# HG changeset patch
# User bgruening
# Date 1684849387 0
# Node ID f7c0a0030254b3923ac4ba3f3c898c744d7601ea

planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/agat commit 0851e9e6d46223a8233c56f3b0bcf14e19d63916

diff -r 000000000000 -r f7c0a0030254 agat.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/agat.xml	Tue May 23 13:43:07 2023 +0000
@@ -0,0 +1,374 @@
+<tool id="agat" name="AGAT" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@">
+    <description>GTF/GFF analysis toolkit</description>
+    <macros>
+        <import>macros.xml</import>
+    </macros>
+    <expand macro="biotools"/>
+    <expand macro="requirements" />
+    <version_command>agat_sq_stat_basic.pl --version</version_command>
+    <command detect_errors="exit_code"><![CDATA[
+        #if $tool.selector == 'fix'
+            @input_annotation_single@
+            agat_convert_sp_gxf2gxf.pl -gff $input_annotation --output 'output.gff' &&
+            cat 'output.gff' > '${annotation_gff}'
+        #else if $tool.selector == 'convert_GFF2GTF'
+            @input_annotation_single@
+            agat_convert_sp_gff2gtf.pl --gff $input_annotation --gtf_version $tool.gtf_version --output 'output.gtf' &&
+            cat 'output.gtf' > '${annotation_gtf}'
+        #else if $tool.selector == 'convert_GTF2GFF'
+            @input_annotation_single@
+            agat_convert_sp_gxf2gxf.pl --gff $input_annotation --output 'output.gff' &&
+            cat 'output.gff' > '${annotation_gff}'
+        #else if $tool.selector == 'compare'
+            @input_annotation_double@
+            agat_sp_compare_two_annotations.pl --gff1 $input1 --gff2 $input2 --output 'temp_output' &&
+            cat 'temp_output' > '${stats_output}'
+        #else if $tool.selector == 'extract'
+            @input_annotation_single@
+            @input_reference@
+            agat_sp_extract_sequences.pl
+            --gff $input_annotation
+            -f $ref_genome
+            $tool.mrna
+            $tool.cdna
+            $tool.clean_final_stop
+            $tool.clean_internal_stop
+            #if $tool.downstream
+                --downstream $tool.downstream
+            #end if
+            $tool.full
+            $tool.keep_attributes
+            $tool.keep_parent_attributes
+            $tool.merge
+            $tool.plus_strand_only
+            $tool.protein
+            $tool.remove_orf_offset
+            $tool.revcomp
+            $tool.split
+            #if $tool.type
+                --type $tool.type
+            #end if
+            #if $tool.upstream
+                --upstream $tool.upstream
+            #end if
+            --output '${sequence_output}'
+        #else if $tool.selector == 'functional_analysis'
+            @input_annotation_single@
+            @input_reference@
+            mkdir -p './statistics' &&
+            agat_sp_statistics.pl
+            --gff $input_annotation
+            --gs $ref_genome
+            --output 'temp_output' &&
+            cat 'temp_output' > '$stats_output'
+        #else if  $tool.selector == 'merge_annotations'
+            @input_annotation_double@
+            agat_sp_merge_annotations.pl -gff $input1 --gff $input2 --output 'temp_output' &&
+             cat 'temp_output' > '${annotation_gff}'
+        #else if $tool.selector == 'annotation_statistics'
+            @input_annotation_single@
+            @input_reference@
+            agat_sp_statistics.pl --gff $input_annotation --gs $ref_genome -d --output 'temp_output' &&
+            cat 'temp_output' > '$stats_output'
+        #else if $tool.selector == 'filter_feature_fasta'
+            @input_annotation_single@
+            @input_reference@
+            agat_sq_filter_feature_from_fasta.pl --gff $input_annotation --fasta $ref_genome --output 'temp_output' &&
+            cat 'temp_output' > '${features_filtered}'
+        #else if $tool.selector == 'complement'
+            @input_annotation_double@
+            agat_sp_complement_annotations.pl --ref $input1 --add $input2 --size_min $tool.size_min --output 'temp_output' &&
+            cat 'temp_output' > '${annotation_gff}'
+        #end if
+        ]]>
+    </command>
+    <inputs>
+        <conditional name="tool">
+            <param name="selector" type="select" label="AGAT tool selector" help="As AGAT is a toolkit, it contains a lot of tools. If any of them is missing, please contact the server admin.">
+                <option value="annotation_statistics">Annotation statistics (agat_sp_statistics.pl)</option>
+                <option value="compare">Compare annotation files (agat_sp_compare_two_annotations.pl)</option>
+                <option value="complement">Complement annotation file (agat_sp_complement_annotations.pl)</option>
+                <option value="extract">Extract sequences (agat_sp_extract_sequences.pl)</option>
+                <option value="convert_GFF2GTF">GFF to GTF format conversion (agat_convert_sp_gff2gtf.pl)</option>
+                <option value="convert_GTF2GFF">GTF to GFF3 format conversion (agat_convert_sp_gxf2gxf.pl)</option>
+                <option value="filter_feature_fasta">Filter annotation by sequence name (agat_sq_filter_feature_from_fasta.pl)</option>
+                <option value="fix">Fix and/or standarize GFF3 annotation file (agat_convert_sp_gxf2gxf.pl)</option>
+                <option value="functional_analysis">Functional analysis (agat_sp_functional_statistics.pl)</option>
+                <option value="merge_annotations">Merge annotations (agat_sp_merge_annotations.pl)</option>
+            </param>
+            <when value="annotation_statistics">
+                <expand macro="ANNOTATION_INPUT"/>
+                <expand macro="REFERENCE_FASTA"/>
+            </when>
+            <when value="compare">
+                <param argument="--gff1" name="input_annotation1" type="data" format="gff,gtf,gff3,gff3.gz" label="Annotation file 1" help="Input GTF/GFF file" />
+                <param argument="--gff2" name="input_annotation2" type="data" format="gff,gtf,gff3,gff3.gz" label="Annotation file 2" help="Input GTF/GFF file" />
+            </when>
+            <when value="extract">
+                <expand macro="ANNOTATION_INPUT"/>
+                <expand macro="REFERENCE_FASTA"/>
+                <param name="type" type="select" label="Type of feature to extract" optional="true" help="Define the feature you want to extract the sequence from.">
+                    <option value="gene">Gene</option>
+                    <option value="transcript">Transcript</option>
+                    <option value="exon">Exon</option>
+                    <option value="cds">CDS</option>
+                    <option value="trna">tRNA</option>
+                    <option value="three_prime_utr">3' UTR</option>
+                    <option value="five_prime_utr">5' UTR</option>
+                </param>
+                <param argument="--mrna" type="boolean" truevalue="--mrna" falsevalue="" checked="false" label="Extract mRNA sequences" help=" This extract the mrna 
+                    sequence (i.e transcribed sequence (devoid of introns, but containing untranslated exons))." />
+                <param argument="--cdna" type="boolean" truevalue="--cdna" falsevalue="" checked="false" label="Extract the cDNA sequence" 
+                    help=" This extract the cdna sequence (i.e reverse complement of the mRNA: transcribed sequence (devoid of introns, but 
+                    containing untranslated exons, then reverse complemented)." />
+                <param argument="--clean_final_stop" type="boolean" truevalue="--clean_final_stop" falsevalue="" checked="false" label="Clean final stop codons" 
+                    help=" This option allows removing the translation of the final stop codons that is represented by the '*' character. This character can be 
+                        disturbing for many programs (e.g interproscan)" />
+                <param argument="--clean_internal_stop" type="boolean" truevalue="--clean_internal_stop" falsevalue="" checked="false" label="Clean internal 
+                    stop codons" help="The Clean Internal Stop option allows replacing the translation of the stop codons present among the sequence that is 
+                    represented by the '*' character by . This character can be disturbing for many programs (e.g interproscan)" />
+                <param argument="--upstream" type="integer" min="0" value="" optional="true" label="Upstream nucleotides" help="It will take that number of nucleotide in more at the 5' extremity." />
+                <param argument="--downstream" type="integer" min="0" value="" optional="true" label="Downstream nucleotides" help="It will take that number of downstream nucleotides." />
+                <param argument="--full" type="boolean" truevalue="--full" falsevalue="" checked="false" label="Full" help="This option allows dealing 
+                    with feature that may span over several locations like CDS or exon, in order to extract the full sequence from the start extremity 
+                    of the first chunck to the end extremity of the last chunk. The use of that option with '--type exon' will extract the pre-mRNA 
+                    sequence (i.e with introns). Use of that option on CDS will give the pre-mRNA without the untraslated regions (UTRs). " />
+                <param argument="--keep_attributes" type="boolean" truevalue="--keep_attributes" falsevalue="" checked="false" label="Keep attributes" 
+                    help="The value of the attribute tags will be extracted from the feature type specified by the option --type and stored in the FASTA header." />
+                <param argument="--keep_parent_attributes" type="boolean" truevalue="--keep_parent_attributes" falsevalue="" checked="false" label="Keep parental attributes" 
+                    help="Keep parental attributes" />
+                <param argument="--merge" type="boolean" truevalue="--merge" falsevalue="" checked="false" label="Merge" help="By default, only features that span 
+                    several locations (e.g. CDS and utr can span over several exons) are merged together. In order to merge other type of features (e.g. exon) you 
+                    must activate this parameter." />
+                <param argument="--plus_strand_only" type="boolean" truevalue="--plus_strand_only" falsevalue="" checked="false" label="Plus strand only" help="By default 
+                    the extrated feature sequences from a minus strand is reverse complemented. Activating this option you will always get sequence from plus strand (not reverse complemented). " />
+                <param argument="--protein" type="boolean" truevalue="--protein" falsevalue="" checked="false" label="Protein" help="It will extract the sequence in amino acids." />
+                <param argument="--remove_orf_offset" type="boolean" truevalue="--remove_orf_offset" falsevalue="" checked="false" label="Remove ORF offset" help=" CDS can start with a phase different 
+                    from 0 when a gene model is fragmented. When asking for protein translation this (start) offset is trimmed out automatically. But when you extract CDS dna sequences, this (start) 
+                    offset is not removed by default. To remove it activate this option. If --upstream or --downstream option are used too, the (start) offset is trimmed first, then is added the piece 
+                    of sequence asked for." />
+                <param argument="--revcomp" type="boolean" truevalue="--revcomp" falsevalue="" checked="false" label="Reverse complement the extracted sequence" help="By default the extrated feature 
+                    sequences from a minus strand is reverse complemented. Consequently, for minus strand features that option will extract the sequences from plus strand from left to right." />
+                <param argument="--split" type="boolean" truevalue="--split" falsevalue="" checked="false" label="Split" help="By default, all features that span several locations (e.g. CDs and UTR can 
+                    span over several exons) are merge together to shape the biological feature (e.g. several CDS chuncks are merged to create the CDS in its whole). If you wish to extract all the chuncks 
+                    independently activate this option." />
+            </when>
+            <when value="convert_GFF2GTF">
+                <expand macro="ANNOTATION_INPUT" format="gff,gff3,gff3.gz"/>
+                <param argument="--gtf_version" type="select" label="GTF version">
+                    <option value="3">GTF v3 - 9 feature types accepted: gene, transcript, exon, CDS, Selenocysteine, start_codon, stop_codon, three_prime_utr and five_prime_utr</option>
+                    <option value="2.5">GTF v2.5 - 8 feature types accepted: gene, transcript, exon, CDS, UTR, start_codon, stop_codon and Selenocysteine</option>
+                    <option value="2.2">GTF v2.2 - 9 feature types accepted: CDS, start_codon, stop_codon, 5UTR, 3UTR, inter, inter_CNS, intron_CNS and exon</option>
+                    <option value="2.1">GTF v2.1 - 6 feature types accepted: CDS, start_codon, stop_codon, exon, 5UTR and 3UTR</option>
+                    <option value="2">GTF v2 - 4 feature types accepted: CDS, start_codon, stop_codon and exon</option>
+                    <option value="1">GTF v1 - 5 feature types accepted: CDS, start_codon, stop_codon, exon and intron</option>
+                    <option value="relax">Relax: all feature types are accepted.</option>
+                </param>
+            </when>
+            <when value="convert_GTF2GFF">
+                <expand macro="ANNOTATION_INPUT" format="gtf"/>
+            </when>
+            <when value="filter_feature_fasta">
+                <expand macro="ANNOTATION_INPUT" />
+                <expand macro="REFERENCE_FASTA"/>
+            </when>
+            <when value="fix">
+                <expand macro="ANNOTATION_INPUT" format="gff,gff3,gff3.gz"/>
+            </when>
+            <when value="functional_analysis">
+                <expand macro="ANNOTATION_INPUT" format="gff,gtf,gff3,gff3.gz"/>
+                <expand macro="REFERENCE_FASTA"/>
+            </when>
+            <when value="merge_annotations">
+                <param argument="--gff1" name="input_annotation1" type="data" format="gff,gtf,gff3,gff3.gz" label="Annotation file 1" help="Input GTF/GFF file" />
+                <param argument="--gff2" name="input_annotation2" type="data" format="gff,gtf,gff3,gff3.gz" label="Annotation file 2" help="Input GTF/GFF file" />
+            </when>
+            <when value="complement">
+                <param argument="--ref" name="input_annotation1" type="data" format="gff,gtf,gff3,gff3.gz" label="Reference annotaiton" help="Reference GTF/GFF file" />
+                <param argument="--add" name="input_annotation2" type="data" format="gff,gtf,gff3,gff3.gz" label="Annotation to complement" help="Annotation file you would like to use to complement the reference annotation." />
+                <param argument="--size_min" type="integer" min="0" value="0" label="Minimun CDS size" help="Option to keep the non-overlping gene only if the CDS size (in nucleotide) is over the minimum 
+                    size defined. Default = 0 that means all of them are kept." />
+            </when>
+        </conditional>
+    </inputs>
+    <outputs>
+        <data name="annotation_gff" format="gff" label="${tool.name} on ${on_string}: annotation file (GFF)">
+            <filter>tool['selector'] not in ['annotation_statistics','extract','functional_analysis','compare','convert_GFF2GTF','filter_feature_fasta']</filter>
+        </data>
+        <data name="annotation_gtf" format="gtf" label="${tool.name} on ${on_string}: annotation file (GTF)">
+            <filter>tool['selector'] == 'convert_GFF2GTF'</filter>
+        </data>
+        <data name="features_filtered" format="tabular" label="${tool.name} on ${on_string}: filtered results">
+            <filter>tool['selector'] == 'filter_feature_fasta'</filter>
+        </data>
+        <data name="sequence_output" format="fasta" label="${tool.name} on ${on_string}: FASTA file">
+            <filter>tool['selector'] =='extract'</filter>
+        </data>
+        <data name="stats_output" format="txt" label="${tool.name} on ${on_string}: stats file">
+            <filter>tool['selector'] in ['annotation_statistics','compare','functional_analysis']</filter>
+        </data>
+        <collection name="distribution_plots_wiso" type="list" label="${tool.name} on ${on_string}: distribution plots (with isoforms)">
+            <discover_datasets pattern="__designation_and_ext__" directory="temp_output_distribution_plots/with_isoforms" format="pdf"/>
+            <filter>tool['selector'] == 'annotation_statistics'</filter>
+        </collection>
+        <collection name="distribution_plots_woiso" type="list" label="${tool.name} on ${on_string}: distribution plots (without isoforms)">
+            <discover_datasets pattern="__designation_and_ext__" directory="temp_output_distribution_plots/without_isoforms" format="pdf"/>
+            <filter>tool['selector'] == 'annotation_statistics'</filter>
+        </collection>
+    </outputs>
+<tests>
+        <!-- Test 01: annotation statistics-->
+        <test expect_num_outputs="3">
+            <conditional name="tool">
+                <param name="selector" value="annotation_statistics"/>
+                <param name="gff" value="annotation.gtf" ftype="gtf"/>
+                <conditional name="reference_genome">
+                    <param name="source" value="history"/>
+                    <param name="history_item" value="genome.fasta.gz"/>
+                </conditional>
+            </conditional>
+            <output name="stats_output" file="test01_stats.txt" ftype="txt"/>
+            <output_collection name="distribution_plots_woiso" type="list" count="4">
+                <element name="transcriptClass_cds" file="test01_plot2.pdf" ftype="pdf" compare="sim_size" delta="100"/>
+            </output_collection>
+            <output_collection name="distribution_plots_wiso" type="list" count="4">
+                <element name="transcriptClass_cds" file="test01_plot1.pdf" ftype="pdf" compare="sim_size" delta="100"/>
+            </output_collection>
+        </test>
+        <!-- Test 02: extract sequences -->
+        <test expect_num_outputs="1">
+            <conditional name="tool">
+                <param name="selector" value="extract"/>
+                <param name="gff" value="annotation_small.gtf"/>
+                <conditional name="reference_genome">
+                    <param name="source" value="history"/>
+                    <param name="history_item" value="genome.fasta.gz"/>
+                </conditional>
+                <param name="type" value="gene"/>
+                <param name="upstream" value="10"/>
+                <param name="downstream" value="20"/>
+            </conditional>
+            <output name="sequence_output" file="test02.fasta" ftype="fasta"/>
+        </test>
+        <!-- Test 03: compare annotations -->
+        <test expect_num_outputs="1">
+            <conditional name="tool">
+                <param name="selector" value="compare"/>
+                <param name="input_annotation1" value="annotation.gtf"/>
+                <param name="input_annotation2" value="annotation_small.gtf"/>
+            </conditional>
+            <output name="stats_output" file="test03.txt" ftype="txt" lines_diff="2"/>
+        </test>
+        <!-- Test 04: comlement annotation -->
+        <test expect_num_outputs="1">
+            <conditional name="tool">
+                <param name="selector" value="complement"/>
+                <param name="input_annotation1" value="annotation_small.gtf" ftype="gtf"/>
+                <param name="input_annotation2" value="annotation_unique.gtf" ftype="gtf"/>
+                <param name="size_min" value="10"/>
+            </conditional>
+            <output name="annotation_gff" file="test04.gff" ftype="gff"/>
+        </test>
+        <!-- Test 05: Convert GFF2GTF -->
+        <test expect_num_outputs="1">
+            <conditional name="tool">
+                <param name="selector" value="convert_GFF2GTF"/>
+                <param name="gff" value="test04.gff" ftype="gff"/>
+                <param name="gtf_version" value="2"/>
+            </conditional>
+            <output name="annotation_gtf" file="test05.gtf" ftype="gtf"/>
+        </test>
+        <!-- Test 06: Convert GTF2GFF -->
+        <test expect_num_outputs="1">
+            <conditional name="tool">
+                <param name="selector" value="convert_GTF2GFF"/>
+                <param name="gff" value="annotation_small.gtf" ftype="gtf"/>
+            </conditional>
+            <output name="annotation_gff" file="test06.gff" ftype="gff"/>
+        </test>
+        <!-- Test 07: Filter feature FASTA -->
+        <test expect_num_outputs="1">
+            <conditional name="tool">
+                <param name="selector" value="filter_feature_fasta"/>
+                <param name="gff" value="annotation_small.gtf" ftype="gtf"/>
+                <conditional name="reference_genome">
+                    <param name="source" value="history"/>
+                    <param name="history_item" value="genome.fasta.gz"/>
+                </conditional>
+            </conditional>
+            <output name="features_filtered" file="test07.tabular" ftype="tabular"/>
+        </test>
+        <!-- Test 08: Fix annotation file -->
+        <test expect_num_outputs="1">
+            <conditional name="tool">
+                <param name="selector" value="fix"/>
+                <param name="gff" value="annotation_broken.gff" ftype="gff"/>
+            </conditional>
+            <output name="annotation_gff" file="annotation_fixed.gff" ftype="gff"/>
+            <assert_stdout>
+                <has_text text="2 exons created that were missing" />
+            </assert_stdout>
+        </test>
+        <!-- Test 09: Functional analysis -->
+        <test expect_num_outputs="1">
+            <conditional name="tool">
+                <param name="selector" value="functional_analysis"/>
+                <param name="gff" value="annotation_small.gtf"/>
+                <conditional name="reference_genome">
+                    <param name="source" value="history"/>
+                    <param name="history_item" value="genome.fasta.gz"/>
+                </conditional>
+            </conditional>
+            <output name="stats_output" file="test09.txt" ftype="txt"/>
+        </test>
+        <!-- Test 10: Merge annotations -->
+        <test expect_num_outputs="1">
+            <conditional name="tool">
+                <param name="selector" value="merge_annotations"/>
+                <param name="input_annotation1" value="annotation_small.gtf"/>
+                <param name="input_annotation2" value="annotation_unique.gtf"/>
+            </conditional>
+            <output name="annotation_gff" file="test10.gff" ftype="gff"/>
+        </test>
+        <!-- Test 11: Test compressed files -->
+        <test expect_num_outputs="1">
+            <conditional name="tool">
+                <param name="selector" value="fix"/>
+                <param name="gff" value="annotation_broken.gff.gz" ftype="gff"/>
+            </conditional>
+            <output name="annotation_gff" file="annotation_fixed.gff" ftype="gff"/>
+            <assert_stdout>
+                <has_text text="2 exons created that were missing" />
+            </assert_stdout>
+        </test>
+        <!-- Test 12:test indexed references -->
+        <test expect_num_outputs="1">
+            <conditional name="tool">
+                <param name="selector" value="extract"/>
+                <param name="gff" value="phix174.gff"/>
+                <conditional name="reference_genome">
+                    <param name="source" value="indexed"/>
+                    <param name="index" value="phix174"/>
+                </conditional>
+                <param name="type" value="gene"/>
+            </conditional>
+            <assert_stdout>
+                <has_text text="Job done" />
+            </assert_stdout>
+        </test>
+    </tests>
+    <help><![CDATA[
+
+.. class:: infomark
+
+**Purpose**
+
+AGAT a GFF/GTF toolkit allowing you to perform almost everything you might want to achieve ^^
+
+AGAT has the power to check, fix, pad missing information (features/attributes) of any kind of GTF and GFF to create complete, sorted and standardised gff3 format. 
+Over the years it has been enriched by many many tools to perform just about any tasks that is possible related to GTF/GFF format files (sanitizing, conversions, 
+merging, modifying, filtering, FASTA sequence extraction, adding information, etc). Comparing to other methods AGAT is robust to even the most despicable GTF/GFF files.
+
+]]></help>
+    <expand macro="citations"/>
+</tool>
diff -r 000000000000 -r f7c0a0030254 macros.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/macros.xml	Tue May 23 13:43:07 2023 +0000
@@ -0,0 +1,63 @@
+<macros>
+    <token name="@TOOL_VERSION@">1.1.0</token>
+    <token name="@VERSION_SUFFIX@">0</token>
+    <xml name="requirements">
+        <requirements>
+            <requirement type="package" version="@TOOL_VERSION@">agat</requirement>
+            <requirement type="package" version="0.34">perl-statistics-r</requirement>
+        </requirements>
+    </xml>
+    <xml name="biotools">
+        <xrefs>
+            <xref type="bio.tools">agat</xref>
+        </xrefs>
+    </xml>
+    <xml name="citations">
+        <citations>
+            <citation type="doi">10.5281/zenodo.3552717</citation>
+        </citations>
+    </xml>
+    <xml name="ANNOTATION_INPUT" token_format="gff,gtf,gff3,gff3.gz">
+        <param argument="--gff" type="data" format="@FORMAT@" label="Annotation file" help="Input GTF/GFF file" />
+    </xml>
+
+    <xml name="REFERENCE_FASTA">
+        <conditional name="reference_genome">
+            <param name="source" type="select" label="Source for the reference genome" help="Built-in references were created using default options.">
+                <option value="indexed" selected="true">Use a built-in genome</option>
+                <option value="history" selected="true">Use a genome from history</option>
+            </param>
+            <when value="indexed">
+                <param name="index" type="select" label="Select a reference genome" help="If your genome of interest is not listed, contact the Galaxy team.">
+                    <options from_data_table="fasta_indexes">
+                        <filter type="sort_by" column="2" />
+                        <validator type="no_options" message="No genomes are available for the selected input dataset" />
+                    </options>
+                </param>
+            </when>
+            <when value="history">
+                <param name="history_item" type="data" format="fasta" label="Reference genome" help="A reference genome in FASTA format" />
+            </when>
+        </conditional>
+    </xml>
+    <token name="@input_annotation_single@"><![CDATA[
+        #set $input_annotation = 'annotation.' + str($tool.gff.ext)
+        ln -s '${tool.gff}' $input_annotation &&
+    ]]></token>
+    <token name="@input_reference@"><![CDATA[
+        #if $tool.reference_genome.source == 'history':
+            #set $ref_genome = 'reference.fasta'
+            ln -s -f '${tool.reference_genome.history_item}' $ref_genome &&
+        #else:
+            #set $ref_genome = $tool.reference_genome.index.fields.path
+        #end if
+    ]]></token>
+    <token name="@input_annotation_double@"><![CDATA[
+        #set $input1 = 'annotation1.' + str($tool.input_annotation1.ext)
+        #set $input2 = 'annotation2.' + str($tool.input_annotation2.ext)
+        ln -s '${tool.input_annotation1}' $input1 &&
+        ln -s '${tool.input_annotation2}' $input2 &&
+    ]]></token>
+    
+
+</macros>
diff -r 000000000000 -r f7c0a0030254 test-data/annotation.gtf
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/annotation.gtf	Tue May 23 13:43:07 2023 +0000
@@ -0,0 +1,1522 @@
+##gtf-version 3
+#!gff-spec-version 1.21
+#!processor NCBI annotwriter
+#!genome-build ASM301845v1
+#!genome-build-accession NCBI_Assembly:GCF_003018455.1
+#!annotation-date 05/25/2022 04:54:31
+#!annotation-source NCBI RefSeq 
+##sequence-region NZ_CP027599.1 1 5942969
+##species https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=562
+NZ_CP027601.1	RefSeq	gene	1	542	.	-	.	gene_id "nbis-pseudogene-254"; ID "nbis-pseudogene-254"; Name "C7A06_RS33350"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33350"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "1";
+NZ_CP027601.1	RefSeq	transcript	1	542	.	-	.	gene_id "nbis-pseudogene-254"; transcript_id "gene-C7A06_RS33350"; ID "gene-C7A06_RS33350"; Name "C7A06_RS33350"; Parent "nbis-pseudogene-254"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33350"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "1";
+NZ_CP027601.1	Protein Homology	exon	1	542	.	-	.	gene_id "nbis-pseudogene-254"; transcript_id "gene-C7A06_RS33350"; ID "nbis-exon-5902"; Note "frameshifted; incomplete; missing C-terminus"; Parent "gene-C7A06_RS33350"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001066419.1"; locus_tag "C7A06_RS33350"; partial "true"; product "IS66 family transposase zinc-finger binding domain-containing protein"; pseudo "true"; start_range "." "1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	1	542	.	-	0	gene_id "nbis-pseudogene-254"; transcript_id "gene-C7A06_RS33350"; ID "cds-C7A06_RS33350"; Note "frameshifted; incomplete; missing C-terminus"; Parent "gene-C7A06_RS33350"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001066419.1"; locus_tag "C7A06_RS33350"; partial "true"; product "IS66 family transposase zinc-finger binding domain-containing protein"; pseudo "true"; start_range "." "1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	562	909	.	-	.	gene_id "nbis-gene-5648"; ID "nbis-gene-5648"; Name "tnpB"; gbkey "Gene"; gene "tnpB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33355";
+NZ_CP027601.1	RefSeq	transcript	562	909	.	-	.	gene_id "nbis-gene-5648"; transcript_id "gene-C7A06_RS33355"; ID "gene-C7A06_RS33355"; Name "tnpB"; Parent "nbis-gene-5648"; gbkey "Gene"; gene "tnpB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33355"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	562	909	.	-	.	gene_id "nbis-gene-5648"; transcript_id "gene-C7A06_RS33355"; Dbxref "Genbank:WP_000631725.1"; ID "nbis-exon-5903"; Name "WP_000631725.1"; Note "TnpB, as the term is used for proteins encoded by IS66 family insertion elements, is considered an accessory protein, since TnpC, encoded by a neighboring gene, is a DDE family transposase."; Parent "gene-C7A06_RS33355"; gbkey "CDS"; gene "tnpB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858152.1"; locus_tag "C7A06_RS33355"; product "IS66 family insertion sequence element accessory protein TnpB"; protein_id "WP_000631725.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	562	909	.	-	0	gene_id "nbis-gene-5648"; transcript_id "gene-C7A06_RS33355"; Dbxref "Genbank:WP_000631725.1"; ID "cds-WP_000631725.1"; Name "WP_000631725.1"; Note "TnpB, as the term is used for proteins encoded by IS66 family insertion elements, is considered an accessory protein, since TnpC, encoded by a neighboring gene, is a DDE family transposase."; Parent "gene-C7A06_RS33355"; gbkey "CDS"; gene "tnpB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858152.1"; locus_tag "C7A06_RS33355"; product "IS66 family insertion sequence element accessory protein TnpB"; protein_id "WP_000631725.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	906	1580	.	-	.	gene_id "nbis-gene-5649"; ID "nbis-gene-5649"; Name "tnpA"; gbkey "Gene"; gene "tnpA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33360";
+NZ_CP027601.1	RefSeq	transcript	906	1580	.	-	.	gene_id "nbis-gene-5649"; transcript_id "gene-C7A06_RS33360"; ID "gene-C7A06_RS33360"; Name "tnpA"; Parent "nbis-gene-5649"; gbkey "Gene"; gene "tnpA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33360"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	906	1580	.	-	.	gene_id "nbis-gene-5649"; transcript_id "gene-C7A06_RS33360"; Dbxref "Genbank:WP_001341423.1"; ID "nbis-exon-5904"; Name "WP_001341423.1"; Ontology_term "GO:0006313" "GO:0003677" "GO:0004803"; Parent "gene-C7A06_RS33360"; gbkey "CDS"; gene "tnpA"; go_function "DNA binding|0003677||IEA" "transposase activity|0004803||IEA"; go_process "transposition, DNA-mediated|0006313||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_311873.1"; locus_tag "C7A06_RS33360"; product "IS66-like element accessory protein TnpA"; protein_id "WP_001341423.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	906	1580	.	-	0	gene_id "nbis-gene-5649"; transcript_id "gene-C7A06_RS33360"; Dbxref "Genbank:WP_001341423.1"; ID "cds-WP_001341423.1"; Name "WP_001341423.1"; Ontology_term "GO:0006313" "GO:0003677" "GO:0004803"; Parent "gene-C7A06_RS33360"; gbkey "CDS"; gene "tnpA"; go_function "DNA binding|0003677||IEA" "transposase activity|0004803||IEA"; go_process "transposition, DNA-mediated|0006313||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_311873.1"; locus_tag "C7A06_RS33360"; product "IS66-like element accessory protein TnpA"; protein_id "WP_001341423.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	1664	1930	.	+	.	gene_id "nbis-pseudogene-366"; ID "nbis-pseudogene-366"; Name "C7A06_RS35230"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS35230"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "1664";
+NZ_CP027601.1	RefSeq	transcript	1664	1930	.	+	.	gene_id "nbis-pseudogene-366"; transcript_id "gene-C7A06_RS35230"; ID "gene-C7A06_RS35230"; Name "C7A06_RS35230"; Parent "nbis-pseudogene-366"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS35230"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "1664";
+NZ_CP027601.1	Protein Homology	exon	1664	1930	.	+	.	gene_id "nbis-pseudogene-366"; transcript_id "gene-C7A06_RS35230"; ID "nbis-exon-6226"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS35230"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_016245103.1"; locus_tag "C7A06_RS35230"; partial "true"; product "YqiJ family protein"; pseudo "true"; start_range "." "1664"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	1664	1930	.	+	0	gene_id "nbis-pseudogene-366"; transcript_id "gene-C7A06_RS35230"; ID "cds-C7A06_RS35230"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS35230"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_016245103.1"; locus_tag "C7A06_RS35230"; partial "true"; product "YqiJ family protein"; pseudo "true"; start_range "." "1664"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	1978	2190	.	-	.	gene_id "nbis-pseudogene-255"; ID "nbis-pseudogene-255"; Name "C7A06_RS33375"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33375"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "1978";
+NZ_CP027601.1	RefSeq	transcript	1978	2190	.	-	.	gene_id "nbis-pseudogene-255"; transcript_id "gene-C7A06_RS33375"; ID "gene-C7A06_RS33375"; Name "C7A06_RS33375"; Parent "nbis-pseudogene-255"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33375"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "1978";
+NZ_CP027601.1	Protein Homology	exon	1978	2190	.	-	.	gene_id "nbis-pseudogene-255"; transcript_id "gene-C7A06_RS33375"; ID "nbis-exon-5905"; Note "incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS33375"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_076611998.1"; locus_tag "C7A06_RS33375"; partial "true"; product "transposase"; pseudo "true"; start_range "." "1978"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	1978	2190	.	-	0	gene_id "nbis-pseudogene-255"; transcript_id "gene-C7A06_RS33375"; ID "cds-C7A06_RS33375"; Note "incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS33375"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_076611998.1"; locus_tag "C7A06_RS33375"; partial "true"; product "transposase"; pseudo "true"; start_range "." "1978"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	2252	2425	.	+	.	gene_id "nbis-pseudogene-256"; ID "nbis-pseudogene-256"; Name "C7A06_RS33380"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33380"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "2252";
+NZ_CP027601.1	RefSeq	transcript	2252	2425	.	+	.	gene_id "nbis-pseudogene-256"; transcript_id "gene-C7A06_RS33380"; ID "gene-C7A06_RS33380"; Name "C7A06_RS33380"; Parent "nbis-pseudogene-256"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33380"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "2252";
+NZ_CP027601.1	Protein Homology	exon	2252	2425	.	+	.	gene_id "nbis-pseudogene-256"; transcript_id "gene-C7A06_RS33380"; ID "nbis-exon-5906"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS33380"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000998048.1"; locus_tag "C7A06_RS33380"; partial "true"; product "IS66 family transposase"; pseudo "true"; start_range "." "2252"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	2252	2425	.	+	0	gene_id "nbis-pseudogene-256"; transcript_id "gene-C7A06_RS33380"; ID "cds-C7A06_RS33380"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS33380"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000998048.1"; locus_tag "C7A06_RS33380"; partial "true"; product "IS66 family transposase"; pseudo "true"; start_range "." "2252"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	2868	6770	.	+	.	gene_id "nbis-gene-5650"; ID "nbis-gene-5650"; Name "espP"; gbkey "Gene"; gene "espP"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33385";
+NZ_CP027601.1	RefSeq	transcript	2868	6770	.	+	.	gene_id "nbis-gene-5650"; transcript_id "gene-C7A06_RS33385"; ID "gene-C7A06_RS33385"; Name "espP"; Parent "nbis-gene-5650"; gbkey "Gene"; gene "espP"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33385"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	2868	6770	.	+	.	gene_id "nbis-gene-5650"; transcript_id "gene-C7A06_RS33385"; Dbxref "Genbank:WP_001034100.1"; ID "nbis-exon-5907"; Name "WP_001034100.1"; Parent "gene-C7A06_RS33385"; gbkey "CDS"; gene "espP"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052685.1"; locus_tag "C7A06_RS33385"; product "serine protease autotransporter EspP"; protein_id "WP_001034100.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	2868	6770	.	+	0	gene_id "nbis-gene-5650"; transcript_id "gene-C7A06_RS33385"; Dbxref "Genbank:WP_001034100.1"; ID "cds-WP_001034100.1"; Name "WP_001034100.1"; Parent "gene-C7A06_RS33385"; gbkey "CDS"; gene "espP"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052685.1"; locus_tag "C7A06_RS33385"; product "serine protease autotransporter EspP"; protein_id "WP_001034100.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	7018	7275	.	-	.	gene_id "nbis-gene-5772"; ID "nbis-gene-5772"; Name "C7A06_RS34375"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS34375";
+NZ_CP027601.1	RefSeq	transcript	7018	7275	.	-	.	gene_id "nbis-gene-5772"; transcript_id "gene-C7A06_RS34375"; ID "gene-C7A06_RS34375"; Name "C7A06_RS34375"; Parent "nbis-gene-5772"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS34375"; original_biotype "mrna";
+NZ_CP027601.1	GeneMarkS-2+	exon	7018	7275	.	-	.	gene_id "nbis-gene-5772"; transcript_id "gene-C7A06_RS34375"; Dbxref "Genbank:WP_000112000.1"; ID "nbis-exon-6062"; Name "WP_000112000.1"; Parent "gene-C7A06_RS34375"; gbkey "CDS"; inference "COORDINATES: ab initio prediction:GeneMarkS-2+"; locus_tag "C7A06_RS34375"; product "hypothetical protein"; protein_id "WP_000112000.1"; transl_table "11";
+NZ_CP027601.1	GeneMarkS-2+	CDS	7018	7275	.	-	0	gene_id "nbis-gene-5772"; transcript_id "gene-C7A06_RS34375"; Dbxref "Genbank:WP_000112000.1"; ID "cds-WP_000112000.1"; Name "WP_000112000.1"; Parent "gene-C7A06_RS34375"; gbkey "CDS"; inference "COORDINATES: ab initio prediction:GeneMarkS-2+"; locus_tag "C7A06_RS34375"; product "hypothetical protein"; protein_id "WP_000112000.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	7314	7526	.	+	.	gene_id "nbis-pseudogene-257"; ID "nbis-pseudogene-257"; Name "C7A06_RS33395"; end_range "7526" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33395"; original_biotype "pseudogene"; partial "true"; pseudo "true";
+NZ_CP027601.1	RefSeq	transcript	7314	7526	.	+	.	gene_id "nbis-pseudogene-257"; transcript_id "gene-C7A06_RS33395"; ID "gene-C7A06_RS33395"; Name "C7A06_RS33395"; Parent "nbis-pseudogene-257"; end_range "7526" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33395"; original_biotype "mrna"; partial "true"; pseudo "true";
+NZ_CP027601.1	Protein Homology	exon	7314	7526	.	+	.	gene_id "nbis-pseudogene-257"; transcript_id "gene-C7A06_RS33395"; ID "nbis-exon-5908"; Note "incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS33395"; end_range "7526" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_076611998.1"; locus_tag "C7A06_RS33395"; partial "true"; product "transposase"; pseudo "true"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	7314	7526	.	+	0	gene_id "nbis-pseudogene-257"; transcript_id "gene-C7A06_RS33395"; ID "cds-C7A06_RS33395"; Note "incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS33395"; end_range "7526" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_076611998.1"; locus_tag "C7A06_RS33395"; partial "true"; product "transposase"; pseudo "true"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	7574	7840	.	-	.	gene_id "nbis-pseudogene-367"; ID "nbis-pseudogene-367"; Name "C7A06_RS35235"; end_range "7840" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS35235"; original_biotype "pseudogene"; partial "true"; pseudo "true";
+NZ_CP027601.1	RefSeq	transcript	7574	7840	.	-	.	gene_id "nbis-pseudogene-367"; transcript_id "gene-C7A06_RS35235"; ID "gene-C7A06_RS35235"; Name "C7A06_RS35235"; Parent "nbis-pseudogene-367"; end_range "7840" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS35235"; original_biotype "mrna"; partial "true"; pseudo "true";
+NZ_CP027601.1	Protein Homology	exon	7574	7840	.	-	.	gene_id "nbis-pseudogene-367"; transcript_id "gene-C7A06_RS35235"; ID "nbis-exon-6227"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS35235"; end_range "7840" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_016245103.1"; locus_tag "C7A06_RS35235"; partial "true"; product "YqiJ family protein"; pseudo "true"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	7574	7840	.	-	0	gene_id "nbis-pseudogene-367"; transcript_id "gene-C7A06_RS35235"; ID "cds-C7A06_RS35235"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS35235"; end_range "7840" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_016245103.1"; locus_tag "C7A06_RS35235"; partial "true"; product "YqiJ family protein"; pseudo "true"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	7986	9199	.	+	.	gene_id "nbis-gene-5651"; ID "nbis-gene-5651"; Name "C7A06_RS33410"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33410";
+NZ_CP027601.1	RefSeq	transcript	7986	9199	.	+	.	gene_id "nbis-gene-5651"; transcript_id "gene-C7A06_RS33410"; ID "gene-C7A06_RS33410"; Name "C7A06_RS33410"; Parent "nbis-gene-5651"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33410"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	7986	9199	.	+	.	gene_id "nbis-gene-5651"; transcript_id "gene-C7A06_RS33410"; Dbxref "Genbank:WP_162908518.1"; ID "nbis-exon-5909"; Name "WP_162908518.1"; Note "programmed frameshift"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33410"; exception "ribosomal slippage"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_086558238.1"; locus_tag "C7A06_RS33410"; product "IS3 family transposase"; protein_id "WP_162908518.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	7986	9199	.	+	0	gene_id "nbis-gene-5651"; transcript_id "gene-C7A06_RS33410"; Dbxref "Genbank:WP_162908518.1"; ID "cds-WP_162908518.1"; Name "WP_162908518.1"; Note "programmed frameshift"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33410"; exception "ribosomal slippage"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_086558238.1"; locus_tag "C7A06_RS33410"; product "IS3 family transposase"; protein_id "WP_162908518.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	9240	9620	.	-	.	gene_id "nbis-pseudogene-258"; ID "nbis-pseudogene-258"; Name "C7A06_RS33415"; end_range "9620" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33415"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "9240";
+NZ_CP027601.1	RefSeq	transcript	9240	9620	.	-	.	gene_id "nbis-pseudogene-258"; transcript_id "gene-C7A06_RS33415"; ID "gene-C7A06_RS33415"; Name "C7A06_RS33415"; Parent "nbis-pseudogene-258"; end_range "9620" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33415"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "9240";
+NZ_CP027601.1	Protein Homology	exon	9240	9620	.	-	.	gene_id "nbis-pseudogene-258"; transcript_id "gene-C7A06_RS33415"; ID "nbis-exon-5910"; Note "incomplete; partial in the middle of a contig; missing N-terminus and C-terminus"; Parent "gene-C7A06_RS33415"; end_range "9620" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_076611997.1"; locus_tag "C7A06_RS33415"; partial "true"; product "IS3 family transposase"; pseudo "true"; start_range "." "9240"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	9240	9620	.	-	0	gene_id "nbis-pseudogene-258"; transcript_id "gene-C7A06_RS33415"; ID "cds-C7A06_RS33415"; Note "incomplete; partial in the middle of a contig; missing N-terminus and C-terminus"; Parent "gene-C7A06_RS33415"; end_range "9620" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_076611997.1"; locus_tag "C7A06_RS33415"; partial "true"; product "IS3 family transposase"; pseudo "true"; start_range "." "9240"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	9651	11222	.	-	.	gene_id "nbis-gene-5652"; ID "nbis-gene-5652"; Name "C7A06_RS33420"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33420";
+NZ_CP027601.1	RefSeq	transcript	9651	11222	.	-	.	gene_id "nbis-gene-5652"; transcript_id "gene-C7A06_RS33420"; ID "gene-C7A06_RS33420"; Name "C7A06_RS33420"; Parent "nbis-gene-5652"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33420"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	9651	11222	.	-	.	gene_id "nbis-gene-5652"; transcript_id "gene-C7A06_RS33420"; Dbxref "Genbank:WP_000381395.1"; ID "nbis-exon-5911"; Name "WP_000381395.1"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33420"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_012904571.1"; locus_tag "C7A06_RS33420"; product "IS66 family transposase"; protein_id "WP_000381395.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	9651	11222	.	-	0	gene_id "nbis-gene-5652"; transcript_id "gene-C7A06_RS33420"; Dbxref "Genbank:WP_000381395.1"; ID "cds-WP_000381395.1-10"; Name "WP_000381395.1"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33420"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_012904571.1"; locus_tag "C7A06_RS33420"; product "IS66 family transposase"; protein_id "WP_000381395.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	11242	11589	.	-	.	gene_id "nbis-gene-5653"; ID "nbis-gene-5653"; Name "tnpB"; gbkey "Gene"; gene "tnpB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33425";
+NZ_CP027601.1	RefSeq	transcript	11242	11589	.	-	.	gene_id "nbis-gene-5653"; transcript_id "gene-C7A06_RS33425"; ID "gene-C7A06_RS33425"; Name "tnpB"; Parent "nbis-gene-5653"; gbkey "Gene"; gene "tnpB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33425"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	11242	11589	.	-	.	gene_id "nbis-gene-5653"; transcript_id "gene-C7A06_RS33425"; Dbxref "Genbank:WP_000624622.1"; ID "nbis-exon-5912"; Name "WP_000624622.1"; Note "TnpB, as the term is used for proteins encoded by IS66 family insertion elements, is considered an accessory protein, since TnpC, encoded by a neighboring gene, is a DDE family transposase."; Parent "gene-C7A06_RS33425"; gbkey "CDS"; gene "tnpB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858152.1"; locus_tag "C7A06_RS33425"; product "IS66 family insertion sequence element accessory protein TnpB"; protein_id "WP_000624622.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	11242	11589	.	-	0	gene_id "nbis-gene-5653"; transcript_id "gene-C7A06_RS33425"; Dbxref "Genbank:WP_000624622.1"; ID "cds-WP_000624622.1-10"; Name "WP_000624622.1"; Note "TnpB, as the term is used for proteins encoded by IS66 family insertion elements, is considered an accessory protein, since TnpC, encoded by a neighboring gene, is a DDE family transposase."; Parent "gene-C7A06_RS33425"; gbkey "CDS"; gene "tnpB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858152.1"; locus_tag "C7A06_RS33425"; product "IS66 family insertion sequence element accessory protein TnpB"; protein_id "WP_000624622.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	11589	12266	.	-	.	gene_id "nbis-gene-5654"; ID "nbis-gene-5654"; Name "tnpA"; gbkey "Gene"; gene "tnpA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33430";
+NZ_CP027601.1	RefSeq	transcript	11589	12266	.	-	.	gene_id "nbis-gene-5654"; transcript_id "gene-C7A06_RS33430"; ID "gene-C7A06_RS33430"; Name "tnpA"; Parent "nbis-gene-5654"; gbkey "Gene"; gene "tnpA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33430"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	11589	12266	.	-	.	gene_id "nbis-gene-5654"; transcript_id "gene-C7A06_RS33430"; Dbxref "Genbank:WP_001339397.1"; ID "nbis-exon-5913"; Name "WP_001339397.1"; Ontology_term "GO:0006313" "GO:0003677" "GO:0004803"; Parent "gene-C7A06_RS33430"; gbkey "CDS"; gene "tnpA"; go_function "DNA binding|0003677||IEA" "transposase activity|0004803||IEA"; go_process "transposition, DNA-mediated|0006313||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001743492.1"; locus_tag "C7A06_RS33430"; product "IS66-like element accessory protein TnpA"; protein_id "WP_001339397.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	11589	12266	.	-	0	gene_id "nbis-gene-5654"; transcript_id "gene-C7A06_RS33430"; Dbxref "Genbank:WP_001339397.1"; ID "cds-WP_001339397.1-10"; Name "WP_001339397.1"; Ontology_term "GO:0006313" "GO:0003677" "GO:0004803"; Parent "gene-C7A06_RS33430"; gbkey "CDS"; gene "tnpA"; go_function "DNA binding|0003677||IEA" "transposase activity|0004803||IEA"; go_process "transposition, DNA-mediated|0006313||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001743492.1"; locus_tag "C7A06_RS33430"; product "IS66-like element accessory protein TnpA"; protein_id "WP_001339397.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	12319	12635	.	-	.	gene_id "nbis-pseudogene-259"; ID "nbis-pseudogene-259"; Name "C7A06_RS33440"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33440"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "12319";
+NZ_CP027601.1	RefSeq	transcript	12319	12635	.	-	.	gene_id "nbis-pseudogene-259"; transcript_id "gene-C7A06_RS33440"; ID "gene-C7A06_RS33440"; Name "C7A06_RS33440"; Parent "nbis-pseudogene-259"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33440"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "12319";
+NZ_CP027601.1	Protein Homology	exon	12319	12635	.	-	.	gene_id "nbis-pseudogene-259"; transcript_id "gene-C7A06_RS33440"; ID "nbis-exon-5914"; Note "frameshifted; incomplete; partial in the middle of a contig; missing C-terminus"; Ontology_term "GO:0006313" "GO:0003677" "GO:0004803"; Parent "gene-C7A06_RS33440"; gbkey "CDS"; go_function "DNA binding|0003677||IEA" "transposase activity|0004803||IEA"; go_process "transposition, DNA-mediated|0006313||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_076611998.1"; locus_tag "C7A06_RS33440"; partial "true"; product "transposase"; pseudo "true"; start_range "." "12319"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	12319	12635	.	-	0	gene_id "nbis-pseudogene-259"; transcript_id "gene-C7A06_RS33440"; ID "cds-C7A06_RS33440"; Note "frameshifted; incomplete; partial in the middle of a contig; missing C-terminus"; Ontology_term "GO:0006313" "GO:0003677" "GO:0004803"; Parent "gene-C7A06_RS33440"; gbkey "CDS"; go_function "DNA binding|0003677||IEA" "transposase activity|0004803||IEA"; go_process "transposition, DNA-mediated|0006313||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_076611998.1"; locus_tag "C7A06_RS33440"; partial "true"; product "transposase"; pseudo "true"; start_range "." "12319"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	12701	12994	.	+	.	gene_id "nbis-pseudogene-368"; ID "nbis-pseudogene-368"; Name "C7A06_RS35240"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS35240"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "12701";
+NZ_CP027601.1	RefSeq	transcript	12701	12994	.	+	.	gene_id "nbis-pseudogene-368"; transcript_id "gene-C7A06_RS35240"; ID "gene-C7A06_RS35240"; Name "C7A06_RS35240"; Parent "nbis-pseudogene-368"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS35240"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "12701";
+NZ_CP027601.1	Protein Homology	exon	12701	12994	.	+	.	gene_id "nbis-pseudogene-368"; transcript_id "gene-C7A06_RS35240"; ID "nbis-exon-6228"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS35240"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000077650.1"; locus_tag "C7A06_RS35240"; partial "true"; product "conjugal transfer protein TrbC"; pseudo "true"; start_range "." "12701"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	12701	12994	.	+	0	gene_id "nbis-pseudogene-368"; transcript_id "gene-C7A06_RS35240"; ID "cds-C7A06_RS35240"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS35240"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000077650.1"; locus_tag "C7A06_RS35240"; partial "true"; product "conjugal transfer protein TrbC"; pseudo "true"; start_range "." "12701"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	13215	15935	.	-	.	gene_id "nbis-gene-5655"; ID "nbis-gene-5655"; Name "C7A06_RS33450"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33450";
+NZ_CP027601.1	RefSeq	transcript	13215	15935	.	-	.	gene_id "nbis-gene-5655"; transcript_id "gene-C7A06_RS33450"; ID "gene-C7A06_RS33450"; Name "C7A06_RS33450"; Parent "nbis-gene-5655"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33450"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	13215	15935	.	-	.	gene_id "nbis-gene-5655"; transcript_id "gene-C7A06_RS33450"; Dbxref "Genbank:WP_000991402.1"; ID "nbis-exon-5915"; Name "WP_000991402.1"; Parent "gene-C7A06_RS33450"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000991381.1"; locus_tag "C7A06_RS33450"; product "relaxase/mobilization nuclease domain-containing protein"; protein_id "WP_000991402.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	13215	15935	.	-	0	gene_id "nbis-gene-5655"; transcript_id "gene-C7A06_RS33450"; Dbxref "Genbank:WP_000991402.1"; ID "cds-WP_000991402.1"; Name "WP_000991402.1"; Parent "gene-C7A06_RS33450"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000991381.1"; locus_tag "C7A06_RS33450"; product "relaxase/mobilization nuclease domain-containing protein"; protein_id "WP_000991402.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	15947	16279	.	-	.	gene_id "nbis-gene-5656"; ID "nbis-gene-5656"; Name "C7A06_RS33455"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33455";
+NZ_CP027601.1	RefSeq	transcript	15947	16279	.	-	.	gene_id "nbis-gene-5656"; transcript_id "gene-C7A06_RS33455"; ID "gene-C7A06_RS33455"; Name "C7A06_RS33455"; Parent "nbis-gene-5656"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33455"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	15947	16279	.	-	.	gene_id "nbis-gene-5656"; transcript_id "gene-C7A06_RS33455"; Dbxref "Genbank:WP_001291056.1"; ID "nbis-exon-5916"; Name "WP_001291056.1"; Parent "gene-C7A06_RS33455"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001291057.1"; locus_tag "C7A06_RS33455"; product "DUF6290 family protein"; protein_id "WP_001291056.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	15947	16279	.	-	0	gene_id "nbis-gene-5656"; transcript_id "gene-C7A06_RS33455"; Dbxref "Genbank:WP_001291056.1"; ID "cds-WP_001291056.1"; Name "WP_001291056.1"; Parent "gene-C7A06_RS33455"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001291057.1"; locus_tag "C7A06_RS33455"; product "DUF6290 family protein"; protein_id "WP_001291056.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	16511	16846	.	+	.	gene_id "nbis-gene-5657"; ID "nbis-gene-5657"; Name "C7A06_RS33460"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33460";
+NZ_CP027601.1	RefSeq	transcript	16511	16846	.	+	.	gene_id "nbis-gene-5657"; transcript_id "gene-C7A06_RS33460"; ID "gene-C7A06_RS33460"; Name "C7A06_RS33460"; Parent "nbis-gene-5657"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33460"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	16511	16846	.	+	.	gene_id "nbis-gene-5657"; transcript_id "gene-C7A06_RS33460"; Dbxref "Genbank:WP_000157095.1"; ID "nbis-exon-5917"; Name "WP_000157095.1"; Parent "gene-C7A06_RS33460"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000157082.1"; locus_tag "C7A06_RS33460"; product "molybdopterin-guanine dinucleotide biosynthesis protein MobC"; protein_id "WP_000157095.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	16511	16846	.	+	0	gene_id "nbis-gene-5657"; transcript_id "gene-C7A06_RS33460"; Dbxref "Genbank:WP_000157095.1"; ID "cds-WP_000157095.1"; Name "WP_000157095.1"; Parent "gene-C7A06_RS33460"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000157082.1"; locus_tag "C7A06_RS33460"; product "molybdopterin-guanine dinucleotide biosynthesis protein MobC"; protein_id "WP_000157095.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	16932	17780	.	-	.	gene_id "nbis-gene-5658"; ID "nbis-gene-5658"; Name "C7A06_RS33465"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33465";
+NZ_CP027601.1	RefSeq	transcript	16932	17780	.	-	.	gene_id "nbis-gene-5658"; transcript_id "gene-C7A06_RS33465"; ID "gene-C7A06_RS33465"; Name "C7A06_RS33465"; Parent "nbis-gene-5658"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33465"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	16932	17780	.	-	.	gene_id "nbis-gene-5658"; transcript_id "gene-C7A06_RS33465"; Dbxref "Genbank:WP_001341408.1"; ID "nbis-exon-5918"; Name "WP_001341408.1"; Parent "gene-C7A06_RS33465"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001401764.1"; locus_tag "C7A06_RS33465"; product "DUF4942 domain-containing protein"; protein_id "WP_001341408.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	16932	17780	.	-	0	gene_id "nbis-gene-5658"; transcript_id "gene-C7A06_RS33465"; Dbxref "Genbank:WP_001341408.1"; ID "cds-WP_001341408.1"; Name "WP_001341408.1"; Parent "gene-C7A06_RS33465"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001401764.1"; locus_tag "C7A06_RS33465"; product "DUF4942 domain-containing protein"; protein_id "WP_001341408.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	17973	18299	.	+	.	gene_id "nbis-gene-5659"; ID "nbis-gene-5659"; Name "C7A06_RS33470"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33470";
+NZ_CP027601.1	RefSeq	transcript	17973	18299	.	+	.	gene_id "nbis-gene-5659"; transcript_id "gene-C7A06_RS33470"; ID "gene-C7A06_RS33470"; Name "C7A06_RS33470"; Parent "nbis-gene-5659"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33470"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	17973	18299	.	+	.	gene_id "nbis-gene-5659"; transcript_id "gene-C7A06_RS33470"; Dbxref "Genbank:WP_199852433.1"; ID "nbis-exon-5919"; Name "WP_199852433.1"; Parent "gene-C7A06_RS33470"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001431784.1"; locus_tag "C7A06_RS33470"; product "hypothetical protein"; protein_id "WP_199852433.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	17973	18299	.	+	0	gene_id "nbis-gene-5659"; transcript_id "gene-C7A06_RS33470"; Dbxref "Genbank:WP_199852433.1"; ID "cds-WP_199852433.1"; Name "WP_199852433.1"; Parent "gene-C7A06_RS33470"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001431784.1"; locus_tag "C7A06_RS33470"; product "hypothetical protein"; protein_id "WP_199852433.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	18358	18609	.	+	.	gene_id "nbis-gene-5660"; ID "nbis-gene-5660"; Name "C7A06_RS33475"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33475";
+NZ_CP027601.1	RefSeq	transcript	18358	18609	.	+	.	gene_id "nbis-gene-5660"; transcript_id "gene-C7A06_RS33475"; ID "gene-C7A06_RS33475"; Name "C7A06_RS33475"; Parent "nbis-gene-5660"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33475"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	18358	18609	.	+	.	gene_id "nbis-gene-5660"; transcript_id "gene-C7A06_RS33475"; Dbxref "Genbank:WP_000148286.1"; ID "nbis-exon-5920"; Name "WP_000148286.1"; Parent "gene-C7A06_RS33475"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_003980153.1"; locus_tag "C7A06_RS33475"; product "helix-turn-helix domain-containing protein"; protein_id "WP_000148286.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	18358	18609	.	+	0	gene_id "nbis-gene-5660"; transcript_id "gene-C7A06_RS33475"; Dbxref "Genbank:WP_000148286.1"; ID "cds-WP_000148286.1"; Name "WP_000148286.1"; Parent "gene-C7A06_RS33475"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_003980153.1"; locus_tag "C7A06_RS33475"; product "helix-turn-helix domain-containing protein"; protein_id "WP_000148286.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	18640	19539	.	-	.	gene_id "nbis-gene-5661"; ID "nbis-gene-5661"; Name "C7A06_RS33480"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33480";
+NZ_CP027601.1	RefSeq	transcript	18640	19539	.	-	.	gene_id "nbis-gene-5661"; transcript_id "gene-C7A06_RS33480"; ID "gene-C7A06_RS33480"; Name "C7A06_RS33480"; Parent "nbis-gene-5661"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33480"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	18640	19539	.	-	.	gene_id "nbis-gene-5661"; transcript_id "gene-C7A06_RS33480"; Dbxref "Genbank:WP_032348834.1"; ID "nbis-exon-5921"; Name "WP_032348834.1"; Parent "gene-C7A06_RS33480"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000038335.1"; locus_tag "C7A06_RS33480"; product "Rpn family recombination-promoting nuclease/putative transposase"; protein_id "WP_032348834.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	18640	19539	.	-	0	gene_id "nbis-gene-5661"; transcript_id "gene-C7A06_RS33480"; Dbxref "Genbank:WP_032348834.1"; ID "cds-WP_032348834.1"; Name "WP_032348834.1"; Parent "gene-C7A06_RS33480"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000038335.1"; locus_tag "C7A06_RS33480"; product "Rpn family recombination-promoting nuclease/putative transposase"; protein_id "WP_032348834.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	19604	19870	.	-	.	gene_id "nbis-gene-5662"; ID "nbis-gene-5662"; Name "C7A06_RS33485"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33485";
+NZ_CP027601.1	RefSeq	transcript	19604	19870	.	-	.	gene_id "nbis-gene-5662"; transcript_id "gene-C7A06_RS33485"; ID "gene-C7A06_RS33485"; Name "C7A06_RS33485"; Parent "nbis-gene-5662"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33485"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	19604	19870	.	-	.	gene_id "nbis-gene-5662"; transcript_id "gene-C7A06_RS33485"; Dbxref "Genbank:WP_001247865.1"; ID "nbis-exon-5922"; Name "WP_001247865.1"; Parent "gene-C7A06_RS33485"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001247860.1"; locus_tag "C7A06_RS33485"; product "hypothetical protein"; protein_id "WP_001247865.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	19604	19870	.	-	0	gene_id "nbis-gene-5662"; transcript_id "gene-C7A06_RS33485"; Dbxref "Genbank:WP_001247865.1"; ID "cds-WP_001247865.1"; Name "WP_001247865.1"; Parent "gene-C7A06_RS33485"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001247860.1"; locus_tag "C7A06_RS33485"; product "hypothetical protein"; protein_id "WP_001247865.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	19963	20397	.	-	.	gene_id "nbis-gene-5663"; ID "nbis-gene-5663"; Name "C7A06_RS33490"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33490";
+NZ_CP027601.1	RefSeq	transcript	19963	20397	.	-	.	gene_id "nbis-gene-5663"; transcript_id "gene-C7A06_RS33490"; ID "gene-C7A06_RS33490"; Name "C7A06_RS33490"; Parent "nbis-gene-5663"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33490"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	19963	20397	.	-	.	gene_id "nbis-gene-5663"; transcript_id "gene-C7A06_RS33490"; Dbxref "Genbank:WP_000218854.1"; ID "nbis-exon-5923"; Name "WP_000218854.1"; Parent "gene-C7A06_RS33490"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000218847.1"; locus_tag "C7A06_RS33490"; product "hypothetical protein"; protein_id "WP_000218854.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	19963	20397	.	-	0	gene_id "nbis-gene-5663"; transcript_id "gene-C7A06_RS33490"; Dbxref "Genbank:WP_000218854.1"; ID "cds-WP_000218854.1"; Name "WP_000218854.1"; Parent "gene-C7A06_RS33490"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000218847.1"; locus_tag "C7A06_RS33490"; product "hypothetical protein"; protein_id "WP_000218854.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	20503	21123	.	+	.	gene_id "nbis-gene-5805"; ID "nbis-gene-5805"; Name "C7A06_RS34645"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS34645";
+NZ_CP027601.1	RefSeq	transcript	20503	21123	.	+	.	gene_id "nbis-gene-5805"; transcript_id "gene-C7A06_RS34645"; ID "gene-C7A06_RS34645"; Name "C7A06_RS34645"; Parent "nbis-gene-5805"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS34645"; original_biotype "mrna";
+NZ_CP027601.1	GeneMarkS-2+	exon	20503	21123	.	+	.	gene_id "nbis-gene-5805"; transcript_id "gene-C7A06_RS34645"; Dbxref "Genbank:WP_162137195.1"; ID "nbis-exon-6111"; Name "WP_162137195.1"; Parent "gene-C7A06_RS34645"; gbkey "CDS"; inference "COORDINATES: ab initio prediction:GeneMarkS-2+"; locus_tag "C7A06_RS34645"; product "hypothetical protein"; protein_id "WP_162137195.1"; transl_table "11";
+NZ_CP027601.1	GeneMarkS-2+	CDS	20503	21123	.	+	0	gene_id "nbis-gene-5805"; transcript_id "gene-C7A06_RS34645"; Dbxref "Genbank:WP_162137195.1"; ID "cds-WP_162137195.1"; Name "WP_162137195.1"; Parent "gene-C7A06_RS34645"; gbkey "CDS"; inference "COORDINATES: ab initio prediction:GeneMarkS-2+"; locus_tag "C7A06_RS34645"; product "hypothetical protein"; protein_id "WP_162137195.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	21125	21625	.	-	.	gene_id "nbis-gene-5664"; ID "nbis-gene-5664"; Name "C7A06_RS33505"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33505";
+NZ_CP027601.1	RefSeq	transcript	21125	21625	.	-	.	gene_id "nbis-gene-5664"; transcript_id "gene-C7A06_RS33505"; ID "gene-C7A06_RS33505"; Name "C7A06_RS33505"; Parent "nbis-gene-5664"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33505"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	21125	21625	.	-	.	gene_id "nbis-gene-5664"; transcript_id "gene-C7A06_RS33505"; Dbxref "Genbank:WP_000117628.1"; ID "nbis-exon-5924"; Name "WP_000117628.1"; Parent "gene-C7A06_RS33505"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000117633.1"; locus_tag "C7A06_RS33505"; product "antirestriction protein ArdA"; protein_id "WP_000117628.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	21125	21625	.	-	0	gene_id "nbis-gene-5664"; transcript_id "gene-C7A06_RS33505"; Dbxref "Genbank:WP_000117628.1"; ID "cds-WP_000117628.1"; Name "WP_000117628.1"; Parent "gene-C7A06_RS33505"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000117633.1"; locus_tag "C7A06_RS33505"; product "antirestriction protein ArdA"; protein_id "WP_000117628.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	22087	22684	.	-	.	gene_id "nbis-pseudogene-306"; ID "nbis-pseudogene-306"; Name "C7A06_RS34650"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS34650"; original_biotype "pseudogene"; pseudo "true";
+NZ_CP027601.1	RefSeq	transcript	22087	22684	.	-	.	gene_id "nbis-pseudogene-306"; transcript_id "gene-C7A06_RS34650"; ID "gene-C7A06_RS34650"; Name "C7A06_RS34650"; Parent "nbis-pseudogene-306"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS34650"; original_biotype "mrna"; pseudo "true";
+NZ_CP027601.1	Protein Homology	exon	22087	22684	.	-	.	gene_id "nbis-pseudogene-306"; transcript_id "gene-C7A06_RS34650"; ID "nbis-exon-6112"; Note "frameshifted"; Parent "gene-C7A06_RS34650"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000978013.1"; locus_tag "C7A06_RS34650"; product "hypothetical protein"; pseudo "true"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	22087	22684	.	-	0	gene_id "nbis-pseudogene-306"; transcript_id "gene-C7A06_RS34650"; ID "cds-C7A06_RS34650"; Note "frameshifted"; Parent "gene-C7A06_RS34650"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000978013.1"; locus_tag "C7A06_RS34650"; product "hypothetical protein"; pseudo "true"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	22681	23400	.	-	.	gene_id "nbis-gene-5665"; ID "nbis-gene-5665"; Name "C7A06_RS33520"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33520";
+NZ_CP027601.1	RefSeq	transcript	22681	23400	.	-	.	gene_id "nbis-gene-5665"; transcript_id "gene-C7A06_RS33520"; ID "gene-C7A06_RS33520"; Name "C7A06_RS33520"; Parent "nbis-gene-5665"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33520"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	22681	23400	.	-	.	gene_id "nbis-gene-5665"; transcript_id "gene-C7A06_RS33520"; Dbxref "Genbank:WP_001276261.1"; ID "nbis-exon-5925"; Name "WP_001276261.1"; Parent "gene-C7A06_RS33520"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001723065.1"; locus_tag "C7A06_RS33520"; product "plasmid SOS inhibition protein A"; protein_id "WP_001276261.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	22681	23400	.	-	0	gene_id "nbis-gene-5665"; transcript_id "gene-C7A06_RS33520"; Dbxref "Genbank:WP_001276261.1"; ID "cds-WP_001276261.1"; Name "WP_001276261.1"; Parent "gene-C7A06_RS33520"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001723065.1"; locus_tag "C7A06_RS33520"; product "plasmid SOS inhibition protein A"; protein_id "WP_001276261.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	23397	23645	.	-	.	gene_id "nbis-pseudogene-307"; ID "nbis-pseudogene-307"; Name "psiB"; end_range "23645" "."; gbkey "Gene"; gene "psiB"; gene_biotype "pseudogene"; locus_tag "C7A06_RS34655"; original_biotype "pseudogene"; partial "true"; pseudo "true";
+NZ_CP027601.1	RefSeq	transcript	23397	23645	.	-	.	gene_id "nbis-pseudogene-307"; transcript_id "gene-C7A06_RS34655"; ID "gene-C7A06_RS34655"; Name "psiB"; Parent "nbis-pseudogene-307"; end_range "23645" "."; gbkey "Gene"; gene "psiB"; gene_biotype "pseudogene"; locus_tag "C7A06_RS34655"; original_biotype "mrna"; partial "true"; pseudo "true";
+NZ_CP027601.1	Protein Homology	exon	23397	23645	.	-	.	gene_id "nbis-pseudogene-307"; transcript_id "gene-C7A06_RS34655"; ID "nbis-exon-6113"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS34655"; end_range "23645" "."; gbkey "CDS"; gene "psiB"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000845953.1"; locus_tag "C7A06_RS34655"; partial "true"; product "conjugation system SOS inhibitor PsiB"; pseudo "true"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	23397	23645	.	-	0	gene_id "nbis-pseudogene-307"; transcript_id "gene-C7A06_RS34655"; ID "cds-C7A06_RS34655"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS34655"; end_range "23645" "."; gbkey "CDS"; gene "psiB"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000845953.1"; locus_tag "C7A06_RS34655"; partial "true"; product "conjugation system SOS inhibitor PsiB"; pseudo "true"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	23640	23879	.	-	.	gene_id "nbis-pseudogene-308"; ID "nbis-pseudogene-308"; Name "C7A06_RS34660"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS34660"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "23640";
+NZ_CP027601.1	RefSeq	transcript	23640	23879	.	-	.	gene_id "nbis-pseudogene-308"; transcript_id "gene-C7A06_RS34660"; ID "gene-C7A06_RS34660"; Name "C7A06_RS34660"; Parent "nbis-pseudogene-308"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS34660"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "23640";
+NZ_CP027601.1	Protein Homology	exon	23640	23879	.	-	.	gene_id "nbis-pseudogene-308"; transcript_id "gene-C7A06_RS34660"; ID "nbis-exon-6114"; Note "incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS34660"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858335.1"; locus_tag "C7A06_RS34660"; partial "true"; product "hypothetical protein"; pseudo "true"; start_range "." "23640"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	23640	23879	.	-	0	gene_id "nbis-pseudogene-308"; transcript_id "gene-C7A06_RS34660"; ID "cds-C7A06_RS34660"; Note "incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS34660"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858335.1"; locus_tag "C7A06_RS34660"; partial "true"; product "hypothetical protein"; pseudo "true"; start_range "." "23640"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	23924	24410	.	-	.	gene_id "nbis-pseudogene-260"; ID "nbis-pseudogene-260"; Name "C7A06_RS33530"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33530"; original_biotype "pseudogene"; pseudo "true";
+NZ_CP027601.1	RefSeq	transcript	23924	24410	.	-	.	gene_id "nbis-pseudogene-260"; transcript_id "gene-C7A06_RS33530"; ID "gene-C7A06_RS33530"; Name "C7A06_RS33530"; Parent "nbis-pseudogene-260"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33530"; original_biotype "mrna"; pseudo "true";
+NZ_CP027601.1	Protein Homology	exon	23924	24410	.	-	.	gene_id "nbis-pseudogene-260"; transcript_id "gene-C7A06_RS33530"; ID "nbis-exon-5926"; Note "frameshifted"; Parent "gene-C7A06_RS33530"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052646.1"; locus_tag "C7A06_RS33530"; product "DUF1380 domain-containing protein"; pseudo "true"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	23924	24410	.	-	0	gene_id "nbis-pseudogene-260"; transcript_id "gene-C7A06_RS33530"; ID "cds-C7A06_RS33530"; Note "frameshifted"; Parent "gene-C7A06_RS33530"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052646.1"; locus_tag "C7A06_RS33530"; product "DUF1380 domain-containing protein"; pseudo "true"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	24370	24588	.	-	.	gene_id "nbis-gene-5666"; ID "nbis-gene-5666"; Name "C7A06_RS33535"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33535";
+NZ_CP027601.1	RefSeq	transcript	24370	24588	.	-	.	gene_id "nbis-gene-5666"; transcript_id "gene-C7A06_RS33535"; ID "gene-C7A06_RS33535"; Name "C7A06_RS33535"; Parent "nbis-gene-5666"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33535"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	24370	24588	.	-	.	gene_id "nbis-gene-5666"; transcript_id "gene-C7A06_RS33535"; Dbxref "Genbank:WP_001443814.1"; ID "nbis-exon-5927"; Name "WP_001443814.1"; Parent "gene-C7A06_RS33535"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858332.1"; locus_tag "C7A06_RS33535"; product "hypothetical protein"; protein_id "WP_001443814.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	24370	24588	.	-	0	gene_id "nbis-gene-5666"; transcript_id "gene-C7A06_RS33535"; Dbxref "Genbank:WP_001443814.1"; ID "cds-WP_001443814.1"; Name "WP_001443814.1"; Parent "gene-C7A06_RS33535"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858332.1"; locus_tag "C7A06_RS33535"; product "hypothetical protein"; protein_id "WP_001443814.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	24588	25271	.	-	.	gene_id "nbis-gene-5667"; ID "nbis-gene-5667"; Name "C7A06_RS33540"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33540";
