annotate test-data/F.vcf @ 3:e332cf9dfa06 draft

"planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit 0f7593f703ba0dfd12aea1c0460e371f08b57d2f"
author artbio
date Thu, 24 Sep 2020 01:32:52 +0000
parents aea952be68cb
children
Ignore whitespace changes - Everywhere: Within whitespace: At end of lines:
rev   line source
2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1 ##fileformat=VCFv4.2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
2 ##FILTER=<ID=PASS,Description="All filters passed">
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
3 ##reference=hg38
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
4 ##source=varscan.py
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
5 ##contig=<ID=chr1,length=248956422>
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
6 ##contig=<ID=chr10,length=133797422>
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
7 ##contig=<ID=chr11,length=135086622>
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
8 ##contig=<ID=chr12,length=133275309>
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
9 ##contig=<ID=chr13,length=114364328>
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
10 ##contig=<ID=chr14,length=107043718>
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
11 ##contig=<ID=chr15,length=101991189>
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
12 ##contig=<ID=chr16,length=90338345>
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
13 ##contig=<ID=chr17,length=83257441>
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
14 ##contig=<ID=chr18,length=80373285>
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
15 ##contig=<ID=chr19,length=58617616>
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
16 ##contig=<ID=chr2,length=242193529>
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
17 ##contig=<ID=chr20,length=64444167>
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
18 ##contig=<ID=chr21,length=46709983>
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
19 ##contig=<ID=chr22,length=50818468>
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
20 ##contig=<ID=chr3,length=198295559>
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
21 ##contig=<ID=chr4,length=190214555>
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
22 ##contig=<ID=chr5,length=181538259>
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
23 ##contig=<ID=chr6,length=170805979>
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
24 ##contig=<ID=chr7,length=159345973>
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
25 ##contig=<ID=chr8,length=145138636>
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
26 ##contig=<ID=chr9,length=138394717>
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
27 ##contig=<ID=chrM,length=16569>
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
28 ##contig=<ID=chrX,length=156040895>
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
29 ##contig=<ID=chrY,length=57227415>
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
30 ##filter="SOMATIC"
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
31 ##INFO=<ID=INDEL,Number=0,Type=Flag,Description="Indicates that the variant is an INDEL">
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
32 ##INFO=<ID=DP,Number=1,Type=Integer,Description="Total depth of quality bases">
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
33 ##INFO=<ID=SOMATIC,Number=0,Type=Flag,Description="Indicates if record is a somatic mutation">
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
34 ##INFO=<ID=SS,Number=1,Type=String,Description="Somatic status of variant (0=Reference,1=Germline,2=Somatic,3=LOH, or 5=Unknown)">
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
35 ##INFO=<ID=SSC,Number=1,Type=String,Description="Somatic score in Phred scale (0-255) derived from somatic p-value">
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
36 ##INFO=<ID=GPV,Number=1,Type=Float,Description="Fisher's Exact Test P-value of tumor+normal versus no variant for Germline calls">
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
37 ##INFO=<ID=SPV,Number=1,Type=Float,Description="Fisher's Exact Test P-value of tumor versus normal for Somatic/LOH calls">
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
38 ##FILTER=<ID=str10,Description="Less than 10% or more than 90% of variant supporting reads on one strand">
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
39 ##FILTER=<ID=indelError,Description="Likely artifact due to indel reads at this position">
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
40 ##FILTER=<ID=VarCount,Description="Fewer than 4 variant-supporting reads">
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
41 ##FILTER=<ID=VarFreq,Description="Variant allele frequency below 0.05">
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
42 ##FILTER=<ID=VarAvgRL,Description="Average clipped length of variant-supporting reads < 90">
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
43 ##FILTER=<ID=VarReadPos,Description="Relative average read position < 0.1">
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
44 ##FILTER=<ID=VarDist3,Description="Average distance to effective 3' end < 0.1">
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
45 ##FILTER=<ID=VarMMQS,Description="Average mismatch quality sum for variant reads > 100">
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
46 ##FILTER=<ID=VarMapQual,Description="Average mapping quality of variant reads < 15">
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
47 ##FILTER=<ID=VarBaseQual,Description="Average base quality of variant reads < 15">
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
48 ##FILTER=<ID=Strand,Description="Strand representation of variant reads < 0.01">
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
49 ##FILTER=<ID=RefAvgRL,Description="Average clipped length of ref-supporting reads < 90">
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
50 ##FILTER=<ID=RefReadPos,Description="Relative average read position < 0.1">
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
51 ##FILTER=<ID=RefDist3,Description="Average distance to effective 3' end < 0.1">
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
52 ##FILTER=<ID=RefMapQual,Description="Average mapping quality of reference reads < 15">
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
53 ##FILTER=<ID=RefBaseQual,Description="Average base quality of ref-supporting reads < 15">
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
54 ##FILTER=<ID=RefMMQS,Description="Average mismatch quality sum for ref-supporting reads > 100">
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
55 ##FILTER=<ID=MMQSdiff,Description="Mismatch quality sum difference (var - ref) > 50">
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
56 ##FILTER=<ID=MinMMQSdiff,Description="Mismatch quality sum difference (var - ref) < 50">
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
57 ##FILTER=<ID=MapQualDiff,Description="Mapping quality difference (ref - var) > 50">
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
58 ##FILTER=<ID=MaxBAQdiff,Description="Average base quality difference (ref - var) > 50">
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
59 ##FILTER=<ID=ReadLenDiff,Description="Average supporting read length difference (ref - var) > 0.25">
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
60 ##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype code">
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
61 ##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype quality">
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
62 ##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read depth">
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
63 ##FORMAT=<ID=AD,Number=R,Type=Integer,Description="Read depth for each allele">
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
64 ##FORMAT=<ID=ADF,Number=R,Type=Integer,Description="Read depth for each allele on the forward strand">
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
65 ##FORMAT=<ID=ADR,Number=R,Type=Integer,Description="Read depth for each allele on the reverse strand">
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
66 #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT TUMOR
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
67 chr1 167967 . G A 0 PASS DP=23;GPV=1;SPV=0.14229;SS=2;SSC=8;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:9:7,2:7,2:0,0
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
68 chr1 271578 . A AT 0 PASS DP=69;GPV=1;SPV=0.012429;SS=2;SSC=19;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:29:17,5:7,2:10,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
69 chr1 636494 . A G 0 PASS DP=113;GPV=1;SPV=0.031633;SS=2;SSC=14;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:60:47,13:24,9:23,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
70 chr1 996625 . A G 0 PASS DP=43;GPV=1;SPV=0.083867;SS=2;SSC=10;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:27:22,5:19,2:3,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
71 chr1 1644921 . A G 0 PASS DP=75;GPV=1;SPV=0.045371;SS=2;SSC=13;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:39:29,10:16,5:13,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
72 chr1 1864314 . C CAAAA 0 PASS DP=26;GPV=1;SPV=0.049428;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:8,7:6,6:2,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
73 chr1 1976870 . C CAG 0 PASS DP=47;GPV=1;SPV=0.00016042;SS=2;SSC=37;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:25:9,16:2,6:7,10
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
74 chr1 2142262 . A C 0 PASS DP=20;GPV=1;SPV=0.18947;SS=2;SSC=7;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:9:7,2:5,1:2,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
75 chr1 2913844 . C G 0 PASS DP=75;GPV=1;SPV=4.1392e-05;SS=2;SSC=43;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:40:26,14:14,6:12,8
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
76 chr1 3181193 . C T 0 PASS DP=50;GPV=1;SPV=0.024399;SS=2;SSC=16;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:25:18,7:5,5:13,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
77 chr1 4251782 . A ATTTTTTT 0 PASS DP=33;GPV=1;SPV=0.085095;SS=2;SSC=10;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:14,4:9,3:5,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
78 chr1 5606389 . A AATATATATATATAT 0 PASS DP=27;GPV=1;SPV=0.018648;SS=2;SSC=17;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:3,7:2,6:1,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
79 chr1 5732600 . A AG 0 PASS DP=31;GPV=1;SPV=0.0043505;SS=2;SSC=23;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:9,7:6,3:3,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
80 chr1 7051663 . C CTGCCAGGACAGACTCATCCCTGTT 0 PASS DP=55;GPV=1;SPV=0.031156;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:24:20,4:11,1:9,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
81 chr1 8167511 . GCACA G 0 PASS DP=26;GPV=1;SPV=0.18132;SS=2;SSC=7;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:14:7,5:4,3:3,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
82 chr1 8233826 . A ATATATTTT 0 PASS DP=16;GPV=1;SPV=0.35714;SS=2;SSC=4;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:8:3,2:1,1:2,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
83 chr1 8501213 . G A 0 PASS DP=36;GPV=1;SPV=0.1016;SS=2;SSC=9;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:21:17,4:3,2:14,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
84 chr1 8647643 . G A 0 PASS DP=51;GPV=1;SPV=0.048962;SS=2;SSC=13;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:11,5:8,4:3,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
85 chr1 9647481 . A AATTATTATT 0 PASS DP=46;GPV=1;SPV=0.0046297;SS=2;SSC=23;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:22:11,10:3,5:8,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
86 chr1 9916882 . G A 0 PASS DP=45;GPV=1;SPV=0.059432;SS=2;SSC=12;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:19,4:12,1:7,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
87 chr1 10583224 . C CT 0 PASS DP=39;GPV=1;SPV=0.022127;SS=2;SSC=16;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:12,4:5,1:7,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
88 chr1 10616234 . G A 0 PASS DP=58;GPV=1;SPV=3.9275e-05;SS=2;SSC=44;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:37:19,18:7,10:12,8
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
89 chr1 11045998 . C T 0 PASS DP=71;GPV=1;SPV=0.00030325;SS=2;SSC=35;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:41:28,13:10,6:18,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
90 chr1 11771345 . C A 0 PASS DP=58;GPV=1;SPV=3.4859e-05;SS=2;SSC=44;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:33:18,15:13,9:5,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
91 chr1 12381912 . C CTTTCT 0 PASS DP=45;GPV=1;SPV=0.022593;SS=2;SSC=16;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:24:16,8:1,4:15,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
92 chr1 12871201 . C CT 0 PASS DP=61;GPV=1;SPV=0.018007;SS=2;SSC=17;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:29:19,10:10,3:9,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
93 chr1 12881560 . G A 0 PASS DP=63;GPV=1;SPV=0.013032;SS=2;SSC=18;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:25:19,6:8,3:11,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
94 chr1 12947985 . CTACAAAAA C 0 PASS DP=76;GPV=1;SPV=0.0010116;SS=2;SSC=29;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:34:24,10:9,3:15,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
95 chr1 13040570 . C T 0 PASS DP=24;GPV=1;SPV=0.067288;SS=2;SSC=11;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:13:9,4:2,3:7,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
96 chr1 13168970 . G A 0 PASS DP=26;GPV=1;SPV=0.020006;SS=2;SSC=16;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:8:4,4:3,1:1,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
97 chr1 13198698 . A G 0 PASS DP=45;GPV=1;SPV=0.024875;SS=2;SSC=16;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:25:15,10:11,4:4,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
98 chr1 13199161 . C A 0 PASS DP=47;GPV=1;SPV=0.03148;SS=2;SSC=15;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:25:16,9:9,6:7,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
99 chr1 13217209 . G A 0 PASS DP=19;GPV=1;SPV=0.21053;SS=2;SSC=6;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:9:7,2:2,1:5,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
100 chr1 13341194 . G A 0 PASS DP=90;GPV=1;SPV=0.0036109;SS=2;SSC=24;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:42:35,7:21,6:14,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
101 chr1 13926652 . T TA 0 PASS DP=47;GPV=1;SPV=0.00036335;SS=2;SSC=34;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:10,7:6,3:4,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
102 chr1 14528362 . G A 0 PASS DP=43;GPV=1;SPV=0.057503;SS=2;SSC=12;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:31:19,8:6,3:13,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
103 chr1 15194917 . CT C 0 PASS DP=39;GPV=1;SPV=0.0074752;SS=2;SSC=21;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:6,11:5,8:1,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
104 chr1 15293726 . C A 0 PASS DP=42;GPV=1;SPV=0.024383;SS=2;SSC=16;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:26:19,7:9,3:10,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
105 chr1 16311503 . A AATAT 0 PASS DP=35;GPV=1;SPV=0.083772;SS=2;SSC=10;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:15,7:9,3:6,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
106 chr1 16631115 . G A 0 PASS DP=226;GPV=1;SPV=0.0019297;SS=2;SSC=27;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:105:81,24:42,14:39,10
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
107 chr1 16656105 . G A 0 PASS DP=37;GPV=1;SPV=0.037397;SS=2;SSC=14;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:20:13,7:11,6:2,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
108 chr1 16690451 . A T 0 PASS DP=69;GPV=1;SPV=0.0079357;SS=2;SSC=21;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:38:25,12:8,3:17,9
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
109 chr1 16732665 . A G 0 PASS DP=162;GPV=1;SPV=0.011554;SS=2;SSC=19;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:70:60,10:37,8:23,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
110 chr1 16733940 . C A 0 PASS DP=31;GPV=1;SPV=0.07564;SS=2;SSC=11;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:13,4:0,0:13,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
111 chr1 16746403 . C A 0 PASS DP=54;GPV=1;SPV=0.018572;SS=2;SSC=17;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:32:20,12:8,5:12,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
112 chr1 16755063 . G A 0 PASS DP=227;GPV=1;SPV=6.2457e-05;SS=2;SSC=42;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:111:98,13:53,5:45,8
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
113 chr1 16849895 . G A 0 PASS DP=76;GPV=1;SPV=0.019869;SS=2;SSC=17;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:48:34,14:17,8:17,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
114 chr1 16860384 . C G 0 PASS DP=98;GPV=1;SPV=0.0059855;SS=2;SSC=22;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:51:39,12:19,3:20,9
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
115 chr1 16896326 . A C 0 PASS DP=113;GPV=1;SPV=0.0087261;SS=2;SSC=20;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:47:40,7:16,3:24,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
116 chr1 17296935 . A G 0 PASS DP=56;GPV=1;SPV=0.0067299;SS=2;SSC=21;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:29:22,7:12,4:10,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
117 chr1 17822187 . G A 0 PASS DP=73;GPV=1;SPV=0.0017389;SS=2;SSC=27;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:27:21,6:8,2:13,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
118 chr1 18611271 . GAGGA G 0 PASS DP=28;GPV=1;SPV=0.023715;SS=2;SSC=16;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:12:6,4:6,3:0,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
119 chr1 21699192 . AT A 0 PASS DP=26;GPV=1;SPV=0.1592;SS=2;SSC=7;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:13,4:8,3:5,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
120 chr1 21977914 . GC G 0 PASS DP=47;GPV=1;SPV=0.0028915;SS=2;SSC=25;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:12,11:5,2:7,9
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
121 chr1 24266066 . T TTGGA 0 PASS DP=39;GPV=1;SPV=0.018564;SS=2;SSC=17;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:21:12,8:7,4:5,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
122 chr1 24407443 . A AT 0 PASS DP=52;GPV=1;SPV=0.0010171;SS=2;SSC=29;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:29:12,10:6,8:6,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
123 chr1 26214945 . A C 0 PASS DP=42;GPV=1;SPV=0.21465;SS=2;SSC=6;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:25:11,5:5,3:6,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
124 chr1 27824672 . C CT 0 PASS DP=21;GPV=1;SPV=0.068111;SS=2;SSC=11;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:12:7,5:2,4:5,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
125 chr1 28923111 . C T 0 PASS DP=35;GPV=1;SPV=0.12308;SS=2;SSC=9;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:5,3:3,1:2,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
126 chr1 33493334 . G T 0 PASS DP=58;GPV=1;SPV=4.8916e-05;SS=2;SSC=43;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:30:17,13:8,4:9,9
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
127 chr1 33510173 . A T 0 PASS DP=19;GPV=1;SPV=0.18301;SS=2;SSC=7;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:8:6,2:2,1:4,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
128 chr1 33890232 . C CT 0 PASS DP=43;GPV=1;SPV=0.0081527;SS=2;SSC=20;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:27:15,12:9,8:6,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
129 chr1 34128594 . G A 0 PASS DP=66;GPV=1;SPV=0.001651;SS=2;SSC=27;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:37:27,10:12,4:15,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
130 chr1 34959242 . CA C 0 PASS DP=31;GPV=1;SPV=0.12318;SS=2;SSC=9;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:15,4:10,3:5,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
131 chr1 35207403 . AT A 0 PASS DP=30;GPV=1;SPV=0.0014564;SS=2;SSC=28;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:18:8,10:6,8:2,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
132 chr1 36806360 . G A 0 PASS DP=62;GPV=1;SPV=2.6735e-05;SS=2;SSC=45;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:36:20,16:9,6:11,10
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
133 chr1 37427639 . G GAAGAAAGAAAGAAAGA 0 PASS DP=23;GPV=1;SPV=0.071429;SS=2;SSC=11;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:12:2,4:2,4:0,0
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
134 chr1 38514430 . C CT 0 PASS DP=31;GPV=1;SPV=0.046962;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:14:8,5:5,3:3,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
135 chr1 39021177 . C T 0 PASS DP=32;GPV=1;SPV=0.068627;SS=2;SSC=11;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:5,3:0,0:5,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
136 chr1 39021181 . C T 0 PASS DP=30;GPV=1;SPV=0.175;SS=2;SSC=7;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:5,2:0,0:5,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
137 chr1 39045665 . G A 0 PASS DP=25;GPV=1;SPV=0.040458;SS=2;SSC=13;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:10,7:3,1:7,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
138 chr1 41260924 . T C 0 PASS DP=44;GPV=1;SPV=0.06057;SS=2;SSC=12;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:26:21,5:11,1:10,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
139 chr1 42131047 . CAAAA C 0 PASS DP=38;GPV=1;SPV=0.035721;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:13:6,4:3,3:3,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
140 chr1 43813905 . A G 0 PASS DP=60;GPV=1;SPV=0.10714;SS=2;SSC=9;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:34:1,2:0,0:1,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
141 chr1 43882975 . A AT 0 PASS DP=44;GPV=1;SPV=0.023174;SS=2;SSC=16;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:27:20,7:9,5:11,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
142 chr1 44006586 . C CA 0 PASS DP=37;GPV=1;SPV=0.15398;SS=2;SSC=8;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:22:16,4:12,3:4,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
143 chr1 45539020 . G A 0 PASS DP=68;GPV=1;SPV=0.064803;SS=2;SSC=11;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:42:26,6:10,3:16,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
144 chr1 46212281 . A AT 0 PASS DP=60;GPV=1;SPV=0.0093079;SS=2;SSC=20;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:29:22,6:13,4:9,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
145 chr1 46242260 . G T 0 PASS DP=36;GPV=1;SPV=0.030805;SS=2;SSC=15;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:12,7:11,7:1,0
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
146 chr1 46700982 . A AGT 0 PASS DP=33;GPV=1;SPV=0.041466;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:10,6:4,3:6,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
147 chr1 48192907 . A G 0 PASS DP=29;GPV=1;SPV=0.010572;SS=2;SSC=19;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:12:6,6:4,2:2,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
148 chr1 51933945 . G A 0 PASS DP=75;GPV=1;SPV=8.4086e-07;SS=2;SSC=60;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:32:18,14:9,8:9,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
149 chr1 52783985 . C CGT 0 PASS DP=48;GPV=1;SPV=0.032155;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:29:20,9:12,6:8,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
150 chr1 54985221 . G A 0 PASS DP=54;GPV=1;SPV=0.21212;SS=2;SSC=6;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:33:4,4:4,4:0,0
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
151 chr1 55030784 . C A 0 PASS DP=49;GPV=1;SPV=0.079204;SS=2;SSC=11;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:33:27,6:12,4:15,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
152 chr1 55941187 . G A 0 PASS DP=47;GPV=1;SPV=0.018827;SS=2;SSC=17;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:28:21,7:10,3:11,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
153 chr1 56227866 . T TACAC 0 PASS DP=42;GPV=1;SPV=0.017469;SS=2;SSC=17;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:11,8:7,4:4,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
154 chr1 57139968 . T A 0 PASS DP=58;GPV=1;SPV=0.00037187;SS=2;SSC=34;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:31:20,11:11,5:9,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
155 chr1 59805102 . A ATG 0 PASS DP=48;GPV=1;SPV=0.0041795;SS=2;SSC=23;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:27:16,11:12,9:4,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
156 chr1 59860777 . C CT 0 PASS DP=39;GPV=1;SPV=0.022366;SS=2;SSC=16;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:14,9:6,4:8,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
157 chr1 60301295 . T TTGTGTG 0 PASS DP=29;GPV=1;SPV=0.026533;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:11:6,5:4,3:2,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
158 chr1 63283765 . A AAG 0 PASS DP=34;GPV=1;SPV=0.034545;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:10,6:5,3:5,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
159 chr1 63817884 . G A 0 PASS DP=69;GPV=1;SPV=1.4829e-05;SS=2;SSC=48;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:33:20,13:8,7:12,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
160 chr1 64268120 . A AAAAAAAC 0 PASS DP=39;GPV=1;SPV=0.012328;SS=2;SSC=19;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:18:12,5:4,2:8,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
161 chr1 64398280 . AAG A 0 PASS DP=30;GPV=1;SPV=0.040038;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:9,6:7,4:2,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
162 chr1 65038938 . T TTGTGTGTGTGTG 0 PASS DP=51;GPV=1;SPV=0.046888;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:24:17,7:9,4:8,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
163 chr1 65518871 . CTT C 0 PASS DP=34;GPV=1;SPV=0.039244;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:12,4:2,1:10,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
164 chr1 65731219 . G A 0 PASS DP=60;GPV=1;SPV=0.0045987;SS=2;SSC=23;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:26:20,6:9,5:11,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
165 chr1 65736482 . T C 0 PASS DP=73;GPV=1;SPV=0.00020766;SS=2;SSC=36;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:31:22,9:14,2:8,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
166 chr1 68406582 . T A 0 PASS DP=55;GPV=1;SPV=0.040021;SS=2;SSC=13;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:32:17,5:7,2:10,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
167 chr1 71928161 . C T 0 PASS DP=30;GPV=1;SPV=0.0079095;SS=2;SSC=21;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:5,8:3,5:2,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
168 chr1 74111090 . G A 0 PASS DP=48;GPV=1;SPV=0.0044219;SS=2;SSC=23;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:21:15,6:7,3:8,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
169 chr1 74448376 . G T 0 PASS DP=45;GPV=1;SPV=0.0047587;SS=2;SSC=23;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:20:14,6:11,4:3,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
170 chr1 77533509 . CAAAAAA C 0 PASS DP=35;GPV=1;SPV=0.037681;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:7,7:6,5:1,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
171 chr1 77765735 . C CT 0 PASS DP=21;GPV=1;SPV=0.017028;SS=2;SSC=17;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:12:6,6:4,3:2,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
172 chr1 77793626 . AT A 0 PASS DP=44;GPV=1;SPV=0.2759;SS=2;SSC=5;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:29:26,3:13,2:13,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
173 chr1 78005365 . CT C 0 PASS DP=59;GPV=1;SPV=0.028465;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:30:25,5:15,4:10,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
174 chr1 79202929 . AC A 0 PASS DP=37;GPV=1;SPV=0.026676;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:14,5:5,1:9,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
175 chr1 80497577 . TA T 0 PASS DP=75;GPV=1;SPV=4.8738e-05;SS=2;SSC=43;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:44:28,16:10,11:18,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
176 chr1 81825657 . C A 0 PASS DP=32;GPV=1;SPV=0.0096686;SS=2;SSC=20;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:12:4,5:3,1:1,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
177 chr1 82627810 . C T 0 PASS DP=33;GPV=1;SPV=0.16484;SS=2;SSC=7;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:4,2:1,1:3,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
178 chr1 83241791 . C CATAT 0 PASS DP=35;GPV=1;SPV=0.19094;SS=2;SSC=7;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:19,4:16,3:3,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
179 chr1 83248504 . A AT 0 PASS DP=81;GPV=1;SPV=0.0060587;SS=2;SSC=22;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:43:29,14:18,12:11,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
180 chr1 83390671 . A C 0 PASS DP=73;GPV=1;SPV=0.011442;SS=2;SSC=19;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:40:33,7:12,6:21,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
181 chr1 83716701 . C G 0 PASS DP=81;GPV=1;SPV=2.4826e-07;SS=2;SSC=66;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:40:22,18:12,9:10,9
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
