Mercurial > repos > artbio > small_rna_signatures

comparison overlapping_reads.xml @ 3:4d9682bd3a6b draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/small_rna_signatures commit 96ed5824190aff281cc3aa47dc60fc66aac41db3
author artbio
date Sat, 02 Sep 2017 06:35:15 -0400
parents 320e06bf99b9
children 20d28cfdeefe
comparison
equal deleted inserted replaced
2:320e06bf99b9 3:4d9682bd3a6b
1 <tool id="overlapping_reads" name="Get overlapping reads" version="0.9.1"> 1 <tool id="overlapping_reads" name="Get overlapping reads" version="0.9.2">
2 <description /> 2 <description />
3 <requirements> 3 <requirements>
4 <requirement type="package" version="0.11.2.1=py27_0">pysam</requirement> 4 <requirement type="package" version="0.11.2.1=py27_0">pysam</requirement>
5 </requirements> 5 </requirements>
6 <stdio> 6 <stdio>
36 <param name="mintarget" value="23" /> 36 <param name="mintarget" value="23" />
37 <param name="maxtarget" value="29" /> 37 <param name="maxtarget" value="29" />
38 <param name="overlap" value="10" /> 38 <param name="overlap" value="10" />
39 <output file="paired.fa" ftype="fasta" name="output" /> 39 <output file="paired.fa" ftype="fasta" name="output" />
40 </test> 40 </test>
41 <test>
42 <param ftype="bam" name="input" value="sr_bowtie.bam" />
43 <param name="minquery" value="20" />
44 <param name="maxquery" value="22" />
45 <param name="mintarget" value="23" />
46 <param name="maxtarget" value="29" />
47 <param name="overlap" value="10" />
48 <output file="paired_2.fa" ftype="fasta" name="output" />
49 </test>
41 </tests> 50 </tests>
42 <help> 51 <help>
43 52
44 **What it does** 53 **What it does**
45 54
50 59
51 .. _Antoniewski (2014): https://link.springer.com/protocol/10.1007%2F978-1-4939-0931-5_12 60 .. _Antoniewski (2014): https://link.springer.com/protocol/10.1007%2F978-1-4939-0931-5_12
52 61
53 **Input** 62 **Input**
54 63
55 A **sorted** BAM alignment file. 64 *A **sorted** BAM alignment file.*
65
66 *Query and target sizes:*
67
68 The algorithm search for each *query* reads (of specified size) in the bam alignment if
69 there are *target* reads (of specified size) that align on the opposite strand with a 10 nt
70 overlap.
71
72 Searching query reads of 20-22 nt that overlap by 10 nt with target
73 reads of 23-29 nt is different from searching query reads of 23-29 nt that overlap by 10 nt
74 with target reads of 20-22 nt. i.e, searching for siRNAs that pair with piRNAs is distinct
75 from searching for siRNAs that pairs with piRNAs, although of course the number of possibly
76 formed piRNA/siRNA pairs is the same as the number of possibly formed siRNA/piRNA pairs.
77
78 *Overlap*
79 The number of nucleotides by which the pairs of sequences will overlap
80
81
56 82
57 **Outputs** 83 **Outputs**
58 84
59 a fasta file of pairable reads such as : 85 a fasta file of pairable reads such as :
60 86
61 >FBgn0000004_17.6|5839|R|26 87 >FBgn0000004_17.6|5855|F|23|n=1
88
89 TTGACGAAAATGATCGAGTGGAT
90
91 >FBgn0000004_17.6|5839|R|26|n=1
62 92
63 TTTTCGTCAATTGTGCCAAATAGGTA 93 TTTTCGTCAATTGTGCCAAATAGGTA
64 94
65 >FBgn0000004_17.6|5855|F|23 95 where FBgn0000004_17.6 stands for the chromosome, 5839 stands for the 1-based read position,
96 R stand for reverse strand (F forward strand), 26 stands for the size of the sequence and
97 n=1 stands for the number of reads of the sequence in the dataset.
66 98
67 TTGACGAAAATGATCGAGTGGAT 99 the second sequence in this example corresponds to 1 read that overlap by 10 nt with
68 100 1 read of the first sequence.
69 where FBgn0000004_17.6 stands for the chromosome, 5839 stands for the 1-based read position,
70 R stand for reverse strand (F forward strand) and 26 stands for the size of the read.
71
72 the second sequence in this example is a read that overlap by 10 nt with the first read.
73 101
74 </help> 102 </help>
75 <citations> 103 <citations>
76 <citation type="doi">10.1007/978-1-4939-0931-5_12</citation> 104 <citation type="doi">10.1007/978-1-4939-0931-5_12</citation>
77 </citations> 105 </citations>