+NZ_CP027601.1	RefSeq	transcript	24588	25271	.	-	.	gene_id "nbis-gene-5667"; transcript_id "gene-C7A06_RS33540"; ID "gene-C7A06_RS33540"; Name "C7A06_RS33540"; Parent "nbis-gene-5667"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33540"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	24588	25271	.	-	.	gene_id "nbis-gene-5667"; transcript_id "gene-C7A06_RS33540"; Dbxref "Genbank:WP_000086167.1"; ID "nbis-exon-5928"; Name "WP_000086167.1"; Parent "gene-C7A06_RS33540"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858331.2"; locus_tag "C7A06_RS33540"; product "DNA methylase"; protein_id "WP_000086167.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	24588	25271	.	-	0	gene_id "nbis-gene-5667"; transcript_id "gene-C7A06_RS33540"; Dbxref "Genbank:WP_000086167.1"; ID "cds-WP_000086167.1"; Name "WP_000086167.1"; Parent "gene-C7A06_RS33540"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858331.2"; locus_tag "C7A06_RS33540"; product "DNA methylase"; protein_id "WP_000086167.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	25347	25658	.	-	.	gene_id "nbis-gene-5668"; ID "nbis-gene-5668"; Name "C7A06_RS33545"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33545";
+NZ_CP027601.1	RefSeq	transcript	25347	25658	.	-	.	gene_id "nbis-gene-5668"; transcript_id "gene-C7A06_RS33545"; ID "gene-C7A06_RS33545"; Name "C7A06_RS33545"; Parent "nbis-gene-5668"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33545"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	25347	25658	.	-	.	gene_id "nbis-gene-5668"; transcript_id "gene-C7A06_RS33545"; Dbxref "Genbank:WP_012680995.1"; ID "nbis-exon-5929"; Name "WP_012680995.1"; Parent "gene-C7A06_RS33545"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858330.2"; locus_tag "C7A06_RS33545"; product "hypothetical protein"; protein_id "WP_012680995.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	25347	25658	.	-	0	gene_id "nbis-gene-5668"; transcript_id "gene-C7A06_RS33545"; Dbxref "Genbank:WP_012680995.1"; ID "cds-WP_012680995.1-2"; Name "WP_012680995.1"; Parent "gene-C7A06_RS33545"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858330.2"; locus_tag "C7A06_RS33545"; product "hypothetical protein"; protein_id "WP_012680995.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	25655	26557	.	-	.	gene_id "nbis-gene-5669"; ID "nbis-gene-5669"; Name "C7A06_RS33550"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33550";
+NZ_CP027601.1	RefSeq	transcript	25655	26557	.	-	.	gene_id "nbis-gene-5669"; transcript_id "gene-C7A06_RS33550"; ID "gene-C7A06_RS33550"; Name "C7A06_RS33550"; Parent "nbis-gene-5669"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33550"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	25655	26557	.	-	.	gene_id "nbis-gene-5669"; transcript_id "gene-C7A06_RS33550"; Dbxref "Genbank:WP_077249722.1"; ID "nbis-exon-5930"; Name "WP_077249722.1"; Parent "gene-C7A06_RS33550"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052643.1"; locus_tag "C7A06_RS33550"; product "DUF1281 domain-containing protein"; protein_id "WP_077249722.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	25655	26557	.	-	0	gene_id "nbis-gene-5669"; transcript_id "gene-C7A06_RS33550"; Dbxref "Genbank:WP_077249722.1"; ID "cds-WP_077249722.1"; Name "WP_077249722.1"; Parent "gene-C7A06_RS33550"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052643.1"; locus_tag "C7A06_RS33550"; product "DUF1281 domain-containing protein"; protein_id "WP_077249722.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	26830	27789	.	+	.	gene_id "nbis-gene-5670"; ID "nbis-gene-5670"; Name "C7A06_RS33555"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33555";
+NZ_CP027601.1	RefSeq	transcript	26830	27789	.	+	.	gene_id "nbis-gene-5670"; transcript_id "gene-C7A06_RS33555"; ID "gene-C7A06_RS33555"; Name "C7A06_RS33555"; Parent "nbis-gene-5670"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33555"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	26830	27789	.	+	.	gene_id "nbis-gene-5670"; transcript_id "gene-C7A06_RS33555"; Dbxref "Genbank:WP_000921957.1"; ID "nbis-exon-5931"; Name "WP_000921957.1"; Parent "gene-C7A06_RS33555"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858328.1"; locus_tag "C7A06_RS33555"; product "plasmid segregation protein ParM"; protein_id "WP_000921957.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	26830	27789	.	+	0	gene_id "nbis-gene-5670"; transcript_id "gene-C7A06_RS33555"; Dbxref "Genbank:WP_000921957.1"; ID "cds-WP_000921957.1"; Name "WP_000921957.1"; Parent "gene-C7A06_RS33555"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858328.1"; locus_tag "C7A06_RS33555"; product "plasmid segregation protein ParM"; protein_id "WP_000921957.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	27789	28184	.	+	.	gene_id "nbis-gene-5671"; ID "nbis-gene-5671"; Name "C7A06_RS33560"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33560";
+NZ_CP027601.1	RefSeq	transcript	27789	28184	.	+	.	gene_id "nbis-gene-5671"; transcript_id "gene-C7A06_RS33560"; ID "gene-C7A06_RS33560"; Name "C7A06_RS33560"; Parent "nbis-gene-5671"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33560"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	27789	28184	.	+	.	gene_id "nbis-gene-5671"; transcript_id "gene-C7A06_RS33560"; Dbxref "Genbank:WP_000445934.1"; ID "nbis-exon-5932"; Name "WP_000445934.1"; Parent "gene-C7A06_RS33560"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858327.1"; locus_tag "C7A06_RS33560"; product "plasmid partitioning/stability family protein"; protein_id "WP_000445934.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	27789	28184	.	+	0	gene_id "nbis-gene-5671"; transcript_id "gene-C7A06_RS33560"; Dbxref "Genbank:WP_000445934.1"; ID "cds-WP_000445934.1"; Name "WP_000445934.1"; Parent "gene-C7A06_RS33560"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858327.1"; locus_tag "C7A06_RS33560"; product "plasmid partitioning/stability family protein"; protein_id "WP_000445934.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	28264	29031	.	-	.	gene_id "nbis-pseudogene-261"; ID "nbis-pseudogene-261"; Name "C7A06_RS33565"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33565"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "28264";
+NZ_CP027601.1	RefSeq	transcript	28264	29031	.	-	.	gene_id "nbis-pseudogene-261"; transcript_id "gene-C7A06_RS33565"; ID "gene-C7A06_RS33565"; Name "C7A06_RS33565"; Parent "nbis-pseudogene-261"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33565"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "28264";
+NZ_CP027601.1	Protein Homology	exon	28264	29031	.	-	.	gene_id "nbis-pseudogene-261"; transcript_id "gene-C7A06_RS33565"; ID "nbis-exon-5933"; Note "frameshifted; internal stop; incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS33565"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_076612086.1"; locus_tag "C7A06_RS33565"; partial "true"; product "IS3 family transposase"; pseudo "true"; start_range "." "28264"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	28264	29031	.	-	0	gene_id "nbis-pseudogene-261"; transcript_id "gene-C7A06_RS33565"; ID "cds-C7A06_RS33565"; Note "frameshifted; internal stop; incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS33565"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_076612086.1"; locus_tag "C7A06_RS33565"; partial "true"; product "IS3 family transposase"; pseudo "true"; start_range "." "28264"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	29145	29534	.	-	.	gene_id "nbis-gene-5672"; ID "nbis-gene-5672"; Name "C7A06_RS33570"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33570";
+NZ_CP027601.1	RefSeq	transcript	29145	29534	.	-	.	gene_id "nbis-gene-5672"; transcript_id "gene-C7A06_RS33570"; ID "gene-C7A06_RS33570"; Name "C7A06_RS33570"; Parent "nbis-gene-5672"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33570"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	29145	29534	.	-	.	gene_id "nbis-gene-5672"; transcript_id "gene-C7A06_RS33570"; Dbxref "Genbank:WP_001172748.1"; ID "nbis-exon-5934"; Name "WP_001172748.1"; Ontology_term "GO:0022900" "GO:0005506" "GO:0009055" "GO:0020037" "GO:0042597"; Parent "gene-C7A06_RS33570"; gbkey "CDS"; go_component "periplasmic space|0042597||IEA"; go_function "iron ion binding|0005506||IEA" "electron transfer activity|0009055||IEA" "heme binding|0020037||IEA"; go_process "electron transport chain|0022900||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_016242783.1"; locus_tag "C7A06_RS33570"; product "cytochrome b562"; protein_id "WP_001172748.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	29145	29534	.	-	0	gene_id "nbis-gene-5672"; transcript_id "gene-C7A06_RS33570"; Dbxref "Genbank:WP_001172748.1"; ID "cds-WP_001172748.1"; Name "WP_001172748.1"; Ontology_term "GO:0022900" "GO:0005506" "GO:0009055" "GO:0020037" "GO:0042597"; Parent "gene-C7A06_RS33570"; gbkey "CDS"; go_component "periplasmic space|0042597||IEA"; go_function "iron ion binding|0005506||IEA" "electron transfer activity|0009055||IEA" "heme binding|0020037||IEA"; go_process "electron transport chain|0022900||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_016242783.1"; locus_tag "C7A06_RS33570"; product "cytochrome b562"; protein_id "WP_001172748.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	29578	31788	.	-	.	gene_id "nbis-gene-5673"; ID "nbis-gene-5673"; Name "katP"; gbkey "Gene"; gene "katP"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33575";
+NZ_CP027601.1	RefSeq	transcript	29578	31788	.	-	.	gene_id "nbis-gene-5673"; transcript_id "gene-C7A06_RS33575"; ID "gene-C7A06_RS33575"; Name "katP"; Parent "nbis-gene-5673"; gbkey "Gene"; gene "katP"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33575"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	29578	31788	.	-	.	gene_id "nbis-gene-5673"; transcript_id "gene-C7A06_RS33575"; Dbxref "Genbank:WP_000592771.1"; ID "nbis-exon-5935"; Name "WP_000592771.1"; Parent "gene-C7A06_RS33575"; gbkey "CDS"; gene "katP"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000592771.1"; locus_tag "C7A06_RS33575"; product "catalase/peroxidase KatP"; protein_id "WP_000592771.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	29578	31788	.	-	0	gene_id "nbis-gene-5673"; transcript_id "gene-C7A06_RS33575"; Dbxref "Genbank:WP_000592771.1"; ID "cds-WP_000592771.1"; Name "WP_000592771.1"; Parent "gene-C7A06_RS33575"; gbkey "CDS"; gene "katP"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000592771.1"; locus_tag "C7A06_RS33575"; product "catalase/peroxidase KatP"; protein_id "WP_000592771.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	31961	33174	.	-	.	gene_id "nbis-gene-5674"; ID "nbis-gene-5674"; Name "C7A06_RS33585"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33585";
+NZ_CP027601.1	RefSeq	transcript	31961	33174	.	-	.	gene_id "nbis-gene-5674"; transcript_id "gene-C7A06_RS33585"; ID "gene-C7A06_RS33585"; Name "C7A06_RS33585"; Parent "nbis-gene-5674"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33585"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	31961	33174	.	-	.	gene_id "nbis-gene-5674"; transcript_id "gene-C7A06_RS33585"; Dbxref "Genbank:WP_162908515.1"; ID "nbis-exon-5936"; Name "WP_162908515.1"; Note "programmed frameshift"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33585"; exception "ribosomal slippage"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_086558238.1"; locus_tag "C7A06_RS33585"; product "IS3 family transposase"; protein_id "WP_162908515.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	31961	33174	.	-	2	gene_id "nbis-gene-5674"; transcript_id "gene-C7A06_RS33585"; Dbxref "Genbank:WP_162908515.1"; ID "cds-WP_162908515.1"; Name "WP_162908515.1"; Note "programmed frameshift"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33585"; exception "ribosomal slippage"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_086558238.1"; locus_tag "C7A06_RS33585"; product "IS3 family transposase"; protein_id "WP_162908515.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	33980	34957	.	+	.	gene_id "nbis-gene-5675"; ID "nbis-gene-5675"; Name "C7A06_RS33590"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33590";
+NZ_CP027601.1	RefSeq	transcript	33980	34957	.	+	.	gene_id "nbis-gene-5675"; transcript_id "gene-C7A06_RS33590"; ID "gene-C7A06_RS33590"; Name "C7A06_RS33590"; Parent "nbis-gene-5675"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33590"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	33980	34957	.	+	.	gene_id "nbis-gene-5675"; transcript_id "gene-C7A06_RS33590"; Dbxref "Genbank:WP_000361610.1"; ID "nbis-exon-5937"; Name "WP_000361610.1"; Ontology_term "GO:0006270" "GO:0003887"; Parent "gene-C7A06_RS33590"; gbkey "CDS"; go_function "DNA-directed DNA polymerase activity|0003887||IEA"; go_process "DNA replication initiation|0006270||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052630.2"; locus_tag "C7A06_RS33590"; product "RepB family plasmid replication initiator protein"; protein_id "WP_000361610.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	33980	34957	.	+	0	gene_id "nbis-gene-5675"; transcript_id "gene-C7A06_RS33590"; Dbxref "Genbank:WP_000361610.1"; ID "cds-WP_000361610.1"; Name "WP_000361610.1"; Ontology_term "GO:0006270" "GO:0003887"; Parent "gene-C7A06_RS33590"; gbkey "CDS"; go_function "DNA-directed DNA polymerase activity|0003887||IEA"; go_process "DNA replication initiation|0006270||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052630.2"; locus_tag "C7A06_RS33590"; product "RepB family plasmid replication initiator protein"; protein_id "WP_000361610.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	35141	35347	.	+	.	gene_id "nbis-gene-5676"; ID "nbis-gene-5676"; Name "C7A06_RS33595"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33595";
+NZ_CP027601.1	RefSeq	transcript	35141	35347	.	+	.	gene_id "nbis-gene-5676"; transcript_id "gene-C7A06_RS33595"; ID "gene-C7A06_RS33595"; Name "C7A06_RS33595"; Parent "nbis-gene-5676"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33595"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	35141	35347	.	+	.	gene_id "nbis-gene-5676"; transcript_id "gene-C7A06_RS33595"; Dbxref "Genbank:WP_012917682.1"; ID "nbis-exon-5938"; Name "WP_012917682.1"; Parent "gene-C7A06_RS33595"; gbkey "CDS"; inference "COORDINATES: protein motif:HMM:NF013677.2"; locus_tag "C7A06_RS33595"; product "transposase"; protein_id "WP_012917682.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	35141	35347	.	+	0	gene_id "nbis-gene-5676"; transcript_id "gene-C7A06_RS33595"; Dbxref "Genbank:WP_012917682.1"; ID "cds-WP_012917682.1"; Name "WP_012917682.1"; Parent "gene-C7A06_RS33595"; gbkey "CDS"; inference "COORDINATES: protein motif:HMM:NF013677.2"; locus_tag "C7A06_RS33595"; product "transposase"; protein_id "WP_012917682.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	35401	36075	.	+	.	gene_id "nbis-gene-5677"; ID "nbis-gene-5677"; Name "tnpA"; gbkey "Gene"; gene "tnpA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33600";
+NZ_CP027601.1	RefSeq	transcript	35401	36075	.	+	.	gene_id "nbis-gene-5677"; transcript_id "gene-C7A06_RS33600"; ID "gene-C7A06_RS33600"; Name "tnpA"; Parent "nbis-gene-5677"; gbkey "Gene"; gene "tnpA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33600"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	35401	36075	.	+	.	gene_id "nbis-gene-5677"; transcript_id "gene-C7A06_RS33600"; Dbxref "Genbank:WP_001341423.1"; ID "nbis-exon-5939"; Name "WP_001341423.1"; Ontology_term "GO:0006313" "GO:0003677" "GO:0004803"; Parent "gene-C7A06_RS33600"; gbkey "CDS"; gene "tnpA"; go_function "DNA binding|0003677||IEA" "transposase activity|0004803||IEA"; go_process "transposition, DNA-mediated|0006313||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_311873.1"; locus_tag "C7A06_RS33600"; product "IS66-like element accessory protein TnpA"; protein_id "WP_001341423.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	35401	36075	.	+	0	gene_id "nbis-gene-5677"; transcript_id "gene-C7A06_RS33600"; Dbxref "Genbank:WP_001341423.1"; ID "cds-WP_001341423.1-2"; Name "WP_001341423.1"; Ontology_term "GO:0006313" "GO:0003677" "GO:0004803"; Parent "gene-C7A06_RS33600"; gbkey "CDS"; gene "tnpA"; go_function "DNA binding|0003677||IEA" "transposase activity|0004803||IEA"; go_process "transposition, DNA-mediated|0006313||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_311873.1"; locus_tag "C7A06_RS33600"; product "IS66-like element accessory protein TnpA"; protein_id "WP_001341423.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	36072	36419	.	+	.	gene_id "nbis-gene-5678"; ID "nbis-gene-5678"; Name "tnpB"; gbkey "Gene"; gene "tnpB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33605";
+NZ_CP027601.1	RefSeq	transcript	36072	36419	.	+	.	gene_id "nbis-gene-5678"; transcript_id "gene-C7A06_RS33605"; ID "gene-C7A06_RS33605"; Name "tnpB"; Parent "nbis-gene-5678"; gbkey "Gene"; gene "tnpB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33605"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	36072	36419	.	+	.	gene_id "nbis-gene-5678"; transcript_id "gene-C7A06_RS33605"; Dbxref "Genbank:WP_000631725.1"; ID "nbis-exon-5940"; Name "WP_000631725.1"; Note "TnpB, as the term is used for proteins encoded by IS66 family insertion elements, is considered an accessory protein, since TnpC, encoded by a neighboring gene, is a DDE family transposase."; Parent "gene-C7A06_RS33605"; gbkey "CDS"; gene "tnpB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858152.1"; locus_tag "C7A06_RS33605"; product "IS66 family insertion sequence element accessory protein TnpB"; protein_id "WP_000631725.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	36072	36419	.	+	0	gene_id "nbis-gene-5678"; transcript_id "gene-C7A06_RS33605"; Dbxref "Genbank:WP_000631725.1"; ID "cds-WP_000631725.1-2"; Name "WP_000631725.1"; Note "TnpB, as the term is used for proteins encoded by IS66 family insertion elements, is considered an accessory protein, since TnpC, encoded by a neighboring gene, is a DDE family transposase."; Parent "gene-C7A06_RS33605"; gbkey "CDS"; gene "tnpB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858152.1"; locus_tag "C7A06_RS33605"; product "IS66 family insertion sequence element accessory protein TnpB"; protein_id "WP_000631725.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	36439	37991	.	+	.	gene_id "nbis-pseudogene-262"; ID "nbis-pseudogene-262"; Name "C7A06_RS33610"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33610"; original_biotype "pseudogene"; pseudo "true";
+NZ_CP027601.1	RefSeq	transcript	36439	37991	.	+	.	gene_id "nbis-pseudogene-262"; transcript_id "gene-C7A06_RS33610"; ID "gene-C7A06_RS33610"; Name "C7A06_RS33610"; Parent "nbis-pseudogene-262"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33610"; original_biotype "mrna"; pseudo "true";
+NZ_CP027601.1	Protein Homology	exon	36439	37991	.	+	.	gene_id "nbis-pseudogene-262"; transcript_id "gene-C7A06_RS33610"; ID "nbis-exon-5941"; Note "frameshifted"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33610"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001066419.1"; locus_tag "C7A06_RS33610"; product "IS66 family transposase"; pseudo "true"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	36439	37991	.	+	0	gene_id "nbis-pseudogene-262"; transcript_id "gene-C7A06_RS33610"; ID "cds-C7A06_RS33610"; Note "frameshifted"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33610"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001066419.1"; locus_tag "C7A06_RS33610"; product "IS66 family transposase"; pseudo "true"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	38025	38414	.	+	.	gene_id "nbis-pseudogene-263"; ID "nbis-pseudogene-263"; Name "C7A06_RS33615"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33615"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "38025";
+NZ_CP027601.1	RefSeq	transcript	38025	38414	.	+	.	gene_id "nbis-pseudogene-263"; transcript_id "gene-C7A06_RS33615"; ID "gene-C7A06_RS33615"; Name "C7A06_RS33615"; Parent "nbis-pseudogene-263"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33615"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "38025";
+NZ_CP027601.1	Protein Homology	exon	38025	38414	.	+	.	gene_id "nbis-pseudogene-263"; transcript_id "gene-C7A06_RS33615"; ID "nbis-exon-5942"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS33615"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052628.1"; locus_tag "C7A06_RS33615"; partial "true"; product "site-specific integrase"; pseudo "true"; start_range "." "38025"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	38025	38414	.	+	0	gene_id "nbis-pseudogene-263"; transcript_id "gene-C7A06_RS33615"; ID "cds-C7A06_RS33615"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS33615"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052628.1"; locus_tag "C7A06_RS33615"; partial "true"; product "site-specific integrase"; pseudo "true"; start_range "." "38025"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	38815	39180	.	+	.	gene_id "nbis-gene-5679"; ID "nbis-gene-5679"; Name "C7A06_RS33625"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33625";
+NZ_CP027601.1	RefSeq	transcript	38815	39180	.	+	.	gene_id "nbis-gene-5679"; transcript_id "gene-C7A06_RS33625"; ID "gene-C7A06_RS33625"; Name "C7A06_RS33625"; Parent "nbis-gene-5679"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33625"; original_biotype "mrna";
+NZ_CP027601.1	GeneMarkS-2+	exon	38815	39180	.	+	.	gene_id "nbis-gene-5679"; transcript_id "gene-C7A06_RS33625"; Dbxref "Genbank:WP_000091308.1"; ID "nbis-exon-5943"; Name "WP_000091308.1"; Parent "gene-C7A06_RS33625"; gbkey "CDS"; inference "COORDINATES: ab initio prediction:GeneMarkS-2+"; locus_tag "C7A06_RS33625"; product "hypothetical protein"; protein_id "WP_000091308.1"; transl_table "11";
+NZ_CP027601.1	GeneMarkS-2+	CDS	38815	39180	.	+	0	gene_id "nbis-gene-5679"; transcript_id "gene-C7A06_RS33625"; Dbxref "Genbank:WP_000091308.1"; ID "cds-WP_000091308.1"; Name "WP_000091308.1"; Parent "gene-C7A06_RS33625"; gbkey "CDS"; inference "COORDINATES: ab initio prediction:GeneMarkS-2+"; locus_tag "C7A06_RS33625"; product "hypothetical protein"; protein_id "WP_000091308.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	39180	40367	.	+	.	gene_id "nbis-gene-5680"; ID "nbis-gene-5680"; Name "C7A06_RS33630"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33630";
+NZ_CP027601.1	RefSeq	transcript	39180	40367	.	+	.	gene_id "nbis-gene-5680"; transcript_id "gene-C7A06_RS33630"; ID "gene-C7A06_RS33630"; Name "C7A06_RS33630"; Parent "nbis-gene-5680"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33630"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	39180	40367	.	+	.	gene_id "nbis-gene-5680"; transcript_id "gene-C7A06_RS33630"; Dbxref "Genbank:WP_000937603.1"; ID "nbis-exon-5944"; Name "WP_000937603.1"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33630"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_013747467.1"; locus_tag "C7A06_RS33630"; product "IS91 family transposase"; protein_id "WP_000937603.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	39180	40367	.	+	0	gene_id "nbis-gene-5680"; transcript_id "gene-C7A06_RS33630"; Dbxref "Genbank:WP_000937603.1"; ID "cds-WP_000937603.1"; Name "WP_000937603.1"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33630"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_013747467.1"; locus_tag "C7A06_RS33630"; product "IS91 family transposase"; protein_id "WP_000937603.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	40646	42198	.	-	.	gene_id "nbis-pseudogene-264"; ID "nbis-pseudogene-264"; Name "C7A06_RS33635"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33635"; original_biotype "pseudogene"; pseudo "true";
+NZ_CP027601.1	RefSeq	transcript	40646	42198	.	-	.	gene_id "nbis-pseudogene-264"; transcript_id "gene-C7A06_RS33635"; ID "gene-C7A06_RS33635"; Name "C7A06_RS33635"; Parent "nbis-pseudogene-264"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33635"; original_biotype "mrna"; pseudo "true";
+NZ_CP027601.1	Protein Homology	exon	40646	42198	.	-	.	gene_id "nbis-pseudogene-264"; transcript_id "gene-C7A06_RS33635"; ID "nbis-exon-5945"; Note "frameshifted"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33635"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001066419.1"; locus_tag "C7A06_RS33635"; product "IS66 family transposase"; pseudo "true"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	40646	42198	.	-	0	gene_id "nbis-pseudogene-264"; transcript_id "gene-C7A06_RS33635"; ID "cds-C7A06_RS33635"; Note "frameshifted"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33635"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001066419.1"; locus_tag "C7A06_RS33635"; product "IS66 family transposase"; pseudo "true"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	42218	42565	.	-	.	gene_id "nbis-gene-5681"; ID "nbis-gene-5681"; Name "tnpB"; gbkey "Gene"; gene "tnpB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33640";
+NZ_CP027601.1	RefSeq	transcript	42218	42565	.	-	.	gene_id "nbis-gene-5681"; transcript_id "gene-C7A06_RS33640"; ID "gene-C7A06_RS33640"; Name "tnpB"; Parent "nbis-gene-5681"; gbkey "Gene"; gene "tnpB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33640"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	42218	42565	.	-	.	gene_id "nbis-gene-5681"; transcript_id "gene-C7A06_RS33640"; Dbxref "Genbank:WP_000631725.1"; ID "nbis-exon-5946"; Name "WP_000631725.1"; Note "TnpB, as the term is used for proteins encoded by IS66 family insertion elements, is considered an accessory protein, since TnpC, encoded by a neighboring gene, is a DDE family transposase."; Parent "gene-C7A06_RS33640"; gbkey "CDS"; gene "tnpB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858152.1"; locus_tag "C7A06_RS33640"; product "IS66 family insertion sequence element accessory protein TnpB"; protein_id "WP_000631725.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	42218	42565	.	-	0	gene_id "nbis-gene-5681"; transcript_id "gene-C7A06_RS33640"; Dbxref "Genbank:WP_000631725.1"; ID "cds-WP_000631725.1-3"; Name "WP_000631725.1"; Note "TnpB, as the term is used for proteins encoded by IS66 family insertion elements, is considered an accessory protein, since TnpC, encoded by a neighboring gene, is a DDE family transposase."; Parent "gene-C7A06_RS33640"; gbkey "CDS"; gene "tnpB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858152.1"; locus_tag "C7A06_RS33640"; product "IS66 family insertion sequence element accessory protein TnpB"; protein_id "WP_000631725.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	42562	43236	.	-	.	gene_id "nbis-gene-5682"; ID "nbis-gene-5682"; Name "tnpA"; gbkey "Gene"; gene "tnpA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33645";
+NZ_CP027601.1	RefSeq	transcript	42562	43236	.	-	.	gene_id "nbis-gene-5682"; transcript_id "gene-C7A06_RS33645"; ID "gene-C7A06_RS33645"; Name "tnpA"; Parent "nbis-gene-5682"; gbkey "Gene"; gene "tnpA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33645"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	42562	43236	.	-	.	gene_id "nbis-gene-5682"; transcript_id "gene-C7A06_RS33645"; Dbxref "Genbank:WP_001341423.1"; ID "nbis-exon-5947"; Name "WP_001341423.1"; Ontology_term "GO:0006313" "GO:0003677" "GO:0004803"; Parent "gene-C7A06_RS33645"; gbkey "CDS"; gene "tnpA"; go_function "DNA binding|0003677||IEA" "transposase activity|0004803||IEA"; go_process "transposition, DNA-mediated|0006313||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_311873.1"; locus_tag "C7A06_RS33645"; product "IS66-like element accessory protein TnpA"; protein_id "WP_001341423.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	42562	43236	.	-	0	gene_id "nbis-gene-5682"; transcript_id "gene-C7A06_RS33645"; Dbxref "Genbank:WP_001341423.1"; ID "cds-WP_001341423.1-3"; Name "WP_001341423.1"; Ontology_term "GO:0006313" "GO:0003677" "GO:0004803"; Parent "gene-C7A06_RS33645"; gbkey "CDS"; gene "tnpA"; go_function "DNA binding|0003677||IEA" "transposase activity|0004803||IEA"; go_process "transposition, DNA-mediated|0006313||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_311873.1"; locus_tag "C7A06_RS33645"; product "IS66-like element accessory protein TnpA"; protein_id "WP_001341423.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	43320	43676	.	-	.	gene_id "nbis-pseudogene-265"; ID "nbis-pseudogene-265"; Name "C7A06_RS33650"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33650"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "43320";
+NZ_CP027601.1	RefSeq	transcript	43320	43676	.	-	.	gene_id "nbis-pseudogene-265"; transcript_id "gene-C7A06_RS33650"; ID "gene-C7A06_RS33650"; Name "C7A06_RS33650"; Parent "nbis-pseudogene-265"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33650"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "43320";
+NZ_CP027601.1	Protein Homology	exon	43320	43676	.	-	.	gene_id "nbis-pseudogene-265"; transcript_id "gene-C7A06_RS33650"; ID "nbis-exon-5948"; Note "incomplete; partial in the middle of a contig; missing C-terminus"; Ontology_term "GO:0006310" "GO:0015074" "GO:0003677"; Parent "gene-C7A06_RS33650"; gbkey "CDS"; go_function "DNA binding|0003677||IEA"; go_process "DNA recombination|0006310||IEA" "DNA integration|0015074||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052628.1"; locus_tag "C7A06_RS33650"; partial "true"; product "tyrosine-type recombinase/integrase"; pseudo "true"; start_range "." "43320"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	43320	43676	.	-	0	gene_id "nbis-pseudogene-265"; transcript_id "gene-C7A06_RS33650"; ID "cds-C7A06_RS33650"; Note "incomplete; partial in the middle of a contig; missing C-terminus"; Ontology_term "GO:0006310" "GO:0015074" "GO:0003677"; Parent "gene-C7A06_RS33650"; gbkey "CDS"; go_function "DNA binding|0003677||IEA"; go_process "DNA recombination|0006310||IEA" "DNA integration|0015074||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052628.1"; locus_tag "C7A06_RS33650"; partial "true"; product "tyrosine-type recombinase/integrase"; pseudo "true"; start_range "." "43320"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	43804	44664	.	+	.	gene_id "nbis-gene-5683"; ID "nbis-gene-5683"; Name "C7A06_RS33655"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33655";
+NZ_CP027601.1	RefSeq	transcript	43804	44664	.	+	.	gene_id "nbis-gene-5683"; transcript_id "gene-C7A06_RS33655"; ID "gene-C7A06_RS33655"; Name "C7A06_RS33655"; Parent "nbis-gene-5683"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33655"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	43804	44664	.	+	.	gene_id "nbis-gene-5683"; transcript_id "gene-C7A06_RS33655"; Dbxref "Genbank:WP_000704534.1"; ID "nbis-exon-5949"; Name "WP_000704534.1"; Parent "gene-C7A06_RS33655"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052670.1"; locus_tag "C7A06_RS33655"; product "alpha/beta hydrolase"; protein_id "WP_000704534.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	43804	44664	.	+	0	gene_id "nbis-gene-5683"; transcript_id "gene-C7A06_RS33655"; Dbxref "Genbank:WP_000704534.1"; ID "cds-WP_000704534.1"; Name "WP_000704534.1"; Parent "gene-C7A06_RS33655"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052670.1"; locus_tag "C7A06_RS33655"; product "alpha/beta hydrolase"; protein_id "WP_000704534.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	45279	45428	.	+	.	gene_id "nbis-gene-5806"; ID "nbis-gene-5806"; Name "C7A06_RS34665"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS34665";
+NZ_CP027601.1	RefSeq	transcript	45279	45428	.	+	.	gene_id "nbis-gene-5806"; transcript_id "gene-C7A06_RS34665"; ID "gene-C7A06_RS34665"; Name "C7A06_RS34665"; Parent "nbis-gene-5806"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS34665"; original_biotype "mrna";
+NZ_CP027601.1	GeneMarkS-2+	exon	45279	45428	.	+	.	gene_id "nbis-gene-5806"; transcript_id "gene-C7A06_RS34665"; Dbxref "Genbank:WP_000955366.1"; ID "nbis-exon-6115"; Name "WP_000955366.1"; Parent "gene-C7A06_RS34665"; gbkey "CDS"; inference "COORDINATES: ab initio prediction:GeneMarkS-2+"; locus_tag "C7A06_RS34665"; product "hypothetical protein"; protein_id "WP_000955366.1"; transl_table "11";
+NZ_CP027601.1	GeneMarkS-2+	CDS	45279	45428	.	+	0	gene_id "nbis-gene-5806"; transcript_id "gene-C7A06_RS34665"; Dbxref "Genbank:WP_000955366.1"; ID "cds-WP_000955366.1"; Name "WP_000955366.1"; Parent "gene-C7A06_RS34665"; gbkey "CDS"; inference "COORDINATES: ab initio prediction:GeneMarkS-2+"; locus_tag "C7A06_RS34665"; product "hypothetical protein"; protein_id "WP_000955366.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	45469	46625	.	-	.	gene_id "nbis-gene-5684"; ID "nbis-gene-5684"; Name "C7A06_RS33660"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33660";
+NZ_CP027601.1	RefSeq	transcript	45469	46625	.	-	.	gene_id "nbis-gene-5684"; transcript_id "gene-C7A06_RS33660"; ID "gene-C7A06_RS33660"; Name "C7A06_RS33660"; Parent "nbis-gene-5684"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33660"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	45469	46625	.	-	.	gene_id "nbis-gene-5684"; transcript_id "gene-C7A06_RS33660"; Dbxref "Genbank:WP_085948186.1"; ID "nbis-exon-5950"; Name "WP_085948186.1"; Note "programmed frameshift"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33660"; exception "ribosomal slippage"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_076611998.1"; locus_tag "C7A06_RS33660"; product "IS3 family transposase"; protein_id "WP_085948186.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	45469	46625	.	-	2	gene_id "nbis-gene-5684"; transcript_id "gene-C7A06_RS33660"; Dbxref "Genbank:WP_085948186.1"; ID "cds-WP_085948186.1-12"; Name "WP_085948186.1"; Note "programmed frameshift"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33660"; exception "ribosomal slippage"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_076611998.1"; locus_tag "C7A06_RS33660"; product "IS3 family transposase"; protein_id "WP_085948186.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	46693	47238	.	+	.	gene_id "nbis-gene-5685"; ID "nbis-gene-5685"; Name "C7A06_RS33665"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33665";
+NZ_CP027601.1	RefSeq	transcript	46693	47238	.	+	.	gene_id "nbis-gene-5685"; transcript_id "gene-C7A06_RS33665"; ID "gene-C7A06_RS33665"; Name "C7A06_RS33665"; Parent "nbis-gene-5685"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33665"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	46693	47238	.	+	.	gene_id "nbis-gene-5685"; transcript_id "gene-C7A06_RS33665"; Dbxref "Genbank:WP_001165114.1"; ID "nbis-exon-5951"; Name "WP_001165114.1"; Parent "gene-C7A06_RS33665"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001165114.1"; locus_tag "C7A06_RS33665"; product "hypothetical protein"; protein_id "WP_001165114.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	46693	47238	.	+	0	gene_id "nbis-gene-5685"; transcript_id "gene-C7A06_RS33665"; Dbxref "Genbank:WP_001165114.1"; ID "cds-WP_001165114.1"; Name "WP_001165114.1"; Parent "gene-C7A06_RS33665"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001165114.1"; locus_tag "C7A06_RS33665"; product "hypothetical protein"; protein_id "WP_001165114.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	47400	47816	.	-	.	gene_id "nbis-gene-5686"; ID "nbis-gene-5686"; Name "C7A06_RS33670"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33670";
+NZ_CP027601.1	RefSeq	transcript	47400	47816	.	-	.	gene_id "nbis-gene-5686"; transcript_id "gene-C7A06_RS33670"; ID "gene-C7A06_RS33670"; Name "C7A06_RS33670"; Parent "nbis-gene-5686"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33670"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	47400	47816	.	-	.	gene_id "nbis-gene-5686"; transcript_id "gene-C7A06_RS33670"; Dbxref "Genbank:WP_001044768.1"; ID "nbis-exon-5952"; Name "WP_001044768.1"; Parent "gene-C7A06_RS33670"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_005229630.1"; locus_tag "C7A06_RS33670"; product "type II toxin-antitoxin system VapC family toxin"; protein_id "WP_001044768.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	47400	47816	.	-	0	gene_id "nbis-gene-5686"; transcript_id "gene-C7A06_RS33670"; Dbxref "Genbank:WP_001044768.1"; ID "cds-WP_001044768.1"; Name "WP_001044768.1"; Parent "gene-C7A06_RS33670"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_005229630.1"; locus_tag "C7A06_RS33670"; product "type II toxin-antitoxin system VapC family toxin"; protein_id "WP_001044768.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	47813	48043	.	-	.	gene_id "nbis-gene-5687"; ID "nbis-gene-5687"; Name "vapB"; gbkey "Gene"; gene "vapB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33675";
+NZ_CP027601.1	RefSeq	transcript	47813	48043	.	-	.	gene_id "nbis-gene-5687"; transcript_id "gene-C7A06_RS33675"; ID "gene-C7A06_RS33675"; Name "vapB"; Parent "nbis-gene-5687"; gbkey "Gene"; gene "vapB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33675"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	47813	48043	.	-	.	gene_id "nbis-gene-5687"; transcript_id "gene-C7A06_RS33675"; Dbxref "Genbank:WP_001261287.1"; ID "nbis-exon-5953"; Name "WP_001261287.1"; Parent "gene-C7A06_RS33675"; gbkey "CDS"; gene "vapB"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_005229629.1"; locus_tag "C7A06_RS33675"; product "type II toxin-antitoxin system VapB family antitoxin"; protein_id "WP_001261287.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	47813	48043	.	-	0	gene_id "nbis-gene-5687"; transcript_id "gene-C7A06_RS33675"; Dbxref "Genbank:WP_001261287.1"; ID "cds-WP_001261287.1"; Name "WP_001261287.1"; Parent "gene-C7A06_RS33675"; gbkey "CDS"; gene "vapB"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_005229629.1"; locus_tag "C7A06_RS33675"; product "type II toxin-antitoxin system VapB family antitoxin"; protein_id "WP_001261287.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	48603	49016	.	+	.	gene_id "nbis-gene-5688"; ID "nbis-gene-5688"; Name "C7A06_RS33695"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33695";
+NZ_CP027601.1	RefSeq	transcript	48603	49016	.	+	.	gene_id "nbis-gene-5688"; transcript_id "gene-C7A06_RS33695"; ID "gene-C7A06_RS33695"; Name "C7A06_RS33695"; Parent "nbis-gene-5688"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33695"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	48603	49016	.	+	.	gene_id "nbis-gene-5688"; transcript_id "gene-C7A06_RS33695"; Dbxref "Genbank:WP_000465041.1"; ID "nbis-exon-5954"; Name "WP_000465041.1"; Parent "gene-C7A06_RS33695"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001536595.1"; locus_tag "C7A06_RS33695"; product "hypothetical protein"; protein_id "WP_000465041.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	48603	49016	.	+	0	gene_id "nbis-gene-5688"; transcript_id "gene-C7A06_RS33695"; Dbxref "Genbank:WP_000465041.1"; ID "cds-WP_000465041.1"; Name "WP_000465041.1"; Parent "gene-C7A06_RS33695"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001536595.1"; locus_tag "C7A06_RS33695"; product "hypothetical protein"; protein_id "WP_000465041.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	49018	49800	.	+	.	gene_id "nbis-gene-5689"; ID "nbis-gene-5689"; Name "C7A06_RS33700"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33700";
+NZ_CP027601.1	RefSeq	transcript	49018	49800	.	+	.	gene_id "nbis-gene-5689"; transcript_id "gene-C7A06_RS33700"; ID "gene-C7A06_RS33700"; Name "C7A06_RS33700"; Parent "nbis-gene-5689"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33700"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	49018	49800	.	+	.	gene_id "nbis-gene-5689"; transcript_id "gene-C7A06_RS33700"; Dbxref "Genbank:WP_001164205.1"; ID "nbis-exon-5955"; Name "WP_001164205.1"; Parent "gene-C7A06_RS33700"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001164193.1"; locus_tag "C7A06_RS33700"; product "site-specific integrase"; protein_id "WP_001164205.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	49018	49800	.	+	0	gene_id "nbis-gene-5689"; transcript_id "gene-C7A06_RS33700"; Dbxref "Genbank:WP_001164205.1"; ID "cds-WP_001164205.1"; Name "WP_001164205.1"; Parent "gene-C7A06_RS33700"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001164193.1"; locus_tag "C7A06_RS33700"; product "site-specific integrase"; protein_id "WP_001164205.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	49972	50325	.	+	.	gene_id "nbis-gene-5690"; ID "nbis-gene-5690"; Name "cmi"; gbkey "Gene"; gene "cmi"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33705";
+NZ_CP027601.1	RefSeq	transcript	49972	50325	.	+	.	gene_id "nbis-gene-5690"; transcript_id "gene-C7A06_RS33705"; ID "gene-C7A06_RS33705"; Name "cmi"; Parent "nbis-gene-5690"; gbkey "Gene"; gene "cmi"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33705"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	49972	50325	.	+	.	gene_id "nbis-gene-5690"; transcript_id "gene-C7A06_RS33705"; Dbxref "Genbank:WP_000864810.1"; ID "nbis-exon-5956"; Name "WP_000864810.1"; Parent "gene-C7A06_RS33705"; gbkey "CDS"; gene "cmi"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_104216667.1"; locus_tag "C7A06_RS33705"; product "colicin M immunity protein"; protein_id "WP_000864810.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	49972	50325	.	+	0	gene_id "nbis-gene-5690"; transcript_id "gene-C7A06_RS33705"; Dbxref "Genbank:WP_000864810.1"; ID "cds-WP_000864810.1"; Name "WP_000864810.1"; Parent "gene-C7A06_RS33705"; gbkey "CDS"; gene "cmi"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_104216667.1"; locus_tag "C7A06_RS33705"; product "colicin M immunity protein"; protein_id "WP_000864810.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	50333	50524	.	-	.	gene_id "nbis-pseudogene-266"; ID "nbis-pseudogene-266"; Name "C7A06_RS33710"; end_range "50524" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33710"; original_biotype "pseudogene"; partial "true"; pseudo "true";
+NZ_CP027601.1	RefSeq	transcript	50333	50524	.	-	.	gene_id "nbis-pseudogene-266"; transcript_id "gene-C7A06_RS33710"; ID "gene-C7A06_RS33710"; Name "C7A06_RS33710"; Parent "nbis-pseudogene-266"; end_range "50524" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33710"; original_biotype "mrna"; partial "true"; pseudo "true";
+NZ_CP027601.1	Protein Homology	exon	50333	50524	.	-	.	gene_id "nbis-pseudogene-266"; transcript_id "gene-C7A06_RS33710"; ID "nbis-exon-5957"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Ontology_term "GO:0042742"; Parent "gene-C7A06_RS33710"; end_range "50524" "."; gbkey "CDS"; go_process "defense response to bacterium|0042742||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000449473.1"; locus_tag "C7A06_RS33710"; partial "true"; product "lipid II-degrading bacteriocin"; pseudo "true"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	50333	50524	.	-	0	gene_id "nbis-pseudogene-266"; transcript_id "gene-C7A06_RS33710"; ID "cds-C7A06_RS33710"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Ontology_term "GO:0042742"; Parent "gene-C7A06_RS33710"; end_range "50524" "."; gbkey "CDS"; go_process "defense response to bacterium|0042742||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000449473.1"; locus_tag "C7A06_RS33710"; partial "true"; product "lipid II-degrading bacteriocin"; pseudo "true"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	50528	50671	.	-	.	gene_id "nbis-pseudogene-267"; ID "nbis-pseudogene-267"; Name "C7A06_RS33715"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33715"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "50528";
+NZ_CP027601.1	RefSeq	transcript	50528	50671	.	-	.	gene_id "nbis-pseudogene-267"; transcript_id "gene-C7A06_RS33715"; ID "gene-C7A06_RS33715"; Name "C7A06_RS33715"; Parent "nbis-pseudogene-267"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33715"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "50528";
+NZ_CP027601.1	Protein Homology	exon	50528	50671	.	-	.	gene_id "nbis-pseudogene-267"; transcript_id "gene-C7A06_RS33715"; ID "nbis-exon-5958"; Note "incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS33715"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_958720.1"; locus_tag "C7A06_RS33715"; partial "true"; product "transcriptional regulator"; pseudo "true"; start_range "." "50528"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	50528	50671	.	-	0	gene_id "nbis-pseudogene-267"; transcript_id "gene-C7A06_RS33715"; ID "cds-C7A06_RS33715"; Note "incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS33715"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_958720.1"; locus_tag "C7A06_RS33715"; partial "true"; product "transcriptional regulator"; pseudo "true"; start_range "." "50528"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	50738	52176	.	-	.	gene_id "nbis-pseudogene-268"; ID "nbis-pseudogene-268"; Name "ehxD"; gbkey "Gene"; gene "ehxD"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33720"; original_biotype "pseudogene"; pseudo "true";
+NZ_CP027601.1	RefSeq	transcript	50738	52176	.	-	.	gene_id "nbis-pseudogene-268"; transcript_id "gene-C7A06_RS33720"; ID "gene-C7A06_RS33720"; Name "ehxD"; Parent "nbis-pseudogene-268"; gbkey "Gene"; gene "ehxD"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33720"; original_biotype "mrna"; pseudo "true";
+NZ_CP027601.1	Protein Homology	exon	50738	52176	.	-	.	gene_id "nbis-pseudogene-268"; transcript_id "gene-C7A06_RS33720"; ID "nbis-exon-5959"; Note "frameshifted"; Parent "gene-C7A06_RS33720"; gbkey "CDS"; gene "ehxD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052626.1"; locus_tag "C7A06_RS33720"; product "enterohemolysin T1SS ABC transporter subunit EhxD"; pseudo "true"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	50738	52176	.	-	0	gene_id "nbis-pseudogene-268"; transcript_id "gene-C7A06_RS33720"; ID "cds-C7A06_RS33720"; Note "frameshifted"; Parent "gene-C7A06_RS33720"; gbkey "CDS"; gene "ehxD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052626.1"; locus_tag "C7A06_RS33720"; product "enterohemolysin T1SS ABC transporter subunit EhxD"; pseudo "true"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	52180	54300	.	-	.	gene_id "nbis-gene-5691"; ID "nbis-gene-5691"; Name "ehxB"; gbkey "Gene"; gene "ehxB"; gene_biotype "protein_coding"; gene_synonym "hlyB"; locus_tag "C7A06_RS33725";
+NZ_CP027601.1	RefSeq	transcript	52180	54300	.	-	.	gene_id "nbis-gene-5691"; transcript_id "gene-C7A06_RS33725"; ID "gene-C7A06_RS33725"; Name "ehxB"; Parent "nbis-gene-5691"; gbkey "Gene"; gene "ehxB"; gene_biotype "protein_coding"; gene_synonym "hlyB"; locus_tag "C7A06_RS33725"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	52180	54300	.	-	.	gene_id "nbis-gene-5691"; transcript_id "gene-C7A06_RS33725"; Dbxref "Genbank:WP_000987096.1"; ID "nbis-exon-5960"; Name "WP_000987096.1"; Parent "gene-C7A06_RS33725"; gbkey "CDS"; gene "ehxB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052625.1"; locus_tag "C7A06_RS33725"; product "enterohemolysin T1SS ABC transporter permease/ATPase EhxB"; protein_id "WP_000987096.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	52180	54300	.	-	0	gene_id "nbis-gene-5691"; transcript_id "gene-C7A06_RS33725"; Dbxref "Genbank:WP_000987096.1"; ID "cds-WP_000987096.1"; Name "WP_000987096.1"; Parent "gene-C7A06_RS33725"; gbkey "CDS"; gene "ehxB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052625.1"; locus_tag "C7A06_RS33725"; product "enterohemolysin T1SS ABC transporter permease/ATPase EhxB"; protein_id "WP_000987096.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	54350	57346	.	-	.	gene_id "nbis-gene-5692"; ID "nbis-gene-5692"; Name "ehxA"; gbkey "Gene"; gene "ehxA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33730";
+NZ_CP027601.1	RefSeq	transcript	54350	57346	.	-	.	gene_id "nbis-gene-5692"; transcript_id "gene-C7A06_RS33730"; ID "gene-C7A06_RS33730"; Name "ehxA"; Parent "nbis-gene-5692"; gbkey "Gene"; gene "ehxA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33730"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	54350	57346	.	-	.	gene_id "nbis-gene-5692"; transcript_id "gene-C7A06_RS33730"; Dbxref "Genbank:WP_000217745.1"; ID "nbis-exon-5961"; Name "WP_000217745.1"; Parent "gene-C7A06_RS33730"; gbkey "CDS"; gene "ehxA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052624.1"; locus_tag "C7A06_RS33730"; product "enterohemolysin EhxA"; protein_id "WP_000217745.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	54350	57346	.	-	0	gene_id "nbis-gene-5692"; transcript_id "gene-C7A06_RS33730"; Dbxref "Genbank:WP_000217745.1"; ID "cds-WP_000217745.1"; Name "WP_000217745.1"; Parent "gene-C7A06_RS33730"; gbkey "CDS"; gene "ehxA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052624.1"; locus_tag "C7A06_RS33730"; product "enterohemolysin EhxA"; protein_id "WP_000217745.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	57348	57862	.	-	.	gene_id "nbis-pseudogene-269"; ID "nbis-pseudogene-269"; Name "ehxC"; gbkey "Gene"; gene "ehxC"; gene_biotype "pseudogene"; gene_synonym "hlyC"; locus_tag "C7A06_RS33735"; original_biotype "pseudogene"; pseudo "true";
+NZ_CP027601.1	RefSeq	transcript	57348	57862	.	-	.	gene_id "nbis-pseudogene-269"; transcript_id "gene-C7A06_RS33735"; ID "gene-C7A06_RS33735"; Name "ehxC"; Parent "nbis-pseudogene-269"; gbkey "Gene"; gene "ehxC"; gene_biotype "pseudogene"; gene_synonym "hlyC"; locus_tag "C7A06_RS33735"; original_biotype "mrna"; pseudo "true";
+NZ_CP027601.1	Protein Homology	exon	57348	57862	.	-	.	gene_id "nbis-pseudogene-269"; transcript_id "gene-C7A06_RS33735"; ID "nbis-exon-5962"; Note "frameshifted"; Parent "gene-C7A06_RS33735"; gbkey "CDS"; gene "ehxC"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000839950.1"; locus_tag "C7A06_RS33735"; product "enterohemolysin-activating lysine-acyltransferase EhxC"; pseudo "true"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	57348	57862	.	-	0	gene_id "nbis-pseudogene-269"; transcript_id "gene-C7A06_RS33735"; ID "cds-C7A06_RS33735"; Note "frameshifted"; Parent "gene-C7A06_RS33735"; gbkey "CDS"; gene "ehxC"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000839950.1"; locus_tag "C7A06_RS33735"; product "enterohemolysin-activating lysine-acyltransferase EhxC"; pseudo "true"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	58385	59037	.	-	.	gene_id "nbis-pseudogene-270"; ID "nbis-pseudogene-270"; Name "C7A06_RS33745"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33745"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "58385";
+NZ_CP027601.1	RefSeq	transcript	58385	59037	.	-	.	gene_id "nbis-pseudogene-270"; transcript_id "gene-C7A06_RS33745"; ID "gene-C7A06_RS33745"; Name "C7A06_RS33745"; Parent "nbis-pseudogene-270"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33745"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "58385";
+NZ_CP027601.1	Protein Homology	exon	58385	59037	.	-	.	gene_id "nbis-pseudogene-270"; transcript_id "gene-C7A06_RS33745"; ID "nbis-exon-5963"; Note "frameshifted; incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS33745"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_076612086.1"; locus_tag "C7A06_RS33745"; partial "true"; product "IS3 family transposase"; pseudo "true"; start_range "." "58385"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	58385	59037	.	-	0	gene_id "nbis-pseudogene-270"; transcript_id "gene-C7A06_RS33745"; ID "cds-C7A06_RS33745"; Note "frameshifted; incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS33745"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_076612086.1"; locus_tag "C7A06_RS33745"; partial "true"; product "IS3 family transposase"; pseudo "true"; start_range "." "58385"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	60511	61332	.	+	.	gene_id "nbis-gene-5693"; ID "nbis-gene-5693"; Name "C7A06_RS33755"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33755";
+NZ_CP027601.1	RefSeq	transcript	60511	61332	.	+	.	gene_id "nbis-gene-5693"; transcript_id "gene-C7A06_RS33755"; ID "gene-C7A06_RS33755"; Name "C7A06_RS33755"; Parent "nbis-gene-5693"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33755"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	60511	61332	.	+	.	gene_id "nbis-gene-5693"; transcript_id "gene-C7A06_RS33755"; Dbxref "Genbank:WP_001302199.1"; ID "nbis-exon-5964"; Name "WP_001302199.1"; Parent "gene-C7A06_RS33755"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001302199.1"; locus_tag "C7A06_RS33755"; product "polysaccharide deacetylase family protein"; protein_id "WP_001302199.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	60511	61332	.	+	0	gene_id "nbis-gene-5693"; transcript_id "gene-C7A06_RS33755"; Dbxref "Genbank:WP_001302199.1"; ID "cds-WP_001302199.1"; Name "WP_001302199.1"; Parent "gene-C7A06_RS33755"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001302199.1"; locus_tag "C7A06_RS33755"; product "polysaccharide deacetylase family protein"; protein_id "WP_001302199.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	61332	62438	.	+	.	gene_id "nbis-gene-5694"; ID "nbis-gene-5694"; Name "C7A06_RS33760"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33760";
+NZ_CP027601.1	RefSeq	transcript	61332	62438	.	+	.	gene_id "nbis-gene-5694"; transcript_id "gene-C7A06_RS33760"; ID "gene-C7A06_RS33760"; Name "C7A06_RS33760"; Parent "nbis-gene-5694"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33760"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	61332	62438	.	+	.	gene_id "nbis-gene-5694"; transcript_id "gene-C7A06_RS33760"; Dbxref "Genbank:WP_000975743.1"; ID "nbis-exon-5965"; Name "WP_000975743.1"; Parent "gene-C7A06_RS33760"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052687.1"; locus_tag "C7A06_RS33760"; product "glycosyltransferase family 4 protein"; protein_id "WP_000975743.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	61332	62438	.	+	0	gene_id "nbis-gene-5694"; transcript_id "gene-C7A06_RS33760"; Dbxref "Genbank:WP_000975743.1"; ID "cds-WP_000975743.1"; Name "WP_000975743.1"; Parent "gene-C7A06_RS33760"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052687.1"; locus_tag "C7A06_RS33760"; product "glycosyltransferase family 4 protein"; protein_id "WP_000975743.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	62532	64253	.	+	.	gene_id "nbis-gene-5695"; ID "nbis-gene-5695"; Name "cptA"; gbkey "Gene"; gene "cptA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33765";
+NZ_CP027601.1	RefSeq	transcript	62532	64253	.	+	.	gene_id "nbis-gene-5695"; transcript_id "gene-C7A06_RS33765"; ID "gene-C7A06_RS33765"; Name "cptA"; Parent "nbis-gene-5695"; gbkey "Gene"; gene "cptA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33765"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	62532	64253	.	+	.	gene_id "nbis-gene-5695"; transcript_id "gene-C7A06_RS33765"; Dbxref "Genbank:WP_000550559.1"; ID "nbis-exon-5966"; Name "WP_000550559.1"; Parent "gene-C7A06_RS33765"; gbkey "CDS"; gene "cptA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052688.1"; locus_tag "C7A06_RS33765"; product "phosphoethanolamine transferase CptA"; protein_id "WP_000550559.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	62532	64253	.	+	0	gene_id "nbis-gene-5695"; transcript_id "gene-C7A06_RS33765"; Dbxref "Genbank:WP_000550559.1"; ID "cds-WP_000550559.1"; Name "WP_000550559.1"; Parent "gene-C7A06_RS33765"; gbkey "CDS"; gene "cptA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052688.1"; locus_tag "C7A06_RS33765"; product "phosphoethanolamine transferase CptA"; protein_id "WP_000550559.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	64327	65325	.	+	.	gene_id "nbis-gene-5696"; ID "nbis-gene-5696"; Name "lpxM"; gbkey "Gene"; gene "lpxM"; gene_biotype "protein_coding"; gene_synonym "msbB"; locus_tag "C7A06_RS33770";
+NZ_CP027601.1	RefSeq	transcript	64327	65325	.	+	.	gene_id "nbis-gene-5696"; transcript_id "gene-C7A06_RS33770"; ID "gene-C7A06_RS33770"; Name "lpxM"; Parent "nbis-gene-5696"; gbkey "Gene"; gene "lpxM"; gene_biotype "protein_coding"; gene_synonym "msbB"; locus_tag "C7A06_RS33770"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	64327	65325	.	+	.	gene_id "nbis-gene-5696"; transcript_id "gene-C7A06_RS33770"; Dbxref "Genbank:WP_012680945.1"; ID "nbis-exon-5967"; Name "WP_012680945.1"; Note "LpxM is lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase, an enzyme characterized in Escherichia coli and involved in biosynthesis of the form of lipid A found in that species and some closely related species."; Ontology_term "GO:0009245" "GO:0016746"; Parent "gene-C7A06_RS33770"; gbkey "CDS"; gene "lpxM"; go_function "acyltransferase activity|0016746||IEA"; go_process "lipid A biosynthetic process|0009245||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052689.1"; locus_tag "C7A06_RS33770"; product "lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase"; protein_id "WP_012680945.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	64327	65325	.	+	0	gene_id "nbis-gene-5696"; transcript_id "gene-C7A06_RS33770"; Dbxref "Genbank:WP_012680945.1"; ID "cds-WP_012680945.1"; Name "WP_012680945.1"; Note "LpxM is lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase, an enzyme characterized in Escherichia coli and involved in biosynthesis of the form of lipid A found in that species and some closely related species."; Ontology_term "GO:0009245" "GO:0016746"; Parent "gene-C7A06_RS33770"; gbkey "CDS"; gene "lpxM"; go_function "acyltransferase activity|0016746||IEA"; go_process "lipid A biosynthetic process|0009245||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052689.1"; locus_tag "C7A06_RS33770"; product "lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase"; protein_id "WP_012680945.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	65378	65566	.	+	.	gene_id "nbis-pseudogene-271"; ID "nbis-pseudogene-271"; Name "C7A06_RS33775"; end_range "65566" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33775"; original_biotype "pseudogene"; partial "true"; pseudo "true";
+NZ_CP027601.1	RefSeq	transcript	65378	65566	.	+	.	gene_id "nbis-pseudogene-271"; transcript_id "gene-C7A06_RS33775"; ID "gene-C7A06_RS33775"; Name "C7A06_RS33775"; Parent "nbis-pseudogene-271"; end_range "65566" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33775"; original_biotype "mrna"; partial "true"; pseudo "true";
+NZ_CP027601.1	Protein Homology	exon	65378	65566	.	+	.	gene_id "nbis-pseudogene-271"; transcript_id "gene-C7A06_RS33775"; ID "nbis-exon-5968"; Note "internal stop; incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS33775"; end_range "65566" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_012767718.1"; locus_tag "C7A06_RS33775"; partial "true"; product "hypothetical protein"; pseudo "true"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	65378	65566	.	+	0	gene_id "nbis-pseudogene-271"; transcript_id "gene-C7A06_RS33775"; ID "cds-C7A06_RS33775"; Note "internal stop; incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS33775"; end_range "65566" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_012767718.1"; locus_tag "C7A06_RS33775"; partial "true"; product "hypothetical protein"; pseudo "true"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	65629	67167	.	-	.	gene_id "nbis-gene-5697"; ID "nbis-gene-5697"; Name "C7A06_RS33780"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33780";
+NZ_CP027601.1	RefSeq	transcript	65629	67167	.	-	.	gene_id "nbis-gene-5697"; transcript_id "gene-C7A06_RS33780"; ID "gene-C7A06_RS33780"; Name "C7A06_RS33780"; Parent "nbis-gene-5697"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33780"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	65629	67167	.	-	.	gene_id "nbis-gene-5697"; transcript_id "gene-C7A06_RS33780"; Dbxref "Genbank:WP_012917688.1"; ID "nbis-exon-5969"; Name "WP_012917688.1"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33780"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000998048.1"; locus_tag "C7A06_RS33780"; product "IS66 family transposase"; protein_id "WP_012917688.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	65629	67167	.	-	0	gene_id "nbis-gene-5697"; transcript_id "gene-C7A06_RS33780"; Dbxref "Genbank:WP_012917688.1"; ID "cds-WP_012917688.1"; Name "WP_012917688.1"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33780"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000998048.1"; locus_tag "C7A06_RS33780"; product "IS66 family transposase"; protein_id "WP_012917688.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	67217	67564	.	-	.	gene_id "nbis-gene-5698"; ID "nbis-gene-5698"; Name "tnpB"; gbkey "Gene"; gene "tnpB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33785";
+NZ_CP027601.1	RefSeq	transcript	67217	67564	.	-	.	gene_id "nbis-gene-5698"; transcript_id "gene-C7A06_RS33785"; ID "gene-C7A06_RS33785"; Name "tnpB"; Parent "nbis-gene-5698"; gbkey "Gene"; gene "tnpB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33785"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	67217	67564	.	-	.	gene_id "nbis-gene-5698"; transcript_id "gene-C7A06_RS33785"; Dbxref "Genbank:WP_000612591.1"; ID "nbis-exon-5970"; Name "WP_000612591.1"; Note "TnpB, as the term is used for proteins encoded by IS66 family insertion elements, is considered an accessory protein, since TnpC, encoded by a neighboring gene, is a DDE family transposase."; Parent "gene-C7A06_RS33785"; gbkey "CDS"; gene "tnpB"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_019104956.1"; locus_tag "C7A06_RS33785"; product "IS66 family insertion sequence element accessory protein TnpB"; protein_id "WP_000612591.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	67217	67564	.	-	0	gene_id "nbis-gene-5698"; transcript_id "gene-C7A06_RS33785"; Dbxref "Genbank:WP_000612591.1"; ID "cds-WP_000612591.1-5"; Name "WP_000612591.1"; Note "TnpB, as the term is used for proteins encoded by IS66 family insertion elements, is considered an accessory protein, since TnpC, encoded by a neighboring gene, is a DDE family transposase."; Parent "gene-C7A06_RS33785"; gbkey "CDS"; gene "tnpB"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_019104956.1"; locus_tag "C7A06_RS33785"; product "IS66 family insertion sequence element accessory protein TnpB"; protein_id "WP_000612591.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	67801	68166	.	+	.	gene_id "nbis-gene-5699"; ID "nbis-gene-5699"; Name "C7A06_RS33795"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33795";
+NZ_CP027601.1	RefSeq	transcript	67801	68166	.	+	.	gene_id "nbis-gene-5699"; transcript_id "gene-C7A06_RS33795"; ID "gene-C7A06_RS33795"; Name "C7A06_RS33795"; Parent "nbis-gene-5699"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33795"; original_biotype "mrna";
+NZ_CP027601.1	GeneMarkS-2+	exon	67801	68166	.	+	.	gene_id "nbis-gene-5699"; transcript_id "gene-C7A06_RS33795"; Dbxref "Genbank:WP_000091308.1"; ID "nbis-exon-5971"; Name "WP_000091308.1"; Parent "gene-C7A06_RS33795"; gbkey "CDS"; inference "COORDINATES: ab initio prediction:GeneMarkS-2+"; locus_tag "C7A06_RS33795"; product "hypothetical protein"; protein_id "WP_000091308.1"; transl_table "11";
+NZ_CP027601.1	GeneMarkS-2+	CDS	67801	68166	.	+	0	gene_id "nbis-gene-5699"; transcript_id "gene-C7A06_RS33795"; Dbxref "Genbank:WP_000091308.1"; ID "cds-WP_000091308.1-2"; Name "WP_000091308.1"; Parent "gene-C7A06_RS33795"; gbkey "CDS"; inference "COORDINATES: ab initio prediction:GeneMarkS-2+"; locus_tag "C7A06_RS33795"; product "hypothetical protein"; protein_id "WP_000091308.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	68166	69353	.	+	.	gene_id "nbis-gene-5700"; ID "nbis-gene-5700"; Name "C7A06_RS33800"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33800";
+NZ_CP027601.1	RefSeq	transcript	68166	69353	.	+	.	gene_id "nbis-gene-5700"; transcript_id "gene-C7A06_RS33800"; ID "gene-C7A06_RS33800"; Name "C7A06_RS33800"; Parent "nbis-gene-5700"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33800"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	68166	69353	.	+	.	gene_id "nbis-gene-5700"; transcript_id "gene-C7A06_RS33800"; Dbxref "Genbank:WP_000937603.1"; ID "nbis-exon-5972"; Name "WP_000937603.1"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33800"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_013747467.1"; locus_tag "C7A06_RS33800"; product "IS91 family transposase"; protein_id "WP_000937603.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	68166	69353	.	+	0	gene_id "nbis-gene-5700"; transcript_id "gene-C7A06_RS33800"; Dbxref "Genbank:WP_000937603.1"; ID "cds-WP_000937603.1-2"; Name "WP_000937603.1"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33800"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_013747467.1"; locus_tag "C7A06_RS33800"; product "IS91 family transposase"; protein_id "WP_000937603.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	69944	70951	.	+	.	gene_id "nbis-pseudogene-272"; ID "nbis-pseudogene-272"; Name "C7A06_RS33810"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33810"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "69944";
+NZ_CP027601.1	RefSeq	transcript	69944	70951	.	+	.	gene_id "nbis-pseudogene-272"; transcript_id "gene-C7A06_RS33810"; ID "gene-C7A06_RS33810"; Name "C7A06_RS33810"; Parent "nbis-pseudogene-272"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33810"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "69944";
+NZ_CP027601.1	Protein Homology	exon	69944	70951	.	+	.	gene_id "nbis-pseudogene-272"; transcript_id "gene-C7A06_RS33810"; ID "nbis-exon-5973"; Note "frameshifted; internal stop; incomplete; partial in the middle of a contig; missing N-terminus"; Ontology_term "GO:0006313" "GO:0003677" "GO:0004803"; Parent "gene-C7A06_RS33810"; gbkey "CDS"; go_function "DNA binding|0003677||IEA" "transposase activity|0004803||IEA"; go_process "transposition, DNA-mediated|0006313||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_013747467.1"; locus_tag "C7A06_RS33810"; partial "true"; product "transposase"; pseudo "true"; start_range "." "69944"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	69944	70951	.	+	0	gene_id "nbis-pseudogene-272"; transcript_id "gene-C7A06_RS33810"; ID "cds-C7A06_RS33810"; Note "frameshifted; internal stop; incomplete; partial in the middle of a contig; missing N-terminus"; Ontology_term "GO:0006313" "GO:0003677" "GO:0004803"; Parent "gene-C7A06_RS33810"; gbkey "CDS"; go_function "DNA binding|0003677||IEA" "transposase activity|0004803||IEA"; go_process "transposition, DNA-mediated|0006313||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_013747467.1"; locus_tag "C7A06_RS33810"; partial "true"; product "transposase"; pseudo "true"; start_range "." "69944"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	71571	73080	.	+	.	gene_id "nbis-pseudogene-273"; ID "nbis-pseudogene-273"; Name "C7A06_RS33815"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33815"; original_biotype "pseudogene"; pseudo "true";
+NZ_CP027601.1	RefSeq	transcript	71571	73080	.	+	.	gene_id "nbis-pseudogene-273"; transcript_id "gene-C7A06_RS33815"; ID "gene-C7A06_RS33815"; Name "C7A06_RS33815"; Parent "nbis-pseudogene-273"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33815"; original_biotype "mrna"; pseudo "true";
+NZ_CP027601.1	Protein Homology	exon	71571	73080	.	+	.	gene_id "nbis-pseudogene-273"; transcript_id "gene-C7A06_RS33815"; ID "nbis-exon-5974"; Note "frameshifted"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33815"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001368704.1"; locus_tag "C7A06_RS33815"; product "ISL3 family transposase"; pseudo "true"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	71571	73080	.	+	0	gene_id "nbis-pseudogene-273"; transcript_id "gene-C7A06_RS33815"; ID "cds-C7A06_RS33815"; Note "frameshifted"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33815"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001368704.1"; locus_tag "C7A06_RS33815"; product "ISL3 family transposase"; pseudo "true"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	73131	73245	.	-	.	gene_id "nbis-pseudogene-274"; ID "nbis-pseudogene-274"; Name "C7A06_RS33820"; end_range "73245" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33820"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "73131";
+NZ_CP027601.1	RefSeq	transcript	73131	73245	.	-	.	gene_id "nbis-pseudogene-274"; transcript_id "gene-C7A06_RS33820"; ID "gene-C7A06_RS33820"; Name "C7A06_RS33820"; Parent "nbis-pseudogene-274"; end_range "73245" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33820"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "73131";
+NZ_CP027601.1	Protein Homology	exon	73131	73245	.	-	.	gene_id "nbis-pseudogene-274"; transcript_id "gene-C7A06_RS33820"; ID "nbis-exon-5975"; Note "frameshifted; incomplete; partial in the middle of a contig; missing N-terminus and C-terminus"; Parent "gene-C7A06_RS33820"; end_range "73245" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_012477168.1"; locus_tag "C7A06_RS33820"; partial "true"; product "IS3 family transposase"; pseudo "true"; start_range "." "73131"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	73131	73245	.	-	0	gene_id "nbis-pseudogene-274"; transcript_id "gene-C7A06_RS33820"; ID "cds-C7A06_RS33820"; Note "frameshifted; incomplete; partial in the middle of a contig; missing N-terminus and C-terminus"; Parent "gene-C7A06_RS33820"; end_range "73245" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_012477168.1"; locus_tag "C7A06_RS33820"; partial "true"; product "IS3 family transposase"; pseudo "true"; start_range "." "73131"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	73332	73808	.	+	.	gene_id "nbis-gene-5701"; ID "nbis-gene-5701"; Name "C7A06_RS33825"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33825";
+NZ_CP027601.1	RefSeq	transcript	73332	73808	.	+	.	gene_id "nbis-gene-5701"; transcript_id "gene-C7A06_RS33825"; ID "gene-C7A06_RS33825"; Name "C7A06_RS33825"; Parent "nbis-gene-5701"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33825"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	73332	73808	.	+	.	gene_id "nbis-gene-5701"; transcript_id "gene-C7A06_RS33825"; Dbxref "Genbank:WP_000422675.1"; ID "nbis-exon-5976"; Name "WP_000422675.1"; Parent "gene-C7A06_RS33825"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000422669.1"; locus_tag "C7A06_RS33825"; product "transposase"; protein_id "WP_000422675.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	73332	73808	.	+	0	gene_id "nbis-gene-5701"; transcript_id "gene-C7A06_RS33825"; Dbxref "Genbank:WP_000422675.1"; ID "cds-WP_000422675.1"; Name "WP_000422675.1"; Parent "gene-C7A06_RS33825"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000422669.1"; locus_tag "C7A06_RS33825"; product "transposase"; protein_id "WP_000422675.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	73789	74941	.	+	.	gene_id "nbis-pseudogene-275"; ID "nbis-pseudogene-275"; Name "C7A06_RS33830"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33830"; original_biotype "pseudogene"; pseudo "true";
+NZ_CP027601.1	RefSeq	transcript	73789	74941	.	+	.	gene_id "nbis-pseudogene-275"; transcript_id "gene-C7A06_RS33830"; ID "gene-C7A06_RS33830"; Name "C7A06_RS33830"; Parent "nbis-pseudogene-275"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33830"; original_biotype "mrna"; pseudo "true";
+NZ_CP027601.1	Protein Homology	exon	73789	74941	.	+	.	gene_id "nbis-pseudogene-275"; transcript_id "gene-C7A06_RS33830"; ID "nbis-exon-5977"; Note "frameshifted"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33830"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_076611553.1"; locus_tag "C7A06_RS33830"; product "IS3 family transposase"; pseudo "true"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	73789	74941	.	+	0	gene_id "nbis-pseudogene-275"; transcript_id "gene-C7A06_RS33830"; ID "cds-C7A06_RS33830"; Note "frameshifted"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33830"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_076611553.1"; locus_tag "C7A06_RS33830"; product "IS3 family transposase"; pseudo "true"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	75004	76453	.	+	.	gene_id "nbis-pseudogene-276"; ID "nbis-pseudogene-276"; Name "C7A06_RS33835"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33835"; original_biotype "pseudogene"; pseudo "true";
+NZ_CP027601.1	RefSeq	transcript	75004	76453	.	+	.	gene_id "nbis-pseudogene-276"; transcript_id "gene-C7A06_RS33835"; ID "gene-C7A06_RS33835"; Name "C7A06_RS33835"; Parent "nbis-pseudogene-276"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33835"; original_biotype "mrna"; pseudo "true";
+NZ_CP027601.1	Protein Homology	exon	75004	76453	.	+	.	gene_id "nbis-pseudogene-276"; transcript_id "gene-C7A06_RS33835"; ID "nbis-exon-5978"; Note "frameshifted; internal stop"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33835"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000080164.1"; locus_tag "C7A06_RS33835"; product "IS66 family transposase"; pseudo "true"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	75004	76453	.	+	0	gene_id "nbis-pseudogene-276"; transcript_id "gene-C7A06_RS33835"; ID "cds-C7A06_RS33835"; Note "frameshifted; internal stop"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33835"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000080164.1"; locus_tag "C7A06_RS33835"; product "IS66 family transposase"; pseudo "true"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	76520	77012	.	-	.	gene_id "nbis-pseudogene-277"; ID "nbis-pseudogene-277"; Name "C7A06_RS33840"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33840"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "76520";
+NZ_CP027601.1	RefSeq	transcript	76520	77012	.	-	.	gene_id "nbis-pseudogene-277"; transcript_id "gene-C7A06_RS33840"; ID "gene-C7A06_RS33840"; Name "C7A06_RS33840"; Parent "nbis-pseudogene-277"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33840"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "76520";
+NZ_CP027601.1	Protein Homology	exon	76520	77012	.	-	.	gene_id "nbis-pseudogene-277"; transcript_id "gene-C7A06_RS33840"; ID "nbis-exon-5979"; Note "frameshifted; incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS33840"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_086558155.1"; locus_tag "C7A06_RS33840"; partial "true"; product "IS3 family transposase"; pseudo "true"; start_range "." "76520"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	76520	77012	.	-	0	gene_id "nbis-pseudogene-277"; transcript_id "gene-C7A06_RS33840"; ID "cds-C7A06_RS33840"; Note "frameshifted; incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS33840"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_086558155.1"; locus_tag "C7A06_RS33840"; partial "true"; product "IS3 family transposase"; pseudo "true"; start_range "." "76520"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	76935	77165	.	+	.	gene_id "nbis-gene-5702"; ID "nbis-gene-5702"; Name "C7A06_RS33845"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33845";
