Mercurial > repos > artbio > mircounts
view mircounts.xml @ 3:6b8adacd4750 draft
planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mircounts commit fa65a844f9041a83767f5305ab360abfdf68f59f
| author | artbio |
|---|---|
| date | Wed, 26 Jul 2017 19:15:08 -0400 |
| parents | f59c643b00fc |
| children | da1aa7de2b19 |
line wrap: on
line source
<tool id="mircounts" name="miRcounts" version="0.9.3"> <description> Counts miRNA alignments from small RNA sequence data</description> <requirements> <requirement type="package" version="1.18">gnu-wget</requirement> <requirement type="package" version="1.2">bowtie</requirement> <requirement type="package" version="1.4.1">samtools</requirement> <requirement type="package" version="0.11.2.1">pysam</requirement> <requirement type="package" version="1.3.2=r3.3.2_0">r-optparse</requirement> <requirement type="package" version="0.20_34=r3.3.2_0">r-lattice</requirement> </requirements> <command detect_errors="exit_code"><![CDATA[ ## To be refactored with guidelines in https://github.com/ARTbio/tools-artbio/issues/140 wget ftp://mirbase.org/pub/mirbase/CURRENT/genomes/${genomeKey}.gff3 && ## download gff3 specified by the variable genomeKey python '$__tool_directory__'/mature_mir_gff_translation.py --input ${genomeKey}.gff3 --output $gff3 && ## transcode the mature miR genome coordinates into coordinates relative to the corresponding "miRNA_primary_transcript". wget ftp://mirbase.org/pub/mirbase/CURRENT/hairpin.fa.gz && sh '$__tool_directory__'/format_fasta_hairpins.sh $genomeKey && #if $cutadapt.cutoption == "yes": python '$__tool_directory__'/yac.py --input $cutadapt.input --output clipped_input.fastq --output_format fastq --adapter_to_clip $cutadapt.clip_source.clip_sequence --min $cutadapt.min --max $cutadapt.max --Nmode $cutadapt.Nmode && #else ln -f -s '$cutadapt.clipped_input' clipped_input.fastq && #end if bowtie-build hairpin.fa hairpin && bowtie -v $v -M 1 --best --strata --norc -p \${GALAXY_SLOTS:-4} --sam hairpin -q clipped_input.fastq 2>/dev/null | samtools sort -O bam -o '$output' && samtools index $output && python '$__tool_directory__'/mircounts.py -pm --alignment $output --gff $gff3 --quality_threshold 10 --pre_mirs $pre_mir_count_file --mirs $mir_count_file --lattice $coverage_dataframe; #if $plotting.plottingOption == 'yes': Rscript '$__tool_directory__'/coverage_plotting.R --dataframe $coverage_dataframe --type $plotting.display --output $latticePDF #end if ]]></command> <inputs> <conditional name="cutadapt"> <param label="Remove adapter sequence before aligning" name="cutoption" type="select"> <option value="no">no</option> <option selected="True" value="yes">yes</option> </param> <when value="yes"> <param format="fastq,fastqsanger" label="Source file" name="input" type="data" /> <param label="min size" name="min" size="4" type="integer" value="15" help="Minimum size of accepted clipped reads" /> <param label="max size" name="max" size="4" type="integer" value="36" help="Maximum size of accepted clipped reads"/> <param label="Accept reads containing N?" name="Nmode" type="select"> <option selected="True" value="accept">accept</option> <option value="reject">reject</option> </param> <conditional name="clip_source"> <param help="Built-in adapters or User-provided" label="Source" name="clip_source_list" type="select"> <option selected="True" value="prebuilt">Use a built-in adapter (select from the list below)</option> <option value="user">Use custom sequence</option> </param> <when value="prebuilt"> <param help="if your adapter is not listed, input your own sequence" label="Select Adapter to clip" name="clip_sequence" type="select"> <option value="TCGTATGCCGTCTTCTGCTTG">Solexa TCGTATGCCGTCTTCTGCTTG</option> <option value="ATCTCGTATGCCGTCTTCTGCTT">Illumina ATCTCGTATGCCGTCTTCTGCTT</option> <option selected="True" value="TGGAATTCTCGGGTGCCAAG">Illumina TruSeq TGGAATTCTCGGGTGCCAAG</option> <option value="CTGTAGGCACCATCAATCGT">IdT CTGTAGGCACCATCAATCGT</option> </param> </when> <when value="user"> <param label="Enter your Sequence" name="clip_sequence" size="35" type="text" value="GAATCC" /> </when> </conditional> </when> <when value="no"> <param label="Select fastq files to align" name="clipped_input" type="data" format="fastq,fastqsanger" help="Note that sequences reads must be clipped from their adapter" /> </when> </conditional> <param name="genomeKey" type="select" label="Choose Organism"> <options from_data_table="miRbase_GenomeKeys"> <column name="name" index="1"/> <column name="value" index="0"/> </options> </param> <param help="command [ bowtie -v 0,1,2,3 -M 1 --best --strata --norc ] will be used. Specify a value for -v (number of mismatches allowed)" label="Number of mismatches allowed" name="v" type="select"> <option value="0">0</option> <option selected="true" value="1">1</option> <option value="2">2</option> <option value="3">3</option> </param> <conditional name="plotting"> <param label="Additional miRNA charts" name="plottingOption" type="select"> <option