182 chr1 84418338 . A C 0 PASS DP=48;GPV=1;SPV=0.065012;SS=2;SSC=11;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:25:21,4:12,1:9,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
183 chr1 86985509 . CAT C 0 PASS DP=37;GPV=1;SPV=0.016414;SS=2;SSC=17;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:18:12,5:3,4:9,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
184 chr1 88567358 . C CA 0 PASS DP=29;GPV=1;SPV=0.028284;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:7,7:5,6:2,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
185 chr1 91040277 . T C 0 PASS DP=24;GPV=1;SPV=0.027415;SS=2;SSC=15;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:6,10:4,6:2,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
186 chr1 95681557 . G T 0 PASS DP=60;GPV=1;SPV=3.7162e-06;SS=2;SSC=54;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:25:13,12:6,6:7,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
187 chr1 96650554 . T TTGTGTGTG 0 PASS DP=46;GPV=1;SPV=0.031354;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:24:15,9:6,1:9,8
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
188 chr1 98112422 . TAA T 0 PASS DP=16;GPV=1;SPV=0.030303;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:8:2,4:2,4:0,0
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
189 chr1 99227734 . C A 0 PASS DP=65;GPV=1;SPV=0.00036745;SS=2;SSC=34;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:44:27,17:15,5:12,12
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
190 chr1 99822926 . T A 0 PASS DP=48;GPV=1;SPV=0.017056;SS=2;SSC=17;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:10,7:5,1:5,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
191 chr1 100283934 . AG A 0 PASS DP=26;GPV=1;SPV=0.094071;SS=2;SSC=10;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:12,5:7,3:5,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
192 chr1 100394111 . C T 0 PASS DP=49;GPV=1;SPV=0.14851;SS=2;SSC=8;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:31:27,4:13,3:14,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
193 chr1 101306166 . C CT 0 PASS DP=28;GPV=1;SPV=0.031121;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:8,9:4,8:4,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
194 chr1 101529118 . G GAC 0 PASS DP=60;GPV=1;SPV=0.00010085;SS=2;SSC=39;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:31:19,12:11,5:8,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
195 chr1 102577728 . C T 0 PASS DP=58;GPV=1;SPV=7.6466e-06;SS=2;SSC=51;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:29:15,14:7,10:8,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
196 chr1 102810163 . C CAA 0 PASS DP=19;GPV=1;SPV=0.041176;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:9:5,4:5,4:0,0
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
197 chr1 103792409 . C T 0 PASS DP=48;GPV=1;SPV=0.0010691;SS=2;SSC=29;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:31:18,13:7,8:11,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
198 chr1 104883863 . C T 0 PASS DP=60;GPV=1;SPV=0.00044723;SS=2;SSC=33;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:36:23,13:16,5:7,8
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
199 chr1 105455897 . AT A 0 PASS DP=67;GPV=1;SPV=6.0123e-06;SS=2;SSC=52;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:26:15,11:9,8:6,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
200 chr1 106599829 . C CTCTCTCTCTA 0 PASS DP=23;GPV=1;SPV=0.035088;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:12:6,4:3,1:3,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
201 chr1 108164778 . T TTG 0 PASS DP=41;GPV=1;SPV=0.026993;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:24:15,9:8,4:7,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
202 chr1 110808911 . T A 0 PASS DP=21;GPV=1;SPV=0.0089783;SS=2;SSC=20;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:9:3,6:1,5:2,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
203 chr1 111632921 . C CA 0 PASS DP=38;GPV=1;SPV=0.11976;SS=2;SSC=9;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:25:16,5:14,3:2,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
204 chr1 112383177 . C CA 0 PASS DP=34;GPV=1;SPV=0.11947;SS=2;SSC=9;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:9,8:6,7:3,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
205 chr1 112918065 . T G 0 PASS DP=64;GPV=1;SPV=0.00086701;SS=2;SSC=30;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:32:17,15:7,5:10,10
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
206 chr1 114716126 . C T 0 PASS DP=60;GPV=1;SPV=0.00056474;SS=2;SSC=32;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:33:22,11:6,5:16,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
207 chr1 115766865 . TGATA T 0 PASS DP=50;GPV=1;SPV=0.0020828;SS=2;SSC=26;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:25:9,10:3,6:6,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
208 chr1 118287981 . T C 0 PASS DP=65;GPV=1;SPV=0.046146;SS=2;SSC=13;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:32:10,5:6,4:4,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
209 chr1 118682202 . ATG A 0 PASS DP=33;GPV=1;SPV=0.024256;SS=2;SSC=16;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:7,8:2,6:5,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
210 chr1 121753005 . C G 0 PASS DP=60;GPV=1;SPV=0.036872;SS=2;SSC=14;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:32:27,5:6,3:21,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
211 chr1 121773480 . TC T 0 PASS DP=68;GPV=1;SPV=0.038637;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:31:27,4:9,2:18,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
212 chr1 122138561 . T A 0 PASS DP=43;GPV=1;SPV=0.013215;SS=2;SSC=18;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:21:12,9:8,7:4,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
213 chr1 122258262 . G C 0 PASS DP=18;GPV=1;SPV=0.23529;SS=2;SSC=6;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:9:7,2:7,2:0,0
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
214 chr1 124704670 . G A 0 PASS DP=25;GPV=1;SPV=0.11647;SS=2;SSC=9;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:12,5:4,4:8,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
215 chr1 124798780 . C T 0 PASS DP=40;GPV=1;SPV=0.065489;SS=2;SSC=11;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:21:17,4:17,4:0,0
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
216 chr1 124872883 . A T 0 PASS DP=77;GPV=1;SPV=0.010192;SS=2;SSC=19;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:32:27,5:1,1:26,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
217 chr1 124906269 . A T 0 PASS DP=191;GPV=1;SPV=0.0092839;SS=2;SSC=20;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:97:76,21:41,6:35,15
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
218 chr1 124921389 . G C 0 PASS DP=21;GPV=1;SPV=0.14706;SS=2;SSC=8;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:11:7,3:2,1:5,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
219 chr1 124924096 . G T 0 PASS DP=22;GPV=1;SPV=0.10714;SS=2;SSC=9;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:11:8,3:6,2:2,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
220 chr1 125094391 . T C 0 PASS DP=185;GPV=1;SPV=0.016143;SS=2;SSC=17;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:100:83,17:45,7:38,10
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
221 chr1 143217456 . T A 0 PASS DP=14662;GPV=1;SPV=0.048859;SS=2;SSC=13;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:7342:6526,739:1761,246:4765,493
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
222 chr1 143217457 . C A 0 PASS DP=13749;GPV=1;SPV=0.0086744;SS=2;SSC=20;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:6854:6080,740:1673,258:4407,482
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
223 chr1 143241404 . A G 0 PASS DP=194;GPV=1;SPV=0.0089788;SS=2;SSC=20;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:82:62,19:58,18:4,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
224 chr1 143256117 . A T 0 PASS DP=1640;GPV=1;SPV=0.03986;SS=2;SSC=13;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:847:755,92:200,20:555,72
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
225 chr1 143334185 . C T 0 PASS DP=21;GPV=1;SPV=0.13333;SS=2;SSC=8;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:8:6,2:6,2:0,0
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
226 chr1 143388651 . ATAT A 0 PASS DP=112;GPV=1;SPV=0.0036516;SS=2;SSC=24;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:52:38,14:28,9:10,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
227 chr1 143509985 . A G 0 PASS DP=71;GPV=1;SPV=0.0045966;SS=2;SSC=23;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:38:30,8:4,1:26,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
228 chr1 143729574 . A C 0 PASS DP=23;GPV=1;SPV=0.037623;SS=2;SSC=14;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:13:6,7:3,4:3,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
229 chr1 143739631 . A T 0 PASS DP=41;GPV=1;SPV=0.017469;SS=2;SSC=17;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:11,8:7,1:4,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
230 chr1 144104657 . C T 0 PASS DP=189;GPV=1;SPV=0.037546;SS=2;SSC=14;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:87:74,13:34,5:40,8
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
231 chr1 144105904 . G A 0 PASS DP=81;GPV=1;SPV=0.03525;SS=2;SSC=14;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:38:29,9:14,8:15,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
232 chr1 144517710 . C T 0 PASS DP=38;GPV=1;SPV=0.018203;SS=2;SSC=17;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:22:13,9:7,1:6,8
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
233 chr1 144529624 . G A 0 PASS DP=43;GPV=1;SPV=0.018956;SS=2;SSC=17;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:18:11,7:4,6:7,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
234 chr1 144549585 . TA T 0 PASS DP=23;GPV=1;SPV=0.15415;SS=2;SSC=8;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:11,4:11,4:0,0
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
235 chr1 145227356 . A G 0 PASS DP=57;GPV=1;SPV=0.14286;SS=2;SSC=8;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:27:1,2:1,2:0,0
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
236 chr1 145257749 . A G 0 PASS DP=32;GPV=1;SPV=0.085095;SS=2;SSC=10;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:18:14,4:1,1:13,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
237 chr1 145602319 . A AT 0 PASS DP=32;GPV=1;SPV=0.017848;SS=2;SSC=17;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:21:8,12:3,4:5,8
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
238 chr1 146129855 . T C 0 PASS DP=54;GPV=1;SPV=2.3666e-05;SS=2;SSC=46;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:18:9,9:5,2:4,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
239 chr1 146626712 . G C 0 PASS DP=68;GPV=1;SPV=0.029248;SS=2;SSC=15;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:40:31,9:20,3:11,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
240 chr1 148067460 . C T 0 PASS DP=38;GPV=1;SPV=0.0018071;SS=2;SSC=27;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:8,8:5,5:3,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
241 chr1 148106039 . GA G 0 PASS DP=53;GPV=1;SPV=0.093588;SS=2;SSC=10;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:30:26,4:14,3:12,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
242 chr1 148556832 . C CCCTT 0 PASS DP=29;GPV=1;SPV=0.16319;SS=2;SSC=7;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:15,4:15,4:0,0
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
243 chr1 148869643 . C G 0 PASS DP=23;GPV=1;SPV=0.055901;SS=2;SSC=12;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:12:8,4:4,1:4,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
244 chr1 148893065 . C CTGTG 0 PASS DP=23;GPV=1;SPV=0.033333;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 1/1:.:8:0,6:0,5:0,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
245 chr1 148906381 . G C 0 PASS DP=22;GPV=1;SPV=0.020124;SS=2;SSC=16;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:14:7,7:1,2:6,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
246 chr1 149801515 . GAAGT G 0 PASS DP=37;GPV=1;SPV=0.023812;SS=2;SSC=16;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:16,7:7,4:9,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
247 chr1 150088434 . A AATATATAT 0 PASS DP=32;GPV=1;SPV=0.030046;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:10,7:6,5:4,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
248 chr1 150241670 . C CT 0 PASS DP=45;GPV=1;SPV=0.034961;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:29:18,11:8,5:10,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
249 chr1 150312297 . G T 0 PASS DP=66;GPV=1;SPV=0.020244;SS=2;SSC=16;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:27:20,7:13,5:7,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
250 chr1 150741885 . G A 0 PASS DP=73;GPV=1;SPV=0.19203;SS=2;SSC=7;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:45:23,4:15,1:8,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
251 chr1 153202842 . C T 0 PASS DP=47;GPV=1;SPV=0.021442;SS=2;SSC=16;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:26:20,6:8,5:12,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
252 chr1 153877887 . TA T 0 PASS DP=43;GPV=1;SPV=0.024795;SS=2;SSC=16;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:18:14,4:12,2:2,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
253 chr1 154304368 . GT G 0 PASS DP=25;GPV=1;SPV=0.014142;SS=2;SSC=18;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:11:5,6:4,5:1,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
254 chr1 157035978 . AAT A 0 PASS DP=33;GPV=1;SPV=0.036101;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:18:13,5:8,4:5,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
255 chr1 158444953 . CTCTT C 0 PASS DP=28;GPV=1;SPV=0.048309;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:9,7:2,5:7,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
256 chr1 158984028 . G GT 0 PASS DP=39;GPV=1;SPV=0.0036613;SS=2;SSC=24;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:24:7,10:3,7:4,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
257 chr1 159126648 . C CAA 0 PASS DP=37;GPV=1;SPV=0.059497;SS=2;SSC=12;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:22:10,8:3,7:7,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
258 chr1 160335883 . CA C 0 PASS DP=29;GPV=1;SPV=0.017385;SS=2;SSC=17;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:12:3,6:1,4:2,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
259 chr1 160948627 . C CT 0 PASS DP=36;GPV=1;SPV=0.010552;SS=2;SSC=19;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:8,8:4,6:4,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
260 chr1 161142085 . T TAAAA 0 PASS DP=24;GPV=1;SPV=0.070652;SS=2;SSC=11;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:10,5:8,3:2,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
261 chr1 161543514 . T C 0 PASS DP=90;GPV=1;SPV=0.044015;SS=2;SSC=13;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:55:46,9:16,6:30,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
262 chr1 161594229 . G A 0 PASS DP=36;GPV=1;SPV=0.082251;SS=2;SSC=10;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:20:16,4:8,2:8,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
263 chr1 161746600 . C CTCTCTCTCTT 0 PASS DP=43;GPV=1;SPV=0.015516;SS=2;SSC=18;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:21:14,5:5,1:9,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
264 chr1 162467966 . CT C 0 PASS DP=27;GPV=1;SPV=0.0057228;SS=2;SSC=22;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:11:6,5:5,4:1,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
265 chr1 162693713 . G C 0 PASS DP=49;GPV=1;SPV=0.00024212;SS=2;SSC=36;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:22:13,9:5,5:8,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
266 chr1 163328474 . A C 0 PASS DP=57;GPV=1;SPV=0.00037903;SS=2;SSC=34;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:34:21,13:10,6:11,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
267 chr1 165020483 . A G 0 PASS DP=35;GPV=1;SPV=0.015907;SS=2;SSC=17;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:10,7:6,3:4,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
268 chr1 166896635 . C CT 0 PASS DP=30;GPV=1;SPV=0.005305;SS=2;SSC=22;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:9:5,4:3,3:2,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
269 chr1 167558484 . C CT 0 PASS DP=40;GPV=1;SPV=0.0028678;SS=2;SSC=25;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:20:9,11:6,7:3,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
270 chr1 168009472 . C T 0 PASS DP=32;GPV=1;SPV=0.13473;SS=2;SSC=8;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:20:16,4:3,1:13,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
271 chr1 168440410 . A G 0 PASS DP=35;GPV=1;SPV=0.036825;SS=2;SSC=14;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:20:12,8:7,4:5,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
272 chr1 170282189 . T TA 0 PASS DP=46;GPV=1;SPV=0.018904;SS=2;SSC=17;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:24:16,8:6,6:10,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
273 chr1 170933516 . A G 0 PASS DP=21;GPV=1;SPV=0.035088;SS=2;SSC=14;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:10:6,4:4,2:2,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
274 chr1 171045482 . G T 0 PASS DP=48;GPV=1;SPV=0.00039944;SS=2;SSC=33;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:27:11,16:3,6:8,10
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
275 chr1 171681188 . C T 0 PASS DP=41;GPV=1;SPV=0.020212;SS=2;SSC=16;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:12:8,4:5,1:3,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
276 chr1 171694664 . G GAA 0 PASS DP=44;GPV=1;SPV=0.11996;SS=2;SSC=9;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:26:19,4:13,2:6,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
277 chr1 171906127 . AT A 0 PASS DP=50;GPV=1;SPV=0.00011732;SS=2;SSC=39;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:21:12,9:9,6:3,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
278 chr1 172872876 . T G 0 PASS DP=25;GPV=1;SPV=0.12;SS=2;SSC=9;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:9:7,2:0,0:7,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
279 chr1 174136273 . T TTA 0 PASS DP=41;GPV=1;SPV=0.027859;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:24:15,6:9,3:6,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
280 chr1 174607239 . G A 0 PASS DP=63;GPV=1;SPV=0.0022162;SS=2;SSC=26;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:34:25,9:16,5:9,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
281 chr1 174946916 . AAAT A 0 PASS DP=30;GPV=1;SPV=0.081597;SS=2;SSC=10;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:14,5:10,2:4,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
282 chr1 175417011 . AAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAG A 0 PASS DP=30;GPV=1;SPV=0.11424;SS=2;SSC=9;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:21:15,6:6,1:9,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
283 chr1 176042270 . C CA 0 PASS DP=35;GPV=1;SPV=0.14387;SS=2;SSC=8;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:26:12,9:7,6:5,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
284 chr1 176406395 . G A 0 PASS DP=55;GPV=1;SPV=0.0010863;SS=2;SSC=29;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:28:19,9:6,3:13,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
285 chr1 178695925 . TA T 0 PASS DP=61;GPV=1;SPV=0.030658;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:26:22,4:12,2:10,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
286 chr1 182650202 . G A 0 PASS DP=70;GPV=1;SPV=3.9131e-05;SS=2;SSC=44;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:31:20,11:9,3:11,8
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
287 chr1 183166550 . C CAA 0 PASS DP=30;GPV=1;SPV=0.043423;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:12,5:10,4:2,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
288 chr1 185077375 . G C 0 PASS DP=49;GPV=1;SPV=0.005596;SS=2;SSC=22;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:25:18,7:4,1:14,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
289 chr1 185454785 . C T 0 PASS DP=63;GPV=1;SPV=0.00025863;SS=2;SSC=35;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:38:24,14:9,7:15,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
290 chr1 185655759 . ATG A 0 PASS DP=61;GPV=1;SPV=0.12656;SS=2;SSC=8;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:37:33,4:19,2:14,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
291 chr1 186628414 . C A 0 PASS DP=75;GPV=1;SPV=6.9826e-06;SS=2;SSC=51;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:46:26,20:17,7:9,13
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
292 chr1 187637839 . G A 0 PASS DP=50;GPV=1;SPV=0.014488;SS=2;SSC=18;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:26:20,6:10,3:10,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
293 chr1 187827169 . G A 0 PASS DP=28;GPV=1;SPV=0.026923;SS=2;SSC=15;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:1,11:1,2:0,9
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
294 chr1 188473743 . A AG 0 PASS DP=36;GPV=1;SPV=0.0094953;SS=2;SSC=20;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:25:7,13:5,2:2,11
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
295 chr1 188805737 . C T 0 PASS DP=60;GPV=1;SPV=1.5288e-05;SS=2;SSC=48;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:31:17,14:7,11:10,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
296 chr1 188848105 . T G 0 PASS DP=35;GPV=1;SPV=0.035819;SS=2;SSC=14;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:14,5:8,2:6,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
297 chr1 191806127 . ATTTG A 0 PASS DP=40;GPV=1;SPV=0.22222;SS=2;SSC=6;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:18:3,2:1,1:2,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
298 chr1 192627568 . TAA T 0 PASS DP=32;GPV=1;SPV=0.015905;SS=2;SSC=17;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:4,8:2,5:2,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
299 chr1 194088881 . T TTATCTATCTATC 0 PASS DP=50;GPV=1;SPV=0.008542;SS=2;SSC=20;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:14,9:5,6:9,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
300 chr1 194698706 . C A 0 PASS DP=55;GPV=1;SPV=0.00026263;SS=2;SSC=35;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:22:14,8:5,6:9,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
301 chr1 195004485 . A C 0 PASS DP=72;GPV=1;SPV=0.00017262;SS=2;SSC=37;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:33:23,10:12,5:11,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
302 chr1 196806094 . C T 0 PASS DP=35;GPV=1;SPV=0.0057417;SS=2;SSC=22;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:8,7:3,6:5,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
303 chr1 196904226 . C T 0 PASS DP=66;GPV=1;SPV=0.00011139;SS=2;SSC=39;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:34:22,12:10,4:12,8
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
304 chr1 197365625 . TC T 0 PASS DP=48;GPV=1;SPV=0.065012;SS=2;SSC=11;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:25:21,4:7,2:14,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
305 chr1 199367532 . T G 0 PASS DP=27;GPV=1;SPV=0.0028686;SS=2;SSC=25;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:5,10:4,6:1,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
306 chr1 200443192 . A ATT 0 PASS DP=37;GPV=1;SPV=0.00057632;SS=2;SSC=32;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:20:6,11:5,5:1,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
307 chr1 200942179 . CA C 0 PASS DP=27;GPV=1;SPV=0.016908;SS=2;SSC=17;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:9,6:7,5:2,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
308 chr1 202847186 . A ATTTTT 0 PASS DP=35;GPV=1;SPV=0.074026;SS=2;SSC=11;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:15,4:7,2:8,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
309 chr1 202928823 . CT C 0 PASS DP=32;GPV=1;SPV=0.031264;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:20:12,6:7,5:5,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
310 chr1 203330817 . CT C 0 PASS DP=30;GPV=1;SPV=0.024751;SS=2;SSC=16;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:12,7:3,4:9,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
311 chr1 204195269 . CACAT C 0 PASS DP=25;GPV=1;SPV=0.046407;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:13:7,6:1,4:6,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
312 chr1 204195292 . A ACATATACG 0 PASS DP=33;GPV=1;SPV=0.018404;SS=2;SSC=17;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:11,5:3,3:8,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
313 chr1 205884539 . CAT C 0 PASS DP=27;GPV=1;SPV=0.13561;SS=2;SSC=8;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:13,4:8,1:5,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
314 chr1 207213830 . T C 0 PASS DP=17;GPV=1;SPV=0.071429;SS=2;SSC=11;SOMATIC GT:GQ:DP:AD:ADF:ADR 1/1:.:9:1,3:0,1:1,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
315 chr1 207729251 . C CA 0 PASS DP=31;GPV=1;SPV=0.098383;SS=2;SSC=10;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:21:9,7:5,6:4,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
316 chr1 208845734 . C T 0 PASS DP=63;GPV=1;SPV=0.016895;SS=2;SSC=17;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:29:24,5:11,1:13,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
317 chr1 210798040 . CT C 0 PASS DP=43;GPV=1;SPV=0.048497;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:21:17,4:9,1:8,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
318 chr1 212210694 . CT C 0 PASS DP=20;GPV=1;SPV=0.10217;SS=2;SSC=9;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:12:8,4:5,1:3,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
319 chr1 212224368 . C CAG 0 PASS DP=58;GPV=1;SPV=0.048094;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:32:27,5:9,2:18,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
320 chr1 213812952 . T A 0 PASS DP=58;GPV=1;SPV=0.0056882;SS=2;SSC=22;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:26:20,6:5,3:15,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
321 chr1 214398606 . CCTG C 0 PASS DP=33;GPV=1;SPV=0.11096;SS=2;SSC=9;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:22:17,5:9,2:8,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
322 chr1 216165808 . G GT 0 PASS DP=42;GPV=1;SPV=0.0041486;SS=2;SSC=23;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:21:10,11:10,9:0,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
323 chr1 218395611 . C CT 0 PASS DP=23;GPV=1;SPV=0.031734;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:11:5,6:2,2:3,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
324 chr1 218482328 . A AT 0 PASS DP=31;GPV=1;SPV=0.044272;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:7,7:3,2:4,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
325 chr1 218788920 . C T 0 PASS DP=57;GPV=1;SPV=0.00076774;SS=2;SSC=31;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:28:19,9:12,2:7,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
326 chr1 222192151 . G A 0 PASS DP=54;GPV=1;SPV=0.00057068;SS=2;SSC=32;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:30:19,11:14,5:5,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
327 chr1 222488201 . G A 0 PASS DP=53;GPV=1;SPV=0.0043971;SS=2;SSC=23;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:17,6:13,4:4,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
328 chr1 222936762 . TAA T 0 PASS DP=22;GPV=1;SPV=0.031734;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:11:5,6:2,4:3,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
329 chr1 224260699 . CT C 0 PASS DP=30;GPV=1;SPV=0.11166;SS=2;SSC=9;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:18:14,4:7,2:7,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
330 chr1 224711794 . C CA 0 PASS DP=33;GPV=1;SPV=0.047826;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:9,4:6,3:3,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
331 chr1 226114622 . T C 0 PASS DP=31;GPV=1;SPV=0.0053554;SS=2;SSC=22;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:7,8:4,3:3,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
332 chr1 226252318 . A G 0 PASS DP=55;GPV=1;SPV=0.10544;SS=2;SSC=9;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:32:28,4:14,1:14,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
333 chr1 226732102 . C CA 0 PASS DP=25;GPV=1;SPV=0.012384;SS=2;SSC=19;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:6,10:3,8:3,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
334 chr1 226795555 . C CTT 0 PASS DP=22;GPV=1;SPV=0.015152;SS=2;SSC=18;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:9:1,4:0,3:1,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
335 chr1 226886041 . T A 0 PASS DP=47;GPV=1;SPV=0.0069488;SS=2;SSC=21;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:22:16,6:4,5:12,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
336 chr1 227726185 . T C 0 PASS DP=33;GPV=1;SPV=0.013278;SS=2;SSC=18;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:20:10,10:6,8:4,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
337 chr1 228903868 . C T 0 PASS DP=65;GPV=1;SPV=6.6453e-08;SS=2;SSC=71;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:33:14,19:11,8:3,11
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
338 chr1 232424065 . C T 0 PASS DP=55;GPV=1;SPV=0.0058348;SS=2;SSC=22;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:28:21,7:14,4:7,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
339 chr1 232496560 . C CAAA 0 PASS DP=43;GPV=1;SPV=0.021659;SS=2;SSC=16;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:27:16,10:8,8:8,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
340 chr1 232849287 . CTT C 0 PASS DP=16;GPV=1;SPV=0.038462;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:8:4,4:2,1:2,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