+NZ_CP027601.1	RefSeq	transcript	76935	77165	.	+	.	gene_id "nbis-gene-5702"; transcript_id "gene-C7A06_RS33845"; ID "gene-C7A06_RS33845"; Name "C7A06_RS33845"; Parent "nbis-gene-5702"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33845"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	76935	77165	.	+	.	gene_id "nbis-gene-5702"; transcript_id "gene-C7A06_RS33845"; Dbxref "Genbank:WP_001443774.1"; ID "nbis-exon-5980"; Name "WP_001443774.1"; Parent "gene-C7A06_RS33845"; gbkey "CDS"; inference "COORDINATES: protein motif:HMM:NF015365.2"; locus_tag "C7A06_RS33845"; product "IS1 family transposase"; protein_id "WP_001443774.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	76935	77165	.	+	0	gene_id "nbis-gene-5702"; transcript_id "gene-C7A06_RS33845"; Dbxref "Genbank:WP_001443774.1"; ID "cds-WP_001443774.1"; Name "WP_001443774.1"; Parent "gene-C7A06_RS33845"; gbkey "CDS"; inference "COORDINATES: protein motif:HMM:NF015365.2"; locus_tag "C7A06_RS33845"; product "IS1 family transposase"; protein_id "WP_001443774.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	77280	86778	.	+	.	gene_id "nbis-pseudogene-278"; ID "nbis-pseudogene-278"; Name "toxB"; gbkey "Gene"; gene "toxB"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33850"; original_biotype "pseudogene"; pseudo "true";
+NZ_CP027601.1	RefSeq	transcript	77280	86778	.	+	.	gene_id "nbis-pseudogene-278"; transcript_id "gene-C7A06_RS33850"; ID "gene-C7A06_RS33850"; Name "toxB"; Parent "nbis-pseudogene-278"; gbkey "Gene"; gene "toxB"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33850"; original_biotype "mrna"; pseudo "true";
+NZ_CP027601.1	Protein Homology	exon	77280	86778	.	+	.	gene_id "nbis-pseudogene-278"; transcript_id "gene-C7A06_RS33850"; ID "nbis-exon-5981"; Note "frameshifted"; Parent "gene-C7A06_RS33850"; gbkey "CDS"; gene "toxB"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000581688.1"; locus_tag "C7A06_RS33850"; product "toxin B"; pseudo "true"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	77280	86778	.	+	0	gene_id "nbis-pseudogene-278"; transcript_id "gene-C7A06_RS33850"; ID "cds-C7A06_RS33850"; Note "frameshifted"; Parent "gene-C7A06_RS33850"; gbkey "CDS"; gene "toxB"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000581688.1"; locus_tag "C7A06_RS33850"; product "toxin B"; pseudo "true"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	87738	88769	.	-	.	gene_id "nbis-gene-5703"; ID "nbis-gene-5703"; Name "C7A06_RS33865"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33865";
+NZ_CP027601.1	RefSeq	transcript	87738	88769	.	-	.	gene_id "nbis-gene-5703"; transcript_id "gene-C7A06_RS33865"; ID "gene-C7A06_RS33865"; Name "C7A06_RS33865"; Parent "nbis-gene-5703"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33865"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	87738	88769	.	-	.	gene_id "nbis-gene-5703"; transcript_id "gene-C7A06_RS33865"; Dbxref "Genbank:WP_000907857.1"; ID "nbis-exon-5982"; Name "WP_000907857.1"; Parent "gene-C7A06_RS33865"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000907860.1"; locus_tag "C7A06_RS33865"; product "replication initiation protein"; protein_id "WP_000907857.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	87738	88769	.	-	0	gene_id "nbis-gene-5703"; transcript_id "gene-C7A06_RS33865"; Dbxref "Genbank:WP_000907857.1"; ID "cds-WP_000907857.1"; Name "WP_000907857.1"; Parent "gene-C7A06_RS33865"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000907860.1"; locus_tag "C7A06_RS33865"; product "replication initiation protein"; protein_id "WP_000907857.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	89478	90119	.	+	.	gene_id "nbis-gene-5704"; ID "nbis-gene-5704"; Name "C7A06_RS33880"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33880";
+NZ_CP027601.1	RefSeq	transcript	89478	90119	.	+	.	gene_id "nbis-gene-5704"; transcript_id "gene-C7A06_RS33880"; ID "gene-C7A06_RS33880"; Name "C7A06_RS33880"; Parent "nbis-gene-5704"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33880"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	89478	90119	.	+	.	gene_id "nbis-gene-5704"; transcript_id "gene-C7A06_RS33880"; Dbxref "Genbank:WP_000335839.1"; ID "nbis-exon-5983"; Name "WP_000335839.1"; Parent "gene-C7A06_RS33880"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000335849.1"; locus_tag "C7A06_RS33880"; product "transcription termination factor NusG"; protein_id "WP_000335839.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	89478	90119	.	+	0	gene_id "nbis-gene-5704"; transcript_id "gene-C7A06_RS33880"; Dbxref "Genbank:WP_000335839.1"; ID "cds-WP_000335839.1"; Name "WP_000335839.1"; Parent "gene-C7A06_RS33880"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000335849.1"; locus_tag "C7A06_RS33880"; product "transcription termination factor NusG"; protein_id "WP_000335839.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	90260	90925	.	+	.	gene_id "nbis-gene-5705"; ID "nbis-gene-5705"; Name "C7A06_RS33885"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33885";
+NZ_CP027601.1	RefSeq	transcript	90260	90925	.	+	.	gene_id "nbis-gene-5705"; transcript_id "gene-C7A06_RS33885"; ID "gene-C7A06_RS33885"; Name "C7A06_RS33885"; Parent "nbis-gene-5705"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33885"; original_biotype "mrna";
+NZ_CP027601.1	Protein Homology	exon	90260	90925	.	+	.	gene_id "nbis-gene-5705"; transcript_id "gene-C7A06_RS33885"; Dbxref "Genbank:WP_000154135.1"; ID "nbis-exon-5984"; Name "WP_000154135.1"; Parent "gene-C7A06_RS33885"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000154135.1"; locus_tag "C7A06_RS33885"; product "hypothetical protein"; protein_id "WP_000154135.1"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	90260	90925	.	+	0	gene_id "nbis-gene-5705"; transcript_id "gene-C7A06_RS33885"; Dbxref "Genbank:WP_000154135.1"; ID "cds-WP_000154135.1"; Name "WP_000154135.1"; Parent "gene-C7A06_RS33885"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000154135.1"; locus_tag "C7A06_RS33885"; product "hypothetical protein"; protein_id "WP_000154135.1"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	91191	91579	.	+	.	gene_id "nbis-pseudogene-279"; ID "nbis-pseudogene-279"; Name "C7A06_RS33895"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33895"; original_biotype "pseudogene"; pseudo "true";
+NZ_CP027601.1	RefSeq	transcript	91191	91579	.	+	.	gene_id "nbis-pseudogene-279"; transcript_id "gene-C7A06_RS33895"; ID "gene-C7A06_RS33895"; Name "C7A06_RS33895"; Parent "nbis-pseudogene-279"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33895"; original_biotype "mrna"; pseudo "true";
+NZ_CP027601.1	Protein Homology	exon	91191	91579	.	+	.	gene_id "nbis-pseudogene-279"; transcript_id "gene-C7A06_RS33895"; ID "nbis-exon-5985"; Note "frameshifted"; Parent "gene-C7A06_RS33895"; gbkey "CDS"; inference "COORDINATES: protein motif:HMM:NF018941.2"; locus_tag "C7A06_RS33895"; product "YqiJ family protein"; pseudo "true"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	91191	91579	.	+	0	gene_id "nbis-pseudogene-279"; transcript_id "gene-C7A06_RS33895"; ID "cds-C7A06_RS33895"; Note "frameshifted"; Parent "gene-C7A06_RS33895"; gbkey "CDS"; inference "COORDINATES: protein motif:HMM:NF018941.2"; locus_tag "C7A06_RS33895"; product "YqiJ family protein"; pseudo "true"; transl_table "11";
+NZ_CP027601.1	RefSeq	gene	91582	92590	.	-	.	gene_id "nbis-pseudogene-280"; ID "nbis-pseudogene-280"; Name "C7A06_RS33900"; end_range "92590" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33900"; original_biotype "pseudogene"; partial "true"; pseudo "true";
+NZ_CP027601.1	RefSeq	transcript	91582	92590	.	-	.	gene_id "nbis-pseudogene-280"; transcript_id "gene-C7A06_RS33900"; ID "gene-C7A06_RS33900"; Name "C7A06_RS33900"; Parent "nbis-pseudogene-280"; end_range "92590" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33900"; original_biotype "mrna"; partial "true"; pseudo "true";
+NZ_CP027601.1	Protein Homology	exon	91582	92590	.	-	.	gene_id "nbis-pseudogene-280"; transcript_id "gene-C7A06_RS33900"; ID "nbis-exon-5986"; Note "frameshifted; incomplete; missing N-terminus"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33900"; end_range "92590" "."; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001066419.1"; locus_tag "C7A06_RS33900"; partial "true"; product "IS66 family transposase"; pseudo "true"; transl_table "11";
+NZ_CP027601.1	Protein Homology	CDS	91582	92590	.	-	2	gene_id "nbis-pseudogene-280"; transcript_id "gene-C7A06_RS33900"; ID "cds-C7A06_RS33900"; Note "frameshifted; incomplete; missing N-terminus"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33900"; end_range "92590" "."; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001066419.1"; locus_tag "C7A06_RS33900"; partial "true"; product "IS66 family transposase"; pseudo "true"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	1052	2152	.	+	.	gene_id "nbis-gene-2"; ID "nbis-gene-2"; Name "dnaN"; gbkey "Gene"; gene "dnaN"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00010";
+NZ_CP027599.1	RefSeq	transcript	1052	2152	.	+	.	gene_id "nbis-gene-2"; transcript_id "gene-C7A06_RS00010"; ID "gene-C7A06_RS00010"; Name "dnaN"; Parent "nbis-gene-2"; gbkey "Gene"; gene "dnaN"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00010"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	1052	2152	.	+	.	gene_id "nbis-gene-2"; transcript_id "gene-C7A06_RS00010"; Dbxref "Genbank:WP_000673464.1"; ID "nbis-exon-2"; Name "WP_000673464.1"; Ontology_term "GO:0006260" "GO:0003887" "GO:0009360"; Parent "gene-C7A06_RS00010"; gbkey "CDS"; gene "dnaN"; go_component "DNA polymerase III complex|0009360||IEA"; go_function "DNA-directed DNA polymerase activity|0003887||IEA"; go_process "DNA replication|0006260||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_006177590.1"; locus_tag "C7A06_RS00010"; product "DNA polymerase III subunit beta"; protein_id "WP_000673464.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	1052	2152	.	+	0	gene_id "nbis-gene-2"; transcript_id "gene-C7A06_RS00010"; Dbxref "Genbank:WP_000673464.1"; ID "cds-WP_000673464.1"; Name "WP_000673464.1"; Ontology_term "GO:0006260" "GO:0003887" "GO:0009360"; Parent "gene-C7A06_RS00010"; gbkey "CDS"; gene "dnaN"; go_component "DNA polymerase III complex|0009360||IEA"; go_function "DNA-directed DNA polymerase activity|0003887||IEA"; go_process "DNA replication|0006260||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_006177590.1"; locus_tag "C7A06_RS00010"; product "DNA polymerase III subunit beta"; protein_id "WP_000673464.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	2152	3225	.	+	.	gene_id "nbis-gene-3"; ID "nbis-gene-3"; Name "recF"; gbkey "Gene"; gene "recF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00015";
+NZ_CP027599.1	RefSeq	transcript	2152	3225	.	+	.	gene_id "nbis-gene-3"; transcript_id "gene-C7A06_RS00015"; ID "gene-C7A06_RS00015"; Name "recF"; Parent "nbis-gene-3"; gbkey "Gene"; gene "recF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00015"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	2152	3225	.	+	.	gene_id "nbis-gene-3"; transcript_id "gene-C7A06_RS00015"; Dbxref "Genbank:WP_000060112.1"; ID "nbis-exon-3"; Name "WP_000060112.1"; Ontology_term "GO:0006281" "GO:0003697" "GO:0005524"; Parent "gene-C7A06_RS00015"; gbkey "CDS"; gene "recF"; go_function "single-stranded DNA binding|0003697||IEA" "ATP binding|0005524||IEA"; go_process "DNA repair|0006281||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005121479.1"; locus_tag "C7A06_RS00015"; product "DNA replication/repair protein RecF"; protein_id "WP_000060112.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	2152	3225	.	+	0	gene_id "nbis-gene-3"; transcript_id "gene-C7A06_RS00015"; Dbxref "Genbank:WP_000060112.1"; ID "cds-WP_000060112.1"; Name "WP_000060112.1"; Ontology_term "GO:0006281" "GO:0003697" "GO:0005524"; Parent "gene-C7A06_RS00015"; gbkey "CDS"; gene "recF"; go_function "single-stranded DNA binding|0003697||IEA" "ATP binding|0005524||IEA"; go_process "DNA repair|0006281||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005121479.1"; locus_tag "C7A06_RS00015"; product "DNA replication/repair protein RecF"; protein_id "WP_000060112.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	3254	5668	.	+	.	gene_id "nbis-gene-4"; ID "nbis-gene-4"; Name "gyrB"; gbkey "Gene"; gene "gyrB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00020";
+NZ_CP027599.1	RefSeq	transcript	3254	5668	.	+	.	gene_id "nbis-gene-4"; transcript_id "gene-C7A06_RS00020"; ID "gene-C7A06_RS00020"; Name "gyrB"; Parent "nbis-gene-4"; gbkey "Gene"; gene "gyrB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00020"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	3254	5668	.	+	.	gene_id "nbis-gene-4"; transcript_id "gene-C7A06_RS00020"; Dbxref "Genbank:WP_000072067.1"; ID "nbis-exon-4"; Name "WP_000072067.1"; Ontology_term "GO:0006265" "GO:0003918" "GO:0009330"; Parent "gene-C7A06_RS00020"; gbkey "CDS"; gene "gyrB"; go_component "DNA topoisomerase type II (double strand cut, ATP-hydrolyzing) complex|0009330||IEA"; go_function "DNA topoisomerase type II (double strand cut, ATP-hydrolyzing) activity|0003918||IEA"; go_process "DNA topological change|0006265||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005121480.1"; locus_tag "C7A06_RS00020"; product "DNA topoisomerase (ATP-hydrolyzing) subunit B"; protein_id "WP_000072067.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	3254	5668	.	+	0	gene_id "nbis-gene-4"; transcript_id "gene-C7A06_RS00020"; Dbxref "Genbank:WP_000072067.1"; ID "cds-WP_000072067.1"; Name "WP_000072067.1"; Ontology_term "GO:0006265" "GO:0003918" "GO:0009330"; Parent "gene-C7A06_RS00020"; gbkey "CDS"; gene "gyrB"; go_component "DNA topoisomerase type II (double strand cut, ATP-hydrolyzing) complex|0009330||IEA"; go_function "DNA topoisomerase type II (double strand cut, ATP-hydrolyzing) activity|0003918||IEA"; go_process "DNA topological change|0006265||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005121480.1"; locus_tag "C7A06_RS00020"; product "DNA topoisomerase (ATP-hydrolyzing) subunit B"; protein_id "WP_000072067.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	5908	6306	.	+	.	gene_id "nbis-gene-5"; ID "nbis-gene-5"; Name "yidB"; gbkey "Gene"; gene "yidB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00025";
+NZ_CP027599.1	RefSeq	transcript	5908	6306	.	+	.	gene_id "nbis-gene-5"; transcript_id "gene-C7A06_RS00025"; ID "gene-C7A06_RS00025"; Name "yidB"; Parent "nbis-gene-5"; gbkey "Gene"; gene "yidB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00025"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	5908	6306	.	+	.	gene_id "nbis-gene-5"; transcript_id "gene-C7A06_RS00025"; Dbxref "Genbank:WP_000522208.1"; ID "nbis-exon-5"; Name "WP_000522208.1"; Parent "gene-C7A06_RS00025"; gbkey "CDS"; gene "yidB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418153.4"; locus_tag "C7A06_RS00025"; product "YidB family protein"; protein_id "WP_000522208.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	5908	6306	.	+	0	gene_id "nbis-gene-5"; transcript_id "gene-C7A06_RS00025"; Dbxref "Genbank:WP_000522208.1"; ID "cds-WP_000522208.1"; Name "WP_000522208.1"; Parent "gene-C7A06_RS00025"; gbkey "CDS"; gene "yidB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418153.4"; locus_tag "C7A06_RS00025"; product "YidB family protein"; protein_id "WP_000522208.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	6421	7233	.	+	.	gene_id "nbis-gene-6"; ID "nbis-gene-6"; Name "yidA"; gbkey "Gene"; gene "yidA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00030";
+NZ_CP027599.1	RefSeq	transcript	6421	7233	.	+	.	gene_id "nbis-gene-6"; transcript_id "gene-C7A06_RS00030"; ID "gene-C7A06_RS00030"; Name "yidA"; Parent "nbis-gene-6"; gbkey "Gene"; gene "yidA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00030"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	6421	7233	.	+	.	gene_id "nbis-gene-6"; transcript_id "gene-C7A06_RS00030"; Dbxref "Genbank:WP_000985541.1"; ID "nbis-exon-6"; Name "WP_000985541.1"; Ontology_term "GO:0016787"; Parent "gene-C7A06_RS00030"; gbkey "CDS"; gene "yidA"; go_function "hydrolase activity|0016787||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418152.1"; locus_tag "C7A06_RS00030"; product "sugar-phosphatase"; protein_id "WP_000985541.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	6421	7233	.	+	0	gene_id "nbis-gene-6"; transcript_id "gene-C7A06_RS00030"; Dbxref "Genbank:WP_000985541.1"; ID "cds-WP_000985541.1"; Name "WP_000985541.1"; Ontology_term "GO:0016787"; Parent "gene-C7A06_RS00030"; gbkey "CDS"; gene "yidA"; go_function "hydrolase activity|0016787||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418152.1"; locus_tag "C7A06_RS00030"; product "sugar-phosphatase"; protein_id "WP_000985541.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	7279	7935	.	-	.	gene_id "nbis-gene-7"; ID "nbis-gene-7"; Name "C7A06_RS00035"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00035";
+NZ_CP027599.1	RefSeq	transcript	7279	7935	.	-	.	gene_id "nbis-gene-7"; transcript_id "gene-C7A06_RS00035"; ID "gene-C7A06_RS00035"; Name "C7A06_RS00035"; Parent "nbis-gene-7"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00035"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	7279	7935	.	-	.	gene_id "nbis-gene-7"; transcript_id "gene-C7A06_RS00035"; Dbxref "Genbank:WP_000772931.1"; ID "nbis-exon-7"; Name "WP_000772931.1"; Parent "gene-C7A06_RS00035"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709504.1"; locus_tag "C7A06_RS00035"; product "hypothetical protein"; protein_id "WP_000772931.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	7279	7935	.	-	0	gene_id "nbis-gene-7"; transcript_id "gene-C7A06_RS00035"; Dbxref "Genbank:WP_000772931.1"; ID "cds-WP_000772931.1"; Name "WP_000772931.1"; Parent "gene-C7A06_RS00035"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709504.1"; locus_tag "C7A06_RS00035"; product "hypothetical protein"; protein_id "WP_000772931.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	8213	8902	.	+	.	gene_id "nbis-gene-8"; ID "nbis-gene-8"; Name "dgoR"; gbkey "Gene"; gene "dgoR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00040";
+NZ_CP027599.1	RefSeq	transcript	8213	8902	.	+	.	gene_id "nbis-gene-8"; transcript_id "gene-C7A06_RS00040"; ID "gene-C7A06_RS00040"; Name "dgoR"; Parent "nbis-gene-8"; gbkey "Gene"; gene "dgoR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00040"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	8213	8902	.	+	.	gene_id "nbis-gene-8"; transcript_id "gene-C7A06_RS00040"; Dbxref "Genbank:WP_000174305.1"; ID "nbis-exon-8"; Name "WP_000174305.1"; Parent "gene-C7A06_RS00040"; gbkey "CDS"; gene "dgoR"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709505.1"; locus_tag "C7A06_RS00040"; product "D-galactonate utilization transcriptional regulator DgoR"; protein_id "WP_000174305.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	8213	8902	.	+	0	gene_id "nbis-gene-8"; transcript_id "gene-C7A06_RS00040"; Dbxref "Genbank:WP_000174305.1"; ID "cds-WP_000174305.1"; Name "WP_000174305.1"; Parent "gene-C7A06_RS00040"; gbkey "CDS"; gene "dgoR"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709505.1"; locus_tag "C7A06_RS00040"; product "D-galactonate utilization transcriptional regulator DgoR"; protein_id "WP_000174305.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	8899	9777	.	+	.	gene_id "nbis-gene-9"; ID "nbis-gene-9"; Name "dgoK"; gbkey "Gene"; gene "dgoK"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00045";
+NZ_CP027599.1	RefSeq	transcript	8899	9777	.	+	.	gene_id "nbis-gene-9"; transcript_id "gene-C7A06_RS00045"; ID "gene-C7A06_RS00045"; Name "dgoK"; Parent "nbis-gene-9"; gbkey "Gene"; gene "dgoK"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00045"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	8899	9777	.	+	.	gene_id "nbis-gene-9"; transcript_id "gene-C7A06_RS00045"; Dbxref "Genbank:WP_000127112.1"; ID "nbis-exon-9"; Name "WP_000127112.1"; Parent "gene-C7A06_RS00045"; gbkey "CDS"; gene "dgoK"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709506.1"; locus_tag "C7A06_RS00045"; product "2-dehydro-3-deoxygalactonokinase"; protein_id "WP_000127112.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	8899	9777	.	+	0	gene_id "nbis-gene-9"; transcript_id "gene-C7A06_RS00045"; Dbxref "Genbank:WP_000127112.1"; ID "cds-WP_000127112.1"; Name "WP_000127112.1"; Parent "gene-C7A06_RS00045"; gbkey "CDS"; gene "dgoK"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709506.1"; locus_tag "C7A06_RS00045"; product "2-dehydro-3-deoxygalactonokinase"; protein_id "WP_000127112.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	9761	10378	.	+	.	gene_id "nbis-gene-10"; ID "nbis-gene-10"; Name "dgoA"; gbkey "Gene"; gene "dgoA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00050";
+NZ_CP027599.1	RefSeq	transcript	9761	10378	.	+	.	gene_id "nbis-gene-10"; transcript_id "gene-C7A06_RS00050"; ID "gene-C7A06_RS00050"; Name "dgoA"; Parent "nbis-gene-10"; gbkey "Gene"; gene "dgoA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00050"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	9761	10378	.	+	.	gene_id "nbis-gene-10"; transcript_id "gene-C7A06_RS00050"; Dbxref "Genbank:WP_001198699.1"; ID "nbis-exon-10"; Name "WP_001198699.1"; Parent "gene-C7A06_RS00050"; gbkey "CDS"; gene "dgoA"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_026238.1"; locus_tag "C7A06_RS00050"; product "2-dehydro-3-deoxy-6-phosphogalactonate aldolase"; protein_id "WP_001198699.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	9761	10378	.	+	0	gene_id "nbis-gene-10"; transcript_id "gene-C7A06_RS00050"; Dbxref "Genbank:WP_001198699.1"; ID "cds-WP_001198699.1"; Name "WP_001198699.1"; Parent "gene-C7A06_RS00050"; gbkey "CDS"; gene "dgoA"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_026238.1"; locus_tag "C7A06_RS00050"; product "2-dehydro-3-deoxy-6-phosphogalactonate aldolase"; protein_id "WP_001198699.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	10375	11523	.	+	.	gene_id "nbis-gene-11"; ID "nbis-gene-11"; Name "dgoD"; gbkey "Gene"; gene "dgoD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00055";
+NZ_CP027599.1	RefSeq	transcript	10375	11523	.	+	.	gene_id "nbis-gene-11"; transcript_id "gene-C7A06_RS00055"; ID "gene-C7A06_RS00055"; Name "dgoD"; Parent "nbis-gene-11"; gbkey "Gene"; gene "dgoD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00055"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	10375	11523	.	+	.	gene_id "nbis-gene-11"; transcript_id "gene-C7A06_RS00055"; Dbxref "Genbank:WP_000705001.1"; ID "nbis-exon-11"; Name "WP_000705001.1"; Ontology_term "GO:0009063" "GO:0008869"; Parent "gene-C7A06_RS00055"; gbkey "CDS"; gene "dgoD"; go_function "galactonate dehydratase activity|0008869||IEA"; go_process "cellular amino acid catabolic process|0009063||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_020077623.1"; locus_tag "C7A06_RS00055"; product "galactonate dehydratase"; protein_id "WP_000705001.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	10375	11523	.	+	0	gene_id "nbis-gene-11"; transcript_id "gene-C7A06_RS00055"; Dbxref "Genbank:WP_000705001.1"; ID "cds-WP_000705001.1"; Name "WP_000705001.1"; Ontology_term "GO:0009063" "GO:0008869"; Parent "gene-C7A06_RS00055"; gbkey "CDS"; gene "dgoD"; go_function "galactonate dehydratase activity|0008869||IEA"; go_process "cellular amino acid catabolic process|0009063||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_020077623.1"; locus_tag "C7A06_RS00055"; product "galactonate dehydratase"; protein_id "WP_000705001.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	11598	12935	.	+	.	gene_id "nbis-gene-12"; ID "nbis-gene-12"; Name "dgoT"; gbkey "Gene"; gene "dgoT"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00060";
+NZ_CP027599.1	RefSeq	transcript	11598	12935	.	+	.	gene_id "nbis-gene-12"; transcript_id "gene-C7A06_RS00060"; ID "gene-C7A06_RS00060"; Name "dgoT"; Parent "nbis-gene-12"; gbkey "Gene"; gene "dgoT"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00060"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	11598	12935	.	+	.	gene_id "nbis-gene-12"; transcript_id "gene-C7A06_RS00060"; Dbxref "Genbank:WP_000253455.1"; ID "nbis-exon-12"; Name "WP_000253455.1"; Parent "gene-C7A06_RS00060"; gbkey "CDS"; gene "dgoT"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709507.1"; locus_tag "C7A06_RS00060"; product "MFS transporter"; protein_id "WP_000253455.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	11598	12935	.	+	0	gene_id "nbis-gene-12"; transcript_id "gene-C7A06_RS00060"; Dbxref "Genbank:WP_000253455.1"; ID "cds-WP_000253455.1"; Name "WP_000253455.1"; Parent "gene-C7A06_RS00060"; gbkey "CDS"; gene "dgoT"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709507.1"; locus_tag "C7A06_RS00060"; product "MFS transporter"; protein_id "WP_000253455.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	12932	13996	.	-	.	gene_id "nbis-gene-13"; ID "nbis-gene-13"; Name "cbrA"; gbkey "Gene"; gene "cbrA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00065";
+NZ_CP027599.1	RefSeq	transcript	12932	13996	.	-	.	gene_id "nbis-gene-13"; transcript_id "gene-C7A06_RS00065"; ID "gene-C7A06_RS00065"; Name "cbrA"; Parent "nbis-gene-13"; gbkey "Gene"; gene "cbrA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00065"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	12932	13996	.	-	.	gene_id "nbis-gene-13"; transcript_id "gene-C7A06_RS00065"; Dbxref "Genbank:WP_001341773.1"; ID "nbis-exon-13"; Name "WP_001341773.1"; Parent "gene-C7A06_RS00065"; gbkey "CDS"; gene "cbrA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418145.2"; locus_tag "C7A06_RS00065"; product "colicin M resistance lipid reductase CbrA"; protein_id "WP_001341773.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	12932	13996	.	-	0	gene_id "nbis-gene-13"; transcript_id "gene-C7A06_RS00065"; Dbxref "Genbank:WP_001341773.1"; ID "cds-WP_001341773.1"; Name "WP_001341773.1"; Parent "gene-C7A06_RS00065"; gbkey "CDS"; gene "cbrA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418145.2"; locus_tag "C7A06_RS00065"; product "colicin M resistance lipid reductase CbrA"; protein_id "WP_001341773.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	14097	15311	.	+	.	gene_id "nbis-gene-14"; ID "nbis-gene-14"; Name "yidR"; gbkey "Gene"; gene "yidR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00070";
+NZ_CP027599.1	RefSeq	transcript	14097	15311	.	+	.	gene_id "nbis-gene-14"; transcript_id "gene-C7A06_RS00070"; ID "gene-C7A06_RS00070"; Name "yidR"; Parent "nbis-gene-14"; gbkey "Gene"; gene "yidR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00070"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	14097	15311	.	+	.	gene_id "nbis-gene-14"; transcript_id "gene-C7A06_RS00070"; Dbxref "Genbank:WP_001448315.1"; ID "nbis-exon-14"; Name "WP_001448315.1"; Parent "gene-C7A06_RS00070"; gbkey "CDS"; gene "yidR"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312656.3"; locus_tag "C7A06_RS00070"; product "DUF3748 domain-containing protein"; protein_id "WP_001448315.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	14097	15311	.	+	0	gene_id "nbis-gene-14"; transcript_id "gene-C7A06_RS00070"; Dbxref "Genbank:WP_001448315.1"; ID "cds-WP_001448315.1"; Name "WP_001448315.1"; Parent "gene-C7A06_RS00070"; gbkey "CDS"; gene "yidR"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312656.3"; locus_tag "C7A06_RS00070"; product "DUF3748 domain-containing protein"; protein_id "WP_001448315.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	15313	15645	.	-	.	gene_id "nbis-gene-15"; ID "nbis-gene-15"; Name "yidQ"; gbkey "Gene"; gene "yidQ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00075";
+NZ_CP027599.1	RefSeq	transcript	15313	15645	.	-	.	gene_id "nbis-gene-15"; transcript_id "gene-C7A06_RS00075"; ID "gene-C7A06_RS00075"; Name "yidQ"; Parent "nbis-gene-15"; gbkey "Gene"; gene "yidQ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00075"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	15313	15645	.	-	.	gene_id "nbis-gene-15"; transcript_id "gene-C7A06_RS00075"; Dbxref "Genbank:WP_000620888.1"; ID "nbis-exon-15"; Name "WP_000620888.1"; Parent "gene-C7A06_RS00075"; gbkey "CDS"; gene "yidQ"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418143.2"; locus_tag "C7A06_RS00075"; product "YceK/YidQ family lipoprotein"; protein_id "WP_000620888.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	15313	15645	.	-	0	gene_id "nbis-gene-15"; transcript_id "gene-C7A06_RS00075"; Dbxref "Genbank:WP_000620888.1"; ID "cds-WP_000620888.1"; Name "WP_000620888.1"; Parent "gene-C7A06_RS00075"; gbkey "CDS"; gene "yidQ"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418143.2"; locus_tag "C7A06_RS00075"; product "YceK/YidQ family lipoprotein"; protein_id "WP_000620888.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	15951	16364	.	+	.	gene_id "nbis-gene-16"; ID "nbis-gene-16"; Name "ibpA"; gbkey "Gene"; gene "ibpA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00080";
+NZ_CP027599.1	RefSeq	transcript	15951	16364	.	+	.	gene_id "nbis-gene-16"; transcript_id "gene-C7A06_RS00080"; ID "gene-C7A06_RS00080"; Name "ibpA"; Parent "nbis-gene-16"; gbkey "Gene"; gene "ibpA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00080"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	15951	16364	.	+	.	gene_id "nbis-gene-16"; transcript_id "gene-C7A06_RS00080"; Dbxref "Genbank:WP_001243437.1"; ID "nbis-exon-16"; Name "WP_001243437.1"; Parent "gene-C7A06_RS00080"; gbkey "CDS"; gene "ibpA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_006687722.1"; locus_tag "C7A06_RS00080"; product "heat shock chaperone IbpA"; protein_id "WP_001243437.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	15951	16364	.	+	0	gene_id "nbis-gene-16"; transcript_id "gene-C7A06_RS00080"; Dbxref "Genbank:WP_001243437.1"; ID "cds-WP_001243437.1"; Name "WP_001243437.1"; Parent "gene-C7A06_RS00080"; gbkey "CDS"; gene "ibpA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_006687722.1"; locus_tag "C7A06_RS00080"; product "heat shock chaperone IbpA"; protein_id "WP_001243437.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	16476	16904	.	+	.	gene_id "nbis-gene-17"; ID "nbis-gene-17"; Name "ibpB"; gbkey "Gene"; gene "ibpB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00085";
+NZ_CP027599.1	RefSeq	transcript	16476	16904	.	+	.	gene_id "nbis-gene-17"; transcript_id "gene-C7A06_RS00085"; ID "gene-C7A06_RS00085"; Name "ibpB"; Parent "nbis-gene-17"; gbkey "Gene"; gene "ibpB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00085"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	16476	16904	.	+	.	gene_id "nbis-gene-17"; transcript_id "gene-C7A06_RS00085"; Dbxref "Genbank:WP_001243431.1"; ID "nbis-exon-17"; Name "WP_001243431.1"; Parent "gene-C7A06_RS00085"; gbkey "CDS"; gene "ibpB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709512.2"; locus_tag "C7A06_RS00085"; product "heat shock chaperone IbpB"; protein_id "WP_001243431.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	16476	16904	.	+	0	gene_id "nbis-gene-17"; transcript_id "gene-C7A06_RS00085"; Dbxref "Genbank:WP_001243431.1"; ID "cds-WP_001243431.1"; Name "WP_001243431.1"; Parent "gene-C7A06_RS00085"; gbkey "CDS"; gene "ibpB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709512.2"; locus_tag "C7A06_RS00085"; product "heat shock chaperone IbpB"; protein_id "WP_001243431.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	17101	18762	.	+	.	gene_id "nbis-gene-18"; ID "nbis-gene-18"; Name "yidE"; gbkey "Gene"; gene "yidE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00090";
+NZ_CP027599.1	RefSeq	transcript	17101	18762	.	+	.	gene_id "nbis-gene-18"; transcript_id "gene-C7A06_RS00090"; ID "gene-C7A06_RS00090"; Name "yidE"; Parent "nbis-gene-18"; gbkey "Gene"; gene "yidE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00090"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	17101	18762	.	+	.	gene_id "nbis-gene-18"; transcript_id "gene-C7A06_RS00090"; Dbxref "Genbank:WP_001279752.1"; ID "nbis-exon-18"; Name "WP_001279752.1"; Ontology_term "GO:0006813" "GO:0008324"; Parent "gene-C7A06_RS00090"; gbkey "CDS"; gene "yidE"; go_function "cation transmembrane transporter activity|0008324||IEA"; go_process "potassium ion transport|0006813||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312652.2"; locus_tag "C7A06_RS00090"; product "putative transporter"; protein_id "WP_001279752.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	17101	18762	.	+	0	gene_id "nbis-gene-18"; transcript_id "gene-C7A06_RS00090"; Dbxref "Genbank:WP_001279752.1"; ID "cds-WP_001279752.1"; Name "WP_001279752.1"; Ontology_term "GO:0006813" "GO:0008324"; Parent "gene-C7A06_RS00090"; gbkey "CDS"; gene "yidE"; go_function "cation transmembrane transporter activity|0008324||IEA"; go_process "potassium ion transport|0006813||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312652.2"; locus_tag "C7A06_RS00090"; product "putative transporter"; protein_id "WP_001279752.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	18759	19475	.	-	.	gene_id "nbis-gene-19"; ID "nbis-gene-19"; Name "yidP"; gbkey "Gene"; gene "yidP"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00095";
+NZ_CP027599.1	RefSeq	transcript	18759	19475	.	-	.	gene_id "nbis-gene-19"; transcript_id "gene-C7A06_RS00095"; ID "gene-C7A06_RS00095"; Name "yidP"; Parent "nbis-gene-19"; gbkey "Gene"; gene "yidP"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00095"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	18759	19475	.	-	.	gene_id "nbis-gene-19"; transcript_id "gene-C7A06_RS00095"; Dbxref "Genbank:WP_001300779.1"; ID "nbis-exon-19"; Name "WP_001300779.1"; Parent "gene-C7A06_RS00095"; gbkey "CDS"; gene "yidP"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418139.1"; locus_tag "C7A06_RS00095"; product "GntR family transcriptional regulator"; protein_id "WP_001300779.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	18759	19475	.	-	0	gene_id "nbis-gene-19"; transcript_id "gene-C7A06_RS00095"; Dbxref "Genbank:WP_001300779.1"; ID "cds-WP_001300779.1"; Name "WP_001300779.1"; Parent "gene-C7A06_RS00095"; gbkey "CDS"; gene "yidP"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418139.1"; locus_tag "C7A06_RS00095"; product "GntR family transcriptional regulator"; protein_id "WP_001300779.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	19771	21387	.	+	.	gene_id "nbis-gene-20"; ID "nbis-gene-20"; Name "C7A06_RS00100"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00100";
+NZ_CP027599.1	RefSeq	transcript	19771	21387	.	+	.	gene_id "nbis-gene-20"; transcript_id "gene-C7A06_RS00100"; ID "gene-C7A06_RS00100"; Name "C7A06_RS00100"; Parent "nbis-gene-20"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00100"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	19771	21387	.	+	.	gene_id "nbis-gene-20"; transcript_id "gene-C7A06_RS00100"; Dbxref "Genbank:WP_000952127.1"; ID "nbis-exon-20"; Name "WP_000952127.1"; Parent "gene-C7A06_RS00100"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312650.2"; locus_tag "C7A06_RS00100"; product "PTS sugar transporter subunit IIB"; protein_id "WP_000952127.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	19771	21387	.	+	0	gene_id "nbis-gene-20"; transcript_id "gene-C7A06_RS00100"; Dbxref "Genbank:WP_000952127.1"; ID "cds-WP_000952127.1"; Name "WP_000952127.1"; Parent "gene-C7A06_RS00100"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312650.2"; locus_tag "C7A06_RS00100"; product "PTS sugar transporter subunit IIB"; protein_id "WP_000952127.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	21387	22201	.	+	.	gene_id "nbis-pseudogene-1"; ID "nbis-pseudogene-1"; Name "C7A06_RS00105"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00105"; original_biotype "pseudogene"; pseudo "true";
+NZ_CP027599.1	RefSeq	transcript	21387	22201	.	+	.	gene_id "nbis-pseudogene-1"; transcript_id "gene-C7A06_RS00105"; ID "gene-C7A06_RS00105"; Name "C7A06_RS00105"; Parent "nbis-pseudogene-1"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00105"; original_biotype "mrna"; pseudo "true";
+NZ_CP027599.1	Protein Homology	exon	21387	22201	.	+	.	gene_id "nbis-pseudogene-1"; transcript_id "gene-C7A06_RS00105"; ID "nbis-exon-21"; Note "frameshifted"; Parent "gene-C7A06_RS00105"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312649.2"; locus_tag "C7A06_RS00105"; product "hypothetical protein"; pseudo "true"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	21387	22201	.	+	0	gene_id "nbis-pseudogene-1"; transcript_id "gene-C7A06_RS00105"; ID "cds-C7A06_RS00105"; Note "frameshifted"; Parent "gene-C7A06_RS00105"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312649.2"; locus_tag "C7A06_RS00105"; product "hypothetical protein"; pseudo "true"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	22198	23091	.	-	.	gene_id "nbis-gene-21"; ID "nbis-gene-21"; Name "yidL"; gbkey "Gene"; gene "yidL"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00110";
+NZ_CP027599.1	RefSeq	transcript	22198	23091	.	-	.	gene_id "nbis-gene-21"; transcript_id "gene-C7A06_RS00110"; ID "gene-C7A06_RS00110"; Name "yidL"; Parent "nbis-gene-21"; gbkey "Gene"; gene "yidL"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00110"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	22198	23091	.	-	.	gene_id "nbis-gene-21"; transcript_id "gene-C7A06_RS00110"; Dbxref "Genbank:WP_001013540.1"; ID "nbis-exon-22"; Name "WP_001013540.1"; Parent "gene-C7A06_RS00110"; gbkey "CDS"; gene "yidL"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418136.2"; locus_tag "C7A06_RS00110"; product "AraC family transcriptional regulator"; protein_id "WP_001013540.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	22198	23091	.	-	0	gene_id "nbis-gene-21"; transcript_id "gene-C7A06_RS00110"; Dbxref "Genbank:WP_001013540.1"; ID "cds-WP_001013540.1"; Name "WP_001013540.1"; Parent "gene-C7A06_RS00110"; gbkey "CDS"; gene "yidL"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418136.2"; locus_tag "C7A06_RS00110"; product "AraC family transcriptional regulator"; protein_id "WP_001013540.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	23258	24973	.	+	.	gene_id "nbis-gene-22"; ID "nbis-gene-22"; Name "yidK"; gbkey "Gene"; gene "yidK"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00115";
+NZ_CP027599.1	RefSeq	transcript	23258	24973	.	+	.	gene_id "nbis-gene-22"; transcript_id "gene-C7A06_RS00115"; ID "gene-C7A06_RS00115"; Name "yidK"; Parent "nbis-gene-22"; gbkey "Gene"; gene "yidK"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00115"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	23258	24973	.	+	.	gene_id "nbis-gene-22"; transcript_id "gene-C7A06_RS00115"; Dbxref "Genbank:WP_001087147.1"; ID "nbis-exon-23"; Name "WP_001087147.1"; Ontology_term "GO:0055085" "GO:0022857" "GO:0016020"; Parent "gene-C7A06_RS00115"; gbkey "CDS"; gene "yidK"; go_component "membrane|0016020||IEA"; go_function "transmembrane transporter activity|0022857||IEA"; go_process "transmembrane transport|0055085||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418135.1"; locus_tag "C7A06_RS00115"; product "solute:sodium symporter family transporter"; protein_id "WP_001087147.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	23258	24973	.	+	0	gene_id "nbis-gene-22"; transcript_id "gene-C7A06_RS00115"; Dbxref "Genbank:WP_001087147.1"; ID "cds-WP_001087147.1"; Name "WP_001087147.1"; Ontology_term "GO:0055085" "GO:0022857" "GO:0016020"; Parent "gene-C7A06_RS00115"; gbkey "CDS"; gene "yidK"; go_component "membrane|0016020||IEA"; go_function "transmembrane transporter activity|0022857||IEA"; go_process "transmembrane transport|0055085||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418135.1"; locus_tag "C7A06_RS00115"; product "solute:sodium symporter family transporter"; protein_id "WP_001087147.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	24970	26463	.	+	.	gene_id "nbis-gene-23"; ID "nbis-gene-23"; Name "yidJ"; gbkey "Gene"; gene "yidJ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00120";
+NZ_CP027599.1	RefSeq	transcript	24970	26463	.	+	.	gene_id "nbis-gene-23"; transcript_id "gene-C7A06_RS00120"; ID "gene-C7A06_RS00120"; Name "yidJ"; Parent "nbis-gene-23"; gbkey "Gene"; gene "yidJ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00120"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	24970	26463	.	+	.	gene_id "nbis-gene-23"; transcript_id "gene-C7A06_RS00120"; Dbxref "Genbank:WP_000828487.1"; ID "nbis-exon-24"; Name "WP_000828487.1"; Ontology_term "GO:0008484"; Parent "gene-C7A06_RS00120"; gbkey "CDS"; gene "yidJ"; go_function "sulfuric ester hydrolase activity|0008484||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418134.1"; locus_tag "C7A06_RS00120"; product "sulfatase-like hydrolase/transferase"; protein_id "WP_000828487.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	24970	26463	.	+	0	gene_id "nbis-gene-23"; transcript_id "gene-C7A06_RS00120"; Dbxref "Genbank:WP_000828487.1"; ID "cds-WP_000828487.1"; Name "WP_000828487.1"; Ontology_term "GO:0008484"; Parent "gene-C7A06_RS00120"; gbkey "CDS"; gene "yidJ"; go_function "sulfuric ester hydrolase activity|0008484||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418134.1"; locus_tag "C7A06_RS00120"; product "sulfatase-like hydrolase/transferase"; protein_id "WP_000828487.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	26510	26959	.	-	.	gene_id "nbis-gene-24"; ID "nbis-gene-24"; Name "C7A06_RS00125"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00125";
+NZ_CP027599.1	RefSeq	transcript	26510	26959	.	-	.	gene_id "nbis-gene-24"; transcript_id "gene-C7A06_RS00125"; ID "gene-C7A06_RS00125"; Name "C7A06_RS00125"; Parent "nbis-gene-24"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00125"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	26510	26959	.	-	.	gene_id "nbis-gene-24"; transcript_id "gene-C7A06_RS00125"; Dbxref "Genbank:WP_000511287.1"; ID "nbis-exon-25"; Name "WP_000511287.1"; Parent "gene-C7A06_RS00125"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418133.1"; locus_tag "C7A06_RS00125"; product "membrane protein"; protein_id "WP_000511287.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	26510	26959	.	-	0	gene_id "nbis-gene-24"; transcript_id "gene-C7A06_RS00125"; Dbxref "Genbank:WP_000511287.1"; ID "cds-WP_000511287.1"; Name "WP_000511287.1"; Parent "gene-C7A06_RS00125"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418133.1"; locus_tag "C7A06_RS00125"; product "membrane protein"; protein_id "WP_000511287.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	27069	27416	.	+	.	gene_id "nbis-gene-25"; ID "nbis-gene-25"; Name "yidH"; gbkey "Gene"; gene "yidH"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00130";
+NZ_CP027599.1	RefSeq	transcript	27069	27416	.	+	.	gene_id "nbis-gene-25"; transcript_id "gene-C7A06_RS00130"; ID "gene-C7A06_RS00130"; Name "yidH"; Parent "nbis-gene-25"; gbkey "Gene"; gene "yidH"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00130"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	27069	27416	.	+	.	gene_id "nbis-gene-25"; transcript_id "gene-C7A06_RS00130"; Dbxref "Genbank:WP_000703959.1"; ID "nbis-exon-26"; Name "WP_000703959.1"; Parent "gene-C7A06_RS00130"; gbkey "CDS"; gene "yidH"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312644.1"; locus_tag "C7A06_RS00130"; product "YidH family protein"; protein_id "WP_000703959.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	27069	27416	.	+	0	gene_id "nbis-gene-25"; transcript_id "gene-C7A06_RS00130"; Dbxref "Genbank:WP_000703959.1"; ID "cds-WP_000703959.1"; Name "WP_000703959.1"; Parent "gene-C7A06_RS00130"; gbkey "CDS"; gene "yidH"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312644.1"; locus_tag "C7A06_RS00130"; product "YidH family protein"; protein_id "WP_000703959.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	27406	27768	.	+	.	gene_id "nbis-gene-26"; ID "nbis-gene-26"; Name "yidG"; gbkey "Gene"; gene "yidG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00135";
+NZ_CP027599.1	RefSeq	transcript	27406	27768	.	+	.	gene_id "nbis-gene-26"; transcript_id "gene-C7A06_RS00135"; ID "gene-C7A06_RS00135"; Name "yidG"; Parent "nbis-gene-26"; gbkey "Gene"; gene "yidG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00135"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	27406	27768	.	+	.	gene_id "nbis-gene-26"; transcript_id "gene-C7A06_RS00135"; Dbxref "Genbank:WP_001113432.1"; ID "nbis-exon-27"; Name "WP_001113432.1"; Parent "gene-C7A06_RS00135"; gbkey "CDS"; gene "yidG"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312643.1"; locus_tag "C7A06_RS00135"; product "DUF202 domain-containing protein"; protein_id "WP_001113432.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	27406	27768	.	+	0	gene_id "nbis-gene-26"; transcript_id "gene-C7A06_RS00135"; Dbxref "Genbank:WP_001113432.1"; ID "cds-WP_001113432.1"; Name "WP_001113432.1"; Parent "gene-C7A06_RS00135"; gbkey "CDS"; gene "yidG"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312643.1"; locus_tag "C7A06_RS00135"; product "DUF202 domain-containing protein"; protein_id "WP_001113432.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	27765	28262	.	+	.	gene_id "nbis-gene-27"; ID "nbis-gene-27"; Name "yidF"; gbkey "Gene"; gene "yidF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00140";
+NZ_CP027599.1	RefSeq	transcript	27765	28262	.	+	.	gene_id "nbis-gene-27"; transcript_id "gene-C7A06_RS00140"; ID "gene-C7A06_RS00140"; Name "yidF"; Parent "nbis-gene-27"; gbkey "Gene"; gene "yidF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00140"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	27765	28262	.	+	.	gene_id "nbis-gene-27"; transcript_id "gene-C7A06_RS00140"; Dbxref "Genbank:WP_000148063.1"; ID "nbis-exon-28"; Name "WP_000148063.1"; Parent "gene-C7A06_RS00140"; gbkey "CDS"; gene "yidF"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709521.1"; locus_tag "C7A06_RS00140"; product "radical SAM protein"; protein_id "WP_000148063.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	27765	28262	.	+	0	gene_id "nbis-gene-27"; transcript_id "gene-C7A06_RS00140"; Dbxref "Genbank:WP_000148063.1"; ID "cds-WP_000148063.1"; Name "WP_000148063.1"; Parent "gene-C7A06_RS00140"; gbkey "CDS"; gene "yidF"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709521.1"; locus_tag "C7A06_RS00140"; product "radical SAM protein"; protein_id "WP_000148063.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	28270	29454	.	-	.	gene_id "nbis-gene-28"; ID "nbis-gene-28"; Name "emrD"; gbkey "Gene"; gene "emrD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00145";
+NZ_CP027599.1	RefSeq	transcript	28270	29454	.	-	.	gene_id "nbis-gene-28"; transcript_id "gene-C7A06_RS00145"; ID "gene-C7A06_RS00145"; Name "emrD"; Parent "nbis-gene-28"; gbkey "Gene"; gene "emrD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00145"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	28270	29454	.	-	.	gene_id "nbis-gene-28"; transcript_id "gene-C7A06_RS00145"; Dbxref "Genbank:WP_000828746.1"; ID "nbis-exon-29"; Name "WP_000828746.1"; Parent "gene-C7A06_RS00145"; gbkey "CDS"; gene "emrD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418129.2"; locus_tag "C7A06_RS00145"; product "multidrug efflux MFS transporter EmrD"; protein_id "WP_000828746.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	28270	29454	.	-	0	gene_id "nbis-gene-28"; transcript_id "gene-C7A06_RS00145"; Dbxref "Genbank:WP_000828746.1"; ID "cds-WP_000828746.1"; Name "WP_000828746.1"; Parent "gene-C7A06_RS00145"; gbkey "CDS"; gene "emrD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418129.2"; locus_tag "C7A06_RS00145"; product "multidrug efflux MFS transporter EmrD"; protein_id "WP_000828746.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	29536	29610	.	+	.	gene_id "nbis-gene-5807"; ID "nbis-gene-5807"; Name "ysdE"; gbkey "Gene"; gene "ysdE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS34670";
+NZ_CP027599.1	RefSeq	transcript	29536	29610	.	+	.	gene_id "nbis-gene-5807"; transcript_id "gene-C7A06_RS34670"; ID "gene-C7A06_RS34670"; Name "ysdE"; Parent "nbis-gene-5807"; gbkey "Gene"; gene "ysdE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS34670"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	29536	29610	.	+	.	gene_id "nbis-gene-5807"; transcript_id "gene-C7A06_RS34670"; Dbxref "Genbank:WP_211180519.1"; ID "nbis-exon-6116"; Name "WP_211180519.1"; Parent "gene-C7A06_RS34670"; gbkey "CDS"; gene "ysdE"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_010051212.1"; locus_tag "C7A06_RS34670"; product "protein YsdE"; protein_id "WP_211180519.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	29536	29610	.	+	0	gene_id "nbis-gene-5807"; transcript_id "gene-C7A06_RS34670"; Dbxref "Genbank:WP_211180519.1"; ID "cds-WP_211180519.1"; Name "WP_211180519.1"; Parent "gene-C7A06_RS34670"; gbkey "CDS"; gene "ysdE"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_010051212.1"; locus_tag "C7A06_RS34670"; product "protein YsdE"; protein_id "WP_211180519.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	29873	29962	.	-	.	gene_id "nbis-gene-29"; ID "nbis-gene-29"; Name "tisB"; gbkey "Gene"; gene "tisB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00155";
+NZ_CP027599.1	RefSeq	transcript	29873	29962	.	-	.	gene_id "nbis-gene-29"; transcript_id "gene-C7A06_RS00155"; ID "gene-C7A06_RS00155"; Name "tisB"; Parent "nbis-gene-29"; gbkey "Gene"; gene "tisB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00155"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	29873	29962	.	-	.	gene_id "nbis-gene-29"; transcript_id "gene-C7A06_RS00155"; Dbxref "Genbank:WP_000060506.1"; ID "nbis-exon-30"; Name "WP_000060506.1"; Parent "gene-C7A06_RS00155"; gbkey "CDS"; gene "tisB"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_009502662.1"; locus_tag "C7A06_RS00155"; product "type I toxin-antitoxin system toxin TisB"; protein_id "WP_000060506.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	29873	29962	.	-	0	gene_id "nbis-gene-29"; transcript_id "gene-C7A06_RS00155"; Dbxref "Genbank:WP_000060506.1"; ID "cds-WP_000060506.1"; Name "WP_000060506.1"; Parent "gene-C7A06_RS00155"; gbkey "CDS"; gene "tisB"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_009502662.1"; locus_tag "C7A06_RS00155"; product "type I toxin-antitoxin system toxin TisB"; protein_id "WP_000060506.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	30527	30625	.	+	.	gene_id "nbis-gene-30"; ID "nbis-gene-30"; Name "ivbL"; gbkey "Gene"; gene "ivbL"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00175";
+NZ_CP027599.1	RefSeq	transcript	30527	30625	.	+	.	gene_id "nbis-gene-30"; transcript_id "gene-C7A06_RS00175"; ID "gene-C7A06_RS00175"; Name "ivbL"; Parent "nbis-gene-30"; gbkey "Gene"; gene "ivbL"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00175"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	30527	30625	.	+	.	gene_id "nbis-gene-30"; transcript_id "gene-C7A06_RS00175"; Dbxref "Genbank:WP_001315912.1"; ID "nbis-exon-31"; Name "WP_001315912.1"; Parent "gene-C7A06_RS00175"; gbkey "CDS"; gene "ivbL"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418128.1"; locus_tag "C7A06_RS00175"; product "ilvB operon leader peptide IvbL"; protein_id "WP_001315912.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	30527	30625	.	+	0	gene_id "nbis-gene-30"; transcript_id "gene-C7A06_RS00175"; Dbxref "Genbank:WP_001315912.1"; ID "cds-WP_001315912.1"; Name "WP_001315912.1"; Parent "gene-C7A06_RS00175"; gbkey "CDS"; gene "ivbL"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418128.1"; locus_tag "C7A06_RS00175"; product "ilvB operon leader peptide IvbL"; protein_id "WP_001315912.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	30731	32419	.	+	.	gene_id "nbis-gene-31"; ID "nbis-gene-31"; Name "ilvB"; gbkey "Gene"; gene "ilvB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00180";
+NZ_CP027599.1	RefSeq	transcript	30731	32419	.	+	.	gene_id "nbis-gene-31"; transcript_id "gene-C7A06_RS00180"; ID "gene-C7A06_RS00180"; Name "ilvB"; Parent "nbis-gene-31"; gbkey "Gene"; gene "ilvB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00180"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	30731	32419	.	+	.	gene_id "nbis-gene-31"; transcript_id "gene-C7A06_RS00180"; Dbxref "Genbank:WP_000168497.1"; ID "nbis-exon-32"; Name "WP_000168497.1"; Ontology_term "GO:0009082" "GO:0000287" "GO:0003984" "GO:0030976" "GO:0050660"; Parent "gene-C7A06_RS00180"; gbkey "CDS"; gene "ilvB"; go_function "magnesium ion binding|0000287||IEA" "acetolactate synthase activity|0003984||IEA" "thiamine pyrophosphate binding|0030976||IEA" "flavin adenine dinucleotide binding|0050660||IEA"; go_process "branched-chain amino acid biosynthetic process|0009082||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418127.1"; locus_tag "C7A06_RS00180"; product "acetolactate synthase large subunit"; protein_id "WP_000168497.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	30731	32419	.	+	0	gene_id "nbis-gene-31"; transcript_id "gene-C7A06_RS00180"; Dbxref "Genbank:WP_000168497.1"; ID "cds-WP_000168497.1"; Name "WP_000168497.1"; Ontology_term "GO:0009082" "GO:0000287" "GO:0003984" "GO:0030976" "GO:0050660"; Parent "gene-C7A06_RS00180"; gbkey "CDS"; gene "ilvB"; go_function "magnesium ion binding|0000287||IEA" "acetolactate synthase activity|0003984||IEA" "thiamine pyrophosphate binding|0030976||IEA" "flavin adenine dinucleotide binding|0050660||IEA"; go_process "branched-chain amino acid biosynthetic process|0009082||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418127.1"; locus_tag "C7A06_RS00180"; product "acetolactate synthase large subunit"; protein_id "WP_000168497.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	32423	32713	.	+	.	gene_id "nbis-gene-32"; ID "nbis-gene-32"; Name "ilvN"; gbkey "Gene"; gene "ilvN"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00185";
+NZ_CP027599.1	RefSeq	transcript	32423	32713	.	+	.	gene_id "nbis-gene-32"; transcript_id "gene-C7A06_RS00185"; ID "gene-C7A06_RS00185"; Name "ilvN"; Parent "nbis-gene-32"; gbkey "Gene"; gene "ilvN"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00185"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	32423	32713	.	+	.	gene_id "nbis-gene-32"; transcript_id "gene-C7A06_RS00185"; Dbxref "Genbank:WP_001181706.1"; ID "nbis-exon-33"; Name "WP_001181706.1"; Parent "gene-C7A06_RS00185"; gbkey "CDS"; gene "ilvN"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312638.1"; locus_tag "C7A06_RS00185"; product "acetolactate synthase small subunit"; protein_id "WP_001181706.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	32423	32713	.	+	0	gene_id "nbis-gene-32"; transcript_id "gene-C7A06_RS00185"; Dbxref "Genbank:WP_001181706.1"; ID "cds-WP_001181706.1"; Name "WP_001181706.1"; Parent "gene-C7A06_RS00185"; gbkey "CDS"; gene "ilvN"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312638.1"; locus_tag "C7A06_RS00185"; product "acetolactate synthase small subunit"; protein_id "WP_001181706.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	32788	33378	.	+	.	gene_id "nbis-gene-33"; ID "nbis-gene-33"; Name "uhpA"; gbkey "Gene"; gene "uhpA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00190";
+NZ_CP027599.1	RefSeq	transcript	32788	33378	.	+	.	gene_id "nbis-gene-33"; transcript_id "gene-C7A06_RS00190"; ID "gene-C7A06_RS00190"; Name "uhpA"; Parent "nbis-gene-33"; gbkey "Gene"; gene "uhpA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00190"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	32788	33378	.	+	.	gene_id "nbis-gene-33"; transcript_id "gene-C7A06_RS00190"; Dbxref "Genbank:WP_000633668.1"; ID "nbis-exon-34"; Name "WP_000633668.1"; Ontology_term "GO:0006355" "GO:0003677"; Parent "gene-C7A06_RS00190"; gbkey "CDS"; gene "uhpA"; go_function "DNA binding|0003677||IEA"; go_process "regulation of transcription, DNA-templated|0006355||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312633.1"; locus_tag "C7A06_RS00190"; product "transcriptional regulator UhpA"; protein_id "WP_000633668.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	32788	33378	.	+	0	gene_id "nbis-gene-33"; transcript_id "gene-C7A06_RS00190"; Dbxref "Genbank:WP_000633668.1"; ID "cds-WP_000633668.1"; Name "WP_000633668.1"; Ontology_term "GO:0006355" "GO:0003677"; Parent "gene-C7A06_RS00190"; gbkey "CDS"; gene "uhpA"; go_function "DNA binding|0003677||IEA"; go_process "regulation of transcription, DNA-templated|0006355||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312633.1"; locus_tag "C7A06_RS00190"; product "transcriptional regulator UhpA"; protein_id "WP_000633668.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	33378	34880	.	+	.	gene_id "nbis-gene-34"; ID "nbis-gene-34"; Name "uhpB"; gbkey "Gene"; gene "uhpB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00195";
+NZ_CP027599.1	RefSeq	transcript	33378	34880	.	+	.	gene_id "nbis-gene-34"; transcript_id "gene-C7A06_RS00195"; ID "gene-C7A06_RS00195"; Name "uhpB"; Parent "nbis-gene-34"; gbkey "Gene"; gene "uhpB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00195"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	33378	34880	.	+	.	gene_id "nbis-gene-34"; transcript_id "gene-C7A06_RS00195"; Dbxref "Genbank:WP_001295243.1"; ID "nbis-exon-35"; Name "WP_001295243.1"; Ontology_term "GO:0000160" "GO:0000155"; Parent "gene-C7A06_RS00195"; gbkey "CDS"; gene "uhpB"; go_function "phosphorelay sensor kinase activity|0000155||IEA"; go_process "phosphorelay signal transduction system|0000160||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418124.4"; locus_tag "C7A06_RS00195"; product "signal transduction histidine-protein kinase/phosphatase UhpB"; protein_id "WP_001295243.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	33378	34880	.	+	0	gene_id "nbis-gene-34"; transcript_id "gene-C7A06_RS00195"; Dbxref "Genbank:WP_001295243.1"; ID "cds-WP_001295243.1"; Name "WP_001295243.1"; Ontology_term "GO:0000160" "GO:0000155"; Parent "gene-C7A06_RS00195"; gbkey "CDS"; gene "uhpB"; go_function "phosphorelay sensor kinase activity|0000155||IEA"; go_process "phosphorelay signal transduction system|0000160||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418124.4"; locus_tag "C7A06_RS00195"; product "signal transduction histidine-protein kinase/phosphatase UhpB"; protein_id "WP_001295243.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	34890	36209	.	+	.	gene_id "nbis-gene-35"; ID "nbis-gene-35"; Name "uhpC"; gbkey "Gene"; gene "uhpC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00200";
+NZ_CP027599.1	RefSeq	transcript	34890	36209	.	+	.	gene_id "nbis-gene-35"; transcript_id "gene-C7A06_RS00200"; ID "gene-C7A06_RS00200"; Name "uhpC"; Parent "nbis-gene-35"; gbkey "Gene"; gene "uhpC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00200"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	34890	36209	.	+	.	gene_id "nbis-gene-35"; transcript_id "gene-C7A06_RS00200"; Dbxref "Genbank:WP_001341770.1"; ID "nbis-exon-36"; Name "WP_001341770.1"; Parent "gene-C7A06_RS00200"; gbkey "CDS"; gene "uhpC"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709527.2"; locus_tag "C7A06_RS00200"; product "MFS transporter family glucose-6-phosphate receptor UhpC"; protein_id "WP_001341770.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	34890	36209	.	+	0	gene_id "nbis-gene-35"; transcript_id "gene-C7A06_RS00200"; Dbxref "Genbank:WP_001341770.1"; ID "cds-WP_001341770.1"; Name "WP_001341770.1"; Parent "gene-C7A06_RS00200"; gbkey "CDS"; gene "uhpC"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709527.2"; locus_tag "C7A06_RS00200"; product "MFS transporter family glucose-6-phosphate receptor UhpC"; protein_id "WP_001341770.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	36465	37856	.	+	.	gene_id "nbis-gene-36"; ID "nbis-gene-36"; Name "uhpT"; gbkey "Gene"; gene "uhpT"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00205";
+NZ_CP027599.1	RefSeq	transcript	36465	37856	.	+	.	gene_id "nbis-gene-36"; transcript_id "gene-C7A06_RS00205"; ID "gene-C7A06_RS00205"; Name "uhpT"; Parent "nbis-gene-36"; gbkey "Gene"; gene "uhpT"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00205"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	36465	37856	.	+	.	gene_id "nbis-gene-36"; transcript_id "gene-C7A06_RS00205"; Dbxref "Genbank:WP_000879194.1"; ID "nbis-exon-37"; Name "WP_000879194.1"; Ontology_term "GO:0055085" "GO:0022857"; Parent "gene-C7A06_RS00205"; gbkey "CDS"; gene "uhpT"; go_function "transmembrane transporter activity|0022857||IEA"; go_process "transmembrane transport|0055085||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312630.1"; locus_tag "C7A06_RS00205"; product "hexose-6-phosphate:phosphate antiporter"; protein_id "WP_000879194.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	36465	37856	.	+	0	gene_id "nbis-gene-36"; transcript_id "gene-C7A06_RS00205"; Dbxref "Genbank:WP_000879194.1"; ID "cds-WP_000879194.1"; Name "WP_000879194.1"; Ontology_term "GO:0055085" "GO:0022857"; Parent "gene-C7A06_RS00205"; gbkey "CDS"; gene "uhpT"; go_function "transmembrane transporter activity|0022857||IEA"; go_process "transmembrane transport|0055085||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312630.1"; locus_tag "C7A06_RS00205"; product "hexose-6-phosphate:phosphate antiporter"; protein_id "WP_000879194.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	37901	39667	.	-	.	gene_id "nbis-gene-37"; ID "nbis-gene-37"; Name "adeD"; gbkey "Gene"; gene "adeD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00210";
+NZ_CP027599.1	RefSeq	transcript	37901	39667	.	-	.	gene_id "nbis-gene-37"; transcript_id "gene-C7A06_RS00210"; ID "gene-C7A06_RS00210"; Name "adeD"; Parent "nbis-gene-37"; gbkey "Gene"; gene "adeD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00210"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	37901	39667	.	-	.	gene_id "nbis-gene-37"; transcript_id "gene-C7A06_RS00210"; Dbxref "Genbank:WP_001065695.1"; ID "nbis-exon-38"; Name "WP_001065695.1"; Parent "gene-C7A06_RS00210"; gbkey "CDS"; gene "adeD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418121.1"; locus_tag "C7A06_RS00210"; product "adenine deaminase"; protein_id "WP_001065695.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	37901	39667	.	-	0	gene_id "nbis-gene-37"; transcript_id "gene-C7A06_RS00210"; Dbxref "Genbank:WP_001065695.1"; ID "cds-WP_001065695.1"; Name "WP_001065695.1"; Parent "gene-C7A06_RS00210"; gbkey "CDS"; gene "adeD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418121.1"; locus_tag "C7A06_RS00210"; product "adenine deaminase"; protein_id "WP_001065695.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	39842	41176	.	+	.	gene_id "nbis-gene-38"; ID "nbis-gene-38"; Name "adeQ"; gbkey "Gene"; gene "adeQ"; gene_biotype "protein_coding"; gene_synonym "yicO"; locus_tag "C7A06_RS00215";
+NZ_CP027599.1	RefSeq	transcript	39842	41176	.	+	.	gene_id "nbis-gene-38"; transcript_id "gene-C7A06_RS00215"; ID "gene-C7A06_RS00215"; Name "adeQ"; Parent "nbis-gene-38"; gbkey "Gene"; gene "adeQ"; gene_biotype "protein_coding"; gene_synonym "yicO"; locus_tag "C7A06_RS00215"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	39842	41176	.	+	.	gene_id "nbis-gene-38"; transcript_id "gene-C7A06_RS00215"; Dbxref "Genbank:WP_001349999.1"; ID "nbis-exon-39"; Name "WP_001349999.1"; Parent "gene-C7A06_RS00215"; gbkey "CDS"; gene "adeQ"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418120.2"; locus_tag "C7A06_RS00215"; product "adenine permease AdeQ"; protein_id "WP_001349999.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	39842	41176	.	+	0	gene_id "nbis-gene-38"; transcript_id "gene-C7A06_RS00215"; Dbxref "Genbank:WP_001349999.1"; ID "cds-WP_001349999.1"; Name "WP_001349999.1"; Parent "gene-C7A06_RS00215"; gbkey "CDS"; gene "adeQ"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418120.2"; locus_tag "C7A06_RS00215"; product "adenine permease AdeQ"; protein_id "WP_001349999.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	41229	41681	.	+	.	gene_id "nbis-gene-39"; ID "nbis-gene-39"; Name "yicN"; gbkey "Gene"; gene "yicN"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00220";
+NZ_CP027599.1	RefSeq	transcript	41229	41681	.	+	.	gene_id "nbis-gene-39"; transcript_id "gene-C7A06_RS00220"; ID "gene-C7A06_RS00220"; Name "yicN"; Parent "nbis-gene-39"; gbkey "Gene"; gene "yicN"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00220"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	41229	41681	.	+	.	gene_id "nbis-gene-39"; transcript_id "gene-C7A06_RS00220"; Dbxref "Genbank:WP_001295241.1"; ID "nbis-exon-40"; Name "WP_001295241.1"; Parent "gene-C7A06_RS00220"; gbkey "CDS"; gene "yicN"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418119.2"; locus_tag "C7A06_RS00220"; product "DUF1198 domain-containing protein"; protein_id "WP_001295241.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	41229	41681	.	+	0	gene_id "nbis-gene-39"; transcript_id "gene-C7A06_RS00220"; Dbxref "Genbank:WP_001295241.1"; ID "cds-WP_001295241.1"; Name "WP_001295241.1"; Parent "gene-C7A06_RS00220"; gbkey "CDS"; gene "yicN"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418119.2"; locus_tag "C7A06_RS00220"; product "DUF1198 domain-containing protein"; protein_id "WP_001295241.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	41892	43082	.	+	.	gene_id "nbis-gene-40"; ID "nbis-gene-40"; Name "nepI"; gbkey "Gene"; gene "nepI"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00230";
+NZ_CP027599.1	RefSeq	transcript	41892	43082	.	+	.	gene_id "nbis-gene-40"; transcript_id "gene-C7A06_RS00230"; ID "gene-C7A06_RS00230"; Name "nepI"; Parent "nbis-gene-40"; gbkey "Gene"; gene "nepI"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00230"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	41892	43082	.	+	.	gene_id "nbis-gene-40"; transcript_id "gene-C7A06_RS00230"; Dbxref "Genbank:WP_001288553.1"; ID "nbis-exon-41"; Name "WP_001288553.1"; Ontology_term "GO:0015860" "GO:0015211" "GO:0016021"; Parent "gene-C7A06_RS00230"; gbkey "CDS"; gene "nepI"; go_component "integral component of membrane|0016021||IEA"; go_function "purine nucleoside transmembrane transporter activity|0015211||IEA"; go_process "purine nucleoside transmembrane transport|0015860||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418118.2"; locus_tag "C7A06_RS00230"; product "purine ribonucleoside efflux pump NepI"; protein_id "WP_001288553.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	41892	43082	.	+	0	gene_id "nbis-gene-40"; transcript_id "gene-C7A06_RS00230"; Dbxref "Genbank:WP_001288553.1"; ID "cds-WP_001288553.1"; Name "WP_001288553.1"; Ontology_term "GO:0015860" "GO:0015211" "GO:0016021"; Parent "gene-C7A06_RS00230"; gbkey "CDS"; gene "nepI"; go_component "integral component of membrane|0016021||IEA"; go_function "purine nucleoside transmembrane transporter activity|0015211||IEA"; go_process "purine nucleoside transmembrane transport|0015860||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418118.2"; locus_tag "C7A06_RS00230"; product "purine ribonucleoside efflux pump NepI"; protein_id "WP_001288553.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	43123	43416	.	-	.	gene_id "nbis-gene-41"; ID "nbis-gene-41"; Name "C7A06_RS00235"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00235";
+NZ_CP027599.1	RefSeq	transcript	43123	43416	.	-	.	gene_id "nbis-gene-41"; transcript_id "gene-C7A06_RS00235"; ID "gene-C7A06_RS00235"; Name "C7A06_RS00235"; Parent "nbis-gene-41"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00235"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	43123	43416	.	-	.	gene_id "nbis-gene-41"; transcript_id "gene-C7A06_RS00235"; Dbxref "Genbank:WP_000805507.1"; ID "nbis-exon-42"; Name "WP_000805507.1"; Parent "gene-C7A06_RS00235"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_588471.1"; locus_tag "C7A06_RS00235"; product "hypothetical protein"; protein_id "WP_000805507.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	43123	43416	.	-	0	gene_id "nbis-gene-41"; transcript_id "gene-C7A06_RS00235"; Dbxref "Genbank:WP_000805507.1"; ID "cds-WP_000805507.1"; Name "WP_000805507.1"; Parent "gene-C7A06_RS00235"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_588471.1"; locus_tag "C7A06_RS00235"; product "hypothetical protein"; protein_id "WP_000805507.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	43638	44456	.	+	.	gene_id "nbis-gene-42"; ID "nbis-gene-42"; Name "nlpA"; gbkey "Gene"; gene "nlpA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00245";
+NZ_CP027599.1	RefSeq	transcript	43638	44456	.	+	.	gene_id "nbis-gene-42"; transcript_id "gene-C7A06_RS00245"; ID "gene-C7A06_RS00245"; Name "nlpA"; Parent "nbis-gene-42"; gbkey "Gene"; gene "nlpA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00245"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	43638	44456	.	+	.	gene_id "nbis-gene-42"; transcript_id "gene-C7A06_RS00245"; Dbxref "Genbank:WP_000779426.1"; ID "nbis-exon-43"; Name "WP_000779426.1"; Parent "gene-C7A06_RS00245"; gbkey "CDS"; gene "nlpA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418117.1"; locus_tag "C7A06_RS00245"; product "lipoprotein NlpA"; protein_id "WP_000779426.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	43638	44456	.	+	0	gene_id "nbis-gene-42"; transcript_id "gene-C7A06_RS00245"; Dbxref "Genbank:WP_000779426.1"; ID "cds-WP_000779426.1"; Name "WP_000779426.1"; Parent "gene-C7A06_RS00245"; gbkey "CDS"; gene "nlpA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418117.1"; locus_tag "C7A06_RS00245"; product "lipoprotein NlpA"; protein_id "WP_000779426.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	44460	45383	.	-	.	gene_id "nbis-gene-43"; ID "nbis-gene-43"; Name "yicL"; gbkey "Gene"; gene "yicL"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00250";
+NZ_CP027599.1	RefSeq	transcript	44460	45383	.	-	.	gene_id "nbis-gene-43"; transcript_id "gene-C7A06_RS00250"; ID "gene-C7A06_RS00250"; Name "yicL"; Parent "nbis-gene-43"; gbkey "Gene"; gene "yicL"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00250"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	44460	45383	.	-	.	gene_id "nbis-gene-43"; transcript_id "gene-C7A06_RS00250"; Dbxref "Genbank:WP_000535958.1"; ID "nbis-exon-44"; Name "WP_000535958.1"; Ontology_term "GO:0016021"; Parent "gene-C7A06_RS00250"; gbkey "CDS"; gene "yicL"; go_component "integral component of membrane|0016021||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418116.1"; locus_tag "C7A06_RS00250"; product "carboxylate/amino acid/amine transporter"; protein_id "WP_000535958.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	44460	45383	.	-	0	gene_id "nbis-gene-43"; transcript_id "gene-C7A06_RS00250"; Dbxref "Genbank:WP_000535958.1"; ID "cds-WP_000535958.1"; Name "WP_000535958.1"; Ontology_term "GO:0016021"; Parent "gene-C7A06_RS00250"; gbkey "CDS"; gene "yicL"; go_component "integral component of membrane|0016021||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418116.1"; locus_tag "C7A06_RS00250"; product "carboxylate/amino acid/amine transporter"; protein_id "WP_000535958.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	45494	46678	.	-	.	gene_id "nbis-gene-44"; ID "nbis-gene-44"; Name "setC"; gbkey "Gene"; gene "setC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00255";
+NZ_CP027599.1	RefSeq	transcript	45494	46678	.	-	.	gene_id "nbis-gene-44"; transcript_id "gene-C7A06_RS00255"; ID "gene-C7A06_RS00255"; Name "setC"; Parent "nbis-gene-44"; gbkey "Gene"; gene "setC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00255"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	45494	46678	.	-	.	gene_id "nbis-gene-44"; transcript_id "gene-C7A06_RS00255"; Dbxref "Genbank:WP_001172895.1"; ID "nbis-exon-45"; Name "WP_001172895.1"; Ontology_term "GO:0008643" "GO:0005351"; Parent "gene-C7A06_RS00255"; gbkey "CDS"; gene "setC"; go_function "carbohydrate:proton symporter activity|0005351||IEA"; go_process "carbohydrate transport|0008643||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418115.1"; locus_tag "C7A06_RS00255"; product "sugar efflux transporter"; protein_id "WP_001172895.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	45494	46678	.	-	0	gene_id "nbis-gene-44"; transcript_id "gene-C7A06_RS00255"; Dbxref "Genbank:WP_001172895.1"; ID "cds-WP_001172895.1"; Name "WP_001172895.1"; Ontology_term "GO:0008643" "GO:0005351"; Parent "gene-C7A06_RS00255"; gbkey "CDS"; gene "setC"; go_function "carbohydrate:proton symporter activity|0005351||IEA"; go_process "carbohydrate transport|0008643||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418115.1"; locus_tag "C7A06_RS00255"; product "sugar efflux transporter"; protein_id "WP_001172895.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	47107	47235	.	-	.	gene_id "nbis-pseudogene-2"; ID "nbis-pseudogene-2"; Name "C7A06_RS00260"; end_range "47235" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00260"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "47107";
+NZ_CP027599.1	RefSeq	transcript	47107	47235	.	-	.	gene_id "nbis-pseudogene-2"; transcript_id "gene-C7A06_RS00260"; ID "gene-C7A06_RS00260"; Name "C7A06_RS00260"; Parent "nbis-pseudogene-2"; end_range "47235" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00260"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "47107";
+NZ_CP027599.1	Protein Homology	exon	47107	47235	.	-	.	gene_id "nbis-pseudogene-2"; transcript_id "gene-C7A06_RS00260"; ID "nbis-exon-46"; Note "internal stop; incomplete; partial in the middle of a contig; missing N-terminus and C-terminus"; Parent "gene-C7A06_RS00260"; end_range "47235" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_462654.1"; locus_tag "C7A06_RS00260"; partial "true"; product "virulence RhuM family protein"; pseudo "true"; start_range "." "47107"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	47107	47235	.	-	0	gene_id "nbis-pseudogene-2"; transcript_id "gene-C7A06_RS00260"; ID "cds-C7A06_RS00260"; Note "internal stop; incomplete; partial in the middle of a contig; missing N-terminus and C-terminus"; Parent "gene-C7A06_RS00260"; end_range "47235" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_462654.1"; locus_tag "C7A06_RS00260"; partial "true"; product "virulence RhuM family protein"; pseudo "true"; start_range "." "47107"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	47473	48315	.	-	.	gene_id "nbis-gene-45"; ID "nbis-gene-45"; Name "C7A06_RS00270"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00270";
+NZ_CP027599.1	RefSeq	transcript	47473	48315	.	-	.	gene_id "nbis-gene-45"; transcript_id "gene-C7A06_RS00270"; ID "gene-C7A06_RS00270"; Name "C7A06_RS00270"; Parent "nbis-gene-45"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00270"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	47473	48315	.	-	.	gene_id "nbis-gene-45"; transcript_id "gene-C7A06_RS00270"; Dbxref "Genbank:WP_032348719.1"; ID "nbis-exon-47"; Name "WP_032348719.1"; Parent "gene-C7A06_RS00270"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001696593.1"; locus_tag "C7A06_RS00270"; product "DUF4942 domain-containing protein"; protein_id "WP_032348719.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	47473	48315	.	-	0	gene_id "nbis-gene-45"; transcript_id "gene-C7A06_RS00270"; Dbxref "Genbank:WP_032348719.1"; ID "cds-WP_032348719.1"; Name "WP_032348719.1"; Parent "gene-C7A06_RS00270"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001696593.1"; locus_tag "C7A06_RS00270"; product "DUF4942 domain-containing protein"; protein_id "WP_032348719.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	48400	48597	.	-	.	gene_id "nbis-gene-46"; ID "nbis-gene-46"; Name "C7A06_RS00275"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00275";
