": \"{\\\"__current_case__\\\": 1, \\\"genomeSource\\\": \\\"history\\\", \\\"ownFile\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\", \"method\": \"\\\"a_option\\\"\"}", 
+            "label": "Align reads against contigs", 
+            "type": "tool", 
+            "id": 6, 
+            "tool_shed_repository": {
+                "owner": "artbio", 
+                "changeset_revision": "0281bb245635", 
+                "name": "sr_bowtie", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "name": "sR_bowtie"
+        }
+    }, 
+    "annotation": "", 
+    "name": "Metavisitor: Workflow for small RNA profiling of contigs"
+}
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/repository_dependencies.xml	Sun Jul 21 19:22:52 2019 -0400
@@ -0,0 +1,4 @@
+<?xml version="1.0" ?>
+<repositories description="These workflows require the repository suite_metavisitor_2">
+    <repository changeset_revision="1570b18266be" name="suite_metavisitor_2" owner="artbio" toolshed="http://toolshed.g2.bx.psu.edu"/>
+</repositories>
\ No newline at end of file