341 chr1 234623890 . A G 0 PASS DP=25;GPV=1;SPV=0.22727;SS=2;SSC=6;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:14:4,2:4,2:0,0
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
342 chr1 234786202 . C T 0 PASS DP=41;GPV=1;SPV=0.059099;SS=2;SSC=12;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:21:17,4:7,2:10,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
343 chr1 236464427 . T C 0 PASS DP=23;GPV=1;SPV=0.089245;SS=2;SSC=10;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:10,5:6,3:4,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
344 chr1 238605947 . CAAAA C 0 PASS DP=27;GPV=1;SPV=0.094071;SS=2;SSC=10;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:12,5:7,4:5,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
345 chr1 238739107 . C A 0 PASS DP=50;GPV=1;SPV=0.0014624;SS=2;SSC=28;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:30:19,11:12,6:7,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
346 chr1 240729885 . C CA 0 PASS DP=33;GPV=1;SPV=0.023384;SS=2;SSC=16;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:9,7:8,2:1,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
347 chr1 241235918 . G A 0 PASS DP=33;GPV=1;SPV=0.034545;SS=2;SSC=14;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:10,6:8,3:2,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
348 chr1 241327129 . A AG 0 PASS DP=22;GPV=1;SPV=0.0095694;SS=2;SSC=20;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:8:4,4:4,4:0,0
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
349 chr1 241428779 . C CTT 0 PASS DP=16;GPV=1;SPV=0.46667;SS=2;SSC=3;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:8:5,2:2,1:3,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
350 chr1 242091832 . C T 0 PASS DP=20;GPV=1;SPV=0.029799;SS=2;SSC=15;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:11:6,5:3,1:3,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
351 chr1 242207816 . T TTA 0 PASS DP=21;GPV=1;SPV=0.045455;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:12:1,6:0,2:1,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
352 chr1 242831901 . G A 0 PASS DP=31;GPV=1;SPV=0.23569;SS=2;SSC=6;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:22:15,5:10,3:5,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
353 chr1 245443291 . G A 0 PASS DP=35;GPV=1;SPV=0.02914;SS=2;SSC=15;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:20:12,8:7,6:5,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
354 chr1 245612107 . A T 0 PASS DP=32;GPV=1;SPV=0.10779;SS=2;SSC=9;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:15,4:5,2:10,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
355 chr1 246232920 . T A 0 PASS DP=41;GPV=1;SPV=0.23453;SS=2;SSC=6;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:29:25,4:13,2:12,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
356 chr1 247428109 . C CTG 0 PASS DP=89;GPV=1;SPV=0.0093304;SS=2;SSC=20;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:44:32,12:21,5:11,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
357 chr1 248658775 . A C 0 PASS DP=72;GPV=1;SPV=0.023086;SS=2;SSC=16;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:29:25,4:11,1:14,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
358 chr1 248942173 . G A 0 PASS DP=70;GPV=1;SPV=0.02714;SS=2;SSC=15;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:33:25,8:21,7:4,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
359 chr10 201585 . T TACACACACACACACACACACACAC 0 PASS DP=28;GPV=1;SPV=0.069231;SS=2;SSC=11;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:5,7:5,4:0,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
360 chr10 347891 . G T 0 PASS DP=18;GPV=1;SPV=0.012987;SS=2;SSC=18;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:10:1,5:0,2:1,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
361 chr10 348012 . C CCCCACACTCA 0 PASS DP=55;GPV=1;SPV=0.080354;SS=2;SSC=10;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:30:26,4:23,2:3,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
362 chr10 467539 . T A 0 PASS DP=53;GPV=1;SPV=0.1;SS=2;SSC=10;SOMATIC GT:GQ:DP:AD:ADF:ADR 1/1:.:33:0,2:0,1:0,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
363 chr10 2430663 . G A 0 PASS DP=29;GPV=1;SPV=0.14945;SS=2;SSC=8;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:18:14,4:14,3:0,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
364 chr10 2571322 . T C 0 PASS DP=45;GPV=1;SPV=0.1958;SS=2;SSC=7;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:21:5,3:2,2:3,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
365 chr10 2967703 . C CGT 0 PASS DP=32;GPV=1;SPV=0.14757;SS=2;SSC=8;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:9,7:6,5:3,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
366 chr10 3323486 . C CA 0 PASS DP=27;GPV=1;SPV=0.048055;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:13:6,5:5,4:1,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
367 chr10 5370005 . G GTA 0 PASS DP=47;GPV=1;SPV=0.27607;SS=2;SSC=5;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:31:16,4:4,1:12,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
368 chr10 5398439 . A C 0 PASS DP=40;GPV=1;SPV=0.053015;SS=2;SSC=12;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:20:16,4:7,2:9,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
369 chr10 5610441 . A T 0 PASS DP=46;GPV=1;SPV=0.28571;SS=2;SSC=5;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:2,2:0,0:2,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
370 chr10 5692149 . C CAAAA 0 PASS DP=42;GPV=1;SPV=0.14387;SS=2;SSC=8;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:31:12,9:8,8:4,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
371 chr10 5707654 . T TTC 0 PASS DP=22;GPV=1;SPV=0.01548;SS=2;SSC=18;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:10:4,6:0,4:4,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
372 chr10 5998631 . G A 0 PASS DP=58;GPV=1;SPV=0.0022186;SS=2;SSC=26;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:38:19,19:7,10:12,9
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
373 chr10 6402371 . C CA 0 PASS DP=32;GPV=1;SPV=0.010145;SS=2;SSC=19;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:8,6:8,5:0,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
374 chr10 6517588 . CTTTTT C 0 PASS DP=19;GPV=1;SPV=0.028846;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:10:4,5:3,4:1,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
375 chr10 6876594 . T TCTCA 0 PASS DP=69;GPV=1;SPV=0.000999;SS=2;SSC=30;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:30:0,10:0,6:0,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
376 chr10 8216268 . CTCTTTCTTTCTT C 0 PASS DP=31;GPV=1;SPV=0.033794;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:13:8,5:1,2:7,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
377 chr10 8696501 . G C 0 PASS DP=44;GPV=1;SPV=0.15083;SS=2;SSC=8;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:28:24,4:8,2:16,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
378 chr10 10743101 . C A 0 PASS DP=77;GPV=1;SPV=0.00016735;SS=2;SSC=37;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:35:25,10:15,7:10,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
379 chr10 10857649 . G GTA 0 PASS DP=22;GPV=1;SPV=0.030075;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:12:7,5:4,4:3,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
380 chr10 12056441 . C T 0 PASS DP=35;GPV=1;SPV=0.00071703;SS=2;SSC=31;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:5,10:1,7:4,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
381 chr10 12226655 . GAT G 0 PASS DP=36;GPV=1;SPV=0.017674;SS=2;SSC=17;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:18:10,5:5,2:5,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
382 chr10 12574497 . T TTTA 0 PASS DP=38;GPV=1;SPV=0.10021;SS=2;SSC=9;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:21:13,4:4,3:9,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
383 chr10 13789769 . ATG A 0 PASS DP=28;GPV=1;SPV=0.14757;SS=2;SSC=8;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:9,4:6,3:3,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
384 chr10 14417553 . C T 0 PASS DP=67;GPV=1;SPV=1.3691e-05;SS=2;SSC=48;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:32:19,13:13,7:6,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
385 chr10 15600251 . TA T 0 PASS DP=57;GPV=1;SPV=2.9244e-05;SS=2;SSC=45;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:36:18,18:8,8:10,10
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
386 chr10 15728097 . G A 0 PASS DP=62;GPV=1;SPV=4.9403e-05;SS=2;SSC=43;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:26:16,10:9,2:7,8
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
387 chr10 16324158 . A G 0 PASS DP=34;GPV=1;SPV=0.042724;SS=2;SSC=13;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:11,6:7,5:4,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
388 chr10 16652392 . C CAA 0 PASS DP=29;GPV=1;SPV=0.052107;SS=2;SSC=12;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:12,5:11,4:1,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
389 chr10 21770395 . CT C 0 PASS DP=30;GPV=1;SPV=0.072149;SS=2;SSC=11;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:18:13,5:9,3:4,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
390 chr10 24369179 . A ATGTG 0 PASS DP=40;GPV=1;SPV=0.0088484;SS=2;SSC=20;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:10,7:3,4:7,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
391 chr10 24436757 . CAA C 0 PASS DP=21;GPV=1;SPV=0.088235;SS=2;SSC=10;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:13:6,4:5,3:1,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
392 chr10 24456706 . T A 0 PASS DP=40;GPV=1;SPV=0.003276;SS=2;SSC=24;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:12,7:9,5:3,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
393 chr10 25983935 . G A 0 PASS DP=64;GPV=1;SPV=0.0017823;SS=2;SSC=27;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:31:23,8:8,3:15,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
394 chr10 26721425 . C T 0 PASS DP=38;GPV=1;SPV=0.005667;SS=2;SSC=22;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:18:10,8:6,2:4,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
395 chr10 27572311 . AT A 0 PASS DP=39;GPV=1;SPV=0.0025759;SS=2;SSC=25;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:21:12,8:6,5:6,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
396 chr10 29329657 . ATCTC A 0 PASS DP=54;GPV=1;SPV=0.036566;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:29:17,6:6,2:11,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
397 chr10 29445342 . GAGAGAA G 0 PASS DP=26;GPV=1;SPV=0.03311;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:12:8,4:5,3:3,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
398 chr10 34724899 . G A 0 PASS DP=66;GPV=1;SPV=0.0058421;SS=2;SSC=22;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:45:33,12:19,4:14,8
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
399 chr10 35196895 . G A 0 PASS DP=35;GPV=1;SPV=0.018501;SS=2;SSC=17;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:13:7,6:3,1:4,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
400 chr10 37327549 . G A 0 PASS DP=69;GPV=1;SPV=7.0959e-05;SS=2;SSC=41;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:40:25,15:16,10:9,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
401 chr10 38621941 . C T 0 PASS DP=71;GPV=1;SPV=0.016232;SS=2;SSC=17;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:37:31,6:17,2:14,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
402 chr10 38745197 . GATGAAATGAA G 0 PASS DP=61;GPV=1;SPV=0.028648;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:26:22,4:15,3:7,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
403 chr10 38930473 . G A 0 PASS DP=99;GPV=1;SPV=0.018934;SS=2;SSC=17;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:57:45,12:20,6:25,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
404 chr10 38957246 . C T 0 PASS DP=356;GPV=1;SPV=0.047562;SS=2;SSC=13;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:176:158,18:95,3:63,15
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
405 chr10 38966360 . C T 0 PASS DP=264;GPV=1;SPV=0.0056063;SS=2;SSC=22;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:136:113,23:64,11:49,12
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
406 chr10 38966727 . T C 0 PASS DP=132;GPV=1;SPV=0.033863;SS=2;SSC=14;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:60:54,6:20,5:34,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
407 chr10 39997897 . G T 0 PASS DP=309;GPV=1;SPV=0.0061832;SS=2;SSC=22;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:139:123,16:52,4:71,12
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
408 chr10 40000624 . C A 0 PASS DP=231;GPV=1;SPV=0.030441;SS=2;SSC=15;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:123:103,20:55,16:48,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
409 chr10 40608677 . A T 0 PASS DP=28;GPV=1;SPV=0.044444;SS=2;SSC=13;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:11,5:2,2:9,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
410 chr10 40706691 . G C 0 PASS DP=40;GPV=1;SPV=0.046847;SS=2;SSC=13;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:11,6:4,3:7,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
411 chr10 40864302 . G A 0 PASS DP=19;GPV=1;SPV=0.21053;SS=2;SSC=6;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:9:7,2:0,0:7,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
412 chr10 40920571 . T C 0 PASS DP=78;GPV=1;SPV=0.033517;SS=2;SSC=14;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:36:29,6:11,1:18,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
413 chr10 40975414 . C G 0 PASS DP=78;GPV=1;SPV=0.012197;SS=2;SSC=19;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:43:36,7:23,2:13,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
414 chr10 41135564 . T A 0 PASS DP=147;GPV=1;SPV=0.04186;SS=2;SSC=13;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:76:64,12:57,11:7,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
415 chr10 41150961 . G C 0 PASS DP=56;GPV=1;SPV=0.032688;SS=2;SSC=14;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:29:22,7:12,4:10,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
416 chr10 41202411 . C A 0 PASS DP=103;GPV=1;SPV=0.0087417;SS=2;SSC=20;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:43:36,7:9,1:27,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
417 chr10 41232580 . T A 0 PASS DP=23;GPV=1;SPV=0.013999;SS=2;SSC=18;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:14:7,7:7,5:0,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
418 chr10 41425591 . A T 0 PASS DP=289;GPV=1;SPV=0.0047975;SS=2;SSC=23;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:139:124,15:11,3:113,12
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
419 chr10 41552857 . A T 0 PASS DP=57;GPV=1;SPV=0.023472;SS=2;SSC=16;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:28:23,5:13,3:10,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
420 chr10 41552862 . T A 0 PASS DP=59;GPV=1;SPV=0.044988;SS=2;SSC=13;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:28:24,4:13,2:11,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
421 chr10 41562381 . T A 0 PASS DP=73;GPV=1;SPV=0.0034912;SS=2;SSC=24;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:31:19,12:7,10:12,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
422 chr10 41562631 . T A 0 PASS DP=55;GPV=1;SPV=0.010634;SS=2;SSC=19;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:14,9:6,2:8,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
423 chr10 41564142 . G A 0 PASS DP=104;GPV=1;SPV=0.040248;SS=2;SSC=13;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:49:43,6:19,4:24,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
424 chr10 41576755 . C G 0 PASS DP=92;GPV=1;SPV=0.032789;SS=2;SSC=14;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:44:36,8:17,6:19,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
425 chr10 41713561 . C T 0 PASS DP=57;GPV=1;SPV=0.0042869;SS=2;SSC=23;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:33:24,9:8,3:16,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
426 chr10 41864307 . A T 0 PASS DP=43;GPV=1;SPV=0.027099;SS=2;SSC=15;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:24:16,8:10,5:6,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
427 chr10 41912091 . G C 0 PASS DP=145;GPV=1;SPV=0.014084;SS=2;SSC=18;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:83:66,17:29,11:37,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
428 chr10 42073656 . C G 0 PASS DP=654;GPV=1;SPV=0.012143;SS=2;SSC=19;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:347:299,40:129,22:170,18
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
429 chr10 42073671 . T A 0 PASS DP=648;GPV=1;SPV=0.013281;SS=2;SSC=18;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:334:287,47:131,26:156,21
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
430 chr10 42080556 . G T 0 PASS DP=821;GPV=1;SPV=0.04623;SS=2;SSC=13;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:411:359,52:199,26:160,26
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
431 chr10 42103837 . G A 0 PASS DP=53;GPV=1;SPV=0.011867;SS=2;SSC=19;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:32:24,8:15,5:9,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
432 chr10 42130049 . A T 0 PASS DP=353;GPV=1;SPV=0.0077328;SS=2;SSC=21;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:168:151,17:105,13:46,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
433 chr10 42190895 . GAT G 0 PASS DP=27;GPV=1;SPV=0.014047;SS=2;SSC=18;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:11:6,4:3,3:3,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
434 chr10 42227104 . C CTCA 0 PASS DP=49;GPV=1;SPV=0.049555;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:31:22,9:8,2:14,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
435 chr10 42271021 . C G 0 PASS DP=157;GPV=1;SPV=0.0039034;SS=2;SSC=24;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:74:58,16:26,7:32,9
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
436 chr10 43330621 . TA T 0 PASS DP=31;GPV=1;SPV=0.032901;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:9,6:4,4:5,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
437 chr10 43729991 . AAG A 0 PASS DP=39;GPV=1;SPV=0.24625;SS=2;SSC=6;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:27:19,4:12,2:7,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
438 chr10 44338700 . G A 0 PASS DP=48;GPV=1;SPV=2.3557e-06;SS=2;SSC=56;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:26:10,16:5,6:5,10
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
439 chr10 45507811 . G GA 0 PASS DP=41;GPV=1;SPV=0.03378;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:18:9,6:5,5:4,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
440 chr10 45695659 . C T 0 PASS DP=39;GPV=1;SPV=0.037203;SS=2;SSC=14;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:18:14,4:10,2:4,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
441 chr10 45775775 . G A 0 PASS DP=50;GPV=1;SPV=0.0090384;SS=2;SSC=20;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:25:15,10:9,3:6,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
442 chr10 46391919 . A G 0 PASS DP=63;GPV=1;SPV=0.053635;SS=2;SSC=12;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:36:31,5:20,3:11,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
443 chr10 46411570 . C T 0 PASS DP=90;GPV=1;SPV=0.033847;SS=2;SSC=14;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:41:31,10:12,6:19,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
444 chr10 46455528 . C A 0 PASS DP=30;GPV=1;SPV=0.14143;SS=2;SSC=8;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:15,4:6,2:9,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
445 chr10 46541273 . GT G 0 PASS DP=86;GPV=1;SPV=0.02442;SS=2;SSC=16;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:43:34,9:8,1:26,8
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
446 chr10 46541275 . C CAG 0 PASS DP=89;GPV=1;SPV=0.027077;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:45:36,9:8,1:28,8
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
447 chr10 47584258 . G T 0 PASS DP=53;GPV=1;SPV=0.10745;SS=2;SSC=9;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:31:27,4:16,3:11,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
448 chr10 47606142 . C T 0 PASS DP=57;GPV=1;SPV=0.017732;SS=2;SSC=17;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:32:23,9:11,3:12,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
449 chr10 47995404 . C T 0 PASS DP=49;GPV=1;SPV=0.016464;SS=2;SSC=17;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:26:20,6:13,3:7,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
450 chr10 48806215 . G T 0 PASS DP=82;GPV=1;SPV=4.3619e-09;SS=2;SSC=83;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:36:17,19:7,8:10,11
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
451 chr10 51621007 . G GTATATATATA 0 PASS DP=21;GPV=1;SPV=0.031702;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:10:2,6:1,2:1,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
452 chr10 52866670 . C CAAAAAA 0 PASS DP=23;GPV=1;SPV=0.051084;SS=2;SSC=12;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:13:7,5:3,4:4,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
453 chr10 53604670 . C CTTTT 0 PASS DP=39;GPV=1;SPV=0.041789;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:14,5:9,3:5,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
454 chr10 54105277 . GATATAT G 0 PASS DP=26;GPV=1;SPV=0.01093;SS=2;SSC=19;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:6,9:3,3:3,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
455 chr10 54146887 . TGTGTATAC T 0 PASS DP=40;GPV=1;SPV=0.11538;SS=2;SSC=9;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:20:17,3:9,1:8,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
456 chr10 54221600 . C CT 0 PASS DP=35;GPV=1;SPV=0.029984;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:14:8,6:5,5:3,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
457 chr10 54503225 . A ATATGTG 0 PASS DP=54;GPV=1;SPV=0.018374;SS=2;SSC=17;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:33:19,10:13,7:6,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
458 chr10 54873697 . A T 0 PASS DP=36;GPV=1;SPV=0.030897;SS=2;SSC=15;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:12,4:4,2:8,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
459 chr10 55253253 . T A 0 PASS DP=49;GPV=1;SPV=0.074732;SS=2;SSC=11;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:30:25,5:9,4:16,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
460 chr10 55781207 . GA G 0 PASS DP=34;GPV=1;SPV=0.048872;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:8,5:5,3:3,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
461 chr10 56390120 . A T 0 PASS DP=47;GPV=1;SPV=0.13333;SS=2;SSC=8;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:20:2,2:1,1:1,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
462 chr10 56546403 . A T 0 PASS DP=61;GPV=1;SPV=0.0011625;SS=2;SSC=29;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:31:22,9:8,3:14,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
463 chr10 57379700 . G A 0 PASS DP=55;GPV=1;SPV=0.0004914;SS=2;SSC=33;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:26:17,9:12,6:5,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
464 chr10 57813753 . G A 0 PASS DP=62;GPV=1;SPV=6.8987e-05;SS=2;SSC=41;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:33:20,13:10,7:10,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
465 chr10 58038377 . C T 0 PASS DP=64;GPV=1;SPV=0.017938;SS=2;SSC=17;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:34:28,6:15,2:13,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
466 chr10 58136758 . G GTA 0 PASS DP=24;GPV=1;SPV=0.012821;SS=2;SSC=18;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:3,5:1,2:2,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
467 chr10 59162436 . G T 0 PASS DP=64;GPV=1;SPV=0.004102;SS=2;SSC=23;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:34:26,8:14,3:12,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
468 chr10 60822450 . A G 0 PASS DP=71;GPV=1;SPV=1.5971e-05;SS=2;SSC=47;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:34:21,13:10,3:11,10
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
469 chr10 63556634 . GTT G 0 PASS DP=29;GPV=1;SPV=0.039683;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 1/1:.:12:1,4:1,2:0,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
470 chr10 63652988 . A T 0 PASS DP=45;GPV=1;SPV=0.11779;SS=2;SSC=9;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:27:23,4:15,2:8,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
471 chr10 63733760 . TAGATCTATATCTAC T 0 PASS DP=41;GPV=1;SPV=3.7518e-05;SS=2;SSC=44;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:26:7,19:3,7:4,12
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
472 chr10 64509039 . T G 0 PASS DP=25;GPV=1;SPV=0.036522;SS=2;SSC=14;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:9:6,3:1,2:5,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
473 chr10 67057674 . G T 0 PASS DP=60;GPV=1;SPV=0.030658;SS=2;SSC=15;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:26:22,4:13,2:9,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
474 chr10 70248478 . G T 0 PASS DP=20;GPV=1;SPV=0.175;SS=2;SSC=7;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:8:5,2:1,1:4,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
475 chr10 71642393 . C T 0 PASS DP=25;GPV=1;SPV=0.18447;SS=2;SSC=7;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:9,4:4,1:5,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
476 chr10 74302101 . G T 0 PASS DP=20;GPV=1;SPV=0.1;SS=2;SSC=9;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:11:5,3:1,1:4,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
477 chr10 75884245 . T TTGTGTGTGTG 0 PASS DP=28;GPV=1;SPV=0.034056;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:6,6:1,2:5,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
478 chr10 76535243 . G A 0 PASS DP=48;GPV=1;SPV=0.0028662;SS=2;SSC=25;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:25:17,8:7,5:10,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
479 chr10 77324971 . C CTG 0 PASS DP=33;GPV=1;SPV=0.012384;SS=2;SSC=19;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:3,6:0,2:3,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
480 chr10 78266694 . C CA 0 PASS DP=40;GPV=1;SPV=0.024256;SS=2;SSC=16;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:26:7,10:2,9:5,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
481 chr10 79787227 . T C 0 PASS DP=63;GPV=1;SPV=0.016895;SS=2;SSC=17;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:29:24,5:12,4:12,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
482 chr10 80061163 . C G 0 PASS DP=34;GPV=1;SPV=0.18947;SS=2;SSC=7;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:14:7,2:4,1:3,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
483 chr10 80158813 . G C 0 PASS DP=54;GPV=1;SPV=0.00057068;SS=2;SSC=32;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:30:19,11:9,7:10,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
484 chr10 80990997 . CT C 0 PASS DP=44;GPV=1;SPV=0.060124;SS=2;SSC=12;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:24:13,5:4,2:9,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
485 chr10 82170653 . G GGT 0 PASS DP=18;GPV=1;SPV=0.036405;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:9:3,6:2,5:1,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
486 chr10 84174493 . T C 0 PASS DP=34;GPV=1;SPV=0.01205;SS=2;SSC=19;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:9,7:6,4:3,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
487 chr10 84319447 . T A 0 PASS DP=32;GPV=1;SPV=0.055901;SS=2;SSC=12;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:8,4:4,2:4,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
488 chr10 84394385 . A ATGTGTGTGTGTG 0 PASS DP=37;GPV=1;SPV=0.053922;SS=2;SSC=12;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:20:6,5:4,4:2,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
489 chr10 88478570 . C A 0 PASS DP=42;GPV=1;SPV=3.9238e-05;SS=2;SSC=44;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:20:9,11:4,9:5,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
490 chr10 90037498 . G GA 0 PASS DP=27;GPV=1;SPV=0.013387;SS=2;SSC=18;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:8,7:6,3:2,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
491 chr10 90102009 . C CAGAGAGAGAG 0 PASS DP=46;GPV=1;SPV=0.016238;SS=2;SSC=17;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:14,7:11,6:3,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
492 chr10 90604983 . GAGAT G 0 PASS DP=56;GPV=1;SPV=0.037837;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:32:22,10:13,5:9,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
493 chr10 91153473 . G A 0 PASS DP=72;GPV=1;SPV=0.00034236;SS=2;SSC=34;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:35:25,10:15,3:10,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
494 chr10 91664097 . G GGGAT 0 PASS DP=49;GPV=1;SPV=0.057396;SS=2;SSC=12;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:29:23,5:12,3:11,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
495 chr10 92675142 . AC A 0 PASS DP=36;GPV=1;SPV=0.01921;SS=2;SSC=17;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:8,7:4,3:4,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
496 chr10 92983490 . CT C 0 PASS DP=26;GPV=1;SPV=0.0047113;SS=2;SSC=23;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:5,11:1,7:4,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
497 chr10 93982563 . C CCTCT 0 PASS DP=48;GPV=1;SPV=0.01018;SS=2;SSC=19;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:29:18,11:7,5:11,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
498 chr10 97282839 . CT C 0 PASS DP=31;GPV=1;SPV=0.0070941;SS=2;SSC=21;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:18:8,10:4,8:4,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
499 chr10 97819830 . G GT 0 PASS DP=32;GPV=1;SPV=0.047619;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 1/1:.:15:0,5:0,4:0,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