+NZ_CP027599.1	RefSeq	transcript	48400	48597	.	-	.	gene_id "nbis-gene-46"; transcript_id "gene-C7A06_RS00275"; ID "gene-C7A06_RS00275"; Name "C7A06_RS00275"; Parent "nbis-gene-46"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00275"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	48400	48597	.	-	.	gene_id "nbis-gene-46"; transcript_id "gene-C7A06_RS00275"; Dbxref "Genbank:WP_086795284.1"; ID "nbis-exon-48"; Name "WP_086795284.1"; Parent "gene-C7A06_RS00275"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_708775.1"; locus_tag "C7A06_RS00275"; product "DUF957 domain-containing protein"; protein_id "WP_086795284.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	48400	48597	.	-	0	gene_id "nbis-gene-46"; transcript_id "gene-C7A06_RS00275"; Dbxref "Genbank:WP_086795284.1"; ID "cds-WP_086795284.1"; Name "WP_086795284.1"; Parent "gene-C7A06_RS00275"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_708775.1"; locus_tag "C7A06_RS00275"; product "DUF957 domain-containing protein"; protein_id "WP_086795284.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	48673	48822	.	-	.	gene_id "nbis-pseudogene-3"; ID "nbis-pseudogene-3"; Name "C7A06_RS00280"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00280"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "48673";
+NZ_CP027599.1	RefSeq	transcript	48673	48822	.	-	.	gene_id "nbis-pseudogene-3"; transcript_id "gene-C7A06_RS00280"; ID "gene-C7A06_RS00280"; Name "C7A06_RS00280"; Parent "nbis-pseudogene-3"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00280"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "48673";
+NZ_CP027599.1	Protein Homology	exon	48673	48822	.	-	.	gene_id "nbis-pseudogene-3"; transcript_id "gene-C7A06_RS00280"; ID "nbis-exon-49"; Note "incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS00280"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_708774.1"; locus_tag "C7A06_RS00280"; partial "true"; product "DUF5983 family protein"; pseudo "true"; start_range "." "48673"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	48673	48822	.	-	0	gene_id "nbis-pseudogene-3"; transcript_id "gene-C7A06_RS00280"; ID "cds-C7A06_RS00280"; Note "incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS00280"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_708774.1"; locus_tag "C7A06_RS00280"; partial "true"; product "DUF5983 family protein"; pseudo "true"; start_range "." "48673"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	48819	49196	.	-	.	gene_id "nbis-gene-47"; ID "nbis-gene-47"; Name "cbtA"; gbkey "Gene"; gene "cbtA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00285";
+NZ_CP027599.1	RefSeq	transcript	48819	49196	.	-	.	gene_id "nbis-gene-47"; transcript_id "gene-C7A06_RS00285"; ID "gene-C7A06_RS00285"; Name "cbtA"; Parent "nbis-gene-47"; gbkey "Gene"; gene "cbtA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00285"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	48819	49196	.	-	.	gene_id "nbis-gene-47"; transcript_id "gene-C7A06_RS00285"; Dbxref "Genbank:WP_000854821.1"; ID "nbis-exon-50"; Name "WP_000854821.1"; Parent "gene-C7A06_RS00285"; gbkey "CDS"; gene "cbtA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000854828.1"; locus_tag "C7A06_RS00285"; product "type IV toxin-antitoxin system toxin CbtA"; protein_id "WP_000854821.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	48819	49196	.	-	0	gene_id "nbis-gene-47"; transcript_id "gene-C7A06_RS00285"; Dbxref "Genbank:WP_000854821.1"; ID "cds-WP_000854821.1"; Name "WP_000854821.1"; Parent "gene-C7A06_RS00285"; gbkey "CDS"; gene "cbtA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000854828.1"; locus_tag "C7A06_RS00285"; product "type IV toxin-antitoxin system toxin CbtA"; protein_id "WP_000854821.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	49286	49654	.	-	.	gene_id "nbis-gene-48"; ID "nbis-gene-48"; Name "C7A06_RS00290"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00290";
+NZ_CP027599.1	RefSeq	transcript	49286	49654	.	-	.	gene_id "nbis-gene-48"; transcript_id "gene-C7A06_RS00290"; ID "gene-C7A06_RS00290"; Name "C7A06_RS00290"; Parent "nbis-gene-48"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00290"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	49286	49654	.	-	.	gene_id "nbis-gene-48"; transcript_id "gene-C7A06_RS00290"; Dbxref "Genbank:WP_001285609.1"; ID "nbis-exon-51"; Name "WP_001285609.1"; Parent "gene-C7A06_RS00290"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001443430.1"; locus_tag "C7A06_RS00290"; product "type IV toxin-antitoxin system YeeU family antitoxin"; protein_id "WP_001285609.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	49286	49654	.	-	0	gene_id "nbis-gene-48"; transcript_id "gene-C7A06_RS00290"; Dbxref "Genbank:WP_001285609.1"; ID "cds-WP_001285609.1"; Name "WP_001285609.1"; Parent "gene-C7A06_RS00290"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001443430.1"; locus_tag "C7A06_RS00290"; product "type IV toxin-antitoxin system YeeU family antitoxin"; protein_id "WP_001285609.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	49734	49955	.	-	.	gene_id "nbis-pseudogene-4"; ID "nbis-pseudogene-4"; Name "C7A06_RS00295"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00295"; original_biotype "pseudogene"; pseudo "true";
+NZ_CP027599.1	RefSeq	transcript	49734	49955	.	-	.	gene_id "nbis-pseudogene-4"; transcript_id "gene-C7A06_RS00295"; ID "gene-C7A06_RS00295"; Name "C7A06_RS00295"; Parent "nbis-pseudogene-4"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00295"; original_biotype "mrna"; pseudo "true";
+NZ_CP027599.1	Protein Homology	exon	49734	49955	.	-	.	gene_id "nbis-pseudogene-4"; transcript_id "gene-C7A06_RS00295"; ID "nbis-exon-52"; Note "internal stop"; Parent "gene-C7A06_RS00295"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_708771.1"; locus_tag "C7A06_RS00295"; product "DUF987 domain-containing protein"; pseudo "true"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	49734	49955	.	-	0	gene_id "nbis-pseudogene-4"; transcript_id "gene-C7A06_RS00295"; ID "cds-C7A06_RS00295"; Note "internal stop"; Parent "gene-C7A06_RS00295"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_708771.1"; locus_tag "C7A06_RS00295"; product "DUF987 domain-containing protein"; pseudo "true"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	50042	50518	.	-	.	gene_id "nbis-gene-49"; ID "nbis-gene-49"; Name "C7A06_RS00300"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00300";
+NZ_CP027599.1	RefSeq	transcript	50042	50518	.	-	.	gene_id "nbis-gene-49"; transcript_id "gene-C7A06_RS00300"; ID "gene-C7A06_RS00300"; Name "C7A06_RS00300"; Parent "nbis-gene-49"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00300"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	50042	50518	.	-	.	gene_id "nbis-gene-49"; transcript_id "gene-C7A06_RS00300"; Dbxref "Genbank:WP_001186768.1"; ID "nbis-exon-53"; Name "WP_001186768.1"; Parent "gene-C7A06_RS00300"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_310830.1"; locus_tag "C7A06_RS00300"; product "RadC family protein"; protein_id "WP_001186768.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	50042	50518	.	-	0	gene_id "nbis-gene-49"; transcript_id "gene-C7A06_RS00300"; Dbxref "Genbank:WP_001186768.1"; ID "cds-WP_001186768.1"; Name "WP_001186768.1"; Parent "gene-C7A06_RS00300"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_310830.1"; locus_tag "C7A06_RS00300"; product "RadC family protein"; protein_id "WP_001186768.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	50533	51012	.	-	.	gene_id "nbis-gene-50"; ID "nbis-gene-50"; Name "C7A06_RS00305"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00305";
+NZ_CP027599.1	RefSeq	transcript	50533	51012	.	-	.	gene_id "nbis-gene-50"; transcript_id "gene-C7A06_RS00305"; ID "gene-C7A06_RS00305"; Name "C7A06_RS00305"; Parent "nbis-gene-50"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00305"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	50533	51012	.	-	.	gene_id "nbis-gene-50"; transcript_id "gene-C7A06_RS00305"; Dbxref "Genbank:WP_000706979.1"; ID "nbis-exon-54"; Name "WP_000706979.1"; Parent "gene-C7A06_RS00305"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_708769.2"; locus_tag "C7A06_RS00305"; product "antirestriction protein"; protein_id "WP_000706979.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	50533	51012	.	-	0	gene_id "nbis-gene-50"; transcript_id "gene-C7A06_RS00305"; Dbxref "Genbank:WP_000706979.1"; ID "cds-WP_000706979.1"; Name "WP_000706979.1"; Parent "gene-C7A06_RS00305"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_708769.2"; locus_tag "C7A06_RS00305"; product "antirestriction protein"; protein_id "WP_000706979.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	51112	51252	.	+	.	gene_id "nbis-gene-5706"; ID "nbis-gene-5706"; Name "C7A06_RS33905"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33905";
+NZ_CP027599.1	RefSeq	transcript	51112	51252	.	+	.	gene_id "nbis-gene-5706"; transcript_id "gene-C7A06_RS33905"; ID "gene-C7A06_RS33905"; Name "C7A06_RS33905"; Parent "nbis-gene-5706"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33905"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	51112	51252	.	+	.	gene_id "nbis-gene-5706"; transcript_id "gene-C7A06_RS33905"; Dbxref "Genbank:WP_000997937.1"; ID "nbis-exon-5987"; Name "WP_000997937.1"; Parent "gene-C7A06_RS33905"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000997937.1"; locus_tag "C7A06_RS33905"; product "hypothetical protein"; protein_id "WP_000997937.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	51112	51252	.	+	0	gene_id "nbis-gene-5706"; transcript_id "gene-C7A06_RS33905"; Dbxref "Genbank:WP_000997937.1"; ID "cds-WP_000997937.1"; Name "WP_000997937.1"; Parent "gene-C7A06_RS33905"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000997937.1"; locus_tag "C7A06_RS33905"; product "hypothetical protein"; protein_id "WP_000997937.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	51290	52096	.	-	.	gene_id "nbis-gene-51"; ID "nbis-gene-51"; Name "C7A06_RS00310"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00310";
+NZ_CP027599.1	RefSeq	transcript	51290	52096	.	-	.	gene_id "nbis-gene-51"; transcript_id "gene-C7A06_RS00310"; ID "gene-C7A06_RS00310"; Name "C7A06_RS00310"; Parent "nbis-gene-51"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00310"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	51290	52096	.	-	.	gene_id "nbis-gene-51"; transcript_id "gene-C7A06_RS00310"; Dbxref "Genbank:WP_001175154.1"; ID "nbis-exon-55"; Name "WP_001175154.1"; Parent "gene-C7A06_RS00310"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_309428.1"; locus_tag "C7A06_RS00310"; product "DUF945 domain-containing protein"; protein_id "WP_001175154.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	51290	52096	.	-	0	gene_id "nbis-gene-51"; transcript_id "gene-C7A06_RS00310"; Dbxref "Genbank:WP_001175154.1"; ID "cds-WP_001175154.1"; Name "WP_001175154.1"; Parent "gene-C7A06_RS00310"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_309428.1"; locus_tag "C7A06_RS00310"; product "DUF945 domain-containing protein"; protein_id "WP_001175154.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	52186	52419	.	-	.	gene_id "nbis-gene-52"; ID "nbis-gene-52"; Name "C7A06_RS00315"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00315";
+NZ_CP027599.1	RefSeq	transcript	52186	52419	.	-	.	gene_id "nbis-gene-52"; transcript_id "gene-C7A06_RS00315"; ID "gene-C7A06_RS00315"; Name "C7A06_RS00315"; Parent "nbis-gene-52"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00315"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	52186	52419	.	-	.	gene_id "nbis-gene-52"; transcript_id "gene-C7A06_RS00315"; Dbxref "Genbank:WP_001278287.1"; ID "nbis-exon-56"; Name "WP_001278287.1"; Parent "gene-C7A06_RS00315"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001278287.1"; locus_tag "C7A06_RS00315"; product "DUF905 family protein"; protein_id "WP_001278287.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	52186	52419	.	-	0	gene_id "nbis-gene-52"; transcript_id "gene-C7A06_RS00315"; Dbxref "Genbank:WP_001278287.1"; ID "cds-WP_001278287.1"; Name "WP_001278287.1"; Parent "gene-C7A06_RS00315"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001278287.1"; locus_tag "C7A06_RS00315"; product "DUF905 family protein"; protein_id "WP_001278287.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	52425	53102	.	-	.	gene_id "nbis-gene-53"; ID "nbis-gene-53"; Name "C7A06_RS00320"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00320";
+NZ_CP027599.1	RefSeq	transcript	52425	53102	.	-	.	gene_id "nbis-gene-53"; transcript_id "gene-C7A06_RS00320"; ID "gene-C7A06_RS00320"; Name "C7A06_RS00320"; Parent "nbis-gene-53"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00320"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	52425	53102	.	-	.	gene_id "nbis-gene-53"; transcript_id "gene-C7A06_RS00320"; Dbxref "Genbank:WP_001097301.1"; ID "nbis-exon-57"; Name "WP_001097301.1"; Parent "gene-C7A06_RS00320"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001097314.1"; locus_tag "C7A06_RS00320"; product "hypothetical protein"; protein_id "WP_001097301.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	52425	53102	.	-	0	gene_id "nbis-gene-53"; transcript_id "gene-C7A06_RS00320"; Dbxref "Genbank:WP_001097301.1"; ID "cds-WP_001097301.1"; Name "WP_001097301.1"; Parent "gene-C7A06_RS00320"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001097314.1"; locus_tag "C7A06_RS00320"; product "hypothetical protein"; protein_id "WP_001097301.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	53250	53930	.	-	.	gene_id "nbis-gene-54"; ID "nbis-gene-54"; Name "C7A06_RS00325"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00325";
+NZ_CP027599.1	RefSeq	transcript	53250	53930	.	-	.	gene_id "nbis-gene-54"; transcript_id "gene-C7A06_RS00325"; ID "gene-C7A06_RS00325"; Name "C7A06_RS00325"; Parent "nbis-gene-54"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00325"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	53250	53930	.	-	.	gene_id "nbis-gene-54"; transcript_id "gene-C7A06_RS00325"; Dbxref "Genbank:WP_001282919.1"; ID "nbis-exon-58"; Name "WP_001282919.1"; Parent "gene-C7A06_RS00325"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001278649.1"; locus_tag "C7A06_RS00325"; product "WYL domain-containing protein"; protein_id "WP_001282919.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	53250	53930	.	-	0	gene_id "nbis-gene-54"; transcript_id "gene-C7A06_RS00325"; Dbxref "Genbank:WP_001282919.1"; ID "cds-WP_001282919.1"; Name "WP_001282919.1"; Parent "gene-C7A06_RS00325"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001278649.1"; locus_tag "C7A06_RS00325"; product "WYL domain-containing protein"; protein_id "WP_001282919.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	54133	55017	.	-	.	gene_id "nbis-gene-55"; ID "nbis-gene-55"; Name "C7A06_RS00330"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00330";
+NZ_CP027599.1	RefSeq	transcript	54133	55017	.	-	.	gene_id "nbis-gene-55"; transcript_id "gene-C7A06_RS00330"; ID "gene-C7A06_RS00330"; Name "C7A06_RS00330"; Parent "nbis-gene-55"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00330"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	54133	55017	.	-	.	gene_id "nbis-gene-55"; transcript_id "gene-C7A06_RS00330"; Dbxref "Genbank:WP_000010408.1"; ID "nbis-exon-59"; Name "WP_000010408.1"; Ontology_term "GO:0005525"; Parent "gene-C7A06_RS00330"; gbkey "CDS"; go_function "GTP binding|0005525||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001557377.1"; locus_tag "C7A06_RS00330"; product "50S ribosome-binding GTPase"; protein_id "WP_000010408.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	54133	55017	.	-	0	gene_id "nbis-gene-55"; transcript_id "gene-C7A06_RS00330"; Dbxref "Genbank:WP_000010408.1"; ID "cds-WP_000010408.1"; Name "WP_000010408.1"; Ontology_term "GO:0005525"; Parent "gene-C7A06_RS00330"; gbkey "CDS"; go_function "GTP binding|0005525||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001557377.1"; locus_tag "C7A06_RS00330"; product "50S ribosome-binding GTPase"; protein_id "WP_000010408.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	55202	56332	.	+	.	gene_id "nbis-gene-56"; ID "nbis-gene-56"; Name "C7A06_RS00335"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00335";
+NZ_CP027599.1	RefSeq	transcript	55202	56332	.	+	.	gene_id "nbis-gene-56"; transcript_id "gene-C7A06_RS00335"; ID "gene-C7A06_RS00335"; Name "C7A06_RS00335"; Parent "nbis-gene-56"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00335"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	55202	56332	.	+	.	gene_id "nbis-gene-56"; transcript_id "gene-C7A06_RS00335"; Dbxref "Genbank:WP_000147741.1"; ID "nbis-exon-60"; Name "WP_000147741.1"; Parent "gene-C7A06_RS00335"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000147750.1"; locus_tag "C7A06_RS00335"; product "hypothetical protein"; protein_id "WP_000147741.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	55202	56332	.	+	0	gene_id "nbis-gene-56"; transcript_id "gene-C7A06_RS00335"; Dbxref "Genbank:WP_000147741.1"; ID "cds-WP_000147741.1"; Name "WP_000147741.1"; Parent "gene-C7A06_RS00335"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000147750.1"; locus_tag "C7A06_RS00335"; product "hypothetical protein"; protein_id "WP_000147741.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	57825	58556	.	+	.	gene_id "nbis-gene-57"; ID "nbis-gene-57"; Name "C7A06_RS00340"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00340";
+NZ_CP027599.1	RefSeq	transcript	57825	58556	.	+	.	gene_id "nbis-gene-57"; transcript_id "gene-C7A06_RS00340"; ID "gene-C7A06_RS00340"; Name "C7A06_RS00340"; Parent "nbis-gene-57"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00340"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	57825	58556	.	+	.	gene_id "nbis-gene-57"; transcript_id "gene-C7A06_RS00340"; Dbxref "Genbank:WP_001075456.1"; ID "nbis-exon-61"; Name "WP_001075456.1"; Parent "gene-C7A06_RS00340"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001075464.1"; locus_tag "C7A06_RS00340"; product "inovirus Gp2 family protein"; protein_id "WP_001075456.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	57825	58556	.	+	0	gene_id "nbis-gene-57"; transcript_id "gene-C7A06_RS00340"; Dbxref "Genbank:WP_001075456.1"; ID "cds-WP_001075456.1"; Name "WP_001075456.1"; Parent "gene-C7A06_RS00340"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001075464.1"; locus_tag "C7A06_RS00340"; product "inovirus Gp2 family protein"; protein_id "WP_001075456.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	58884	59762	.	+	.	gene_id "nbis-gene-58"; ID "nbis-gene-58"; Name "C7A06_RS00345"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00345";
+NZ_CP027599.1	RefSeq	transcript	58884	59762	.	+	.	gene_id "nbis-gene-58"; transcript_id "gene-C7A06_RS00345"; ID "gene-C7A06_RS00345"; Name "C7A06_RS00345"; Parent "nbis-gene-58"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00345"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	58884	59762	.	+	.	gene_id "nbis-gene-58"; transcript_id "gene-C7A06_RS00345"; Dbxref "Genbank:WP_000769115.1"; ID "nbis-exon-62"; Name "WP_000769115.1"; Parent "gene-C7A06_RS00345"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_008786839.1"; locus_tag "C7A06_RS00345"; product "restriction endonuclease"; protein_id "WP_000769115.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	58884	59762	.	+	0	gene_id "nbis-gene-58"; transcript_id "gene-C7A06_RS00345"; Dbxref "Genbank:WP_000769115.1"; ID "cds-WP_000769115.1"; Name "WP_000769115.1"; Parent "gene-C7A06_RS00345"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_008786839.1"; locus_tag "C7A06_RS00345"; product "restriction endonuclease"; protein_id "WP_000769115.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	59816	60369	.	+	.	gene_id "nbis-pseudogene-5"; ID "nbis-pseudogene-5"; Name "C7A06_RS00350"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00350"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "59816";
+NZ_CP027599.1	RefSeq	transcript	59816	60369	.	+	.	gene_id "nbis-pseudogene-5"; transcript_id "gene-C7A06_RS00350"; ID "gene-C7A06_RS00350"; Name "C7A06_RS00350"; Parent "nbis-pseudogene-5"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00350"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "59816";
+NZ_CP027599.1	Protein Homology	exon	59816	60369	.	+	.	gene_id "nbis-pseudogene-5"; transcript_id "gene-C7A06_RS00350"; ID "nbis-exon-63"; Note "frameshifted; internal stop; incomplete; partial in the middle of a contig; missing N-terminus"; Ontology_term "GO:0006313" "GO:0003677" "GO:0004803"; Parent "gene-C7A06_RS00350"; gbkey "CDS"; go_function "DNA binding|0003677||IEA" "transposase activity|0004803||IEA"; go_process "transposition, DNA-mediated|0006313||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000343613.1"; locus_tag "C7A06_RS00350"; partial "true"; product "transposase"; pseudo "true"; start_range "." "59816"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	59816	60369	.	+	0	gene_id "nbis-pseudogene-5"; transcript_id "gene-C7A06_RS00350"; ID "cds-C7A06_RS00350"; Note "frameshifted; internal stop; incomplete; partial in the middle of a contig; missing N-terminus"; Ontology_term "GO:0006313" "GO:0003677" "GO:0004803"; Parent "gene-C7A06_RS00350"; gbkey "CDS"; go_function "DNA binding|0003677||IEA" "transposase activity|0004803||IEA"; go_process "transposition, DNA-mediated|0006313||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000343613.1"; locus_tag "C7A06_RS00350"; partial "true"; product "transposase"; pseudo "true"; start_range "." "59816"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	61437	62003	.	+	.	gene_id "nbis-gene-59"; ID "nbis-gene-59"; Name "C7A06_RS00355"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00355";
+NZ_CP027599.1	RefSeq	transcript	61437	62003	.	+	.	gene_id "nbis-gene-59"; transcript_id "gene-C7A06_RS00355"; ID "gene-C7A06_RS00355"; Name "C7A06_RS00355"; Parent "nbis-gene-59"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00355"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	61437	62003	.	+	.	gene_id "nbis-gene-59"; transcript_id "gene-C7A06_RS00355"; Dbxref "Genbank:WP_001126817.1"; ID "nbis-exon-64"; Name "WP_001126817.1"; Parent "gene-C7A06_RS00355"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001126805.1"; locus_tag "C7A06_RS00355"; product "inovirus-type Gp2 protein"; protein_id "WP_001126817.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	61437	62003	.	+	0	gene_id "nbis-gene-59"; transcript_id "gene-C7A06_RS00355"; Dbxref "Genbank:WP_001126817.1"; ID "cds-WP_001126817.1"; Name "WP_001126817.1"; Parent "gene-C7A06_RS00355"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001126805.1"; locus_tag "C7A06_RS00355"; product "inovirus-type Gp2 protein"; protein_id "WP_001126817.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	62250	62822	.	+	.	gene_id "nbis-gene-60"; ID "nbis-gene-60"; Name "C7A06_RS00360"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00360";
+NZ_CP027599.1	RefSeq	transcript	62250	62822	.	+	.	gene_id "nbis-gene-60"; transcript_id "gene-C7A06_RS00360"; ID "gene-C7A06_RS00360"; Name "C7A06_RS00360"; Parent "nbis-gene-60"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00360"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	62250	62822	.	+	.	gene_id "nbis-gene-60"; transcript_id "gene-C7A06_RS00360"; Dbxref "Genbank:WP_000991590.1"; ID "nbis-exon-65"; Name "WP_000991590.1"; Parent "gene-C7A06_RS00360"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_012602601.1"; locus_tag "C7A06_RS00360"; product "hypothetical protein"; protein_id "WP_000991590.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	62250	62822	.	+	0	gene_id "nbis-gene-60"; transcript_id "gene-C7A06_RS00360"; Dbxref "Genbank:WP_000991590.1"; ID "cds-WP_000991590.1"; Name "WP_000991590.1"; Parent "gene-C7A06_RS00360"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_012602601.1"; locus_tag "C7A06_RS00360"; product "hypothetical protein"; protein_id "WP_000991590.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	62891	63127	.	+	.	gene_id "nbis-gene-61"; ID "nbis-gene-61"; Name "C7A06_RS00365"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00365";
+NZ_CP027599.1	RefSeq	transcript	62891	63127	.	+	.	gene_id "nbis-gene-61"; transcript_id "gene-C7A06_RS00365"; ID "gene-C7A06_RS00365"; Name "C7A06_RS00365"; Parent "nbis-gene-61"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00365"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	62891	63127	.	+	.	gene_id "nbis-gene-61"; transcript_id "gene-C7A06_RS00365"; Dbxref "Genbank:WP_000958094.1"; ID "nbis-exon-66"; Name "WP_000958094.1"; Parent "gene-C7A06_RS00365"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000958092.1"; locus_tag "C7A06_RS00365"; product "AlpA family transcriptional regulator"; protein_id "WP_000958094.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	62891	63127	.	+	0	gene_id "nbis-gene-61"; transcript_id "gene-C7A06_RS00365"; Dbxref "Genbank:WP_000958094.1"; ID "cds-WP_000958094.1"; Name "WP_000958094.1"; Parent "gene-C7A06_RS00365"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000958092.1"; locus_tag "C7A06_RS00365"; product "AlpA family transcriptional regulator"; protein_id "WP_000958094.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	63762	64880	.	+	.	gene_id "nbis-gene-62"; ID "nbis-gene-62"; Name "C7A06_RS00375"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00375";
+NZ_CP027599.1	RefSeq	transcript	63762	64880	.	+	.	gene_id "nbis-gene-62"; transcript_id "gene-C7A06_RS00375"; ID "gene-C7A06_RS00375"; Name "C7A06_RS00375"; Parent "nbis-gene-62"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00375"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	63762	64880	.	+	.	gene_id "nbis-gene-62"; transcript_id "gene-C7A06_RS00375"; Dbxref "Genbank:WP_001231527.1"; ID "nbis-exon-67"; Name "WP_001231527.1"; Parent "gene-C7A06_RS00375"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001231518.1"; locus_tag "C7A06_RS00375"; product "glycosyltransferase"; protein_id "WP_001231527.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	63762	64880	.	+	0	gene_id "nbis-gene-62"; transcript_id "gene-C7A06_RS00375"; Dbxref "Genbank:WP_001231527.1"; ID "cds-WP_001231527.1"; Name "WP_001231527.1"; Parent "gene-C7A06_RS00375"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001231518.1"; locus_tag "C7A06_RS00375"; product "glycosyltransferase"; protein_id "WP_001231527.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	65029	66294	.	-	.	gene_id "nbis-gene-63"; ID "nbis-gene-63"; Name "C7A06_RS00380"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00380";
+NZ_CP027599.1	RefSeq	transcript	65029	66294	.	-	.	gene_id "nbis-gene-63"; transcript_id "gene-C7A06_RS00380"; ID "gene-C7A06_RS00380"; Name "C7A06_RS00380"; Parent "nbis-gene-63"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00380"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	65029	66294	.	-	.	gene_id "nbis-gene-63"; transcript_id "gene-C7A06_RS00380"; Dbxref "Genbank:WP_000800845.1"; ID "nbis-exon-68"; Name "WP_000800845.1"; Parent "gene-C7A06_RS00380"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000800843.1"; locus_tag "C7A06_RS00380"; product "alpha/beta hydrolase-fold protein"; protein_id "WP_000800845.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	65029	66294	.	-	0	gene_id "nbis-gene-63"; transcript_id "gene-C7A06_RS00380"; Dbxref "Genbank:WP_000800845.1"; ID "cds-WP_000800845.1"; Name "WP_000800845.1"; Parent "gene-C7A06_RS00380"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000800843.1"; locus_tag "C7A06_RS00380"; product "alpha/beta hydrolase-fold protein"; protein_id "WP_000800845.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	66842	67276	.	-	.	gene_id "nbis-gene-64"; ID "nbis-gene-64"; Name "C7A06_RS00390"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00390";
+NZ_CP027599.1	RefSeq	transcript	66842	67276	.	-	.	gene_id "nbis-gene-64"; transcript_id "gene-C7A06_RS00390"; ID "gene-C7A06_RS00390"; Name "C7A06_RS00390"; Parent "nbis-gene-64"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00390"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	66842	67276	.	-	.	gene_id "nbis-gene-64"; transcript_id "gene-C7A06_RS00390"; Dbxref "Genbank:WP_000281561.1"; ID "nbis-exon-69"; Name "WP_000281561.1"; Parent "gene-C7A06_RS00390"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001554632.1"; locus_tag "C7A06_RS00390"; product "hypothetical protein"; protein_id "WP_000281561.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	66842	67276	.	-	0	gene_id "nbis-gene-64"; transcript_id "gene-C7A06_RS00390"; Dbxref "Genbank:WP_000281561.1"; ID "cds-WP_000281561.1"; Name "WP_000281561.1"; Parent "gene-C7A06_RS00390"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001554632.1"; locus_tag "C7A06_RS00390"; product "hypothetical protein"; protein_id "WP_000281561.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	68088	68297	.	+	.	gene_id "nbis-gene-65"; ID "nbis-gene-65"; Name "mchI"; gbkey "Gene"; gene "mchI"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00395";
+NZ_CP027599.1	RefSeq	transcript	68088	68297	.	+	.	gene_id "nbis-gene-65"; transcript_id "gene-C7A06_RS00395"; ID "gene-C7A06_RS00395"; Name "mchI"; Parent "nbis-gene-65"; gbkey "Gene"; gene "mchI"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00395"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	68088	68297	.	+	.	gene_id "nbis-gene-65"; transcript_id "gene-C7A06_RS00395"; Dbxref "Genbank:WP_000120664.1"; ID "nbis-exon-70"; Name "WP_000120664.1"; Parent "gene-C7A06_RS00395"; gbkey "CDS"; gene "mchI"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000120664.1"; locus_tag "C7A06_RS00395"; product "microcin H47 immunity protein MchI"; protein_id "WP_000120664.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	68088	68297	.	+	0	gene_id "nbis-gene-65"; transcript_id "gene-C7A06_RS00395"; Dbxref "Genbank:WP_000120664.1"; ID "cds-WP_000120664.1"; Name "WP_000120664.1"; Parent "gene-C7A06_RS00395"; gbkey "CDS"; gene "mchI"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000120664.1"; locus_tag "C7A06_RS00395"; product "microcin H47 immunity protein MchI"; protein_id "WP_000120664.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	68314	68541	.	+	.	gene_id "nbis-gene-66"; ID "nbis-gene-66"; Name "mchB"; gbkey "Gene"; gene "mchB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00400";
+NZ_CP027599.1	RefSeq	transcript	68314	68541	.	+	.	gene_id "nbis-gene-66"; transcript_id "gene-C7A06_RS00400"; ID "gene-C7A06_RS00400"; Name "mchB"; Parent "nbis-gene-66"; gbkey "Gene"; gene "mchB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00400"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	68314	68541	.	+	.	gene_id "nbis-gene-66"; transcript_id "gene-C7A06_RS00400"; Dbxref "Genbank:WP_001375214.1"; ID "nbis-exon-71"; Name "WP_001375214.1"; Parent "gene-C7A06_RS00400"; gbkey "CDS"; gene "mchB"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001375214.1"; locus_tag "C7A06_RS00400"; product "microcin H47"; protein_id "WP_001375214.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	68314	68541	.	+	0	gene_id "nbis-gene-66"; transcript_id "gene-C7A06_RS00400"; Dbxref "Genbank:WP_001375214.1"; ID "cds-WP_001375214.1"; Name "WP_001375214.1"; Parent "gene-C7A06_RS00400"; gbkey "CDS"; gene "mchB"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001375214.1"; locus_tag "C7A06_RS00400"; product "microcin H47"; protein_id "WP_001375214.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	68812	70362	.	+	.	gene_id "nbis-gene-67"; ID "nbis-gene-67"; Name "C7A06_RS00405"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00405";
+NZ_CP027599.1	RefSeq	transcript	68812	70362	.	+	.	gene_id "nbis-gene-67"; transcript_id "gene-C7A06_RS00405"; ID "gene-C7A06_RS00405"; Name "C7A06_RS00405"; Parent "nbis-gene-67"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00405"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	68812	70362	.	+	.	gene_id "nbis-gene-67"; transcript_id "gene-C7A06_RS00405"; Dbxref "Genbank:WP_000019329.1"; ID "nbis-exon-72"; Name "WP_000019329.1"; Parent "gene-C7A06_RS00405"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000019324.1"; locus_tag "C7A06_RS00405"; product "hypothetical protein"; protein_id "WP_000019329.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	68812	70362	.	+	0	gene_id "nbis-gene-67"; transcript_id "gene-C7A06_RS00405"; Dbxref "Genbank:WP_000019329.1"; ID "cds-WP_000019329.1"; Name "WP_000019329.1"; Parent "gene-C7A06_RS00405"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000019324.1"; locus_tag "C7A06_RS00405"; product "hypothetical protein"; protein_id "WP_000019329.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	70466	70840	.	+	.	gene_id "nbis-gene-68"; ID "nbis-gene-68"; Name "C7A06_RS00410"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00410";
+NZ_CP027599.1	RefSeq	transcript	70466	70840	.	+	.	gene_id "nbis-gene-68"; transcript_id "gene-C7A06_RS00410"; ID "gene-C7A06_RS00410"; Name "C7A06_RS00410"; Parent "nbis-gene-68"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00410"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	70466	70840	.	+	.	gene_id "nbis-gene-68"; transcript_id "gene-C7A06_RS00410"; Dbxref "Genbank:WP_001391575.1"; ID "nbis-exon-73"; Name "WP_001391575.1"; Ontology_term "GO:0009404" "GO:0016746" "GO:0005737"; Parent "gene-C7A06_RS00410"; gbkey "CDS"; go_component "cytoplasm|0005737||IEA"; go_function "acyltransferase activity|0016746||IEA"; go_process "toxin metabolic process|0009404||IEA"; inference "COORDINATES: protein motif:HMM:NF014813.2"; locus_tag "C7A06_RS00410"; product "toxin-activating lysine-acyltransferase"; protein_id "WP_001391575.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	70466	70840	.	+	0	gene_id "nbis-gene-68"; transcript_id "gene-C7A06_RS00410"; Dbxref "Genbank:WP_001391575.1"; ID "cds-WP_001391575.1"; Name "WP_001391575.1"; Ontology_term "GO:0009404" "GO:0016746" "GO:0005737"; Parent "gene-C7A06_RS00410"; gbkey "CDS"; go_component "cytoplasm|0005737||IEA"; go_function "acyltransferase activity|0016746||IEA"; go_process "toxin metabolic process|0009404||IEA"; inference "COORDINATES: protein motif:HMM:NF014813.2"; locus_tag "C7A06_RS00410"; product "toxin-activating lysine-acyltransferase"; protein_id "WP_001391575.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	70993	72267	.	+	.	gene_id "nbis-gene-69"; ID "nbis-gene-69"; Name "C7A06_RS00415"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00415";
+NZ_CP027599.1	RefSeq	transcript	70993	72267	.	+	.	gene_id "nbis-gene-69"; transcript_id "gene-C7A06_RS00415"; ID "gene-C7A06_RS00415"; Name "C7A06_RS00415"; Parent "nbis-gene-69"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00415"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	70993	72267	.	+	.	gene_id "nbis-gene-69"; transcript_id "gene-C7A06_RS00415"; Dbxref "Genbank:WP_000489612.1"; ID "nbis-exon-74"; Name "WP_000489612.1"; Parent "gene-C7A06_RS00415"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000489618.1"; locus_tag "C7A06_RS00415"; product "HlyD family secretion protein"; protein_id "WP_000489612.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	70993	72267	.	+	0	gene_id "nbis-gene-69"; transcript_id "gene-C7A06_RS00415"; Dbxref "Genbank:WP_000489612.1"; ID "cds-WP_000489612.1"; Name "WP_000489612.1"; Parent "gene-C7A06_RS00415"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000489618.1"; locus_tag "C7A06_RS00415"; product "HlyD family secretion protein"; protein_id "WP_000489612.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	72260	74356	.	+	.	gene_id "nbis-gene-70"; ID "nbis-gene-70"; Name "mchF"; gbkey "Gene"; gene "mchF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00420";
+NZ_CP027599.1	RefSeq	transcript	72260	74356	.	+	.	gene_id "nbis-gene-70"; transcript_id "gene-C7A06_RS00420"; ID "gene-C7A06_RS00420"; Name "mchF"; Parent "nbis-gene-70"; gbkey "Gene"; gene "mchF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00420"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	72260	74356	.	+	.	gene_id "nbis-gene-70"; transcript_id "gene-C7A06_RS00420"; Dbxref "Genbank:WP_000181294.1"; ID "nbis-exon-75"; Name "WP_000181294.1"; Parent "gene-C7A06_RS00420"; gbkey "CDS"; gene "mchF"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001529577.1"; locus_tag "C7A06_RS00420"; product "microcin export transporter peptidase/ATP-binding subunit MchF"; protein_id "WP_000181294.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	72260	74356	.	+	0	gene_id "nbis-gene-70"; transcript_id "gene-C7A06_RS00420"; Dbxref "Genbank:WP_000181294.1"; ID "cds-WP_000181294.1"; Name "WP_000181294.1"; Parent "gene-C7A06_RS00420"; gbkey "CDS"; gene "mchF"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001529577.1"; locus_tag "C7A06_RS00420"; product "microcin export transporter peptidase/ATP-binding subunit MchF"; protein_id "WP_000181294.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	74610	74888	.	+	.	gene_id "nbis-gene-71"; ID "nbis-gene-71"; Name "mcmA"; gbkey "Gene"; gene "mcmA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00430";
+NZ_CP027599.1	RefSeq	transcript	74610	74888	.	+	.	gene_id "nbis-gene-71"; transcript_id "gene-C7A06_RS00430"; ID "gene-C7A06_RS00430"; Name "mcmA"; Parent "nbis-gene-71"; gbkey "Gene"; gene "mcmA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00430"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	74610	74888	.	+	.	gene_id "nbis-gene-71"; transcript_id "gene-C7A06_RS00430"; Dbxref "Genbank:WP_071531329.1"; ID "nbis-exon-76"; Name "WP_071531329.1"; Parent "gene-C7A06_RS00430"; gbkey "CDS"; gene "mcmA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001466656.1"; locus_tag "C7A06_RS00430"; product "microcin McmA"; protein_id "WP_071531329.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	74610	74888	.	+	0	gene_id "nbis-gene-71"; transcript_id "gene-C7A06_RS00430"; Dbxref "Genbank:WP_071531329.1"; ID "cds-WP_071531329.1"; Name "WP_071531329.1"; Parent "gene-C7A06_RS00430"; gbkey "CDS"; gene "mcmA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001466656.1"; locus_tag "C7A06_RS00430"; product "microcin McmA"; protein_id "WP_071531329.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	75027	75203	.	-	.	gene_id "nbis-gene-5829"; ID "nbis-gene-5829"; Name "C7A06_RS34795"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS34795";
+NZ_CP027599.1	RefSeq	transcript	75027	75203	.	-	.	gene_id "nbis-gene-5829"; transcript_id "gene-C7A06_RS34795"; ID "gene-C7A06_RS34795"; Name "C7A06_RS34795"; Parent "nbis-gene-5829"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS34795"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	75027	75203	.	-	.	gene_id "nbis-gene-5829"; transcript_id "gene-C7A06_RS34795"; Dbxref "Genbank:WP_231360822.1"; ID "nbis-exon-6139"; Name "WP_231360822.1"; Parent "gene-C7A06_RS34795"; gbkey "CDS"; inference "COORDINATES: protein motif:HMM:NF014566.2"; locus_tag "C7A06_RS34795"; product "hypothetical protein"; protein_id "WP_231360822.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	75027	75203	.	-	0	gene_id "nbis-gene-5829"; transcript_id "gene-C7A06_RS34795"; Dbxref "Genbank:WP_231360822.1"; ID "cds-WP_231360822.1"; Name "WP_231360822.1"; Parent "gene-C7A06_RS34795"; gbkey "CDS"; inference "COORDINATES: protein motif:HMM:NF014566.2"; locus_tag "C7A06_RS34795"; product "hypothetical protein"; protein_id "WP_231360822.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	75790	76101	.	-	.	gene_id "nbis-pseudogene-310"; ID "nbis-pseudogene-310"; Name "C7A06_RS34800"; end_range "76101" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS34800"; original_biotype "pseudogene"; partial "true"; pseudo "true";
+NZ_CP027599.1	RefSeq	transcript	75790	76101	.	-	.	gene_id "nbis-pseudogene-310"; transcript_id "gene-C7A06_RS34800"; ID "gene-C7A06_RS34800"; Name "C7A06_RS34800"; Parent "nbis-pseudogene-310"; end_range "76101" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS34800"; original_biotype "mrna"; partial "true"; pseudo "true";
+NZ_CP027599.1	Protein Homology	exon	75790	76101	.	-	.	gene_id "nbis-pseudogene-310"; transcript_id "gene-C7A06_RS34800"; ID "nbis-exon-6140"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS34800"; end_range "76101" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_309401.1"; locus_tag "C7A06_RS34800"; partial "true"; product "hypothetical protein"; pseudo "true"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	75790	76101	.	-	0	gene_id "nbis-pseudogene-310"; transcript_id "gene-C7A06_RS34800"; ID "cds-C7A06_RS34800"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS34800"; end_range "76101" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_309401.1"; locus_tag "C7A06_RS34800"; partial "true"; product "hypothetical protein"; pseudo "true"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	76178	76726	.	+	.	gene_id "nbis-gene-72"; ID "nbis-gene-72"; Name "C7A06_RS00450"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00450";
+NZ_CP027599.1	RefSeq	transcript	76178	76726	.	+	.	gene_id "nbis-gene-72"; transcript_id "gene-C7A06_RS00450"; ID "gene-C7A06_RS00450"; Name "C7A06_RS00450"; Parent "nbis-gene-72"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00450"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	76178	76726	.	+	.	gene_id "nbis-gene-72"; transcript_id "gene-C7A06_RS00450"; Dbxref "Genbank:WP_001167431.1"; ID "nbis-exon-77"; Name "WP_001167431.1"; Parent "gene-C7A06_RS00450"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001167424.1"; locus_tag "C7A06_RS00450"; product "hypothetical protein"; protein_id "WP_001167431.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	76178	76726	.	+	0	gene_id "nbis-gene-72"; transcript_id "gene-C7A06_RS00450"; Dbxref "Genbank:WP_001167431.1"; ID "cds-WP_001167431.1"; Name "WP_001167431.1"; Parent "gene-C7A06_RS00450"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001167424.1"; locus_tag "C7A06_RS00450"; product "hypothetical protein"; protein_id "WP_001167431.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	76745	77089	.	-	.	gene_id "nbis-gene-73"; ID "nbis-gene-73"; Name "C7A06_RS00455"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00455";
+NZ_CP027599.1	RefSeq	transcript	76745	77089	.	-	.	gene_id "nbis-gene-73"; transcript_id "gene-C7A06_RS00455"; ID "gene-C7A06_RS00455"; Name "C7A06_RS00455"; Parent "nbis-gene-73"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00455"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	76745	77089	.	-	.	gene_id "nbis-gene-73"; transcript_id "gene-C7A06_RS00455"; Dbxref "Genbank:WP_000166948.1"; ID "nbis-exon-78"; Name "WP_000166948.1"; Parent "gene-C7A06_RS00455"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000166950.1"; locus_tag "C7A06_RS00455"; product "ProQ/FinO family protein"; protein_id "WP_000166948.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	76745	77089	.	-	0	gene_id "nbis-gene-73"; transcript_id "gene-C7A06_RS00455"; Dbxref "Genbank:WP_000166948.1"; ID "cds-WP_000166948.1"; Name "WP_000166948.1"; Parent "gene-C7A06_RS00455"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000166950.1"; locus_tag "C7A06_RS00455"; product "ProQ/FinO family protein"; protein_id "WP_000166948.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	77086	77259	.	-	.	gene_id "nbis-gene-74"; ID "nbis-gene-74"; Name "C7A06_RS00460"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00460";
+NZ_CP027599.1	RefSeq	transcript	77086	77259	.	-	.	gene_id "nbis-gene-74"; transcript_id "gene-C7A06_RS00460"; ID "gene-C7A06_RS00460"; Name "C7A06_RS00460"; Parent "nbis-gene-74"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00460"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	77086	77259	.	-	.	gene_id "nbis-gene-74"; transcript_id "gene-C7A06_RS00460"; Dbxref "Genbank:WP_000258194.1"; ID "nbis-exon-79"; Name "WP_000258194.1"; Parent "gene-C7A06_RS00460"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000258194.1"; locus_tag "C7A06_RS00460"; product "hypothetical protein"; protein_id "WP_000258194.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	77086	77259	.	-	0	gene_id "nbis-gene-74"; transcript_id "gene-C7A06_RS00460"; Dbxref "Genbank:WP_000258194.1"; ID "cds-WP_000258194.1"; Name "WP_000258194.1"; Parent "gene-C7A06_RS00460"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000258194.1"; locus_tag "C7A06_RS00460"; product "hypothetical protein"; protein_id "WP_000258194.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	77395	77568	.	+	.	gene_id "nbis-gene-75"; ID "nbis-gene-75"; Name "C7A06_RS00465"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00465";
+NZ_CP027599.1	RefSeq	transcript	77395	77568	.	+	.	gene_id "nbis-gene-75"; transcript_id "gene-C7A06_RS00465"; ID "gene-C7A06_RS00465"; Name "C7A06_RS00465"; Parent "nbis-gene-75"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00465"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	77395	77568	.	+	.	gene_id "nbis-gene-75"; transcript_id "gene-C7A06_RS00465"; Dbxref "Genbank:WP_153274857.1"; ID "nbis-exon-80"; Name "WP_153274857.1"; Parent "gene-C7A06_RS00465"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000130014.1"; locus_tag "C7A06_RS00465"; product "hypothetical protein"; protein_id "WP_153274857.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	77395	77568	.	+	0	gene_id "nbis-gene-75"; transcript_id "gene-C7A06_RS00465"; Dbxref "Genbank:WP_153274857.1"; ID "cds-WP_153274857.1"; Name "WP_153274857.1"; Parent "gene-C7A06_RS00465"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000130014.1"; locus_tag "C7A06_RS00465"; product "hypothetical protein"; protein_id "WP_153274857.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	77982	78416	.	+	.	gene_id "nbis-gene-76"; ID "nbis-gene-76"; Name "C7A06_RS00475"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00475";
+NZ_CP027599.1	RefSeq	transcript	77982	78416	.	+	.	gene_id "nbis-gene-76"; transcript_id "gene-C7A06_RS00475"; ID "gene-C7A06_RS00475"; Name "C7A06_RS00475"; Parent "nbis-gene-76"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00475"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	77982	78416	.	+	.	gene_id "nbis-gene-76"; transcript_id "gene-C7A06_RS00475"; Dbxref "Genbank:WP_000038249.1"; ID "nbis-exon-81"; Name "WP_000038249.1"; Ontology_term "GO:0006355" "GO:0003677"; Parent "gene-C7A06_RS00475"; gbkey "CDS"; go_function "DNA binding|0003677||IEA"; go_process "regulation of transcription, DNA-templated|0006355||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000038245.1"; locus_tag "C7A06_RS00475"; product "H-NS histone family protein"; protein_id "WP_000038249.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	77982	78416	.	+	0	gene_id "nbis-gene-76"; transcript_id "gene-C7A06_RS00475"; Dbxref "Genbank:WP_000038249.1"; ID "cds-WP_000038249.1"; Name "WP_000038249.1"; Ontology_term "GO:0006355" "GO:0003677"; Parent "gene-C7A06_RS00475"; gbkey "CDS"; go_function "DNA binding|0003677||IEA"; go_process "regulation of transcription, DNA-templated|0006355||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000038245.1"; locus_tag "C7A06_RS00475"; product "H-NS histone family protein"; protein_id "WP_000038249.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	78833	79402	.	-	.	gene_id "nbis-gene-77"; ID "nbis-gene-77"; Name "C7A06_RS00480"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00480";
+NZ_CP027599.1	RefSeq	transcript	78833	79402	.	-	.	gene_id "nbis-gene-77"; transcript_id "gene-C7A06_RS00480"; ID "gene-C7A06_RS00480"; Name "C7A06_RS00480"; Parent "nbis-gene-77"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00480"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	78833	79402	.	-	.	gene_id "nbis-gene-77"; transcript_id "gene-C7A06_RS00480"; Dbxref "Genbank:WP_000517678.1"; ID "nbis-exon-82"; Name "WP_000517678.1"; Parent "gene-C7A06_RS00480"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000517641.1"; locus_tag "C7A06_RS00480"; product "hypothetical protein"; protein_id "WP_000517678.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	78833	79402	.	-	0	gene_id "nbis-gene-77"; transcript_id "gene-C7A06_RS00480"; Dbxref "Genbank:WP_000517678.1"; ID "cds-WP_000517678.1"; Name "WP_000517678.1"; Parent "gene-C7A06_RS00480"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000517641.1"; locus_tag "C7A06_RS00480"; product "hypothetical protein"; protein_id "WP_000517678.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	79502	80734	.	-	.	gene_id "nbis-gene-78"; ID "nbis-gene-78"; Name "dgt"; gbkey "Gene"; gene "dgt"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00485";
+NZ_CP027599.1	RefSeq	transcript	79502	80734	.	-	.	gene_id "nbis-gene-78"; transcript_id "gene-C7A06_RS00485"; ID "gene-C7A06_RS00485"; Name "dgt"; Parent "nbis-gene-78"; gbkey "Gene"; gene "dgt"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00485"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	79502	80734	.	-	.	gene_id "nbis-gene-78"; transcript_id "gene-C7A06_RS00485"; Dbxref "Genbank:WP_000271619.1"; ID "nbis-exon-83"; Name "WP_000271619.1"; Ontology_term "GO:0015949" "GO:0008832"; Parent "gene-C7A06_RS00485"; gbkey "CDS"; gene "dgt"; go_function "dGTPase activity|0008832||IEA"; go_process "nucleobase-containing small molecule interconversion|0015949||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001566974.1"; locus_tag "C7A06_RS00485"; product "dNTP triphosphohydrolase"; protein_id "WP_000271619.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	79502	80734	.	-	0	gene_id "nbis-gene-78"; transcript_id "gene-C7A06_RS00485"; Dbxref "Genbank:WP_000271619.1"; ID "cds-WP_000271619.1"; Name "WP_000271619.1"; Ontology_term "GO:0015949" "GO:0008832"; Parent "gene-C7A06_RS00485"; gbkey "CDS"; gene "dgt"; go_function "dGTPase activity|0008832||IEA"; go_process "nucleobase-containing small molecule interconversion|0015949||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001566974.1"; locus_tag "C7A06_RS00485"; product "dNTP triphosphohydrolase"; protein_id "WP_000271619.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	80885	82047	.	-	.	gene_id "nbis-gene-79"; ID "nbis-gene-79"; Name "C7A06_RS00490"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00490";
+NZ_CP027599.1	RefSeq	transcript	80885	82047	.	-	.	gene_id "nbis-gene-79"; transcript_id "gene-C7A06_RS00490"; ID "gene-C7A06_RS00490"; Name "C7A06_RS00490"; Parent "nbis-gene-79"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00490"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	80885	82047	.	-	.	gene_id "nbis-gene-79"; transcript_id "gene-C7A06_RS00490"; Dbxref "Genbank:WP_106904140.1"; ID "nbis-exon-84"; Name "WP_106904140.1"; Note "programmed frameshift"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS00490"; exception "ribosomal slippage"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_012477168.1"; locus_tag "C7A06_RS00490"; product "IS3 family transposase"; protein_id "WP_106904140.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	80885	82047	.	-	2	gene_id "nbis-gene-79"; transcript_id "gene-C7A06_RS00490"; Dbxref "Genbank:WP_106904140.1"; ID "cds-WP_106904140.1"; Name "WP_106904140.1"; Note "programmed frameshift"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS00490"; exception "ribosomal slippage"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_012477168.1"; locus_tag "C7A06_RS00490"; product "IS3 family transposase"; protein_id "WP_106904140.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	82610	83124	.	-	.	gene_id "nbis-pseudogene-6"; ID "nbis-pseudogene-6"; Name "C7A06_RS00500"; end_range "83124" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00500"; original_biotype "pseudogene"; partial "true"; pseudo "true";
+NZ_CP027599.1	RefSeq	transcript	82610	83124	.	-	.	gene_id "nbis-pseudogene-6"; transcript_id "gene-C7A06_RS00500"; ID "gene-C7A06_RS00500"; Name "C7A06_RS00500"; Parent "nbis-pseudogene-6"; end_range "83124" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00500"; original_biotype "mrna"; partial "true"; pseudo "true";
+NZ_CP027599.1	Protein Homology	exon	82610	83124	.	-	.	gene_id "nbis-pseudogene-6"; transcript_id "gene-C7A06_RS00500"; ID "nbis-exon-85"; Note "frameshifted; incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS00500"; end_range "83124" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001368704.1"; locus_tag "C7A06_RS00500"; partial "true"; product "transposase"; pseudo "true"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	82610	83124	.	-	0	gene_id "nbis-pseudogene-6"; transcript_id "gene-C7A06_RS00500"; ID "cds-C7A06_RS00500"; Note "frameshifted; incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS00500"; end_range "83124" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001368704.1"; locus_tag "C7A06_RS00500"; partial "true"; product "transposase"; pseudo "true"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	83732	87145	.	+	.	gene_id "nbis-gene-80"; ID "nbis-gene-80"; Name "C7A06_RS00510"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00510";
+NZ_CP027599.1	RefSeq	transcript	83732	87145	.	+	.	gene_id "nbis-gene-80"; transcript_id "gene-C7A06_RS00510"; ID "gene-C7A06_RS00510"; Name "C7A06_RS00510"; Parent "nbis-gene-80"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00510"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	83732	87145	.	+	.	gene_id "nbis-gene-80"; transcript_id "gene-C7A06_RS00510"; Dbxref "Genbank:WP_000438167.1"; ID "nbis-exon-86"; Name "WP_000438167.1"; Ontology_term "GO:0003677" "GO:0005524" "GO:0016787"; Parent "gene-C7A06_RS00510"; gbkey "CDS"; go_function "DNA binding|0003677||IEA" "ATP binding|0005524||IEA" "hydrolase activity|0016787||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000438152.1"; locus_tag "C7A06_RS00510"; product "DEAD/DEAH box helicase family protein"; protein_id "WP_000438167.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	83732	87145	.	+	0	gene_id "nbis-gene-80"; transcript_id "gene-C7A06_RS00510"; Dbxref "Genbank:WP_000438167.1"; ID "cds-WP_000438167.1"; Name "WP_000438167.1"; Ontology_term "GO:0003677" "GO:0005524" "GO:0016787"; Parent "gene-C7A06_RS00510"; gbkey "CDS"; go_function "DNA binding|0003677||IEA" "ATP binding|0005524||IEA" "hydrolase activity|0016787||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000438152.1"; locus_tag "C7A06_RS00510"; product "DEAD/DEAH box helicase family protein"; protein_id "WP_000438167.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	87209	88843	.	+	.	gene_id "nbis-gene-81"; ID "nbis-gene-81"; Name "C7A06_RS00515"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00515";
+NZ_CP027599.1	RefSeq	transcript	87209	88843	.	+	.	gene_id "nbis-gene-81"; transcript_id "gene-C7A06_RS00515"; ID "gene-C7A06_RS00515"; Name "C7A06_RS00515"; Parent "nbis-gene-81"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00515"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	87209	88843	.	+	.	gene_id "nbis-gene-81"; transcript_id "gene-C7A06_RS00515"; Dbxref "Genbank:WP_000627719.1"; ID "nbis-exon-87"; Name "WP_000627719.1"; Parent "gene-C7A06_RS00515"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000627727.1"; locus_tag "C7A06_RS00515"; product "type I restriction-modification system subunit M"; protein_id "WP_000627719.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	87209	88843	.	+	0	gene_id "nbis-gene-81"; transcript_id "gene-C7A06_RS00515"; Dbxref "Genbank:WP_000627719.1"; ID "cds-WP_000627719.1"; Name "WP_000627719.1"; Parent "gene-C7A06_RS00515"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000627727.1"; locus_tag "C7A06_RS00515"; product "type I restriction-modification system subunit M"; protein_id "WP_000627719.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	88840	89982	.	+	.	gene_id "nbis-gene-82"; ID "nbis-gene-82"; Name "C7A06_RS00520"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00520";
+NZ_CP027599.1	RefSeq	transcript	88840	89982	.	+	.	gene_id "nbis-gene-82"; transcript_id "gene-C7A06_RS00520"; ID "gene-C7A06_RS00520"; Name "C7A06_RS00520"; Parent "nbis-gene-82"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00520"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	88840	89982	.	+	.	gene_id "nbis-gene-82"; transcript_id "gene-C7A06_RS00520"; Dbxref "Genbank:WP_001680721.1"; ID "nbis-exon-88"; Name "WP_001680721.1"; Ontology_term "GO:0006304" "GO:0003677"; Parent "gene-C7A06_RS00520"; gbkey "CDS"; go_function "DNA binding|0003677||IEA"; go_process "DNA modification|0006304||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001680721.1"; locus_tag "C7A06_RS00520"; product "restriction endonuclease subunit S"; protein_id "WP_001680721.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	88840	89982	.	+	0	gene_id "nbis-gene-82"; transcript_id "gene-C7A06_RS00520"; Dbxref "Genbank:WP_001680721.1"; ID "cds-WP_001680721.1"; Name "WP_001680721.1"; Ontology_term "GO:0006304" "GO:0003677"; Parent "gene-C7A06_RS00520"; gbkey "CDS"; go_function "DNA binding|0003677||IEA"; go_process "DNA modification|0006304||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001680721.1"; locus_tag "C7A06_RS00520"; product "restriction endonuclease subunit S"; protein_id "WP_001680721.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	89991	91613	.	+	.	gene_id "nbis-gene-83"; ID "nbis-gene-83"; Name "C7A06_RS00525"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00525";
+NZ_CP027599.1	RefSeq	transcript	89991	91613	.	+	.	gene_id "nbis-gene-83"; transcript_id "gene-C7A06_RS00525"; ID "gene-C7A06_RS00525"; Name "C7A06_RS00525"; Parent "nbis-gene-83"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00525"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	89991	91613	.	+	.	gene_id "nbis-gene-83"; transcript_id "gene-C7A06_RS00525"; Dbxref "Genbank:WP_000778953.1"; ID "nbis-exon-89"; Name "WP_000778953.1"; Parent "gene-C7A06_RS00525"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000778955.1"; locus_tag "C7A06_RS00525"; product "AAA family ATPase"; protein_id "WP_000778953.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	89991	91613	.	+	0	gene_id "nbis-gene-83"; transcript_id "gene-C7A06_RS00525"; Dbxref "Genbank:WP_000778953.1"; ID "cds-WP_000778953.1"; Name "WP_000778953.1"; Parent "gene-C7A06_RS00525"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000778955.1"; locus_tag "C7A06_RS00525"; product "AAA family ATPase"; protein_id "WP_000778953.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	91613	92509	.	+	.	gene_id "nbis-gene-84"; ID "nbis-gene-84"; Name "C7A06_RS00530"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00530";
+NZ_CP027599.1	RefSeq	transcript	91613	92509	.	+	.	gene_id "nbis-gene-84"; transcript_id "gene-C7A06_RS00530"; ID "gene-C7A06_RS00530"; Name "C7A06_RS00530"; Parent "nbis-gene-84"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00530"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	91613	92509	.	+	.	gene_id "nbis-gene-84"; transcript_id "gene-C7A06_RS00530"; Dbxref "Genbank:WP_001680722.1"; ID "nbis-exon-90"; Name "WP_001680722.1"; Parent "gene-C7A06_RS00530"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001680722.1"; locus_tag "C7A06_RS00530"; product "hypothetical protein"; protein_id "WP_001680722.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	91613	92509	.	+	0	gene_id "nbis-gene-84"; transcript_id "gene-C7A06_RS00530"; Dbxref "Genbank:WP_001680722.1"; ID "cds-WP_001680722.1"; Name "WP_001680722.1"; Parent "gene-C7A06_RS00530"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001680722.1"; locus_tag "C7A06_RS00530"; product "hypothetical protein"; protein_id "WP_001680722.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	92732	92910	.	-	.	gene_id "nbis-pseudogene-7"; ID "nbis-pseudogene-7"; Name "C7A06_RS00535"; end_range "92910" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00535"; original_biotype "pseudogene"; partial "true"; pseudo "true";
+NZ_CP027599.1	RefSeq	transcript	92732	92910	.	-	.	gene_id "nbis-pseudogene-7"; transcript_id "gene-C7A06_RS00535"; ID "gene-C7A06_RS00535"; Name "C7A06_RS00535"; Parent "nbis-pseudogene-7"; end_range "92910" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00535"; original_biotype "mrna"; partial "true"; pseudo "true";
+NZ_CP027599.1	Protein Homology	exon	92732	92910	.	-	.	gene_id "nbis-pseudogene-7"; transcript_id "gene-C7A06_RS00535"; ID "nbis-exon-91"; Note "frameshifted; incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS00535"; end_range "92910" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_012421665.1"; locus_tag "C7A06_RS00535"; partial "true"; product "integrase"; pseudo "true"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	92732	92910	.	-	0	gene_id "nbis-pseudogene-7"; transcript_id "gene-C7A06_RS00535"; ID "cds-C7A06_RS00535"; Note "frameshifted; incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS00535"; end_range "92910" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_012421665.1"; locus_tag "C7A06_RS00535"; partial "true"; product "integrase"; pseudo "true"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	93193	93561	.	+	.	gene_id "nbis-gene-85"; ID "nbis-gene-85"; Name "C7A06_RS00540"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00540";
+NZ_CP027599.1	RefSeq	transcript	93193	93561	.	+	.	gene_id "nbis-gene-85"; transcript_id "gene-C7A06_RS00540"; ID "gene-C7A06_RS00540"; Name "C7A06_RS00540"; Parent "nbis-gene-85"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00540"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	93193	93561	.	+	.	gene_id "nbis-gene-85"; transcript_id "gene-C7A06_RS00540"; Dbxref "Genbank:WP_001275820.1"; ID "nbis-exon-92"; Name "WP_001275820.1"; Parent "gene-C7A06_RS00540"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001275822.1"; locus_tag "C7A06_RS00540"; product "hypothetical protein"; protein_id "WP_001275820.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	93193	93561	.	+	0	gene_id "nbis-gene-85"; transcript_id "gene-C7A06_RS00540"; Dbxref "Genbank:WP_001275820.1"; ID "cds-WP_001275820.1"; Name "WP_001275820.1"; Parent "gene-C7A06_RS00540"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001275822.1"; locus_tag "C7A06_RS00540"; product "hypothetical protein"; protein_id "WP_001275820.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	93779	94525	.	+	.	gene_id "nbis-gene-86"; ID "nbis-gene-86"; Name "C7A06_RS00545"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00545";
+NZ_CP027599.1	RefSeq	transcript	93779	94525	.	+	.	gene_id "nbis-gene-86"; transcript_id "gene-C7A06_RS00545"; ID "gene-C7A06_RS00545"; Name "C7A06_RS00545"; Parent "nbis-gene-86"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00545"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	93779	94525	.	+	.	gene_id "nbis-gene-86"; transcript_id "gene-C7A06_RS00545"; Dbxref "Genbank:WP_000755107.1"; ID "nbis-exon-93"; Name "WP_000755107.1"; Parent "gene-C7A06_RS00545"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001536427.1"; locus_tag "C7A06_RS00545"; product "porin family protein"; protein_id "WP_000755107.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	93779	94525	.	+	0	gene_id "nbis-gene-86"; transcript_id "gene-C7A06_RS00545"; Dbxref "Genbank:WP_000755107.1"; ID "cds-WP_000755107.1"; Name "WP_000755107.1"; Parent "gene-C7A06_RS00545"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001536427.1"; locus_tag "C7A06_RS00545"; product "porin family protein"; protein_id "WP_000755107.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	94710	96211	.	+	.	gene_id "nbis-pseudogene-8"; ID "nbis-pseudogene-8"; Name "C7A06_RS00550"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00550"; original_biotype "pseudogene"; pseudo "true";
+NZ_CP027599.1	RefSeq	transcript	94710	96211	.	+	.	gene_id "nbis-pseudogene-8"; transcript_id "gene-C7A06_RS00550"; ID "gene-C7A06_RS00550"; Name "C7A06_RS00550"; Parent "nbis-pseudogene-8"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00550"; original_biotype "mrna"; pseudo "true";
+NZ_CP027599.1	Protein Homology	exon	94710	96211	.	+	.	gene_id "nbis-pseudogene-8"; transcript_id "gene-C7A06_RS00550"; ID "nbis-exon-94"; Note "frameshifted"; Parent "gene-C7A06_RS00550"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001608786.1"; locus_tag "C7A06_RS00550"; product "phosphoethanolamine transferase"; pseudo "true"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	94710	96211	.	+	0	gene_id "nbis-pseudogene-8"; transcript_id "gene-C7A06_RS00550"; ID "cds-C7A06_RS00550"; Note "frameshifted"; Parent "gene-C7A06_RS00550"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001608786.1"; locus_tag "C7A06_RS00550"; product "phosphoethanolamine transferase"; pseudo "true"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	96571	97614	.	-	.	gene_id "nbis-gene-87"; ID "nbis-gene-87"; Name "C7A06_RS00560"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00560";
+NZ_CP027599.1	RefSeq	transcript	96571	97614	.	-	.	gene_id "nbis-gene-87"; transcript_id "gene-C7A06_RS00560"; ID "gene-C7A06_RS00560"; Name "C7A06_RS00560"; Parent "nbis-gene-87"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00560"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	96571	97614	.	-	.	gene_id "nbis-gene-87"; transcript_id "gene-C7A06_RS00560"; Dbxref "Genbank:WP_000999846.1"; ID "nbis-exon-95"; Name "WP_000999846.1"; Parent "gene-C7A06_RS00560"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709438.1"; locus_tag "C7A06_RS00560"; product "hypothetical protein"; protein_id "WP_000999846.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	96571	97614	.	-	0	gene_id "nbis-gene-87"; transcript_id "gene-C7A06_RS00560"; Dbxref "Genbank:WP_000999846.1"; ID "cds-WP_000999846.1"; Name "WP_000999846.1"; Parent "gene-C7A06_RS00560"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709438.1"; locus_tag "C7A06_RS00560"; product "hypothetical protein"; protein_id "WP_000999846.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	98026	99210	.	-	.	gene_id "nbis-gene-88"; ID "nbis-gene-88"; Name "C7A06_RS00565"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00565";
+NZ_CP027599.1	RefSeq	transcript	98026	99210	.	-	.	gene_id "nbis-gene-88"; transcript_id "gene-C7A06_RS00565"; ID "gene-C7A06_RS00565"; Name "C7A06_RS00565"; Parent "nbis-gene-88"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00565"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	98026	99210	.	-	.	gene_id "nbis-gene-88"; transcript_id "gene-C7A06_RS00565"; Dbxref "Genbank:WP_001218900.1"; ID "nbis-exon-96"; Name "WP_001218900.1"; Ontology_term "GO:0006310" "GO:0015074" "GO:0003677"; Parent "gene-C7A06_RS00565"; gbkey "CDS"; go_function "DNA binding|0003677||IEA"; go_process "DNA recombination|0006310||IEA" "DNA integration|0015074||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001218899.1"; locus_tag "C7A06_RS00565"; product "tyrosine-type recombinase/integrase"; protein_id "WP_001218900.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	98026	99210	.	-	0	gene_id "nbis-gene-88"; transcript_id "gene-C7A06_RS00565"; Dbxref "Genbank:WP_001218900.1"; ID "cds-WP_001218900.1"; Name "WP_001218900.1"; Ontology_term "GO:0006310" "GO:0015074" "GO:0003677"; Parent "gene-C7A06_RS00565"; gbkey "CDS"; go_function "DNA binding|0003677||IEA"; go_process "DNA recombination|0006310||IEA" "DNA integration|0015074||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001218899.1"; locus_tag "C7A06_RS00565"; product "tyrosine-type recombinase/integrase"; protein_id "WP_001218900.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	99510	99604	.	-	.	gene_id "gene-C7A06_RS00570"; ID "gene-C7A06_RS00570"; Name "C7A06_RS00570"; gbkey "Gene"; gene_biotype "tRNA"; locus_tag "C7A06_RS00570";
+NZ_CP027599.1	tRNAscan-SE	transcript	99510	99604	.	-	.	gene_id "gene-C7A06_RS00570"; transcript_id "rna-C7A06_RS00570"; ID "rna-C7A06_RS00570"; Parent "gene-C7A06_RS00570"; anticodon "(pos:complement(99568..99570))"; gbkey "tRNA"; inference "COORDINATES: profile:tRNAscan-SE:2.0.7"; locus_tag "C7A06_RS00570"; original_biotype "trna"; product "tRNA-Sec";
+NZ_CP027599.1	tRNAscan-SE	exon	99510	99604	.	-	.	gene_id "gene-C7A06_RS00570"; transcript_id "rna-C7A06_RS00570"; ID "exon-C7A06_RS00570-1"; Parent "rna-C7A06_RS00570"; anticodon "(pos:complement(99568..99570))"; gbkey "tRNA"; inference "COORDINATES: profile:tRNAscan-SE:2.0.7"; locus_tag "C7A06_RS00570"; product "tRNA-Sec";
+NZ_CP027599.1	RefSeq	gene	99897	101279	.	+	.	gene_id "nbis-gene-89"; ID "nbis-gene-89"; Name "yicJ"; gbkey "Gene"; gene "yicJ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00575";
+NZ_CP027599.1	RefSeq	transcript	99897	101279	.	+	.	gene_id "nbis-gene-89"; transcript_id "gene-C7A06_RS00575"; ID "gene-C7A06_RS00575"; Name "yicJ"; Parent "nbis-gene-89"; gbkey "Gene"; gene "yicJ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00575"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	99897	101279	.	+	.	gene_id "nbis-gene-89"; transcript_id "gene-C7A06_RS00575"; Dbxref "Genbank:WP_000834439.1"; ID "nbis-exon-97"; Name "WP_000834439.1"; Ontology_term "GO:0006814" "GO:0008643" "GO:0015293" "GO:0016021"; Parent "gene-C7A06_RS00575"; gbkey "CDS"; gene "yicJ"; go_component "integral component of membrane|0016021||IEA"; go_function "symporter activity|0015293||IEA"; go_process "sodium ion transport|0006814||IEA" "carbohydrate transport|0008643||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418114.4"; locus_tag "C7A06_RS00575"; product "glycoside-pentoside-hexuronide family transporter"; protein_id "WP_000834439.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	99897	101279	.	+	0	gene_id "nbis-gene-89"; transcript_id "gene-C7A06_RS00575"; Dbxref "Genbank:WP_000834439.1"; ID "cds-WP_000834439.1"; Name "WP_000834439.1"; Ontology_term "GO:0006814" "GO:0008643" "GO:0015293" "GO:0016021"; Parent "gene-C7A06_RS00575"; gbkey "CDS"; gene "yicJ"; go_component "integral component of membrane|0016021||IEA"; go_function "symporter activity|0015293||IEA"; go_process "sodium ion transport|0006814||IEA" "carbohydrate transport|0008643||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418114.4"; locus_tag "C7A06_RS00575"; product "glycoside-pentoside-hexuronide family transporter"; protein_id "WP_000834439.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	101289	103607	.	+	.	gene_id "nbis-gene-90"; ID "nbis-gene-90"; Name "yicI"; gbkey "Gene"; gene "yicI"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00580";
+NZ_CP027599.1	RefSeq	transcript	101289	103607	.	+	.	gene_id "nbis-gene-90"; transcript_id "gene-C7A06_RS00580"; ID "gene-C7A06_RS00580"; Name "yicI"; Parent "nbis-gene-90"; gbkey "Gene"; gene "yicI"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00580"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	101289	103607	.	+	.	gene_id "nbis-gene-90"; transcript_id "gene-C7A06_RS00580"; Dbxref "Genbank:WP_000702953.1"; ID "nbis-exon-98"; Name "WP_000702953.1"; Ontology_term "GO:0005975" "GO:0004553"; Parent "gene-C7A06_RS00580"; gbkey "CDS"; gene "yicI"; go_function "hydrolase activity, hydrolyzing O-glycosyl compounds|0004553||IEA"; go_process "carbohydrate metabolic process|0005975||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418113.1"; locus_tag "C7A06_RS00580"; product "alpha-xylosidase"; protein_id "WP_000702953.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	101289	103607	.	+	0	gene_id "nbis-gene-90"; transcript_id "gene-C7A06_RS00580"; Dbxref "Genbank:WP_000702953.1"; ID "cds-WP_000702953.1"; Name "WP_000702953.1"; Ontology_term "GO:0005975" "GO:0004553"; Parent "gene-C7A06_RS00580"; gbkey "CDS"; gene "yicI"; go_function "hydrolase activity, hydrolyzing O-glycosyl compounds|0004553||IEA"; go_process "carbohydrate metabolic process|0005975||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418113.1"; locus_tag "C7A06_RS00580"; product "alpha-xylosidase"; protein_id "WP_000702953.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	103660	105369	.	-	.	gene_id "nbis-gene-91"; ID "nbis-gene-91"; Name "yicH"; gbkey "Gene"; gene "yicH"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00585";
+NZ_CP027599.1	RefSeq	transcript	103660	105369	.	-	.	gene_id "nbis-gene-91"; transcript_id "gene-C7A06_RS00585"; ID "gene-C7A06_RS00585"; Name "yicH"; Parent "nbis-gene-91"; gbkey "Gene"; gene "yicH"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00585"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	103660	105369	.	-	.	gene_id "nbis-gene-91"; transcript_id "gene-C7A06_RS00585"; Dbxref "Genbank:WP_001341763.1"; ID "nbis-exon-99"; Name "WP_001341763.1"; Parent "gene-C7A06_RS00585"; gbkey "CDS"; gene "yicH"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418112.1"; locus_tag "C7A06_RS00585"; product "AsmA family protein"; protein_id "WP_001341763.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	103660	105369	.	-	0	gene_id "nbis-gene-91"; transcript_id "gene-C7A06_RS00585"; Dbxref "Genbank:WP_001341763.1"; ID "cds-WP_001341763.1"; Name "WP_001341763.1"; Parent "gene-C7A06_RS00585"; gbkey "CDS"; gene "yicH"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418112.1"; locus_tag "C7A06_RS00585"; product "AsmA family protein"; protein_id "WP_001341763.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	105490	106881	.	-	.	gene_id "nbis-gene-92"; ID "nbis-gene-92"; Name "xanP"; gbkey "Gene"; gene "xanP"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00590";
+NZ_CP027599.1	RefSeq	transcript	105490	106881	.	-	.	gene_id "nbis-gene-92"; transcript_id "gene-C7A06_RS00590"; ID "gene-C7A06_RS00590"; Name "xanP"; Parent "nbis-gene-92"; gbkey "Gene"; gene "xanP"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00590"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	105490	106881	.	-	.	gene_id "nbis-gene-92"; transcript_id "gene-C7A06_RS00590"; Dbxref "Genbank:WP_001295238.1"; ID "nbis-exon-100"; Name "WP_001295238.1"; Parent "gene-C7A06_RS00590"; gbkey "CDS"; gene "xanP"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312557.1"; locus_tag "C7A06_RS00590"; product "xanthine/proton symporter XanP"; protein_id "WP_001295238.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	105490	106881	.	-	0	gene_id "nbis-gene-92"; transcript_id "gene-C7A06_RS00590"; Dbxref "Genbank:WP_001295238.1"; ID "cds-WP_001295238.1"; Name "WP_001295238.1"; Parent "gene-C7A06_RS00590"; gbkey "CDS"; gene "xanP"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312557.1"; locus_tag "C7A06_RS00590"; product "xanthine/proton symporter XanP"; protein_id "WP_001295238.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	107161	108366	.	+	.	gene_id "nbis-gene-93"; ID "nbis-gene-93"; Name "gltS"; gbkey "Gene"; gene "gltS"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00595";