value="no">no</option> <option value="yes" selected="True">yes</option> </param> <when value="yes"> <param label="Display Coverage with absolute number of reads or relatively to the total number of read matching the gene or mir" name="display" type="select"> <option selected="True" value="relative">Relative Coverage</option> <option value="absolute">Absolute Coverage</option> </param> </when> <when value="no"> </when> </conditional> </inputs> <outputs> <data format="bam" label="BAM alignment" name="output" /> <data format="gff3" label="GFF3 generated by miRCounts" name="gff3"/> <data format="tabular" label="Pre-mir Counts" name="pre_mir_count_file" /> <data format="tabular" label="Mir Counts" name="mir_count_file" /> <data format="tabular" label="Coverage Table" name="coverage_dataframe"> <filter>plotting['plottingOption'] == "yes"</filter> </data> <data format="pdf" label="Pre-mir coverage (${plotting.display})" name="latticePDF"> <filter>plotting['plottingOption'] == "yes"</filter> </data> </outputs> <tests> <test> <param name="cutoption" value="yes" /> <param name="min" value="15"/> <param name="max" value="25"/> <param name="Nmode" value="reject"/> <param name="clip_sequence" value="TCGTATGCCGTCTTCTGCTTG"/> <param name="v" value="0"/> <param name="genomeKey" value="dme"/> <param name="input" value="input.unclipped.fastqsanger" ftype="fastqsanger"/> <param name="plottingOption" value="no"/> <output name="output" file="unclipped.out.bam" ftype="bam"/> <output name="gff3" file="translated_dme.gff3" ftype="gff3"/> <output name="pre_mir_count_file" file="pre_mirs_unclipped_count.tab"/> <output name="mir_count_file" file="mirs_unclipped_count.tab"/> </test> <test> <param name="cutoption" value="yes" /> <param name="min" value="15"/> <param name="max" value="25"/> <param name="Nmode" value="reject"/> <param name="clip_sequence" value="TCGTATGCCGTCTTCTGCTTG"/> <param name="v" value="0"/> <param name="genomeKey" value="dme"/> <param name="input" value="input.unclipped.fastqsanger" ftype="fastqsanger"/> <param name="plottingOption" value="yes"/> <param name="display" value="relative"/> <output name="output" file="unclipped.out.bam" ftype="bam"/> <output name="gff3" file="translated_dme.gff3" ftype="gff3"/> <output name="pre_mir_count_file" file="pre_mirs_unclipped_count.tab"/> <output name="mir_count_file" file="mirs_unclipped_count.tab"/> <output name="latticePDF" file="mir_unclipped_coverage.pdf" ftype="pdf"/> <output name="coverage_dataframe" file="lattice_unclipped_dataframe.tab"/> </test> <test> <param name="cutoption" value="no" /> <param name="v" value="1"/> <param name="genomeKey" value="dme"/> <param name="clipped_input" value="input.clipped.fastqsanger" ftype="fastqsanger"/> <param name="plottingOption" value="yes"/> <param name="display" value="absolute"/> <output name="output" file="clipped.out.bam" ftype="bam"/> <output name="gff3" file="translated_dme.gff3" ftype="gff3"/> <output name="pre_mir_count_file" file="pre_mirs_clipped_count.tab"/> <output name="mir_count_file" file="mirs_clipped_count.tab"/> <output name="latticePDF" file="mir_clipped_coverage.pdf" ftype="pdf"/> <output name="coverage_dataframe" file="lattice_clipped_dataframe.tab"/> </test> </tests> <help> **What it does** + Clips adapter (optional) + Aligns small RNA reads to miRNA mirBase_ reference using bowtie + Computes pre-mir and mir counts using the pysam python package + Plots pre-mir read coverages using R lattice package (optional) This tool uses a species-specific GFF3 file generated from mirBase_ to guide the parsing of a bam file of small RNA alignments. .. _mirBase: ftp://mirbase.org/pub/mirbase/CURRENT/genomes/ ------ **Inputs** 1. A fastq file of reads that may or may not be clipped from their adapter sequence. The tool includes a clipping option if needed. 2. Select the appropriate organism which reads originate from. 3. Choose whether you wish or not to plot the pre-mir coverages. The coverage can be expressed in absolute number of reads covering the real coordinates of the pre-mir sequences, or, as a fraction of the maximum coverage (set to 1) covering the coordinates of pre-mirs expressed as a fraction of the length of the pre-mirs. ------ Absolute : + .. image:: premirs_absolute.png Relative : + .. image:: premirs_relative.png ------- **Outputs** 1. A BAM alignment of input reads 2. A GFF3 file generated by the tool to compute mature mir counts 3. A table of pre-mir counts 4. A table of mature mir counts Optional: 5. A table of pre-mir coverage 6. A PDF file with covererage plots </help> <citations> <citation type="doi">10.1093/bioinformatics/btp352</citation> <citation type="doi">10.1186/gb-2009-10-3-r25</citation> <citation type="bibtex">@Book{, title = {Lattice: Multivariate Data Visualization with R}, author = {Deepayan Sarkar}, publisher = {Springer}, address = {New York}, year = {2008}, note = {ISBN 978-0-387-75968-5}, url = {http://lmdvr.r-forge.r-project.org}, }</citation> </citations> </tool>