500 chr10 100676628 . C G 0 PASS DP=55;GPV=1;SPV=0.043486;SS=2;SSC=13;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:28:20,5:11,3:9,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
501 chr10 102520212 . CT C 0 PASS DP=37;GPV=1;SPV=0.035568;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:20:15,5:9,3:6,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
502 chr10 102894439 . TAA T 0 PASS DP=58;GPV=1;SPV=0.16089;SS=2;SSC=7;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:37:20,4:10,1:10,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
503 chr10 103639625 . A G 0 PASS DP=43;GPV=1;SPV=0.1037;SS=2;SSC=9;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:22:12,4:4,1:8,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
504 chr10 104620423 . T TTG 0 PASS DP=41;GPV=1;SPV=0.066203;SS=2;SSC=11;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:24:11,7:8,5:3,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
505 chr10 104696666 . A T 0 PASS DP=25;GPV=1;SPV=0.20979;SS=2;SSC=6;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:6,4:4,3:2,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
506 chr10 105411722 . T G 0 PASS DP=55;GPV=1;SPV=0.00018161;SS=2;SSC=37;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:26:16,10:7,5:9,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
507 chr10 106291175 . C T 0 PASS DP=71;GPV=1;SPV=7.0793e-06;SS=2;SSC=51;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:25:15,10:11,3:4,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
508 chr10 106779547 . A T 0 PASS DP=50;GPV=1;SPV=0.080632;SS=2;SSC=10;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:30:12,6:8,2:4,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
509 chr10 107171514 . C CTTT 0 PASS DP=27;GPV=1;SPV=0.051282;SS=2;SSC=12;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:4,7:1,5:3,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
510 chr10 108936941 . CTG C 0 PASS DP=46;GPV=1;SPV=0.10755;SS=2;SSC=9;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:27:23,4:11,2:12,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
511 chr10 109850929 . CAA C 0 PASS DP=34;GPV=1;SPV=0.049428;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:20:8,10:4,9:4,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
512 chr10 112251080 . G A 0 PASS DP=83;GPV=1;SPV=7.2935e-07;SS=2;SSC=61;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:39:23,16:9,5:14,11
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
513 chr10 113118664 . G T 0 PASS DP=30;GPV=1;SPV=0.15;SS=2;SSC=8;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:6,3:1,2:5,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
514 chr10 113658881 . C CA 0 PASS DP=23;GPV=1;SPV=0.055138;SS=2;SSC=12;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:12:7,4:3,1:4,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
515 chr10 116267948 . C A 0 PASS DP=64;GPV=1;SPV=0.10989;SS=2;SSC=9;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:26:3,2:2,1:1,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
516 chr10 116628774 . C A 0 PASS DP=24;GPV=1;SPV=0.23333;SS=2;SSC=6;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:11:6,2:5,1:1,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
517 chr10 117146974 . ATT A 0 PASS DP=38;GPV=1;SPV=0.067079;SS=2;SSC=11;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:22:9,6:3,5:6,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
518 chr10 118438311 . CT C 0 PASS DP=27;GPV=1;SPV=0.20798;SS=2;SSC=6;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:8,4:4,3:4,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
519 chr10 118944739 . A C 0 PASS DP=37;GPV=1;SPV=0.046332;SS=2;SSC=13;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:18:14,4:6,2:8,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
520 chr10 119001107 . ATG A 0 PASS DP=36;GPV=1;SPV=0.023193;SS=2;SSC=16;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:20:12,8:6,5:6,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
521 chr10 119567417 . AT A 0 PASS DP=24;GPV=1;SPV=0.067288;SS=2;SSC=11;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:13:9,4:4,2:5,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
522 chr10 119666547 . T TGTGCTCAGCGAGATGCATGAG 0 PASS DP=42;GPV=1;SPV=0.046549;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:21:15,6:9,3:6,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
523 chr10 121167304 . C T 0 PASS DP=68;GPV=1;SPV=9.9495e-05;SS=2;SSC=40;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:24:16,8:10,5:6,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
524 chr10 121955444 . AT A 0 PASS DP=39;GPV=1;SPV=0.02028;SS=2;SSC=16;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:2,7:2,3:0,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
525 chr10 123078525 . CTTTTTTTTT C 0 PASS DP=23;GPV=1;SPV=0.045113;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:12:7,4:5,3:2,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
526 chr10 124580721 . C CT 0 PASS DP=35;GPV=1;SPV=0.097902;SS=2;SSC=10;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:4,4:0,0:4,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
527 chr10 124587024 . CTT C 0 PASS DP=25;GPV=1;SPV=0.03028;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:13:8,5:5,2:3,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
528 chr10 124949522 . C T 0 PASS DP=36;GPV=1;SPV=0.16484;SS=2;SSC=7;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:21:4,2:4,1:0,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
529 chr10 125486448 . T TAAAAA 0 PASS DP=43;GPV=1;SPV=0.003311;SS=2;SSC=24;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:21:11,9:3,5:8,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
530 chr10 126558020 . G A 0 PASS DP=68;GPV=1;SPV=0.00161;SS=2;SSC=27;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:29:22,7:10,3:12,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
531 chr10 126651080 . C A 0 PASS DP=54;GPV=1;SPV=5.0681e-05;SS=2;SSC=42;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:27:15,12:8,6:7,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
532 chr10 129343960 . A ATT 0 PASS DP=31;GPV=1;SPV=0.030629;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:18:10,8:10,5:0,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
533 chr10 130705325 . G A 0 PASS DP=64;GPV=1;SPV=1.57e-05;SS=2;SSC=48;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:31:18,13:8,4:10,9
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
534 chr10 133645068 . G A 0 PASS DP=100;GPV=1;SPV=0.0040096;SS=2;SSC=23;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:47:37,9:14,7:23,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
535 chr10 133657809 . A G 0 PASS DP=265;GPV=1;SPV=0.029166;SS=2;SSC=15;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:139:124,15:66,8:58,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
536 chr11 179314 . C T 0 PASS DP=82;GPV=1;SPV=0.014318;SS=2;SSC=18;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:39:27,12:17,2:10,10
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
537 chr11 350146 . A C 0 PASS DP=22;GPV=1;SPV=0.076023;SS=2;SSC=11;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:14:9,5:7,4:2,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
538 chr11 350151 . C CACA 0 PASS DP=24;GPV=1;SPV=0.13684;SS=2;SSC=8;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:14:10,4:7,3:3,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
539 chr11 2178862 . C G 0 PASS DP=60;GPV=1;SPV=0.00056474;SS=2;SSC=32;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:33:22,11:14,6:8,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
540 chr11 3257577 . G T 0 PASS DP=31;GPV=1;SPV=0.023384;SS=2;SSC=16;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:9,7:3,6:6,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
541 chr11 4160122 . C A 0 PASS DP=53;GPV=1;SPV=0.12318;SS=2;SSC=9;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:27:15,4:9,3:6,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
542 chr11 4228378 . C T 0 PASS DP=74;GPV=1;SPV=0.038913;SS=2;SSC=14;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:35:29,6:12,1:17,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
543 chr11 4276958 . C A 0 PASS DP=27;GPV=1;SPV=0.010145;SS=2;SSC=19;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:14:8,6:4,1:4,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
544 chr11 4335202 . A G 0 PASS DP=26;GPV=1;SPV=0.094071;SS=2;SSC=10;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:12,5:4,4:8,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
545 chr11 6385445 . A AAAGGAAGG 0 PASS DP=34;GPV=1;SPV=0.10217;SS=2;SSC=9;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:8,4:3,2:5,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
546 chr11 7282591 . C T 0 PASS DP=54;GPV=1;SPV=0.00088456;SS=2;SSC=30;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:31:20,11:9,5:11,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
547 chr11 7407360 . ATTTTTT A 0 PASS DP=34;GPV=1;SPV=0.12318;SS=2;SSC=9;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:21:15,4:10,2:5,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
548 chr11 7889212 . C A 0 PASS DP=59;GPV=1;SPV=0.0030692;SS=2;SSC=25;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:33:24,9:14,4:10,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
549 chr11 8862322 . CTTTT C 0 PASS DP=25;GPV=1;SPV=0.0032575;SS=2;SSC=24;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 1/1:.:16:4,12:3,9:1,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
550 chr11 9671357 . TAAATA T 0 PASS DP=28;GPV=1;SPV=0.0041408;SS=2;SSC=23;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:8,8:2,1:6,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
551 chr11 10901712 . C T 0 PASS DP=18;GPV=1;SPV=0.21429;SS=2;SSC=6;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:8:2,2:1,1:1,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
552 chr11 14781161 . G A 0 PASS DP=48;GPV=1;SPV=0.0028662;SS=2;SSC=25;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:25:17,8:8,6:9,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
553 chr11 15298915 . T C 0 PASS DP=24;GPV=1;SPV=0.12308;SS=2;SSC=9;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:12:5,3:0,0:5,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
554 chr11 15298919 . T C 0 PASS DP=25;GPV=1;SPV=0.15;SS=2;SSC=8;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:13:6,3:0,0:6,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
555 chr11 15502822 . G GCA 0 PASS DP=36;GPV=1;SPV=0.066411;SS=2;SSC=11;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:20:12,4:8,3:4,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
556 chr11 16149796 . T C 0 PASS DP=52;GPV=1;SPV=6.7064e-05;SS=2;SSC=41;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:31:16,15:5,8:11,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
557 chr11 17756520 . AACACACAC A 0 PASS DP=35;GPV=1;SPV=0.014706;SS=2;SSC=18;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:20:4,9:3,5:1,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
558 chr11 18377215 . G GTTT 0 PASS DP=34;GPV=1;SPV=0.040248;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:22:8,6:6,5:2,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
559 chr11 19234145 . T TA 0 PASS DP=34;GPV=1;SPV=0.013278;SS=2;SSC=18;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:10,12:9,10:1,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
560 chr11 20289136 . C T 0 PASS DP=66;GPV=1;SPV=0.11996;SS=2;SSC=9;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:36:19,4:7,2:12,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
561 chr11 20549262 . T C 0 PASS DP=33;GPV=1;SPV=0.094721;SS=2;SSC=10;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:15,4:5,2:10,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
562 chr11 21251540 . C T 0 PASS DP=56;GPV=1;SPV=0.0041203;SS=2;SSC=23;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:30:22,8:15,5:7,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
563 chr11 21697973 . A AATT 0 PASS DP=29;GPV=1;SPV=0.037648;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:9,7:5,5:4,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
564 chr11 21697974 . T G 0 PASS DP=23;GPV=1;SPV=0.041958;SS=2;SSC=13;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:14:4,6:1,5:3,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
565 chr11 22659898 . G A 0 PASS DP=22;GPV=1;SPV=0.2;SS=2;SSC=6;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:9:1,2:1,2:0,0
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
566 chr11 24926388 . TAC T 0 PASS DP=40;GPV=1;SPV=0.080042;SS=2;SSC=10;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:22:18,4:5,1:13,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
567 chr11 25300473 . C CTT 0 PASS DP=34;GPV=1;SPV=0.0063246;SS=2;SSC=21;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:5,8:3,7:2,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
568 chr11 25475491 . A G 0 PASS DP=50;GPV=1;SPV=6.2951e-05;SS=2;SSC=42;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:22:12,10:4,4:8,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
569 chr11 26447206 . C CA 0 PASS DP=27;GPV=1;SPV=0.11068;SS=2;SSC=9;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:18:8,5:7,4:1,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
570 chr11 26726156 . TCTTCCTTC T 0 PASS DP=40;GPV=1;SPV=0.039732;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:24:6,8:4,3:2,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
571 chr11 28433172 . G T 0 PASS DP=54;GPV=1;SPV=0.074026;SS=2;SSC=11;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:27:15,4:8,2:7,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
572 chr11 29820724 . T TA 0 PASS DP=53;GPV=1;SPV=6.6326e-05;SS=2;SSC=41;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:21:12,9:8,5:4,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
573 chr11 30235108 . G C 0 PASS DP=62;GPV=1;SPV=9.1194e-06;SS=2;SSC=50;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:31:17,14:3,5:14,9
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
574 chr11 30790121 . GA G 0 PASS DP=38;GPV=1;SPV=0.081081;SS=2;SSC=10;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:21:17,4:14,2:3,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
575 chr11 31148210 . T TAA 0 PASS DP=34;GPV=1;SPV=0.14945;SS=2;SSC=8;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:20:14,4:7,3:7,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
576 chr11 31163795 . C T 0 PASS DP=49;GPV=1;SPV=7.0087e-06;SS=2;SSC=51;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:22:10,12:4,7:6,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
577 chr11 32503846 . G A 0 PASS DP=17;GPV=1;SPV=0.38182;SS=2;SSC=4;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:8:5,2:2,1:3,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
578 chr11 34424259 . C CAA 0 PASS DP=21;GPV=1;SPV=0.06993;SS=2;SSC=11;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:10:4,4:3,3:1,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
579 chr11 37194539 . CTT C 0 PASS DP=37;GPV=1;SPV=0.010145;SS=2;SSC=19;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:18:8,6:3,4:5,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
580 chr11 37216846 . C G 0 PASS DP=64;GPV=1;SPV=9.263e-06;SS=2;SSC=50;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:28:16,12:8,3:8,9
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
581 chr11 40578140 . GGTTTTTTTTTTTT G 0 PASS DP=18;GPV=1;SPV=0.022967;SS=2;SSC=16;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:10:3,7:2,4:1,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
582 chr11 40834919 . C G 0 PASS DP=43;GPV=1;SPV=0.14221;SS=2;SSC=8;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:27:23,4:9,3:14,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
583 chr11 40851076 . C T 0 PASS DP=65;GPV=1;SPV=4.316e-06;SS=2;SSC=53;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:27:15,12:6,5:9,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
584 chr11 41083294 . G T 0 PASS DP=49;GPV=1;SPV=0.00014258;SS=2;SSC=38;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:28:15,13:11,7:4,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
585 chr11 41304529 . T G 0 PASS DP=16;GPV=1;SPV=0.23333;SS=2;SSC=6;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:8:6,2:2,1:4,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
586 chr11 41938396 . G A 0 PASS DP=51;GPV=1;SPV=0.047696;SS=2;SSC=13;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:22:15,6:9,3:6,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
587 chr11 42125346 . AC A 0 PASS DP=47;GPV=1;SPV=0.031857;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 1/1:.:27:1,7:0,1:1,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
588 chr11 43810371 . AT A 0 PASS DP=37;GPV=1;SPV=0.012987;SS=2;SSC=18;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:0,5:0,2:0,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
589 chr11 45923985 . CAAAAAAAAAAAAAAAAAAAAAA C 0 PASS DP=22;GPV=1;SPV=0.004257;SS=2;SSC=23;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:12:4,7:4,5:0,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
590 chr11 45989490 . T TAAA 0 PASS DP=36;GPV=1;SPV=0.033948;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:7,9:3,6:4,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
591 chr11 46816787 . T A 0 PASS DP=35;GPV=1;SPV=0.1958;SS=2;SSC=7;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:21:5,3:3,2:2,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
592 chr11 49035339 . ATTTTTTTTTTTTTT A 0 PASS DP=25;GPV=1;SPV=0.046584;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:12:8,4:4,1:4,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
593 chr11 49212688 . C G 0 PASS DP=61;GPV=1;SPV=9.3552e-05;SS=2;SSC=40;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:27:17,10:10,6:7,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
594 chr11 49857032 . C T 0 PASS DP=48;GPV=1;SPV=0.00029985;SS=2;SSC=35;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:24:14,10:7,5:7,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
595 chr11 51289722 . C T 0 PASS DP=60;GPV=1;SPV=0.073744;SS=2;SSC=11;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:32:28,4:6,2:22,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
596 chr11 51622370 . G A 0 PASS DP=45;GPV=1;SPV=0.020274;SS=2;SSC=16;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:26:17,9:1,2:16,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
597 chr11 51850532 . C G 0 PASS DP=27;GPV=1;SPV=0.057037;SS=2;SSC=12;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:14:10,4:7,3:3,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
598 chr11 52142061 . A C 0 PASS DP=19;GPV=1;SPV=0.16374;SS=2;SSC=7;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:8:6,2:4,1:2,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
599 chr11 52304615 . G T 0 PASS DP=72;GPV=1;SPV=0.064197;SS=2;SSC=11;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:37:33,4:2,0:31,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
600 chr11 52482834 . A T 0 PASS DP=160;GPV=1;SPV=0.024396;SS=2;SSC=16;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:84:74,10:30,3:44,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
601 chr11 52556895 . T C 0 PASS DP=147;GPV=1;SPV=0.016892;SS=2;SSC=17;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:67:53,14:9,7:44,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
602 chr11 53372519 . T G 0 PASS DP=376;GPV=1;SPV=0.025298;SS=2;SSC=15;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:172:150,22:81,3:69,19
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
603 chr11 53604369 . G T 0 PASS DP=78;GPV=1;SPV=0.0085098;SS=2;SSC=20;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:41:34,7:14,5:20,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
604 chr11 53628092 . T C 0 PASS DP=83;GPV=1;SPV=0.031193;SS=2;SSC=15;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:46:34,12:14,10:20,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
605 chr11 53698751 . C A 0 PASS DP=45;GPV=1;SPV=0.032518;SS=2;SSC=14;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:20:16,4:0,0:16,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
606 chr11 54372015 . C G 0 PASS DP=42;GPV=1;SPV=0.036365;SS=2;SSC=14;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:29:21,8:8,2:13,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
607 chr11 54384523 . C G 0 PASS DP=39;GPV=1;SPV=0.10766;SS=2;SSC=9;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:19,4:14,3:5,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
608 chr11 54533839 . T A 0 PASS DP=38;GPV=1;SPV=0.024656;SS=2;SSC=16;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:12,4:4,1:8,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
609 chr11 55775691 . C G 0 PASS DP=51;GPV=1;SPV=0.034379;SS=2;SSC=14;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:24:18,6:10,4:8,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
610 chr11 56166092 . GA G 0 PASS DP=47;GPV=1;SPV=0.0055032;SS=2;SSC=22;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:24:17,7:12,5:5,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
611 chr11 60451481 . C T 0 PASS DP=22;GPV=1;SPV=0.039341;SS=2;SSC=14;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:8:4,4:2,3:2,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
612 chr11 62899037 . C CAAA 0 PASS DP=27;GPV=1;SPV=0.2066;SS=2;SSC=6;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:10,4:7,3:3,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
613 chr11 64236716 . CAAAAAAAAAAA C 0 PASS DP=30;GPV=1;SPV=0.048055;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:14:6,5:2,3:4,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
614 chr11 64733395 . AACAC A 0 PASS DP=35;GPV=1;SPV=0.034325;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:6,6:4,5:2,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
615 chr11 66213902 . G A 0 PASS DP=72;GPV=1;SPV=6.4422e-05;SS=2;SSC=41;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:43:27,16:12,9:15,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
616 chr11 68426423 . C CTT 0 PASS DP=35;GPV=1;SPV=0.14626;SS=2;SSC=8;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:17,4:13,3:4,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
617 chr11 68954772 . A AAAG 0 PASS DP=20;GPV=1;SPV=0.092308;SS=2;SSC=10;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:12:5,4:1,1:4,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
618 chr11 69026145 . CAAA C 0 PASS DP=31;GPV=1;SPV=0.0012058;SS=2;SSC=29;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:8,9:6,7:2,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
619 chr11 70157979 . CA C 0 PASS DP=31;GPV=1;SPV=0.052107;SS=2;SSC=12;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:12,5:9,4:3,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
620 chr11 71133346 . A ATGGCTGGCTGGC 0 PASS DP=20;GPV=1;SPV=0.043344;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:10:6,4:3,2:3,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
621 chr11 71658720 . C G 0 PASS DP=48;GPV=1;SPV=0.057396;SS=2;SSC=12;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:28:23,5:15,2:8,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
622 chr11 74636665 . C CT 0 PASS DP=53;GPV=1;SPV=0.00052897;SS=2;SSC=32;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:31:19,12:10,8:9,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
623 chr11 74656744 . G GT 0 PASS DP=49;GPV=1;SPV=0.0033983;SS=2;SSC=24;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:26:9,9:8,7:1,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
624 chr11 76236832 . A G 0 PASS DP=50;GPV=1;SPV=0.0034541;SS=2;SSC=24;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:32:21,11:12,7:9,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
625 chr11 76494720 . TTCC T 0 PASS DP=21;GPV=1;SPV=0.12281;SS=2;SSC=9;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:9:5,2:1,1:4,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
626 chr11 83008989 . G C 0 PASS DP=47;GPV=1;SPV=0.0069488;SS=2;SSC=21;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:22:16,6:7,3:9,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
627 chr11 83467810 . T TACAC 0 PASS DP=24;GPV=1;SPV=0.038462;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:12:4,4:3,1:1,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
628 chr11 83848124 . CTT C 0 PASS DP=49;GPV=1;SPV=0.081016;SS=2;SSC=10;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:25:17,7:11,2:6,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
629 chr11 86602116 . G A 0 PASS DP=54;GPV=1;SPV=0.11792;SS=2;SSC=9;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:27:24,3:12,1:12,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
630 chr11 87419191 . C CA 0 PASS DP=55;GPV=1;SPV=0.00039192;SS=2;SSC=34;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:31:14,17:8,11:6,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
631 chr11 88052933 . T TG 0 PASS DP=20;GPV=1;SPV=0.35714;SS=2;SSC=4;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:12:3,2:2,1:1,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
632 chr11 88570571 . A T 0 PASS DP=27;GPV=1;SPV=0.15385;SS=2;SSC=8;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:6,4:4,2:2,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
633 chr11 89749670 . A G 0 PASS DP=58;GPV=1;SPV=0.011696;SS=2;SSC=19;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:35:24,11:12,7:12,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
634 chr11 89772506 . T C 0 PASS DP=80;GPV=1;SPV=0.019233;SS=2;SSC=17;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:39:30,9:16,1:14,8
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
635 chr11 89883593 . G A 0 PASS DP=44;GPV=1;SPV=0.0143;SS=2;SSC=18;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:17,6:2,3:15,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
636 chr11 89960943 . C T 0 PASS DP=28;GPV=1;SPV=0.024176;SS=2;SSC=16;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:12:8,4:5,3:3,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
637 chr11 90971910 . G C 0 PASS DP=25;GPV=1;SPV=0.07913;SS=2;SSC=11;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:14:10,4:7,1:3,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
638 chr11 92315479 . G A 0 PASS DP=22;GPV=1;SPV=0.047472;SS=2;SSC=13;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:8:4,4:4,3:0,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
639 chr11 92950475 . TCTCCCTCCCTCCCTTCCTTCCTTCCTTCTTTC T 0 PASS DP=22;GPV=1;SPV=0.23636;SS=2;SSC=6;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:14:11,3:1,0:10,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
640 chr11 93243149 . A G 0 PASS DP=47;GPV=1;SPV=0.048406;SS=2;SSC=13;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:28:20,8:13,4:7,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
641 chr11 93420517 . C T 0 PASS DP=58;GPV=1;SPV=0.0051564;SS=2;SSC=22;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:20:14,6:3,2:11,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
642 chr11 94810793 . C CA 0 PASS DP=42;GPV=1;SPV=0.0010673;SS=2;SSC=29;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:20:12,8:7,4:5,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
643 chr11 95403130 . AT A 0 PASS DP=23;GPV=1;SPV=0.020362;SS=2;SSC=16;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:11:4,5:2,4:2,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
644 chr11 95654621 . G A 0 PASS DP=57;GPV=1;SPV=0.069378;SS=2;SSC=11;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:30:26,4:11,2:15,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
645 chr11 98275560 . T C 0 PASS DP=38;GPV=1;SPV=0.01707;SS=2;SSC=17;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:18:13,5:6,1:7,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
646 chr11 98977220 . C T 0 PASS DP=33;GPV=1;SPV=0.026047;SS=2;SSC=15;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:13:7,6:5,2:2,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
647 chr11 99080980 . GT G 0 PASS DP=43;GPV=1;SPV=0.044901;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:18,5:11,4:7,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
648 chr11 99151211 . T A 0 PASS DP=51;GPV=1;SPV=0.061499;SS=2;SSC=12;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:33:27,6:10,4:17,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
649 chr11 99724327 . A T 0 PASS DP=52;GPV=1;SPV=0.0035931;SS=2;SSC=24;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:25:18,7:8,3:10,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
650 chr11 100194603 . GA G 0 PASS DP=46;GPV=1;SPV=0.00078184;SS=2;SSC=31;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:28:16,12:10,10:6,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
651 chr11 101263877 . GTATA G 0 PASS DP=46;GPV=1;SPV=0.012394;SS=2;SSC=19;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:24:17,6:15,3:2,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
652 chr11 101263883 . A G 0 PASS DP=43;GPV=1;SPV=0.034629;SS=2;SSC=14;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:20:15,4:13,2:2,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
653 chr11 104194686 . G A 0 PASS DP=23;GPV=1;SPV=0.016624;SS=2;SSC=17;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:13:5,8:3,4:2,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
654 chr11 105161856 . CA C 0 PASS DP=21;GPV=1;SPV=0.0089783;SS=2;SSC=20;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:9:3,6:2,1:1,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
655 chr11 107523052 . A C 0 PASS DP=47;GPV=1;SPV=0.46667;SS=2;SSC=3;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:30:5,2:1,1:4,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
656 chr11 107572651 . A AT 0 PASS DP=63;GPV=1;SPV=0.0060836;SS=2;SSC=22;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:32:25,7:17,4:8,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
657 chr11 109323949 . T C 0 PASS DP=38;GPV=1;SPV=0.00034172;SS=2;SSC=34;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:22:8,14:5,9:3,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