+NZ_CP027599.1	RefSeq	transcript	107161	108366	.	+	.	gene_id "nbis-gene-93"; transcript_id "gene-C7A06_RS00595"; ID "gene-C7A06_RS00595"; Name "gltS"; Parent "nbis-gene-93"; gbkey "Gene"; gene "gltS"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00595"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	107161	108366	.	+	.	gene_id "nbis-gene-93"; transcript_id "gene-C7A06_RS00595"; Dbxref "Genbank:WP_000468836.1"; ID "nbis-exon-101"; Name "WP_000468836.1"; Ontology_term "GO:0015813" "GO:0015501"; Parent "gene-C7A06_RS00595"; gbkey "CDS"; gene "gltS"; go_function "glutamate:sodium symporter activity|0015501||IEA"; go_process "L-glutamate transmembrane transport|0015813||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312556.1"; locus_tag "C7A06_RS00595"; product "sodium/glutamate symporter"; protein_id "WP_000468836.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	107161	108366	.	+	0	gene_id "nbis-gene-93"; transcript_id "gene-C7A06_RS00595"; Dbxref "Genbank:WP_000468836.1"; ID "cds-WP_000468836.1"; Name "WP_000468836.1"; Ontology_term "GO:0015813" "GO:0015501"; Parent "gene-C7A06_RS00595"; gbkey "CDS"; gene "gltS"; go_function "glutamate:sodium symporter activity|0015501||IEA"; go_process "L-glutamate transmembrane transport|0015813||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312556.1"; locus_tag "C7A06_RS00595"; product "sodium/glutamate symporter"; protein_id "WP_000468836.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	108369	109235	.	+	.	gene_id "nbis-gene-94"; ID "nbis-gene-94"; Name "C7A06_RS00600"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00600";
+NZ_CP027599.1	RefSeq	transcript	108369	109235	.	+	.	gene_id "nbis-gene-94"; transcript_id "gene-C7A06_RS00600"; ID "gene-C7A06_RS00600"; Name "C7A06_RS00600"; Parent "nbis-gene-94"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00600"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	108369	109235	.	+	.	gene_id "nbis-gene-94"; transcript_id "gene-C7A06_RS00600"; Dbxref "Genbank:WP_000747329.1"; ID "nbis-exon-102"; Name "WP_000747329.1"; Parent "gene-C7A06_RS00600"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312555.2"; locus_tag "C7A06_RS00600"; product "hypothetical protein"; protein_id "WP_000747329.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	108369	109235	.	+	0	gene_id "nbis-gene-94"; transcript_id "gene-C7A06_RS00600"; Dbxref "Genbank:WP_000747329.1"; ID "cds-WP_000747329.1"; Name "WP_000747329.1"; Parent "gene-C7A06_RS00600"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312555.2"; locus_tag "C7A06_RS00600"; product "hypothetical protein"; protein_id "WP_000747329.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	109220	111301	.	-	.	gene_id "nbis-gene-95"; ID "nbis-gene-95"; Name "recG"; gbkey "Gene"; gene "recG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00605";
+NZ_CP027599.1	RefSeq	transcript	109220	111301	.	-	.	gene_id "nbis-gene-95"; transcript_id "gene-C7A06_RS00605"; ID "gene-C7A06_RS00605"; Name "recG"; Parent "nbis-gene-95"; gbkey "Gene"; gene "recG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00605"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	109220	111301	.	-	.	gene_id "nbis-gene-95"; transcript_id "gene-C7A06_RS00605"; Dbxref "Genbank:WP_000678419.1"; ID "nbis-exon-103"; Name "WP_000678419.1"; Ontology_term "GO:0006281" "GO:0006310" "GO:0003676" "GO:0003678" "GO:0005524"; Parent "gene-C7A06_RS00605"; gbkey "CDS"; gene "recG"; go_function "nucleic acid binding|0003676||IEA" "DNA helicase activity|0003678||IEA" "ATP binding|0005524||IEA"; go_process "DNA repair|0006281||IEA" "DNA recombination|0006310||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418109.1"; locus_tag "C7A06_RS00605"; product "ATP-dependent DNA helicase RecG"; protein_id "WP_000678419.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	109220	111301	.	-	0	gene_id "nbis-gene-95"; transcript_id "gene-C7A06_RS00605"; Dbxref "Genbank:WP_000678419.1"; ID "cds-WP_000678419.1"; Name "WP_000678419.1"; Ontology_term "GO:0006281" "GO:0006310" "GO:0003676" "GO:0003678" "GO:0005524"; Parent "gene-C7A06_RS00605"; gbkey "CDS"; gene "recG"; go_function "nucleic acid binding|0003676||IEA" "DNA helicase activity|0003678||IEA" "ATP binding|0005524||IEA"; go_process "DNA repair|0006281||IEA" "DNA recombination|0006310||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418109.1"; locus_tag "C7A06_RS00605"; product "ATP-dependent DNA helicase RecG"; protein_id "WP_000678419.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	111307	111996	.	-	.	gene_id "nbis-gene-96"; ID "nbis-gene-96"; Name "trmH"; gbkey "Gene"; gene "trmH"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00610";
+NZ_CP027599.1	RefSeq	transcript	111307	111996	.	-	.	gene_id "nbis-gene-96"; transcript_id "gene-C7A06_RS00610"; ID "gene-C7A06_RS00610"; Name "trmH"; Parent "nbis-gene-96"; gbkey "Gene"; gene "trmH"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00610"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	111307	111996	.	-	.	gene_id "nbis-gene-96"; transcript_id "gene-C7A06_RS00610"; Dbxref "Genbank:WP_001070177.1"; ID "nbis-exon-104"; Name "WP_001070177.1"; Ontology_term "GO:0030488" "GO:0008173" "GO:0009020"; Parent "gene-C7A06_RS00610"; gbkey "CDS"; gene "trmH"; go_function "RNA methyltransferase activity|0008173||IEA" "tRNA (guanosine-2'-O-)-methyltransferase activity|0009020||IEA"; go_process "tRNA methylation|0030488||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418108.1"; locus_tag "C7A06_RS00610"; product "tRNA (guanosine(18)-2'-O)-methyltransferase TrmH"; protein_id "WP_001070177.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	111307	111996	.	-	0	gene_id "nbis-gene-96"; transcript_id "gene-C7A06_RS00610"; Dbxref "Genbank:WP_001070177.1"; ID "cds-WP_001070177.1"; Name "WP_001070177.1"; Ontology_term "GO:0030488" "GO:0008173" "GO:0009020"; Parent "gene-C7A06_RS00610"; gbkey "CDS"; gene "trmH"; go_function "RNA methyltransferase activity|0008173||IEA" "tRNA (guanosine-2'-O-)-methyltransferase activity|0009020||IEA"; go_process "tRNA methylation|0030488||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418108.1"; locus_tag "C7A06_RS00610"; product "tRNA (guanosine(18)-2'-O)-methyltransferase TrmH"; protein_id "WP_001070177.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	112003	114111	.	-	.	gene_id "nbis-gene-97"; ID "nbis-gene-97"; Name "spoT"; gbkey "Gene"; gene "spoT"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00615";
+NZ_CP027599.1	RefSeq	transcript	112003	114111	.	-	.	gene_id "nbis-gene-97"; transcript_id "gene-C7A06_RS00615"; ID "gene-C7A06_RS00615"; Name "spoT"; Parent "nbis-gene-97"; gbkey "Gene"; gene "spoT"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00615"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	112003	114111	.	-	.	gene_id "nbis-gene-97"; transcript_id "gene-C7A06_RS00615"; Dbxref "Genbank:WP_000280488.1"; ID "nbis-exon-105"; Name "WP_000280488.1"; Ontology_term "GO:0015969" "GO:0008728" "GO:0008893"; Parent "gene-C7A06_RS00615"; gbkey "CDS"; gene "spoT"; go_function "GTP diphosphokinase activity|0008728||IEA" "guanosine-3',5'-bis(diphosphate) 3'-diphosphatase activity|0008893||IEA"; go_process "guanosine tetraphosphate metabolic process|0015969||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312552.1"; locus_tag "C7A06_RS00615"; product "bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase"; protein_id "WP_000280488.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	112003	114111	.	-	0	gene_id "nbis-gene-97"; transcript_id "gene-C7A06_RS00615"; Dbxref "Genbank:WP_000280488.1"; ID "cds-WP_000280488.1"; Name "WP_000280488.1"; Ontology_term "GO:0015969" "GO:0008728" "GO:0008893"; Parent "gene-C7A06_RS00615"; gbkey "CDS"; gene "spoT"; go_function "GTP diphosphokinase activity|0008728||IEA" "guanosine-3',5'-bis(diphosphate) 3'-diphosphatase activity|0008893||IEA"; go_process "guanosine tetraphosphate metabolic process|0015969||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312552.1"; locus_tag "C7A06_RS00615"; product "bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase"; protein_id "WP_000280488.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	114130	114405	.	-	.	gene_id "nbis-gene-98"; ID "nbis-gene-98"; Name "rpoZ"; gbkey "Gene"; gene "rpoZ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00620";
+NZ_CP027599.1	RefSeq	transcript	114130	114405	.	-	.	gene_id "nbis-gene-98"; transcript_id "gene-C7A06_RS00620"; ID "gene-C7A06_RS00620"; Name "rpoZ"; Parent "nbis-gene-98"; gbkey "Gene"; gene "rpoZ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00620"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	114130	114405	.	-	.	gene_id "nbis-gene-98"; transcript_id "gene-C7A06_RS00620"; Dbxref "Genbank:WP_000135058.1"; ID "nbis-exon-106"; Name "WP_000135058.1"; Ontology_term "GO:0006351" "GO:0003899" "GO:0000345"; Parent "gene-C7A06_RS00620"; gbkey "CDS"; gene "rpoZ"; go_component "cytosolic DNA-directed RNA polymerase complex|0000345||IEA"; go_function "DNA-directed 5'-3' RNA polymerase activity|0003899||IEA"; go_process "transcription, DNA-templated|0006351||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_013511051.1"; locus_tag "C7A06_RS00620"; product "DNA-directed RNA polymerase subunit omega"; protein_id "WP_000135058.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	114130	114405	.	-	0	gene_id "nbis-gene-98"; transcript_id "gene-C7A06_RS00620"; Dbxref "Genbank:WP_000135058.1"; ID "cds-WP_000135058.1"; Name "WP_000135058.1"; Ontology_term "GO:0006351" "GO:0003899" "GO:0000345"; Parent "gene-C7A06_RS00620"; gbkey "CDS"; gene "rpoZ"; go_component "cytosolic DNA-directed RNA polymerase complex|0000345||IEA"; go_function "DNA-directed 5'-3' RNA polymerase activity|0003899||IEA"; go_process "transcription, DNA-templated|0006351||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_013511051.1"; locus_tag "C7A06_RS00620"; product "DNA-directed RNA polymerase subunit omega"; protein_id "WP_000135058.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	114460	115083	.	-	.	gene_id "nbis-gene-99"; ID "nbis-gene-99"; Name "gmk"; gbkey "Gene"; gene "gmk"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00625";
+NZ_CP027599.1	RefSeq	transcript	114460	115083	.	-	.	gene_id "nbis-gene-99"; transcript_id "gene-C7A06_RS00625"; ID "gene-C7A06_RS00625"; Name "gmk"; Parent "nbis-gene-99"; gbkey "Gene"; gene "gmk"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00625"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	114460	115083	.	-	.	gene_id "nbis-gene-99"; transcript_id "gene-C7A06_RS00625"; Dbxref "Genbank:WP_001295237.1"; ID "nbis-exon-107"; Name "WP_001295237.1"; Ontology_term "GO:0015949" "GO:0004385"; Parent "gene-C7A06_RS00625"; gbkey "CDS"; gene "gmk"; go_function "guanylate kinase activity|0004385||IEA"; go_process "nucleobase-containing small molecule interconversion|0015949||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000046969.1"; locus_tag "C7A06_RS00625"; product "guanylate kinase"; protein_id "WP_001295237.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	114460	115083	.	-	0	gene_id "nbis-gene-99"; transcript_id "gene-C7A06_RS00625"; Dbxref "Genbank:WP_001295237.1"; ID "cds-WP_001295237.1"; Name "WP_001295237.1"; Ontology_term "GO:0015949" "GO:0004385"; Parent "gene-C7A06_RS00625"; gbkey "CDS"; gene "gmk"; go_function "guanylate kinase activity|0004385||IEA"; go_process "nucleobase-containing small molecule interconversion|0015949||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000046969.1"; locus_tag "C7A06_RS00625"; product "guanylate kinase"; protein_id "WP_001295237.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	115341	117023	.	+	.	gene_id "nbis-gene-100"; ID "nbis-gene-100"; Name "ligB"; gbkey "Gene"; gene "ligB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00630";
+NZ_CP027599.1	RefSeq	transcript	115341	117023	.	+	.	gene_id "nbis-gene-100"; transcript_id "gene-C7A06_RS00630"; ID "gene-C7A06_RS00630"; Name "ligB"; Parent "nbis-gene-100"; gbkey "Gene"; gene "ligB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00630"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	115341	117023	.	+	.	gene_id "nbis-gene-100"; transcript_id "gene-C7A06_RS00630"; Dbxref "Genbank:WP_001426185.1"; ID "nbis-exon-108"; Name "WP_001426185.1"; Ontology_term "GO:0006260" "GO:0006281" "GO:0003911"; Parent "gene-C7A06_RS00630"; gbkey "CDS"; gene "ligB"; go_function "DNA ligase (NAD+) activity|0003911||IEA"; go_process "DNA replication|0006260||IEA" "DNA repair|0006281||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312549.2"; locus_tag "C7A06_RS00630"; product "NAD-dependent DNA ligase LigB"; protein_id "WP_001426185.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	115341	117023	.	+	0	gene_id "nbis-gene-100"; transcript_id "gene-C7A06_RS00630"; Dbxref "Genbank:WP_001426185.1"; ID "cds-WP_001426185.1"; Name "WP_001426185.1"; Ontology_term "GO:0006260" "GO:0006281" "GO:0003911"; Parent "gene-C7A06_RS00630"; gbkey "CDS"; gene "ligB"; go_function "DNA ligase (NAD+) activity|0003911||IEA"; go_process "DNA replication|0006260||IEA" "DNA repair|0006281||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312549.2"; locus_tag "C7A06_RS00630"; product "NAD-dependent DNA ligase LigB"; protein_id "WP_001426185.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	117020	117637	.	-	.	gene_id "nbis-gene-101"; ID "nbis-gene-101"; Name "yicG"; gbkey "Gene"; gene "yicG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00635";
+NZ_CP027599.1	RefSeq	transcript	117020	117637	.	-	.	gene_id "nbis-gene-101"; transcript_id "gene-C7A06_RS00635"; ID "gene-C7A06_RS00635"; Name "yicG"; Parent "nbis-gene-101"; gbkey "Gene"; gene "yicG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00635"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	117020	117637	.	-	.	gene_id "nbis-gene-101"; transcript_id "gene-C7A06_RS00635"; Dbxref "Genbank:WP_000924289.1"; ID "nbis-exon-109"; Name "WP_000924289.1"; Parent "gene-C7A06_RS00635"; gbkey "CDS"; gene "yicG"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312548.2"; locus_tag "C7A06_RS00635"; product "trimeric intracellular cation channel family protein"; protein_id "WP_000924289.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	117020	117637	.	-	0	gene_id "nbis-gene-101"; transcript_id "gene-C7A06_RS00635"; Dbxref "Genbank:WP_000924289.1"; ID "cds-WP_000924289.1"; Name "WP_000924289.1"; Parent "gene-C7A06_RS00635"; gbkey "CDS"; gene "yicG"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312548.2"; locus_tag "C7A06_RS00635"; product "trimeric intracellular cation channel family protein"; protein_id "WP_000924289.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	117929	118753	.	-	.	gene_id "nbis-gene-102"; ID "nbis-gene-102"; Name "dinD"; gbkey "Gene"; gene "dinD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00640";
+NZ_CP027599.1	RefSeq	transcript	117929	118753	.	-	.	gene_id "nbis-gene-102"; transcript_id "gene-C7A06_RS00640"; ID "gene-C7A06_RS00640"; Name "dinD"; Parent "nbis-gene-102"; gbkey "Gene"; gene "dinD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00640"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	117929	118753	.	-	.	gene_id "nbis-gene-102"; transcript_id "gene-C7A06_RS00640"; Dbxref "Genbank:WP_001297374.1"; ID "nbis-exon-110"; Name "WP_001297374.1"; Parent "gene-C7A06_RS00640"; gbkey "CDS"; gene "dinD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312547.2"; locus_tag "C7A06_RS00640"; product "DNA damage-inducible protein D"; protein_id "WP_001297374.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	117929	118753	.	-	0	gene_id "nbis-gene-102"; transcript_id "gene-C7A06_RS00640"; Dbxref "Genbank:WP_001297374.1"; ID "cds-WP_001297374.1"; Name "WP_001297374.1"; Parent "gene-C7A06_RS00640"; gbkey "CDS"; gene "dinD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312547.2"; locus_tag "C7A06_RS00640"; product "DNA damage-inducible protein D"; protein_id "WP_001297374.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	118974	119837	.	-	.	gene_id "nbis-gene-103"; ID "nbis-gene-103"; Name "yicC"; gbkey "Gene"; gene "yicC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00645";
+NZ_CP027599.1	RefSeq	transcript	118974	119837	.	-	.	gene_id "nbis-gene-103"; transcript_id "gene-C7A06_RS00645"; ID "gene-C7A06_RS00645"; Name "yicC"; Parent "nbis-gene-103"; gbkey "Gene"; gene "yicC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00645"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	118974	119837	.	-	.	gene_id "nbis-gene-103"; transcript_id "gene-C7A06_RS00645"; Dbxref "Genbank:WP_000621336.1"; ID "nbis-exon-111"; Name "WP_000621336.1"; Parent "gene-C7A06_RS00645"; gbkey "CDS"; gene "yicC"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005122606.1"; locus_tag "C7A06_RS00645"; product "YicC family protein"; protein_id "WP_000621336.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	118974	119837	.	-	0	gene_id "nbis-gene-103"; transcript_id "gene-C7A06_RS00645"; Dbxref "Genbank:WP_000621336.1"; ID "cds-WP_000621336.1"; Name "WP_000621336.1"; Parent "gene-C7A06_RS00645"; gbkey "CDS"; gene "yicC"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005122606.1"; locus_tag "C7A06_RS00645"; product "YicC family protein"; protein_id "WP_000621336.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	119964	120680	.	+	.	gene_id "nbis-gene-104"; ID "nbis-gene-104"; Name "rph"; gbkey "Gene"; gene "rph"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00655";
+NZ_CP027599.1	RefSeq	transcript	119964	120680	.	+	.	gene_id "nbis-gene-104"; transcript_id "gene-C7A06_RS00655"; ID "gene-C7A06_RS00655"; Name "rph"; Parent "nbis-gene-104"; gbkey "Gene"; gene "rph"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00655"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	119964	120680	.	+	.	gene_id "nbis-gene-104"; transcript_id "gene-C7A06_RS00655"; Dbxref "Genbank:WP_001247089.1"; ID "nbis-exon-112"; Name "WP_001247089.1"; Ontology_term "GO:0008033" "GO:0004549"; Parent "gene-C7A06_RS00655"; gbkey "CDS"; gene "rph"; go_function "tRNA-specific ribonuclease activity|0004549||IEA"; go_process "tRNA processing|0008033||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_006803115.1"; locus_tag "C7A06_RS00655"; product "ribonuclease PH"; protein_id "WP_001247089.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	119964	120680	.	+	0	gene_id "nbis-gene-104"; transcript_id "gene-C7A06_RS00655"; Dbxref "Genbank:WP_001247089.1"; ID "cds-WP_001247089.1"; Name "WP_001247089.1"; Ontology_term "GO:0008033" "GO:0004549"; Parent "gene-C7A06_RS00655"; gbkey "CDS"; gene "rph"; go_function "tRNA-specific ribonuclease activity|0004549||IEA"; go_process "tRNA processing|0008033||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_006803115.1"; locus_tag "C7A06_RS00655"; product "ribonuclease PH"; protein_id "WP_001247089.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	120746	121387	.	+	.	gene_id "nbis-gene-105"; ID "nbis-gene-105"; Name "pyrE"; gbkey "Gene"; gene "pyrE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00660";
+NZ_CP027599.1	RefSeq	transcript	120746	121387	.	+	.	gene_id "nbis-gene-105"; transcript_id "gene-C7A06_RS00660"; ID "gene-C7A06_RS00660"; Name "pyrE"; Parent "nbis-gene-105"; gbkey "Gene"; gene "pyrE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00660"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	120746	121387	.	+	.	gene_id "nbis-gene-105"; transcript_id "gene-C7A06_RS00660"; Dbxref "Genbank:WP_000806161.1"; ID "nbis-exon-113"; Name "WP_000806161.1"; Ontology_term "GO:0009220" "GO:0004588"; Parent "gene-C7A06_RS00660"; gbkey "CDS"; gene "pyrE"; go_function "orotate phosphoribosyltransferase activity|0004588||IEA"; go_process "pyrimidine ribonucleotide biosynthetic process|0009220||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312544.1"; locus_tag "C7A06_RS00660"; product "orotate phosphoribosyltransferase"; protein_id "WP_000806161.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	120746	121387	.	+	0	gene_id "nbis-gene-105"; transcript_id "gene-C7A06_RS00660"; Dbxref "Genbank:WP_000806161.1"; ID "cds-WP_000806161.1"; Name "WP_000806161.1"; Ontology_term "GO:0009220" "GO:0004588"; Parent "gene-C7A06_RS00660"; gbkey "CDS"; gene "pyrE"; go_function "orotate phosphoribosyltransferase activity|0004588||IEA"; go_process "pyrimidine ribonucleotide biosynthetic process|0009220||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312544.1"; locus_tag "C7A06_RS00660"; product "orotate phosphoribosyltransferase"; protein_id "WP_000806161.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	121424	122020	.	-	.	gene_id "nbis-gene-106"; ID "nbis-gene-106"; Name "slmA"; gbkey "Gene"; gene "slmA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00665";
+NZ_CP027599.1	RefSeq	transcript	121424	122020	.	-	.	gene_id "nbis-gene-106"; transcript_id "gene-C7A06_RS00665"; ID "gene-C7A06_RS00665"; Name "slmA"; Parent "nbis-gene-106"; gbkey "Gene"; gene "slmA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00665"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	121424	122020	.	-	.	gene_id "nbis-gene-106"; transcript_id "gene-C7A06_RS00665"; Dbxref "Genbank:WP_000818601.1"; ID "nbis-exon-114"; Name "WP_000818601.1"; Ontology_term "GO:0010974" "GO:0003677"; Parent "gene-C7A06_RS00665"; gbkey "CDS"; gene "slmA"; go_function "DNA binding|0003677||IEA"; go_process "negative regulation of division septum assembly|0010974||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000818604.1"; locus_tag "C7A06_RS00665"; product "nucleoid occlusion factor SlmA"; protein_id "WP_000818601.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	121424	122020	.	-	0	gene_id "nbis-gene-106"; transcript_id "gene-C7A06_RS00665"; Dbxref "Genbank:WP_000818601.1"; ID "cds-WP_000818601.1"; Name "WP_000818601.1"; Ontology_term "GO:0010974" "GO:0003677"; Parent "gene-C7A06_RS00665"; gbkey "CDS"; gene "slmA"; go_function "DNA binding|0003677||IEA"; go_process "negative regulation of division septum assembly|0010974||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000818604.1"; locus_tag "C7A06_RS00665"; product "nucleoid occlusion factor SlmA"; protein_id "WP_000818601.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	122127	122585	.	-	.	gene_id "nbis-gene-107"; ID "nbis-gene-107"; Name "dut"; gbkey "Gene"; gene "dut"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00670";
+NZ_CP027599.1	RefSeq	transcript	122127	122585	.	-	.	gene_id "nbis-gene-107"; transcript_id "gene-C7A06_RS00670"; ID "gene-C7A06_RS00670"; Name "dut"; Parent "nbis-gene-107"; gbkey "Gene"; gene "dut"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00670"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	122127	122585	.	-	.	gene_id "nbis-gene-107"; transcript_id "gene-C7A06_RS00670"; Dbxref "Genbank:WP_000976070.1"; ID "nbis-exon-115"; Name "WP_000976070.1"; Ontology_term "GO:0006226" "GO:0046081" "GO:0000287" "GO:0004170"; Parent "gene-C7A06_RS00670"; gbkey "CDS"; gene "dut"; go_function "magnesium ion binding|0000287||IEA" "dUTP diphosphatase activity|0004170||IEA"; go_process "dUMP biosynthetic process|0006226||IEA" "dUTP catabolic process|0046081||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000976070.1"; locus_tag "C7A06_RS00670"; product "dUTP diphosphatase"; protein_id "WP_000976070.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	122127	122585	.	-	0	gene_id "nbis-gene-107"; transcript_id "gene-C7A06_RS00670"; Dbxref "Genbank:WP_000976070.1"; ID "cds-WP_000976070.1"; Name "WP_000976070.1"; Ontology_term "GO:0006226" "GO:0046081" "GO:0000287" "GO:0004170"; Parent "gene-C7A06_RS00670"; gbkey "CDS"; gene "dut"; go_function "magnesium ion binding|0000287||IEA" "dUTP diphosphatase activity|0004170||IEA"; go_process "dUMP biosynthetic process|0006226||IEA" "dUTP catabolic process|0046081||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000976070.1"; locus_tag "C7A06_RS00670"; product "dUTP diphosphatase"; protein_id "WP_000976070.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	122563	123783	.	-	.	gene_id "nbis-gene-108"; ID "nbis-gene-108"; Name "coaBC"; gbkey "Gene"; gene "coaBC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00675";
+NZ_CP027599.1	RefSeq	transcript	122563	123783	.	-	.	gene_id "nbis-gene-108"; transcript_id "gene-C7A06_RS00675"; ID "gene-C7A06_RS00675"; Name "coaBC"; Parent "nbis-gene-108"; gbkey "Gene"; gene "coaBC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00675"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	122563	123783	.	-	.	gene_id "nbis-gene-108"; transcript_id "gene-C7A06_RS00675"; Dbxref "Genbank:WP_000050139.1"; ID "nbis-exon-116"; Name "WP_000050139.1"; Ontology_term "GO:0015937" "GO:0015939" "GO:0004632" "GO:0004633"; Parent "gene-C7A06_RS00675"; gbkey "CDS"; gene "coaBC"; go_function "phosphopantothenate--cysteine ligase activity|0004632||IEA" "phosphopantothenoylcysteine decarboxylase activity|0004633||IEA"; go_process "coenzyme A biosynthetic process|0015937||IEA" "pantothenate metabolic process|0015939||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418096.4"; locus_tag "C7A06_RS00675"; product "bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC"; protein_id "WP_000050139.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	122563	123783	.	-	0	gene_id "nbis-gene-108"; transcript_id "gene-C7A06_RS00675"; Dbxref "Genbank:WP_000050139.1"; ID "cds-WP_000050139.1"; Name "WP_000050139.1"; Ontology_term "GO:0015937" "GO:0015939" "GO:0004632" "GO:0004633"; Parent "gene-C7A06_RS00675"; gbkey "CDS"; gene "coaBC"; go_function "phosphopantothenate--cysteine ligase activity|0004632||IEA" "phosphopantothenoylcysteine decarboxylase activity|0004633||IEA"; go_process "coenzyme A biosynthetic process|0015937||IEA" "pantothenate metabolic process|0015939||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418096.4"; locus_tag "C7A06_RS00675"; product "bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC"; protein_id "WP_000050139.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	123955	124623	.	+	.	gene_id "nbis-gene-109"; ID "nbis-gene-109"; Name "radC"; gbkey "Gene"; gene "radC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00680";
+NZ_CP027599.1	RefSeq	transcript	123955	124623	.	+	.	gene_id "nbis-gene-109"; transcript_id "gene-C7A06_RS00680"; ID "gene-C7A06_RS00680"; Name "radC"; Parent "nbis-gene-109"; gbkey "Gene"; gene "radC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00680"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	123955	124623	.	+	.	gene_id "nbis-gene-109"; transcript_id "gene-C7A06_RS00680"; Dbxref "Genbank:WP_001297375.1"; ID "nbis-exon-117"; Name "WP_001297375.1"; Ontology_term "GO:0006281" "GO:0003677"; Parent "gene-C7A06_RS00680"; gbkey "CDS"; gene "radC"; go_function "DNA binding|0003677||IEA"; go_process "DNA repair|0006281||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709417.4"; locus_tag "C7A06_RS00680"; product "DNA repair protein RadC"; protein_id "WP_001297375.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	123955	124623	.	+	0	gene_id "nbis-gene-109"; transcript_id "gene-C7A06_RS00680"; Dbxref "Genbank:WP_001297375.1"; ID "cds-WP_001297375.1"; Name "WP_001297375.1"; Ontology_term "GO:0006281" "GO:0003677"; Parent "gene-C7A06_RS00680"; gbkey "CDS"; gene "radC"; go_function "DNA binding|0003677||IEA"; go_process "DNA repair|0006281||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709417.4"; locus_tag "C7A06_RS00680"; product "DNA repair protein RadC"; protein_id "WP_001297375.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	124840	125076	.	+	.	gene_id "nbis-gene-110"; ID "nbis-gene-110"; Name "rpmB"; gbkey "Gene"; gene "rpmB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00685";
+NZ_CP027599.1	RefSeq	transcript	124840	125076	.	+	.	gene_id "nbis-gene-110"; transcript_id "gene-C7A06_RS00685"; ID "gene-C7A06_RS00685"; Name "rpmB"; Parent "nbis-gene-110"; gbkey "Gene"; gene "rpmB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00685"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	124840	125076	.	+	.	gene_id "nbis-gene-110"; transcript_id "gene-C7A06_RS00685"; Dbxref "Genbank:WP_000091955.1"; ID "nbis-exon-118"; Name "WP_000091955.1"; Ontology_term "GO:0006412" "GO:0003735" "GO:0000311" "GO:0022625"; Parent "gene-C7A06_RS00685"; gbkey "CDS"; gene "rpmB"; go_component "plastid large ribosomal subunit|0000311||IEA" "cytosolic large ribosomal subunit|0022625||IEA"; go_function "structural constituent of ribosome|0003735||IEA"; go_process "translation|0006412||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_008457442.1"; locus_tag "C7A06_RS00685"; product "50S ribosomal protein L28"; protein_id "WP_000091955.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	124840	125076	.	+	0	gene_id "nbis-gene-110"; transcript_id "gene-C7A06_RS00685"; Dbxref "Genbank:WP_000091955.1"; ID "cds-WP_000091955.1"; Name "WP_000091955.1"; Ontology_term "GO:0006412" "GO:0003735" "GO:0000311" "GO:0022625"; Parent "gene-C7A06_RS00685"; gbkey "CDS"; gene "rpmB"; go_component "plastid large ribosomal subunit|0000311||IEA" "cytosolic large ribosomal subunit|0022625||IEA"; go_function "structural constituent of ribosome|0003735||IEA"; go_process "translation|0006412||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_008457442.1"; locus_tag "C7A06_RS00685"; product "50S ribosomal protein L28"; protein_id "WP_000091955.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	125097	125264	.	+	.	gene_id "nbis-gene-111"; ID "nbis-gene-111"; Name "rpmG"; gbkey "Gene"; gene "rpmG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00690";
+NZ_CP027599.1	RefSeq	transcript	125097	125264	.	+	.	gene_id "nbis-gene-111"; transcript_id "gene-C7A06_RS00690"; ID "gene-C7A06_RS00690"; Name "rpmG"; Parent "nbis-gene-111"; gbkey "Gene"; gene "rpmG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00690"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	125097	125264	.	+	.	gene_id "nbis-gene-111"; transcript_id "gene-C7A06_RS00690"; Dbxref "Genbank:WP_001051798.1"; ID "nbis-exon-119"; Name "WP_001051798.1"; Ontology_term "GO:0006412" "GO:0003735" "GO:0000315" "GO:0022625"; Parent "gene-C7A06_RS00690"; gbkey "CDS"; gene "rpmG"; go_component "organellar large ribosomal subunit|0000315||IEA" "cytosolic large ribosomal subunit|0022625||IEA"; go_function "structural constituent of ribosome|0003735||IEA"; go_process "translation|0006412||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_010847629.1"; locus_tag "C7A06_RS00690"; product "50S ribosomal protein L33"; protein_id "WP_001051798.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	125097	125264	.	+	0	gene_id "nbis-gene-111"; transcript_id "gene-C7A06_RS00690"; Dbxref "Genbank:WP_001051798.1"; ID "cds-WP_001051798.1"; Name "WP_001051798.1"; Ontology_term "GO:0006412" "GO:0003735" "GO:0000315" "GO:0022625"; Parent "gene-C7A06_RS00690"; gbkey "CDS"; gene "rpmG"; go_component "organellar large ribosomal subunit|0000315||IEA" "cytosolic large ribosomal subunit|0022625||IEA"; go_function "structural constituent of ribosome|0003735||IEA"; go_process "translation|0006412||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_010847629.1"; locus_tag "C7A06_RS00690"; product "50S ribosomal protein L33"; protein_id "WP_001051798.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	125362	126171	.	+	.	gene_id "nbis-gene-112"; ID "nbis-gene-112"; Name "mutM"; gbkey "Gene"; gene "mutM"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00695";
+NZ_CP027599.1	RefSeq	transcript	125362	126171	.	+	.	gene_id "nbis-gene-112"; transcript_id "gene-C7A06_RS00695"; ID "gene-C7A06_RS00695"; Name "mutM"; Parent "nbis-gene-112"; gbkey "Gene"; gene "mutM"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00695"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	125362	126171	.	+	.	gene_id "nbis-gene-112"; transcript_id "gene-C7A06_RS00695"; Dbxref "Genbank:WP_001114533.1"; ID "nbis-exon-120"; Name "WP_001114533.1"; Ontology_term "GO:0006281" "GO:0006284" "GO:0003676" "GO:0003684" "GO:0003906" "GO:0008534" "GO:0016799" "GO:0019104"; Parent "gene-C7A06_RS00695"; gbkey "CDS"; gene "mutM"; go_function "nucleic acid binding|0003676||IEA" "damaged DNA binding|0003684||IEA" "DNA-(apurinic or apyrimidinic site) endonuclease activity|0003906||IEA" "oxidized purine nucleobase lesion DNA N-glycosylase activity|0008534||IEA" "hydrolase activity, hydrolyzing N-glycosyl compounds|0016799||IEA" "DNA N-glycosylase activity|0019104||IEA"; go_process "DNA repair|0006281||IEA" "base-excision repair|0006284||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312537.1"; locus_tag "C7A06_RS00695"; product "bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase"; protein_id "WP_001114533.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	125362	126171	.	+	0	gene_id "nbis-gene-112"; transcript_id "gene-C7A06_RS00695"; Dbxref "Genbank:WP_001114533.1"; ID "cds-WP_001114533.1"; Name "WP_001114533.1"; Ontology_term "GO:0006281" "GO:0006284" "GO:0003676" "GO:0003684" "GO:0003906" "GO:0008534" "GO:0016799" "GO:0019104"; Parent "gene-C7A06_RS00695"; gbkey "CDS"; gene "mutM"; go_function "nucleic acid binding|0003676||IEA" "damaged DNA binding|0003684||IEA" "DNA-(apurinic or apyrimidinic site) endonuclease activity|0003906||IEA" "oxidized purine nucleobase lesion DNA N-glycosylase activity|0008534||IEA" "hydrolase activity, hydrolyzing N-glycosyl compounds|0016799||IEA" "DNA N-glycosylase activity|0019104||IEA"; go_process "DNA repair|0006281||IEA" "base-excision repair|0006284||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312537.1"; locus_tag "C7A06_RS00695"; product "bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase"; protein_id "WP_001114533.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	126210	126689	.	-	.	gene_id "nbis-gene-113"; ID "nbis-gene-113"; Name "coaD"; gbkey "Gene"; gene "coaD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00700";
+NZ_CP027599.1	RefSeq	transcript	126210	126689	.	-	.	gene_id "nbis-gene-113"; transcript_id "gene-C7A06_RS00700"; ID "gene-C7A06_RS00700"; Name "coaD"; Parent "nbis-gene-113"; gbkey "Gene"; gene "coaD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00700"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	126210	126689	.	-	.	gene_id "nbis-gene-113"; transcript_id "gene-C7A06_RS00700"; Dbxref "Genbank:WP_001171866.1"; ID "nbis-exon-121"; Name "WP_001171866.1"; Ontology_term "GO:0015937" "GO:0004595"; Parent "gene-C7A06_RS00700"; gbkey "CDS"; gene "coaD"; go_function "pantetheine-phosphate adenylyltransferase activity|0004595||IEA"; go_process "coenzyme A biosynthetic process|0015937||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312536.1"; locus_tag "C7A06_RS00700"; product "pantetheine-phosphate adenylyltransferase"; protein_id "WP_001171866.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	126210	126689	.	-	0	gene_id "nbis-gene-113"; transcript_id "gene-C7A06_RS00700"; Dbxref "Genbank:WP_001171866.1"; ID "cds-WP_001171866.1"; Name "WP_001171866.1"; Ontology_term "GO:0015937" "GO:0004595"; Parent "gene-C7A06_RS00700"; gbkey "CDS"; gene "coaD"; go_function "pantetheine-phosphate adenylyltransferase activity|0004595||IEA"; go_process "coenzyme A biosynthetic process|0015937||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312536.1"; locus_tag "C7A06_RS00700"; product "pantetheine-phosphate adenylyltransferase"; protein_id "WP_001171866.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	126697	127974	.	-	.	gene_id "nbis-gene-114"; ID "nbis-gene-114"; Name "waaA"; gbkey "Gene"; gene "waaA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00705";
+NZ_CP027599.1	RefSeq	transcript	126697	127974	.	-	.	gene_id "nbis-gene-114"; transcript_id "gene-C7A06_RS00705"; ID "gene-C7A06_RS00705"; Name "waaA"; Parent "nbis-gene-114"; gbkey "Gene"; gene "waaA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00705"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	126697	127974	.	-	.	gene_id "nbis-gene-114"; transcript_id "gene-C7A06_RS00705"; Dbxref "Genbank:WP_000891564.1"; ID "nbis-exon-122"; Name "WP_000891564.1"; Ontology_term "GO:0016740"; Parent "gene-C7A06_RS00705"; gbkey "CDS"; gene "waaA"; go_function "transferase activity|0016740||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312535.1"; locus_tag "C7A06_RS00705"; product "lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase"; protein_id "WP_000891564.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	126697	127974	.	-	0	gene_id "nbis-gene-114"; transcript_id "gene-C7A06_RS00705"; Dbxref "Genbank:WP_000891564.1"; ID "cds-WP_000891564.1"; Name "WP_000891564.1"; Ontology_term "GO:0016740"; Parent "gene-C7A06_RS00705"; gbkey "CDS"; gene "waaA"; go_function "transferase activity|0016740||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312535.1"; locus_tag "C7A06_RS00705"; product "lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase"; protein_id "WP_000891564.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	128387	129445	.	+	.	gene_id "nbis-gene-115"; ID "nbis-gene-115"; Name "rfaQ"; gbkey "Gene"; gene "rfaQ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00710";
+NZ_CP027599.1	RefSeq	transcript	128387	129445	.	+	.	gene_id "nbis-gene-115"; transcript_id "gene-C7A06_RS00710"; ID "gene-C7A06_RS00710"; Name "rfaQ"; Parent "nbis-gene-115"; gbkey "Gene"; gene "rfaQ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00710"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	128387	129445	.	+	.	gene_id "nbis-gene-115"; transcript_id "gene-C7A06_RS00710"; Dbxref "Genbank:WP_000360406.1"; ID "nbis-exon-123"; Name "WP_000360406.1"; Ontology_term "GO:0016757"; Parent "gene-C7A06_RS00710"; gbkey "CDS"; gene "rfaQ"; go_function "glycosyltransferase activity|0016757||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709409.1"; locus_tag "C7A06_RS00710"; product "lipopolysaccharide core heptosyltransferase RfaQ"; protein_id "WP_000360406.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	128387	129445	.	+	0	gene_id "nbis-gene-115"; transcript_id "gene-C7A06_RS00710"; Dbxref "Genbank:WP_000360406.1"; ID "cds-WP_000360406.1"; Name "WP_000360406.1"; Ontology_term "GO:0016757"; Parent "gene-C7A06_RS00710"; gbkey "CDS"; gene "rfaQ"; go_function "glycosyltransferase activity|0016757||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709409.1"; locus_tag "C7A06_RS00710"; product "lipopolysaccharide core heptosyltransferase RfaQ"; protein_id "WP_000360406.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	129442	130566	.	+	.	gene_id "nbis-gene-116"; ID "nbis-gene-116"; Name "waaG"; gbkey "Gene"; gene "waaG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00715";
+NZ_CP027599.1	RefSeq	transcript	129442	130566	.	+	.	gene_id "nbis-gene-116"; transcript_id "gene-C7A06_RS00715"; ID "gene-C7A06_RS00715"; Name "waaG"; Parent "nbis-gene-116"; gbkey "Gene"; gene "waaG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00715"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	129442	130566	.	+	.	gene_id "nbis-gene-116"; transcript_id "gene-C7A06_RS00715"; Dbxref "Genbank:WP_000634240.1"; ID "nbis-exon-124"; Name "WP_000634240.1"; Parent "gene-C7A06_RS00715"; gbkey "CDS"; gene "waaG"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312533.1"; locus_tag "C7A06_RS00715"; product "glycosyltransferase family 4 protein"; protein_id "WP_000634240.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	129442	130566	.	+	0	gene_id "nbis-gene-116"; transcript_id "gene-C7A06_RS00715"; Dbxref "Genbank:WP_000634240.1"; ID "cds-WP_000634240.1"; Name "WP_000634240.1"; Parent "gene-C7A06_RS00715"; gbkey "CDS"; gene "waaG"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312533.1"; locus_tag "C7A06_RS00715"; product "glycosyltransferase family 4 protein"; protein_id "WP_000634240.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	130559	131356	.	+	.	gene_id "nbis-gene-117"; ID "nbis-gene-117"; Name "rfaP"; gbkey "Gene"; gene "rfaP"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00720";
+NZ_CP027599.1	RefSeq	transcript	130559	131356	.	+	.	gene_id "nbis-gene-117"; transcript_id "gene-C7A06_RS00720"; ID "gene-C7A06_RS00720"; Name "rfaP"; Parent "nbis-gene-117"; gbkey "Gene"; gene "rfaP"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00720"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	130559	131356	.	+	.	gene_id "nbis-gene-117"; transcript_id "gene-C7A06_RS00720"; Dbxref "Genbank:WP_001341761.1"; ID "nbis-exon-125"; Name "WP_001341761.1"; Ontology_term "GO:0009103" "GO:0016301"; Parent "gene-C7A06_RS00720"; gbkey "CDS"; gene "rfaP"; go_function "kinase activity|0016301||IEA"; go_process "lipopolysaccharide biosynthetic process|0009103||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312532.2"; locus_tag "C7A06_RS00720"; product "lipopolysaccharide core heptose(I) kinase RfaP"; protein_id "WP_001341761.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	130559	131356	.	+	0	gene_id "nbis-gene-117"; transcript_id "gene-C7A06_RS00720"; Dbxref "Genbank:WP_001341761.1"; ID "cds-WP_001341761.1"; Name "WP_001341761.1"; Ontology_term "GO:0009103" "GO:0016301"; Parent "gene-C7A06_RS00720"; gbkey "CDS"; gene "rfaP"; go_function "kinase activity|0016301||IEA"; go_process "lipopolysaccharide biosynthetic process|0009103||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312532.2"; locus_tag "C7A06_RS00720"; product "lipopolysaccharide core heptose(I) kinase RfaP"; protein_id "WP_001341761.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	131399	132406	.	+	.	gene_id "nbis-gene-118"; ID "nbis-gene-118"; Name "waaO"; gbkey "Gene"; gene "waaO"; gene_biotype "protein_coding"; gene_synonym "rfaI"; locus_tag "C7A06_RS00725";
+NZ_CP027599.1	RefSeq	transcript	131399	132406	.	+	.	gene_id "nbis-gene-118"; transcript_id "gene-C7A06_RS00725"; ID "gene-C7A06_RS00725"; Name "waaO"; Parent "nbis-gene-118"; gbkey "Gene"; gene "waaO"; gene_biotype "protein_coding"; gene_synonym "rfaI"; locus_tag "C7A06_RS00725"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	131399	132406	.	+	.	gene_id "nbis-gene-118"; transcript_id "gene-C7A06_RS00725"; Dbxref "Genbank:WP_000080643.1"; ID "nbis-exon-126"; Name "WP_000080643.1"; Ontology_term "GO:0009103" "GO:0008918"; Parent "gene-C7A06_RS00725"; gbkey "CDS"; gene "waaO"; go_function "lipopolysaccharide 3-alpha-galactosyltransferase activity|0008918||IEA"; go_process "lipopolysaccharide biosynthetic process|0009103||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001521942.1"; locus_tag "C7A06_RS00725"; product "lipopolysaccharide 3-alpha-galactosyltransferase"; protein_id "WP_000080643.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	131399	132406	.	+	0	gene_id "nbis-gene-118"; transcript_id "gene-C7A06_RS00725"; Dbxref "Genbank:WP_000080643.1"; ID "cds-WP_000080643.1"; Name "WP_000080643.1"; Ontology_term "GO:0009103" "GO:0008918"; Parent "gene-C7A06_RS00725"; gbkey "CDS"; gene "waaO"; go_function "lipopolysaccharide 3-alpha-galactosyltransferase activity|0008918||IEA"; go_process "lipopolysaccharide biosynthetic process|0009103||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001521942.1"; locus_tag "C7A06_RS00725"; product "lipopolysaccharide 3-alpha-galactosyltransferase"; protein_id "WP_000080643.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	132432	133139	.	+	.	gene_id "nbis-gene-119"; ID "nbis-gene-119"; Name "rfaY"; gbkey "Gene"; gene "rfaY"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00730";
+NZ_CP027599.1	RefSeq	transcript	132432	133139	.	+	.	gene_id "nbis-gene-119"; transcript_id "gene-C7A06_RS00730"; ID "gene-C7A06_RS00730"; Name "rfaY"; Parent "nbis-gene-119"; gbkey "Gene"; gene "rfaY"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00730"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	132432	133139	.	+	.	gene_id "nbis-gene-119"; transcript_id "gene-C7A06_RS00730"; Dbxref "Genbank:WP_000639946.1"; ID "nbis-exon-127"; Name "WP_000639946.1"; Parent "gene-C7A06_RS00730"; gbkey "CDS"; gene "rfaY"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709405.1"; locus_tag "C7A06_RS00730"; product "lipopolysaccharide core heptose(II) kinase RfaY"; protein_id "WP_000639946.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	132432	133139	.	+	0	gene_id "nbis-gene-119"; transcript_id "gene-C7A06_RS00730"; Dbxref "Genbank:WP_000639946.1"; ID "cds-WP_000639946.1"; Name "WP_000639946.1"; Parent "gene-C7A06_RS00730"; gbkey "CDS"; gene "rfaY"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709405.1"; locus_tag "C7A06_RS00730"; product "lipopolysaccharide core heptose(II) kinase RfaY"; protein_id "WP_000639946.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	133164	134177	.	+	.	gene_id "nbis-gene-120"; ID "nbis-gene-120"; Name "C7A06_RS00735"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00735";
+NZ_CP027599.1	RefSeq	transcript	133164	134177	.	+	.	gene_id "nbis-gene-120"; transcript_id "gene-C7A06_RS00735"; ID "gene-C7A06_RS00735"; Name "C7A06_RS00735"; Parent "nbis-gene-120"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00735"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	133164	134177	.	+	.	gene_id "nbis-gene-120"; transcript_id "gene-C7A06_RS00735"; Dbxref "Genbank:WP_000346017.1"; ID "nbis-exon-128"; Name "WP_000346017.1"; Parent "gene-C7A06_RS00735"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312529.1"; locus_tag "C7A06_RS00735"; product "UDP-glucose--(galactosyl) LPS alpha1,2-glucosyltransferase"; protein_id "WP_000346017.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	133164	134177	.	+	0	gene_id "nbis-gene-120"; transcript_id "gene-C7A06_RS00735"; Dbxref "Genbank:WP_000346017.1"; ID "cds-WP_000346017.1"; Name "WP_000346017.1"; Parent "gene-C7A06_RS00735"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312529.1"; locus_tag "C7A06_RS00735"; product "UDP-glucose--(galactosyl) LPS alpha1,2-glucosyltransferase"; protein_id "WP_000346017.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	134186	135328	.	+	.	gene_id "nbis-gene-121"; ID "nbis-gene-121"; Name "C7A06_RS00740"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00740";
+NZ_CP027599.1	RefSeq	transcript	134186	135328	.	+	.	gene_id "nbis-gene-121"; transcript_id "gene-C7A06_RS00740"; ID "gene-C7A06_RS00740"; Name "C7A06_RS00740"; Parent "nbis-gene-121"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00740"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	134186	135328	.	+	.	gene_id "nbis-gene-121"; transcript_id "gene-C7A06_RS00740"; Dbxref "Genbank:WP_000227812.1"; ID "nbis-exon-129"; Name "WP_000227812.1"; Parent "gene-C7A06_RS00740"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312528.1"; locus_tag "C7A06_RS00740"; product "lipopolysaccharide N-acetylglucosaminyltransferase"; protein_id "WP_000227812.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	134186	135328	.	+	0	gene_id "nbis-gene-121"; transcript_id "gene-C7A06_RS00740"; Dbxref "Genbank:WP_000227812.1"; ID "cds-WP_000227812.1"; Name "WP_000227812.1"; Parent "gene-C7A06_RS00740"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312528.1"; locus_tag "C7A06_RS00740"; product "lipopolysaccharide N-acetylglucosaminyltransferase"; protein_id "WP_000227812.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	135364	136572	.	-	.	gene_id "nbis-gene-122"; ID "nbis-gene-122"; Name "rfaL"; gbkey "Gene"; gene "rfaL"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00745";
+NZ_CP027599.1	RefSeq	transcript	135364	136572	.	-	.	gene_id "nbis-gene-122"; transcript_id "gene-C7A06_RS00745"; ID "gene-C7A06_RS00745"; Name "rfaL"; Parent "nbis-gene-122"; gbkey "Gene"; gene "rfaL"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00745"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	135364	136572	.	-	.	gene_id "nbis-gene-122"; transcript_id "gene-C7A06_RS00745"; Dbxref "Genbank:WP_000204742.1"; ID "nbis-exon-130"; Name "WP_000204742.1"; Parent "gene-C7A06_RS00745"; gbkey "CDS"; gene "rfaL"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312527.1"; locus_tag "C7A06_RS00745"; product "O-antigen ligase RfaL"; protein_id "WP_000204742.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	135364	136572	.	-	0	gene_id "nbis-gene-122"; transcript_id "gene-C7A06_RS00745"; Dbxref "Genbank:WP_000204742.1"; ID "cds-WP_000204742.1"; Name "WP_000204742.1"; Parent "gene-C7A06_RS00745"; gbkey "CDS"; gene "rfaL"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312527.1"; locus_tag "C7A06_RS00745"; product "O-antigen ligase RfaL"; protein_id "WP_000204742.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	136569	137561	.	-	.	gene_id "nbis-gene-123"; ID "nbis-gene-123"; Name "rfaC"; gbkey "Gene"; gene "rfaC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00750";
+NZ_CP027599.1	RefSeq	transcript	136569	137561	.	-	.	gene_id "nbis-gene-123"; transcript_id "gene-C7A06_RS00750"; ID "gene-C7A06_RS00750"; Name "rfaC"; Parent "nbis-gene-123"; gbkey "Gene"; gene "rfaC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00750"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	136569	137561	.	-	.	gene_id "nbis-gene-123"; transcript_id "gene-C7A06_RS00750"; Dbxref "Genbank:WP_001264565.1"; ID "nbis-exon-131"; Name "WP_001264565.1"; Ontology_term "GO:0009244" "GO:0008920"; Parent "gene-C7A06_RS00750"; gbkey "CDS"; gene "rfaC"; go_function "lipopolysaccharide heptosyltransferase activity|0008920||IEA"; go_process "lipopolysaccharide core region biosynthetic process|0009244||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312526.1"; locus_tag "C7A06_RS00750"; product "lipopolysaccharide heptosyltransferase RfaC"; protein_id "WP_001264565.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	136569	137561	.	-	0	gene_id "nbis-gene-123"; transcript_id "gene-C7A06_RS00750"; Dbxref "Genbank:WP_001264565.1"; ID "cds-WP_001264565.1"; Name "WP_001264565.1"; Ontology_term "GO:0009244" "GO:0008920"; Parent "gene-C7A06_RS00750"; gbkey "CDS"; gene "rfaC"; go_function "lipopolysaccharide heptosyltransferase activity|0008920||IEA"; go_process "lipopolysaccharide core region biosynthetic process|0009244||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312526.1"; locus_tag "C7A06_RS00750"; product "lipopolysaccharide heptosyltransferase RfaC"; protein_id "WP_001264565.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	137565	138611	.	-	.	gene_id "nbis-gene-124"; ID "nbis-gene-124"; Name "rfaF"; gbkey "Gene"; gene "rfaF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00755";
+NZ_CP027599.1	RefSeq	transcript	137565	138611	.	-	.	gene_id "nbis-gene-124"; transcript_id "gene-C7A06_RS00755"; ID "gene-C7A06_RS00755"; Name "rfaF"; Parent "nbis-gene-124"; gbkey "Gene"; gene "rfaF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00755"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	137565	138611	.	-	.	gene_id "nbis-gene-124"; transcript_id "gene-C7A06_RS00755"; Dbxref "Genbank:WP_000699219.1"; ID "nbis-exon-132"; Name "WP_000699219.1"; Ontology_term "GO:0009103" "GO:0016757"; Parent "gene-C7A06_RS00755"; gbkey "CDS"; gene "rfaF"; go_function "glycosyltransferase activity|0016757||IEA"; go_process "lipopolysaccharide biosynthetic process|0009103||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418077.1"; locus_tag "C7A06_RS00755"; product "ADP-heptose--LPS heptosyltransferase RfaF"; protein_id "WP_000699219.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	137565	138611	.	-	0	gene_id "nbis-gene-124"; transcript_id "gene-C7A06_RS00755"; Dbxref "Genbank:WP_000699219.1"; ID "cds-WP_000699219.1"; Name "WP_000699219.1"; Ontology_term "GO:0009103" "GO:0016757"; Parent "gene-C7A06_RS00755"; gbkey "CDS"; gene "rfaF"; go_function "glycosyltransferase activity|0016757||IEA"; go_process "lipopolysaccharide biosynthetic process|0009103||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418077.1"; locus_tag "C7A06_RS00755"; product "ADP-heptose--LPS heptosyltransferase RfaF"; protein_id "WP_000699219.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	138621	139553	.	-	.	gene_id "nbis-gene-125"; ID "nbis-gene-125"; Name "rfaD"; gbkey "Gene"; gene "rfaD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00760";
+NZ_CP027599.1	RefSeq	transcript	138621	139553	.	-	.	gene_id "nbis-gene-125"; transcript_id "gene-C7A06_RS00760"; ID "gene-C7A06_RS00760"; Name "rfaD"; Parent "nbis-gene-125"; gbkey "Gene"; gene "rfaD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00760"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	138621	139553	.	-	.	gene_id "nbis-gene-125"; transcript_id "gene-C7A06_RS00760"; Dbxref "Genbank:WP_000587764.1"; ID "nbis-exon-133"; Name "WP_000587764.1"; Ontology_term "GO:0005975" "GO:0008712"; Parent "gene-C7A06_RS00760"; gbkey "CDS"; gene "rfaD"; go_function "ADP-glyceromanno-heptose 6-epimerase activity|0008712||IEA"; go_process "carbohydrate metabolic process|0005975||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_020233050.1"; locus_tag "C7A06_RS00760"; product "ADP-glyceromanno-heptose 6-epimerase"; protein_id "WP_000587764.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	138621	139553	.	-	0	gene_id "nbis-gene-125"; transcript_id "gene-C7A06_RS00760"; Dbxref "Genbank:WP_000587764.1"; ID "cds-WP_000587764.1"; Name "WP_000587764.1"; Ontology_term "GO:0005975" "GO:0008712"; Parent "gene-C7A06_RS00760"; gbkey "CDS"; gene "rfaD"; go_function "ADP-glyceromanno-heptose 6-epimerase activity|0008712||IEA"; go_process "carbohydrate metabolic process|0005975||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_020233050.1"; locus_tag "C7A06_RS00760"; product "ADP-glyceromanno-heptose 6-epimerase"; protein_id "WP_000587764.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	139857	140714	.	+	.	gene_id "nbis-gene-126"; ID "nbis-gene-126"; Name "yibB"; gbkey "Gene"; gene "yibB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00765";
+NZ_CP027599.1	RefSeq	transcript	139857	140714	.	+	.	gene_id "nbis-gene-126"; transcript_id "gene-C7A06_RS00765"; ID "gene-C7A06_RS00765"; Name "yibB"; Parent "nbis-gene-126"; gbkey "Gene"; gene "yibB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00765"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	139857	140714	.	+	.	gene_id "nbis-gene-126"; transcript_id "gene-C7A06_RS00765"; Dbxref "Genbank:WP_000842823.1"; ID "nbis-exon-134"; Name "WP_000842823.1"; Parent "gene-C7A06_RS00765"; gbkey "CDS"; gene "yibB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418075.2"; locus_tag "C7A06_RS00765"; product "protein YibB"; protein_id "WP_000842823.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	139857	140714	.	+	0	gene_id "nbis-gene-126"; transcript_id "gene-C7A06_RS00765"; Dbxref "Genbank:WP_000842823.1"; ID "cds-WP_000842823.1"; Name "WP_000842823.1"; Parent "gene-C7A06_RS00765"; gbkey "CDS"; gene "yibB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418075.2"; locus_tag "C7A06_RS00765"; product "protein YibB"; protein_id "WP_000842823.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	140989	142185	.	+	.	gene_id "nbis-gene-127"; ID "nbis-gene-127"; Name "kbl"; gbkey "Gene"; gene "kbl"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00770";
+NZ_CP027599.1	RefSeq	transcript	140989	142185	.	+	.	gene_id "nbis-gene-127"; transcript_id "gene-C7A06_RS00770"; ID "gene-C7A06_RS00770"; Name "kbl"; Parent "nbis-gene-127"; gbkey "Gene"; gene "kbl"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00770"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	140989	142185	.	+	.	gene_id "nbis-gene-127"; transcript_id "gene-C7A06_RS00770"; Dbxref "Genbank:WP_001213834.1"; ID "nbis-exon-135"; Name "WP_001213834.1"; Ontology_term "GO:0006567" "GO:0008890"; Parent "gene-C7A06_RS00770"; gbkey "CDS"; gene "kbl"; go_function "glycine C-acetyltransferase activity|0008890||IEA"; go_process "threonine catabolic process|0006567||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_020239151.1"; locus_tag "C7A06_RS00770"; product "glycine C-acetyltransferase"; protein_id "WP_001213834.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	140989	142185	.	+	0	gene_id "nbis-gene-127"; transcript_id "gene-C7A06_RS00770"; Dbxref "Genbank:WP_001213834.1"; ID "cds-WP_001213834.1"; Name "WP_001213834.1"; Ontology_term "GO:0006567" "GO:0008890"; Parent "gene-C7A06_RS00770"; gbkey "CDS"; gene "kbl"; go_function "glycine C-acetyltransferase activity|0008890||IEA"; go_process "threonine catabolic process|0006567||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_020239151.1"; locus_tag "C7A06_RS00770"; product "glycine C-acetyltransferase"; protein_id "WP_001213834.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	142195	143220	.	+	.	gene_id "nbis-gene-128"; ID "nbis-gene-128"; Name "tdh"; gbkey "Gene"; gene "tdh"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00775";
+NZ_CP027599.1	RefSeq	transcript	142195	143220	.	+	.	gene_id "nbis-gene-128"; transcript_id "gene-C7A06_RS00775"; ID "gene-C7A06_RS00775"; Name "tdh"; Parent "nbis-gene-128"; gbkey "Gene"; gene "tdh"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00775"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	142195	143220	.	+	.	gene_id "nbis-gene-128"; transcript_id "gene-C7A06_RS00775"; Dbxref "Genbank:WP_000646014.1"; ID "nbis-exon-136"; Name "WP_000646014.1"; Ontology_term "GO:0006567" "GO:0008743"; Parent "gene-C7A06_RS00775"; gbkey "CDS"; gene "tdh"; go_function "L-threonine 3-dehydrogenase activity|0008743||IEA"; go_process "threonine catabolic process|0006567||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005120462.1"; locus_tag "C7A06_RS00775"; product "L-threonine 3-dehydrogenase"; protein_id "WP_000646014.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	142195	143220	.	+	0	gene_id "nbis-gene-128"; transcript_id "gene-C7A06_RS00775"; Dbxref "Genbank:WP_000646014.1"; ID "cds-WP_000646014.1"; Name "WP_000646014.1"; Ontology_term "GO:0006567" "GO:0008743"; Parent "gene-C7A06_RS00775"; gbkey "CDS"; gene "tdh"; go_function "L-threonine 3-dehydrogenase activity|0008743||IEA"; go_process "threonine catabolic process|0006567||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005120462.1"; locus_tag "C7A06_RS00775"; product "L-threonine 3-dehydrogenase"; protein_id "WP_000646014.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	143472	144506	.	+	.	gene_id "nbis-gene-129"; ID "nbis-gene-129"; Name "waaH"; gbkey "Gene"; gene "waaH"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00780";
+NZ_CP027599.1	RefSeq	transcript	143472	144506	.	+	.	gene_id "nbis-gene-129"; transcript_id "gene-C7A06_RS00780"; ID "gene-C7A06_RS00780"; Name "waaH"; Parent "nbis-gene-129"; gbkey "Gene"; gene "waaH"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00780"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	143472	144506	.	+	.	gene_id "nbis-gene-129"; transcript_id "gene-C7A06_RS00780"; Dbxref "Genbank:WP_000982091.1"; ID "nbis-exon-137"; Name "WP_000982091.1"; Parent "gene-C7A06_RS00780"; gbkey "CDS"; gene "waaH"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418072.1"; locus_tag "C7A06_RS00780"; product "UDP-glucuronate:LPS(HepIII) glycosyltransferase"; protein_id "WP_000982091.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	143472	144506	.	+	0	gene_id "nbis-gene-129"; transcript_id "gene-C7A06_RS00780"; Dbxref "Genbank:WP_000982091.1"; ID "cds-WP_000982091.1"; Name "WP_000982091.1"; Parent "gene-C7A06_RS00780"; gbkey "CDS"; gene "waaH"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418072.1"; locus_tag "C7A06_RS00780"; product "UDP-glucuronate:LPS(HepIII) glycosyltransferase"; protein_id "WP_000982091.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	144493	145452	.	-	.	gene_id "nbis-gene-130"; ID "nbis-gene-130"; Name "yibQ"; gbkey "Gene"; gene "yibQ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00785";
+NZ_CP027599.1	RefSeq	transcript	144493	145452	.	-	.	gene_id "nbis-gene-130"; transcript_id "gene-C7A06_RS00785"; ID "gene-C7A06_RS00785"; Name "yibQ"; Parent "nbis-gene-130"; gbkey "Gene"; gene "yibQ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00785"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	144493	145452	.	-	.	gene_id "nbis-gene-130"; transcript_id "gene-C7A06_RS00785"; Dbxref "Genbank:WP_000483865.1"; ID "nbis-exon-138"; Name "WP_000483865.1"; Parent "gene-C7A06_RS00785"; gbkey "CDS"; gene "yibQ"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312519.2"; locus_tag "C7A06_RS00785"; product "divergent polysaccharide deacetylase family protein"; protein_id "WP_000483865.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	144493	145452	.	-	0	gene_id "nbis-gene-130"; transcript_id "gene-C7A06_RS00785"; Dbxref "Genbank:WP_000483865.1"; ID "cds-WP_000483865.1"; Name "WP_000483865.1"; Parent "gene-C7A06_RS00785"; gbkey "CDS"; gene "yibQ"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312519.2"; locus_tag "C7A06_RS00785"; product "divergent polysaccharide deacetylase family protein"; protein_id "WP_000483865.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	145456	146715	.	-	.	gene_id "nbis-gene-131"; ID "nbis-gene-131"; Name "envC"; gbkey "Gene"; gene "envC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00790";
+NZ_CP027599.1	RefSeq	transcript	145456	146715	.	-	.	gene_id "nbis-gene-131"; transcript_id "gene-C7A06_RS00790"; ID "gene-C7A06_RS00790"; Name "envC"; Parent "nbis-gene-131"; gbkey "Gene"; gene "envC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00790"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	145456	146715	.	-	.	gene_id "nbis-gene-131"; transcript_id "gene-C7A06_RS00790"; Dbxref "Genbank:WP_000196256.1"; ID "nbis-exon-139"; Name "WP_000196256.1"; Parent "gene-C7A06_RS00790"; gbkey "CDS"; gene "envC"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418070.6"; locus_tag "C7A06_RS00790"; product "murein hydrolase activator EnvC"; protein_id "WP_000196256.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	145456	146715	.	-	0	gene_id "nbis-gene-131"; transcript_id "gene-C7A06_RS00790"; Dbxref "Genbank:WP_000196256.1"; ID "cds-WP_000196256.1"; Name "WP_000196256.1"; Parent "gene-C7A06_RS00790"; gbkey "CDS"; gene "envC"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418070.6"; locus_tag "C7A06_RS00790"; product "murein hydrolase activator EnvC"; protein_id "WP_000196256.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	146749	148293	.	-	.	gene_id "nbis-gene-132"; ID "nbis-gene-132"; Name "gpmM"; gbkey "Gene"; gene "gpmM"; gene_biotype "protein_coding"; gene_synonym "pgmI"; locus_tag "C7A06_RS00795";
+NZ_CP027599.1	RefSeq	transcript	146749	148293	.	-	.	gene_id "nbis-gene-132"; transcript_id "gene-C7A06_RS00795"; ID "gene-C7A06_RS00795"; Name "gpmM"; Parent "nbis-gene-132"; gbkey "Gene"; gene "gpmM"; gene_biotype "protein_coding"; gene_synonym "pgmI"; locus_tag "C7A06_RS00795"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	146749	148293	.	-	.	gene_id "nbis-gene-132"; transcript_id "gene-C7A06_RS00795"; Dbxref "Genbank:WP_000116566.1"; ID "nbis-exon-140"; Name "WP_000116566.1"; Ontology_term "GO:0006007" "GO:0004619"; Parent "gene-C7A06_RS00795"; gbkey "CDS"; gene "gpmM"; go_function "phosphoglycerate mutase activity|0004619||IEA"; go_process "glucose catabolic process|0006007||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312517.1"; locus_tag "C7A06_RS00795"; product "2,3-bisphosphoglycerate-independent phosphoglycerate mutase"; protein_id "WP_000116566.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	146749	148293	.	-	0	gene_id "nbis-gene-132"; transcript_id "gene-C7A06_RS00795"; Dbxref "Genbank:WP_000116566.1"; ID "cds-WP_000116566.1"; Name "WP_000116566.1"; Ontology_term "GO:0006007" "GO:0004619"; Parent "gene-C7A06_RS00795"; gbkey "CDS"; gene "gpmM"; go_function "phosphoglycerate mutase activity|0004619||IEA"; go_process "glucose catabolic process|0006007||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312517.1"; locus_tag "C7A06_RS00795"; product "2,3-bisphosphoglycerate-independent phosphoglycerate mutase"; protein_id "WP_000116566.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	148538	148969	.	+	.	gene_id "nbis-gene-133"; ID "nbis-gene-133"; Name "yibN"; gbkey "Gene"; gene "yibN"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00805";
+NZ_CP027599.1	RefSeq	transcript	148538	148969	.	+	.	gene_id "nbis-gene-133"; transcript_id "gene-C7A06_RS00805"; ID "gene-C7A06_RS00805"; Name "yibN"; Parent "nbis-gene-133"; gbkey "Gene"; gene "yibN"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00805"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	148538	148969	.	+	.	gene_id "nbis-gene-133"; transcript_id "gene-C7A06_RS00805"; Dbxref "Genbank:WP_001156181.1"; ID "nbis-exon-141"; Name "WP_001156181.1"; Parent "gene-C7A06_RS00805"; gbkey "CDS"; gene "yibN"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312516.1"; locus_tag "C7A06_RS00805"; product "rhodanese-like domain-containing protein"; protein_id "WP_001156181.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	148538	148969	.	+	0	gene_id "nbis-gene-133"; transcript_id "gene-C7A06_RS00805"; Dbxref "Genbank:WP_001156181.1"; ID "cds-WP_001156181.1"; Name "WP_001156181.1"; Parent "gene-C7A06_RS00805"; gbkey "CDS"; gene "yibN"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312516.1"; locus_tag "C7A06_RS00805"; product "rhodanese-like domain-containing protein"; protein_id "WP_001156181.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	149111	149362	.	+	.	gene_id "nbis-gene-134"; ID "nbis-gene-134"; Name "grxC"; gbkey "Gene"; gene "grxC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00810";
+NZ_CP027599.1	RefSeq	transcript	149111	149362	.	+	.	gene_id "nbis-gene-134"; transcript_id "gene-C7A06_RS00810"; ID "gene-C7A06_RS00810"; Name "grxC"; Parent "nbis-gene-134"; gbkey "Gene"; gene "grxC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00810"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	149111	149362	.	+	.	gene_id "nbis-gene-134"; transcript_id "gene-C7A06_RS00810"; Dbxref "Genbank:WP_000024392.1"; ID "nbis-exon-142"; Name "WP_000024392.1"; Parent "gene-C7A06_RS00810"; gbkey "CDS"; gene "grxC"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312515.1"; locus_tag "C7A06_RS00810"; product "glutaredoxin 3"; protein_id "WP_000024392.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	149111	149362	.	+	0	gene_id "nbis-gene-134"; transcript_id "gene-C7A06_RS00810"; Dbxref "Genbank:WP_000024392.1"; ID "cds-WP_000024392.1"; Name "WP_000024392.1"; Parent "gene-C7A06_RS00810"; gbkey "CDS"; gene "grxC"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312515.1"; locus_tag "C7A06_RS00810"; product "glutaredoxin 3"; protein_id "WP_000024392.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	149425	149892	.	+	.	gene_id "nbis-gene-135"; ID "nbis-gene-135"; Name "secB"; gbkey "Gene"; gene "secB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00815";
+NZ_CP027599.1	RefSeq	transcript	149425	149892	.	+	.	gene_id "nbis-gene-135"; transcript_id "gene-C7A06_RS00815"; ID "gene-C7A06_RS00815"; Name "secB"; Parent "nbis-gene-135"; gbkey "Gene"; gene "secB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00815"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	149425	149892	.	+	.	gene_id "nbis-gene-135"; transcript_id "gene-C7A06_RS00815"; Dbxref "Genbank:WP_000003377.1"; ID "nbis-exon-143"; Name "WP_000003377.1"; Parent "gene-C7A06_RS00815"; gbkey "CDS"; gene "secB"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_015369180.1"; locus_tag "C7A06_RS00815"; product "protein-export chaperone SecB"; protein_id "WP_000003377.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	149425	149892	.	+	0	gene_id "nbis-gene-135"; transcript_id "gene-C7A06_RS00815"; Dbxref "Genbank:WP_000003377.1"; ID "cds-WP_000003377.1"; Name "WP_000003377.1"; Parent "gene-C7A06_RS00815"; gbkey "CDS"; gene "secB"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_015369180.1"; locus_tag "C7A06_RS00815"; product "protein-export chaperone SecB"; protein_id "WP_000003377.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	149892	150911	.	+	.	gene_id "nbis-gene-136"; ID "nbis-gene-136"; Name "gpsA"; gbkey "Gene"; gene "gpsA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00820";
+NZ_CP027599.1	RefSeq	transcript	149892	150911	.	+	.	gene_id "nbis-gene-136"; transcript_id "gene-C7A06_RS00820"; ID "gene-C7A06_RS00820"; Name "gpsA"; Parent "nbis-gene-136"; gbkey "Gene"; gene "gpsA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00820"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	149892	150911	.	+	.	gene_id "nbis-gene-136"; transcript_id "gene-C7A06_RS00820"; Dbxref "Genbank:WP_001076194.1"; ID "nbis-exon-144"; Name "WP_001076194.1"; Ontology_term "GO:0006072" "GO:0004367"; Parent "gene-C7A06_RS00820"; gbkey "CDS"; gene "gpsA"; go_function "glycerol-3-phosphate dehydrogenase [NAD+] activity|0004367||IEA"; go_process "glycerol-3-phosphate metabolic process|0006072||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312513.1"; locus_tag "C7A06_RS00820"; product "NAD(P)H-dependent glycerol-3-phosphate dehydrogenase"; protein_id "WP_001076194.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	149892	150911	.	+	0	gene_id "nbis-gene-136"; transcript_id "gene-C7A06_RS00820"; Dbxref "Genbank:WP_001076194.1"; ID "cds-WP_001076194.1"; Name "WP_001076194.1"; Ontology_term "GO:0006072" "GO:0004367"; Parent "gene-C7A06_RS00820"; gbkey "CDS"; gene "gpsA"; go_function "glycerol-3-phosphate dehydrogenase [NAD+] activity|0004367||IEA"; go_process "glycerol-3-phosphate metabolic process|0006072||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312513.1"; locus_tag "C7A06_RS00820"; product "NAD(P)H-dependent glycerol-3-phosphate dehydrogenase"; protein_id "WP_001076194.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	150991	151812	.	+	.	gene_id "nbis-gene-137"; ID "nbis-gene-137"; Name "cysE"; gbkey "Gene"; gene "cysE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00825";
+NZ_CP027599.1	RefSeq	transcript	150991	151812	.	+	.	gene_id "nbis-gene-137"; transcript_id "gene-C7A06_RS00825"; ID "gene-C7A06_RS00825"; Name "cysE"; Parent "nbis-gene-137"; gbkey "Gene"; gene "cysE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00825"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	150991	151812	.	+	.	gene_id "nbis-gene-137"; transcript_id "gene-C7A06_RS00825"; Dbxref "Genbank:WP_001277561.1"; ID "nbis-exon-145"; Name "WP_001277561.1"; Ontology_term "GO:0006535" "GO:0009001"; Parent "gene-C7A06_RS00825"; gbkey "CDS"; gene "cysE"; go_function "serine O-acetyltransferase activity|0009001||IEA"; go_process "cysteine biosynthetic process from serine|0006535||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001112113.1"; locus_tag "C7A06_RS00825"; product "serine O-acetyltransferase"; protein_id "WP_001277561.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	150991	151812	.	+	0	gene_id "nbis-gene-137"; transcript_id "gene-C7A06_RS00825"; Dbxref "Genbank:WP_001277561.1"; ID "cds-WP_001277561.1"; Name "WP_001277561.1"; Ontology_term "GO:0006535" "GO:0009001"; Parent "gene-C7A06_RS00825"; gbkey "CDS"; gene "cysE"; go_function "serine O-acetyltransferase activity|0009001||IEA"; go_process "cysteine biosynthetic process from serine|0006535||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001112113.1"; locus_tag "C7A06_RS00825"; product "serine O-acetyltransferase"; protein_id "WP_001277561.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	151865	152338	.	-	.	gene_id "nbis-gene-138"; ID "nbis-gene-138"; Name "trmL"; gbkey "Gene"; gene "trmL"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00830";
+NZ_CP027599.1	RefSeq	transcript	151865	152338	.	-	.	gene_id "nbis-gene-138"; transcript_id "gene-C7A06_RS00830"; ID "gene-C7A06_RS00830"; Name "trmL"; Parent "nbis-gene-138"; gbkey "Gene"; gene "trmL"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00830"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	151865	152338	.	-	.	gene_id "nbis-gene-138"; transcript_id "gene-C7A06_RS00830"; Dbxref "Genbank:WP_000932342.1"; ID "nbis-exon-146"; Name "WP_000932342.1"; Ontology_term "GO:0001510" "GO:0008173"; Parent "gene-C7A06_RS00830"; gbkey "CDS"; gene "trmL"; go_function "RNA methyltransferase activity|0008173||IEA"; go_process "RNA methylation|0001510||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312511.1"; locus_tag "C7A06_RS00830"; product "tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL"; protein_id "WP_000932342.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	151865	152338	.	-	0	gene_id "nbis-gene-138"; transcript_id "gene-C7A06_RS00830"; Dbxref "Genbank:WP_000932342.1"; ID "cds-WP_000932342.1"; Name "WP_000932342.1"; Ontology_term "GO:0001510" "GO:0008173"; Parent "gene-C7A06_RS00830"; gbkey "CDS"; gene "trmL"; go_function "RNA methyltransferase activity|0008173||IEA"; go_process "RNA methylation|0001510||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312511.1"; locus_tag "C7A06_RS00830"; product "tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL"; protein_id "WP_000932342.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	152524	153714	.	-	.	gene_id "nbis-gene-139"; ID "nbis-gene-139"; Name "lldD"; gbkey "Gene"; gene "lldD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00835";
+NZ_CP027599.1	RefSeq	transcript	152524	153714	.	-	.	gene_id "nbis-gene-139"; transcript_id "gene-C7A06_RS00835"; ID "gene-C7A06_RS00835"; Name "lldD"; Parent "nbis-gene-139"; gbkey "Gene"; gene "lldD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00835"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	152524	153714	.	-	.	gene_id "nbis-gene-139"; transcript_id "gene-C7A06_RS00835"; Dbxref "Genbank:WP_000586964.1"; ID "nbis-exon-147"; Name "WP_000586964.1"; Parent "gene-C7A06_RS00835"; gbkey "CDS"; gene "lldD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312510.1"; locus_tag "C7A06_RS00835"; product "quinone-dependent L-lactate dehydrogenase"; protein_id "WP_000586964.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	152524	153714	.	-	0	gene_id "nbis-gene-139"; transcript_id "gene-C7A06_RS00835"; Dbxref "Genbank:WP_000586964.1"; ID "cds-WP_000586964.1"; Name "WP_000586964.1"; Parent "gene-C7A06_RS00835"; gbkey "CDS"; gene "lldD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312510.1"; locus_tag "C7A06_RS00835"; product "quinone-dependent L-lactate dehydrogenase"; protein_id "WP_000586964.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	153711	154487	.	-	.	gene_id "nbis-gene-140"; ID "nbis-gene-140"; Name "lldR"; gbkey "Gene"; gene "lldR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00840";
