diff overlapping_reads.xml @ 1:6f1378738798 draft

planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/small_rna_signatures commit 6133bb114c76a795fa12a4a11edb1a8b80fd104d

--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/overlapping_reads.xml	Tue Aug 29 20:02:15 2017 -0400
@@ -0,0 +1,78 @@
+<tool id="overlapping_reads" name="Get overlapping reads" version="0.9.0">
+    <description />
+    <requirements>
+        <requirement type="package" version="0.11.2.1=py27_0">pysam</requirement>
+    </requirements>
+    <stdio>
+        <exit_code range="1:" level="fatal" description="Tool exception" />
+    </stdio>
+      <command detect_errors="exit_code"><![CDATA[
+        samtools index '$input' &&
+        python '$__tool_directory__'/overlapping_reads.py
+           --input '$input'
+           --minquery '$minquery'
+           --maxquery '$maxquery'
+           --mintarget '$mintarget'
+           --maxtarget '$maxtarget'
+           --overlap '$overlap'
+           --output '$output'
+    ]]></command>
+    <inputs>
+        <param format="bam" label="Compute signature from this bowtie standard output" name="input" type="data" />
+        <param help="'23' = 23 nucleotides" label="Min size of query small RNAs" name="minquery" size="3" type="integer" value="23" />
+        <param help="'29' = 29 nucleotides" label="Max size of query small RNAs" name="maxquery" size="3" type="integer" value="29" />
+        <param help="'23' = 23 nucleotides" label="Min size of target small RNAs" name="mintarget" size="3" type="integer" value="23" />
+        <param help="'29' = 29 nucleotides" label="Max size of target small RNAs" name="maxtarget" size="3" type="integer" value="29" />
+        <param help="'10' = 10 nucleotides overlap" label="Overlap (in nt)" name="overlap" size="3" type="integer" value="10" />
+    </inputs>
+    <outputs>
+        <data format="fasta" label="pairable reads" name="output" />
+    </outputs>
+    <tests>
+        <test>
+            <param ftype="bam" name="input" value="sr_bowtie.bam" />
+            <param name="minquery" value="23" />
+            <param name="maxquery" value="29" />
+            <param name="mintarget" value="23" />
+            <param name="maxtarget" value="29" />
+            <param name="overlap" value="10" />
+            <output file="paired.fa" ftype="fasta" name="output" />
+        </test>
+    </tests>
+    <help>
+
+**What it does**
+
+Extract reads with overlap signatures of the specified overlap (in nt) and 
+return a fasta file of these "pairable" reads.
+
+See `Antoniewski (2014)`_ for background and details
+
+.. _Antoniewski (2014): https://link.springer.com/protocol/10.1007%2F978-1-4939-0931-5_12
+
+**Input**
+
+A **sorted** BAM alignment file.
+
+**Outputs**
+
+a fasta file of pairable reads such as :
+
+>FBgn0000004_17.6|5839|R|26
+
+TTTTCGTCAATTGTGCCAAATAGGTA
+
+>FBgn0000004_17.6|5855|F|23
+
+TTGACGAAAATGATCGAGTGGAT
+
+where FBgn0000004_17.6 stands for the chromosome, 5839 stands for the 1-based read position, 
+R stand for reverse strand (F forward strand) and 26 stands for the size of the read.
+
+the second sequence in this example is a read that overlap by 10 nt with the first read.
+
+        </help>
+    <citations>
+            <citation type="doi">10.1007/978-1-4939-0931-5_12</citation>
+    </citations>
+</tool>