658 chr11 109757896 . TTCTCTCTCTCTCTCTC T 0 PASS DP=28;GPV=1;SPV=0.028205;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:13:8,4:4,1:4,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
659 chr11 111005139 . A ATG 0 PASS DP=37;GPV=1;SPV=0.047826;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:8,6:5,5:3,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
660 chr11 111177973 . CTT C 0 PASS DP=31;GPV=1;SPV=0.076023;SS=2;SSC=11;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:9,5:4,4:5,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
661 chr11 111768842 . C CGTGTGT 0 PASS DP=27;GPV=1;SPV=0.15385;SS=2;SSC=8;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:5,6:5,2:0,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
662 chr11 112108914 . CA C 0 PASS DP=45;GPV=1;SPV=0.027541;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:18,5:15,3:3,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
663 chr11 114468134 . A T 0 PASS DP=44;GPV=1;SPV=0.083333;SS=2;SSC=10;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:20:1,2:0,1:1,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
664 chr11 115169206 . A ATTTTT 0 PASS DP=25;GPV=1;SPV=0.063246;SS=2;SSC=11;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:8,5:5,3:3,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
665 chr11 116818336 . TA T 0 PASS DP=34;GPV=1;SPV=0.12905;SS=2;SSC=8;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:21:17,4:8,2:9,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
666 chr11 117514578 . T C 0 PASS DP=42;GPV=1;SPV=0.032696;SS=2;SSC=14;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:12,7:7,1:5,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
667 chr11 118419127 . G T 0 PASS DP=58;GPV=1;SPV=3.4113e-05;SS=2;SSC=44;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:28:16,12:8,4:8,8
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
668 chr11 118852964 . A AT 0 PASS DP=73;GPV=1;SPV=0.019318;SS=2;SSC=17;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:34:27,5:13,3:14,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
669 chr11 119022957 . G GT 0 PASS DP=24;GPV=1;SPV=0.068627;SS=2;SSC=11;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:12:6,4:2,3:4,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
670 chr11 119763937 . TTTTTC T 0 PASS DP=20;GPV=1;SPV=0.085139;SS=2;SSC=10;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:11:7,4:2,2:5,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
671 chr11 123102279 . G GTT 0 PASS DP=31;GPV=1;SPV=0.030289;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:13:7,5:4,4:3,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
672 chr11 123565202 . C CT 0 PASS DP=32;GPV=1;SPV=0.034106;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:20:11,9:10,8:1,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
673 chr11 126863356 . A AGTGTGTGTTTGAGTGCGT 0 PASS DP=53;GPV=1;SPV=0.10123;SS=2;SSC=9;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:31:26,4:13,2:13,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
674 chr11 127364704 . C T 0 PASS DP=68;GPV=1;SPV=0.026693;SS=2;SSC=15;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:34:29,5:16,2:13,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
675 chr11 127553387 . C CAAAA 0 PASS DP=46;GPV=1;SPV=0.048514;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:22:14,7:11,6:3,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
676 chr11 129585183 . C CT 0 PASS DP=43;GPV=1;SPV=0.0051722;SS=2;SSC=22;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:20:13,6:7,4:6,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
677 chr11 129585356 . G GT 0 PASS DP=56;GPV=1;SPV=0.041497;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:30:15,8:5,7:10,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
678 chr11 129688629 . CAAA C 0 PASS DP=50;GPV=1;SPV=0.052323;SS=2;SSC=12;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:31:21,9:15,3:6,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
679 chr11 130037592 . A G 0 PASS DP=44;GPV=1;SPV=0.024807;SS=2;SSC=16;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:26:17,9:10,2:7,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
680 chr11 130596877 . C CGGATGGAT 0 PASS DP=41;GPV=1;SPV=0.02564;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:20:11,8:5,6:6,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
681 chr11 131137267 . C CACACATACACACAT 0 PASS DP=58;GPV=1;SPV=0.04269;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:29:17,8:12,4:5,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
682 chr11 131265696 . A ATCT 0 PASS DP=23;GPV=1;SPV=0.048872;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:13:8,5:5,2:3,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
683 chr11 131325631 . C CTG 0 PASS DP=68;GPV=1;SPV=0.00011829;SS=2;SSC=39;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:34:17,12:8,8:9,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
684 chr11 131578609 . G A 0 PASS DP=81;GPV=1;SPV=3.9881e-07;SS=2;SSC=63;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:35:20,15:6,8:14,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
685 chr11 132161395 . T C 0 PASS DP=30;GPV=1;SPV=0.010538;SS=2;SSC=19;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:7,10:3,4:4,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
686 chr11 133437271 . C T 0 PASS DP=58;GPV=1;SPV=0.0011582;SS=2;SSC=29;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:27:19,8:5,5:14,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
687 chr11 135047060 . C T 0 PASS DP=38;GPV=1;SPV=0.02835;SS=2;SSC=15;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:14,9:8,8:6,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
688 chr12 544240 . T G 0 PASS DP=46;GPV=1;SPV=0.11667;SS=2;SSC=9;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:20,3:17,1:3,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
689 chr12 1122125 . G C 0 PASS DP=22;GPV=1;SPV=0.26316;SS=2;SSC=5;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:11:8,2:5,1:3,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
690 chr12 1522170 . A AAAAAAAATAC 0 PASS DP=34;GPV=1;SPV=0.045792;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:12,7:5,6:7,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
691 chr12 1522184 . C A 0 PASS DP=28;GPV=1;SPV=0.034783;SS=2;SSC=14;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:10,6:4,5:6,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
692 chr12 3496214 . A ATATT 0 PASS DP=27;GPV=1;SPV=0.023799;SS=2;SSC=16;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:9,7:8,6:1,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
693 chr12 3919773 . GTTTT G 0 PASS DP=24;GPV=1;SPV=0.047472;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:10:4,4:2,3:2,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
694 chr12 4512508 . C T 0 PASS DP=83;GPV=1;SPV=0.030096;SS=2;SSC=15;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:40:29,11:15,3:14,8
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
695 chr12 6820855 . TGAGA T 0 PASS DP=35;GPV=1;SPV=0.02381;SS=2;SSC=16;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:1,5:1,1:0,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
696 chr12 8215041 . C T 0 PASS DP=73;GPV=1;SPV=0.01931;SS=2;SSC=17;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:38:30,8:14,2:16,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
697 chr12 8455116 . G GATTTT 0 PASS DP=31;GPV=1;SPV=0.031264;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:12,6:9,5:3,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
698 chr12 9216233 . G T 0 PASS DP=63;GPV=1;SPV=0.00072423;SS=2;SSC=31;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:33:23,10:11,3:12,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
699 chr12 9284109 . G C 0 PASS DP=42;GPV=1;SPV=0.034629;SS=2;SSC=14;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:15,4:5,3:10,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
700 chr12 10239540 . T C 0 PASS DP=28;GPV=1;SPV=0.013043;SS=2;SSC=18;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:8,6:1,1:7,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
701 chr12 10526141 . CACATATATATATATATATATATATATATATATATATATATATATATATATA C 0 PASS DP=27;GPV=1;SPV=0.016317;SS=2;SSC=17;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:13:2,6:2,4:0,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
702 chr12 11160485 . T G 0 PASS DP=45;GPV=1;SPV=0.019565;SS=2;SSC=17;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:28:8,5:5,1:3,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
703 chr12 11524456 . CTTAG C 0 PASS DP=60;GPV=1;SPV=6.1809e-05;SS=2;SSC=42;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:30:18,12:7,8:11,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
704 chr12 12909937 . T TAA 0 PASS DP=29;GPV=1;SPV=0.044444;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:11,5:4,4:7,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
705 chr12 13698823 . C T 0 PASS DP=57;GPV=1;SPV=0.00076774;SS=2;SSC=31;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:28:19,9:12,5:7,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
706 chr12 13880506 . T C 0 PASS DP=44;GPV=1;SPV=0.0054908;SS=2;SSC=22;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:20:14,6:7,2:7,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
707 chr12 15143335 . T TA 0 PASS DP=54;GPV=1;SPV=0.0084034;SS=2;SSC=20;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:20:8,4:5,2:3,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
708 chr12 15166540 . GGTA G 0 PASS DP=67;GPV=1;SPV=0.10731;SS=2;SSC=9;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:39:35,4:17,2:18,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
709 chr12 15610657 . T TA 0 PASS DP=55;GPV=1;SPV=0.025398;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:31:25,6:12,5:13,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
710 chr12 16235270 . ATG A 0 PASS DP=69;GPV=1;SPV=0.053645;SS=2;SSC=12;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:34:30,4:16,2:14,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
711 chr12 17722701 . GA G 0 PASS DP=43;GPV=1;SPV=0.12174;SS=2;SSC=9;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:25:12,4:3,2:9,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
712 chr12 18255252 . T C 0 PASS DP=46;GPV=1;SPV=0.15033;SS=2;SSC=8;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:26:19,4:10,1:9,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
713 chr12 18516261 . G GTT 0 PASS DP=48;GPV=1;SPV=3.7614e-05;SS=2;SSC=44;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:20:7,13:4,6:3,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
714 chr12 18524479 . T A 0 PASS DP=72;GPV=1;SPV=6.7124e-08;SS=2;SSC=71;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:29:14,15:6,6:8,9
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
715 chr12 19439669 . A G 0 PASS DP=49;GPV=1;SPV=0.08867;SS=2;SSC=10;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:22:7,2:3,1:4,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
716 chr12 21181585 . C A 0 PASS DP=62;GPV=1;SPV=7.8463e-05;SS=2;SSC=41;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:27:17,10:9,5:8,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
717 chr12 21419847 . T G 0 PASS DP=39;GPV=1;SPV=0.028152;SS=2;SSC=15;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:26:15,11:8,2:7,9
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
718 chr12 23379875 . CA C 0 PASS DP=21;GPV=1;SPV=0.034965;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:10:2,5:2,4:0,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
719 chr12 23726118 . CGAGA C 0 PASS DP=28;GPV=1;SPV=0.30409;SS=2;SSC=5;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:18:12,4:8,3:4,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
720 chr12 23907746 . CAA C 0 PASS DP=44;GPV=1;SPV=0.069923;SS=2;SSC=11;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:26:16,8:7,5:9,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
721 chr12 28183993 . T C 0 PASS DP=50;GPV=1;SPV=0.00019854;SS=2;SSC=37;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:22:13,9:11,5:2,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
722 chr12 29299213 . CA C 0 PASS DP=26;GPV=1;SPV=0.037185;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:9,6:6,5:3,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
723 chr12 30362495 . ATATATATATGTATATATATATATATATATATG A 0 PASS DP=18;GPV=1;SPV=0.066667;SS=2;SSC=11;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 1/1:.:8:0,2:0,2:0,0
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
724 chr12 31048468 . C T 0 PASS DP=63;GPV=1;SPV=0.077856;SS=2;SSC=11;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:34:30,4:9,2:21,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
725 chr12 31108896 . T C 0 PASS DP=31;GPV=1;SPV=0.012102;SS=2;SSC=19;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:18:11,7:4,6:7,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
726 chr12 32676648 . G A 0 PASS DP=62;GPV=1;SPV=0.00010246;SS=2;SSC=39;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:12,7:8,3:4,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
727 chr12 32742129 . C G 0 PASS DP=52;GPV=1;SPV=0.0066191;SS=2;SSC=21;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:33:20,13:8,5:12,8
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
728 chr12 33459924 . C G 0 PASS DP=54;GPV=1;SPV=0.02299;SS=2;SSC=16;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:30:24,6:12,2:12,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
729 chr12 33962526 . A G 0 PASS DP=71;GPV=1;SPV=0.00051786;SS=2;SSC=32;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:33:24,9:16,3:8,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
730 chr12 34349437 . G GT 0 PASS DP=24;GPV=1;SPV=0.046584;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:12:8,4:6,3:2,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
731 chr12 34796338 . C T 0 PASS DP=38;GPV=1;SPV=0.0054096;SS=2;SSC=22;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:9,7:7,6:2,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
732 chr12 34907117 . G T 0 PASS DP=376;GPV=1;SPV=0.0066075;SS=2;SSC=21;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:179:156,23:75,19:81,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
733 chr12 34916097 . T C 0 PASS DP=138;GPV=1;SPV=0.031211;SS=2;SSC=15;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:69:62,7:28,1:34,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
734 chr12 35037606 . A C 0 PASS DP=137;GPV=1;SPV=0.033931;SS=2;SSC=14;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:52:46,6:18,2:28,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
735 chr12 35208597 . C G 0 PASS DP=422;GPV=1;SPV=0.022837;SS=2;SSC=16;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:201:169,32:74,16:95,16
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
736 chr12 35302590 . T C 0 PASS DP=202;GPV=1;SPV=0.024674;SS=2;SSC=16;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:92:75,17:33,7:42,10
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
737 chr12 36508012 . G A 0 PASS DP=18;GPV=1;SPV=0.068627;SS=2;SSC=11;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:8:5,3:0,0:5,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
738 chr12 36854572 . G C 0 PASS DP=234;GPV=1;SPV=0.027728;SS=2;SSC=15;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:118:103,14:94,12:9,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
739 chr12 36965324 . G C 0 PASS DP=23;GPV=1;SPV=0.14229;SS=2;SSC=8;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:9:7,2:0,1:7,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
740 chr12 37433992 . G GTT 0 PASS DP=25;GPV=1;SPV=0.016957;SS=2;SSC=17;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:14:8,6:7,5:1,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
741 chr12 37948223 . C A 0 PASS DP=52;GPV=1;SPV=0.18371;SS=2;SSC=7;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:30:27,3:16,1:11,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
742 chr12 46415122 . C CT 0 PASS DP=29;GPV=1;SPV=0.031059;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:14:8,6:6,4:2,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
743 chr12 46716673 . A C 0 PASS DP=53;GPV=1;SPV=0.14286;SS=2;SSC=8;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:27:1,2:1,1:0,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
744 chr12 48078370 . CAT C 0 PASS DP=27;GPV=1;SPV=0.026533;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:11:6,5:3,3:3,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
745 chr12 50172552 . A ATT 0 PASS DP=32;GPV=1;SPV=0.10021;SS=2;SSC=9;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:13,4:11,3:2,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
746 chr12 51199139 . GATGGAACCAAGTGGTCAAGGCCCCGCAGAGGCTA G 0 PASS DP=41;GPV=1;SPV=0.12491;SS=2;SSC=9;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:25:21,4:8,1:13,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
747 chr12 53788018 . G GTA 0 PASS DP=25;GPV=1;SPV=0.0070433;SS=2;SSC=21;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:5,10:3,8:2,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
748 chr12 54026966 . G T 0 PASS DP=65;GPV=1;SPV=0.12093;SS=2;SSC=9;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:34:18,5:9,4:9,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
749 chr12 54412066 . G A 0 PASS DP=54;GPV=1;SPV=0.025527;SS=2;SSC=15;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:27:22,5:9,2:13,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
750 chr12 56691319 . CA C 0 PASS DP=26;GPV=1;SPV=0.01204;SS=2;SSC=19;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:12:7,5:4,4:3,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
751 chr12 56876294 . C CTT 0 PASS DP=20;GPV=1;SPV=0.023736;SS=2;SSC=16;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:9:3,5:1,3:2,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
752 chr12 57658719 . CAA C 0 PASS DP=20;GPV=1;SPV=0.045455;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:8:1,4:1,3:0,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
753 chr12 58023731 . A G 0 PASS DP=23;GPV=1;SPV=0.0069323;SS=2;SSC=21;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:12:4,8:3,7:1,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
754 chr12 58261437 . C T 0 PASS DP=63;GPV=1;SPV=0.00013297;SS=2;SSC=38;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:33:21,12:12,6:9,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
755 chr12 61299907 . A T 0 PASS DP=47;GPV=1;SPV=0.13128;SS=2;SSC=8;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:32:27,5:16,2:11,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
756 chr12 61518665 . A AAAG 0 PASS DP=32;GPV=1;SPV=0.020875;SS=2;SSC=16;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:9,9:7,6:2,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
757 chr12 62059139 . A ATGTGTGTGTG 0 PASS DP=49;GPV=1;SPV=0.023489;SS=2;SSC=16;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:24:16,7:7,6:9,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
758 chr12 64288489 . C T 0 PASS DP=37;GPV=1;SPV=0.0070131;SS=2;SSC=21;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:21:11,10:10,7:1,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
759 chr12 64328700 . AAAAAAAATATATATATATAT A 0 PASS DP=28;GPV=1;SPV=0.048309;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:9,7:7,5:2,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
760 chr12 66000736 . G A 0 PASS DP=38;GPV=1;SPV=0.07913;SS=2;SSC=11;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:22:10,4:2,2:8,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
761 chr12 66815848 . CTT C 0 PASS DP=64;GPV=1;SPV=0.043132;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:30:26,4:12,3:14,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
762 chr12 67634086 . A T 0 PASS DP=23;GPV=1;SPV=0.045455;SS=2;SSC=13;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:13:2,5:2,2:0,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
763 chr12 68683283 . CA C 0 PASS DP=45;GPV=1;SPV=0.01093;SS=2;SSC=19;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:6,9:5,7:1,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
764 chr12 69200310 . ATAAGAAAGAGATAAGAGATAAGAGG A 0 PASS DP=46;GPV=1;SPV=0.042832;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:25:18,7:9,3:9,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
765 chr12 69491505 . AT A 0 PASS DP=31;GPV=1;SPV=0.04735;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:18:10,7:7,5:3,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
766 chr12 70103509 . CA C 0 PASS DP=52;GPV=1;SPV=0.0016986;SS=2;SSC=27;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:25:17,8:8,5:9,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
767 chr12 72373657 . G T 0 PASS DP=68;GPV=1;SPV=7.1266e-06;SS=2;SSC=51;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:29:17,12:9,7:8,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
768 chr12 73319208 . C CT 0 PASS DP=36;GPV=1;SPV=0.030844;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:14,5:5,3:9,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
769 chr12 75435052 . G GTT 0 PASS DP=23;GPV=1;SPV=0.092234;SS=2;SSC=10;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:9,6:7,4:2,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
770 chr12 76122077 . TATATA T 0 PASS DP=23;GPV=1;SPV=0.13684;SS=2;SSC=8;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:10,4:8,1:2,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
771 chr12 76122145 . TA T 0 PASS DP=37;GPV=1;SPV=0.1143;SS=2;SSC=9;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:22:17,4:14,1:3,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
772 chr12 76122149 . AT A 0 PASS DP=34;GPV=1;SPV=0.083578;SS=2;SSC=10;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:15,4:13,1:2,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
773 chr12 77090322 . TTCCTTCCTTCCC T 0 PASS DP=22;GPV=1;SPV=0.13684;SS=2;SSC=8;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:14:10,4:1,0:9,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
774 chr12 79486998 . CT C 0 PASS DP=24;GPV=1;SPV=0.047101;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:14:9,5:8,2:1,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
775 chr12 79563504 . G C 0 PASS DP=55;GPV=1;SPV=3.9623e-05;SS=2;SSC=44;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:27:15,12:9,9:6,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
776 chr12 79890901 . C A 0 PASS DP=19;GPV=1;SPV=0.10294;SS=2;SSC=9;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:9:6,3:3,1:3,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
777 chr12 80355229 . C T 0 PASS DP=21;GPV=1;SPV=0.25455;SS=2;SSC=5;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:10:5,3:5,2:0,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
778 chr12 80504030 . T C 0 PASS DP=46;GPV=1;SPV=0.004138;SS=2;SSC=23;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:20:14,6:5,3:9,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
779 chr12 81922880 . A AT 0 PASS DP=26;GPV=1;SPV=0.034479;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:9:5,4:2,3:3,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
780 chr12 83409601 . A G 0 PASS DP=28;GPV=1;SPV=0.18462;SS=2;SSC=7;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:6,3:4,2:2,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
781 chr12 84275060 . T TATATATAAAATATATTTTATATATATATA 0 PASS DP=32;GPV=1;SPV=0.066667;SS=2;SSC=11;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:11,4:5,3:6,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
782 chr12 85464656 . TACAC T 0 PASS DP=35;GPV=1;SPV=0.063246;SS=2;SSC=11;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:8,5:8,1:0,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
783 chr12 85488282 . T C 0 PASS DP=55;GPV=1;SPV=0.002853;SS=2;SSC=25;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:36:24,12:11,5:13,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
784 chr12 86376844 . CAGAG C 0 PASS DP=44;GPV=1;SPV=0.013285;SS=2;SSC=18;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:9,6:6,5:3,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
785 chr12 86502767 . ATG A 0 PASS DP=25;GPV=1;SPV=0.45333;SS=2;SSC=3;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:15,2:4,1:11,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
786 chr12 88745578 . G A 0 PASS DP=35;GPV=1;SPV=0.034783;SS=2;SSC=14;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:21:10,6:9,5:1,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
787 chr12 89677954 . TTATA T 0 PASS DP=39;GPV=1;SPV=0.036896;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:21:10,9:6,7:4,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
788 chr12 89862508 . T G 0 PASS DP=61;GPV=1;SPV=0.065982;SS=2;SSC=11;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:28:14,4:6,2:8,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
789 chr12 90181091 . T A 0 PASS DP=18;GPV=1;SPV=0.12238;SS=2;SSC=9;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:9:4,3:2,2:2,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
790 chr12 91180314 . A G 0 PASS DP=53;GPV=1;SPV=0.0432;SS=2;SSC=13;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:25:21,4:13,2:8,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
791 chr12 92079801 . A C 0 PASS DP=47;GPV=1;SPV=0.27273;SS=2;SSC=5;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:22:4,2:1,1:3,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
792 chr12 92537344 . T A 0 PASS DP=49;GPV=1;SPV=0.02229;SS=2;SSC=16;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:24:19,5:9,2:10,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
793 chr12 92632819 . T G 0 PASS DP=73;GPV=1;SPV=3.2072e-07;SS=2;SSC=64;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:40:20,20:8,9:12,11
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
794 chr12 92998044 . G GAC 0 PASS DP=43;GPV=1;SPV=0.030474;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:26:17,9:11,7:6,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
795 chr12 94014289 . C CT 0 PASS DP=17;GPV=1;SPV=0.11905;SS=2;SSC=9;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:9:2,4:0,1:2,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
796 chr12 95055952 . C CA 0 PASS DP=27;GPV=1;SPV=0.023452;SS=2;SSC=16;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:8:4,4:4,3:0,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
797 chr12 95347547 . C CT 0 PASS DP=23;GPV=1;SPV=0.19298;SS=2;SSC=7;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:9,3:4,1:5,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
798 chr12 95424716 . C CT 0 PASS DP=38;GPV=1;SPV=0.018733;SS=2;SSC=17;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:21:12,9:7,4:5,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
799 chr12 95641273 . A T 0 PASS DP=53;GPV=1;SPV=0.045693;SS=2;SSC=13;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:29:24,5:13,2:11,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
800 chr12 96561704 . TACACACAC T 0 PASS DP=35;GPV=1;SPV=0.0093665;SS=2;SSC=20;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:20:12,7:8,4:4,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
801 chr12 96591717 . G A 0 PASS DP=67;GPV=1;SPV=0.00022263;SS=2;SSC=36;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:34:23,11:9,4:14,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
802 chr12 96868430 . C CT 0 PASS DP=43;GPV=1;SPV=0.0094148;SS=2;SSC=20;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:11,10:6,8:5,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
803 chr12 97614646 . G T 0 PASS DP=38;GPV=1;SPV=0.073359;SS=2;SSC=11;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:21:16,4:9,1:7,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
804 chr12 98037742 . G GGGAA 0 PASS DP=53;GPV=1;SPV=0.008898;SS=2;SSC=20;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:27:10,11:8,6:2,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
805 chr12 99151541 . A T 0 PASS DP=45;GPV=1;SPV=0.001665;SS=2;SSC=27;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:26:16,10:9,6:7,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
806 chr12 99322275 . G A 0 PASS DP=56;GPV=1;SPV=0.011127;SS=2;SSC=19;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:24:19,5:11,1:8,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
807 chr12 99693781 . CT C 0 PASS DP=37;GPV=1;SPV=0.060413;SS=2;SSC=12;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:22:17,5:6,3:11,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
808 chr12 102337565 . G A 0 PASS DP=68;GPV=1;SPV=0.00056917;SS=2;SSC=32;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:32:23,9:16,4:7,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
809 chr12 105088569 . A AAACAACAACAAC 0 PASS DP=37;GPV=1;SPV=0.026636;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:25:6,12:5,6:1,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
810 chr12 106200353 . T C 0 PASS DP=30;GPV=1;SPV=0.036526;SS=2;SSC=14;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:14:10,4:6,2:4,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
811 chr12 107124459 . C CA 0 PASS DP=31;GPV=1;SPV=0.12884;SS=2;SSC=8;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:20:14,4:14,4:0,0
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
812 chr12 107987959 . T TACACACACACACAC 0 PASS DP=29;GPV=1;SPV=0.0085139;SS=2;SSC=20;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:5,10:3,6:2,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
813 chr12 110311733 . A T 0 PASS DP=47;GPV=1;SPV=0.05;SS=2;SSC=13;SOMATIC GT:GQ:DP:AD:ADF:ADR 1/1:.:29:0,3:0,1:0,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
814 chr12 113061450 . G A 0 PASS DP=57;GPV=1;SPV=0.00065454;SS=2;SSC=31;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:25:17,8:6,4:11,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
815 chr12 114219607 . CA C 0 PASS DP=34;GPV=1;SPV=0.023376;SS=2;SSC=16;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:11,8:8,4:3,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
816 chr12 114556107 . C A 0 PASS DP=72;GPV=1;SPV=5.048e-05;SS=2;SSC=42;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:39:25,14:11,5:14,9