+NZ_CP027599.1	RefSeq	transcript	153711	154487	.	-	.	gene_id "nbis-gene-140"; transcript_id "gene-C7A06_RS00840"; ID "gene-C7A06_RS00840"; Name "lldR"; Parent "nbis-gene-140"; gbkey "Gene"; gene "lldR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00840"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	153711	154487	.	-	.	gene_id "nbis-gene-140"; transcript_id "gene-C7A06_RS00840"; Dbxref "Genbank:WP_000636500.1"; ID "nbis-exon-148"; Name "WP_000636500.1"; Ontology_term "GO:0006355" "GO:0003700"; Parent "gene-C7A06_RS00840"; gbkey "CDS"; gene "lldR"; go_function "DNA-binding transcription factor activity|0003700||IEA"; go_process "regulation of transcription, DNA-templated|0006355||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418061.1"; locus_tag "C7A06_RS00840"; product "transcriptional regulator LldR"; protein_id "WP_000636500.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	153711	154487	.	-	0	gene_id "nbis-gene-140"; transcript_id "gene-C7A06_RS00840"; Dbxref "Genbank:WP_000636500.1"; ID "cds-WP_000636500.1"; Name "WP_000636500.1"; Ontology_term "GO:0006355" "GO:0003700"; Parent "gene-C7A06_RS00840"; gbkey "CDS"; gene "lldR"; go_function "DNA-binding transcription factor activity|0003700||IEA"; go_process "regulation of transcription, DNA-templated|0006355||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418061.1"; locus_tag "C7A06_RS00840"; product "transcriptional regulator LldR"; protein_id "WP_000636500.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	154487	156142	.	-	.	gene_id "nbis-gene-141"; ID "nbis-gene-141"; Name "lldP"; gbkey "Gene"; gene "lldP"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00845";
+NZ_CP027599.1	RefSeq	transcript	154487	156142	.	-	.	gene_id "nbis-gene-141"; transcript_id "gene-C7A06_RS00845"; ID "gene-C7A06_RS00845"; Name "lldP"; Parent "nbis-gene-141"; gbkey "Gene"; gene "lldP"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00845"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	154487	156142	.	-	.	gene_id "nbis-gene-141"; transcript_id "gene-C7A06_RS00845"; Dbxref "Genbank:WP_001297977.1"; ID "nbis-exon-149"; Name "WP_001297977.1"; Ontology_term "GO:0015727" "GO:0015129" "GO:0005887"; Parent "gene-C7A06_RS00845"; gbkey "CDS"; gene "lldP"; go_component "integral component of plasma membrane|0005887||IEA"; go_function "lactate transmembrane transporter activity|0015129||IEA"; go_process "lactate transport|0015727||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312508.1"; locus_tag "C7A06_RS00845"; product "L-lactate permease"; protein_id "WP_001297977.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	154487	156142	.	-	0	gene_id "nbis-gene-141"; transcript_id "gene-C7A06_RS00845"; Dbxref "Genbank:WP_001297977.1"; ID "cds-WP_001297977.1"; Name "WP_001297977.1"; Ontology_term "GO:0015727" "GO:0015129" "GO:0005887"; Parent "gene-C7A06_RS00845"; gbkey "CDS"; gene "lldP"; go_component "integral component of plasma membrane|0005887||IEA"; go_function "lactate transmembrane transporter activity|0015129||IEA"; go_process "lactate transport|0015727||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312508.1"; locus_tag "C7A06_RS00845"; product "L-lactate permease"; protein_id "WP_001297977.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	156511	161361	.	-	.	gene_id "nbis-gene-142"; ID "nbis-gene-142"; Name "ehaG"; gbkey "Gene"; gene "ehaG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00855";
+NZ_CP027599.1	RefSeq	transcript	156511	161361	.	-	.	gene_id "nbis-gene-142"; transcript_id "gene-C7A06_RS00855"; ID "gene-C7A06_RS00855"; Name "ehaG"; Parent "nbis-gene-142"; gbkey "Gene"; gene "ehaG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00855"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	156511	161361	.	-	.	gene_id "nbis-gene-142"; transcript_id "gene-C7A06_RS00855"; Dbxref "Genbank:WP_001033225.1"; ID "nbis-exon-150"; Name "WP_001033225.1"; Parent "gene-C7A06_RS00855"; gbkey "CDS"; gene "ehaG"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312507.1"; locus_tag "C7A06_RS00855"; product "trimeric autotransporter adhesin EhaG"; protein_id "WP_001033225.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	156511	161361	.	-	0	gene_id "nbis-gene-142"; transcript_id "gene-C7A06_RS00855"; Dbxref "Genbank:WP_001033225.1"; ID "cds-WP_001033225.1"; Name "WP_001033225.1"; Parent "gene-C7A06_RS00855"; gbkey "CDS"; gene "ehaG"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312507.1"; locus_tag "C7A06_RS00855"; product "trimeric autotransporter adhesin EhaG"; protein_id "WP_001033225.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	161361	162089	.	-	.	gene_id "nbis-gene-143"; ID "nbis-gene-143"; Name "C7A06_RS00860"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00860";
+NZ_CP027599.1	RefSeq	transcript	161361	162089	.	-	.	gene_id "nbis-gene-143"; transcript_id "gene-C7A06_RS00860"; ID "gene-C7A06_RS00860"; Name "C7A06_RS00860"; Parent "nbis-gene-143"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00860"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	161361	162089	.	-	.	gene_id "nbis-gene-143"; transcript_id "gene-C7A06_RS00860"; Dbxref "Genbank:WP_001049540.1"; ID "nbis-exon-151"; Name "WP_001049540.1"; Parent "gene-C7A06_RS00860"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001049551.1"; locus_tag "C7A06_RS00860"; product "DUF3251 domain-containing protein"; protein_id "WP_001049540.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	161361	162089	.	-	0	gene_id "nbis-gene-143"; transcript_id "gene-C7A06_RS00860"; Dbxref "Genbank:WP_001049540.1"; ID "cds-WP_001049540.1"; Name "WP_001049540.1"; Parent "gene-C7A06_RS00860"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001049551.1"; locus_tag "C7A06_RS00860"; product "DUF3251 domain-containing protein"; protein_id "WP_001049540.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	162632	162994	.	-	.	gene_id "nbis-gene-144"; ID "nbis-gene-144"; Name "yibL"; gbkey "Gene"; gene "yibL"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00870";
+NZ_CP027599.1	RefSeq	transcript	162632	162994	.	-	.	gene_id "nbis-gene-144"; transcript_id "gene-C7A06_RS00870"; ID "gene-C7A06_RS00870"; Name "yibL"; Parent "nbis-gene-144"; gbkey "Gene"; gene "yibL"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00870"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	162632	162994	.	-	.	gene_id "nbis-gene-144"; transcript_id "gene-C7A06_RS00870"; Dbxref "Genbank:WP_000665680.1"; ID "nbis-exon-152"; Name "WP_000665680.1"; Parent "gene-C7A06_RS00870"; gbkey "CDS"; gene "yibL"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312505.1"; locus_tag "C7A06_RS00870"; product "YibL family ribosome-associated protein"; protein_id "WP_000665680.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	162632	162994	.	-	0	gene_id "nbis-gene-144"; transcript_id "gene-C7A06_RS00870"; Dbxref "Genbank:WP_000665680.1"; ID "cds-WP_000665680.1"; Name "WP_000665680.1"; Parent "gene-C7A06_RS00870"; gbkey "CDS"; gene "yibL"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312505.1"; locus_tag "C7A06_RS00870"; product "YibL family ribosome-associated protein"; protein_id "WP_000665680.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	163279	163488	.	+	.	gene_id "nbis-gene-145"; ID "nbis-gene-145"; Name "C7A06_RS00875"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00875";
+NZ_CP027599.1	RefSeq	transcript	163279	163488	.	+	.	gene_id "nbis-gene-145"; transcript_id "gene-C7A06_RS00875"; ID "gene-C7A06_RS00875"; Name "C7A06_RS00875"; Parent "nbis-gene-145"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00875"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	163279	163488	.	+	.	gene_id "nbis-gene-145"; transcript_id "gene-C7A06_RS00875"; Dbxref "Genbank:WP_000517100.1"; ID "nbis-exon-153"; Name "WP_000517100.1"; Parent "gene-C7A06_RS00875"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_588470.1"; locus_tag "C7A06_RS00875"; product "hypothetical protein"; protein_id "WP_000517100.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	163279	163488	.	+	0	gene_id "nbis-gene-145"; transcript_id "gene-C7A06_RS00875"; Dbxref "Genbank:WP_000517100.1"; ID "cds-WP_000517100.1"; Name "WP_000517100.1"; Parent "gene-C7A06_RS00875"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_588470.1"; locus_tag "C7A06_RS00875"; product "hypothetical protein"; protein_id "WP_000517100.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	163500	164087	.	-	.	gene_id "nbis-gene-146"; ID "nbis-gene-146"; Name "mtlR"; gbkey "Gene"; gene "mtlR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00880";
+NZ_CP027599.1	RefSeq	transcript	163500	164087	.	-	.	gene_id "nbis-gene-146"; transcript_id "gene-C7A06_RS00880"; ID "gene-C7A06_RS00880"; Name "mtlR"; Parent "nbis-gene-146"; gbkey "Gene"; gene "mtlR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00880"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	163500	164087	.	-	.	gene_id "nbis-gene-146"; transcript_id "gene-C7A06_RS00880"; Dbxref "Genbank:WP_000228271.1"; ID "nbis-exon-154"; Name "WP_000228271.1"; Parent "gene-C7A06_RS00880"; gbkey "CDS"; gene "mtlR"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312504.1"; locus_tag "C7A06_RS00880"; product "mannitol operon repressor MtlR"; protein_id "WP_000228271.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	163500	164087	.	-	0	gene_id "nbis-gene-146"; transcript_id "gene-C7A06_RS00880"; Dbxref "Genbank:WP_000228271.1"; ID "cds-WP_000228271.1"; Name "WP_000228271.1"; Parent "gene-C7A06_RS00880"; gbkey "CDS"; gene "mtlR"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312504.1"; locus_tag "C7A06_RS00880"; product "mannitol operon repressor MtlR"; protein_id "WP_000228271.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	164087	165235	.	-	.	gene_id "nbis-gene-147"; ID "nbis-gene-147"; Name "mtlD"; gbkey "Gene"; gene "mtlD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00885";
+NZ_CP027599.1	RefSeq	transcript	164087	165235	.	-	.	gene_id "nbis-gene-147"; transcript_id "gene-C7A06_RS00885"; ID "gene-C7A06_RS00885"; Name "mtlD"; Parent "nbis-gene-147"; gbkey "Gene"; gene "mtlD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00885"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	164087	165235	.	-	.	gene_id "nbis-gene-147"; transcript_id "gene-C7A06_RS00885"; Dbxref "Genbank:WP_000645424.1"; ID "nbis-exon-155"; Name "WP_000645424.1"; Ontology_term "GO:0019594" "GO:0008926"; Parent "gene-C7A06_RS00885"; gbkey "CDS"; gene "mtlD"; go_function "mannitol-1-phosphate 5-dehydrogenase activity|0008926||IEA"; go_process "mannitol metabolic process|0019594||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709374.2"; locus_tag "C7A06_RS00885"; product "mannitol-1-phosphate 5-dehydrogenase"; protein_id "WP_000645424.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	164087	165235	.	-	0	gene_id "nbis-gene-147"; transcript_id "gene-C7A06_RS00885"; Dbxref "Genbank:WP_000645424.1"; ID "cds-WP_000645424.1"; Name "WP_000645424.1"; Ontology_term "GO:0019594" "GO:0008926"; Parent "gene-C7A06_RS00885"; gbkey "CDS"; gene "mtlD"; go_function "mannitol-1-phosphate 5-dehydrogenase activity|0008926||IEA"; go_process "mannitol metabolic process|0019594||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709374.2"; locus_tag "C7A06_RS00885"; product "mannitol-1-phosphate 5-dehydrogenase"; protein_id "WP_000645424.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	165465	167378	.	-	.	gene_id "nbis-gene-148"; ID "nbis-gene-148"; Name "mtlA"; gbkey "Gene"; gene "mtlA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00890";
+NZ_CP027599.1	RefSeq	transcript	165465	167378	.	-	.	gene_id "nbis-gene-148"; transcript_id "gene-C7A06_RS00890"; ID "gene-C7A06_RS00890"; Name "mtlA"; Parent "nbis-gene-148"; gbkey "Gene"; gene "mtlA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00890"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	165465	167378	.	-	.	gene_id "nbis-gene-148"; transcript_id "gene-C7A06_RS00890"; Dbxref "Genbank:WP_000093261.1"; ID "nbis-exon-156"; Name "WP_000093261.1"; Parent "gene-C7A06_RS00890"; gbkey "CDS"; gene "mtlA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709373.1"; locus_tag "C7A06_RS00890"; product "PTS mannitol transporter subunit IICBA"; protein_id "WP_000093261.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	165465	167378	.	-	0	gene_id "nbis-gene-148"; transcript_id "gene-C7A06_RS00890"; Dbxref "Genbank:WP_000093261.1"; ID "cds-WP_000093261.1"; Name "WP_000093261.1"; Parent "gene-C7A06_RS00890"; gbkey "CDS"; gene "mtlA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709373.1"; locus_tag "C7A06_RS00890"; product "PTS mannitol transporter subunit IICBA"; protein_id "WP_000093261.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	167915	168277	.	+	.	gene_id "nbis-gene-149"; ID "nbis-gene-149"; Name "yibI"; gbkey "Gene"; gene "yibI"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00895";
+NZ_CP027599.1	RefSeq	transcript	167915	168277	.	+	.	gene_id "nbis-gene-149"; transcript_id "gene-C7A06_RS00895"; ID "gene-C7A06_RS00895"; Name "yibI"; Parent "nbis-gene-149"; gbkey "Gene"; gene "yibI"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00895"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	167915	168277	.	+	.	gene_id "nbis-gene-149"; transcript_id "gene-C7A06_RS00895"; Dbxref "Genbank:WP_000479624.1"; ID "nbis-exon-157"; Name "WP_000479624.1"; Parent "gene-C7A06_RS00895"; gbkey "CDS"; gene "yibI"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418055.1"; locus_tag "C7A06_RS00895"; product "DUF3302 domain-containing protein"; protein_id "WP_000479624.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	167915	168277	.	+	0	gene_id "nbis-gene-149"; transcript_id "gene-C7A06_RS00895"; Dbxref "Genbank:WP_000479624.1"; ID "cds-WP_000479624.1"; Name "WP_000479624.1"; Parent "gene-C7A06_RS00895"; gbkey "CDS"; gene "yibI"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418055.1"; locus_tag "C7A06_RS00895"; product "DUF3302 domain-containing protein"; protein_id "WP_000479624.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	168280	169346	.	+	.	gene_id "nbis-pseudogene-9"; ID "nbis-pseudogene-9"; Name "yibH"; gbkey "Gene"; gene "yibH"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00900"; original_biotype "pseudogene"; pseudo "true";
+NZ_CP027599.1	RefSeq	transcript	168280	169346	.	+	.	gene_id "nbis-pseudogene-9"; transcript_id "gene-C7A06_RS00900"; ID "gene-C7A06_RS00900"; Name "yibH"; Parent "nbis-pseudogene-9"; gbkey "Gene"; gene "yibH"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00900"; original_biotype "mrna"; pseudo "true";
+NZ_CP027599.1	Protein Homology	exon	168280	169346	.	+	.	gene_id "nbis-pseudogene-9"; transcript_id "gene-C7A06_RS00900"; ID "nbis-exon-158"; Note "frameshifted"; Parent "gene-C7A06_RS00900"; gbkey "CDS"; gene "yibH"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312500.1"; locus_tag "C7A06_RS00900"; product "HlyD family secretion protein"; pseudo "true"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	168280	169346	.	+	0	gene_id "nbis-pseudogene-9"; transcript_id "gene-C7A06_RS00900"; ID "cds-C7A06_RS00900"; Note "frameshifted"; Parent "gene-C7A06_RS00900"; gbkey "CDS"; gene "yibH"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312500.1"; locus_tag "C7A06_RS00900"; product "HlyD family secretion protein"; pseudo "true"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	169806	170315	.	-	.	gene_id "nbis-gene-150"; ID "nbis-gene-150"; Name "C7A06_RS00905"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00905";
+NZ_CP027599.1	RefSeq	transcript	169806	170315	.	-	.	gene_id "nbis-gene-150"; transcript_id "gene-C7A06_RS00905"; ID "gene-C7A06_RS00905"; Name "C7A06_RS00905"; Parent "nbis-gene-150"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00905"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	169806	170315	.	-	.	gene_id "nbis-gene-150"; transcript_id "gene-C7A06_RS00905"; Dbxref "Genbank:WP_236917825.1"; ID "nbis-exon-159"; Name "WP_236917825.1"; Parent "gene-C7A06_RS00905"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_016158939.1"; locus_tag "C7A06_RS00905"; product "Imm57 family immunity protein"; protein_id "WP_236917825.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	169806	170315	.	-	0	gene_id "nbis-gene-150"; transcript_id "gene-C7A06_RS00905"; Dbxref "Genbank:WP_236917825.1"; ID "cds-WP_236917825.1"; Name "WP_236917825.1"; Parent "gene-C7A06_RS00905"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_016158939.1"; locus_tag "C7A06_RS00905"; product "Imm57 family immunity protein"; protein_id "WP_236917825.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	170950	171411	.	-	.	gene_id "nbis-gene-151"; ID "nbis-gene-151"; Name "yibG"; gbkey "Gene"; gene "yibG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00920";
+NZ_CP027599.1	RefSeq	transcript	170950	171411	.	-	.	gene_id "nbis-gene-151"; transcript_id "gene-C7A06_RS00920"; ID "gene-C7A06_RS00920"; Name "yibG"; Parent "nbis-gene-151"; gbkey "Gene"; gene "yibG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00920"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	170950	171411	.	-	.	gene_id "nbis-gene-151"; transcript_id "gene-C7A06_RS00920"; Dbxref "Genbank:WP_000642489.1"; ID "nbis-exon-160"; Name "WP_000642489.1"; Parent "gene-C7A06_RS00920"; gbkey "CDS"; gene "yibG"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418053.1"; locus_tag "C7A06_RS00920"; product "sel1 repeat family protein"; protein_id "WP_000642489.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	170950	171411	.	-	0	gene_id "nbis-gene-151"; transcript_id "gene-C7A06_RS00920"; Dbxref "Genbank:WP_000642489.1"; ID "cds-WP_000642489.1"; Name "WP_000642489.1"; Parent "gene-C7A06_RS00920"; gbkey "CDS"; gene "yibG"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418053.1"; locus_tag "C7A06_RS00920"; product "sel1 repeat family protein"; protein_id "WP_000642489.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	171423	172381	.	-	.	gene_id "nbis-pseudogene-281"; ID "nbis-pseudogene-281"; Name "C7A06_RS33910"; end_range "172381" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33910"; original_biotype "pseudogene"; partial "true"; pseudo "true";
+NZ_CP027599.1	RefSeq	transcript	171423	172381	.	-	.	gene_id "nbis-pseudogene-281"; transcript_id "gene-C7A06_RS33910"; ID "gene-C7A06_RS33910"; Name "C7A06_RS33910"; Parent "nbis-pseudogene-281"; end_range "172381" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33910"; original_biotype "mrna"; partial "true"; pseudo "true";
+NZ_CP027599.1	Protein Homology	exon	171423	172381	.	-	.	gene_id "nbis-pseudogene-281"; transcript_id "gene-C7A06_RS33910"; ID "nbis-exon-5988"; Note "frameshifted; incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS33910"; end_range "172381" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312497.1"; locus_tag "C7A06_RS33910"; partial "true"; product "RHS domain-containing protein"; pseudo "true"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	171423	172381	.	-	0	gene_id "nbis-pseudogene-281"; transcript_id "gene-C7A06_RS33910"; ID "cds-C7A06_RS33910"; Note "frameshifted; incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS33910"; end_range "172381" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312497.1"; locus_tag "C7A06_RS33910"; partial "true"; product "RHS domain-containing protein"; pseudo "true"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	172409	173251	.	-	.	gene_id "nbis-gene-152"; ID "nbis-gene-152"; Name "yibA"; gbkey "Gene"; gene "yibA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00930";
+NZ_CP027599.1	RefSeq	transcript	172409	173251	.	-	.	gene_id "nbis-gene-152"; transcript_id "gene-C7A06_RS00930"; ID "gene-C7A06_RS00930"; Name "yibA"; Parent "nbis-gene-152"; gbkey "Gene"; gene "yibA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00930"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	172409	173251	.	-	.	gene_id "nbis-gene-152"; transcript_id "gene-C7A06_RS00930"; Dbxref "Genbank:WP_000072850.1"; ID "nbis-exon-161"; Name "WP_000072850.1"; Parent "gene-C7A06_RS00930"; gbkey "CDS"; gene "yibA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418051.1"; locus_tag "C7A06_RS00930"; product "HEAT repeat domain-containing protein"; protein_id "WP_000072850.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	172409	173251	.	-	0	gene_id "nbis-gene-152"; transcript_id "gene-C7A06_RS00930"; Dbxref "Genbank:WP_000072850.1"; ID "cds-WP_000072850.1"; Name "WP_000072850.1"; Parent "gene-C7A06_RS00930"; gbkey "CDS"; gene "yibA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418051.1"; locus_tag "C7A06_RS00930"; product "HEAT repeat domain-containing protein"; protein_id "WP_000072850.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	173272	177393	.	-	.	gene_id "nbis-gene-153"; ID "nbis-gene-153"; Name "C7A06_RS00935"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00935";
+NZ_CP027599.1	RefSeq	transcript	173272	177393	.	-	.	gene_id "nbis-gene-153"; transcript_id "gene-C7A06_RS00935"; ID "gene-C7A06_RS00935"; Name "C7A06_RS00935"; Parent "nbis-gene-153"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00935"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	173272	177393	.	-	.	gene_id "nbis-gene-153"; transcript_id "gene-C7A06_RS00935"; Dbxref "Genbank:WP_000015217.1"; ID "nbis-exon-162"; Name "WP_000015217.1"; Parent "gene-C7A06_RS00935"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418050.1"; locus_tag "C7A06_RS00935"; product "polymorphic toxin type 34 domain-containing protein"; protein_id "WP_000015217.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	173272	177393	.	-	0	gene_id "nbis-gene-153"; transcript_id "gene-C7A06_RS00935"; Dbxref "Genbank:WP_000015217.1"; ID "cds-WP_000015217.1"; Name "WP_000015217.1"; Parent "gene-C7A06_RS00935"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418050.1"; locus_tag "C7A06_RS00935"; product "polymorphic toxin type 34 domain-containing protein"; protein_id "WP_000015217.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	177622	178230	.	+	.	gene_id "nbis-gene-154"; ID "nbis-gene-154"; Name "yibF"; gbkey "Gene"; gene "yibF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00940";
+NZ_CP027599.1	RefSeq	transcript	177622	178230	.	+	.	gene_id "nbis-gene-154"; transcript_id "gene-C7A06_RS00940"; ID "gene-C7A06_RS00940"; Name "yibF"; Parent "nbis-gene-154"; gbkey "Gene"; gene "yibF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00940"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	177622	178230	.	+	.	gene_id "nbis-gene-154"; transcript_id "gene-C7A06_RS00940"; Dbxref "Genbank:WP_000779792.1"; ID "nbis-exon-163"; Name "WP_000779792.1"; Ontology_term "GO:0006749" "GO:0005515"; Parent "gene-C7A06_RS00940"; gbkey "CDS"; gene "yibF"; go_function "protein binding|0005515||IEA"; go_process "glutathione metabolic process|0006749||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418049.1"; locus_tag "C7A06_RS00940"; product "glutathione S-transferase"; protein_id "WP_000779792.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	177622	178230	.	+	0	gene_id "nbis-gene-154"; transcript_id "gene-C7A06_RS00940"; Dbxref "Genbank:WP_000779792.1"; ID "cds-WP_000779792.1"; Name "WP_000779792.1"; Ontology_term "GO:0006749" "GO:0005515"; Parent "gene-C7A06_RS00940"; gbkey "CDS"; gene "yibF"; go_function "protein binding|0005515||IEA"; go_process "glutathione metabolic process|0006749||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418049.1"; locus_tag "C7A06_RS00940"; product "glutathione S-transferase"; protein_id "WP_000779792.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	178328	179719	.	+	.	gene_id "nbis-gene-155"; ID "nbis-gene-155"; Name "selA"; gbkey "Gene"; gene "selA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00945";
+NZ_CP027599.1	RefSeq	transcript	178328	179719	.	+	.	gene_id "nbis-gene-155"; transcript_id "gene-C7A06_RS00945"; ID "gene-C7A06_RS00945"; Name "selA"; Parent "nbis-gene-155"; gbkey "Gene"; gene "selA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00945"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	178328	179719	.	+	.	gene_id "nbis-gene-155"; transcript_id "gene-C7A06_RS00945"; Dbxref "Genbank:WP_000206271.1"; ID "nbis-exon-164"; Name "WP_000206271.1"; Ontology_term "GO:0016260" "GO:0004125"; Parent "gene-C7A06_RS00945"; gbkey "CDS"; gene "selA"; go_function "L-seryl-tRNASec selenium transferase activity|0004125||IEA"; go_process "selenocysteine biosynthetic process|0016260||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312495.1"; locus_tag "C7A06_RS00945"; product "L-seryl-tRNA(Sec) selenium transferase"; protein_id "WP_000206271.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	178328	179719	.	+	0	gene_id "nbis-gene-155"; transcript_id "gene-C7A06_RS00945"; Dbxref "Genbank:WP_000206271.1"; ID "cds-WP_000206271.1"; Name "WP_000206271.1"; Ontology_term "GO:0016260" "GO:0004125"; Parent "gene-C7A06_RS00945"; gbkey "CDS"; gene "selA"; go_function "L-seryl-tRNASec selenium transferase activity|0004125||IEA"; go_process "selenocysteine biosynthetic process|0016260||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312495.1"; locus_tag "C7A06_RS00945"; product "L-seryl-tRNA(Sec) selenium transferase"; protein_id "WP_000206271.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	179716	181560	.	+	.	gene_id "nbis-gene-156"; ID "nbis-gene-156"; Name "selB"; gbkey "Gene"; gene "selB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00950";
+NZ_CP027599.1	RefSeq	transcript	179716	181560	.	+	.	gene_id "nbis-gene-156"; transcript_id "gene-C7A06_RS00950"; ID "gene-C7A06_RS00950"; Name "selB"; Parent "nbis-gene-156"; gbkey "Gene"; gene "selB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00950"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	179716	181560	.	+	.	gene_id "nbis-gene-156"; transcript_id "gene-C7A06_RS00950"; Dbxref "Genbank:WP_000582492.1"; ID "nbis-exon-165"; Name "WP_000582492.1"; Ontology_term "GO:0001514" "GO:0003723" "GO:0003746" "GO:0003924" "GO:0005525"; Parent "gene-C7A06_RS00950"; gbkey "CDS"; gene "selB"; go_function "RNA binding|0003723||IEA" "translation elongation factor activity|0003746||IEA" "GTPase activity|0003924||IEA" "GTP binding|0005525||IEA"; go_process "selenocysteine incorporation|0001514||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418047.1"; locus_tag "C7A06_RS00950"; product "selenocysteine-specific translation elongation factor"; protein_id "WP_000582492.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	179716	181560	.	+	0	gene_id "nbis-gene-156"; transcript_id "gene-C7A06_RS00950"; Dbxref "Genbank:WP_000582492.1"; ID "cds-WP_000582492.1"; Name "WP_000582492.1"; Ontology_term "GO:0001514" "GO:0003723" "GO:0003746" "GO:0003924" "GO:0005525"; Parent "gene-C7A06_RS00950"; gbkey "CDS"; gene "selB"; go_function "RNA binding|0003723||IEA" "translation elongation factor activity|0003746||IEA" "GTPase activity|0003924||IEA" "GTP binding|0005525||IEA"; go_process "selenocysteine incorporation|0001514||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418047.1"; locus_tag "C7A06_RS00950"; product "selenocysteine-specific translation elongation factor"; protein_id "WP_000582492.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	181750	182901	.	+	.	gene_id "nbis-gene-157"; ID "nbis-gene-157"; Name "yiaY"; gbkey "Gene"; gene "yiaY"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00955";
+NZ_CP027599.1	RefSeq	transcript	181750	182901	.	+	.	gene_id "nbis-gene-157"; transcript_id "gene-C7A06_RS00955"; ID "gene-C7A06_RS00955"; Name "yiaY"; Parent "nbis-gene-157"; gbkey "Gene"; gene "yiaY"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00955"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	181750	182901	.	+	.	gene_id "nbis-gene-157"; transcript_id "gene-C7A06_RS00955"; Dbxref "Genbank:WP_000168712.1"; ID "nbis-exon-166"; Name "WP_000168712.1"; Ontology_term "GO:0016491"; Parent "gene-C7A06_RS00955"; gbkey "CDS"; gene "yiaY"; go_function "oxidoreductase activity|0016491||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312493.1"; locus_tag "C7A06_RS00955"; product "L-threonine dehydrogenase"; protein_id "WP_000168712.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	181750	182901	.	+	0	gene_id "nbis-gene-157"; transcript_id "gene-C7A06_RS00955"; Dbxref "Genbank:WP_000168712.1"; ID "cds-WP_000168712.1"; Name "WP_000168712.1"; Ontology_term "GO:0016491"; Parent "gene-C7A06_RS00955"; gbkey "CDS"; gene "yiaY"; go_function "oxidoreductase activity|0016491||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312493.1"; locus_tag "C7A06_RS00955"; product "L-threonine dehydrogenase"; protein_id "WP_000168712.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	183066	184604	.	+	.	gene_id "nbis-gene-158"; ID "nbis-gene-158"; Name "aldB"; gbkey "Gene"; gene "aldB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00960";
+NZ_CP027599.1	RefSeq	transcript	183066	184604	.	+	.	gene_id "nbis-gene-158"; transcript_id "gene-C7A06_RS00960"; ID "gene-C7A06_RS00960"; Name "aldB"; Parent "nbis-gene-158"; gbkey "Gene"; gene "aldB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00960"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	183066	184604	.	+	.	gene_id "nbis-gene-158"; transcript_id "gene-C7A06_RS00960"; Dbxref "Genbank:WP_000183978.1"; ID "nbis-exon-167"; Name "WP_000183978.1"; Parent "gene-C7A06_RS00960"; gbkey "CDS"; gene "aldB"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001551836.1"; locus_tag "C7A06_RS00960"; product "aldehyde dehydrogenase AldB"; protein_id "WP_000183978.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	183066	184604	.	+	0	gene_id "nbis-gene-158"; transcript_id "gene-C7A06_RS00960"; Dbxref "Genbank:WP_000183978.1"; ID "cds-WP_000183978.1"; Name "WP_000183978.1"; Parent "gene-C7A06_RS00960"; gbkey "CDS"; gene "aldB"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001551836.1"; locus_tag "C7A06_RS00960"; product "aldehyde dehydrogenase AldB"; protein_id "WP_000183978.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	184823	184987	.	-	.	gene_id "nbis-gene-159"; ID "nbis-gene-159"; Name "C7A06_RS00965"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00965";
+NZ_CP027599.1	RefSeq	transcript	184823	184987	.	-	.	gene_id "nbis-gene-159"; transcript_id "gene-C7A06_RS00965"; ID "gene-C7A06_RS00965"; Name "C7A06_RS00965"; Parent "nbis-gene-159"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00965"; original_biotype "mrna";
+NZ_CP027599.1	GeneMarkS-2+	exon	184823	184987	.	-	.	gene_id "nbis-gene-159"; transcript_id "gene-C7A06_RS00965"; Dbxref "Genbank:WP_001375509.1"; ID "nbis-exon-168"; Name "WP_001375509.1"; Parent "gene-C7A06_RS00965"; gbkey "CDS"; inference "COORDINATES: ab initio prediction:GeneMarkS-2+"; locus_tag "C7A06_RS00965"; product "hypothetical protein"; protein_id "WP_001375509.1"; transl_table "11";
+NZ_CP027599.1	GeneMarkS-2+	CDS	184823	184987	.	-	0	gene_id "nbis-gene-159"; transcript_id "gene-C7A06_RS00965"; Dbxref "Genbank:WP_001375509.1"; ID "cds-WP_001375509.1"; Name "WP_001375509.1"; Parent "gene-C7A06_RS00965"; gbkey "CDS"; inference "COORDINATES: ab initio prediction:GeneMarkS-2+"; locus_tag "C7A06_RS00965"; product "hypothetical protein"; protein_id "WP_001375509.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	185169	185471	.	+	.	gene_id "nbis-gene-160"; ID "nbis-gene-160"; Name "yiaW"; gbkey "Gene"; gene "yiaW"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00975";
+NZ_CP027599.1	RefSeq	transcript	185169	185471	.	+	.	gene_id "nbis-gene-160"; transcript_id "gene-C7A06_RS00975"; ID "gene-C7A06_RS00975"; Name "yiaW"; Parent "nbis-gene-160"; gbkey "Gene"; gene "yiaW"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00975"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	185169	185471	.	+	.	gene_id "nbis-gene-160"; transcript_id "gene-C7A06_RS00975"; Dbxref "Genbank:WP_032348558.1"; ID "nbis-exon-169"; Name "WP_032348558.1"; Parent "gene-C7A06_RS00975"; gbkey "CDS"; gene "yiaW"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312490.1"; locus_tag "C7A06_RS00975"; product "DUF3302 domain-containing protein"; protein_id "WP_032348558.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	185169	185471	.	+	0	gene_id "nbis-gene-160"; transcript_id "gene-C7A06_RS00975"; Dbxref "Genbank:WP_032348558.1"; ID "cds-WP_032348558.1"; Name "WP_032348558.1"; Parent "gene-C7A06_RS00975"; gbkey "CDS"; gene "yiaW"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312490.1"; locus_tag "C7A06_RS00975"; product "DUF3302 domain-containing protein"; protein_id "WP_032348558.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	185477	186613	.	+	.	gene_id "nbis-gene-161"; ID "nbis-gene-161"; Name "yiaV"; gbkey "Gene"; gene "yiaV"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00980";
+NZ_CP027599.1	RefSeq	transcript	185477	186613	.	+	.	gene_id "nbis-gene-161"; transcript_id "gene-C7A06_RS00980"; ID "gene-C7A06_RS00980"; Name "yiaV"; Parent "nbis-gene-161"; gbkey "Gene"; gene "yiaV"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00980"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	185477	186613	.	+	.	gene_id "nbis-gene-161"; transcript_id "gene-C7A06_RS00980"; Dbxref "Genbank:WP_000364874.1"; ID "nbis-exon-170"; Name "WP_000364874.1"; Parent "gene-C7A06_RS00980"; gbkey "CDS"; gene "yiaV"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418043.1"; locus_tag "C7A06_RS00980"; product "HlyD family secretion protein"; protein_id "WP_000364874.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	185477	186613	.	+	0	gene_id "nbis-gene-161"; transcript_id "gene-C7A06_RS00980"; Dbxref "Genbank:WP_000364874.1"; ID "cds-WP_000364874.1"; Name "WP_000364874.1"; Parent "gene-C7A06_RS00980"; gbkey "CDS"; gene "yiaV"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418043.1"; locus_tag "C7A06_RS00980"; product "HlyD family secretion protein"; protein_id "WP_000364874.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	186610	187584	.	-	.	gene_id "nbis-gene-162"; ID "nbis-gene-162"; Name "yiaU"; gbkey "Gene"; gene "yiaU"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00985";
+NZ_CP027599.1	RefSeq	transcript	186610	187584	.	-	.	gene_id "nbis-gene-162"; transcript_id "gene-C7A06_RS00985"; ID "gene-C7A06_RS00985"; Name "yiaU"; Parent "nbis-gene-162"; gbkey "Gene"; gene "yiaU"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00985"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	186610	187584	.	-	.	gene_id "nbis-gene-162"; transcript_id "gene-C7A06_RS00985"; Dbxref "Genbank:WP_000164036.1"; ID "nbis-exon-171"; Name "WP_000164036.1"; Parent "gene-C7A06_RS00985"; gbkey "CDS"; gene "yiaU"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418042.1"; locus_tag "C7A06_RS00985"; product "LysR family transcriptional regulator"; protein_id "WP_000164036.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	186610	187584	.	-	0	gene_id "nbis-gene-162"; transcript_id "gene-C7A06_RS00985"; Dbxref "Genbank:WP_000164036.1"; ID "cds-WP_000164036.1"; Name "WP_000164036.1"; Parent "gene-C7A06_RS00985"; gbkey "CDS"; gene "yiaU"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418042.1"; locus_tag "C7A06_RS00985"; product "LysR family transcriptional regulator"; protein_id "WP_000164036.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	187708	188448	.	+	.	gene_id "nbis-gene-163"; ID "nbis-gene-163"; Name "yiaT"; gbkey "Gene"; gene "yiaT"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00990";
+NZ_CP027599.1	RefSeq	transcript	187708	188448	.	+	.	gene_id "nbis-gene-163"; transcript_id "gene-C7A06_RS00990"; ID "gene-C7A06_RS00990"; Name "yiaT"; Parent "nbis-gene-163"; gbkey "Gene"; gene "yiaT"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00990"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	187708	188448	.	+	.	gene_id "nbis-gene-163"; transcript_id "gene-C7A06_RS00990"; Dbxref "Genbank:WP_000906808.1"; ID "nbis-exon-172"; Name "WP_000906808.1"; Parent "gene-C7A06_RS00990"; gbkey "CDS"; gene "yiaT"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312487.1"; locus_tag "C7A06_RS00990"; product "MipA/OmpV family protein"; protein_id "WP_000906808.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	187708	188448	.	+	0	gene_id "nbis-gene-163"; transcript_id "gene-C7A06_RS00990"; Dbxref "Genbank:WP_000906808.1"; ID "cds-WP_000906808.1"; Name "WP_000906808.1"; Parent "gene-C7A06_RS00990"; gbkey "CDS"; gene "yiaT"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312487.1"; locus_tag "C7A06_RS00990"; product "MipA/OmpV family protein"; protein_id "WP_000906808.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	188395	188658	.	-	.	gene_id "nbis-pseudogene-311"; ID "nbis-pseudogene-311"; Name "C7A06_RS34805"; end_range "188658" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS34805"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "188395";
+NZ_CP027599.1	RefSeq	transcript	188395	188658	.	-	.	gene_id "nbis-pseudogene-311"; transcript_id "gene-C7A06_RS34805"; ID "gene-C7A06_RS34805"; Name "C7A06_RS34805"; Parent "nbis-pseudogene-311"; end_range "188658" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS34805"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "188395";
+NZ_CP027599.1	Protein Homology	exon	188395	188658	.	-	.	gene_id "nbis-pseudogene-311"; transcript_id "gene-C7A06_RS34805"; ID "nbis-exon-6141"; Note "incomplete; partial in the middle of a contig; missing N-terminus and C-terminus"; Parent "gene-C7A06_RS34805"; end_range "188658" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_020239594.1"; locus_tag "C7A06_RS34805"; partial "true"; product "hypothetical protein"; pseudo "true"; start_range "." "188395"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	188395	188658	.	-	0	gene_id "nbis-pseudogene-311"; transcript_id "gene-C7A06_RS34805"; ID "cds-C7A06_RS34805"; Note "incomplete; partial in the middle of a contig; missing N-terminus and C-terminus"; Parent "gene-C7A06_RS34805"; end_range "188658" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_020239594.1"; locus_tag "C7A06_RS34805"; partial "true"; product "hypothetical protein"; pseudo "true"; start_range "." "188395"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	188662	188763	.	+	.	gene_id "nbis-pseudogene-290"; ID "nbis-pseudogene-290"; Name "C7A06_RS34380"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS34380"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "188662";
+NZ_CP027599.1	RefSeq	transcript	188662	188763	.	+	.	gene_id "nbis-pseudogene-290"; transcript_id "gene-C7A06_RS34380"; ID "gene-C7A06_RS34380"; Name "C7A06_RS34380"; Parent "nbis-pseudogene-290"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS34380"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "188662";
+NZ_CP027599.1	Protein Homology	exon	188662	188763	.	+	.	gene_id "nbis-pseudogene-290"; transcript_id "gene-C7A06_RS34380"; ID "nbis-exon-6063"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS34380"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312484.1"; locus_tag "C7A06_RS34380"; partial "true"; product "AraC family transcriptional regulator"; pseudo "true"; start_range "." "188662"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	188662	188763	.	+	0	gene_id "nbis-pseudogene-290"; transcript_id "gene-C7A06_RS34380"; ID "cds-C7A06_RS34380"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS34380"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312484.1"; locus_tag "C7A06_RS34380"; partial "true"; product "AraC family transcriptional regulator"; pseudo "true"; start_range "." "188662"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	188795	189490	.	-	.	gene_id "nbis-gene-164"; ID "nbis-gene-164"; Name "araD"; gbkey "Gene"; gene "araD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01000";
+NZ_CP027599.1	RefSeq	transcript	188795	189490	.	-	.	gene_id "nbis-gene-164"; transcript_id "gene-C7A06_RS01000"; ID "gene-C7A06_RS01000"; Name "araD"; Parent "nbis-gene-164"; gbkey "Gene"; gene "araD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01000"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	188795	189490	.	-	.	gene_id "nbis-gene-164"; transcript_id "gene-C7A06_RS01000"; Dbxref "Genbank:WP_000893142.1"; ID "nbis-exon-173"; Name "WP_000893142.1"; Ontology_term "GO:0019568" "GO:0008742"; Parent "gene-C7A06_RS01000"; gbkey "CDS"; gene "araD"; go_function "L-ribulose-phosphate 4-epimerase activity|0008742||IEA"; go_process "arabinose catabolic process|0019568||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418040.1"; locus_tag "C7A06_RS01000"; product "L-ribulose-5-phosphate 4-epimerase"; protein_id "WP_000893142.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	188795	189490	.	-	0	gene_id "nbis-gene-164"; transcript_id "gene-C7A06_RS01000"; Dbxref "Genbank:WP_000893142.1"; ID "cds-WP_000893142.1"; Name "WP_000893142.1"; Ontology_term "GO:0019568" "GO:0008742"; Parent "gene-C7A06_RS01000"; gbkey "CDS"; gene "araD"; go_function "L-ribulose-phosphate 4-epimerase activity|0008742||IEA"; go_process "arabinose catabolic process|0019568||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418040.1"; locus_tag "C7A06_RS01000"; product "L-ribulose-5-phosphate 4-epimerase"; protein_id "WP_000893142.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	189484	190344	.	-	.	gene_id "nbis-gene-165"; ID "nbis-gene-165"; Name "sgbU"; gbkey "Gene"; gene "sgbU"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01005";
+NZ_CP027599.1	RefSeq	transcript	189484	190344	.	-	.	gene_id "nbis-gene-165"; transcript_id "gene-C7A06_RS01005"; ID "gene-C7A06_RS01005"; Name "sgbU"; Parent "nbis-gene-165"; gbkey "Gene"; gene "sgbU"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01005"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	189484	190344	.	-	.	gene_id "nbis-gene-165"; transcript_id "gene-C7A06_RS01005"; Dbxref "Genbank:WP_001296811.1"; ID "nbis-exon-174"; Name "WP_001296811.1"; Parent "gene-C7A06_RS01005"; gbkey "CDS"; gene "sgbU"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418039.2"; locus_tag "C7A06_RS01005"; product "L-ribulose-5-phosphate 3-epimerase"; protein_id "WP_001296811.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	189484	190344	.	-	0	gene_id "nbis-gene-165"; transcript_id "gene-C7A06_RS01005"; Dbxref "Genbank:WP_001296811.1"; ID "cds-WP_001296811.1"; Name "WP_001296811.1"; Parent "gene-C7A06_RS01005"; gbkey "CDS"; gene "sgbU"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418039.2"; locus_tag "C7A06_RS01005"; product "L-ribulose-5-phosphate 3-epimerase"; protein_id "WP_001296811.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	190337	190999	.	-	.	gene_id "nbis-gene-166"; ID "nbis-gene-166"; Name "ulaD"; gbkey "Gene"; gene "ulaD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01010";
+NZ_CP027599.1	RefSeq	transcript	190337	190999	.	-	.	gene_id "nbis-gene-166"; transcript_id "gene-C7A06_RS01010"; ID "gene-C7A06_RS01010"; Name "ulaD"; Parent "nbis-gene-166"; gbkey "Gene"; gene "ulaD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01010"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	190337	190999	.	-	.	gene_id "nbis-gene-166"; transcript_id "gene-C7A06_RS01010"; Dbxref "Genbank:WP_000089497.1"; ID "nbis-exon-175"; Name "WP_000089497.1"; Parent "gene-C7A06_RS01010"; gbkey "CDS"; gene "ulaD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418038.1"; locus_tag "C7A06_RS01010"; product "3-keto-L-gulonate-6-phosphate decarboxylase UlaD"; protein_id "WP_000089497.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	190337	190999	.	-	0	gene_id "nbis-gene-166"; transcript_id "gene-C7A06_RS01010"; Dbxref "Genbank:WP_000089497.1"; ID "cds-WP_000089497.1"; Name "WP_000089497.1"; Parent "gene-C7A06_RS01010"; gbkey "CDS"; gene "ulaD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418038.1"; locus_tag "C7A06_RS01010"; product "3-keto-L-gulonate-6-phosphate decarboxylase UlaD"; protein_id "WP_000089497.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	190996	192492	.	-	.	gene_id "nbis-gene-167"; ID "nbis-gene-167"; Name "lyxK"; gbkey "Gene"; gene "lyxK"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01015";
+NZ_CP027599.1	RefSeq	transcript	190996	192492	.	-	.	gene_id "nbis-gene-167"; transcript_id "gene-C7A06_RS01015"; ID "gene-C7A06_RS01015"; Name "lyxK"; Parent "nbis-gene-167"; gbkey "Gene"; gene "lyxK"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01015"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	190996	192492	.	-	.	gene_id "nbis-gene-167"; transcript_id "gene-C7A06_RS01015"; Dbxref "Genbank:WP_000196086.1"; ID "nbis-exon-176"; Name "WP_000196086.1"; Parent "gene-C7A06_RS01015"; gbkey "CDS"; gene "lyxK"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418037.1"; locus_tag "C7A06_RS01015"; product "L-xylulokinase"; protein_id "WP_000196086.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	190996	192492	.	-	0	gene_id "nbis-gene-167"; transcript_id "gene-C7A06_RS01015"; Dbxref "Genbank:WP_000196086.1"; ID "cds-WP_000196086.1"; Name "WP_000196086.1"; Parent "gene-C7A06_RS01015"; gbkey "CDS"; gene "lyxK"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418037.1"; locus_tag "C7A06_RS01015"; product "L-xylulokinase"; protein_id "WP_000196086.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	192496	193482	.	-	.	gene_id "nbis-gene-168"; ID "nbis-gene-168"; Name "yiaO"; gbkey "Gene"; gene "yiaO"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01020";
+NZ_CP027599.1	RefSeq	transcript	192496	193482	.	-	.	gene_id "nbis-gene-168"; transcript_id "gene-C7A06_RS01020"; ID "gene-C7A06_RS01020"; Name "yiaO"; Parent "nbis-gene-168"; gbkey "Gene"; gene "yiaO"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01020"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	192496	193482	.	-	.	gene_id "nbis-gene-168"; transcript_id "gene-C7A06_RS01020"; Dbxref "Genbank:WP_000776892.1"; ID "nbis-exon-177"; Name "WP_000776892.1"; Parent "gene-C7A06_RS01020"; gbkey "CDS"; gene "yiaO"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418036.1"; locus_tag "C7A06_RS01020"; product "2,3-diketo-L-gulonate transporter substrate-binding protein YiaO"; protein_id "WP_000776892.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	192496	193482	.	-	0	gene_id "nbis-gene-168"; transcript_id "gene-C7A06_RS01020"; Dbxref "Genbank:WP_000776892.1"; ID "cds-WP_000776892.1"; Name "WP_000776892.1"; Parent "gene-C7A06_RS01020"; gbkey "CDS"; gene "yiaO"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418036.1"; locus_tag "C7A06_RS01020"; product "2,3-diketo-L-gulonate transporter substrate-binding protein YiaO"; protein_id "WP_000776892.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	193495	194772	.	-	.	gene_id "nbis-gene-169"; ID "nbis-gene-169"; Name "yiaN"; gbkey "Gene"; gene "yiaN"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01025";
+NZ_CP027599.1	RefSeq	transcript	193495	194772	.	-	.	gene_id "nbis-gene-169"; transcript_id "gene-C7A06_RS01025"; ID "gene-C7A06_RS01025"; Name "yiaN"; Parent "nbis-gene-169"; gbkey "Gene"; gene "yiaN"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01025"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	193495	194772	.	-	.	gene_id "nbis-gene-169"; transcript_id "gene-C7A06_RS01025"; Dbxref "Genbank:WP_000279599.1"; ID "nbis-exon-178"; Name "WP_000279599.1"; Parent "gene-C7A06_RS01025"; gbkey "CDS"; gene "yiaN"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_026232.1"; locus_tag "C7A06_RS01025"; product "2,3-diketo-L-gulonate transporter large permease YiaN"; protein_id "WP_000279599.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	193495	194772	.	-	0	gene_id "nbis-gene-169"; transcript_id "gene-C7A06_RS01025"; Dbxref "Genbank:WP_000279599.1"; ID "cds-WP_000279599.1"; Name "WP_000279599.1"; Parent "gene-C7A06_RS01025"; gbkey "CDS"; gene "yiaN"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_026232.1"; locus_tag "C7A06_RS01025"; product "2,3-diketo-L-gulonate transporter large permease YiaN"; protein_id "WP_000279599.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	194775	195248	.	-	.	gene_id "nbis-gene-170"; ID "nbis-gene-170"; Name "yiaM"; gbkey "Gene"; gene "yiaM"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01030";
+NZ_CP027599.1	RefSeq	transcript	194775	195248	.	-	.	gene_id "nbis-gene-170"; transcript_id "gene-C7A06_RS01030"; ID "gene-C7A06_RS01030"; Name "yiaM"; Parent "nbis-gene-170"; gbkey "Gene"; gene "yiaM"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01030"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	194775	195248	.	-	.	gene_id "nbis-gene-170"; transcript_id "gene-C7A06_RS01030"; Dbxref "Genbank:WP_000721664.1"; ID "nbis-exon-179"; Name "WP_000721664.1"; Parent "gene-C7A06_RS01030"; gbkey "CDS"; gene "yiaM"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418034.1"; locus_tag "C7A06_RS01030"; product "2,3-diketo-L-gulonate TRAP transporter small permease YiaM"; protein_id "WP_000721664.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	194775	195248	.	-	0	gene_id "nbis-gene-170"; transcript_id "gene-C7A06_RS01030"; Dbxref "Genbank:WP_000721664.1"; ID "cds-WP_000721664.1"; Name "WP_000721664.1"; Parent "gene-C7A06_RS01030"; gbkey "CDS"; gene "yiaM"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418034.1"; locus_tag "C7A06_RS01030"; product "2,3-diketo-L-gulonate TRAP transporter small permease YiaM"; protein_id "WP_000721664.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	195366	195833	.	-	.	gene_id "nbis-gene-171"; ID "nbis-gene-171"; Name "yiaL"; gbkey "Gene"; gene "yiaL"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01035";
+NZ_CP027599.1	RefSeq	transcript	195366	195833	.	-	.	gene_id "nbis-gene-171"; transcript_id "gene-C7A06_RS01035"; ID "gene-C7A06_RS01035"; Name "yiaL"; Parent "nbis-gene-171"; gbkey "Gene"; gene "yiaL"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01035"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	195366	195833	.	-	.	gene_id "nbis-gene-171"; transcript_id "gene-C7A06_RS01035"; Dbxref "Genbank:WP_000576071.1"; ID "nbis-exon-180"; Name "WP_000576071.1"; Parent "gene-C7A06_RS01035"; gbkey "CDS"; gene "yiaL"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418033.1"; locus_tag "C7A06_RS01035"; product "YhcH/YjgK/YiaL family protein"; protein_id "WP_000576071.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	195366	195833	.	-	0	gene_id "nbis-gene-171"; transcript_id "gene-C7A06_RS01035"; Dbxref "Genbank:WP_000576071.1"; ID "cds-WP_000576071.1"; Name "WP_000576071.1"; Parent "gene-C7A06_RS01035"; gbkey "CDS"; gene "yiaL"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418033.1"; locus_tag "C7A06_RS01035"; product "YhcH/YjgK/YiaL family protein"; protein_id "WP_000576071.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	195845	196843	.	-	.	gene_id "nbis-gene-172"; ID "nbis-gene-172"; Name "yiaK"; gbkey "Gene"; gene "yiaK"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01040";
+NZ_CP027599.1	RefSeq	transcript	195845	196843	.	-	.	gene_id "nbis-gene-172"; transcript_id "gene-C7A06_RS01040"; ID "gene-C7A06_RS01040"; Name "yiaK"; Parent "nbis-gene-172"; gbkey "Gene"; gene "yiaK"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01040"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	195845	196843	.	-	.	gene_id "nbis-gene-172"; transcript_id "gene-C7A06_RS01040"; Dbxref "Genbank:WP_000869039.1"; ID "nbis-exon-181"; Name "WP_000869039.1"; Ontology_term "GO:0047559" "GO:0070403"; Parent "gene-C7A06_RS01040"; gbkey "CDS"; gene "yiaK"; go_function "3-dehydro-L-gulonate 2-dehydrogenase activity|0047559||IEA" "NAD+ binding|0070403||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709360.1"; locus_tag "C7A06_RS01040"; product "3-dehydro-L-gulonate 2-dehydrogenase"; protein_id "WP_000869039.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	195845	196843	.	-	0	gene_id "nbis-gene-172"; transcript_id "gene-C7A06_RS01040"; Dbxref "Genbank:WP_000869039.1"; ID "cds-WP_000869039.1"; Name "WP_000869039.1"; Ontology_term "GO:0047559" "GO:0070403"; Parent "gene-C7A06_RS01040"; gbkey "CDS"; gene "yiaK"; go_function "3-dehydro-L-gulonate 2-dehydrogenase activity|0047559||IEA" "NAD+ binding|0070403||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709360.1"; locus_tag "C7A06_RS01040"; product "3-dehydro-L-gulonate 2-dehydrogenase"; protein_id "WP_000869039.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	197044	197892	.	+	.	gene_id "nbis-gene-173"; ID "nbis-gene-173"; Name "yiaJ"; gbkey "Gene"; gene "yiaJ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01045";
+NZ_CP027599.1	RefSeq	transcript	197044	197892	.	+	.	gene_id "nbis-gene-173"; transcript_id "gene-C7A06_RS01045"; ID "gene-C7A06_RS01045"; Name "yiaJ"; Parent "nbis-gene-173"; gbkey "Gene"; gene "yiaJ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01045"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	197044	197892	.	+	.	gene_id "nbis-gene-173"; transcript_id "gene-C7A06_RS01045"; Dbxref "Genbank:WP_000514230.1"; ID "nbis-exon-182"; Name "WP_000514230.1"; Parent "gene-C7A06_RS01045"; gbkey "CDS"; gene "yiaJ"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418031.1"; locus_tag "C7A06_RS01045"; product "IclR family transcriptional regulator YiaJ"; protein_id "WP_000514230.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	197044	197892	.	+	0	gene_id "nbis-gene-173"; transcript_id "gene-C7A06_RS01045"; Dbxref "Genbank:WP_000514230.1"; ID "cds-WP_000514230.1"; Name "WP_000514230.1"; Parent "gene-C7A06_RS01045"; gbkey "CDS"; gene "yiaJ"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418031.1"; locus_tag "C7A06_RS01045"; product "IclR family transcriptional regulator YiaJ"; protein_id "WP_000514230.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	197994	198467	.	+	.	gene_id "nbis-gene-174"; ID "nbis-gene-174"; Name "ysaA"; gbkey "Gene"; gene "ysaA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01050";
+NZ_CP027599.1	RefSeq	transcript	197994	198467	.	+	.	gene_id "nbis-gene-174"; transcript_id "gene-C7A06_RS01050"; ID "gene-C7A06_RS01050"; Name "ysaA"; Parent "nbis-gene-174"; gbkey "Gene"; gene "ysaA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01050"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	197994	198467	.	+	.	gene_id "nbis-gene-174"; transcript_id "gene-C7A06_RS01050"; Dbxref "Genbank:WP_001296790.1"; ID "nbis-exon-183"; Name "WP_001296790.1"; Parent "gene-C7A06_RS01050"; gbkey "CDS"; gene "ysaA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312483.1"; locus_tag "C7A06_RS01050"; product "4Fe-4S binding protein"; protein_id "WP_001296790.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	197994	198467	.	+	0	gene_id "nbis-gene-174"; transcript_id "gene-C7A06_RS01050"; Dbxref "Genbank:WP_001296790.1"; ID "cds-WP_001296790.1"; Name "WP_001296790.1"; Parent "gene-C7A06_RS01050"; gbkey "CDS"; gene "ysaA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312483.1"; locus_tag "C7A06_RS01050"; product "4Fe-4S binding protein"; protein_id "WP_001296790.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	198619	199872	.	-	.	gene_id "nbis-gene-175"; ID "nbis-gene-175"; Name "avtA"; gbkey "Gene"; gene "avtA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01055";
+NZ_CP027599.1	RefSeq	transcript	198619	199872	.	-	.	gene_id "nbis-gene-175"; transcript_id "gene-C7A06_RS01055"; ID "gene-C7A06_RS01055"; Name "avtA"; Parent "nbis-gene-175"; gbkey "Gene"; gene "avtA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01055"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	198619	199872	.	-	.	gene_id "nbis-gene-175"; transcript_id "gene-C7A06_RS01055"; Dbxref "Genbank:WP_000144361.1"; ID "nbis-exon-184"; Name "WP_000144361.1"; Parent "gene-C7A06_RS01055"; gbkey "CDS"; gene "avtA"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_026231.1"; locus_tag "C7A06_RS01055"; product "valine--pyruvate transaminase"; protein_id "WP_000144361.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	198619	199872	.	-	0	gene_id "nbis-gene-175"; transcript_id "gene-C7A06_RS01055"; Dbxref "Genbank:WP_000144361.1"; ID "cds-WP_000144361.1"; Name "WP_000144361.1"; Parent "gene-C7A06_RS01055"; gbkey "CDS"; gene "avtA"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_026231.1"; locus_tag "C7A06_RS01055"; product "valine--pyruvate transaminase"; protein_id "WP_000144361.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	200050	202080	.	-	.	gene_id "nbis-gene-176"; ID "nbis-gene-176"; Name "malS"; gbkey "Gene"; gene "malS"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01060";
+NZ_CP027599.1	RefSeq	transcript	200050	202080	.	-	.	gene_id "nbis-gene-176"; transcript_id "gene-C7A06_RS01060"; ID "gene-C7A06_RS01060"; Name "malS"; Parent "nbis-gene-176"; gbkey "Gene"; gene "malS"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01060"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	200050	202080	.	-	.	gene_id "nbis-gene-176"; transcript_id "gene-C7A06_RS01060"; Dbxref "Genbank:WP_000761204.1"; ID "nbis-exon-185"; Name "WP_000761204.1"; Ontology_term "GO:0004556"; Parent "gene-C7A06_RS01060"; gbkey "CDS"; gene "malS"; go_function "alpha-amylase activity|0004556||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312481.1"; locus_tag "C7A06_RS01060"; product "alpha-amylase"; protein_id "WP_000761204.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	200050	202080	.	-	0	gene_id "nbis-gene-176"; transcript_id "gene-C7A06_RS01060"; Dbxref "Genbank:WP_000761204.1"; ID "cds-WP_000761204.1"; Name "WP_000761204.1"; Ontology_term "GO:0004556"; Parent "gene-C7A06_RS01060"; gbkey "CDS"; gene "malS"; go_function "alpha-amylase activity|0004556||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312481.1"; locus_tag "C7A06_RS01060"; product "alpha-amylase"; protein_id "WP_000761204.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	202400	203224	.	+	.	gene_id "nbis-gene-177"; ID "nbis-gene-177"; Name "bax"; gbkey "Gene"; gene "bax"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01065";
+NZ_CP027599.1	RefSeq	transcript	202400	203224	.	+	.	gene_id "nbis-gene-177"; transcript_id "gene-C7A06_RS01065"; ID "gene-C7A06_RS01065"; Name "bax"; Parent "nbis-gene-177"; gbkey "Gene"; gene "bax"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01065"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	202400	203224	.	+	.	gene_id "nbis-gene-177"; transcript_id "gene-C7A06_RS01065"; Dbxref "Genbank:WP_001296804.1"; ID "nbis-exon-186"; Name "WP_001296804.1"; Parent "gene-C7A06_RS01065"; gbkey "CDS"; gene "bax"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_026230.1"; locus_tag "C7A06_RS01065"; product "protein bax"; protein_id "WP_001296804.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	202400	203224	.	+	0	gene_id "nbis-gene-177"; transcript_id "gene-C7A06_RS01065"; Dbxref "Genbank:WP_001296804.1"; ID "cds-WP_001296804.1"; Name "WP_001296804.1"; Parent "gene-C7A06_RS01065"; gbkey "CDS"; gene "bax"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_026230.1"; locus_tag "C7A06_RS01065"; product "protein bax"; protein_id "WP_001296804.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	203332	204510	.	-	.	gene_id "nbis-gene-178"; ID "nbis-gene-178"; Name "xylR"; gbkey "Gene"; gene "xylR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01070";
+NZ_CP027599.1	RefSeq	transcript	203332	204510	.	-	.	gene_id "nbis-gene-178"; transcript_id "gene-C7A06_RS01070"; ID "gene-C7A06_RS01070"; Name "xylR"; Parent "nbis-gene-178"; gbkey "Gene"; gene "xylR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01070"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	203332	204510	.	-	.	gene_id "nbis-gene-178"; transcript_id "gene-C7A06_RS01070"; Dbxref "Genbank:WP_000494484.1"; ID "nbis-exon-187"; Name "WP_000494484.1"; Parent "gene-C7A06_RS01070"; gbkey "CDS"; gene "xylR"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312479.1"; locus_tag "C7A06_RS01070"; product "DNA-binding transcriptional regulator XylR"; protein_id "WP_000494484.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	203332	204510	.	-	0	gene_id "nbis-gene-178"; transcript_id "gene-C7A06_RS01070"; Dbxref "Genbank:WP_000494484.1"; ID "cds-WP_000494484.1"; Name "WP_000494484.1"; Parent "gene-C7A06_RS01070"; gbkey "CDS"; gene "xylR"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312479.1"; locus_tag "C7A06_RS01070"; product "DNA-binding transcriptional regulator XylR"; protein_id "WP_000494484.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	204588	205769	.	-	.	gene_id "nbis-gene-179"; ID "nbis-gene-179"; Name "xylH"; gbkey "Gene"; gene "xylH"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01075";
+NZ_CP027599.1	RefSeq	transcript	204588	205769	.	-	.	gene_id "nbis-gene-179"; transcript_id "gene-C7A06_RS01075"; ID "gene-C7A06_RS01075"; Name "xylH"; Parent "nbis-gene-179"; gbkey "Gene"; gene "xylH"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01075"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	204588	205769	.	-	.	gene_id "nbis-gene-179"; transcript_id "gene-C7A06_RS01075"; Dbxref "Genbank:WP_000045978.1"; ID "nbis-exon-188"; Name "WP_000045978.1"; Parent "gene-C7A06_RS01075"; gbkey "CDS"; gene "xylH"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312478.1"; locus_tag "C7A06_RS01075"; product "xylose ABC transporter permease XylH"; protein_id "WP_000045978.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	204588	205769	.	-	0	gene_id "nbis-gene-179"; transcript_id "gene-C7A06_RS01075"; Dbxref "Genbank:WP_000045978.1"; ID "cds-WP_000045978.1"; Name "WP_000045978.1"; Parent "gene-C7A06_RS01075"; gbkey "CDS"; gene "xylH"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312478.1"; locus_tag "C7A06_RS01075"; product "xylose ABC transporter permease XylH"; protein_id "WP_000045978.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	205747	207288	.	-	.	gene_id "nbis-gene-180"; ID "nbis-gene-180"; Name "xylG"; gbkey "Gene"; gene "xylG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01080";
+NZ_CP027599.1	RefSeq	transcript	205747	207288	.	-	.	gene_id "nbis-gene-180"; transcript_id "gene-C7A06_RS01080"; ID "gene-C7A06_RS01080"; Name "xylG"; Parent "nbis-gene-180"; gbkey "Gene"; gene "xylG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01080"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	205747	207288	.	-	.	gene_id "nbis-gene-180"; transcript_id "gene-C7A06_RS01080"; Dbxref "Genbank:WP_001146482.1"; ID "nbis-exon-189"; Name "WP_001146482.1"; Ontology_term "GO:0015753" "GO:0005524" "GO:0015614" "GO:0009898" "GO:0055052"; Parent "gene-C7A06_RS01080"; gbkey "CDS"; gene "xylG"; go_component "cytoplasmic side of plasma membrane|0009898||IEA" "ATP-binding cassette (ABC) transporter complex, substrate-binding subunit-containing|0055052||IEA"; go_function "ATP binding|0005524||IEA" "ABC-type D-xylose transporter activity|0015614||IEA"; go_process "D-xylose transmembrane transport|0015753||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312477.1"; locus_tag "C7A06_RS01080"; product "D-xylose ABC transporter ATP-binding protein"; protein_id "WP_001146482.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	205747	207288	.	-	0	gene_id "nbis-gene-180"; transcript_id "gene-C7A06_RS01080"; Dbxref "Genbank:WP_001146482.1"; ID "cds-WP_001146482.1"; Name "WP_001146482.1"; Ontology_term "GO:0015753" "GO:0005524" "GO:0015614" "GO:0009898" "GO:0055052"; Parent "gene-C7A06_RS01080"; gbkey "CDS"; gene "xylG"; go_component "cytoplasmic side of plasma membrane|0009898||IEA" "ATP-binding cassette (ABC) transporter complex, substrate-binding subunit-containing|0055052||IEA"; go_function "ATP binding|0005524||IEA" "ABC-type D-xylose transporter activity|0015614||IEA"; go_process "D-xylose transmembrane transport|0015753||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312477.1"; locus_tag "C7A06_RS01080"; product "D-xylose ABC transporter ATP-binding protein"; protein_id "WP_001146482.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	207366	208358	.	-	.	gene_id "nbis-gene-181"; ID "nbis-gene-181"; Name "xylF"; gbkey "Gene"; gene "xylF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01085";
+NZ_CP027599.1	RefSeq	transcript	207366	208358	.	-	.	gene_id "nbis-gene-181"; transcript_id "gene-C7A06_RS01085"; ID "gene-C7A06_RS01085"; Name "xylF"; Parent "nbis-gene-181"; gbkey "Gene"; gene "xylF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01085"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	207366	208358	.	-	.	gene_id "nbis-gene-181"; transcript_id "gene-C7A06_RS01085"; Dbxref "Genbank:WP_001296518.1"; ID "nbis-exon-190"; Name "WP_001296518.1"; Ontology_term "GO:0015753"; Parent "gene-C7A06_RS01085"; gbkey "CDS"; gene "xylF"; go_process "D-xylose transmembrane transport|0015753||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418023.1"; locus_tag "C7A06_RS01085"; product "D-xylose ABC transporter substrate-binding protein"; protein_id "WP_001296518.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	207366	208358	.	-	0	gene_id "nbis-gene-181"; transcript_id "gene-C7A06_RS01085"; Dbxref "Genbank:WP_001296518.1"; ID "cds-WP_001296518.1"; Name "WP_001296518.1"; Ontology_term "GO:0015753"; Parent "gene-C7A06_RS01085"; gbkey "CDS"; gene "xylF"; go_process "D-xylose transmembrane transport|0015753||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418023.1"; locus_tag "C7A06_RS01085"; product "D-xylose ABC transporter substrate-binding protein"; protein_id "WP_001296518.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	208724	210046	.	+	.	gene_id "nbis-gene-182"; ID "nbis-gene-182"; Name "xylA"; gbkey "Gene"; gene "xylA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01090";
+NZ_CP027599.1	RefSeq	transcript	208724	210046	.	+	.	gene_id "nbis-gene-182"; transcript_id "gene-C7A06_RS01090"; ID "gene-C7A06_RS01090"; Name "xylA"; Parent "nbis-gene-182"; gbkey "Gene"; gene "xylA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01090"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	208724	210046	.	+	.	gene_id "nbis-gene-182"; transcript_id "gene-C7A06_RS01090"; Dbxref "Genbank:WP_001149582.1"; ID "nbis-exon-191"; Name "WP_001149582.1"; Ontology_term "GO:0006098" "GO:0042732" "GO:0000287" "GO:0009045"; Parent "gene-C7A06_RS01090"; gbkey "CDS"; gene "xylA"; go_function "magnesium ion binding|0000287||IEA" "xylose isomerase activity|0009045||IEA"; go_process "pentose-phosphate shunt|0006098||IEA" "D-xylose metabolic process|0042732||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312475.1"; locus_tag "C7A06_RS01090"; product "xylose isomerase"; protein_id "WP_001149582.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	208724	210046	.	+	0	gene_id "nbis-gene-182"; transcript_id "gene-C7A06_RS01090"; Dbxref "Genbank:WP_001149582.1"; ID "cds-WP_001149582.1"; Name "WP_001149582.1"; Ontology_term "GO:0006098" "GO:0042732" "GO:0000287" "GO:0009045"; Parent "gene-C7A06_RS01090"; gbkey "CDS"; gene "xylA"; go_function "magnesium ion binding|0000287||IEA" "xylose isomerase activity|0009045||IEA"; go_process "pentose-phosphate shunt|0006098||IEA" "D-xylose metabolic process|0042732||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312475.1"; locus_tag "C7A06_RS01090"; product "xylose isomerase"; protein_id "WP_001149582.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	210118	211572	.	+	.	gene_id "nbis-gene-183"; ID "nbis-gene-183"; Name "xylB"; gbkey "Gene"; gene "xylB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01095";
+NZ_CP027599.1	RefSeq	transcript	210118	211572	.	+	.	gene_id "nbis-gene-183"; transcript_id "gene-C7A06_RS01095"; ID "gene-C7A06_RS01095"; Name "xylB"; Parent "nbis-gene-183"; gbkey "Gene"; gene "xylB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01095"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	210118	211572	.	+	.	gene_id "nbis-gene-183"; transcript_id "gene-C7A06_RS01095"; Dbxref "Genbank:WP_000275386.1"; ID "nbis-exon-192"; Name "WP_000275386.1"; Ontology_term "GO:0005997" "GO:0004856"; Parent "gene-C7A06_RS01095"; gbkey "CDS"; gene "xylB"; go_function "xylulokinase activity|0004856||IEA"; go_process "xylulose metabolic process|0005997||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709351.1"; locus_tag "C7A06_RS01095"; product "xylulokinase"; protein_id "WP_000275386.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	210118	211572	.	+	0	gene_id "nbis-gene-183"; transcript_id "gene-C7A06_RS01095"; Dbxref "Genbank:WP_000275386.1"; ID "cds-WP_000275386.1"; Name "WP_000275386.1"; Ontology_term "GO:0005997" "GO:0004856"; Parent "gene-C7A06_RS01095"; gbkey "CDS"; gene "xylB"; go_function "xylulokinase activity|0004856||IEA"; go_process "xylulose metabolic process|0005997||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709351.1"; locus_tag "C7A06_RS01095"; product "xylulokinase"; protein_id "WP_000275386.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	211741	212082	.	+	.	gene_id "nbis-gene-184"; ID "nbis-gene-184"; Name "C7A06_RS01100"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01100";
+NZ_CP027599.1	RefSeq	transcript	211741	212082	.	+	.	gene_id "nbis-gene-184"; transcript_id "gene-C7A06_RS01100"; ID "gene-C7A06_RS01100"; Name "C7A06_RS01100"; Parent "nbis-gene-184"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01100"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	211741	212082	.	+	.	gene_id "nbis-gene-184"; transcript_id "gene-C7A06_RS01100"; Dbxref "Genbank:WP_000858193.1"; ID "nbis-exon-193"; Name "WP_000858193.1"; Parent "gene-C7A06_RS01100"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709350.2"; locus_tag "C7A06_RS01100"; product "hypothetical protein"; protein_id "WP_000858193.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	211741	212082	.	+	0	gene_id "nbis-gene-184"; transcript_id "gene-C7A06_RS01100"; Dbxref "Genbank:WP_000858193.1"; ID "cds-WP_000858193.1"; Name "WP_000858193.1"; Parent "gene-C7A06_RS01100"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709350.2"; locus_tag "C7A06_RS01100"; product "hypothetical protein"; protein_id "WP_000858193.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	212128	212565	.	+	.	gene_id "nbis-gene-185"; ID "nbis-gene-185"; Name "yiaA"; gbkey "Gene"; gene "yiaA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01105";
+NZ_CP027599.1	RefSeq	transcript	212128	212565	.	+	.	gene_id "nbis-gene-185"; transcript_id "gene-C7A06_RS01105"; ID "gene-C7A06_RS01105"; Name "yiaA"; Parent "nbis-gene-185"; gbkey "Gene"; gene "yiaA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01105"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	212128	212565	.	+	.	gene_id "nbis-gene-185"; transcript_id "gene-C7A06_RS01105"; Dbxref "Genbank:WP_001298726.1"; ID "nbis-exon-194"; Name "WP_001298726.1"; Parent "gene-C7A06_RS01105"; gbkey "CDS"; gene "yiaA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312472.2"; locus_tag "C7A06_RS01105"; product "YiaB family inner membrane protein"; protein_id "WP_001298726.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	212128	212565	.	+	0	gene_id "nbis-gene-185"; transcript_id "gene-C7A06_RS01105"; Dbxref "Genbank:WP_001298726.1"; ID "cds-WP_001298726.1"; Name "WP_001298726.1"; Parent "gene-C7A06_RS01105"; gbkey "CDS"; gene "yiaA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312472.2"; locus_tag "C7A06_RS01105"; product "YiaB family inner membrane protein"; protein_id "WP_001298726.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	212607	213602	.	-	.	gene_id "nbis-gene-186"; ID "nbis-gene-186"; Name "wecH"; gbkey "Gene"; gene "wecH"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01110";
+NZ_CP027599.1	RefSeq	transcript	212607	213602	.	-	.	gene_id "nbis-gene-186"; transcript_id "gene-C7A06_RS01110"; ID "gene-C7A06_RS01110"; Name "wecH"; Parent "nbis-gene-186"; gbkey "Gene"; gene "wecH"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01110"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	212607	213602	.	-	.	gene_id "nbis-gene-186"; transcript_id "gene-C7A06_RS01110"; Dbxref "Genbank:WP_001182671.1"; ID "nbis-exon-195"; Name "WP_001182671.1"; Parent "gene-C7A06_RS01110"; gbkey "CDS"; gene "wecH"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709348.1"; locus_tag "C7A06_RS01110"; product "O-acetyltransferase WecH"; protein_id "WP_001182671.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	212607	213602	.	-	0	gene_id "nbis-gene-186"; transcript_id "gene-C7A06_RS01110"; Dbxref "Genbank:WP_001182671.1"; ID "cds-WP_001182671.1"; Name "WP_001182671.1"; Parent "gene-C7A06_RS01110"; gbkey "CDS"; gene "wecH"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709348.1"; locus_tag "C7A06_RS01110"; product "O-acetyltransferase WecH"; protein_id "WP_001182671.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	213777	214076	.	+	.	gene_id "nbis-gene-187"; ID "nbis-gene-187"; Name "ysaB"; gbkey "Gene"; gene "ysaB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01115";
+NZ_CP027599.1	RefSeq	transcript	213777	214076	.	+	.	gene_id "nbis-gene-187"; transcript_id "gene-C7A06_RS01115"; ID "gene-C7A06_RS01115"; Name "ysaB"; Parent "nbis-gene-187"; gbkey "Gene"; gene "ysaB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01115"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	213777	214076	.	+	.	gene_id "nbis-gene-187"; transcript_id "gene-C7A06_RS01115"; Dbxref "Genbank:WP_000980114.1"; ID "nbis-exon-196"; Name "WP_000980114.1"; Parent "gene-C7A06_RS01115"; gbkey "CDS"; gene "ysaB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709347.1"; locus_tag "C7A06_RS01115"; product "YsaB family lipoprotein"; protein_id "WP_000980114.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	213777	214076	.	+	0	gene_id "nbis-gene-187"; transcript_id "gene-C7A06_RS01115"; Dbxref "Genbank:WP_000980114.1"; ID "cds-WP_000980114.1"; Name "WP_000980114.1"; Parent "gene-C7A06_RS01115"; gbkey "CDS"; gene "ysaB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709347.1"; locus_tag "C7A06_RS01115"; product "YsaB family lipoprotein"; protein_id "WP_000980114.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	214171	215082	.	+	.	gene_id "nbis-gene-188"; ID "nbis-gene-188"; Name "glyQ"; gbkey "Gene"; gene "glyQ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01120";
+NZ_CP027599.1	RefSeq	transcript	214171	215082	.	+	.	gene_id "nbis-gene-188"; transcript_id "gene-C7A06_RS01120"; ID "gene-C7A06_RS01120"; Name "glyQ"; Parent "nbis-gene-188"; gbkey "Gene"; gene "glyQ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01120"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	214171	215082	.	+	.	gene_id "nbis-gene-188"; transcript_id "gene-C7A06_RS01120"; Dbxref "Genbank:WP_001168544.1"; ID "nbis-exon-197"; Name "WP_001168544.1"; Ontology_term "GO:0006426" "GO:0004820" "GO:0009345"; Parent "gene-C7A06_RS01120"; gbkey "CDS"; gene "glyQ"; go_component "glycine-tRNA ligase complex|0009345||IEA"; go_function "glycine-tRNA ligase activity|0004820||IEA"; go_process "glycyl-tRNA aminoacylation|0006426||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312470.1"; locus_tag "C7A06_RS01120"; product "glycine--tRNA ligase subunit alpha"; protein_id "WP_001168544.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	214171	215082	.	+	0	gene_id "nbis-gene-188"; transcript_id "gene-C7A06_RS01120"; Dbxref "Genbank:WP_001168544.1"; ID "cds-WP_001168544.1"; Name "WP_001168544.1"; Ontology_term "GO:0006426" "GO:0004820" "GO:0009345"; Parent "gene-C7A06_RS01120"; gbkey "CDS"; gene "glyQ"; go_component "glycine-tRNA ligase complex|0009345||IEA"; go_function "glycine-tRNA ligase activity|0004820||IEA"; go_process "glycyl-tRNA aminoacylation|0006426||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312470.1"; locus_tag "C7A06_RS01120"; product "glycine--tRNA ligase subunit alpha"; protein_id "WP_001168544.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	215092	217161	.	+	.	gene_id "nbis-gene-189"; ID "nbis-gene-189"; Name "glyS"; gbkey "Gene"; gene "glyS"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01125";
