Mercurial > repos > artbio > small_rna_signatures
diff overlapping_reads.xml @ 5:a7fd04208764 draft
planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/small_rna_signatures commit 24d44a9b7ec9db4dce3d839b597eea2b1be34adb
author | artbio |
---|---|
date | Sat, 09 Sep 2017 11:57:39 -0400 |
parents | 20d28cfdeefe |
children | 4da23f009c9e |
line wrap: on
line diff
--- a/overlapping_reads.xml Fri Sep 08 04:44:22 2017 -0400 +++ b/overlapping_reads.xml Sat Sep 09 11:57:39 2017 -0400 @@ -1,4 +1,4 @@ -<tool id="overlapping_reads" name="Get overlapping reads" version="0.9.3"> +<tool id="overlapping_reads" name="Get overlapping reads" version="0.9.4"> <description /> <requirements> <requirement type="package" version="0.11.2.1=py27_0">pysam</requirement> @@ -47,6 +47,24 @@ <param name="overlap" value="10" /> <output file="paired_2.fa" ftype="fasta" name="output" /> </test> + <test> + <param ftype="bam" name="input" value="sr_bowtie.bam" /> + <param name="minquery" value="23" /> + <param name="maxquery" value="29" /> + <param name="mintarget" value="20" /> + <param name="maxtarget" value="22" /> + <param name="overlap" value="10" /> + <output file="paired_3.fa" ftype="fasta" name="output" /> + </test> + <test> + <param ftype="bam" name="input" value="sr_bowtie.bam" /> + <param name="minquery" value="20" /> + <param name="maxquery" value="22" /> + <param name="mintarget" value="20" /> + <param name="maxtarget" value="22" /> + <param name="overlap" value="10" /> + <output file="paired_4.fa" ftype="fasta" name="output" /> + </test> </tests> <help> @@ -70,10 +88,12 @@ overlap. Searching query reads of 20-22 nt that overlap by 10 nt with target -reads of 23-29 nt is different from searching query reads of 23-29 nt that overlap by 10 nt -with target reads of 20-22 nt. i.e, searching for siRNAs that pair with piRNAs is distinct -from searching for siRNAs that pairs with piRNAs, although of course the number of possibly -formed piRNA/siRNA pairs is the same as the number of possibly formed siRNA/piRNA pairs. +reads of 23-29 nt is equivalent to searching query reads of 23-29 nt that overlap by 10 nt +with target reads of 20-22 nt. i.e, searching for siRNAs that pair with piRNAs is equivalent +to searching for siRNAs that pairs with piRNAs. In contrast, searching query reads of 20-22 nt +that overlap by 10 nt with target reads of 23-29 nt is different from searching query reads of +23-29 nt that overlap by 10 nt with target reads of 23-29 nt, since the number of "heterotypic" +pairs of reads is likely to be different from the number of "homotypic" pairs of reads. *Overlap* The number of nucleotides by which the pairs of sequences will overlap @@ -84,17 +104,18 @@ a fasta file of pairable reads such as : ->FBgn0000004_17.6|5855|F|23|n=1 +>FBgn0000004_17.6|coord=5839|strand -|size=26|nreads=1 + +TTTTCGTCAATTGTGCCAAATAGGTA + +>FBgn0000004_17.6|coord=5855|strand +|size=23|nreads=1 TTGACGAAAATGATCGAGTGGAT ->FBgn0000004_17.6|5839|R|26|n=1 - -TTTTCGTCAATTGTGCCAAATAGGTA where FBgn0000004_17.6 stands for the chromosome, 5839 stands for the 1-based read position, -R stand for reverse strand (F forward strand), 26 stands for the size of the sequence and -n=1 stands for the number of reads of the sequence in the dataset. +'strand -' stands for lower strand of chromosome, 26 stands for the size of the sequence and +nreads=1 stands for the number of reads of the sequence in the dataset. the second sequence in this example corresponds to 1 read that overlap by 10 nt with 1 read of the first sequence.