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
817 chr12 114617380 . G GTT 0 PASS DP=29;GPV=1;SPV=0.12981;SS=2;SSC=8;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:18:11,5:10,3:1,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
818 chr12 114698158 . T C 0 PASS DP=64;GPV=1;SPV=0.040348;SS=2;SSC=13;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:34:15,6:6,1:9,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
819 chr12 114783555 . TA T 0 PASS DP=45;GPV=1;SPV=0.00070128;SS=2;SSC=31;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:18:11,7:7,3:4,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
820 chr12 115353202 . TC T 0 PASS DP=58;GPV=1;SPV=6.5361e-05;SS=2;SSC=41;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:31:18,13:8,8:10,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
821 chr12 115441818 . CTCTATA C 0 PASS DP=27;GPV=1;SPV=0.097744;SS=2;SSC=10;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:9,4:1,2:8,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
822 chr12 115627826 . TAA T 0 PASS DP=34;GPV=1;SPV=0.009628;SS=2;SSC=20;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:20:10,10:7,6:3,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
823 chr12 116356029 . C CAAAAA 0 PASS DP=26;GPV=1;SPV=0.053922;SS=2;SSC=12;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:6,5:2,4:4,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
824 chr12 116800812 . T TTAAAATAAAA 0 PASS DP=40;GPV=1;SPV=0.10779;SS=2;SSC=9;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:15,4:5,3:10,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
825 chr12 117135743 . CTTT C 0 PASS DP=27;GPV=1;SPV=0.022967;SS=2;SSC=16;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:3,7:1,5:2,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
826 chr12 117283855 . C CAAA 0 PASS DP=33;GPV=1;SPV=0.17876;SS=2;SSC=7;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:22:18,4:16,3:2,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
827 chr12 117632218 . CTTTT C 0 PASS DP=27;GPV=1;SPV=0.12771;SS=2;SSC=8;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:8,4:2,2:6,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
828 chr12 117734745 . C CATGGATGGATGGATGGATGG 0 PASS DP=42;GPV=1;SPV=0.026469;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:21:14,7:10,4:4,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
829 chr12 117833965 . C CA 0 PASS DP=38;GPV=1;SPV=0.0054096;SS=2;SSC=22;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:9,7:4,4:5,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
830 chr12 118345748 . G A 0 PASS DP=43;GPV=1;SPV=0.00077493;SS=2;SSC=31;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:25:14,11:8,4:6,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
831 chr12 118701939 . C CA 0 PASS DP=46;GPV=1;SPV=0.016233;SS=2;SSC=17;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:12,9:9,6:3,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
832 chr12 118938845 . C A 0 PASS DP=60;GPV=1;SPV=3.0928e-07;SS=2;SSC=65;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:30:13,17:6,8:7,9
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
833 chr12 119731475 . CA C 0 PASS DP=29;GPV=1;SPV=0.0078215;SS=2;SSC=21;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:18:9,8:6,6:3,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
834 chr12 120201481 . C CT 0 PASS DP=30;GPV=1;SPV=0.0016572;SS=2;SSC=27;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:10:3,7:3,3:0,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
835 chr12 121530227 . C CA 0 PASS DP=28;GPV=1;SPV=0.069881;SS=2;SSC=11;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:18:11,6:9,5:2,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
836 chr12 122124584 . C T 0 PASS DP=40;GPV=1;SPV=0.0019379;SS=2;SSC=27;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:18:8,10:5,8:3,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
837 chr12 122458532 . A ATTTAAT 0 PASS DP=48;GPV=1;SPV=0.030143;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:15,8:8,5:7,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
838 chr12 123273990 . C T 0 PASS DP=53;GPV=1;SPV=0.00041286;SS=2;SSC=33;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:32:19,13:10,8:9,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
839 chr12 123733313 . CA C 0 PASS DP=45;GPV=1;SPV=0.0014958;SS=2;SSC=28;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:25:13,12:9,10:4,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
840 chr12 125696500 . A T 0 PASS DP=76;GPV=1;SPV=0.00083898;SS=2;SSC=30;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:38:12,9:6,3:6,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
841 chr12 125708010 . C T 0 PASS DP=74;GPV=1;SPV=3.8667e-06;SS=2;SSC=54;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:40:23,17:12,11:11,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
842 chr12 126612632 . A G 0 PASS DP=33;GPV=1;SPV=0.056522;SS=2;SSC=12;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:18:9,4:3,2:6,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
843 chr12 127036284 . C T 0 PASS DP=54;GPV=1;SPV=0.0001362;SS=2;SSC=38;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:27:16,11:8,5:8,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
844 chr12 127136130 . G C 0 PASS DP=66;GPV=1;SPV=8.543e-06;SS=2;SSC=50;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:36:20,16:12,9:8,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
845 chr12 127592713 . G C 0 PASS DP=69;GPV=1;SPV=6.605e-08;SS=2;SSC=71;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:28:13,15:6,7:7,8
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
846 chr12 128462101 . GT G 0 PASS DP=61;GPV=1;SPV=0.10033;SS=2;SSC=9;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:35:31,4:13,1:18,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
847 chr12 129297613 . C T 0 PASS DP=53;GPV=1;SPV=0.0076814;SS=2;SSC=21;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:28:21,7:8,3:13,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
848 chr12 129588746 . TTC T 0 PASS DP=42;GPV=1;SPV=0.12121;SS=2;SSC=9;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:26:3,3:1,2:2,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
849 chr12 130532162 . T A 0 PASS DP=26;GPV=1;SPV=0.049428;SS=2;SSC=13;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:18:8,10:2,3:6,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
850 chr12 131278535 . C T 0 PASS DP=52;GPV=1;SPV=0.0044741;SS=2;SSC=23;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:14,5:9,4:5,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
851 chr12 132054452 . C A 0 PASS DP=54;GPV=1;SPV=0.00018612;SS=2;SSC=37;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:31:18,13:8,7:10,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
852 chr12 132380926 . G A 0 PASS DP=41;GPV=1;SPV=0.016594;SS=2;SSC=17;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:22:16,6:8,3:8,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
853 chr12 132692796 . G C 0 PASS DP=35;GPV=1;SPV=0.0074932;SS=2;SSC=21;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:12,7:9,4:3,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
854 chr12 132895660 . A G 0 PASS DP=29;GPV=1;SPV=0.049017;SS=2;SSC=13;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:9,6:5,2:4,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
855 chr12 132965438 . CT C 0 PASS DP=27;GPV=1;SPV=0.057037;SS=2;SSC=12;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:14:10,4:7,3:3,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
856 chr13 18178573 . A G 0 PASS DP=326;GPV=1;SPV=0.027138;SS=2;SSC=15;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:159:140,19:67,12:73,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
857 chr13 18194779 . G A 0 PASS DP=71;GPV=1;SPV=0.01173;SS=2;SSC=19;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:30:22,8:10,4:12,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
858 chr13 18336400 . C T 0 PASS DP=72;GPV=1;SPV=0.01598;SS=2;SSC=17;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:28:20,8:12,2:8,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
859 chr13 18747015 . C T 0 PASS DP=61;GPV=1;SPV=0.023954;SS=2;SSC=16;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:30:25,5:9,4:16,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
860 chr13 19779877 . C T 0 PASS DP=52;GPV=1;SPV=0.015217;SS=2;SSC=18;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:30:23,7:16,5:7,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
861 chr13 20851711 . CA C 0 PASS DP=24;GPV=1;SPV=0.15385;SS=2;SSC=8;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:6,5:3,4:3,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
862 chr13 21884018 . T G 0 PASS DP=41;GPV=1;SPV=0.080042;SS=2;SSC=10;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:22:18,4:7,1:11,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
863 chr13 22402137 . C CT 0 PASS DP=34;GPV=1;SPV=0.068627;SS=2;SSC=11;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:18:6,8:0,4:6,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
864 chr13 24421478 . G C 0 PASS DP=104;GPV=1;SPV=0.035001;SS=2;SSC=14;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:54:45,9:30,8:15,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
865 chr13 25159298 . G T 0 PASS DP=46;GPV=1;SPV=0.044826;SS=2;SSC=13;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:22:18,4:6,3:12,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
866 chr13 25159308 . A AAT 0 PASS DP=51;GPV=1;SPV=0.025437;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:16,6:7,4:9,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
867 chr13 25310519 . C CT 0 PASS DP=26;GPV=1;SPV=0.044272;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:7,6:4,4:3,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
868 chr13 25740308 . CA C 0 PASS DP=33;GPV=1;SPV=0.0031242;SS=2;SSC=25;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:8,11:6,9:2,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
869 chr13 26723699 . G A 0 PASS DP=38;GPV=1;SPV=0.0093762;SS=2;SSC=20;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:11,8:2,3:9,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
870 chr13 26805525 . T C 0 PASS DP=36;GPV=1;SPV=0.00058707;SS=2;SSC=32;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:21:10,11:4,6:6,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
871 chr13 26897028 . C T 0 PASS DP=76;GPV=1;SPV=1.4106e-07;SS=2;SSC=68;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:37:19,18:12,11:7,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
872 chr13 28646352 . C CA 0 PASS DP=50;GPV=1;SPV=0.0031516;SS=2;SSC=25;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:21:10,8:6,4:4,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
873 chr13 28737290 . A AAGT 0 PASS DP=19;GPV=1;SPV=0.068627;SS=2;SSC=11;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:10:6,4:0,1:6,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
874 chr13 29168888 . C CTGTGTGTGTGTGTGTGTGTGTG 0 PASS DP=25;GPV=1;SPV=0.034056;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:6,6:2,4:4,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
875 chr13 29181857 . C T 0 PASS DP=50;GPV=1;SPV=0.00033748;SS=2;SSC=34;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:30:17,13:4,5:13,8
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
876 chr13 31038665 . T C 0 PASS DP=45;GPV=1;SPV=0.13742;SS=2;SSC=8;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:28:24,4:8,2:16,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
877 chr13 34362939 . AAAAG A 0 PASS DP=23;GPV=1;SPV=0.055901;SS=2;SSC=12;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:12:8,4:2,3:6,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
878 chr13 34368386 . G C 0 PASS DP=53;GPV=1;SPV=0.0016883;SS=2;SSC=27;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:20:14,6:9,3:5,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
879 chr13 34802492 . T TA 0 PASS DP=70;GPV=1;SPV=0.014855;SS=2;SSC=18;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:36:30,6:12,2:18,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
880 chr13 34992238 . G GTATA 0 PASS DP=31;GPV=1;SPV=0.028638;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:4,6:3,4:1,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
881 chr13 36142687 . AC A 0 PASS DP=30;GPV=1;SPV=0.038406;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:8,6:3,3:5,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
882 chr13 37335480 . A ATTTACCCCAT 0 PASS DP=40;GPV=1;SPV=0.043236;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:10,6:5,4:5,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
883 chr13 37844797 . G A 0 PASS DP=53;GPV=1;SPV=0.00043265;SS=2;SSC=33;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:27:17,10:7,6:10,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
884 chr13 42841090 . T C 0 PASS DP=44;GPV=1;SPV=0.093185;SS=2;SSC=10;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:25:21,4:13,1:8,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
885 chr13 43434943 . T G 0 PASS DP=21;GPV=1;SPV=0.0089783;SS=2;SSC=20;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:9:3,6:0,5:3,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
886 chr13 43879836 . T C 0 PASS DP=43;GPV=1;SPV=0.086845;SS=2;SSC=10;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:21:13,4:6,3:7,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
887 chr13 44066175 . C CT 0 PASS DP=26;GPV=1;SPV=0.011037;SS=2;SSC=19;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:11:5,6:2,4:3,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
888 chr13 47559950 . CAAAAAAAAAAAAAAAAAAAA C 0 PASS DP=17;GPV=1;SPV=0.092308;SS=2;SSC=10;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:9:5,4:2,3:3,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
889 chr13 47702279 . A T 0 PASS DP=42;GPV=1;SPV=0.034325;SS=2;SSC=14;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:22:6,6:5,5:1,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
890 chr13 48636013 . T TACATATAGAGAGAGAGAGAGAGAGAGAGAG 0 PASS DP=35;GPV=1;SPV=0.015417;SS=2;SSC=18;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:14:9,4:5,1:4,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
891 chr13 48641363 . C CAAA 0 PASS DP=46;GPV=1;SPV=0.010106;SS=2;SSC=19;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:21:11,8:5,6:6,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
892 chr13 51479845 . C CT 0 PASS DP=20;GPV=1;SPV=0.12281;SS=2;SSC=9;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:8:5,2:3,1:2,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
893 chr13 51963736 . C CA 0 PASS DP=36;GPV=1;SPV=0.027836;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:10,4:9,4:1,0
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
894 chr13 52223586 . A T 0 PASS DP=37;GPV=1;SPV=0.013095;SS=2;SSC=18;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:8,5:5,1:3,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
895 chr13 52281163 . TGTGTGTGTGC T 0 PASS DP=113;GPV=1;SPV=0.045903;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:67:52,15:22,5:30,10
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
896 chr13 52333747 . G A 0 PASS DP=76;GPV=1;SPV=0.039673;SS=2;SSC=14;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:40:33,7:17,6:16,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
897 chr13 52504583 . G A 0 PASS DP=34;GPV=1;SPV=0.019548;SS=2;SSC=17;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:10,7:3,5:7,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
898 chr13 54672674 . GGT G 0 PASS DP=28;GPV=1;SPV=0.021053;SS=2;SSC=16;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:11:5,4:2,3:3,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
899 chr13 56018887 . G T 0 PASS DP=60;GPV=1;SPV=0.011027;SS=2;SSC=19;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:38:29,9:15,5:14,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
900 chr13 56024786 . C A 0 PASS DP=58;GPV=1;SPV=0.00094048;SS=2;SSC=30;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:29:20,9:10,6:10,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
901 chr13 56089113 . TA T 0 PASS DP=61;GPV=1;SPV=0.011057;SS=2;SSC=19;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:26:21,5:11,3:10,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
902 chr13 56277723 . A G 0 PASS DP=36;GPV=1;SPV=0.022727;SS=2;SSC=16;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:18:13,5:8,3:5,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
903 chr13 56368797 . C T 0 PASS DP=62;GPV=1;SPV=0.0041064;SS=2;SSC=23;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:33:25,8:15,5:10,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
904 chr13 58582543 . G T 0 PASS DP=54;GPV=1;SPV=0.054928;SS=2;SSC=12;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:29:21,4:13,1:8,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
905 chr13 59443228 . T TAAAAAAAAAA 0 PASS DP=26;GPV=1;SPV=0.15;SS=2;SSC=8;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:6,7:2,4:4,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
906 chr13 60014969 . T TTTTTGTTTTG 0 PASS DP=47;GPV=1;SPV=0.011765;SS=2;SSC=19;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:31:11,12:3,5:8,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
907 chr13 60321660 . CT C 0 PASS DP=24;GPV=1;SPV=0.0059289;SS=2;SSC=22;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:10:5,5:3,4:2,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
908 chr13 60662347 . CT C 0 PASS DP=25;GPV=1;SPV=0.023799;SS=2;SSC=16;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:9,7:7,3:2,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
909 chr13 60859020 . G A 0 PASS DP=81;GPV=1;SPV=7.8995e-05;SS=2;SSC=41;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:40:28,12:18,8:10,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
910 chr13 61015496 . C CTCTCTCTCTCTCTCTCTCTATATATA 0 PASS DP=46;GPV=1;SPV=0.010905;SS=2;SSC=19;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:27:16,7:12,5:4,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
911 chr13 64416401 . CATCTATCT C 0 PASS DP=48;GPV=1;SPV=0.026352;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:30:20,10:10,5:10,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
912 chr13 65280394 . A AGTGTGTGT 0 PASS DP=48;GPV=1;SPV=0.00066757;SS=2;SSC=31;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:27:13,13:9,5:4,8
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
913 chr13 65288043 . G A 0 PASS DP=42;GPV=1;SPV=0.043286;SS=2;SSC=13;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:20:16,4:7,2:9,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
914 chr13 65513553 . TAAAA T 0 PASS DP=24;GPV=1;SPV=0.013595;SS=2;SSC=18;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:5,11:4,8:1,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
915 chr13 66114842 . T A 0 PASS DP=24;GPV=1;SPV=0.083011;SS=2;SSC=10;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:13:8,5:3,2:5,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
916 chr13 66687365 . C T 0 PASS DP=56;GPV=1;SPV=0.0028364;SS=2;SSC=25;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:26:19,7:9,4:10,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
917 chr13 66756542 . C T 0 PASS DP=47;GPV=1;SPV=0.014137;SS=2;SSC=18;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:26:15,6:5,3:10,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
918 chr13 66820549 . G T 0 PASS DP=53;GPV=1;SPV=0.00070506;SS=2;SSC=31;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:26:17,9:4,5:13,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
919 chr13 69784882 . A AT 0 PASS DP=28;GPV=1;SPV=0.021256;SS=2;SSC=16;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:10,6:7,3:3,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
920 chr13 70753162 . CTT C 0 PASS DP=27;GPV=1;SPV=0.017168;SS=2;SSC=17;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:8:4,4:2,3:2,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
921 chr13 71864164 . AGCGC A 0 PASS DP=18;GPV=1;SPV=0.014706;SS=2;SSC=18;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:9:4,5:1,2:3,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
922 chr13 77377562 . T C 0 PASS DP=44;GPV=1;SPV=0.039138;SS=2;SSC=14;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:24:19,5:14,2:5,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
923 chr13 79219049 . G A 0 PASS DP=38;GPV=1;SPV=0.38182;SS=2;SSC=4;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:22:5,2:0,1:5,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
924 chr13 81088696 . C A 0 PASS DP=67;GPV=1;SPV=1.2865e-09;SS=2;SSC=88;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:36:12,24:6,10:6,14
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
925 chr13 81658352 . A G 0 PASS DP=34;GPV=1;SPV=0.25826;SS=2;SSC=5;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:10,4:5,2:5,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
926 chr13 82684636 . T A 0 PASS DP=71;GPV=1;SPV=0.060625;SS=2;SSC=12;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:36:32,4:13,2:19,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
927 chr13 86756239 . C A 0 PASS DP=57;GPV=1;SPV=0.2416;SS=2;SSC=6;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:34:21,4:6,3:15,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
928 chr13 87090543 . C CT 0 PASS DP=50;GPV=1;SPV=0.0092175;SS=2;SSC=20;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:29:16,13:9,4:7,9
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
929 chr13 87331654 . C T 0 PASS DP=72;GPV=1;SPV=0.001382;SS=2;SSC=28;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:30:23,7:12,6:11,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
930 chr13 87837249 . T TTCTCTCTCTC 0 PASS DP=30;GPV=1;SPV=0.13025;SS=2;SSC=8;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:13,5:3,4:10,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
931 chr13 88347891 . A AG 0 PASS DP=16;GPV=1;SPV=0.23077;SS=2;SSC=6;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:8:5,2:5,2:0,0
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
932 chr13 89527562 . C CTTTTCTTTTCT 0 PASS DP=40;GPV=1;SPV=0.0018592;SS=2;SSC=27;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:21:10,8:5,6:5,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
933 chr13 90344571 . C CATATAT 0 PASS DP=34;GPV=1;SPV=0.04308;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:9,5:6,4:3,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
934 chr13 92064310 . C T 0 PASS DP=73;GPV=1;SPV=2.8865e-06;SS=2;SSC=55;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:39:22,17:16,10:6,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
935 chr13 93459617 . G A 0 PASS DP=67;GPV=1;SPV=8.3669e-06;SS=2;SSC=50;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:33:19,14:10,9:9,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
936 chr13 93495622 . TTTCTG T 0 PASS DP=25;GPV=1;SPV=0.02253;SS=2;SSC=16;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:10:5,5:1,3:4,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
937 chr13 94214796 . G A 0 PASS DP=57;GPV=1;SPV=0.00046384;SS=2;SSC=33;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:29:19,10:8,8:11,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
938 chr13 94455381 . T TAG 0 PASS DP=46;GPV=1;SPV=0.035323;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:15,8:7,3:8,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
939 chr13 94738966 . A T 0 PASS DP=71;GPV=1;SPV=5.0918e-06;SS=2;SSC=52;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:27:16,11:6,4:10,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
940 chr13 96074548 . C T 0 PASS DP=38;GPV=1;SPV=0.018018;SS=2;SSC=17;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:9,7:2,5:7,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
941 chr13 97852827 . G C 0 PASS DP=44;GPV=1;SPV=0.0063975;SS=2;SSC=21;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:16,7:7,5:9,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
942 chr13 98064640 . C CTT 0 PASS DP=24;GPV=1;SPV=0.14757;SS=2;SSC=8;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:10,5:5,4:5,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
943 chr13 98078917 . A G 0 PASS DP=47;GPV=1;SPV=2.3919e-06;SS=2;SSC=56;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:9,14:4,6:5,8
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
944 chr13 98705202 . G A 0 PASS DP=30;GPV=1;SPV=0.034965;SS=2;SSC=14;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:2,7:1,1:1,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
945 chr13 101092811 . C T 0 PASS DP=54;GPV=1;SPV=0.0001513;SS=2;SSC=38;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:29:17,12:6,4:11,8
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
946 chr13 101693624 . G GTCTGTCTA 0 PASS DP=42;GPV=1;SPV=0.036102;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:11,7:3,5:8,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
947 chr13 102728046 . A G 0 PASS DP=46;GPV=1;SPV=0.0065417;SS=2;SSC=21;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:9,8:4,4:5,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
948 chr13 104498343 . ATATATTTT A 0 PASS DP=25;GPV=1;SPV=0.0027765;SS=2;SSC=25;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:14:6,8:1,4:5,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
949 chr13 106245764 . G T 0 PASS DP=29;GPV=1;SPV=0.057471;SS=2;SSC=12;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:11,4:5,2:6,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
950 chr13 106763047 . ACCCTCTCTCTCTCT A 0 PASS DP=43;GPV=1;SPV=0.11304;SS=2;SSC=9;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:26:10,4:6,2:4,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
951 chr13 107176318 . T A 0 PASS DP=43;GPV=1;SPV=0.010674;SS=2;SSC=19;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:8,4:5,3:3,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
952 chr13 109147175 . GA G 0 PASS DP=34;GPV=1;SPV=0.055718;SS=2;SSC=12;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:20:15,5:10,4:5,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
953 chr13 109765530 . A T 0 PASS DP=20;GPV=1;SPV=0.10217;SS=2;SSC=9;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:12:8,4:0,1:8,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
954 chr13 110960659 . GT G 0 PASS DP=48;GPV=1;SPV=0.057396;SS=2;SSC=12;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:28:23,5:15,4:8,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
955 chr13 111622955 . C G 0 PASS DP=19;GPV=1;SPV=0.023736;SS=2;SSC=16;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:8:3,5:2,3:1,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
956 chr13 112640591 . C T 0 PASS DP=19;GPV=1;SPV=0.010101;SS=2;SSC=19;SOMATIC GT:GQ:DP:AD:ADF:ADR 1/1:.:9:1,4:0,1:1,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
957 chr13 112787108 . C CG 0 PASS DP=54;GPV=1;SPV=0.031421;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:21:15,6:8,5:7,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
958 chr13 113512592 . C T 0 PASS DP=43;GPV=1;SPV=0.016558;SS=2;SSC=17;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:17,6:8,3:9,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
959 chr13 113593081 . G A 0 PASS DP=33;GPV=1;SPV=0.016935;SS=2;SSC=17;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:10:6,3:4,1:2,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
960 chr13 113804730 . C G 0 PASS DP=32;GPV=1;SPV=0.019346;SS=2;SSC=17;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:21:13,8:5,5:8,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
961 chr14 16085235 . G T 0 PASS DP=21;GPV=1;SPV=0.037461;SS=2;SSC=14;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:13:5,8:4,4:1,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
962 chr14 18276446 . T C 0 PASS DP=18;GPV=1;SPV=0.068627;SS=2;SSC=11;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:8:5,3:0,0:5,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
963 chr14 18288630 . C T 0 PASS DP=54;GPV=1;SPV=0.044297;SS=2;SSC=13;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:18,5:14,4:4,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
964 chr14 18293945 . G T 0 PASS DP=71;GPV=1;SPV=0.010989;SS=2;SSC=19;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:38:25,13:10,5:15,8
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
965 chr14 18426424 . A T 0 PASS DP=64;GPV=1;SPV=0.03636;SS=2;SSC=14;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:28:20,8:7,2:13,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
966 chr14 18529582 . A G 0 PASS DP=28;GPV=1;SPV=0.013155;SS=2;SSC=18;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:12:6,6:4,3:2,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
967 chr14 18700193 . C T 0 PASS DP=54;GPV=1;SPV=0.022061;SS=2;SSC=16;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:29:21,8:12,6:9,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
968 chr14 18939956 . CCTGA C 0 PASS DP=148;GPV=1;SPV=0.00027128;SS=2;SSC=35;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:81:60,21:28,7:32,14
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
969 chr14 18969317 . G A 0 PASS DP=58;GPV=1;SPV=0.036102;SS=2;SSC=14;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:30:11,7:8,6:3,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
970 chr14 18969319 . A G 0 PASS DP=65;GPV=1;SPV=0.009659;SS=2;SSC=20;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:35:28,7:12,6:16,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
971 chr14 18974856 . T A 0 PASS DP=65;GPV=1;SPV=3.57e-05;SS=2;SSC=44;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:31:15,16:7,4:8,12
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
972 chr14 18979682 . G A 0 PASS DP=24;GPV=1;SPV=0.13043;SS=2;SSC=8;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:9:7,2:7,2:0,0
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
973 chr14 19108286 . T C 0 PASS DP=82;GPV=1;SPV=0.0086983;SS=2;SSC=20;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:33:28,5:16,4:12,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