+NZ_CP027599.1	RefSeq	transcript	215092	217161	.	+	.	gene_id "nbis-gene-189"; transcript_id "gene-C7A06_RS01125"; ID "gene-C7A06_RS01125"; Name "glyS"; Parent "nbis-gene-189"; gbkey "Gene"; gene "glyS"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01125"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	215092	217161	.	+	.	gene_id "nbis-gene-189"; transcript_id "gene-C7A06_RS01125"; Dbxref "Genbank:WP_001291774.1"; ID "nbis-exon-198"; Name "WP_001291774.1"; Ontology_term "GO:0006426" "GO:0004820" "GO:0009345"; Parent "gene-C7A06_RS01125"; gbkey "CDS"; gene "glyS"; go_component "glycine-tRNA ligase complex|0009345||IEA"; go_function "glycine-tRNA ligase activity|0004820||IEA"; go_process "glycyl-tRNA aminoacylation|0006426||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001291772.1"; locus_tag "C7A06_RS01125"; product "glycine--tRNA ligase subunit beta"; protein_id "WP_001291774.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	215092	217161	.	+	0	gene_id "nbis-gene-189"; transcript_id "gene-C7A06_RS01125"; Dbxref "Genbank:WP_001291774.1"; ID "cds-WP_001291774.1"; Name "WP_001291774.1"; Ontology_term "GO:0006426" "GO:0004820" "GO:0009345"; Parent "gene-C7A06_RS01125"; gbkey "CDS"; gene "glyS"; go_component "glycine-tRNA ligase complex|0009345||IEA"; go_function "glycine-tRNA ligase activity|0004820||IEA"; go_process "glycyl-tRNA aminoacylation|0006426||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001291772.1"; locus_tag "C7A06_RS01125"; product "glycine--tRNA ligase subunit beta"; protein_id "WP_001291774.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	217486	217638	.	+	.	gene_id "nbis-gene-190"; ID "nbis-gene-190"; Name "hokA"; gbkey "Gene"; gene "hokA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01130";
+NZ_CP027599.1	RefSeq	transcript	217486	217638	.	+	.	gene_id "nbis-gene-190"; transcript_id "gene-C7A06_RS01130"; ID "gene-C7A06_RS01130"; Name "hokA"; Parent "nbis-gene-190"; gbkey "Gene"; gene "hokA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01130"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	217486	217638	.	+	.	gene_id "nbis-gene-190"; transcript_id "gene-C7A06_RS01130"; Dbxref "Genbank:WP_001135738.1"; ID "nbis-exon-199"; Name "WP_001135738.1"; Parent "gene-C7A06_RS01130"; gbkey "CDS"; gene "hokA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_012540334.1"; locus_tag "C7A06_RS01130"; product "type I toxin-antitoxin system toxin HokA"; protein_id "WP_001135738.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	217486	217638	.	+	0	gene_id "nbis-gene-190"; transcript_id "gene-C7A06_RS01130"; Dbxref "Genbank:WP_001135738.1"; ID "cds-WP_001135738.1"; Name "WP_001135738.1"; Parent "gene-C7A06_RS01130"; gbkey "CDS"; gene "hokA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_012540334.1"; locus_tag "C7A06_RS01130"; product "type I toxin-antitoxin system toxin HokA"; protein_id "WP_001135738.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	217627	217686	.	-	.	gene_id "nbis-gene-5808"; ID "nbis-gene-5808"; Name "C7A06_RS34675"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS34675";
+NZ_CP027599.1	RefSeq	transcript	217627	217686	.	-	.	gene_id "nbis-gene-5808"; transcript_id "gene-C7A06_RS34675"; ID "gene-C7A06_RS34675"; Name "C7A06_RS34675"; Parent "nbis-gene-5808"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS34675"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	217627	217686	.	-	.	gene_id "nbis-gene-5808"; transcript_id "gene-C7A06_RS34675"; Dbxref "Genbank:WP_212591412.1"; ID "nbis-exon-6117"; Name "WP_212591412.1"; Parent "gene-C7A06_RS34675"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_010051206.1"; locus_tag "C7A06_RS34675"; product "hypothetical protein"; protein_id "WP_212591412.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	217627	217686	.	-	0	gene_id "nbis-gene-5808"; transcript_id "gene-C7A06_RS34675"; Dbxref "Genbank:WP_212591412.1"; ID "cds-WP_212591412.1"; Name "WP_212591412.1"; Parent "gene-C7A06_RS34675"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_010051206.1"; locus_tag "C7A06_RS34675"; product "hypothetical protein"; protein_id "WP_212591412.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	217826	218038	.	-	.	gene_id "nbis-gene-191"; ID "nbis-gene-191"; Name "cspA"; gbkey "Gene"; gene "cspA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01135";
+NZ_CP027599.1	RefSeq	transcript	217826	218038	.	-	.	gene_id "nbis-gene-191"; transcript_id "gene-C7A06_RS01135"; ID "gene-C7A06_RS01135"; Name "cspA"; Parent "nbis-gene-191"; gbkey "Gene"; gene "cspA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01135"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	217826	218038	.	-	.	gene_id "nbis-gene-191"; transcript_id "gene-C7A06_RS01135"; Dbxref "Genbank:WP_000014594.1"; ID "nbis-exon-200"; Name "WP_000014594.1"; Parent "gene-C7A06_RS01135"; gbkey "CDS"; gene "cspA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312468.1"; locus_tag "C7A06_RS01135"; product "RNA chaperone/antiterminator CspA"; protein_id "WP_000014594.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	217826	218038	.	-	0	gene_id "nbis-gene-191"; transcript_id "gene-C7A06_RS01135"; Dbxref "Genbank:WP_000014594.1"; ID "cds-WP_000014594.1"; Name "WP_000014594.1"; Parent "gene-C7A06_RS01135"; gbkey "CDS"; gene "cspA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312468.1"; locus_tag "C7A06_RS01135"; product "RNA chaperone/antiterminator CspA"; protein_id "WP_000014594.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	218319	218609	.	-	.	gene_id "nbis-gene-192"; ID "nbis-gene-192"; Name "yiaG"; gbkey "Gene"; gene "yiaG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01140";
+NZ_CP027599.1	RefSeq	transcript	218319	218609	.	-	.	gene_id "nbis-gene-192"; transcript_id "gene-C7A06_RS01140"; ID "gene-C7A06_RS01140"; Name "yiaG"; Parent "nbis-gene-192"; gbkey "Gene"; gene "yiaG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01140"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	218319	218609	.	-	.	gene_id "nbis-gene-192"; transcript_id "gene-C7A06_RS01140"; Dbxref "Genbank:WP_000455798.1"; ID "nbis-exon-201"; Name "WP_000455798.1"; Parent "gene-C7A06_RS01140"; gbkey "CDS"; gene "yiaG"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312467.1"; locus_tag "C7A06_RS01140"; product "HTH-type transcriptional regulator"; protein_id "WP_000455798.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	218319	218609	.	-	0	gene_id "nbis-gene-192"; transcript_id "gene-C7A06_RS01140"; Dbxref "Genbank:WP_000455798.1"; ID "cds-WP_000455798.1"; Name "WP_000455798.1"; Parent "gene-C7A06_RS01140"; gbkey "CDS"; gene "yiaG"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312467.1"; locus_tag "C7A06_RS01140"; product "HTH-type transcriptional regulator"; protein_id "WP_000455798.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	219043	219753	.	+	.	gene_id "nbis-gene-193"; ID "nbis-gene-193"; Name "yiaF"; gbkey "Gene"; gene "yiaF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01145";
+NZ_CP027599.1	RefSeq	transcript	219043	219753	.	+	.	gene_id "nbis-gene-193"; transcript_id "gene-C7A06_RS01145"; ID "gene-C7A06_RS01145"; Name "yiaF"; Parent "nbis-gene-193"; gbkey "Gene"; gene "yiaF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01145"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	219043	219753	.	+	.	gene_id "nbis-gene-193"; transcript_id "gene-C7A06_RS01145"; Dbxref "Genbank:WP_000190517.1"; ID "nbis-exon-202"; Name "WP_000190517.1"; Parent "gene-C7A06_RS01145"; gbkey "CDS"; gene "yiaF"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418010.2"; locus_tag "C7A06_RS01145"; product "DUF3053 domain-containing protein"; protein_id "WP_000190517.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	219043	219753	.	+	0	gene_id "nbis-gene-193"; transcript_id "gene-C7A06_RS01145"; Dbxref "Genbank:WP_000190517.1"; ID "cds-WP_000190517.1"; Name "WP_000190517.1"; Parent "gene-C7A06_RS01145"; gbkey "CDS"; gene "yiaF"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418010.2"; locus_tag "C7A06_RS01145"; product "DUF3053 domain-containing protein"; protein_id "WP_000190517.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	219803	220777	.	-	.	gene_id "nbis-gene-194"; ID "nbis-gene-194"; Name "ghrB"; gbkey "Gene"; gene "ghrB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01150";
+NZ_CP027599.1	RefSeq	transcript	219803	220777	.	-	.	gene_id "nbis-gene-194"; transcript_id "gene-C7A06_RS01150"; ID "gene-C7A06_RS01150"; Name "ghrB"; Parent "nbis-gene-194"; gbkey "Gene"; gene "ghrB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01150"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	219803	220777	.	-	.	gene_id "nbis-gene-194"; transcript_id "gene-C7A06_RS01150"; Dbxref "Genbank:WP_000805027.1"; ID "nbis-exon-203"; Name "WP_000805027.1"; Ontology_term "GO:0016616" "GO:0051287"; Parent "gene-C7A06_RS01150"; gbkey "CDS"; gene "ghrB"; go_function "oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor|0016616||IEA" "NAD binding|0051287||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312465.2"; locus_tag "C7A06_RS01150"; product "glyoxylate/hydroxypyruvate reductase GhrB"; protein_id "WP_000805027.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	219803	220777	.	-	0	gene_id "nbis-gene-194"; transcript_id "gene-C7A06_RS01150"; Dbxref "Genbank:WP_000805027.1"; ID "cds-WP_000805027.1"; Name "WP_000805027.1"; Ontology_term "GO:0016616" "GO:0051287"; Parent "gene-C7A06_RS01150"; gbkey "CDS"; gene "ghrB"; go_function "oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor|0016616||IEA" "NAD binding|0051287||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312465.2"; locus_tag "C7A06_RS01150"; product "glyoxylate/hydroxypyruvate reductase GhrB"; protein_id "WP_000805027.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	220881	221540	.	-	.	gene_id "nbis-gene-195"; ID "nbis-gene-195"; Name "yiaD"; gbkey "Gene"; gene "yiaD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01155";
+NZ_CP027599.1	RefSeq	transcript	220881	221540	.	-	.	gene_id "nbis-gene-195"; transcript_id "gene-C7A06_RS01155"; ID "gene-C7A06_RS01155"; Name "yiaD"; Parent "nbis-gene-195"; gbkey "Gene"; gene "yiaD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01155"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	220881	221540	.	-	.	gene_id "nbis-gene-195"; transcript_id "gene-C7A06_RS01155"; Dbxref "Genbank:WP_000747625.1"; ID "nbis-exon-204"; Name "WP_000747625.1"; Ontology_term "GO:0009279"; Parent "gene-C7A06_RS01155"; gbkey "CDS"; gene "yiaD"; go_component "cell outer membrane|0009279||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312464.1"; locus_tag "C7A06_RS01155"; product "OmpA family lipoprotein"; protein_id "WP_000747625.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	220881	221540	.	-	0	gene_id "nbis-gene-195"; transcript_id "gene-C7A06_RS01155"; Dbxref "Genbank:WP_000747625.1"; ID "cds-WP_000747625.1"; Name "WP_000747625.1"; Ontology_term "GO:0009279"; Parent "gene-C7A06_RS01155"; gbkey "CDS"; gene "yiaD"; go_component "cell outer membrane|0009279||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312464.1"; locus_tag "C7A06_RS01155"; product "OmpA family lipoprotein"; protein_id "WP_000747625.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	221693	224026	.	+	.	gene_id "nbis-gene-196"; ID "nbis-gene-196"; Name "bisC"; gbkey "Gene"; gene "bisC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01160";
+NZ_CP027599.1	RefSeq	transcript	221693	224026	.	+	.	gene_id "nbis-gene-196"; transcript_id "gene-C7A06_RS01160"; ID "gene-C7A06_RS01160"; Name "bisC"; Parent "nbis-gene-196"; gbkey "Gene"; gene "bisC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01160"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	221693	224026	.	+	.	gene_id "nbis-gene-196"; transcript_id "gene-C7A06_RS01160"; Dbxref "Genbank:WP_000013916.1"; ID "nbis-exon-205"; Name "WP_000013916.1"; Parent "gene-C7A06_RS01160"; gbkey "CDS"; gene "bisC"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418007.3"; locus_tag "C7A06_RS01160"; product "biotin sulfoxide reductase"; protein_id "WP_000013916.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	221693	224026	.	+	0	gene_id "nbis-gene-196"; transcript_id "gene-C7A06_RS01160"; Dbxref "Genbank:WP_000013916.1"; ID "cds-WP_000013916.1"; Name "WP_000013916.1"; Parent "gene-C7A06_RS01160"; gbkey "CDS"; gene "bisC"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418007.3"; locus_tag "C7A06_RS01160"; product "biotin sulfoxide reductase"; protein_id "WP_000013916.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	223995	224435	.	-	.	gene_id "nbis-gene-197"; ID "nbis-gene-197"; Name "yiaC"; gbkey "Gene"; gene "yiaC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01165";
+NZ_CP027599.1	RefSeq	transcript	223995	224435	.	-	.	gene_id "nbis-gene-197"; transcript_id "gene-C7A06_RS01165"; ID "gene-C7A06_RS01165"; Name "yiaC"; Parent "nbis-gene-197"; gbkey "Gene"; gene "yiaC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01165"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	223995	224435	.	-	.	gene_id "nbis-gene-197"; transcript_id "gene-C7A06_RS01165"; Dbxref "Genbank:WP_000617478.1"; ID "nbis-exon-206"; Name "WP_000617478.1"; Ontology_term "GO:0008080"; Parent "gene-C7A06_RS01165"; gbkey "CDS"; gene "yiaC"; go_function "N-acetyltransferase activity|0008080||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709328.1"; locus_tag "C7A06_RS01165"; product "N-acetyltransferase"; protein_id "WP_000617478.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	223995	224435	.	-	0	gene_id "nbis-gene-197"; transcript_id "gene-C7A06_RS01165"; Dbxref "Genbank:WP_000617478.1"; ID "cds-WP_000617478.1"; Name "WP_000617478.1"; Ontology_term "GO:0008080"; Parent "gene-C7A06_RS01165"; gbkey "CDS"; gene "yiaC"; go_function "N-acetyltransferase activity|0008080||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709328.1"; locus_tag "C7A06_RS01165"; product "N-acetyltransferase"; protein_id "WP_000617478.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	224432	224995	.	-	.	gene_id "nbis-gene-198"; ID "nbis-gene-198"; Name "tag"; gbkey "Gene"; gene "tag"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01170";
+NZ_CP027599.1	RefSeq	transcript	224432	224995	.	-	.	gene_id "nbis-gene-198"; transcript_id "gene-C7A06_RS01170"; ID "gene-C7A06_RS01170"; Name "tag"; Parent "nbis-gene-198"; gbkey "Gene"; gene "tag"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01170"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	224432	224995	.	-	.	gene_id "nbis-gene-198"; transcript_id "gene-C7A06_RS01170"; Dbxref "Genbank:WP_000438953.1"; ID "nbis-exon-207"; Name "WP_000438953.1"; Parent "gene-C7A06_RS01170"; gbkey "CDS"; gene "tag"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418005.1"; locus_tag "C7A06_RS01170"; product "DNA-3-methyladenine glycosylase I"; protein_id "WP_000438953.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	224432	224995	.	-	0	gene_id "nbis-gene-198"; transcript_id "gene-C7A06_RS01170"; Dbxref "Genbank:WP_000438953.1"; ID "cds-WP_000438953.1"; Name "WP_000438953.1"; Parent "gene-C7A06_RS01170"; gbkey "CDS"; gene "tag"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418005.1"; locus_tag "C7A06_RS01170"; product "DNA-3-methyladenine glycosylase I"; protein_id "WP_000438953.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	225153	225851	.	+	.	gene_id "nbis-gene-199"; ID "nbis-gene-199"; Name "yhjY"; gbkey "Gene"; gene "yhjY"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01175";
+NZ_CP027599.1	RefSeq	transcript	225153	225851	.	+	.	gene_id "nbis-gene-199"; transcript_id "gene-C7A06_RS01175"; ID "gene-C7A06_RS01175"; Name "yhjY"; Parent "nbis-gene-199"; gbkey "Gene"; gene "yhjY"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01175"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	225153	225851	.	+	.	gene_id "nbis-gene-199"; transcript_id "gene-C7A06_RS01175"; Dbxref "Genbank:WP_001296791.1"; ID "nbis-exon-208"; Name "WP_001296791.1"; Parent "gene-C7A06_RS01175"; gbkey "CDS"; gene "yhjY"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709326.2"; locus_tag "C7A06_RS01175"; product "autotransporter outer membrane beta-barrel domain-containing protein"; protein_id "WP_001296791.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	225153	225851	.	+	0	gene_id "nbis-gene-199"; transcript_id "gene-C7A06_RS01175"; Dbxref "Genbank:WP_001296791.1"; ID "cds-WP_001296791.1"; Name "WP_001296791.1"; Parent "gene-C7A06_RS01175"; gbkey "CDS"; gene "yhjY"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709326.2"; locus_tag "C7A06_RS01175"; product "autotransporter outer membrane beta-barrel domain-containing protein"; protein_id "WP_001296791.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	226080	227282	.	+	.	gene_id "nbis-gene-200"; ID "nbis-gene-200"; Name "yhjX"; gbkey "Gene"; gene "yhjX"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01185";
+NZ_CP027599.1	RefSeq	transcript	226080	227282	.	+	.	gene_id "nbis-gene-200"; transcript_id "gene-C7A06_RS01185"; ID "gene-C7A06_RS01185"; Name "yhjX"; Parent "nbis-gene-200"; gbkey "Gene"; gene "yhjX"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01185"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	226080	227282	.	+	.	gene_id "nbis-gene-200"; transcript_id "gene-C7A06_RS01185"; Dbxref "Genbank:WP_000189036.1"; ID "nbis-exon-209"; Name "WP_000189036.1"; Parent "gene-C7A06_RS01185"; gbkey "CDS"; gene "yhjX"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312459.1"; locus_tag "C7A06_RS01185"; product "MFS transporter"; protein_id "WP_000189036.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	226080	227282	.	+	0	gene_id "nbis-gene-200"; transcript_id "gene-C7A06_RS01185"; Dbxref "Genbank:WP_000189036.1"; ID "cds-WP_000189036.1"; Name "WP_000189036.1"; Parent "gene-C7A06_RS01185"; gbkey "CDS"; gene "yhjX"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312459.1"; locus_tag "C7A06_RS01185"; product "MFS transporter"; protein_id "WP_000189036.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	227606	228130	.	+	.	gene_id "nbis-gene-201"; ID "nbis-gene-201"; Name "C7A06_RS01190"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01190";
+NZ_CP027599.1	RefSeq	transcript	227606	228130	.	+	.	gene_id "nbis-gene-201"; transcript_id "gene-C7A06_RS01190"; ID "gene-C7A06_RS01190"; Name "C7A06_RS01190"; Parent "nbis-gene-201"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01190"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	227606	228130	.	+	.	gene_id "nbis-gene-201"; transcript_id "gene-C7A06_RS01190"; Dbxref "Genbank:WP_000756356.1"; ID "nbis-exon-210"; Name "WP_000756356.1"; Parent "gene-C7A06_RS01190"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000756357.1"; locus_tag "C7A06_RS01190"; product "long polar fimbria major subunit LpfA"; protein_id "WP_000756356.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	227606	228130	.	+	0	gene_id "nbis-gene-201"; transcript_id "gene-C7A06_RS01190"; Dbxref "Genbank:WP_000756356.1"; ID "cds-WP_000756356.1"; Name "WP_000756356.1"; Parent "gene-C7A06_RS01190"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000756357.1"; locus_tag "C7A06_RS01190"; product "long polar fimbria major subunit LpfA"; protein_id "WP_000756356.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	228214	228900	.	+	.	gene_id "nbis-gene-202"; ID "nbis-gene-202"; Name "lpfB"; gbkey "Gene"; gene "lpfB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01195";
+NZ_CP027599.1	RefSeq	transcript	228214	228900	.	+	.	gene_id "nbis-gene-202"; transcript_id "gene-C7A06_RS01195"; ID "gene-C7A06_RS01195"; Name "lpfB"; Parent "nbis-gene-202"; gbkey "Gene"; gene "lpfB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01195"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	228214	228900	.	+	.	gene_id "nbis-gene-202"; transcript_id "gene-C7A06_RS01195"; Dbxref "Genbank:WP_000822476.1"; ID "nbis-exon-211"; Name "WP_000822476.1"; Parent "gene-C7A06_RS01195"; gbkey "CDS"; gene "lpfB"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000822474.1"; locus_tag "C7A06_RS01195"; product "long polar fimbrial biogenesis chaperone LpfB"; protein_id "WP_000822476.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	228214	228900	.	+	0	gene_id "nbis-gene-202"; transcript_id "gene-C7A06_RS01195"; Dbxref "Genbank:WP_000822476.1"; ID "cds-WP_000822476.1"; Name "WP_000822476.1"; Parent "gene-C7A06_RS01195"; gbkey "CDS"; gene "lpfB"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000822474.1"; locus_tag "C7A06_RS01195"; product "long polar fimbrial biogenesis chaperone LpfB"; protein_id "WP_000822476.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	228924	231455	.	+	.	gene_id "nbis-gene-203"; ID "nbis-gene-203"; Name "lpfC"; gbkey "Gene"; gene "lpfC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01200";
+NZ_CP027599.1	RefSeq	transcript	228924	231455	.	+	.	gene_id "nbis-gene-203"; transcript_id "gene-C7A06_RS01200"; ID "gene-C7A06_RS01200"; Name "lpfC"; Parent "nbis-gene-203"; gbkey "Gene"; gene "lpfC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01200"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	228924	231455	.	+	.	gene_id "nbis-gene-203"; transcript_id "gene-C7A06_RS01200"; Dbxref "Genbank:WP_000558677.1"; ID "nbis-exon-212"; Name "WP_000558677.1"; Parent "gene-C7A06_RS01200"; gbkey "CDS"; gene "lpfC"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001759518.1"; locus_tag "C7A06_RS01200"; product "outer membrane usher protein LpfC"; protein_id "WP_000558677.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	228924	231455	.	+	0	gene_id "nbis-gene-203"; transcript_id "gene-C7A06_RS01200"; Dbxref "Genbank:WP_000558677.1"; ID "cds-WP_000558677.1"; Name "WP_000558677.1"; Parent "gene-C7A06_RS01200"; gbkey "CDS"; gene "lpfC"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001759518.1"; locus_tag "C7A06_RS01200"; product "outer membrane usher protein LpfC"; protein_id "WP_000558677.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	231466	232521	.	+	.	gene_id "nbis-gene-204"; ID "nbis-gene-204"; Name "lpfD"; gbkey "Gene"; gene "lpfD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01205";
+NZ_CP027599.1	RefSeq	transcript	231466	232521	.	+	.	gene_id "nbis-gene-204"; transcript_id "gene-C7A06_RS01205"; ID "gene-C7A06_RS01205"; Name "lpfD"; Parent "nbis-gene-204"; gbkey "Gene"; gene "lpfD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01205"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	231466	232521	.	+	.	gene_id "nbis-gene-204"; transcript_id "gene-C7A06_RS01205"; Dbxref "Genbank:WP_000694926.1"; ID "nbis-exon-213"; Name "WP_000694926.1"; Parent "gene-C7A06_RS01205"; gbkey "CDS"; gene "lpfD"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000694923.1"; locus_tag "C7A06_RS01205"; product "long polar fimbrial protein LpfD"; protein_id "WP_000694926.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	231466	232521	.	+	0	gene_id "nbis-gene-204"; transcript_id "gene-C7A06_RS01205"; Dbxref "Genbank:WP_000694926.1"; ID "cds-WP_000694926.1"; Name "WP_000694926.1"; Parent "gene-C7A06_RS01205"; gbkey "CDS"; gene "lpfD"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000694923.1"; locus_tag "C7A06_RS01205"; product "long polar fimbrial protein LpfD"; protein_id "WP_000694926.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	232527	233051	.	+	.	gene_id "nbis-gene-205"; ID "nbis-gene-205"; Name "lpfE"; gbkey "Gene"; gene "lpfE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01210";
+NZ_CP027599.1	RefSeq	transcript	232527	233051	.	+	.	gene_id "nbis-gene-205"; transcript_id "gene-C7A06_RS01210"; ID "gene-C7A06_RS01210"; Name "lpfE"; Parent "nbis-gene-205"; gbkey "Gene"; gene "lpfE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01210"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	232527	233051	.	+	.	gene_id "nbis-gene-205"; transcript_id "gene-C7A06_RS01210"; Dbxref "Genbank:WP_000831422.1"; ID "nbis-exon-214"; Name "WP_000831422.1"; Parent "gene-C7A06_RS01210"; gbkey "CDS"; gene "lpfE"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000792957.1"; locus_tag "C7A06_RS01210"; product "long polar fimbrial protein LpfE"; protein_id "WP_000831422.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	232527	233051	.	+	0	gene_id "nbis-gene-205"; transcript_id "gene-C7A06_RS01210"; Dbxref "Genbank:WP_000831422.1"; ID "cds-WP_000831422.1"; Name "WP_000831422.1"; Parent "gene-C7A06_RS01210"; gbkey "CDS"; gene "lpfE"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000792957.1"; locus_tag "C7A06_RS01210"; product "long polar fimbrial protein LpfE"; protein_id "WP_000831422.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	233304	234995	.	+	.	gene_id "nbis-gene-206"; ID "nbis-gene-206"; Name "eptB"; gbkey "Gene"; gene "eptB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01215";
+NZ_CP027599.1	RefSeq	transcript	233304	234995	.	+	.	gene_id "nbis-gene-206"; transcript_id "gene-C7A06_RS01215"; ID "gene-C7A06_RS01215"; Name "eptB"; Parent "nbis-gene-206"; gbkey "Gene"; gene "eptB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01215"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	233304	234995	.	+	.	gene_id "nbis-gene-206"; transcript_id "gene-C7A06_RS01215"; Dbxref "Genbank:WP_001269224.1"; ID "nbis-exon-215"; Name "WP_001269224.1"; Ontology_term "GO:0008484"; Parent "gene-C7A06_RS01215"; gbkey "CDS"; gene "eptB"; go_function "sulfuric ester hydrolase activity|0008484||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418002.2"; locus_tag "C7A06_RS01215"; product "kdo(2)-lipid A phosphoethanolamine 7''-transferase"; protein_id "WP_001269224.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	233304	234995	.	+	0	gene_id "nbis-gene-206"; transcript_id "gene-C7A06_RS01215"; Dbxref "Genbank:WP_001269224.1"; ID "cds-WP_001269224.1"; Name "WP_001269224.1"; Ontology_term "GO:0008484"; Parent "gene-C7A06_RS01215"; gbkey "CDS"; gene "eptB"; go_function "sulfuric ester hydrolase activity|0008484||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418002.2"; locus_tag "C7A06_RS01215"; product "kdo(2)-lipid A phosphoethanolamine 7''-transferase"; protein_id "WP_001269224.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	235087	235163	.	+	.	gene_id "gene-C7A06_RS01220"; ID "gene-C7A06_RS01220"; Name "C7A06_RS01220"; gbkey "Gene"; gene_biotype "tRNA"; locus_tag "C7A06_RS01220";
+NZ_CP027599.1	tRNAscan-SE	transcript	235087	235163	.	+	.	gene_id "gene-C7A06_RS01220"; transcript_id "rna-C7A06_RS01220"; ID "rna-C7A06_RS01220"; Parent "gene-C7A06_RS01220"; anticodon "(pos:235121..235123)"; gbkey "tRNA"; inference "COORDINATES: profile:tRNAscan-SE:2.0.7"; locus_tag "C7A06_RS01220"; original_biotype "trna"; product "tRNA-Pro";
+NZ_CP027599.1	tRNAscan-SE	exon	235087	235163	.	+	.	gene_id "gene-C7A06_RS01220"; transcript_id "rna-C7A06_RS01220"; ID "exon-C7A06_RS01220-1"; Parent "rna-C7A06_RS01220"; anticodon "(pos:235121..235123)"; gbkey "tRNA"; inference "COORDINATES: profile:tRNAscan-SE:2.0.7"; locus_tag "C7A06_RS01220"; product "tRNA-Pro";
+NZ_CP027599.1	RefSeq	gene	235198	235331	.	+	.	gene_id "gene-C7A06_RS01225"; ID "gene-C7A06_RS01225"; Name "C7A06_RS01225"; gbkey "Gene"; gene_biotype "ncRNA"; locus_tag "C7A06_RS01225";
+NZ_CP027599.1	cmsearch	transcript	235198	235331	.	+	.	gene_id "gene-C7A06_RS01225"; transcript_id "rna-C7A06_RS01225"; Dbxref "RFAM:RF00391"; ID "rna-C7A06_RS01225"; Note "rtT sRNA, processed from tyrT transcript"; Parent "gene-C7A06_RS01225"; gbkey "ncRNA"; inference "COORDINATES: profile:INFERNAL:1.1.1"; locus_tag "C7A06_RS01225"; original_biotype "ncrna"; product "RtT sRNA";
+NZ_CP027599.1	cmsearch	exon	235198	235331	.	+	.	gene_id "gene-C7A06_RS01225"; transcript_id "rna-C7A06_RS01225"; Dbxref "RFAM:RF00391"; ID "exon-C7A06_RS01225-1"; Note "rtT sRNA, processed from tyrT transcript"; Parent "rna-C7A06_RS01225"; gbkey "ncRNA"; inference "COORDINATES: profile:INFERNAL:1.1.1"; locus_tag "C7A06_RS01225"; product "RtT sRNA";
+NZ_CP027599.1	RefSeq	gene	235531	236511	.	-	.	gene_id "nbis-gene-207"; ID "nbis-gene-207"; Name "C7A06_RS01235"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01235";
+NZ_CP027599.1	RefSeq	transcript	235531	236511	.	-	.	gene_id "nbis-gene-207"; transcript_id "gene-C7A06_RS01235"; ID "gene-C7A06_RS01235"; Name "C7A06_RS01235"; Parent "nbis-gene-207"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01235"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	235531	236511	.	-	.	gene_id "nbis-gene-207"; transcript_id "gene-C7A06_RS01235"; Dbxref "Genbank:WP_000399648.1"; ID "nbis-exon-216"; Name "WP_000399648.1"; Parent "gene-C7A06_RS01235"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_012904434.1"; locus_tag "C7A06_RS01235"; product "IS110-like element IS621 family transposase"; protein_id "WP_000399648.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	235531	236511	.	-	0	gene_id "nbis-gene-207"; transcript_id "gene-C7A06_RS01235"; Dbxref "Genbank:WP_000399648.1"; ID "cds-WP_000399648.1"; Name "WP_000399648.1"; Parent "gene-C7A06_RS01235"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_012904434.1"; locus_tag "C7A06_RS01235"; product "IS110-like element IS621 family transposase"; protein_id "WP_000399648.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	236503	237003	.	+	.	gene_id "nbis-gene-5830"; ID "nbis-gene-5830"; Name "C7A06_RS34810"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS34810";
+NZ_CP027599.1	RefSeq	transcript	236503	237003	.	+	.	gene_id "nbis-gene-5830"; transcript_id "gene-C7A06_RS34810"; ID "gene-C7A06_RS34810"; Name "C7A06_RS34810"; Parent "nbis-gene-5830"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS34810"; original_biotype "mrna";
+NZ_CP027599.1	GeneMarkS-2+	exon	236503	237003	.	+	.	gene_id "nbis-gene-5830"; transcript_id "gene-C7A06_RS34810"; Dbxref "Genbank:WP_000469071.1"; ID "nbis-exon-6142"; Name "WP_000469071.1"; Parent "gene-C7A06_RS34810"; gbkey "CDS"; inference "COORDINATES: ab initio prediction:GeneMarkS-2+"; locus_tag "C7A06_RS34810"; product "hypothetical protein"; protein_id "WP_000469071.1"; transl_table "11";
+NZ_CP027599.1	GeneMarkS-2+	CDS	236503	237003	.	+	0	gene_id "nbis-gene-5830"; transcript_id "gene-C7A06_RS34810"; Dbxref "Genbank:WP_000469071.1"; ID "cds-WP_000469071.1"; Name "WP_000469071.1"; Parent "gene-C7A06_RS34810"; gbkey "CDS"; inference "COORDINATES: ab initio prediction:GeneMarkS-2+"; locus_tag "C7A06_RS34810"; product "hypothetical protein"; protein_id "WP_000469071.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	237355	238962	.	+	.	gene_id "nbis-gene-208"; ID "nbis-gene-208"; Name "dppA"; gbkey "Gene"; gene "dppA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01245";
+NZ_CP027599.1	RefSeq	transcript	237355	238962	.	+	.	gene_id "nbis-gene-208"; transcript_id "gene-C7A06_RS01245"; ID "gene-C7A06_RS01245"; Name "dppA"; Parent "nbis-gene-208"; gbkey "Gene"; gene "dppA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01245"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	237355	238962	.	+	.	gene_id "nbis-gene-208"; transcript_id "gene-C7A06_RS01245"; Dbxref "Genbank:WP_001222883.1"; ID "nbis-exon-217"; Name "WP_001222883.1"; Parent "gene-C7A06_RS01245"; gbkey "CDS"; gene "dppA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418001.1"; locus_tag "C7A06_RS01245"; product "dipeptide ABC transporter substrate-binding protein DppA"; protein_id "WP_001222883.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	237355	238962	.	+	0	gene_id "nbis-gene-208"; transcript_id "gene-C7A06_RS01245"; Dbxref "Genbank:WP_001222883.1"; ID "cds-WP_001222883.1"; Name "WP_001222883.1"; Parent "gene-C7A06_RS01245"; gbkey "CDS"; gene "dppA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418001.1"; locus_tag "C7A06_RS01245"; product "dipeptide ABC transporter substrate-binding protein DppA"; protein_id "WP_001222883.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	239113	240132	.	+	.	gene_id "nbis-gene-209"; ID "nbis-gene-209"; Name "dppB"; gbkey "Gene"; gene "dppB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01255";
+NZ_CP027599.1	RefSeq	transcript	239113	240132	.	+	.	gene_id "nbis-gene-209"; transcript_id "gene-C7A06_RS01255"; ID "gene-C7A06_RS01255"; Name "dppB"; Parent "nbis-gene-209"; gbkey "Gene"; gene "dppB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01255"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	239113	240132	.	+	.	gene_id "nbis-gene-209"; transcript_id "gene-C7A06_RS01255"; Dbxref "Genbank:WP_000938864.1"; ID "nbis-exon-218"; Name "WP_000938864.1"; Parent "gene-C7A06_RS01255"; gbkey "CDS"; gene "dppB"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005133865.1"; locus_tag "C7A06_RS01255"; product "dipeptide ABC transporter permease DppB"; protein_id "WP_000938864.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	239113	240132	.	+	0	gene_id "nbis-gene-209"; transcript_id "gene-C7A06_RS01255"; Dbxref "Genbank:WP_000938864.1"; ID "cds-WP_000938864.1"; Name "WP_000938864.1"; Parent "gene-C7A06_RS01255"; gbkey "CDS"; gene "dppB"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005133865.1"; locus_tag "C7A06_RS01255"; product "dipeptide ABC transporter permease DppB"; protein_id "WP_000938864.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	240142	241044	.	+	.	gene_id "nbis-gene-210"; ID "nbis-gene-210"; Name "dppC"; gbkey "Gene"; gene "dppC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01260";
+NZ_CP027599.1	RefSeq	transcript	240142	241044	.	+	.	gene_id "nbis-gene-210"; transcript_id "gene-C7A06_RS01260"; ID "gene-C7A06_RS01260"; Name "dppC"; Parent "nbis-gene-210"; gbkey "Gene"; gene "dppC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01260"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	240142	241044	.	+	.	gene_id "nbis-gene-210"; transcript_id "gene-C7A06_RS01260"; Dbxref "Genbank:WP_000084677.1"; ID "nbis-exon-219"; Name "WP_000084677.1"; Ontology_term "GO:0055085"; Parent "gene-C7A06_RS01260"; gbkey "CDS"; gene "dppC"; go_process "transmembrane transport|0055085||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_010426221.1"; locus_tag "C7A06_RS01260"; product "dipeptide ABC transporter permease DppC"; protein_id "WP_000084677.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	240142	241044	.	+	0	gene_id "nbis-gene-210"; transcript_id "gene-C7A06_RS01260"; Dbxref "Genbank:WP_000084677.1"; ID "cds-WP_000084677.1"; Name "WP_000084677.1"; Ontology_term "GO:0055085"; Parent "gene-C7A06_RS01260"; gbkey "CDS"; gene "dppC"; go_process "transmembrane transport|0055085||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_010426221.1"; locus_tag "C7A06_RS01260"; product "dipeptide ABC transporter permease DppC"; protein_id "WP_000084677.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	241055	242038	.	+	.	gene_id "nbis-gene-211"; ID "nbis-gene-211"; Name "dppD"; gbkey "Gene"; gene "dppD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01265";
+NZ_CP027599.1	RefSeq	transcript	241055	242038	.	+	.	gene_id "nbis-gene-211"; transcript_id "gene-C7A06_RS01265"; ID "gene-C7A06_RS01265"; Name "dppD"; Parent "nbis-gene-211"; gbkey "Gene"; gene "dppD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01265"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	241055	242038	.	+	.	gene_id "nbis-gene-211"; transcript_id "gene-C7A06_RS01265"; Dbxref "Genbank:WP_001196495.1"; ID "nbis-exon-220"; Name "WP_001196495.1"; Ontology_term "GO:0015833" "GO:0000166" "GO:0005524"; Parent "gene-C7A06_RS01265"; gbkey "CDS"; gene "dppD"; go_function "nucleotide binding|0000166||IEA" "ATP binding|0005524||IEA"; go_process "peptide transport|0015833||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312448.1"; locus_tag "C7A06_RS01265"; product "dipeptide ABC transporter ATP-binding protein"; protein_id "WP_001196495.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	241055	242038	.	+	0	gene_id "nbis-gene-211"; transcript_id "gene-C7A06_RS01265"; Dbxref "Genbank:WP_001196495.1"; ID "cds-WP_001196495.1"; Name "WP_001196495.1"; Ontology_term "GO:0015833" "GO:0000166" "GO:0005524"; Parent "gene-C7A06_RS01265"; gbkey "CDS"; gene "dppD"; go_function "nucleotide binding|0000166||IEA" "ATP binding|0005524||IEA"; go_process "peptide transport|0015833||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312448.1"; locus_tag "C7A06_RS01265"; product "dipeptide ABC transporter ATP-binding protein"; protein_id "WP_001196495.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	242035	243039	.	+	.	gene_id "nbis-gene-212"; ID "nbis-gene-212"; Name "dppF"; gbkey "Gene"; gene "dppF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01270";
+NZ_CP027599.1	RefSeq	transcript	242035	243039	.	+	.	gene_id "nbis-gene-212"; transcript_id "gene-C7A06_RS01270"; ID "gene-C7A06_RS01270"; Name "dppF"; Parent "nbis-gene-212"; gbkey "Gene"; gene "dppF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01270"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	242035	243039	.	+	.	gene_id "nbis-gene-212"; transcript_id "gene-C7A06_RS01270"; Dbxref "Genbank:WP_000107031.1"; ID "nbis-exon-221"; Name "WP_000107031.1"; Parent "gene-C7A06_RS01270"; gbkey "CDS"; gene "dppF"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312447.1"; locus_tag "C7A06_RS01270"; product "dipeptide ABC transporter ATP-binding subunit DppF"; protein_id "WP_000107031.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	242035	243039	.	+	0	gene_id "nbis-gene-212"; transcript_id "gene-C7A06_RS01270"; Dbxref "Genbank:WP_000107031.1"; ID "cds-WP_000107031.1"; Name "WP_000107031.1"; Parent "gene-C7A06_RS01270"; gbkey "CDS"; gene "dppF"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312447.1"; locus_tag "C7A06_RS01270"; product "dipeptide ABC transporter ATP-binding subunit DppF"; protein_id "WP_000107031.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	243069	244340	.	-	.	gene_id "nbis-gene-213"; ID "nbis-gene-213"; Name "yhjV"; gbkey "Gene"; gene "yhjV"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01275";
+NZ_CP027599.1	RefSeq	transcript	243069	244340	.	-	.	gene_id "nbis-gene-213"; transcript_id "gene-C7A06_RS01275"; ID "gene-C7A06_RS01275"; Name "yhjV"; Parent "nbis-gene-213"; gbkey "Gene"; gene "yhjV"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01275"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	243069	244340	.	-	.	gene_id "nbis-gene-213"; transcript_id "gene-C7A06_RS01275"; Dbxref "Genbank:WP_001296805.1"; ID "nbis-exon-222"; Name "WP_001296805.1"; Parent "gene-C7A06_RS01275"; gbkey "CDS"; gene "yhjV"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417996.1"; locus_tag "C7A06_RS01275"; product "amino acid permease"; protein_id "WP_001296805.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	243069	244340	.	-	0	gene_id "nbis-gene-213"; transcript_id "gene-C7A06_RS01275"; Dbxref "Genbank:WP_001296805.1"; ID "cds-WP_001296805.1"; Name "WP_001296805.1"; Parent "gene-C7A06_RS01275"; gbkey "CDS"; gene "yhjV"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417996.1"; locus_tag "C7A06_RS01275"; product "amino acid permease"; protein_id "WP_001296805.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	244816	244923	.	+	.	gene_id "nbis-gene-214"; ID "nbis-gene-214"; Name "C7A06_RS01285"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01285";
+NZ_CP027599.1	RefSeq	transcript	244816	244923	.	+	.	gene_id "nbis-gene-214"; transcript_id "gene-C7A06_RS01285"; ID "gene-C7A06_RS01285"; Name "C7A06_RS01285"; Parent "nbis-gene-214"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01285"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	244816	244923	.	+	.	gene_id "nbis-gene-214"; transcript_id "gene-C7A06_RS01285"; Dbxref "Genbank:WP_001295224.1"; ID "nbis-exon-223"; Name "WP_001295224.1"; Parent "gene-C7A06_RS01285"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_009502657.1"; locus_tag "C7A06_RS01285"; product "type I toxin-antitoxin system toxin Ldr family protein"; protein_id "WP_001295224.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	244816	244923	.	+	0	gene_id "nbis-gene-214"; transcript_id "gene-C7A06_RS01285"; Dbxref "Genbank:WP_001295224.1"; ID "cds-WP_001295224.1"; Name "WP_001295224.1"; Parent "gene-C7A06_RS01285"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_009502657.1"; locus_tag "C7A06_RS01285"; product "type I toxin-antitoxin system toxin Ldr family protein"; protein_id "WP_001295224.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	245299	245406	.	+	.	gene_id "nbis-gene-5707"; ID "nbis-gene-5707"; Name "C7A06_RS33915"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33915";
+NZ_CP027599.1	RefSeq	transcript	245299	245406	.	+	.	gene_id "nbis-gene-5707"; transcript_id "gene-C7A06_RS33915"; ID "gene-C7A06_RS33915"; Name "C7A06_RS33915"; Parent "nbis-gene-5707"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33915"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	245299	245406	.	+	.	gene_id "nbis-gene-5707"; transcript_id "gene-C7A06_RS33915"; Dbxref "Genbank:WP_001295224.1"; ID "nbis-exon-5989"; Name "WP_001295224.1"; Parent "gene-C7A06_RS33915"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_009502657.1"; locus_tag "C7A06_RS33915"; product "type I toxin-antitoxin system toxin Ldr family protein"; protein_id "WP_001295224.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	245299	245406	.	+	0	gene_id "nbis-gene-5707"; transcript_id "gene-C7A06_RS33915"; Dbxref "Genbank:WP_001295224.1"; ID "cds-WP_001295224.1-2"; Name "WP_001295224.1"; Parent "gene-C7A06_RS33915"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_009502657.1"; locus_tag "C7A06_RS33915"; product "type I toxin-antitoxin system toxin Ldr family protein"; protein_id "WP_001295224.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	245782	245889	.	+	.	gene_id "nbis-gene-5708"; ID "nbis-gene-5708"; Name "C7A06_RS33920"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33920";
+NZ_CP027599.1	RefSeq	transcript	245782	245889	.	+	.	gene_id "nbis-gene-5708"; transcript_id "gene-C7A06_RS33920"; ID "gene-C7A06_RS33920"; Name "C7A06_RS33920"; Parent "nbis-gene-5708"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33920"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	245782	245889	.	+	.	gene_id "nbis-gene-5708"; transcript_id "gene-C7A06_RS33920"; Dbxref "Genbank:WP_001295224.1"; ID "nbis-exon-5990"; Name "WP_001295224.1"; Parent "gene-C7A06_RS33920"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_009502657.1"; locus_tag "C7A06_RS33920"; product "type I toxin-antitoxin system toxin Ldr family protein"; protein_id "WP_001295224.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	245782	245889	.	+	0	gene_id "nbis-gene-5708"; transcript_id "gene-C7A06_RS33920"; Dbxref "Genbank:WP_001295224.1"; ID "cds-WP_001295224.1-3"; Name "WP_001295224.1"; Parent "gene-C7A06_RS33920"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_009502657.1"; locus_tag "C7A06_RS33920"; product "type I toxin-antitoxin system toxin Ldr family protein"; protein_id "WP_001295224.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	246265	246372	.	+	.	gene_id "nbis-gene-215"; ID "nbis-gene-215"; Name "C7A06_RS01315"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01315";
+NZ_CP027599.1	RefSeq	transcript	246265	246372	.	+	.	gene_id "nbis-gene-215"; transcript_id "gene-C7A06_RS01315"; ID "gene-C7A06_RS01315"; Name "C7A06_RS01315"; Parent "nbis-gene-215"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01315"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	246265	246372	.	+	.	gene_id "nbis-gene-215"; transcript_id "gene-C7A06_RS01315"; Dbxref "Genbank:WP_001295224.1"; ID "nbis-exon-224"; Name "WP_001295224.1"; Parent "gene-C7A06_RS01315"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_009502657.1"; locus_tag "C7A06_RS01315"; product "type I toxin-antitoxin system toxin Ldr family protein"; protein_id "WP_001295224.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	246265	246372	.	+	0	gene_id "nbis-gene-215"; transcript_id "gene-C7A06_RS01315"; Dbxref "Genbank:WP_001295224.1"; ID "cds-WP_001295224.1-4"; Name "WP_001295224.1"; Parent "gene-C7A06_RS01315"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_009502657.1"; locus_tag "C7A06_RS01315"; product "type I toxin-antitoxin system toxin Ldr family protein"; protein_id "WP_001295224.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	246459	248138	.	-	.	gene_id "nbis-gene-216"; ID "nbis-gene-216"; Name "bcsG"; gbkey "Gene"; gene "bcsG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01320";
+NZ_CP027599.1	RefSeq	transcript	246459	248138	.	-	.	gene_id "nbis-gene-216"; transcript_id "gene-C7A06_RS01320"; ID "gene-C7A06_RS01320"; Name "bcsG"; Parent "nbis-gene-216"; gbkey "Gene"; gene "bcsG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01320"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	246459	248138	.	-	.	gene_id "nbis-gene-216"; transcript_id "gene-C7A06_RS01320"; Dbxref "Genbank:WP_000191606.1"; ID "nbis-exon-225"; Name "WP_000191606.1"; Ontology_term "GO:0030244" "GO:0003674" "GO:0005575"; Parent "gene-C7A06_RS01320"; gbkey "CDS"; gene "bcsG"; go_component "cellular_component|0005575||IEA"; go_function "molecular_function|0003674||IEA"; go_process "cellulose biosynthetic process|0030244||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312445.1"; locus_tag "C7A06_RS01320"; product "cellulose biosynthesis protein BcsG"; protein_id "WP_000191606.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	246459	248138	.	-	0	gene_id "nbis-gene-216"; transcript_id "gene-C7A06_RS01320"; Dbxref "Genbank:WP_000191606.1"; ID "cds-WP_000191606.1"; Name "WP_000191606.1"; Ontology_term "GO:0030244" "GO:0003674" "GO:0005575"; Parent "gene-C7A06_RS01320"; gbkey "CDS"; gene "bcsG"; go_component "cellular_component|0005575||IEA"; go_function "molecular_function|0003674||IEA"; go_process "cellulose biosynthetic process|0030244||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312445.1"; locus_tag "C7A06_RS01320"; product "cellulose biosynthesis protein BcsG"; protein_id "WP_000191606.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	248135	248326	.	-	.	gene_id "nbis-gene-217"; ID "nbis-gene-217"; Name "bcsF"; gbkey "Gene"; gene "bcsF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01325";
+NZ_CP027599.1	RefSeq	transcript	248135	248326	.	-	.	gene_id "nbis-gene-217"; transcript_id "gene-C7A06_RS01325"; ID "gene-C7A06_RS01325"; Name "bcsF"; Parent "nbis-gene-217"; gbkey "Gene"; gene "bcsF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01325"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	248135	248326	.	-	.	gene_id "nbis-gene-217"; transcript_id "gene-C7A06_RS01325"; Dbxref "Genbank:WP_000988308.1"; ID "nbis-exon-226"; Name "WP_000988308.1"; Ontology_term "GO:0052324" "GO:0003674" "GO:0005575"; Parent "gene-C7A06_RS01325"; gbkey "CDS"; gene "bcsF"; go_component "cellular_component|0005575||IEA"; go_function "molecular_function|0003674||IEA"; go_process "plant-type cell wall cellulose biosynthetic process|0052324||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417994.2"; locus_tag "C7A06_RS01325"; product "cellulose biosynthesis protein BcsF"; protein_id "WP_000988308.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	248135	248326	.	-	0	gene_id "nbis-gene-217"; transcript_id "gene-C7A06_RS01325"; Dbxref "Genbank:WP_000988308.1"; ID "cds-WP_000988308.1"; Name "WP_000988308.1"; Ontology_term "GO:0052324" "GO:0003674" "GO:0005575"; Parent "gene-C7A06_RS01325"; gbkey "CDS"; gene "bcsF"; go_component "cellular_component|0005575||IEA"; go_function "molecular_function|0003674||IEA"; go_process "plant-type cell wall cellulose biosynthetic process|0052324||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417994.2"; locus_tag "C7A06_RS01325"; product "cellulose biosynthesis protein BcsF"; protein_id "WP_000988308.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	248323	249894	.	-	.	gene_id "nbis-gene-218"; ID "nbis-gene-218"; Name "bcsE"; gbkey "Gene"; gene "bcsE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01330";
+NZ_CP027599.1	RefSeq	transcript	248323	249894	.	-	.	gene_id "nbis-gene-218"; transcript_id "gene-C7A06_RS01330"; ID "gene-C7A06_RS01330"; Name "bcsE"; Parent "nbis-gene-218"; gbkey "Gene"; gene "bcsE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01330"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	248323	249894	.	-	.	gene_id "nbis-gene-218"; transcript_id "gene-C7A06_RS01330"; Dbxref "Genbank:WP_001204931.1"; ID "nbis-exon-227"; Name "WP_001204931.1"; Ontology_term "GO:0035438"; Parent "gene-C7A06_RS01330"; gbkey "CDS"; gene "bcsE"; go_function "cyclic-di-GMP binding|0035438||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417993.1"; locus_tag "C7A06_RS01330"; product "cellulose biosynthesis protein BcsE"; protein_id "WP_001204931.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	248323	249894	.	-	0	gene_id "nbis-gene-218"; transcript_id "gene-C7A06_RS01330"; Dbxref "Genbank:WP_001204931.1"; ID "cds-WP_001204931.1"; Name "WP_001204931.1"; Ontology_term "GO:0035438"; Parent "gene-C7A06_RS01330"; gbkey "CDS"; gene "bcsE"; go_function "cyclic-di-GMP binding|0035438||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417993.1"; locus_tag "C7A06_RS01330"; product "cellulose biosynthesis protein BcsE"; protein_id "WP_001204931.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	250167	250355	.	+	.	gene_id "nbis-gene-219"; ID "nbis-gene-219"; Name "bcsR"; gbkey "Gene"; gene "bcsR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01335";
+NZ_CP027599.1	RefSeq	transcript	250167	250355	.	+	.	gene_id "nbis-gene-219"; transcript_id "gene-C7A06_RS01335"; ID "gene-C7A06_RS01335"; Name "bcsR"; Parent "nbis-gene-219"; gbkey "Gene"; gene "bcsR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01335"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	250167	250355	.	+	.	gene_id "nbis-gene-219"; transcript_id "gene-C7A06_RS01335"; Dbxref "Genbank:WP_001063318.1"; ID "nbis-exon-228"; Name "WP_001063318.1"; Parent "gene-C7A06_RS01335"; gbkey "CDS"; gene "bcsR"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417992.1"; locus_tag "C7A06_RS01335"; product "cellulose biosynthesis protein BcsR"; protein_id "WP_001063318.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	250167	250355	.	+	0	gene_id "nbis-gene-219"; transcript_id "gene-C7A06_RS01335"; Dbxref "Genbank:WP_001063318.1"; ID "cds-WP_001063318.1"; Name "WP_001063318.1"; Parent "gene-C7A06_RS01335"; gbkey "CDS"; gene "bcsR"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417992.1"; locus_tag "C7A06_RS01335"; product "cellulose biosynthesis protein BcsR"; protein_id "WP_001063318.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	250367	251119	.	+	.	gene_id "nbis-gene-220"; ID "nbis-gene-220"; Name "bcsQ"; gbkey "Gene"; gene "bcsQ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01340";
+NZ_CP027599.1	RefSeq	transcript	250367	251119	.	+	.	gene_id "nbis-gene-220"; transcript_id "gene-C7A06_RS01340"; ID "gene-C7A06_RS01340"; Name "bcsQ"; Parent "nbis-gene-220"; gbkey "Gene"; gene "bcsQ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01340"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	250367	251119	.	+	.	gene_id "nbis-gene-220"; transcript_id "gene-C7A06_RS01340"; Dbxref "Genbank:WP_000279530.1"; ID "nbis-exon-229"; Name "WP_000279530.1"; Parent "gene-C7A06_RS01340"; gbkey "CDS"; gene "bcsQ"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709309.1"; locus_tag "C7A06_RS01340"; product "cellulose biosynthesis protein BcsQ"; protein_id "WP_000279530.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	250367	251119	.	+	0	gene_id "nbis-gene-220"; transcript_id "gene-C7A06_RS01340"; Dbxref "Genbank:WP_000279530.1"; ID "cds-WP_000279530.1"; Name "WP_000279530.1"; Parent "gene-C7A06_RS01340"; gbkey "CDS"; gene "bcsQ"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709309.1"; locus_tag "C7A06_RS01340"; product "cellulose biosynthesis protein BcsQ"; protein_id "WP_000279530.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	251116	253734	.	+	.	gene_id "nbis-gene-221"; ID "nbis-gene-221"; Name "bcsA"; gbkey "Gene"; gene "bcsA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01345";
+NZ_CP027599.1	RefSeq	transcript	251116	253734	.	+	.	gene_id "nbis-gene-221"; transcript_id "gene-C7A06_RS01345"; ID "gene-C7A06_RS01345"; Name "bcsA"; Parent "nbis-gene-221"; gbkey "Gene"; gene "bcsA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01345"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	251116	253734	.	+	.	gene_id "nbis-gene-221"; transcript_id "gene-C7A06_RS01345"; Dbxref "Genbank:WP_000025892.1"; ID "nbis-exon-230"; Name "WP_000025892.1"; Ontology_term "GO:0006011" "GO:0030244" "GO:0016760" "GO:0035438" "GO:0016020"; Parent "gene-C7A06_RS01345"; gbkey "CDS"; gene "bcsA"; go_component "membrane|0016020||IEA"; go_function "cellulose synthase (UDP-forming) activity|0016760||IEA" "cyclic-di-GMP binding|0035438||IEA"; go_process "UDP-glucose metabolic process|0006011||IEA" "cellulose biosynthetic process|0030244||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417990.4"; locus_tag "C7A06_RS01345"; product "UDP-forming cellulose synthase catalytic subunit"; protein_id "WP_000025892.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	251116	253734	.	+	0	gene_id "nbis-gene-221"; transcript_id "gene-C7A06_RS01345"; Dbxref "Genbank:WP_000025892.1"; ID "cds-WP_000025892.1"; Name "WP_000025892.1"; Ontology_term "GO:0006011" "GO:0030244" "GO:0016760" "GO:0035438" "GO:0016020"; Parent "gene-C7A06_RS01345"; gbkey "CDS"; gene "bcsA"; go_component "membrane|0016020||IEA"; go_function "cellulose synthase (UDP-forming) activity|0016760||IEA" "cyclic-di-GMP binding|0035438||IEA"; go_process "UDP-glucose metabolic process|0006011||IEA" "cellulose biosynthetic process|0030244||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417990.4"; locus_tag "C7A06_RS01345"; product "UDP-forming cellulose synthase catalytic subunit"; protein_id "WP_000025892.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	253745	256084	.	+	.	gene_id "nbis-gene-222"; ID "nbis-gene-222"; Name "bcsB"; gbkey "Gene"; gene "bcsB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01350";
+NZ_CP027599.1	RefSeq	transcript	253745	256084	.	+	.	gene_id "nbis-gene-222"; transcript_id "gene-C7A06_RS01350"; ID "gene-C7A06_RS01350"; Name "bcsB"; Parent "nbis-gene-222"; gbkey "Gene"; gene "bcsB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01350"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	253745	256084	.	+	.	gene_id "nbis-gene-222"; transcript_id "gene-C7A06_RS01350"; Dbxref "Genbank:WP_000823624.1"; ID "nbis-exon-231"; Name "WP_000823624.1"; Parent "gene-C7A06_RS01350"; gbkey "CDS"; gene "bcsB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417989.1"; locus_tag "C7A06_RS01350"; product "cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB"; protein_id "WP_000823624.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	253745	256084	.	+	0	gene_id "nbis-gene-222"; transcript_id "gene-C7A06_RS01350"; Dbxref "Genbank:WP_000823624.1"; ID "cds-WP_000823624.1"; Name "WP_000823624.1"; Parent "gene-C7A06_RS01350"; gbkey "CDS"; gene "bcsB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417989.1"; locus_tag "C7A06_RS01350"; product "cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB"; protein_id "WP_000823624.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	256091	257197	.	+	.	gene_id "nbis-gene-223"; ID "nbis-gene-223"; Name "bcsZ"; gbkey "Gene"; gene "bcsZ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01355";
+NZ_CP027599.1	RefSeq	transcript	256091	257197	.	+	.	gene_id "nbis-gene-223"; transcript_id "gene-C7A06_RS01355"; ID "gene-C7A06_RS01355"; Name "bcsZ"; Parent "nbis-gene-223"; gbkey "Gene"; gene "bcsZ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01355"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	256091	257197	.	+	.	gene_id "nbis-gene-223"; transcript_id "gene-C7A06_RS01355"; Dbxref "Genbank:WP_001341948.1"; ID "nbis-exon-232"; Name "WP_001341948.1"; Ontology_term "GO:0005975" "GO:0004553"; Parent "gene-C7A06_RS01355"; gbkey "CDS"; gene "bcsZ"; go_function "hydrolase activity, hydrolyzing O-glycosyl compounds|0004553||IEA"; go_process "carbohydrate metabolic process|0005975||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312438.1"; locus_tag "C7A06_RS01355"; product "cellulose synthase complex periplasmic endoglucanase BcsZ"; protein_id "WP_001341948.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	256091	257197	.	+	0	gene_id "nbis-gene-223"; transcript_id "gene-C7A06_RS01355"; Dbxref "Genbank:WP_001341948.1"; ID "cds-WP_001341948.1"; Name "WP_001341948.1"; Ontology_term "GO:0005975" "GO:0004553"; Parent "gene-C7A06_RS01355"; gbkey "CDS"; gene "bcsZ"; go_function "hydrolase activity, hydrolyzing O-glycosyl compounds|0004553||IEA"; go_process "carbohydrate metabolic process|0005975||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312438.1"; locus_tag "C7A06_RS01355"; product "cellulose synthase complex periplasmic endoglucanase BcsZ"; protein_id "WP_001341948.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	257179	260652	.	+	.	gene_id "nbis-gene-224"; ID "nbis-gene-224"; Name "bcsC"; gbkey "Gene"; gene "bcsC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01360";
+NZ_CP027599.1	RefSeq	transcript	257179	260652	.	+	.	gene_id "nbis-gene-224"; transcript_id "gene-C7A06_RS01360"; ID "gene-C7A06_RS01360"; Name "bcsC"; Parent "nbis-gene-224"; gbkey "Gene"; gene "bcsC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01360"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	257179	260652	.	+	.	gene_id "nbis-gene-224"; transcript_id "gene-C7A06_RS01360"; Dbxref "Genbank:WP_001225108.1"; ID "nbis-exon-233"; Name "WP_001225108.1"; Ontology_term "GO:0030244" "GO:0005515" "GO:0019867"; Parent "gene-C7A06_RS01360"; gbkey "CDS"; gene "bcsC"; go_component "outer membrane|0019867||IEA"; go_function "protein binding|0005515||IEA"; go_process "cellulose biosynthetic process|0030244||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_026226.4"; locus_tag "C7A06_RS01360"; product "cellulose synthase complex outer membrane protein BcsC"; protein_id "WP_001225108.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	257179	260652	.	+	0	gene_id "nbis-gene-224"; transcript_id "gene-C7A06_RS01360"; Dbxref "Genbank:WP_001225108.1"; ID "cds-WP_001225108.1"; Name "WP_001225108.1"; Ontology_term "GO:0030244" "GO:0005515" "GO:0019867"; Parent "gene-C7A06_RS01360"; gbkey "CDS"; gene "bcsC"; go_component "outer membrane|0019867||IEA"; go_function "protein binding|0005515||IEA"; go_process "cellulose biosynthetic process|0030244||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_026226.4"; locus_tag "C7A06_RS01360"; product "cellulose synthase complex outer membrane protein BcsC"; protein_id "WP_001225108.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	260734	262722	.	+	.	gene_id "nbis-gene-225"; ID "nbis-gene-225"; Name "hmsP"; gbkey "Gene"; gene "hmsP"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01365";
+NZ_CP027599.1	RefSeq	transcript	260734	262722	.	+	.	gene_id "nbis-gene-225"; transcript_id "gene-C7A06_RS01365"; ID "gene-C7A06_RS01365"; Name "hmsP"; Parent "nbis-gene-225"; gbkey "Gene"; gene "hmsP"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01365"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	260734	262722	.	+	.	gene_id "nbis-gene-225"; transcript_id "gene-C7A06_RS01365"; Dbxref "Genbank:WP_001266286.1"; ID "nbis-exon-234"; Name "WP_001266286.1"; Ontology_term "GO:0007165"; Parent "gene-C7A06_RS01365"; gbkey "CDS"; gene "hmsP"; go_process "signal transduction|0007165||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417986.4"; locus_tag "C7A06_RS01365"; product "biofilm formation regulator HmsP"; protein_id "WP_001266286.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	260734	262722	.	+	0	gene_id "nbis-gene-225"; transcript_id "gene-C7A06_RS01365"; Dbxref "Genbank:WP_001266286.1"; ID "cds-WP_001266286.1"; Name "WP_001266286.1"; Ontology_term "GO:0007165"; Parent "gene-C7A06_RS01365"; gbkey "CDS"; gene "hmsP"; go_process "signal transduction|0007165||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417986.4"; locus_tag "C7A06_RS01365"; product "biofilm formation regulator HmsP"; protein_id "WP_001266286.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	262905	264191	.	+	.	gene_id "nbis-gene-226"; ID "nbis-gene-226"; Name "dctA"; gbkey "Gene"; gene "dctA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01375";
+NZ_CP027599.1	RefSeq	transcript	262905	264191	.	+	.	gene_id "nbis-gene-226"; transcript_id "gene-C7A06_RS01375"; ID "gene-C7A06_RS01375"; Name "dctA"; Parent "nbis-gene-226"; gbkey "Gene"; gene "dctA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01375"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	262905	264191	.	+	.	gene_id "nbis-gene-226"; transcript_id "gene-C7A06_RS01375"; Dbxref "Genbank:WP_044164517.1"; ID "nbis-exon-235"; Name "WP_044164517.1"; Parent "gene-C7A06_RS01375"; gbkey "CDS"; gene "dctA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417985.1"; locus_tag "C7A06_RS01375"; product "C4-dicarboxylate transporter DctC"; protein_id "WP_044164517.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	262905	264191	.	+	0	gene_id "nbis-gene-226"; transcript_id "gene-C7A06_RS01375"; Dbxref "Genbank:WP_044164517.1"; ID "cds-WP_044164517.1"; Name "WP_044164517.1"; Parent "gene-C7A06_RS01375"; gbkey "CDS"; gene "dctA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417985.1"; locus_tag "C7A06_RS01375"; product "C4-dicarboxylate transporter DctC"; protein_id "WP_044164517.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	264411	265907	.	+	.	gene_id "nbis-gene-227"; ID "nbis-gene-227"; Name "yhjJ"; gbkey "Gene"; gene "yhjJ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01385";
+NZ_CP027599.1	RefSeq	transcript	264411	265907	.	+	.	gene_id "nbis-gene-227"; transcript_id "gene-C7A06_RS01385"; ID "gene-C7A06_RS01385"; Name "yhjJ"; Parent "nbis-gene-227"; gbkey "Gene"; gene "yhjJ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01385"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	264411	265907	.	+	.	gene_id "nbis-gene-227"; transcript_id "gene-C7A06_RS01385"; Dbxref "Genbank:WP_001163135.1"; ID "nbis-exon-236"; Name "WP_001163135.1"; Parent "gene-C7A06_RS01385"; gbkey "CDS"; gene "yhjJ"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312434.1"; locus_tag "C7A06_RS01385"; product "insulinase family protein"; protein_id "WP_001163135.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	264411	265907	.	+	0	gene_id "nbis-gene-227"; transcript_id "gene-C7A06_RS01385"; Dbxref "Genbank:WP_001163135.1"; ID "cds-WP_001163135.1"; Name "WP_001163135.1"; Parent "gene-C7A06_RS01385"; gbkey "CDS"; gene "yhjJ"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312434.1"; locus_tag "C7A06_RS01385"; product "insulinase family protein"; protein_id "WP_001163135.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	266003	266932	.	-	.	gene_id "nbis-gene-228"; ID "nbis-gene-228"; Name "kdgK"; gbkey "Gene"; gene "kdgK"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01390";
+NZ_CP027599.1	RefSeq	transcript	266003	266932	.	-	.	gene_id "nbis-gene-228"; transcript_id "gene-C7A06_RS01390"; ID "gene-C7A06_RS01390"; Name "kdgK"; Parent "nbis-gene-228"; gbkey "Gene"; gene "kdgK"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01390"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	266003	266932	.	-	.	gene_id "nbis-gene-228"; transcript_id "gene-C7A06_RS01390"; Dbxref "Genbank:WP_001296796.1"; ID "nbis-exon-237"; Name "WP_001296796.1"; Parent "gene-C7A06_RS01390"; gbkey "CDS"; gene "kdgK"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417983.2"; locus_tag "C7A06_RS01390"; product "2-dehydro-3-deoxygluconokinase"; protein_id "WP_001296796.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	266003	266932	.	-	0	gene_id "nbis-gene-228"; transcript_id "gene-C7A06_RS01390"; Dbxref "Genbank:WP_001296796.1"; ID "cds-WP_001296796.1"; Name "WP_001296796.1"; Parent "gene-C7A06_RS01390"; gbkey "CDS"; gene "kdgK"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417983.2"; locus_tag "C7A06_RS01390"; product "2-dehydro-3-deoxygluconokinase"; protein_id "WP_001296796.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	267164	267931	.	+	.	gene_id "nbis-gene-229"; ID "nbis-gene-229"; Name "pdeH"; gbkey "Gene"; gene "pdeH"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01400";
+NZ_CP027599.1	RefSeq	transcript	267164	267931	.	+	.	gene_id "nbis-gene-229"; transcript_id "gene-C7A06_RS01400"; ID "gene-C7A06_RS01400"; Name "pdeH"; Parent "nbis-gene-229"; gbkey "Gene"; gene "pdeH"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01400"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	267164	267931	.	+	.	gene_id "nbis-gene-229"; transcript_id "gene-C7A06_RS01400"; Dbxref "Genbank:WP_001295219.1"; ID "nbis-exon-238"; Name "WP_001295219.1"; Parent "gene-C7A06_RS01400"; gbkey "CDS"; gene "pdeH"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417982.2"; locus_tag "C7A06_RS01400"; product "cyclic-guanylate-specific phosphodiesterase"; protein_id "WP_001295219.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	267164	267931	.	+	0	gene_id "nbis-gene-229"; transcript_id "gene-C7A06_RS01400"; Dbxref "Genbank:WP_001295219.1"; ID "cds-WP_001295219.1"; Name "WP_001295219.1"; Parent "gene-C7A06_RS01400"; gbkey "CDS"; gene "pdeH"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417982.2"; locus_tag "C7A06_RS01400"; product "cyclic-guanylate-specific phosphodiesterase"; protein_id "WP_001295219.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	268001	270061	.	+	.	gene_id "nbis-gene-230"; ID "nbis-gene-230"; Name "yhjG"; gbkey "Gene"; gene "yhjG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01405";
+NZ_CP027599.1	RefSeq	transcript	268001	270061	.	+	.	gene_id "nbis-gene-230"; transcript_id "gene-C7A06_RS01405"; ID "gene-C7A06_RS01405"; Name "yhjG"; Parent "nbis-gene-230"; gbkey "Gene"; gene "yhjG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01405"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	268001	270061	.	+	.	gene_id "nbis-gene-230"; transcript_id "gene-C7A06_RS01405"; Dbxref "Genbank:WP_001344892.1"; ID "nbis-exon-239"; Name "WP_001344892.1"; Parent "gene-C7A06_RS01405"; gbkey "CDS"; gene "yhjG"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417981.2"; locus_tag "C7A06_RS01405"; product "AsmA family protein"; protein_id "WP_001344892.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	268001	270061	.	+	0	gene_id "nbis-gene-230"; transcript_id "gene-C7A06_RS01405"; Dbxref "Genbank:WP_001344892.1"; ID "cds-WP_001344892.1"; Name "WP_001344892.1"; Parent "gene-C7A06_RS01405"; gbkey "CDS"; gene "yhjG"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417981.2"; locus_tag "C7A06_RS01405"; product "AsmA family protein"; protein_id "WP_001344892.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	270295	271617	.	-	.	gene_id "nbis-gene-231"; ID "nbis-gene-231"; Name "yhjE"; gbkey "Gene"; gene "yhjE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01410";
+NZ_CP027599.1	RefSeq	transcript	270295	271617	.	-	.	gene_id "nbis-gene-231"; transcript_id "gene-C7A06_RS01410"; ID "gene-C7A06_RS01410"; Name "yhjE"; Parent "nbis-gene-231"; gbkey "Gene"; gene "yhjE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01410"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	270295	271617	.	-	.	gene_id "nbis-gene-231"; transcript_id "gene-C7A06_RS01410"; Dbxref "Genbank:WP_001149002.1"; ID "nbis-exon-240"; Name "WP_001149002.1"; Parent "gene-C7A06_RS01410"; gbkey "CDS"; gene "yhjE"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417980.1"; locus_tag "C7A06_RS01410"; product "MHS family MFS transporter"; protein_id "WP_001149002.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	270295	271617	.	-	0	gene_id "nbis-gene-231"; transcript_id "gene-C7A06_RS01410"; Dbxref "Genbank:WP_001149002.1"; ID "cds-WP_001149002.1"; Name "WP_001149002.1"; Parent "gene-C7A06_RS01410"; gbkey "CDS"; gene "yhjE"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417980.1"; locus_tag "C7A06_RS01410"; product "MHS family MFS transporter"; protein_id "WP_001149002.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	272028	273041	.	-	.	gene_id "nbis-gene-232"; ID "nbis-gene-232"; Name "yhjD"; gbkey "Gene"; gene "yhjD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01415";
+NZ_CP027599.1	RefSeq	transcript	272028	273041	.	-	.	gene_id "nbis-gene-232"; transcript_id "gene-C7A06_RS01415"; ID "gene-C7A06_RS01415"; Name "yhjD"; Parent "nbis-gene-232"; gbkey "Gene"; gene "yhjD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01415"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	272028	273041	.	-	.	gene_id "nbis-gene-232"; transcript_id "gene-C7A06_RS01415"; Dbxref "Genbank:WP_000191257.1"; ID "nbis-exon-241"; Name "WP_000191257.1"; Parent "gene-C7A06_RS01415"; gbkey "CDS"; gene "yhjD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312429.1"; locus_tag "C7A06_RS01415"; product "inner membrane protein YhjD"; protein_id "WP_000191257.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	272028	273041	.	-	0	gene_id "nbis-gene-232"; transcript_id "gene-C7A06_RS01415"; Dbxref "Genbank:WP_000191257.1"; ID "cds-WP_000191257.1"; Name "WP_000191257.1"; Parent "gene-C7A06_RS01415"; gbkey "CDS"; gene "yhjD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312429.1"; locus_tag "C7A06_RS01415"; product "inner membrane protein YhjD"; protein_id "WP_000191257.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	273090	273989	.	-	.	gene_id "nbis-gene-233"; ID "nbis-gene-233"; Name "rcdB"; gbkey "Gene"; gene "rcdB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01420";
+NZ_CP027599.1	RefSeq	transcript	273090	273989	.	-	.	gene_id "nbis-gene-233"; transcript_id "gene-C7A06_RS01420"; ID "gene-C7A06_RS01420"; Name "rcdB"; Parent "nbis-gene-233"; gbkey "Gene"; gene "rcdB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01420"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	273090	273989	.	-	.	gene_id "nbis-gene-233"; transcript_id "gene-C7A06_RS01420"; Dbxref "Genbank:WP_001307449.1"; ID "nbis-exon-242"; Name "WP_001307449.1"; Parent "gene-C7A06_RS01420"; gbkey "CDS"; gene "rcdB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417978.2"; locus_tag "C7A06_RS01420"; product "LysR family transcriptional regulator"; protein_id "WP_001307449.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	273090	273989	.	-	0	gene_id "nbis-gene-233"; transcript_id "gene-C7A06_RS01420"; Dbxref "Genbank:WP_001307449.1"; ID "cds-WP_001307449.1"; Name "WP_001307449.1"; Parent "gene-C7A06_RS01420"; gbkey "CDS"; gene "rcdB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417978.2"; locus_tag "C7A06_RS01420"; product "LysR family transcriptional regulator"; protein_id "WP_001307449.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	274509	275111	.	+	.	gene_id "nbis-gene-234"; ID "nbis-gene-234"; Name "yhjB"; gbkey "Gene"; gene "yhjB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01425";
+NZ_CP027599.1	RefSeq	transcript	274509	275111	.	+	.	gene_id "nbis-gene-234"; transcript_id "gene-C7A06_RS01425"; ID "gene-C7A06_RS01425"; Name "yhjB"; Parent "nbis-gene-234"; gbkey "Gene"; gene "yhjB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01425"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	274509	275111	.	+	.	gene_id "nbis-gene-234"; transcript_id "gene-C7A06_RS01425"; Dbxref "Genbank:WP_001167676.1"; ID "nbis-exon-243"; Name "WP_001167676.1"; Parent "gene-C7A06_RS01425"; gbkey "CDS"; gene "yhjB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417977.1"; locus_tag "C7A06_RS01425"; product "response regulator transcription factor"; protein_id "WP_001167676.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	274509	275111	.	+	0	gene_id "nbis-gene-234"; transcript_id "gene-C7A06_RS01425"; Dbxref "Genbank:WP_001167676.1"; ID "cds-WP_001167676.1"; Name "WP_001167676.1"; Parent "gene-C7A06_RS01425"; gbkey "CDS"; gene "yhjB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417977.1"; locus_tag "C7A06_RS01425"; product "response regulator transcription factor"; protein_id "WP_001167676.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	275162	276811	.	-	.	gene_id "nbis-gene-235"; ID "nbis-gene-235"; Name "treF"; gbkey "Gene"; gene "treF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01430";
+NZ_CP027599.1	RefSeq	transcript	275162	276811	.	-	.	gene_id "nbis-gene-235"; transcript_id "gene-C7A06_RS01430"; ID "gene-C7A06_RS01430"; Name "treF"; Parent "nbis-gene-235"; gbkey "Gene"; gene "treF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01430"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	275162	276811	.	-	.	gene_id "nbis-gene-235"; transcript_id "gene-C7A06_RS01430"; Dbxref "Genbank:WP_000934218.1"; ID "nbis-exon-244"; Name "WP_000934218.1"; Parent "gene-C7A06_RS01430"; gbkey "CDS"; gene "treF"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709297.1"; locus_tag "C7A06_RS01430"; product "alpha,alpha-trehalase"; protein_id "WP_000934218.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	275162	276811	.	-	0	gene_id "nbis-gene-235"; transcript_id "gene-C7A06_RS01430"; Dbxref "Genbank:WP_000934218.1"; ID "cds-WP_000934218.1"; Name "WP_000934218.1"; Parent "gene-C7A06_RS01430"; gbkey "CDS"; gene "treF"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709297.1"; locus_tag "C7A06_RS01430"; product "alpha,alpha-trehalase"; protein_id "WP_000934218.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	277216	278613	.	+	.	gene_id "nbis-gene-236"; ID "nbis-gene-236"; Name "ccp"; gbkey "Gene"; gene "ccp"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01435";
+NZ_CP027599.1	RefSeq	transcript	277216	278613	.	+	.	gene_id "nbis-gene-236"; transcript_id "gene-C7A06_RS01435"; ID "gene-C7A06_RS01435"; Name "ccp"; Parent "nbis-gene-236"; gbkey "Gene"; gene "ccp"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01435"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	277216	278613	.	+	.	gene_id "nbis-gene-236"; transcript_id "gene-C7A06_RS01435"; Dbxref "Genbank:WP_000784821.1"; ID "nbis-exon-245"; Name "WP_000784821.1"; Parent "gene-C7A06_RS01435"; gbkey "CDS"; gene "ccp"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312425.1"; locus_tag "C7A06_RS01435"; product "cytochrome c peroxidase"; protein_id "WP_000784821.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	277216	278613	.	+	0	gene_id "nbis-gene-236"; transcript_id "gene-C7A06_RS01435"; Dbxref "Genbank:WP_000784821.1"; ID "cds-WP_000784821.1"; Name "WP_000784821.1"; Parent "gene-C7A06_RS01435"; gbkey "CDS"; gene "ccp"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312425.1"; locus_tag "C7A06_RS01435"; product "cytochrome c peroxidase"; protein_id "WP_000784821.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	278824	280224	.	+	.	gene_id "nbis-gene-237"; ID "nbis-gene-237"; Name "gadA"; gbkey "Gene"; gene "gadA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01440";