974 chr14 19232448 . C T 0 PASS DP=42;GPV=1;SPV=0.077327;SS=2;SSC=11;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:26:21,5:13,3:8,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
975 chr14 19298439 . CT C 0 PASS DP=20;GPV=1;SPV=0.070707;SS=2;SSC=11;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:9:3,4:2,3:1,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
976 chr14 19301996 . A G 0 PASS DP=40;GPV=1;SPV=0.080744;SS=2;SSC=10;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:25:20,5:13,4:7,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
977 chr14 19372235 . G A 0 PASS DP=45;GPV=1;SPV=0.016655;SS=2;SSC=17;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:21:16,5:7,3:9,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
978 chr14 19390940 . C A 0 PASS DP=37;GPV=1;SPV=0.033806;SS=2;SSC=14;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:10,7:8,3:2,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
979 chr14 19475066 . T G 0 PASS DP=20;GPV=1;SPV=0.10217;SS=2;SSC=9;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:12:8,4:8,4:0,0
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
980 chr14 19667110 . T A 0 PASS DP=40;GPV=1;SPV=0.040303;SS=2;SSC=13;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:12,5:5,1:7,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
981 chr14 19817651 . C T 0 PASS DP=57;GPV=1;SPV=2.5681e-09;SS=2;SSC=85;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:28:8,20:4,9:4,11
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
982 chr14 21222040 . CAA C 0 PASS DP=24;GPV=1;SPV=0.05418;SS=2;SSC=12;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:12:6,4:5,3:1,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
983 chr14 21696025 . GTT G 0 PASS DP=50;GPV=1;SPV=0.050152;SS=2;SSC=12;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:24:20,4:10,2:10,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
984 chr14 22034527 . A ATTTTTT 0 PASS DP=23;GPV=1;SPV=0.089245;SS=2;SSC=10;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:10,5:6,3:4,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
985 chr14 22637442 . A C 0 PASS DP=23;GPV=1;SPV=0.14229;SS=2;SSC=8;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:9:7,2:2,1:5,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
986 chr14 23962302 . G A 0 PASS DP=39;GPV=1;SPV=0.026928;SS=2;SSC=15;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:20:15,5:12,4:3,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
987 chr14 24719632 . ATG A 0 PASS DP=21;GPV=1;SPV=0.0089783;SS=2;SSC=20;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:9:3,6:2,1:1,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
988 chr14 25523801 . CT C 0 PASS DP=27;GPV=1;SPV=0.026533;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:11:6,5:3,3:3,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
989 chr14 26813631 . GT G 0 PASS DP=23;GPV=1;SPV=0.33333;SS=2;SSC=4;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:10:4,2:4,2:0,0
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
990 chr14 29466327 . TA T 0 PASS DP=48;GPV=1;SPV=0.037605;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:17,6:5,3:12,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
991 chr14 29826544 . G A 0 PASS DP=28;GPV=1;SPV=0.066667;SS=2;SSC=11;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:11,4:4,2:7,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
992 chr14 30445162 . GA G 0 PASS DP=54;GPV=1;SPV=0.00058755;SS=2;SSC=32;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:26:17,9:10,7:7,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
993 chr14 31052934 . A AT 0 PASS DP=36;GPV=1;SPV=0.02914;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:20:12,8:8,5:4,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
994 chr14 31933233 . ATT A 0 PASS DP=22;GPV=1;SPV=0.006192;SS=2;SSC=22;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:9:4,5:3,3:1,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
995 chr14 32475678 . C CT 0 PASS DP=29;GPV=1;SPV=0.12771;SS=2;SSC=8;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:8,4:5,3:3,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
996 chr14 34702539 . AT A 0 PASS DP=23;GPV=1;SPV=0.15415;SS=2;SSC=8;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:11,4:6,2:5,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
997 chr14 34840768 . C A 0 PASS DP=48;GPV=1;SPV=0.12121;SS=2;SSC=9;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:6,2:0,1:6,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
998 chr14 35007749 . A AT 0 PASS DP=55;GPV=1;SPV=0.10544;SS=2;SSC=9;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:32:28,4:15,2:13,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
999 chr14 36122153 . A ATT 0 PASS DP=46;GPV=1;SPV=0.05418;SS=2;SSC=12;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:24:6,9:2,5:4,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1000 chr14 37200850 . ATG A 0 PASS DP=29;GPV=1;SPV=0.001204;SS=2;SSC=29;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:5,7:0,6:5,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1001 chr14 39187659 . T C 0 PASS DP=42;GPV=1;SPV=0.025265;SS=2;SSC=15;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:22:13,9:8,4:5,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1002 chr14 39300937 . TATATAC T 0 PASS DP=44;GPV=1;SPV=0.019016;SS=2;SSC=17;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:13,6:8,2:5,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1003 chr14 39300953 . CAT C 0 PASS DP=44;GPV=1;SPV=0.047286;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:22:16,6:10,2:6,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1004 chr14 39300963 . C T 0 PASS DP=48;GPV=1;SPV=0.046549;SS=2;SSC=13;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:25:15,6:10,2:5,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1005 chr14 42051617 . T TA 0 PASS DP=35;GPV=1;SPV=0.040038;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:9,6:4,4:5,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1006 chr14 42624923 . A G 0 PASS DP=60;GPV=1;SPV=7.799e-06;SS=2;SSC=51;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:33:17,16:8,8:9,8
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1007 chr14 43213467 . C T 0 PASS DP=64;GPV=1;SPV=3.148e-05;SS=2;SSC=45;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:40:22,18:9,11:13,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1008 chr14 43528639 . C T 0 PASS DP=73;GPV=1;SPV=1.537e-06;SS=2;SSC=58;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:41:22,19:12,6:10,13
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1009 chr14 45692176 . A G 0 PASS DP=42;GPV=1;SPV=0.037585;SS=2;SSC=14;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:32:17,15:11,6:6,9
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1010 chr14 45887569 . T A 0 PASS DP=44;GPV=1;SPV=0.0076872;SS=2;SSC=21;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:21:15,6:5,3:10,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1011 chr14 48767763 . A AT 0 PASS DP=56;GPV=1;SPV=0.043843;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:33:22,10:10,7:12,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1012 chr14 49960412 . C T 0 PASS DP=33;GPV=1;SPV=0.034533;SS=2;SSC=14;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:14:5,5:2,3:3,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1013 chr14 50224327 . A G 0 PASS DP=36;GPV=1;SPV=0.15033;SS=2;SSC=8;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:19,4:13,3:6,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1014 chr14 50236734 . A T 0 PASS DP=40;GPV=1;SPV=0.047431;SS=2;SSC=13;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:6,3:3,1:3,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1015 chr14 50479008 . T G 0 PASS DP=40;GPV=1;SPV=0.41667;SS=2;SSC=3;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:4,2:3,1:1,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1016 chr14 50811544 . C CTT 0 PASS DP=23;GPV=1;SPV=0.11538;SS=2;SSC=9;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:14:6,4:5,2:1,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1017 chr14 56444101 . C T 0 PASS DP=26;GPV=1;SPV=0.029565;SS=2;SSC=15;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:10,7:2,4:8,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1018 chr14 56922072 . C CAT 0 PASS DP=30;GPV=1;SPV=0.027053;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:10,6:4,5:6,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1019 chr14 57323176 . CAAAAAAAAAAAAAA C 0 PASS DP=27;GPV=1;SPV=0.037112;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:4,7:2,5:2,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1020 chr14 60667650 . A AATAT 0 PASS DP=26;GPV=1;SPV=0.046584;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:13:8,4:6,1:2,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1021 chr14 63439356 . T C 0 PASS DP=60;GPV=1;SPV=0.030658;SS=2;SSC=15;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:26:22,4:9,3:13,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1022 chr14 63846582 . T TTTCTG 0 PASS DP=34;GPV=1;SPV=0.036101;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:13,5:6,2:7,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1023 chr14 64492119 . A C 0 PASS DP=33;GPV=1;SPV=0.23333;SS=2;SSC=6;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:6,2:1,1:5,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1024 chr14 64583073 . A T 0 PASS DP=40;GPV=1;SPV=0.0027027;SS=2;SSC=25;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:12,7:4,5:8,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1025 chr14 64949722 . CA C 0 PASS DP=28;GPV=1;SPV=0.031121;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:18:8,9:4,7:4,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1026 chr14 65247931 . C CACACAT 0 PASS DP=36;GPV=1;SPV=0.006031;SS=2;SSC=22;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:10,12:5,7:5,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1027 chr14 65266406 . T A 0 PASS DP=39;GPV=1;SPV=0.030303;SS=2;SSC=15;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:18:2,4:1,3:1,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1028 chr14 66516183 . T A 0 PASS DP=51;GPV=1;SPV=0.00016223;SS=2;SSC=37;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:26:15,11:6,2:9,9
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1029 chr14 67780754 . G A 0 PASS DP=56;GPV=1;SPV=8.1801e-07;SS=2;SSC=60;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:32:13,19:6,13:7,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1030 chr14 67803228 . C T 0 PASS DP=48;GPV=1;SPV=0.076832;SS=2;SSC=11;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:26:22,4:11,2:11,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1031 chr14 69654792 . T G 0 PASS DP=36;GPV=1;SPV=0.2;SS=2;SSC=6;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:1,2:1,1:0,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1032 chr14 69745994 . T TACAC 0 PASS DP=38;GPV=1;SPV=0.020719;SS=2;SSC=16;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:8,6:5,3:3,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1033 chr14 70710663 . CTTTCT C 0 PASS DP=35;GPV=1;SPV=0.058162;SS=2;SSC=12;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:18:13,4:1,2:12,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1034 chr14 70710706 . TTC T 0 PASS DP=26;GPV=1;SPV=0.091304;SS=2;SSC=10;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:11,4:1,2:10,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1035 chr14 71906790 . A T 0 PASS DP=31;GPV=1;SPV=0.0081121;SS=2;SSC=20;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:8,9:7,5:1,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1036 chr14 71906791 . G GAAAAGCATATGCTGAAAAGCATAATACTTTTTA 0 PASS DP=29;GPV=1;SPV=0.0020704;SS=2;SSC=26;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:7,8:6,5:1,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1037 chr14 73536516 . T TA 0 PASS DP=47;GPV=1;SPV=0.014845;SS=2;SSC=18;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:21:16,5:10,4:6,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1038 chr14 74014389 . C A 0 PASS DP=62;GPV=1;SPV=0.14744;SS=2;SSC=8;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:39:35,4:24,2:11,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1039 chr14 74520801 . AAATG A 0 PASS DP=62;GPV=1;SPV=0.0079392;SS=2;SSC=21;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:31:19,12:11,6:8,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1040 chr14 74868313 . TTATA T 0 PASS DP=21;GPV=1;SPV=0.14141;SS=2;SSC=8;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:11:4,4:3,3:1,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1041 chr14 75153777 . C CTTTTTTTTT 0 PASS DP=36;GPV=1;SPV=0.045968;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:16,6:6,3:10,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1042 chr14 75257469 . G A 0 PASS DP=66;GPV=1;SPV=0.00012491;SS=2;SSC=39;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:38:24,14:13,8:11,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1043 chr14 79233666 . C CTG 0 PASS DP=47;GPV=1;SPV=0.0036809;SS=2;SSC=24;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:20:11,9:6,7:5,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1044 chr14 79233730 . A C 0 PASS DP=41;GPV=1;SPV=0.0041486;SS=2;SSC=23;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:21:10,11:7,4:3,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1045 chr14 79343870 . C A 0 PASS DP=71;GPV=1;SPV=2.537e-05;SS=2;SSC=45;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:37:23,14:13,9:10,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1046 chr14 80195814 . TA T 0 PASS DP=40;GPV=1;SPV=0.00021796;SS=2;SSC=36;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:20:10,10:8,9:2,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1047 chr14 81572276 . T A 0 PASS DP=31;GPV=1;SPV=0.060215;SS=2;SSC=12;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:8:6,2:4,1:2,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1048 chr14 82823662 . C A 0 PASS DP=49;GPV=1;SPV=0.00063642;SS=2;SSC=31;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:24:15,9:8,3:7,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1049 chr14 83327150 . C T 0 PASS DP=59;GPV=1;SPV=0.0016044;SS=2;SSC=27;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:31:22,9:7,5:15,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1050 chr14 83577812 . G GAT 0 PASS DP=31;GPV=1;SPV=0.030629;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:18:10,8:7,4:3,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1051 chr14 83936135 . AAG A 0 PASS DP=31;GPV=1;SPV=0.029654;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:11:5,4:3,2:2,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1052 chr14 84703045 . GATATAT G 0 PASS DP=44;GPV=1;SPV=0.019067;SS=2;SSC=17;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:24:18,6:10,2:8,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1053 chr14 85440994 . C CT 0 PASS DP=24;GPV=1;SPV=0.0091533;SS=2;SSC=20;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:13:6,6:6,5:0,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1054 chr14 85470210 . T C 0 PASS DP=42;GPV=1;SPV=1.7795e-05;SS=2;SSC=47;SOMATIC GT:GQ:DP:AD:ADF:ADR 1/1:.:29:6,23:2,14:4,9
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1055 chr14 87551018 . A T 0 PASS DP=60;GPV=1;SPV=0.16667;SS=2;SSC=7;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:35:2,2:1,1:1,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1056 chr14 88484211 . CTAT C 0 PASS DP=39;GPV=1;SPV=0.033935;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:24:15,9:8,4:7,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1057 chr14 88716732 . AAC A 0 PASS DP=35;GPV=1;SPV=0.00049132;SS=2;SSC=33;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:3,12:3,8:0,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1058 chr14 90237501 . A AAGG 0 PASS DP=39;GPV=1;SPV=0.0043369;SS=2;SSC=23;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:9,12:3,5:6,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1059 chr14 90983813 . C CTCTCTG 0 PASS DP=40;GPV=1;SPV=0.035372;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:18:8,6:7,2:1,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1060 chr14 91572426 . CT C 0 PASS DP=26;GPV=1;SPV=0.023045;SS=2;SSC=16;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:7,9:4,4:3,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1061 chr14 91661524 . C CAT 0 PASS DP=46;GPV=1;SPV=0.0015312;SS=2;SSC=28;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:22:5,9:4,6:1,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1062 chr14 92808663 . G GT 0 PASS DP=42;GPV=1;SPV=0.00024986;SS=2;SSC=36;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:21:9,12:6,7:3,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1063 chr14 92808701 . G GA 0 PASS DP=39;GPV=1;SPV=0.0011741;SS=2;SSC=29;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:24:11,11:8,5:3,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1064 chr14 93357775 . G A 0 PASS DP=25;GPV=1;SPV=0.014142;SS=2;SSC=18;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:11:5,6:0,2:5,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1065 chr14 94533813 . TAA T 0 PASS DP=44;GPV=1;SPV=0.055478;SS=2;SSC=12;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:24:16,6:10,3:6,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1066 chr14 95476466 . C T 0 PASS DP=70;GPV=1;SPV=0.0024931;SS=2;SSC=26;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:35:27,8:16,4:11,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1067 chr14 97068412 . CT C 0 PASS DP=34;GPV=1;SPV=0.088889;SS=2;SSC=10;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:12,4:3,2:9,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1068 chr14 97154203 . TTTCCTTCCTTCC T 0 PASS DP=32;GPV=1;SPV=0.076628;SS=2;SSC=11;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:12,4:0,1:12,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1069 chr14 97193720 . A AT 0 PASS DP=53;GPV=1;SPV=0.00067301;SS=2;SSC=31;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:28:18,10:8,7:10,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1070 chr14 99130508 . GAA G 0 PASS DP=29;GPV=1;SPV=0.0094953;SS=2;SSC=20;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:7,8:7,7:0,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1071 chr14 99811184 . T G 0 PASS DP=48;GPV=1;SPV=9.8865e-05;SS=2;SSC=40;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:22:12,10:5,5:7,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1072 chr14 99846281 . A ATTTT 0 PASS DP=34;GPV=1;SPV=0.010024;SS=2;SSC=19;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:12,10:11,9:1,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1073 chr14 101397815 . T C 0 PASS DP=28;GPV=1;SPV=0.0078215;SS=2;SSC=21;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:9,8:8,4:1,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1074 chr14 101397817 . T C 0 PASS DP=27;GPV=1;SPV=0.037198;SS=2;SSC=14;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:10,5:8,3:2,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1075 chr14 101674930 . T C 0 PASS DP=51;GPV=1;SPV=0.031763;SS=2;SSC=14;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:18,4:12,2:6,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1076 chr14 101942512 . CA C 0 PASS DP=38;GPV=1;SPV=0.0025217;SS=2;SSC=25;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:18:11,7:6,5:5,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1077 chr14 102202372 . GT G 0 PASS DP=21;GPV=1;SPV=0.11947;SS=2;SSC=9;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:13:9,4:6,2:3,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1078 chr14 104097956 . G A 0 PASS DP=23;GPV=1;SPV=0.016624;SS=2;SSC=17;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:14:5,9:2,2:3,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1079 chr14 105598771 . C T 0 PASS DP=53;GPV=1;SPV=0.016371;SS=2;SSC=17;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:26:17,9:11,8:6,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1080 chr14 105927535 . AGG A 0 PASS DP=46;GPV=1;SPV=0.077519;SS=2;SSC=11;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:25:21,4:12,2:9,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1081 chr14 106419214 . G A 0 PASS DP=25;GPV=1;SPV=0.0065876;SS=2;SSC=21;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:9:4,4:3,3:1,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1082 chr14 106459602 . C CT 0 PASS DP=27;GPV=1;SPV=0.054945;SS=2;SSC=12;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:3,8:1,6:2,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1083 chr15 17745729 . G A 0 PASS DP=25;GPV=1;SPV=0.040316;SS=2;SSC=13;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:9:5,4:1,3:4,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1084 chr15 18358341 . A G 0 PASS DP=44;GPV=1;SPV=0.031815;SS=2;SSC=14;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:16,7:7,3:9,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1085 chr15 18749305 . A G 0 PASS DP=21;GPV=1;SPV=0.13333;SS=2;SSC=8;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:8:6,2:0,0:6,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1086 chr15 19910197 . C T 0 PASS DP=72;GPV=1;SPV=6.3405e-07;SS=2;SSC=61;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:36:19,17:9,10:10,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1087 chr15 20170452 . C A 0 PASS DP=82;GPV=1;SPV=0.036717;SS=2;SSC=14;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:40:32,8:13,7:19,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1088 chr15 20247398 . C A 0 PASS DP=86;GPV=1;SPV=0.036143;SS=2;SSC=14;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:48:38,10:10,3:28,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1089 chr15 20336424 . G A 0 PASS DP=50;GPV=1;SPV=0.0036197;SS=2;SSC=24;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:26:16,10:6,7:10,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1090 chr15 20336442 . G GTTTTTTGTTT 0 PASS DP=46;GPV=1;SPV=0.0073947;SS=2;SSC=21;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:22:11,10:6,7:5,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1091 chr15 20347933 . G A 0 PASS DP=105;GPV=1;SPV=0.020231;SS=2;SSC=16;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:50:37,13:21,5:16,8
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1092 chr15 20355877 . C CTTTCTTTCTTTTTTTT 0 PASS DP=70;GPV=1;SPV=0.091036;SS=2;SSC=10;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:38:28,4:15,1:13,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1093 chr15 20550951 . G A 0 PASS DP=32;GPV=1;SPV=0.04308;SS=2;SSC=13;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:14:9,5:5,4:4,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1094 chr15 20582882 . T C 0 PASS DP=90;GPV=1;SPV=0.049331;SS=2;SSC=13;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:52:40,12:17,9:23,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1095 chr15 20670150 . T C 0 PASS DP=29;GPV=1;SPV=0.12884;SS=2;SSC=8;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:18:14,4:7,2:7,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1096 chr15 21254323 . C T 0 PASS DP=44;GPV=1;SPV=0.014276;SS=2;SSC=18;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:20:15,5:7,4:8,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1097 chr15 22422812 . C T 0 PASS DP=50;GPV=1;SPV=0.024399;SS=2;SSC=16;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:25:18,7:8,6:10,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1098 chr15 22444687 . G C 0 PASS DP=72;GPV=1;SPV=0.016949;SS=2;SSC=17;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:38:26,12:16,9:10,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1099 chr15 22949262 . TGCCTAAGCCTAAAGCGGGGACCAGGCGGGCCGGAAGGCGGGCACAATGC T 0 PASS DP=39;GPV=1;SPV=0.058905;SS=2;SSC=12;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:20:16,4:12,2:4,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1100 chr15 23217430 . ATTT A 0 PASS DP=39;GPV=1;SPV=0.07313;SS=2;SSC=11;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:24:16,5:10,3:6,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1101 chr15 24080017 . C T 0 PASS DP=57;GPV=1;SPV=2.7719e-05;SS=2;SSC=45;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:29:16,13:6,3:10,10
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1102 chr15 24334109 . G A 0 PASS DP=74;GPV=1;SPV=0.085094;SS=2;SSC=10;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:46:41,5:19,1:22,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1103 chr15 25132879 . CA C 0 PASS DP=29;GPV=1;SPV=0.028886;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:18:9,9:4,7:5,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1104 chr15 26251855 . A T 0 PASS DP=18;GPV=1;SPV=0.23529;SS=2;SSC=6;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:9:7,2:3,1:4,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1105 chr15 28422218 . A G 0 PASS DP=43;GPV=1;SPV=0.059274;SS=2;SSC=12;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:22:18,4:2,2:16,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1106 chr15 28493416 . T C 0 PASS DP=217;GPV=1;SPV=0.032621;SS=2;SSC=14;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:123:110,13:66,7:44,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1107 chr15 29057406 . A C 0 PASS DP=59;GPV=1;SPV=7.6729e-05;SS=2;SSC=41;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:28:17,11:5,4:12,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1108 chr15 30524903 . G A 0 PASS DP=73;GPV=1;SPV=0.020062;SS=2;SSC=16;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:33:25,8:13,5:12,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1109 chr15 30691517 . C T 0 PASS DP=55;GPV=1;SPV=0.025964;SS=2;SSC=15;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:19,4:11,3:8,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1110 chr15 31165579 . C CTT 0 PASS DP=26;GPV=1;SPV=0.053755;SS=2;SSC=12;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:11,6:7,5:4,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1111 chr15 31567594 . C T 0 PASS DP=66;GPV=1;SPV=0.00058845;SS=2;SSC=32;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:40:27,13:19,10:8,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1112 chr15 32044253 . C CTCCTTCCTTCCTTCCTTCCT 0 PASS DP=35;GPV=1;SPV=0.070652;SS=2;SSC=11;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:21:10,5:5,3:5,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1113 chr15 32162135 . C T 0 PASS DP=43;GPV=1;SPV=0.011004;SS=2;SSC=19;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:25:15,10:13,6:2,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1114 chr15 32181183 . A G 0 PASS DP=17;GPV=1;SPV=0.082353;SS=2;SSC=10;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:8:5,3:5,3:0,0
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1115 chr15 32580639 . C G 0 PASS DP=27;GPV=1;SPV=0.047826;SS=2;SSC=13;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:14:8,6:4,3:4,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1116 chr15 33343334 . T A 0 PASS DP=63;GPV=1;SPV=1.022e-05;SS=2;SSC=49;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:40:20,20:11,13:9,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1117 chr15 33889981 . G A 0 PASS DP=67;GPV=1;SPV=1.4224e-05;SS=2;SSC=48;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:34:20,14:8,7:12,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1118 chr15 34053319 . A AATAT 0 PASS DP=18;GPV=1;SPV=0.27778;SS=2;SSC=5;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:8:3,2:2,1:1,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1119 chr15 34423155 . A G 0 PASS DP=60;GPV=1;SPV=0.1208;SS=2;SSC=9;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:36:32,4:19,2:13,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1120 chr15 34543009 . T C 0 PASS DP=29;GPV=1;SPV=0.031059;SS=2;SSC=15;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:14:8,6:4,2:4,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1121 chr15 34949276 . A ATGAGCCACTACACTGGGCC 0 PASS DP=28;GPV=1;SPV=0.027053;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:10,6:5,5:5,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1122 chr15 35482218 . T G 0 PASS DP=66;GPV=1;SPV=3.4893e-05;SS=2;SSC=44;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:37:22,15:12,5:10,10
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1123 chr15 36178301 . A AT 0 PASS DP=60;GPV=1;SPV=0.00085567;SS=2;SSC=30;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:32:22,10:9,7:13,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1124 chr15 36278095 . CATAT C 0 PASS DP=35;GPV=1;SPV=0.13971;SS=2;SSC=8;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:22:18,4:11,2:7,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1125 chr15 36286610 . G A 0 PASS DP=30;GPV=1;SPV=0.0090312;SS=2;SSC=20;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:13:8,5:3,4:5,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1126 chr15 36471641 . C CAAA 0 PASS DP=32;GPV=1;SPV=0.10134;SS=2;SSC=9;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:22:16,6:11,5:5,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1127 chr15 36722985 . G GTGTGTGTGTGTT 0 PASS DP=72;GPV=1;SPV=0.10396;SS=2;SSC=9;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:38:25,5:11,3:14,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1128 chr15 40504337 . G GTGTATATA 0 PASS DP=70;GPV=1;SPV=0.035289;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:31:19,6:9,1:10,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1129 chr15 40951605 . A C 0 PASS DP=23;GPV=1;SPV=0.10714;SS=2;SSC=9;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:11:1,2:0,0:1,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1130 chr15 41179528 . A AAAGGAAGGAAGGAAGG 0 PASS DP=35;GPV=1;SPV=0.022489;SS=2;SSC=16;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:8,7:4,3:4,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1131 chr15 42789854 . T TACACACACACAC 0 PASS DP=49;GPV=1;SPV=0.00026695;SS=2;SSC=35;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:24:12,12:8,7:4,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1132 chr15 45934450 . G A 0 PASS DP=54;GPV=1;SPV=0.00070687;SS=2;SSC=31;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:24:16,8:10,5:6,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1133 chr15 48314237 . C T 0 PASS DP=17;GPV=1;SPV=0.20588;SS=2;SSC=6;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:8:6,2:5,1:1,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1134 chr15 48435768 . GTA G 0 PASS DP=26;GPV=1;SPV=0.016317;SS=2;SSC=17;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:12:2,5:2,2:0,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1135 chr15 50874129 . C T 0 PASS DP=38;GPV=1;SPV=0.0074524;SS=2;SSC=21;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:24:12,12:3,4:9,8
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1136 chr15 51583106 . CT C 0 PASS DP=18;GPV=1;SPV=0.022876;SS=2;SSC=16;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:8:4,4:3,3:1,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1137 chr15 51747017 . T TA 0 PASS DP=25;GPV=1;SPV=0.024224;SS=2;SSC=16;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:13:8,5:6,4:2,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1138 chr15 51912441 . T A 0 PASS DP=49;GPV=1;SPV=0.08867;SS=2;SSC=10;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:21:7,2:5,1:2,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1139 chr15 52462280 . G A 0 PASS DP=48;GPV=1;SPV=0.034205;SS=2;SSC=14;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:5,4:2,1:3,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1140 chr15 55518897 . C A 0 PASS DP=49;GPV=1;SPV=0.18814;SS=2;SSC=7;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:29:13,4:6,2:7,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1141 chr15 55778195 . C CTCTT 0 PASS DP=30;GPV=1;SPV=0.052107;SS=2;SSC=12;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:12,5:3,2:9,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1142 chr15 56312269 . C T 0 PASS DP=35;GPV=1;SPV=0.036146;SS=2;SSC=14;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:13,10:4,5:9,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1143 chr15 57007764 . TTCTTTCTTTCTTTCTTTCTTTCTTTCTC T 0 PASS DP=27;GPV=1;SPV=0.059289;SS=2;SSC=12;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:8:4,2:0,0:4,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1144 chr15 57223643 . GTTT G 0 PASS DP=34;GPV=1;SPV=0.1532;SS=2;SSC=8;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:22:13,6:9,4:4,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1145 chr15 57336148 . CT C 0 PASS DP=23;GPV=1;SPV=0.024887;SS=2;SSC=16;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:12:3,6:3,5:0,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1146 chr15 59093361 . T TC 0 PASS DP=24;GPV=1;SPV=0.074661;SS=2;SSC=11;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:6,5:3,1:3,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1147 chr15 59359330 . T A 0 PASS DP=32;GPV=1;SPV=0.0023112;SS=2;SSC=26;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:9,8:6,4:3,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1148 chr15 59719506 . CAAAA C 0 PASS DP=24;GPV=1;SPV=0.070652;SS=2;SSC=11;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:10,5:7,4:3,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1149 chr15 60009125 . A T 0 PASS DP=65;GPV=1;SPV=0.066667;SS=2;SSC=11;SOMATIC GT:GQ:DP:AD:ADF:ADR 1/1:.:35:0,2:0,1:0,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1150 chr15 60132343 . GGGA G 0 PASS DP=23;GPV=1;SPV=0.27778;SS=2;SSC=5;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:10:3,2:3,1:0,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1151 chr15 60993644 . CA C 0 PASS DP=33;GPV=1;SPV=0.0099161;SS=2;SSC=20;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:7,10:3,9:4,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1152 chr15 61451616 . T TTTTTTC 0 PASS DP=27;GPV=1;SPV=0.021672;SS=2;SSC=16;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:5,5:2,1:3,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1153 chr15 62096613 . AT A 0 PASS DP=51;GPV=1;SPV=0.00077001;SS=2;SSC=31;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:15,8:11,5:4,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1154 chr15 64718753 . G GGTGTGTGTGTGT 0 PASS DP=35;GPV=1;SPV=0.034996;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:21:14,6:8,2:6,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1155 chr15 66432959 . A AGTGTGT 0 PASS DP=36;GPV=1;SPV=0.025287;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:8,6:6,5:2,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1156 chr15 67055971 . C CAA 0 PASS DP=38;GPV=1;SPV=0.037533;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:21:11,7:7,5:4,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1157 chr15 68741633 . C CA 0 PASS DP=27;GPV=1;SPV=0.026636;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:13:6,6:5,5:1,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1158 chr15 69078387 . C T 0 PASS DP=45;GPV=1;SPV=0.0072477;SS=2;SSC=21;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:26:18,8:7,2:11,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1159 chr15 72665570 . A G 0 PASS DP=47;GPV=1;SPV=0.010436;SS=2;SSC=19;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:27:17,10:9,3:8,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1160 chr15 74073767 . C T 0 PASS DP=20;GPV=1;SPV=0.049123;SS=2;SSC=13;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:8:5,3:0,0:5,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1161 chr15 76330727 . T TTA 0 PASS DP=42;GPV=1;SPV=0.024887;SS=2;SSC=16;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:3,6:1,5:2,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1162 chr15 76572915 . T TCACACA 0 PASS DP=35;GPV=1;SPV=0.010394;SS=2;SSC=19;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:22:4,9:2,3:2,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1163 chr15 77024962 . G A 0 PASS DP=62;GPV=1;SPV=1.4083e-05;SS=2;SSC=48;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:28:16,12:9,8:7,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1164 chr15 77343482 . CTTTT C 0 PASS DP=46;GPV=1;SPV=0.026054;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:11,6:2,3:9,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1165 chr15 77509555 . CGTGTGT C 0 PASS DP=37;GPV=1;SPV=0.027772;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:5,5:4,4:1,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1166 chr15 77883340 . C G 0 PASS DP=23;GPV=1;SPV=0.037623;SS=2;SSC=14;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:13:6,7:4,5:2,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1167 chr15 78215763 . A G 0 PASS DP=48;GPV=1;SPV=0.069354;SS=2;SSC=11;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:29:24,5:17,2:7,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1168 chr15 78877117 . T A 0 PASS DP=30;GPV=1;SPV=0.46667;SS=2;SSC=3;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:18:5,2:4,1:1,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1169 chr15 80339873 . G A 0 PASS DP=65;GPV=1;SPV=0.0014199;SS=2;SSC=28;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:36:26,10:12,4:14,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1170 chr15 80382911 . C CAATA 0 PASS DP=41;GPV=1;SPV=0.027154;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:21:16,5:6,4:10,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1171 chr15 81179982 . CT C 0 PASS DP=38;GPV=1;SPV=0.019656;SS=2;SSC=17;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:21:15,6:10,3:5,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1172 chr15 82383908 . T A 0 PASS DP=35;GPV=1;SPV=0.03602;SS=2;SSC=14;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:11,6:5,4:6,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1173 chr15 82427338 . CTCTT C 0 PASS DP=49;GPV=1;SPV=0.082831;SS=2;SSC=10;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:27:23,4:6,1:17,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1174 chr15 82523942 . A G 0 PASS DP=25;GPV=1;SPV=0.12;SS=2;SSC=9;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:9:7,2:4,1:3,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1175 chr15 82916807 . A AT 0 PASS DP=56;GPV=1;SPV=0.011338;SS=2;SSC=19;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:31:24,7:13,3:11,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1176 chr15 83417902 . T TA 0 PASS DP=41;GPV=1;SPV=0.01095;SS=2;SSC=19;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:25:9,10:5,8:4,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1177 chr15 83822769 . C T 0 PASS DP=66;GPV=1;SPV=2.1474e-05;SS=2;SSC=46;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:30:18,12:8,7:10,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1178 chr15 84419727 . G A 0 PASS DP=67;GPV=1;SPV=0.0219;SS=2;SSC=16;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:39:10,7:4,3:6,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1179 chr15 84425290 . C T 0 PASS DP=61;GPV=1;SPV=0.014936;SS=2;SSC=18;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:24:17,7:10,5:7,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1180 chr15 85151765 . CAA C 0 PASS DP=24;GPV=1;SPV=0.038248;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:14:8,5:4,4:4,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1181 chr15 85504515 . A C 0 PASS DP=25;GPV=1;SPV=0.056522;SS=2;SSC=12;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:13:9,4:4,2:5,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1182 chr15 85841139 . A ATTTTT 0 PASS DP=40;GPV=1;SPV=0.027415;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:18:12,6:7,4:5,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1183 chr15 86380935 . A AGTGTGT 0 PASS DP=56;GPV=1;SPV=0.0010872;SS=2;SSC=29;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:15,8:9,4:6,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1184 chr15 86703427 . C T 0 PASS DP=57;GPV=1;SPV=8.1679e-06;SS=2;SSC=50;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:21:11,10:6,4:5,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1185 chr15 86826036 . C CA 0 PASS DP=41;GPV=1;SPV=0.0076326;SS=2;SSC=21;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:29:13,15:8,9:5,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1186 chr15 87055660 . A C 0 PASS DP=70;GPV=1;SPV=3.3351e-05;SS=2;SSC=44;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:33:21,12:12,8:9,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1187 chr15 89354401 . CTT C 0 PASS DP=24;GPV=1;SPV=0.043512;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:13:3,5:2,2:1,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1188 chr15 89952550 . CA C 0 PASS DP=26;GPV=1;SPV=0.030435;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:14:9,5:4,4:5,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1189 chr15 90175683 . CT C 0 PASS DP=43;GPV=1;SPV=0.0015067;SS=2;SSC=28;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:10,9:6,7:4,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1190 chr15 90407221 . T C 0 PASS DP=71;GPV=1;SPV=0.0005505;SS=2;SSC=32;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:36:26,10:16,3:10,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1191 chr15 90651919 . CT C 0 PASS DP=26;GPV=1;SPV=0.038248;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:8,5:5,3:3,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1192 chr15 90735236 . AAT A 0 PASS DP=32;GPV=1;SPV=0.013932;SS=2;SSC=18;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:18:3,12:2,9:1,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1193 chr15 91420126 . CTG C 0 PASS DP=52;GPV=1;SPV=0.070228;SS=2;SSC=11;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:27:23,4:10,2:13,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1194 chr15 92587513 . C CAAAAA 0 PASS DP=49;GPV=1;SPV=0.013891;SS=2;SSC=18;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:14,7:9,6:5,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1195 chr15 92767870 . C T 0 PASS DP=54;GPV=1;SPV=0.017924;SS=2;SSC=17;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:22:15,7:7,2:8,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1196 chr15 92999083 . CA C 0 PASS DP=27;GPV=1;SPV=0.015182;SS=2;SSC=18;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:10:5,5:1,4:4,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1197 chr15 93677756 . A T 0 PASS DP=42;GPV=1;SPV=0.027339;SS=2;SSC=15;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:18:14,4:6,2:8,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1198 chr15 93940288 . AAAAG A 0 PASS DP=30;GPV=1;SPV=0.04735;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:10,7:2,4:8,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1199 chr15 94162144 . T C 0 PASS DP=33;GPV=1;SPV=0.024497;SS=2;SSC=16;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:13,6:6,4:7,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1200 chr15 96447738 . TATC T 0 PASS DP=51;GPV=1;SPV=0.013865;SS=2;SSC=18;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:26:18,8:8,4:10,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1201 chr15 96857600 . C CAAAAAA 0 PASS DP=37;GPV=1;SPV=0.023277;SS=2;SSC=16;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:22:13,9:9,8:4,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1202 chr15 96865316 . G A 0 PASS DP=60;GPV=1;SPV=0.1208;SS=2;SSC=9;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:36:32,4:15,2:17,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1203 chr15 99085857 . T G 0 PASS DP=66;GPV=1;SPV=0.34286;SS=2;SSC=4;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:34:7,2:4,1:3,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1204 chr15 100759176 . A T 0 PASS DP=57;GPV=1;SPV=1.3625e-05;SS=2;SSC=48;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:31:16,15:10,8:6,7
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1205 chr15 101258008 . CTT C 0 PASS DP=36;GPV=1;SPV=0.039412;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:9,6:7,2:2,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1206 chr15 101743927 . C CTCTT 0 PASS DP=75;GPV=1;SPV=0.04982;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:35:28,7:15,1:13,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1207 chr16 1833555 . T C 0 PASS DP=35;GPV=1;SPV=0.064336;SS=2;SSC=11;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:25:17,7:11,4:6,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1208 chr16 2542624 . A G 0 PASS DP=53;GPV=1;SPV=0.028132;SS=2;SSC=15;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:27:22,5:10,4:12,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1209 chr16 3329169 . G GACACAC 0 PASS DP=20;GPV=1;SPV=0.031702;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:11:2,6:1,5:1,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1210 chr16 3889002 . G T 0 PASS DP=64;GPV=1;SPV=0.00013223;SS=2;SSC=38;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:29:19,10:6,2:13,8
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1211 chr16 5801341 . C CT 0 PASS DP=32;GPV=1;SPV=0.020486;SS=2;SSC=16;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:18:12,6:8,4:4,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1212 chr16 6134683 . A ATTTTTTTTTTT 0 PASS DP=30;GPV=1;SPV=0.040038;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:9,6:3,4:6,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1213 chr16 6220657 . T A 0 PASS DP=41;GPV=1;SPV=0.013378;SS=2;SSC=18;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:27:18,9:11,5:7,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1214 chr16 6367254 . G GTTTTGT 0 PASS DP=59;GPV=1;SPV=0.0019606;SS=2;SSC=27;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:37:15,17:6,9:9,8
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1215 chr16 6562757 . T A 0 PASS DP=53;GPV=1;SPV=0.0043971;SS=2;SSC=23;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:17,6:9,1:8,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1216 chr16 8563144 . AG A 0 PASS DP=65;GPV=1;SPV=0.024978;SS=2;SSC=16;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:27:19,8:13,5:6,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1217 chr16 9019654 . T A 0 PASS DP=45;GPV=1;SPV=0.084902;SS=2;SSC=10;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:25:21,4:13,2:8,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1218 chr16 9199895 . GTCCT G 0 PASS DP=22;GPV=1;SPV=0.034965;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:10:2,5:2,2:0,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1219 chr16 10612629 . A AG 0 PASS DP=44;GPV=1;SPV=0.039138;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:24:19,5:9,2:10,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1220 chr16 11067187 . TTG T 0 PASS DP=38;GPV=1;SPV=0.13514;SS=2;SSC=8;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:20:17,3:9,2:8,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1221 chr16 11505470 . T C 0 PASS DP=30;GPV=1;SPV=0.029563;SS=2;SSC=15;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:9,7:6,2:3,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1222 chr16 11712929 . A AACACACACACACAC 0 PASS DP=22;GPV=1;SPV=0.045113;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:11:7,4:3,2:4,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1223 chr16 12105223 . C T 0 PASS DP=24;GPV=1;SPV=0.10145;SS=2;SSC=9;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:8:6,2:0,0:6,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1224 chr16 12380394 . C A 0 PASS DP=17;GPV=1;SPV=0.20588;SS=2;SSC=6;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:8:6,2:0,0:6,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1225 chr16 12817263 . CT C 0 PASS DP=24;GPV=1;SPV=0.034325;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:12:6,6:2,3:4,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1226 chr16 14360253 . C CCA 0 PASS DP=38;GPV=1;SPV=0.00026837;SS=2;SSC=35;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:5,11:3,8:2,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1227 chr16 14978118 . G A 0 PASS DP=112;GPV=1;SPV=0.049005;SS=2;SSC=13;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:50:42,8:28,7:14,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1228 chr16 15164208 . A ATTTTTTT 0 PASS DP=28;GPV=1;SPV=0.037926;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:14:4,5:1,1:3,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1229 chr16 15175445 . G A 0 PASS DP=90;GPV=1;SPV=0.039721;SS=2;SSC=14;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:47:35,12:13,7:22,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1230 chr16 15857202 . T C 0 PASS DP=52;GPV=1;SPV=0.022078;SS=2;SSC=16;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:26:18,6:14,4:4,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1231 chr16 15861496 . A G 0 PASS DP=34;GPV=1;SPV=0.098383;SS=2;SSC=10;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:9,5:5,3:4,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1232 chr16 16139611 . C CAA 0 PASS DP=31;GPV=1;SPV=0.037681;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:8,7:4,6:4,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1233 chr16 16274259 . T TTGGA 0 PASS DP=57;GPV=1;SPV=0.038169;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:22:15,7:5,3:10,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1234 chr16 16462130 . G C 0 PASS DP=40;GPV=1;SPV=0.0070044;SS=2;SSC=21;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:21:12,9:7,7:5,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1235 chr16 16464052 . G GTGTGTT 0 PASS DP=48;GPV=1;SPV=0.015379;SS=2;SSC=18;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:22:17,5:4,2:13,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1236 chr16 16602352 . T G 0 PASS DP=40;GPV=1;SPV=8.1261e-05;SS=2;SSC=40;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:25:10,15:8,10:2,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1237 chr16 16918059 . C T 0 PASS DP=61;GPV=1;SPV=3.3463e-07;SS=2;SSC=64;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:29:13,16:8,7:5,9
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1238 chr16 17044323 . C T 0 PASS DP=21;GPV=1;SPV=0.082707;SS=2;SSC=10;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:12:8,4:2,3:6,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1239 chr16 18121796 . GGTTT G 0 PASS DP=83;GPV=1;SPV=0.037048;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:49:43,6:22,5:21,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1240 chr16 18130476 . TAAAAAA T 0 PASS DP=27;GPV=1;SPV=0.018634;SS=2;SSC=17;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:13:7,5:2,2:5,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1241 chr16 18144826 . CT C 0 PASS DP=26;GPV=1;SPV=0.033948;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:7,8:4,5:3,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1242 chr16 19101995 . CTTTT C 0 PASS DP=22;GPV=1;SPV=0.031674;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:11:3,5:3,3:0,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1243 chr16 19162689 . C T 0 PASS DP=54;GPV=1;SPV=0.02313;SS=2;SSC=16;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:22:18,4:10,1:8,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1244 chr16 20195336 . A AATTT 0 PASS DP=38;GPV=1;SPV=0.01192;SS=2;SSC=19;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:17:9,8:3,3:6,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1245 chr16 20295279 . C CTT 0 PASS DP=23;GPV=1;SPV=0.00761;SS=2;SSC=21;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:13:2,8:1,7:1,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1246 chr16 20489820 . C T 0 PASS DP=55;GPV=1;SPV=0.028251;SS=2;SSC=15;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:28:23,5:11,2:12,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1247 chr16 20545378 . G A 0 PASS DP=60;GPV=1;SPV=0.0022994;SS=2;SSC=26;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:27:20,7:15,4:5,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1248 chr16 20596673 . G A 0 PASS DP=74;GPV=1;SPV=0.085094;SS=2;SSC=10;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:46:41,5:26,1:15,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1249 chr16 21269193 . G T 0 PASS DP=38;GPV=1;SPV=0.010026;SS=2;SSC=19;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:15,8:9,4:6,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1250 chr16 21307622 . GTATATA G 0 PASS DP=43;GPV=1;SPV=0.0055997;SS=2;SSC=22;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:24:7,9:2,4:5,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1251 chr16 21354148 . C T 0 PASS DP=63;GPV=1;SPV=0.011503;SS=2;SSC=19;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:28:21,7:12,1:9,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1252 chr16 22469165 . C T 0 PASS DP=39;GPV=1;SPV=0.022366;SS=2;SSC=16;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:23:14,9:7,4:7,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1253 chr16 22553505 . A G 0 PASS DP=77;GPV=1;SPV=0.023251;SS=2;SSC=16;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:31:27,4:18,3:9,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1254 chr16 22632007 . CTATA C 0 PASS DP=43;GPV=1;SPV=0.01174;SS=2;SSC=19;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:29:11,9:5,6:6,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1255 chr16 23875759 . T C 0 PASS DP=58;GPV=1;SPV=0.021895;SS=2;SSC=16;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:31:23,8:9,6:14,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1256 chr16 24479358 . T C 0 PASS DP=24;GPV=1;SPV=0.13043;SS=2;SSC=8;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:9:7,2:4,1:3,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1257 chr16 24579241 . G GTTTTTT 0 PASS DP=43;GPV=1;SPV=0.19016;SS=2;SSC=7;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:32:25,5:20,3:5,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1258 chr16 26887122 . G A 0 PASS DP=28;GPV=1;SPV=0.16374;SS=2;SSC=7;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:9:6,2:6,1:0,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1259 chr16 28162560 . A AT 0 PASS DP=52;GPV=1;SPV=0.085726;SS=2;SSC=10;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:32:27,5:17,2:10,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1260 chr16 29482918 . T G 0 PASS DP=26;GPV=1;SPV=0.12174;SS=2;SSC=9;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:12,4:0,0:12,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1261 chr16 29648003 . T TTG 0 PASS DP=25;GPV=1;SPV=0.026006;SS=2;SSC=15;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:11:5,4:2,2:3,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1262 chr16 30032642 . GT G 0 PASS DP=33;GPV=1;SPV=0.034545;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:10,6:7,3:3,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1263 chr16 30342200 . A AT 0 PASS DP=25;GPV=1;SPV=0.02253;SS=2;SSC=16;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:10:5,5:3,3:2,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1264 chr16 32125849 . GT G 0 PASS DP=80;GPV=1;SPV=0.0053747;SS=2;SSC=22;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:35:27,8:15,4:12,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1265 chr16 32176170 . C A 0 PASS DP=19;GPV=1;SPV=0.21053;SS=2;SSC=6;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:9:7,2:7,2:0,0
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1266 chr16 32465038 . G A 0 PASS DP=73;GPV=1;SPV=0.021299;SS=2;SSC=16;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:41:30,11:15,3:15,8
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1267 chr16 32837836 . G C 0 PASS DP=230;GPV=1;SPV=0.021664;SS=2;SSC=16;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:129:106,23:69,20:37,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1268 chr16 32838865 . A G 0 PASS DP=312;GPV=1;SPV=0.024159;SS=2;SSC=16;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:165:146,19:81,14:65,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1269 chr16 32839745 . G A 0 PASS DP=189;GPV=1;SPV=0.0027228;SS=2;SSC=25;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:95:80,15:47,9:33,6
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1270 chr16 33049073 . GA G 0 PASS DP=45;GPV=1;SPV=0.18393;SS=2;SSC=7;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:30:26,4:21,1:5,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1271 chr16 33506889 . TAAAAAA T 0 PASS DP=40;GPV=1;SPV=0.038556;SS=2;SSC=14;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:13,6:8,4:5,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1272 chr16 33543309 . C G 0 PASS DP=154;GPV=1;SPV=0.024242;SS=2;SSC=16;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:65:53,12:21,8:32,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1273 chr16 33912493 . T C 0 PASS DP=88;GPV=1;SPV=0.013578;SS=2;SSC=18;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:41:32,9:17,1:15,8
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1274 chr16 34585666 . C A 0 PASS DP=7755;GPV=1;SPV=0.025427;SS=2;SSC=15;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:3857:3455,402:2115,221:1340,181
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1275 chr16 34811099 . G A 0 PASS DP=66;GPV=1;SPV=0.0003763;SS=2;SSC=34;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:37:25,12:13,4:12,8
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1276 chr16 35340267 . C A 0 PASS DP=57;GPV=1;SPV=4.1874e-05;SS=2;SSC=43;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:26:15,11:8,6:7,5
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1277 chr16 37852470 . G T 0 PASS DP=229;GPV=1;SPV=0.029413;SS=2;SSC=15;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:116:99,17:30,5:69,12
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1278 chr16 37878930 . C T 0 PASS DP=20;GPV=1;SPV=0.043344;SS=2;SSC=13;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:10:6,4:6,4:0,0
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1279 chr16 46460582 . A G 0 PASS DP=129;GPV=1;SPV=0.023263;SS=2;SSC=16;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:67:52,15:25,12:27,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1280 chr16 48416181 . T A 0 PASS DP=49;GPV=1;SPV=0.047619;SS=2;SSC=13;SOMATIC GT:GQ:DP:AD:ADF:ADR 1/1:.:21:0,2:0,2:0,0
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1281 chr16 49058614 . AT A 0 PASS DP=25;GPV=1;SPV=0.27198;SS=2;SSC=5;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:13:8,4:4,2:4,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1282 chr16 49702923 . A G 0 PASS DP=68;GPV=1;SPV=0.064294;SS=2;SSC=11;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:35:31,4:9,2:22,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1283 chr16 50938942 . C T 0 PASS DP=73;GPV=1;SPV=4.0799e-05;SS=2;SSC=43;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:39:25,14:14,6:11,8
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1284 chr16 51663775 . G T 0 PASS DP=69;GPV=1;SPV=5.9786e-05;SS=2;SSC=42;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:36:23,13:7,3:16,10
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1285 chr16 52826730 . AGT A 0 PASS DP=31;GPV=1;SPV=0.021672;SS=2;SSC=16;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:15:5,5:2,3:3,2
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1286 chr16 53403333 . G C 0 PASS DP=60;GPV=1;SPV=0.0021291;SS=2;SSC=26;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:19:14,5:8,2:6,3
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1287 chr16 53551675 . CAAA C 0 PASS DP=29;GPV=1;SPV=0.012836;SS=2;SSC=18;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:16:7,8:2,7:5,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1288 chr16 54680831 . A ATACATGTATGTG 0 PASS DP=26;GPV=1;SPV=0.091949;SS=2;SSC=10;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:18:11,6:3,2:8,4
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1289 chr16 55472560 . TAAAAAAAAA T 0 PASS DP=21;GPV=1;SPV=0.10784;SS=2;SSC=9;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:12:7,4:5,3:2,1
aea952be68cb "planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mutational_patterns commit cd8f633245d53cf47eaf860a4e0ae8d806c34419"
artbio
parents:
diff changeset
1290 chr16 56300008 . C CGTGT 0 PASS DP=40;GPV=1;SPV=0.040876;SS=2;SSC=13;INDEL;SOMATIC GT:GQ:DP:AD:ADF:ADR 0/1:.:24:15,8:7,4:8,4