+NZ_CP027599.1	RefSeq	transcript	278824	280224	.	+	.	gene_id "nbis-gene-237"; transcript_id "gene-C7A06_RS01440"; ID "gene-C7A06_RS01440"; Name "gadA"; Parent "nbis-gene-237"; gbkey "Gene"; gene "gadA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01440"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	278824	280224	.	+	.	gene_id "nbis-gene-237"; transcript_id "gene-C7A06_RS01440"; Dbxref "Genbank:WP_000372240.1"; ID "nbis-exon-246"; Name "WP_000372240.1"; Ontology_term "GO:0006540" "GO:0004351"; Parent "gene-C7A06_RS01440"; gbkey "CDS"; gene "gadA"; go_function "glutamate decarboxylase activity|0004351||IEA"; go_process "glutamate decarboxylation to succinate|0006540||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417974.1"; locus_tag "C7A06_RS01440"; product "glutamate decarboxylase"; protein_id "WP_000372240.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	278824	280224	.	+	0	gene_id "nbis-gene-237"; transcript_id "gene-C7A06_RS01440"; Dbxref "Genbank:WP_000372240.1"; ID "cds-WP_000372240.1"; Name "WP_000372240.1"; Ontology_term "GO:0006540" "GO:0004351"; Parent "gene-C7A06_RS01440"; gbkey "CDS"; gene "gadA"; go_function "glutamate decarboxylase activity|0004351||IEA"; go_process "glutamate decarboxylation to succinate|0006540||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417974.1"; locus_tag "C7A06_RS01440"; product "glutamate decarboxylase"; protein_id "WP_000372240.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	280594	281418	.	+	.	gene_id "nbis-gene-238"; ID "nbis-gene-238"; Name "gadX"; gbkey "Gene"; gene "gadX"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01445";
+NZ_CP027599.1	RefSeq	transcript	280594	281418	.	+	.	gene_id "nbis-gene-238"; transcript_id "gene-C7A06_RS01445"; ID "gene-C7A06_RS01445"; Name "gadX"; Parent "nbis-gene-238"; gbkey "Gene"; gene "gadX"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01445"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	280594	281418	.	+	.	gene_id "nbis-gene-238"; transcript_id "gene-C7A06_RS01445"; Dbxref "Genbank:WP_001191068.1"; ID "nbis-exon-247"; Name "WP_001191068.1"; Parent "gene-C7A06_RS01445"; gbkey "CDS"; gene "gadX"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709339.1"; locus_tag "C7A06_RS01445"; product "acid resistance transcriptional activator GadX"; protein_id "WP_001191068.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	280594	281418	.	+	0	gene_id "nbis-gene-238"; transcript_id "gene-C7A06_RS01445"; Dbxref "Genbank:WP_001191068.1"; ID "cds-WP_001191068.1"; Name "WP_001191068.1"; Parent "gene-C7A06_RS01445"; gbkey "CDS"; gene "gadX"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709339.1"; locus_tag "C7A06_RS01445"; product "acid resistance transcriptional activator GadX"; protein_id "WP_001191068.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	281786	282514	.	+	.	gene_id "nbis-gene-239"; ID "nbis-gene-239"; Name "gadW"; gbkey "Gene"; gene "gadW"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01450";
+NZ_CP027599.1	RefSeq	transcript	281786	282514	.	+	.	gene_id "nbis-gene-239"; transcript_id "gene-C7A06_RS01450"; ID "gene-C7A06_RS01450"; Name "gadW"; Parent "nbis-gene-239"; gbkey "Gene"; gene "gadW"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01450"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	281786	282514	.	+	.	gene_id "nbis-gene-239"; transcript_id "gene-C7A06_RS01450"; Dbxref "Genbank:WP_000149991.1"; ID "nbis-exon-248"; Name "WP_000149991.1"; Parent "gene-C7A06_RS01450"; gbkey "CDS"; gene "gadW"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312422.1"; locus_tag "C7A06_RS01450"; product "acid resistance transcriptional activator GadW"; protein_id "WP_000149991.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	281786	282514	.	+	0	gene_id "nbis-gene-239"; transcript_id "gene-C7A06_RS01450"; Dbxref "Genbank:WP_000149991.1"; ID "cds-WP_000149991.1"; Name "WP_000149991.1"; Parent "gene-C7A06_RS01450"; gbkey "CDS"; gene "gadW"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312422.1"; locus_tag "C7A06_RS01450"; product "acid resistance transcriptional activator GadW"; protein_id "WP_000149991.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	282877	285990	.	-	.	gene_id "nbis-gene-240"; ID "nbis-gene-240"; Name "mdtF"; gbkey "Gene"; gene "mdtF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01460";
+NZ_CP027599.1	RefSeq	transcript	282877	285990	.	-	.	gene_id "nbis-gene-240"; transcript_id "gene-C7A06_RS01460"; ID "gene-C7A06_RS01460"; Name "mdtF"; Parent "nbis-gene-240"; gbkey "Gene"; gene "mdtF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01460"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	282877	285990	.	-	.	gene_id "nbis-gene-240"; transcript_id "gene-C7A06_RS01460"; Dbxref "Genbank:WP_000024892.1"; ID "nbis-exon-249"; Name "WP_000024892.1"; Parent "gene-C7A06_RS01460"; gbkey "CDS"; gene "mdtF"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312421.1"; locus_tag "C7A06_RS01460"; product "multidrug efflux pump RND permease MdtF"; protein_id "WP_000024892.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	282877	285990	.	-	0	gene_id "nbis-gene-240"; transcript_id "gene-C7A06_RS01460"; Dbxref "Genbank:WP_000024892.1"; ID "cds-WP_000024892.1"; Name "WP_000024892.1"; Parent "gene-C7A06_RS01460"; gbkey "CDS"; gene "mdtF"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312421.1"; locus_tag "C7A06_RS01460"; product "multidrug efflux pump RND permease MdtF"; protein_id "WP_000024892.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	286015	287172	.	-	.	gene_id "nbis-gene-241"; ID "nbis-gene-241"; Name "mdtE"; gbkey "Gene"; gene "mdtE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01465";
+NZ_CP027599.1	RefSeq	transcript	286015	287172	.	-	.	gene_id "nbis-gene-241"; transcript_id "gene-C7A06_RS01465"; ID "gene-C7A06_RS01465"; Name "mdtE"; Parent "nbis-gene-241"; gbkey "Gene"; gene "mdtE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01465"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	286015	287172	.	-	.	gene_id "nbis-gene-241"; transcript_id "gene-C7A06_RS01465"; Dbxref "Genbank:WP_001081984.1"; ID "nbis-exon-250"; Name "WP_001081984.1"; Parent "gene-C7A06_RS01465"; gbkey "CDS"; gene "mdtE"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417970.1"; locus_tag "C7A06_RS01465"; product "multidrug transporter subunit MdtE"; protein_id "WP_001081984.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	286015	287172	.	-	0	gene_id "nbis-gene-241"; transcript_id "gene-C7A06_RS01465"; Dbxref "Genbank:WP_001081984.1"; ID "cds-WP_001081984.1"; Name "WP_001081984.1"; Parent "gene-C7A06_RS01465"; gbkey "CDS"; gene "mdtE"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417970.1"; locus_tag "C7A06_RS01465"; product "multidrug transporter subunit MdtE"; protein_id "WP_001081984.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	287232	287510	.	+	.	gene_id "nbis-gene-242"; ID "nbis-gene-242"; Name "C7A06_RS01470"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01470";
+NZ_CP027599.1	RefSeq	transcript	287232	287510	.	+	.	gene_id "nbis-gene-242"; transcript_id "gene-C7A06_RS01470"; ID "gene-C7A06_RS01470"; Name "C7A06_RS01470"; Parent "nbis-gene-242"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01470"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	287232	287510	.	+	.	gene_id "nbis-gene-242"; transcript_id "gene-C7A06_RS01470"; Dbxref "Genbank:WP_001205329.1"; ID "nbis-exon-251"; Name "WP_001205329.1"; Parent "gene-C7A06_RS01470"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_009502656.1"; locus_tag "C7A06_RS01470"; product "hypothetical protein"; protein_id "WP_001205329.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	287232	287510	.	+	0	gene_id "nbis-gene-242"; transcript_id "gene-C7A06_RS01470"; Dbxref "Genbank:WP_001205329.1"; ID "cds-WP_001205329.1"; Name "WP_001205329.1"; Parent "gene-C7A06_RS01470"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_009502656.1"; locus_tag "C7A06_RS01470"; product "hypothetical protein"; protein_id "WP_001205329.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	287511	288038	.	-	.	gene_id "nbis-gene-243"; ID "nbis-gene-243"; Name "gadE"; gbkey "Gene"; gene "gadE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01475";
+NZ_CP027599.1	RefSeq	transcript	287511	288038	.	-	.	gene_id "nbis-gene-243"; transcript_id "gene-C7A06_RS01475"; ID "gene-C7A06_RS01475"; Name "gadE"; Parent "nbis-gene-243"; gbkey "Gene"; gene "gadE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01475"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	287511	288038	.	-	.	gene_id "nbis-gene-243"; transcript_id "gene-C7A06_RS01475"; Dbxref "Genbank:WP_000576690.1"; ID "nbis-exon-252"; Name "WP_000576690.1"; Parent "gene-C7A06_RS01475"; gbkey "CDS"; gene "gadE"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312419.1"; locus_tag "C7A06_RS01475"; product "acid resistance transcriptional activator GadE"; protein_id "WP_000576690.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	287511	288038	.	-	0	gene_id "nbis-gene-243"; transcript_id "gene-C7A06_RS01475"; Dbxref "Genbank:WP_000576690.1"; ID "cds-WP_000576690.1"; Name "WP_000576690.1"; Parent "gene-C7A06_RS01475"; gbkey "CDS"; gene "gadE"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312419.1"; locus_tag "C7A06_RS01475"; product "acid resistance transcriptional activator GadE"; protein_id "WP_000576690.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	288837	289409	.	-	.	gene_id "nbis-gene-244"; ID "nbis-gene-244"; Name "hdeD"; gbkey "Gene"; gene "hdeD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01480";
+NZ_CP027599.1	RefSeq	transcript	288837	289409	.	-	.	gene_id "nbis-gene-244"; transcript_id "gene-C7A06_RS01480"; ID "gene-C7A06_RS01480"; Name "hdeD"; Parent "nbis-gene-244"; gbkey "Gene"; gene "hdeD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01480"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	288837	289409	.	-	.	gene_id "nbis-gene-244"; transcript_id "gene-C7A06_RS01480"; Dbxref "Genbank:WP_000965672.1"; ID "nbis-exon-253"; Name "WP_000965672.1"; Parent "gene-C7A06_RS01480"; gbkey "CDS"; gene "hdeD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312418.1"; locus_tag "C7A06_RS01480"; product "acid-resistance protein HdeD"; protein_id "WP_000965672.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	288837	289409	.	-	0	gene_id "nbis-gene-244"; transcript_id "gene-C7A06_RS01480"; Dbxref "Genbank:WP_000965672.1"; ID "cds-WP_000965672.1"; Name "WP_000965672.1"; Parent "gene-C7A06_RS01480"; gbkey "CDS"; gene "hdeD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312418.1"; locus_tag "C7A06_RS01480"; product "acid-resistance protein HdeD"; protein_id "WP_000965672.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	289664	289996	.	+	.	gene_id "nbis-gene-245"; ID "nbis-gene-245"; Name "hdeA"; gbkey "Gene"; gene "hdeA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01485";
+NZ_CP027599.1	RefSeq	transcript	289664	289996	.	+	.	gene_id "nbis-gene-245"; transcript_id "gene-C7A06_RS01485"; ID "gene-C7A06_RS01485"; Name "hdeA"; Parent "nbis-gene-245"; gbkey "Gene"; gene "hdeA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01485"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	289664	289996	.	+	.	gene_id "nbis-gene-245"; transcript_id "gene-C7A06_RS01485"; Dbxref "Genbank:WP_000756550.1"; ID "nbis-exon-254"; Name "WP_000756550.1"; Parent "gene-C7A06_RS01485"; gbkey "CDS"; gene "hdeA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312417.1"; locus_tag "C7A06_RS01485"; product "acid-activated periplasmic chaperone HdeA"; protein_id "WP_000756550.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	289664	289996	.	+	0	gene_id "nbis-gene-245"; transcript_id "gene-C7A06_RS01485"; Dbxref "Genbank:WP_000756550.1"; ID "cds-WP_000756550.1"; Name "WP_000756550.1"; Parent "gene-C7A06_RS01485"; gbkey "CDS"; gene "hdeA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312417.1"; locus_tag "C7A06_RS01485"; product "acid-activated periplasmic chaperone HdeA"; protein_id "WP_000756550.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	290112	290438	.	+	.	gene_id "nbis-gene-246"; ID "nbis-gene-246"; Name "hdeB"; gbkey "Gene"; gene "hdeB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01490";
+NZ_CP027599.1	RefSeq	transcript	290112	290438	.	+	.	gene_id "nbis-gene-246"; transcript_id "gene-C7A06_RS01490"; ID "gene-C7A06_RS01490"; Name "hdeB"; Parent "nbis-gene-246"; gbkey "Gene"; gene "hdeB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01490"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	290112	290438	.	+	.	gene_id "nbis-gene-246"; transcript_id "gene-C7A06_RS01490"; Dbxref "Genbank:WP_001298717.1"; ID "nbis-exon-255"; Name "WP_001298717.1"; Parent "gene-C7A06_RS01490"; gbkey "CDS"; gene "hdeB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417966.4"; locus_tag "C7A06_RS01490"; product "acid-activated periplasmic chaperone HdeB"; protein_id "WP_001298717.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	290112	290438	.	+	0	gene_id "nbis-gene-246"; transcript_id "gene-C7A06_RS01490"; Dbxref "Genbank:WP_001298717.1"; ID "cds-WP_001298717.1"; Name "WP_001298717.1"; Parent "gene-C7A06_RS01490"; gbkey "CDS"; gene "hdeB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417966.4"; locus_tag "C7A06_RS01490"; product "acid-activated periplasmic chaperone HdeB"; protein_id "WP_001298717.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	290502	291149	.	+	.	gene_id "nbis-gene-247"; ID "nbis-gene-247"; Name "yhiD"; gbkey "Gene"; gene "yhiD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01495";
+NZ_CP027599.1	RefSeq	transcript	290502	291149	.	+	.	gene_id "nbis-gene-247"; transcript_id "gene-C7A06_RS01495"; ID "gene-C7A06_RS01495"; Name "yhiD"; Parent "nbis-gene-247"; gbkey "Gene"; gene "yhiD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01495"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	290502	291149	.	+	.	gene_id "nbis-gene-247"; transcript_id "gene-C7A06_RS01495"; Dbxref "Genbank:WP_001341943.1"; ID "nbis-exon-256"; Name "WP_001341943.1"; Parent "gene-C7A06_RS01495"; gbkey "CDS"; gene "yhiD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417965.1"; locus_tag "C7A06_RS01495"; product "MgtC/SapB family protein"; protein_id "WP_001341943.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	290502	291149	.	+	0	gene_id "nbis-gene-247"; transcript_id "gene-C7A06_RS01495"; Dbxref "Genbank:WP_001341943.1"; ID "cds-WP_001341943.1"; Name "WP_001341943.1"; Parent "gene-C7A06_RS01495"; gbkey "CDS"; gene "yhiD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417965.1"; locus_tag "C7A06_RS01495"; product "MgtC/SapB family protein"; protein_id "WP_001341943.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	291191	291721	.	-	.	gene_id "nbis-gene-248"; ID "nbis-gene-248"; Name "dctR"; gbkey "Gene"; gene "dctR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01500";
+NZ_CP027599.1	RefSeq	transcript	291191	291721	.	-	.	gene_id "nbis-gene-248"; transcript_id "gene-C7A06_RS01500"; ID "gene-C7A06_RS01500"; Name "dctR"; Parent "nbis-gene-248"; gbkey "Gene"; gene "dctR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01500"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	291191	291721	.	-	.	gene_id "nbis-gene-248"; transcript_id "gene-C7A06_RS01500"; Dbxref "Genbank:WP_000478623.1"; ID "nbis-exon-257"; Name "WP_000478623.1"; Ontology_term "GO:0006355"; Parent "gene-C7A06_RS01500"; gbkey "CDS"; gene "dctR"; go_process "regulation of transcription, DNA-templated|0006355||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709290.2"; locus_tag "C7A06_RS01500"; product "LuxR C-terminal-related transcriptional regulator"; protein_id "WP_000478623.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	291191	291721	.	-	0	gene_id "nbis-gene-248"; transcript_id "gene-C7A06_RS01500"; Dbxref "Genbank:WP_000478623.1"; ID "cds-WP_000478623.1"; Name "WP_000478623.1"; Ontology_term "GO:0006355"; Parent "gene-C7A06_RS01500"; gbkey "CDS"; gene "dctR"; go_process "regulation of transcription, DNA-templated|0006355||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709290.2"; locus_tag "C7A06_RS01500"; product "LuxR C-terminal-related transcriptional regulator"; protein_id "WP_000478623.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	291877	292443	.	-	.	gene_id "nbis-gene-249"; ID "nbis-gene-249"; Name "slp"; gbkey "Gene"; gene "slp"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01510";
+NZ_CP027599.1	RefSeq	transcript	291877	292443	.	-	.	gene_id "nbis-gene-249"; transcript_id "gene-C7A06_RS01510"; ID "gene-C7A06_RS01510"; Name "slp"; Parent "nbis-gene-249"; gbkey "Gene"; gene "slp"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01510"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	291877	292443	.	-	.	gene_id "nbis-gene-249"; transcript_id "gene-C7A06_RS01510"; Dbxref "Genbank:WP_001057453.1"; ID "nbis-exon-258"; Name "WP_001057453.1"; Parent "gene-C7A06_RS01510"; gbkey "CDS"; gene "slp"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312404.2"; locus_tag "C7A06_RS01510"; product "outer membrane lipoprotein Slp"; protein_id "WP_001057453.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	291877	292443	.	-	0	gene_id "nbis-gene-249"; transcript_id "gene-C7A06_RS01510"; Dbxref "Genbank:WP_001057453.1"; ID "cds-WP_001057453.1"; Name "WP_001057453.1"; Parent "gene-C7A06_RS01510"; gbkey "CDS"; gene "slp"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312404.2"; locus_tag "C7A06_RS01510"; product "outer membrane lipoprotein Slp"; protein_id "WP_001057453.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	292798	293913	.	-	.	gene_id "nbis-pseudogene-291"; ID "nbis-pseudogene-291"; Name "C7A06_RS34385"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS34385"; original_biotype "pseudogene"; pseudo "true";
+NZ_CP027599.1	RefSeq	transcript	292798	293913	.	-	.	gene_id "nbis-pseudogene-291"; transcript_id "gene-C7A06_RS34385"; ID "gene-C7A06_RS34385"; Name "C7A06_RS34385"; Parent "nbis-pseudogene-291"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS34385"; original_biotype "mrna"; pseudo "true";
+NZ_CP027599.1	Protein Homology	exon	292798	293913	.	-	.	gene_id "nbis-pseudogene-291"; transcript_id "gene-C7A06_RS34385"; ID "nbis-exon-6064"; Note "frameshifted; internal stop"; Parent "gene-C7A06_RS34385"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312403.1"; locus_tag "C7A06_RS34385"; product "hypothetical protein"; pseudo "true"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	292798	293913	.	-	0	gene_id "nbis-pseudogene-291"; transcript_id "gene-C7A06_RS34385"; ID "cds-C7A06_RS34385"; Note "frameshifted; internal stop"; Parent "gene-C7A06_RS34385"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312403.1"; locus_tag "C7A06_RS34385"; product "hypothetical protein"; pseudo "true"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	294493	295494	.	-	.	gene_id "nbis-gene-250"; ID "nbis-gene-250"; Name "C7A06_RS01520"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01520";
+NZ_CP027599.1	RefSeq	transcript	294493	295494	.	-	.	gene_id "nbis-gene-250"; transcript_id "gene-C7A06_RS01520"; ID "gene-C7A06_RS01520"; Name "C7A06_RS01520"; Parent "nbis-gene-250"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01520"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	294493	295494	.	-	.	gene_id "nbis-gene-250"; transcript_id "gene-C7A06_RS01520"; Dbxref "Genbank:WP_000100276.1"; ID "nbis-exon-259"; Name "WP_000100276.1"; Parent "gene-C7A06_RS01520"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000100290.1"; locus_tag "C7A06_RS01520"; product "permease"; protein_id "WP_000100276.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	294493	295494	.	-	0	gene_id "nbis-gene-250"; transcript_id "gene-C7A06_RS01520"; Dbxref "Genbank:WP_000100276.1"; ID "cds-WP_000100276.1"; Name "WP_000100276.1"; Parent "gene-C7A06_RS01520"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000100290.1"; locus_tag "C7A06_RS01520"; product "permease"; protein_id "WP_000100276.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	295601	295897	.	+	.	gene_id "nbis-gene-251"; ID "nbis-gene-251"; Name "C7A06_RS01525"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01525";
+NZ_CP027599.1	RefSeq	transcript	295601	295897	.	+	.	gene_id "nbis-gene-251"; transcript_id "gene-C7A06_RS01525"; ID "gene-C7A06_RS01525"; Name "C7A06_RS01525"; Parent "nbis-gene-251"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01525"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	295601	295897	.	+	.	gene_id "nbis-gene-251"; transcript_id "gene-C7A06_RS01525"; Dbxref "Genbank:WP_001175589.1"; ID "nbis-exon-260"; Name "WP_001175589.1"; Parent "gene-C7A06_RS01525"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001465662.1"; locus_tag "C7A06_RS01525"; product "helix-turn-helix domain-containing protein"; protein_id "WP_001175589.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	295601	295897	.	+	0	gene_id "nbis-gene-251"; transcript_id "gene-C7A06_RS01525"; Dbxref "Genbank:WP_001175589.1"; ID "cds-WP_001175589.1"; Name "WP_001175589.1"; Parent "gene-C7A06_RS01525"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001465662.1"; locus_tag "C7A06_RS01525"; product "helix-turn-helix domain-containing protein"; protein_id "WP_001175589.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	296031	296456	.	-	.	gene_id "nbis-gene-252"; ID "nbis-gene-252"; Name "arsC"; gbkey "Gene"; gene "arsC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01530";
+NZ_CP027599.1	RefSeq	transcript	296031	296456	.	-	.	gene_id "nbis-gene-252"; transcript_id "gene-C7A06_RS01530"; ID "gene-C7A06_RS01530"; Name "arsC"; Parent "nbis-gene-252"; gbkey "Gene"; gene "arsC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01530"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	296031	296456	.	-	.	gene_id "nbis-gene-252"; transcript_id "gene-C7A06_RS01530"; Dbxref "Genbank:WP_000065769.1"; ID "nbis-exon-261"; Name "WP_000065769.1"; Ontology_term "GO:0008794"; Parent "gene-C7A06_RS01530"; gbkey "CDS"; gene "arsC"; go_function "arsenate reductase (glutaredoxin) activity|0008794||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417960.1"; locus_tag "C7A06_RS01530"; product "glutaredoxin-dependent arsenate reductase"; protein_id "WP_000065769.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	296031	296456	.	-	0	gene_id "nbis-gene-252"; transcript_id "gene-C7A06_RS01530"; Dbxref "Genbank:WP_000065769.1"; ID "cds-WP_000065769.1"; Name "WP_000065769.1"; Ontology_term "GO:0008794"; Parent "gene-C7A06_RS01530"; gbkey "CDS"; gene "arsC"; go_function "arsenate reductase (glutaredoxin) activity|0008794||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417960.1"; locus_tag "C7A06_RS01530"; product "glutaredoxin-dependent arsenate reductase"; protein_id "WP_000065769.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	296469	297758	.	-	.	gene_id "nbis-gene-253"; ID "nbis-gene-253"; Name "arsB"; gbkey "Gene"; gene "arsB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01535";
+NZ_CP027599.1	RefSeq	transcript	296469	297758	.	-	.	gene_id "nbis-gene-253"; transcript_id "gene-C7A06_RS01535"; ID "gene-C7A06_RS01535"; Name "arsB"; Parent "nbis-gene-253"; gbkey "Gene"; gene "arsB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01535"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	296469	297758	.	-	.	gene_id "nbis-gene-253"; transcript_id "gene-C7A06_RS01535"; Dbxref "Genbank:WP_000922639.1"; ID "nbis-exon-262"; Name "WP_000922639.1"; Parent "gene-C7A06_RS01535"; gbkey "CDS"; gene "arsB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312401.1"; locus_tag "C7A06_RS01535"; product "arsenite/antimonite:H(+) antiporter ArsB"; protein_id "WP_000922639.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	296469	297758	.	-	0	gene_id "nbis-gene-253"; transcript_id "gene-C7A06_RS01535"; Dbxref "Genbank:WP_000922639.1"; ID "cds-WP_000922639.1"; Name "WP_000922639.1"; Parent "gene-C7A06_RS01535"; gbkey "CDS"; gene "arsB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312401.1"; locus_tag "C7A06_RS01535"; product "arsenite/antimonite:H(+) antiporter ArsB"; protein_id "WP_000922639.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	297812	298165	.	-	.	gene_id "nbis-gene-254"; ID "nbis-gene-254"; Name "arsR"; gbkey "Gene"; gene "arsR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01540";
+NZ_CP027599.1	RefSeq	transcript	297812	298165	.	-	.	gene_id "nbis-gene-254"; transcript_id "gene-C7A06_RS01540"; ID "gene-C7A06_RS01540"; Name "arsR"; Parent "nbis-gene-254"; gbkey "Gene"; gene "arsR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01540"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	297812	298165	.	-	.	gene_id "nbis-gene-254"; transcript_id "gene-C7A06_RS01540"; Dbxref "Genbank:WP_000008957.1"; ID "nbis-exon-263"; Name "WP_000008957.1"; Parent "gene-C7A06_RS01540"; gbkey "CDS"; gene "arsR"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417958.1"; locus_tag "C7A06_RS01540"; product "As(III)-sensing metalloregulatory transcriptional repressor ArsR"; protein_id "WP_000008957.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	297812	298165	.	-	0	gene_id "nbis-gene-254"; transcript_id "gene-C7A06_RS01540"; Dbxref "Genbank:WP_000008957.1"; ID "cds-WP_000008957.1"; Name "WP_000008957.1"; Parent "gene-C7A06_RS01540"; gbkey "CDS"; gene "arsR"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417958.1"; locus_tag "C7A06_RS01540"; product "As(III)-sensing metalloregulatory transcriptional repressor ArsR"; protein_id "WP_000008957.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	298905	298988	.	+	.	gene_id "nbis-gene-255"; ID "nbis-gene-255"; Name "dinQ"; gbkey "Gene"; gene "dinQ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01550";
+NZ_CP027599.1	RefSeq	transcript	298905	298988	.	+	.	gene_id "nbis-gene-255"; transcript_id "gene-C7A06_RS01550"; ID "gene-C7A06_RS01550"; Name "dinQ"; Parent "nbis-gene-255"; gbkey "Gene"; gene "dinQ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01550"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	298905	298988	.	+	.	gene_id "nbis-gene-255"; transcript_id "gene-C7A06_RS01550"; Dbxref "Genbank:WP_001295215.1"; ID "nbis-exon-264"; Name "WP_001295215.1"; Parent "gene-C7A06_RS01550"; gbkey "CDS"; gene "dinQ"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_001165328.2"; locus_tag "C7A06_RS01550"; product "hypothetical protein"; protein_id "WP_001295215.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	298905	298988	.	+	0	gene_id "nbis-gene-255"; transcript_id "gene-C7A06_RS01550"; Dbxref "Genbank:WP_001295215.1"; ID "cds-WP_001295215.1"; Name "WP_001295215.1"; Parent "gene-C7A06_RS01550"; gbkey "CDS"; gene "dinQ"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_001165328.2"; locus_tag "C7A06_RS01550"; product "hypothetical protein"; protein_id "WP_001295215.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	299042	300394	.	-	.	gene_id "nbis-gene-256"; ID "nbis-gene-256"; Name "gorA"; gbkey "Gene"; gene "gorA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01555";
+NZ_CP027599.1	RefSeq	transcript	299042	300394	.	-	.	gene_id "nbis-gene-256"; transcript_id "gene-C7A06_RS01555"; ID "gene-C7A06_RS01555"; Name "gorA"; Parent "nbis-gene-256"; gbkey "Gene"; gene "gorA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01555"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	299042	300394	.	-	.	gene_id "nbis-gene-256"; transcript_id "gene-C7A06_RS01555"; Dbxref "Genbank:WP_000160808.1"; ID "nbis-exon-265"; Name "WP_000160808.1"; Ontology_term "GO:0006749" "GO:0045454" "GO:0004362" "GO:0050660" "GO:0050661"; Parent "gene-C7A06_RS01555"; gbkey "CDS"; gene "gorA"; go_function "glutathione-disulfide reductase (NADPH) activity|0004362||IEA" "flavin adenine dinucleotide binding|0050660||IEA" "NADP binding|0050661||IEA"; go_process "glutathione metabolic process|0006749||IEA" "cell redox homeostasis|0045454||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_003861215.1"; locus_tag "C7A06_RS01555"; product "glutathione-disulfide reductase"; protein_id "WP_000160808.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	299042	300394	.	-	0	gene_id "nbis-gene-256"; transcript_id "gene-C7A06_RS01555"; Dbxref "Genbank:WP_000160808.1"; ID "cds-WP_000160808.1"; Name "WP_000160808.1"; Ontology_term "GO:0006749" "GO:0045454" "GO:0004362" "GO:0050660" "GO:0050661"; Parent "gene-C7A06_RS01555"; gbkey "CDS"; gene "gorA"; go_function "glutathione-disulfide reductase (NADPH) activity|0004362||IEA" "flavin adenine dinucleotide binding|0050660||IEA" "NADP binding|0050661||IEA"; go_process "glutathione metabolic process|0006749||IEA" "cell redox homeostasis|0045454||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_003861215.1"; locus_tag "C7A06_RS01555"; product "glutathione-disulfide reductase"; protein_id "WP_000160808.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	300466	301308	.	-	.	gene_id "nbis-gene-257"; ID "nbis-gene-257"; Name "rlmJ"; gbkey "Gene"; gene "rlmJ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01560";
+NZ_CP027599.1	RefSeq	transcript	300466	301308	.	-	.	gene_id "nbis-gene-257"; transcript_id "gene-C7A06_RS01560"; ID "gene-C7A06_RS01560"; Name "rlmJ"; Parent "nbis-gene-257"; gbkey "Gene"; gene "rlmJ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01560"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	300466	301308	.	-	.	gene_id "nbis-gene-257"; transcript_id "gene-C7A06_RS01560"; Dbxref "Genbank:WP_000954225.1"; ID "nbis-exon-266"; Name "WP_000954225.1"; Parent "gene-C7A06_RS01560"; gbkey "CDS"; gene "rlmJ"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312398.1"; locus_tag "C7A06_RS01560"; product "23S rRNA (adenine(2030)-N(6))-methyltransferase"; protein_id "WP_000954225.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	300466	301308	.	-	0	gene_id "nbis-gene-257"; transcript_id "gene-C7A06_RS01560"; Dbxref "Genbank:WP_000954225.1"; ID "cds-WP_000954225.1"; Name "WP_000954225.1"; Parent "gene-C7A06_RS01560"; gbkey "CDS"; gene "rlmJ"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312398.1"; locus_tag "C7A06_RS01560"; product "23S rRNA (adenine(2030)-N(6))-methyltransferase"; protein_id "WP_000954225.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	301511	303553	.	+	.	gene_id "nbis-gene-258"; ID "nbis-gene-258"; Name "prlC"; gbkey "Gene"; gene "prlC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01565";
+NZ_CP027599.1	RefSeq	transcript	301511	303553	.	+	.	gene_id "nbis-gene-258"; transcript_id "gene-C7A06_RS01565"; ID "gene-C7A06_RS01565"; Name "prlC"; Parent "nbis-gene-258"; gbkey "Gene"; gene "prlC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01565"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	301511	303553	.	+	.	gene_id "nbis-gene-258"; transcript_id "gene-C7A06_RS01565"; Dbxref "Genbank:WP_001341942.1"; ID "nbis-exon-267"; Name "WP_001341942.1"; Ontology_term "GO:0006508" "GO:0004222"; Parent "gene-C7A06_RS01565"; gbkey "CDS"; gene "prlC"; go_function "metalloendopeptidase activity|0004222||IEA"; go_process "proteolysis|0006508||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_020317218.1"; locus_tag "C7A06_RS01565"; product "oligopeptidase A"; protein_id "WP_001341942.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	301511	303553	.	+	0	gene_id "nbis-gene-258"; transcript_id "gene-C7A06_RS01565"; Dbxref "Genbank:WP_001341942.1"; ID "cds-WP_001341942.1"; Name "WP_001341942.1"; Ontology_term "GO:0006508" "GO:0004222"; Parent "gene-C7A06_RS01565"; gbkey "CDS"; gene "prlC"; go_function "metalloendopeptidase activity|0004222||IEA"; go_process "proteolysis|0006508||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_020317218.1"; locus_tag "C7A06_RS01565"; product "oligopeptidase A"; protein_id "WP_001341942.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	303561	304313	.	+	.	gene_id "nbis-gene-259"; ID "nbis-gene-259"; Name "rsmJ"; gbkey "Gene"; gene "rsmJ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01570";
+NZ_CP027599.1	RefSeq	transcript	303561	304313	.	+	.	gene_id "nbis-gene-259"; transcript_id "gene-C7A06_RS01570"; ID "gene-C7A06_RS01570"; Name "rsmJ"; Parent "nbis-gene-259"; gbkey "Gene"; gene "rsmJ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01570"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	303561	304313	.	+	.	gene_id "nbis-gene-259"; transcript_id "gene-C7A06_RS01570"; Dbxref "Genbank:WP_000686608.1"; ID "nbis-exon-268"; Name "WP_000686608.1"; Ontology_term "GO:0031167" "GO:0008990"; Parent "gene-C7A06_RS01570"; gbkey "CDS"; gene "rsmJ"; go_function "rRNA (guanine-N2-)-methyltransferase activity|0008990||IEA"; go_process "rRNA methylation|0031167||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709277.2"; locus_tag "C7A06_RS01570"; product "16S rRNA (guanine(1516)-N(2))-methyltransferase RsmJ"; protein_id "WP_000686608.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	303561	304313	.	+	0	gene_id "nbis-gene-259"; transcript_id "gene-C7A06_RS01570"; Dbxref "Genbank:WP_000686608.1"; ID "cds-WP_000686608.1"; Name "WP_000686608.1"; Ontology_term "GO:0031167" "GO:0008990"; Parent "gene-C7A06_RS01570"; gbkey "CDS"; gene "rsmJ"; go_function "rRNA (guanine-N2-)-methyltransferase activity|0008990||IEA"; go_process "rRNA methylation|0031167||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709277.2"; locus_tag "C7A06_RS01570"; product "16S rRNA (guanine(1516)-N(2))-methyltransferase RsmJ"; protein_id "WP_000686608.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	304362	305831	.	-	.	gene_id "nbis-gene-260"; ID "nbis-gene-260"; Name "dtpB"; gbkey "Gene"; gene "dtpB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01575";
+NZ_CP027599.1	RefSeq	transcript	304362	305831	.	-	.	gene_id "nbis-gene-260"; transcript_id "gene-C7A06_RS01575"; ID "gene-C7A06_RS01575"; Name "dtpB"; Parent "nbis-gene-260"; gbkey "Gene"; gene "dtpB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01575"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	304362	305831	.	-	.	gene_id "nbis-gene-260"; transcript_id "gene-C7A06_RS01575"; Dbxref "Genbank:WP_001098647.1"; ID "nbis-exon-269"; Name "WP_001098647.1"; Parent "gene-C7A06_RS01575"; gbkey "CDS"; gene "dtpB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417953.1"; locus_tag "C7A06_RS01575"; product "dipeptide/tripeptide permease DtpB"; protein_id "WP_001098647.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	304362	305831	.	-	0	gene_id "nbis-gene-260"; transcript_id "gene-C7A06_RS01575"; Dbxref "Genbank:WP_001098647.1"; ID "cds-WP_001098647.1"; Name "WP_001098647.1"; Parent "gene-C7A06_RS01575"; gbkey "CDS"; gene "dtpB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417953.1"; locus_tag "C7A06_RS01575"; product "dipeptide/tripeptide permease DtpB"; protein_id "WP_001098647.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	305997	306050	.	+	.	gene_id "nbis-gene-5809"; ID "nbis-gene-5809"; Name "C7A06_RS34680"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS34680";
+NZ_CP027599.1	RefSeq	transcript	305997	306050	.	+	.	gene_id "nbis-gene-5809"; transcript_id "gene-C7A06_RS34680"; ID "gene-C7A06_RS34680"; Name "C7A06_RS34680"; Parent "nbis-gene-5809"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS34680"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	305997	306050	.	+	.	gene_id "nbis-gene-5809"; transcript_id "gene-C7A06_RS34680"; Dbxref "Genbank:WP_212591402.1"; ID "nbis-exon-6118"; Name "WP_212591402.1"; Parent "gene-C7A06_RS34680"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_010051205.1"; locus_tag "C7A06_RS34680"; product "hypothetical protein"; protein_id "WP_212591402.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	305997	306050	.	+	0	gene_id "nbis-gene-5809"; transcript_id "gene-C7A06_RS34680"; Dbxref "Genbank:WP_212591402.1"; ID "cds-WP_212591402.1"; Name "WP_212591402.1"; Parent "gene-C7A06_RS34680"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_010051205.1"; locus_tag "C7A06_RS34680"; product "hypothetical protein"; protein_id "WP_212591402.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	306149	306583	.	-	.	gene_id "nbis-gene-261"; ID "nbis-gene-261"; Name "uspA"; gbkey "Gene"; gene "uspA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01585";
+NZ_CP027599.1	RefSeq	transcript	306149	306583	.	-	.	gene_id "nbis-gene-261"; transcript_id "gene-C7A06_RS01585"; ID "gene-C7A06_RS01585"; Name "uspA"; Parent "nbis-gene-261"; gbkey "Gene"; gene "uspA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01585"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	306149	306583	.	-	.	gene_id "nbis-gene-261"; transcript_id "gene-C7A06_RS01585"; Dbxref "Genbank:WP_000323571.1"; ID "nbis-exon-270"; Name "WP_000323571.1"; Parent "gene-C7A06_RS01585"; gbkey "CDS"; gene "uspA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312394.1"; locus_tag "C7A06_RS01585"; product "universal stress protein UspA"; protein_id "WP_000323571.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	306149	306583	.	-	0	gene_id "nbis-gene-261"; transcript_id "gene-C7A06_RS01585"; Dbxref "Genbank:WP_000323571.1"; ID "cds-WP_000323571.1"; Name "WP_000323571.1"; Parent "gene-C7A06_RS01585"; gbkey "CDS"; gene "uspA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312394.1"; locus_tag "C7A06_RS01585"; product "universal stress protein UspA"; protein_id "WP_000323571.1"; transl_table "11";
\ No newline at end of file
diff -r 000000000000 -r f7c0a0030254 test-data/annotation_broken.gff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/annotation_broken.gff	Tue May 23 13:43:07 2023 +0000
@@ -0,0 +1,44 @@
+##gff-version 3
+##gtf-version 3
+#!gff-spec-version 1.21
+#!processor NCBI annotwriter
+#!genome-build ASM301845v1
+#!genome-build-accession NCBI_Assembly:GCF_003018455.1
+#!annotation-date 05/25/2022 04:54:31
+#!annotation-source NCBI RefSeq 
+##sequence-region NZ_CP027599.1 1 5942969
+##species https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=562
+NZ_CP027599.1	RefSeq	gene	1052	2152	.	+	.	ID=nbis-gene-2;Name=dnaN;gbkey=Gene;gene=dnaN;gene_biotype=protein_coding;gene_id=nbis-gene-2;locus_tag=C7A06_RS00010
+NZ_CP027599.1	RefSeq	transcript	1052	2152	.	+	.	ID=gene-C7A06_RS00010;Parent=nbis-gene-2;Name=dnaN;gbkey=Gene;gene=dnaN;gene_biotype=protein_coding;gene_id=nbis-gene-2;locus_tag=C7A06_RS00010;original_biotype=mrna;transcript_id=gene-C7A06_RS00010
+NZ_CP027599.1	Protein Homology	exon	1052	2152	.	+	.	ID=nbis-exon-2;Parent=gene-C7A06_RS00010;Dbxref=Genbank:WP_000673464.1;Name=WP_000673464.1;Ontology_term=GO:0006260,GO:0003887,GO:0009360;gbkey=CDS;gene=dnaN;gene_id=nbis-gene-2;go_component=DNA polymerase III complex|0009360||IEA;go_function=DNA-directed DNA polymerase activity|0003887||IEA;go_process=DNA replication|0006260||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_006177590.1;locus_tag=C7A06_RS00010;product=DNA polymerase III subunit beta;protein_id=WP_000673464.1;transcript_id=gene-C7A06_RS00010;transl_table=11
+NZ_CP027599.1	Protein Homology	CDS	1052	2152	.	+	0	ID=cds-WP_000673464.1;Parent=gene-C7A06_RS00010;Dbxref=Genbank:WP_000673464.1;Name=WP_000673464.1;Ontology_term=GO:0006260,GO:0003887,GO:0009360;gbkey=CDS;gene=dnaN;gene_id=nbis-gene-2;go_component=DNA polymerase III complex|0009360||IEA;go_function=DNA-directed DNA polymerase activity|0003887||IEA;go_process=DNA replication|0006260||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_006177590.1;locus_tag=C7A06_RS00010;product=DNA polymerase III subunit beta;protein_id=WP_000673464.1;transcript_id=gene-C7A06_RS00010;transl_table=11
+NZ_CP027599.1	RefSeq	gene	2152	3225	.	+	.	ID=nbis-gene-3;Name=recF;gbkey=Gene;gene=recF;gene_biotype=protein_coding;gene_id=nbis-gene-3;locus_tag=C7A06_RS00015
+NZ_CP027599.1	RefSeq	transcript	2152	3225	.	+	.	ID=gene-C7A06_RS00015;Parent=nbis-gene-3;Name=recF;gbkey=Gene;gene=recF;gene_biotype=protein_coding;gene_id=nbis-gene-3;locus_tag=C7A06_RS00015;original_biotype=mrna;transcript_id=gene-C7A06_RS00015
+NZ_CP027599.1	Protein Homology	CDS	2152	3225	.	+	0	ID=cds-WP_000060112.1;Parent=gene-C7A06_RS00015;Dbxref=Genbank:WP_000060112.1;Name=WP_000060112.1;Ontology_term=GO:0006281,GO:0003697,GO:0005524;gbkey=CDS;gene=recF;gene_id=nbis-gene-3;go_function=single-stranded DNA binding|0003697||IEA,ATP binding|0005524||IEA;go_process=DNA repair|0006281||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121479.1;locus_tag=C7A06_RS00015;product=DNA replication/repair protein RecF;protein_id=WP_000060112.1;transcript_id=gene-C7A06_RS00015;transl_table=11
+NZ_CP027599.1	RefSeq	gene	3254	5668	.	+	.	ID=nbis-gene-4;Name=gyrB;gbkey=Gene;gene=gyrB;gene_biotype=protein_coding;gene_id=nbis-gene-4;locus_tag=C7A06_RS00020
+NZ_CP027599.1	Protein Homology	CDS	3254	5668	.	+	0	ID=cds-WP_000072067.1;Parent=gene-C7A06_RS00020;Dbxref=Genbank:WP_000072067.1;Name=WP_000072067.1;Ontology_term=GO:0006265,GO:0003918,GO:0009330;gbkey=CDS;gene=gyrB;gene_id=nbis-gene-4;go_component=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) complex|0009330||IEA;go_function=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) activity|0003918||IEA;go_process=DNA topological change|0006265||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121480.1;locus_tag=C7A06_RS00020;product=DNA topoisomerase (ATP-hydrolyzing) subunit B;protein_id=WP_000072067.1;transcript_id=gene-C7A06_RS00020;transl_table=11
+NZ_CP027599.1	RefSeq	gene	5908	6306	.	+	.	ID=nbis-gene-5;Name=yidB;gbkey=Gene;gene=yidB;gene_biotype=protein_coding;gene_id=nbis-gene-5;locus_tag=C7A06_RS00025
+NZ_CP027599.1	RefSeq	transcript	5908	6306	.	+	.	ID=gene-C7A06_RS00025;Parent=nbis-gene-5;Name=yidB;gbkey=Gene;gene=yidB;gene_biotype=protein_coding;gene_id=nbis-gene-5;locus_tag=C7A06_RS00025;original_biotype=mrna;transcript_id=gene-C7A06_RS00025
+NZ_CP027599.1	Protein Homology	exon	5908	6306	.	+	.	ID=nbis-exon-5;Parent=gene-C7A06_RS00025;Dbxref=Genbank:WP_000522208.1;Name=WP_000522208.1;gbkey=CDS;gene=yidB;gene_id=nbis-gene-5;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418153.4;locus_tag=C7A06_RS00025;product=YidB family protein;protein_id=WP_000522208.1;transcript_id=gene-C7A06_RS00025;transl_table=11
+NZ_CP027599.1	Protein Homology	CDS	5908	6306	.	+	0	ID=cds-WP_000522208.1;Parent=gene-C7A06_RS00025;Dbxref=Genbank:WP_000522208.1;Name=WP_000522208.1;gbkey=CDS;gene=yidB;gene_id=nbis-gene-5;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418153.4;locus_tag=C7A06_RS00025;product=YidB family protein;protein_id=WP_000522208.1;transcript_id=gene-C7A06_RS00025;transl_table=11
+NZ_CP027599.1	RefSeq	gene	6421	7233	.	+	.	ID=nbis-gene-6;Name=yidA;gbkey=Gene;gene=yidA;gene_biotype=protein_coding;gene_id=nbis-gene-6;locus_tag=C7A06_RS00030
+NZ_CP027599.1	RefSeq	transcript	6421	7233	.	+	.	ID=gene-C7A06_RS00030;Parent=nbis-gene-6;Name=yidA;gbkey=Gene;gene=yidA;gene_biotype=protein_coding;gene_id=nbis-gene-6;locus_tag=C7A06_RS00030;original_biotype=mrna;transcript_id=gene-C7A06_RS00030
+NZ_CP027599.1	Protein Homology	exon	6421	7233	.	+	.	ID=nbis-exon-6;Parent=gene-C7A06_RS00030;Dbxref=Genbank:WP_000985541.1;Name=WP_000985541.1;Ontology_term=GO:0016787;gbkey=CDS;gene=yidA;gene_id=nbis-gene-6;go_function=hydrolase activity|0016787||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418152.1;locus_tag=C7A06_RS00030;product=sugar-phosphatase;protein_id=WP_000985541.1;transcript_id=gene-C7A06_RS00030;transl_table=11
+NZ_CP027599.1	RefSeq	transcript	7279	7935	.	-	.	ID=gene-C7A06_RS00035;Parent=nbis-gene-7;Name=C7A06_RS00035;gbkey=Gene;gene_biotype=protein_coding;gene_id=nbis-gene-7;locus_tag=C7A06_RS00035;original_biotype=mrna;transcript_id=gene-C7A06_RS00035
+NZ_CP027599.1	Protein Homology	exon	7279	7935	.	-	.	ID=nbis-exon-7;Parent=gene-C7A06_RS00035;Dbxref=Genbank:WP_000772931.1;Name=WP_000772931.1;gbkey=CDS;gene_id=nbis-gene-7;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709504.1;locus_tag=C7A06_RS00035;product=hypothetical protein;protein_id=WP_000772931.1;transcript_id=gene-C7A06_RS00035;transl_table=11
+NZ_CP027599.1	Protein Homology	CDS	7279	7935	.	-	0	ID=cds-WP_000772931.1;Parent=gene-C7A06_RS00035;Dbxref=Genbank:WP_000772931.1;Name=WP_000772931.1;gbkey=CDS;gene_id=nbis-gene-7;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709504.1;locus_tag=C7A06_RS00035;product=hypothetical protein;protein_id=WP_000772931.1;transcript_id=gene-C7A06_RS00035;transl_table=11
+NZ_CP027599.1	RefSeq	gene	8213	8902	.	+	.	ID=nbis-gene-8;Name=dgoR;gbkey=Gene;gene=dgoR;gene_biotype=protein_coding;gene_id=nbis-gene-8;locus_tag=C7A06_RS00040
+NZ_CP027599.1	RefSeq	transcript	8213	8902	.	+	.	ID=gene-C7A06_RS00040;Parent=nbis-gene-8;Name=dgoR;gbkey=Gene;gene=dgoR;gene_biotype=protein_coding;gene_id=nbis-gene-8;locus_tag=C7A06_RS00040;original_biotype=mrna;transcript_id=gene-C7A06_RS00040
+NZ_CP027599.1	Protein Homology	exon	8213	8902	.	+	.	ID=nbis-exon-8;Parent=gene-C7A06_RS00040;Dbxref=Genbank:WP_000174305.1;Name=WP_000174305.1;gbkey=CDS;gene=dgoR;gene_id=nbis-gene-8;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709505.1;locus_tag=C7A06_RS00040;product=D-galactonate utilization transcriptional regulator DgoR;protein_id=WP_000174305.1;transcript_id=gene-C7A06_RS00040;transl_table=11
+NZ_CP027599.1	Protein Homology	CDS	8213	8902	.	+	0	ID=cds-WP_000174305.1;Parent=gene-C7A06_RS00040;Dbxref=Genbank:WP_000174305.1;Name=WP_000174305.1;gbkey=CDS;gene=dgoR;gene_id=nbis-gene-8;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709505.1;locus_tag=C7A06_RS00040;product=D-galactonate utilization transcriptional regulator DgoR;protein_id=WP_000174305.1;transcript_id=gene-C7A06_RS00040;transl_table=11
+NZ_CP027599.1	RefSeq	gene	8899	9777	.	+	.	ID=nbis-gene-9;Name=dgoK;gbkey=Gene;gene=dgoK;gene_biotype=protein_coding;gene_id=nbis-gene-9;locus_tag=C7A06_RS00045
+NZ_CP027599.1	Protein Homology	exon	8899	9777	.	+	.	ID=nbis-exon-9;Parent=gene-C7A06_RS00045;Dbxref=Genbank:WP_000127112.1;Name=WP_000127112.1;gbkey=CDS;gene=dgoK;gene_id=nbis-gene-9;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709506.1;locus_tag=C7A06_RS00045;product=2-dehydro-3-deoxygalactonokinase;protein_id=WP_000127112.1;transcript_id=gene-C7A06_RS00045;transl_table=11
+NZ_CP027599.1	Protein Homology	CDS	8899	9777	.	+	0	ID=cds-WP_000127112.1;Parent=gene-C7A06_RS00045;Dbxref=Genbank:WP_000127112.1;Name=WP_000127112.1;gbkey=CDS;gene=dgoK;gene_id=nbis-gene-9;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709506.1;locus_tag=C7A06_RS00045;product=2-dehydro-3-deoxygalactonokinase;protein_id=WP_000127112.1;transcript_id=gene-C7A06_RS00045;transl_table=11
+NZ_CP027599.1	RefSeq	gene	9761	10378	.	+	.	ID=nbis-gene-10;Name=dgoA;gbkey=Gene;gene=dgoA;gene_biotype=protein_coding;gene_id=nbis-gene-10;locus_tag=C7A06_RS00050
+NZ_CP027599.1	RefSeq	transcript	9761	10378	.	+	.	ID=gene-C7A06_RS00050;Parent=nbis-gene-10;Name=dgoA;gbkey=Gene;gene=dgoA;gene_biotype=protein_coding;gene_id=nbis-gene-10;locus_tag=C7A06_RS00050;original_biotype=mrna;transcript_id=gene-C7A06_RS00050
+NZ_CP027599.1	Protein Homology	exon	9761	10378	.	+	.	ID=nbis-exon-10;Parent=gene-C7A06_RS00050;Dbxref=Genbank:WP_001198699.1;Name=WP_001198699.1;gbkey=CDS;gene=dgoA;gene_id=nbis-gene-10;inference=COORDINATES: similar to AA sequence:RefSeq:YP_026238.1;locus_tag=C7A06_RS00050;product=2-dehydro-3-deoxy-6-phosphogalactonate aldolase;protein_id=WP_001198699.1;transcript_id=gene-C7A06_RS00050;transl_table=11
+NZ_CP027599.1	Protein Homology	CDS	9761	10378	.	+	0	ID=cds-WP_001198699.1;Parent=gene-C7A06_RS00050;Dbxref=Genbank:WP_001198699.1;Name=WP_001198699.1;gbkey=CDS;gene=dgoA;gene_id=nbis-gene-10;inference=COORDINATES: similar to AA sequence:RefSeq:YP_026238.1;locus_tag=C7A06_RS00050;product=2-dehydro-3-deoxy-6-phosphogalactonate aldolase;protein_id=WP_001198699.1;transcript_id=gene-C7A06_RS00050;transl_table=11
+NZ_CP027599.1	RefSeq	gene	10375	11523	.	+	.	ID=nbis-gene-11;Name=dgoD;gbkey=Gene;gene=dgoD;gene_biotype=protein_coding;gene_id=nbis-gene-11;locus_tag=C7A06_RS00055
+NZ_CP027599.1	RefSeq	transcript	10375	11523	.	+	.	ID=gene-C7A06_RS00055;Parent=nbis-gene-11;Name=dgoD;gbkey=Gene;gene=dgoD;gene_biotype=protein_coding;gene_id=nbis-gene-11;locus_tag=C7A06_RS00055;original_biotype=mrna;transcript_id=gene-C7A06_RS00055
+NZ_CP027599.1	Protein Homology	exon	10375	11523	.	+	.	ID=nbis-exon-11;Parent=gene-C7A06_RS00055;Dbxref=Genbank:WP_000705001.1;Name=WP_000705001.1;Ontology_term=GO:0009063,GO:0008869;gbkey=CDS;gene=dgoD;gene_id=nbis-gene-11;go_function=galactonate dehydratase activity|0008869||IEA;go_process=cellular amino acid catabolic process|0009063||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_020077623.1;locus_tag=C7A06_RS00055;product=galactonate dehydratase;protein_id=WP_000705001.1;transcript_id=gene-C7A06_RS00055;transl_table=11
+NZ_CP027599.1	Protein Homology	CDS	10375	11523	.	+	0	ID=cds-WP_000705001.1;Parent=gene-C7A06_RS00055;Dbxref=Genbank:WP_000705001.1;Name=WP_000705001.1;Ontology_term=GO:0009063,GO:0008869;gbkey=CDS;gene=dgoD;gene_id=nbis-gene-11;go_function=galactonate dehydratase activity|0008869||IEA;go_process=cellular amino acid catabolic process|0009063||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_020077623.1;locus_tag=C7A06_RS00055;product=galactonate dehydratase;protein_id=WP_000705001.1;transcript_id=gene-C7A06_RS00055;transl_table=11
diff -r 000000000000 -r f7c0a0030254 test-data/annotation_broken.gff.gz
Binary file test-data/annotation_broken.gff.gz has changed
diff -r 000000000000 -r f7c0a0030254 test-data/annotation_fixed.gff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/annotation_fixed.gff	Tue May 23 13:43:07 2023 +0000
@@ -0,0 +1,49 @@
+##gff-version 3
+##gtf-version 3
+#!gff-spec-version 1.21
+#!processor NCBI annotwriter
+#!genome-build ASM301845v1
+#!genome-build-accession NCBI_Assembly:GCF_003018455.1
+#!annotation-date 05/25/2022 04:54:31
+#!annotation-source NCBI RefSeq 
+##sequence-region NZ_CP027599.1 1 5942969
+##species https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=562
+NZ_CP027599.1	RefSeq	gene	1052	2152	.	+	.	ID=nbis-gene-2;Name=dnaN;gbkey=Gene;gene=dnaN;gene_biotype=protein_coding;gene_id=nbis-gene-2;locus_tag=C7A06_RS00010
+NZ_CP027599.1	RefSeq	transcript	1052	2152	.	+	.	ID=gene-C7A06_RS00010;Parent=nbis-gene-2;Name=dnaN;gbkey=Gene;gene=dnaN;gene_biotype=protein_coding;gene_id=nbis-gene-2;locus_tag=C7A06_RS00010;original_biotype=mrna;transcript_id=gene-C7A06_RS00010
+NZ_CP027599.1	Protein Homology	exon	1052	2152	.	+	.	ID=nbis-exon-2;Parent=gene-C7A06_RS00010;Dbxref=Genbank:WP_000673464.1;Name=WP_000673464.1;Ontology_term=GO:0006260,GO:0003887,GO:0009360;gbkey=CDS;gene=dnaN;gene_id=nbis-gene-2;go_component=DNA polymerase III complex|0009360||IEA;go_function=DNA-directed DNA polymerase activity|0003887||IEA;go_process=DNA replication|0006260||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_006177590.1;locus_tag=C7A06_RS00010;product=DNA polymerase III subunit beta;protein_id=WP_000673464.1;transcript_id=gene-C7A06_RS00010;transl_table=11
+NZ_CP027599.1	Protein Homology	CDS	1052	2152	.	+	0	ID=cds-WP_000673464.1;Parent=gene-C7A06_RS00010;Dbxref=Genbank:WP_000673464.1;Name=WP_000673464.1;Ontology_term=GO:0006260,GO:0003887,GO:0009360;gbkey=CDS;gene=dnaN;gene_id=nbis-gene-2;go_component=DNA polymerase III complex|0009360||IEA;go_function=DNA-directed DNA polymerase activity|0003887||IEA;go_process=DNA replication|0006260||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_006177590.1;locus_tag=C7A06_RS00010;product=DNA polymerase III subunit beta;protein_id=WP_000673464.1;transcript_id=gene-C7A06_RS00010;transl_table=11
+NZ_CP027599.1	RefSeq	gene	2152	3225	.	+	.	ID=nbis-gene-3;Name=recF;gbkey=Gene;gene=recF;gene_biotype=protein_coding;gene_id=nbis-gene-3;locus_tag=C7A06_RS00015
+NZ_CP027599.1	RefSeq	transcript	2152	3225	.	+	.	ID=gene-C7A06_RS00015;Parent=nbis-gene-3;Name=recF;gbkey=Gene;gene=recF;gene_biotype=protein_coding;gene_id=nbis-gene-3;locus_tag=C7A06_RS00015;original_biotype=mrna;transcript_id=gene-C7A06_RS00015
+NZ_CP027599.1	Protein Homology	exon	2152	3225	.	+	.	ID=nbis-exon-1;Parent=gene-C7A06_RS00015;Dbxref=Genbank:WP_000060112.1;Name=WP_000060112.1;Ontology_term=GO:0006281,GO:0003697,GO:0005524;gbkey=CDS;gene=recF;gene_id=nbis-gene-3;go_function=single-stranded DNA binding|0003697||IEA,ATP binding|0005524||IEA;go_process=DNA repair|0006281||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121479.1;locus_tag=C7A06_RS00015;product=DNA replication/repair protein RecF;protein_id=WP_000060112.1;transcript_id=gene-C7A06_RS00015;transl_table=11
+NZ_CP027599.1	Protein Homology	CDS	2152	3225	.	+	0	ID=cds-WP_000060112.1;Parent=gene-C7A06_RS00015;Dbxref=Genbank:WP_000060112.1;Name=WP_000060112.1;Ontology_term=GO:0006281,GO:0003697,GO:0005524;gbkey=CDS;gene=recF;gene_id=nbis-gene-3;go_function=single-stranded DNA binding|0003697||IEA,ATP binding|0005524||IEA;go_process=DNA repair|0006281||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121479.1;locus_tag=C7A06_RS00015;product=DNA replication/repair protein RecF;protein_id=WP_000060112.1;transcript_id=gene-C7A06_RS00015;transl_table=11
+NZ_CP027599.1	RefSeq	gene	3254	5668	.	+	.	ID=nbis-gene-4;Name=gyrB;gbkey=Gene;gene=gyrB;gene_biotype=protein_coding;gene_id=nbis-gene-4;locus_tag=C7A06_RS00020
+NZ_CP027599.1	RefSeq	mRNA	3254	5668	.	+	.	ID=gene-C7A06_RS00020;Parent=nbis-gene-4;Name=gyrB;gbkey=Gene;gene=gyrB;gene_biotype=protein_coding;gene_id=nbis-gene-4;locus_tag=C7A06_RS00020
+NZ_CP027599.1	Protein Homology	exon	3254	5668	.	+	.	ID=nbis-exon-3;Parent=gene-C7A06_RS00020;Dbxref=Genbank:WP_000072067.1;Name=WP_000072067.1;Ontology_term=GO:0006265,GO:0003918,GO:0009330;gbkey=CDS;gene=gyrB;gene_id=nbis-gene-4;go_component=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) complex|0009330||IEA;go_function=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) activity|0003918||IEA;go_process=DNA topological change|0006265||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121480.1;locus_tag=C7A06_RS00020;product=DNA topoisomerase (ATP-hydrolyzing) subunit B;protein_id=WP_000072067.1;transcript_id=gene-C7A06_RS00020;transl_table=11
+NZ_CP027599.1	Protein Homology	CDS	3254	5668	.	+	0	ID=cds-WP_000072067.1;Parent=gene-C7A06_RS00020;Dbxref=Genbank:WP_000072067.1;Name=WP_000072067.1;Ontology_term=GO:0006265,GO:0003918,GO:0009330;gbkey=CDS;gene=gyrB;gene_id=nbis-gene-4;go_component=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) complex|0009330||IEA;go_function=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) activity|0003918||IEA;go_process=DNA topological change|0006265||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121480.1;locus_tag=C7A06_RS00020;product=DNA topoisomerase (ATP-hydrolyzing) subunit B;protein_id=WP_000072067.1;transcript_id=gene-C7A06_RS00020;transl_table=11
+NZ_CP027599.1	RefSeq	gene	5908	6306	.	+	.	ID=nbis-gene-5;Name=yidB;gbkey=Gene;gene=yidB;gene_biotype=protein_coding;gene_id=nbis-gene-5;locus_tag=C7A06_RS00025
+NZ_CP027599.1	RefSeq	transcript	5908	6306	.	+	.	ID=gene-C7A06_RS00025;Parent=nbis-gene-5;Name=yidB;gbkey=Gene;gene=yidB;gene_biotype=protein_coding;gene_id=nbis-gene-5;locus_tag=C7A06_RS00025;original_biotype=mrna;transcript_id=gene-C7A06_RS00025
+NZ_CP027599.1	Protein Homology	exon	5908	6306	.	+	.	ID=nbis-exon-5;Parent=gene-C7A06_RS00025;Dbxref=Genbank:WP_000522208.1;Name=WP_000522208.1;gbkey=CDS;gene=yidB;gene_id=nbis-gene-5;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418153.4;locus_tag=C7A06_RS00025;product=YidB family protein;protein_id=WP_000522208.1;transcript_id=gene-C7A06_RS00025;transl_table=11
+NZ_CP027599.1	Protein Homology	CDS	5908	6306	.	+	0	ID=cds-WP_000522208.1;Parent=gene-C7A06_RS00025;Dbxref=Genbank:WP_000522208.1;Name=WP_000522208.1;gbkey=CDS;gene=yidB;gene_id=nbis-gene-5;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418153.4;locus_tag=C7A06_RS00025;product=YidB family protein;protein_id=WP_000522208.1;transcript_id=gene-C7A06_RS00025;transl_table=11
+NZ_CP027599.1	RefSeq	gene	6421	7233	.	+	.	ID=nbis-gene-6;Name=yidA;gbkey=Gene;gene=yidA;gene_biotype=protein_coding;gene_id=nbis-gene-6;locus_tag=C7A06_RS00030
+NZ_CP027599.1	RefSeq	transcript	6421	7233	.	+	.	ID=gene-C7A06_RS00030;Parent=nbis-gene-6;Name=yidA;gbkey=Gene;gene=yidA;gene_biotype=protein_coding;gene_id=nbis-gene-6;locus_tag=C7A06_RS00030;original_biotype=mrna;transcript_id=gene-C7A06_RS00030
+NZ_CP027599.1	Protein Homology	exon	6421	7233	.	+	.	ID=nbis-exon-6;Parent=gene-C7A06_RS00030;Dbxref=Genbank:WP_000985541.1;Name=WP_000985541.1;Ontology_term=GO:0016787;gbkey=CDS;gene=yidA;gene_id=nbis-gene-6;go_function=hydrolase activity|0016787||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418152.1;locus_tag=C7A06_RS00030;product=sugar-phosphatase;protein_id=WP_000985541.1;transcript_id=gene-C7A06_RS00030;transl_table=11
+NZ_CP027599.1	RefSeq	gene	7279	7935	.	-	.	ID=nbis-gene-7;Name=C7A06_RS00035;gbkey=Gene;gene_biotype=protein_coding;gene_id=nbis-gene-7;locus_tag=C7A06_RS00035;original_biotype=mrna;transcript_id=gene-C7A06_RS00035
+NZ_CP027599.1	RefSeq	transcript	7279	7935	.	-	.	ID=gene-C7A06_RS00035;Parent=nbis-gene-7;Name=C7A06_RS00035;gbkey=Gene;gene_biotype=protein_coding;gene_id=nbis-gene-7;locus_tag=C7A06_RS00035;original_biotype=mrna;transcript_id=gene-C7A06_RS00035
+NZ_CP027599.1	Protein Homology	exon	7279	7935	.	-	.	ID=nbis-exon-7;Parent=gene-C7A06_RS00035;Dbxref=Genbank:WP_000772931.1;Name=WP_000772931.1;gbkey=CDS;gene_id=nbis-gene-7;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709504.1;locus_tag=C7A06_RS00035;product=hypothetical protein;protein_id=WP_000772931.1;transcript_id=gene-C7A06_RS00035;transl_table=11
+NZ_CP027599.1	Protein Homology	CDS	7279	7935	.	-	0	ID=cds-WP_000772931.1;Parent=gene-C7A06_RS00035;Dbxref=Genbank:WP_000772931.1;Name=WP_000772931.1;gbkey=CDS;gene_id=nbis-gene-7;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709504.1;locus_tag=C7A06_RS00035;product=hypothetical protein;protein_id=WP_000772931.1;transcript_id=gene-C7A06_RS00035;transl_table=11
+NZ_CP027599.1	RefSeq	gene	8213	8902	.	+	.	ID=nbis-gene-8;Name=dgoR;gbkey=Gene;gene=dgoR;gene_biotype=protein_coding;gene_id=nbis-gene-8;locus_tag=C7A06_RS00040
+NZ_CP027599.1	RefSeq	transcript	8213	8902	.	+	.	ID=gene-C7A06_RS00040;Parent=nbis-gene-8;Name=dgoR;gbkey=Gene;gene=dgoR;gene_biotype=protein_coding;gene_id=nbis-gene-8;locus_tag=C7A06_RS00040;original_biotype=mrna;transcript_id=gene-C7A06_RS00040
+NZ_CP027599.1	Protein Homology	exon	8213	8902	.	+	.	ID=nbis-exon-8;Parent=gene-C7A06_RS00040;Dbxref=Genbank:WP_000174305.1;Name=WP_000174305.1;gbkey=CDS;gene=dgoR;gene_id=nbis-gene-8;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709505.1;locus_tag=C7A06_RS00040;product=D-galactonate utilization transcriptional regulator DgoR;protein_id=WP_000174305.1;transcript_id=gene-C7A06_RS00040;transl_table=11
+NZ_CP027599.1	Protein Homology	CDS	8213	8902	.	+	0	ID=cds-WP_000174305.1;Parent=gene-C7A06_RS00040;Dbxref=Genbank:WP_000174305.1;Name=WP_000174305.1;gbkey=CDS;gene=dgoR;gene_id=nbis-gene-8;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709505.1;locus_tag=C7A06_RS00040;product=D-galactonate utilization transcriptional regulator DgoR;protein_id=WP_000174305.1;transcript_id=gene-C7A06_RS00040;transl_table=11
+NZ_CP027599.1	RefSeq	gene	8899	9777	.	+	.	ID=nbis-gene-9;Name=dgoK;gbkey=Gene;gene=dgoK;gene_biotype=protein_coding;gene_id=nbis-gene-9;locus_tag=C7A06_RS00045
+NZ_CP027599.1	RefSeq	mRNA	8899	9777	.	+	.	ID=gene-C7A06_RS00045;Parent=nbis-gene-9;Name=dgoK;gbkey=Gene;gene=dgoK;gene_biotype=protein_coding;gene_id=nbis-gene-9;locus_tag=C7A06_RS00045
+NZ_CP027599.1	Protein Homology	exon	8899	9777	.	+	.	ID=nbis-exon-9;Parent=gene-C7A06_RS00045;Dbxref=Genbank:WP_000127112.1;Name=WP_000127112.1;gbkey=CDS;gene=dgoK;gene_id=nbis-gene-9;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709506.1;locus_tag=C7A06_RS00045;product=2-dehydro-3-deoxygalactonokinase;protein_id=WP_000127112.1;transcript_id=gene-C7A06_RS00045;transl_table=11
+NZ_CP027599.1	Protein Homology	CDS	8899	9777	.	+	0	ID=cds-WP_000127112.1;Parent=gene-C7A06_RS00045;Dbxref=Genbank:WP_000127112.1;Name=WP_000127112.1;gbkey=CDS;gene=dgoK;gene_id=nbis-gene-9;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709506.1;locus_tag=C7A06_RS00045;product=2-dehydro-3-deoxygalactonokinase;protein_id=WP_000127112.1;transcript_id=gene-C7A06_RS00045;transl_table=11
+NZ_CP027599.1	RefSeq	gene	9761	10378	.	+	.	ID=nbis-gene-10;Name=dgoA;gbkey=Gene;gene=dgoA;gene_biotype=protein_coding;gene_id=nbis-gene-10;locus_tag=C7A06_RS00050
+NZ_CP027599.1	RefSeq	transcript	9761	10378	.	+	.	ID=gene-C7A06_RS00050;Parent=nbis-gene-10;Name=dgoA;gbkey=Gene;gene=dgoA;gene_biotype=protein_coding;gene_id=nbis-gene-10;locus_tag=C7A06_RS00050;original_biotype=mrna;transcript_id=gene-C7A06_RS00050
+NZ_CP027599.1	Protein Homology	exon	9761	10378	.	+	.	ID=nbis-exon-10;Parent=gene-C7A06_RS00050;Dbxref=Genbank:WP_001198699.1;Name=WP_001198699.1;gbkey=CDS;gene=dgoA;gene_id=nbis-gene-10;inference=COORDINATES: similar to AA sequence:RefSeq:YP_026238.1;locus_tag=C7A06_RS00050;product=2-dehydro-3-deoxy-6-phosphogalactonate aldolase;protein_id=WP_001198699.1;transcript_id=gene-C7A06_RS00050;transl_table=11
+NZ_CP027599.1	Protein Homology	CDS	9761	10378	.	+	0	ID=cds-WP_001198699.1;Parent=gene-C7A06_RS00050;Dbxref=Genbank:WP_001198699.1;Name=WP_001198699.1;gbkey=CDS;gene=dgoA;gene_id=nbis-gene-10;inference=COORDINATES: similar to AA sequence:RefSeq:YP_026238.1;locus_tag=C7A06_RS00050;product=2-dehydro-3-deoxy-6-phosphogalactonate aldolase;protein_id=WP_001198699.1;transcript_id=gene-C7A06_RS00050;transl_table=11
+NZ_CP027599.1	RefSeq	gene	10375	11523	.	+	.	ID=nbis-gene-11;Name=dgoD;gbkey=Gene;gene=dgoD;gene_biotype=protein_coding;gene_id=nbis-gene-11;locus_tag=C7A06_RS00055
+NZ_CP027599.1	RefSeq	transcript	10375	11523	.	+	.	ID=gene-C7A06_RS00055;Parent=nbis-gene-11;Name=dgoD;gbkey=Gene;gene=dgoD;gene_biotype=protein_coding;gene_id=nbis-gene-11;locus_tag=C7A06_RS00055;original_biotype=mrna;transcript_id=gene-C7A06_RS00055
+NZ_CP027599.1	Protein Homology	exon	10375	11523	.	+	.	ID=nbis-exon-11;Parent=gene-C7A06_RS00055;Dbxref=Genbank:WP_000705001.1;Name=WP_000705001.1;Ontology_term=GO:0009063,GO:0008869;gbkey=CDS;gene=dgoD;gene_id=nbis-gene-11;go_function=galactonate dehydratase activity|0008869||IEA;go_process=cellular amino acid catabolic process|0009063||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_020077623.1;locus_tag=C7A06_RS00055;product=galactonate dehydratase;protein_id=WP_000705001.1;transcript_id=gene-C7A06_RS00055;transl_table=11
+NZ_CP027599.1	Protein Homology	CDS	10375	11523	.	+	0	ID=cds-WP_000705001.1;Parent=gene-C7A06_RS00055;Dbxref=Genbank:WP_000705001.1;Name=WP_000705001.1;Ontology_term=GO:0009063,GO:0008869;gbkey=CDS;gene=dgoD;gene_id=nbis-gene-11;go_function=galactonate dehydratase activity|0008869||IEA;go_process=cellular amino acid catabolic process|0009063||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_020077623.1;locus_tag=C7A06_RS00055;product=galactonate dehydratase;protein_id=WP_000705001.1;transcript_id=gene-C7A06_RS00055;transl_table=11
diff -r 000000000000 -r f7c0a0030254 test-data/annotation_small.gtf
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/annotation_small.gtf	Tue May 23 13:43:07 2023 +0000
@@ -0,0 +1,49 @@
+##gtf-version 3
+#!gff-spec-version 1.21
+#!processor NCBI annotwriter
+#!genome-build ASM301845v1
+#!genome-build-accession NCBI_Assembly:GCF_003018455.1
+#!annotation-date 05/25/2022 04:54:31
+#!annotation-source NCBI RefSeq 
+##sequence-region NZ_CP027599.1 1 5942969
+##species https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=562
+NZ_CP027599.1	RefSeq	gene	1052	2152	.	+	.	gene_id "nbis-gene-2"; ID "nbis-gene-2"; Name "dnaN"; gbkey "Gene"; gene "dnaN"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00010";
+NZ_CP027599.1	RefSeq	transcript	1052	2152	.	+	.	gene_id "nbis-gene-2"; transcript_id "gene-C7A06_RS00010"; ID "gene-C7A06_RS00010"; Name "dnaN"; Parent "nbis-gene-2"; gbkey "Gene"; gene "dnaN"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00010"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	1052	2152	.	+	.	gene_id "nbis-gene-2"; transcript_id "gene-C7A06_RS00010"; Dbxref "Genbank:WP_000673464.1"; ID "nbis-exon-2"; Name "WP_000673464.1"; Ontology_term "GO:0006260" "GO:0003887" "GO:0009360"; Parent "gene-C7A06_RS00010"; gbkey "CDS"; gene "dnaN"; go_component "DNA polymerase III complex|0009360||IEA"; go_function "DNA-directed DNA polymerase activity|0003887||IEA"; go_process "DNA replication|0006260||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_006177590.1"; locus_tag "C7A06_RS00010"; product "DNA polymerase III subunit beta"; protein_id "WP_000673464.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	1052	2152	.	+	0	gene_id "nbis-gene-2"; transcript_id "gene-C7A06_RS00010"; Dbxref "Genbank:WP_000673464.1"; ID "cds-WP_000673464.1"; Name "WP_000673464.1"; Ontology_term "GO:0006260" "GO:0003887" "GO:0009360"; Parent "gene-C7A06_RS00010"; gbkey "CDS"; gene "dnaN"; go_component "DNA polymerase III complex|0009360||IEA"; go_function "DNA-directed DNA polymerase activity|0003887||IEA"; go_process "DNA replication|0006260||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_006177590.1"; locus_tag "C7A06_RS00010"; product "DNA polymerase III subunit beta"; protein_id "WP_000673464.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	2152	3225	.	+	.	gene_id "nbis-gene-3"; ID "nbis-gene-3"; Name "recF"; gbkey "Gene"; gene "recF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00015";
+NZ_CP027599.1	RefSeq	transcript	2152	3225	.	+	.	gene_id "nbis-gene-3"; transcript_id "gene-C7A06_RS00015"; ID "gene-C7A06_RS00015"; Name "recF"; Parent "nbis-gene-3"; gbkey "Gene"; gene "recF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00015"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	2152	3225	.	+	.	gene_id "nbis-gene-3"; transcript_id "gene-C7A06_RS00015"; Dbxref "Genbank:WP_000060112.1"; ID "nbis-exon-3"; Name "WP_000060112.1"; Ontology_term "GO:0006281" "GO:0003697" "GO:0005524"; Parent "gene-C7A06_RS00015"; gbkey "CDS"; gene "recF"; go_function "single-stranded DNA binding|0003697||IEA" "ATP binding|0005524||IEA"; go_process "DNA repair|0006281||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005121479.1"; locus_tag "C7A06_RS00015"; product "DNA replication/repair protein RecF"; protein_id "WP_000060112.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	2152	3225	.	+	0	gene_id "nbis-gene-3"; transcript_id "gene-C7A06_RS00015"; Dbxref "Genbank:WP_000060112.1"; ID "cds-WP_000060112.1"; Name "WP_000060112.1"; Ontology_term "GO:0006281" "GO:0003697" "GO:0005524"; Parent "gene-C7A06_RS00015"; gbkey "CDS"; gene "recF"; go_function "single-stranded DNA binding|0003697||IEA" "ATP binding|0005524||IEA"; go_process "DNA repair|0006281||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005121479.1"; locus_tag "C7A06_RS00015"; product "DNA replication/repair protein RecF"; protein_id "WP_000060112.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	3254	5668	.	+	.	gene_id "nbis-gene-4"; ID "nbis-gene-4"; Name "gyrB"; gbkey "Gene"; gene "gyrB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00020";
+NZ_CP027599.1	RefSeq	transcript	3254	5668	.	+	.	gene_id "nbis-gene-4"; transcript_id "gene-C7A06_RS00020"; ID "gene-C7A06_RS00020"; Name "gyrB"; Parent "nbis-gene-4"; gbkey "Gene"; gene "gyrB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00020"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	3254	5668	.	+	.	gene_id "nbis-gene-4"; transcript_id "gene-C7A06_RS00020"; Dbxref "Genbank:WP_000072067.1"; ID "nbis-exon-4"; Name "WP_000072067.1"; Ontology_term "GO:0006265" "GO:0003918" "GO:0009330"; Parent "gene-C7A06_RS00020"; gbkey "CDS"; gene "gyrB"; go_component "DNA topoisomerase type II (double strand cut, ATP-hydrolyzing) complex|0009330||IEA"; go_function "DNA topoisomerase type II (double strand cut, ATP-hydrolyzing) activity|0003918||IEA"; go_process "DNA topological change|0006265||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005121480.1"; locus_tag "C7A06_RS00020"; product "DNA topoisomerase (ATP-hydrolyzing) subunit B"; protein_id "WP_000072067.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	3254	5668	.	+	0	gene_id "nbis-gene-4"; transcript_id "gene-C7A06_RS00020"; Dbxref "Genbank:WP_000072067.1"; ID "cds-WP_000072067.1"; Name "WP_000072067.1"; Ontology_term "GO:0006265" "GO:0003918" "GO:0009330"; Parent "gene-C7A06_RS00020"; gbkey "CDS"; gene "gyrB"; go_component "DNA topoisomerase type II (double strand cut, ATP-hydrolyzing) complex|0009330||IEA"; go_function "DNA topoisomerase type II (double strand cut, ATP-hydrolyzing) activity|0003918||IEA"; go_process "DNA topological change|0006265||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005121480.1"; locus_tag "C7A06_RS00020"; product "DNA topoisomerase (ATP-hydrolyzing) subunit B"; protein_id "WP_000072067.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	5908	6306	.	+	.	gene_id "nbis-gene-5"; ID "nbis-gene-5"; Name "yidB"; gbkey "Gene"; gene "yidB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00025";
+NZ_CP027599.1	RefSeq	transcript	5908	6306	.	+	.	gene_id "nbis-gene-5"; transcript_id "gene-C7A06_RS00025"; ID "gene-C7A06_RS00025"; Name "yidB"; Parent "nbis-gene-5"; gbkey "Gene"; gene "yidB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00025"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	5908	6306	.	+	.	gene_id "nbis-gene-5"; transcript_id "gene-C7A06_RS00025"; Dbxref "Genbank:WP_000522208.1"; ID "nbis-exon-5"; Name "WP_000522208.1"; Parent "gene-C7A06_RS00025"; gbkey "CDS"; gene "yidB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418153.4"; locus_tag "C7A06_RS00025"; product "YidB family protein"; protein_id "WP_000522208.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	5908	6306	.	+	0	gene_id "nbis-gene-5"; transcript_id "gene-C7A06_RS00025"; Dbxref "Genbank:WP_000522208.1"; ID "cds-WP_000522208.1"; Name "WP_000522208.1"; Parent "gene-C7A06_RS00025"; gbkey "CDS"; gene "yidB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418153.4"; locus_tag "C7A06_RS00025"; product "YidB family protein"; protein_id "WP_000522208.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	6421	7233	.	+	.	gene_id "nbis-gene-6"; ID "nbis-gene-6"; Name "yidA"; gbkey "Gene"; gene "yidA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00030";
+NZ_CP027599.1	RefSeq	transcript	6421	7233	.	+	.	gene_id "nbis-gene-6"; transcript_id "gene-C7A06_RS00030"; ID "gene-C7A06_RS00030"; Name "yidA"; Parent "nbis-gene-6"; gbkey "Gene"; gene "yidA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00030"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	6421	7233	.	+	.	gene_id "nbis-gene-6"; transcript_id "gene-C7A06_RS00030"; Dbxref "Genbank:WP_000985541.1"; ID "nbis-exon-6"; Name "WP_000985541.1"; Ontology_term "GO:0016787"; Parent "gene-C7A06_RS00030"; gbkey "CDS"; gene "yidA"; go_function "hydrolase activity|0016787||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418152.1"; locus_tag "C7A06_RS00030"; product "sugar-phosphatase"; protein_id "WP_000985541.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	6421	7233	.	+	0	gene_id "nbis-gene-6"; transcript_id "gene-C7A06_RS00030"; Dbxref "Genbank:WP_000985541.1"; ID "cds-WP_000985541.1"; Name "WP_000985541.1"; Ontology_term "GO:0016787"; Parent "gene-C7A06_RS00030"; gbkey "CDS"; gene "yidA"; go_function "hydrolase activity|0016787||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418152.1"; locus_tag "C7A06_RS00030"; product "sugar-phosphatase"; protein_id "WP_000985541.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	7279	7935	.	-	.	gene_id "nbis-gene-7"; ID "nbis-gene-7"; Name "C7A06_RS00035"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00035";
+NZ_CP027599.1	RefSeq	transcript	7279	7935	.	-	.	gene_id "nbis-gene-7"; transcript_id "gene-C7A06_RS00035"; ID "gene-C7A06_RS00035"; Name "C7A06_RS00035"; Parent "nbis-gene-7"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00035"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	7279	7935	.	-	.	gene_id "nbis-gene-7"; transcript_id "gene-C7A06_RS00035"; Dbxref "Genbank:WP_000772931.1"; ID "nbis-exon-7"; Name "WP_000772931.1"; Parent "gene-C7A06_RS00035"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709504.1"; locus_tag "C7A06_RS00035"; product "hypothetical protein"; protein_id "WP_000772931.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	7279	7935	.	-	0	gene_id "nbis-gene-7"; transcript_id "gene-C7A06_RS00035"; Dbxref "Genbank:WP_000772931.1"; ID "cds-WP_000772931.1"; Name "WP_000772931.1"; Parent "gene-C7A06_RS00035"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709504.1"; locus_tag "C7A06_RS00035"; product "hypothetical protein"; protein_id "WP_000772931.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	8213	8902	.	+	.	gene_id "nbis-gene-8"; ID "nbis-gene-8"; Name "dgoR"; gbkey "Gene"; gene "dgoR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00040";
+NZ_CP027599.1	RefSeq	transcript	8213	8902	.	+	.	gene_id "nbis-gene-8"; transcript_id "gene-C7A06_RS00040"; ID "gene-C7A06_RS00040"; Name "dgoR"; Parent "nbis-gene-8"; gbkey "Gene"; gene "dgoR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00040"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	8213	8902	.	+	.	gene_id "nbis-gene-8"; transcript_id "gene-C7A06_RS00040"; Dbxref "Genbank:WP_000174305.1"; ID "nbis-exon-8"; Name "WP_000174305.1"; Parent "gene-C7A06_RS00040"; gbkey "CDS"; gene "dgoR"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709505.1"; locus_tag "C7A06_RS00040"; product "D-galactonate utilization transcriptional regulator DgoR"; protein_id "WP_000174305.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	8213	8902	.	+	0	gene_id "nbis-gene-8"; transcript_id "gene-C7A06_RS00040"; Dbxref "Genbank:WP_000174305.1"; ID "cds-WP_000174305.1"; Name "WP_000174305.1"; Parent "gene-C7A06_RS00040"; gbkey "CDS"; gene "dgoR"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709505.1"; locus_tag "C7A06_RS00040"; product "D-galactonate utilization transcriptional regulator DgoR"; protein_id "WP_000174305.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	8899	9777	.	+	.	gene_id "nbis-gene-9"; ID "nbis-gene-9"; Name "dgoK"; gbkey "Gene"; gene "dgoK"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00045";
+NZ_CP027599.1	RefSeq	transcript	8899	9777	.	+	.	gene_id "nbis-gene-9"; transcript_id "gene-C7A06_RS00045"; ID "gene-C7A06_RS00045"; Name "dgoK"; Parent "nbis-gene-9"; gbkey "Gene"; gene "dgoK"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00045"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	8899	9777	.	+	.	gene_id "nbis-gene-9"; transcript_id "gene-C7A06_RS00045"; Dbxref "Genbank:WP_000127112.1"; ID "nbis-exon-9"; Name "WP_000127112.1"; Parent "gene-C7A06_RS00045"; gbkey "CDS"; gene "dgoK"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709506.1"; locus_tag "C7A06_RS00045"; product "2-dehydro-3-deoxygalactonokinase"; protein_id "WP_000127112.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	8899	9777	.	+	0	gene_id "nbis-gene-9"; transcript_id "gene-C7A06_RS00045"; Dbxref "Genbank:WP_000127112.1"; ID "cds-WP_000127112.1"; Name "WP_000127112.1"; Parent "gene-C7A06_RS00045"; gbkey "CDS"; gene "dgoK"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709506.1"; locus_tag "C7A06_RS00045"; product "2-dehydro-3-deoxygalactonokinase"; protein_id "WP_000127112.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	9761	10378	.	+	.	gene_id "nbis-gene-10"; ID "nbis-gene-10"; Name "dgoA"; gbkey "Gene"; gene "dgoA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00050";
+NZ_CP027599.1	RefSeq	transcript	9761	10378	.	+	.	gene_id "nbis-gene-10"; transcript_id "gene-C7A06_RS00050"; ID "gene-C7A06_RS00050"; Name "dgoA"; Parent "nbis-gene-10"; gbkey "Gene"; gene "dgoA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00050"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	9761	10378	.	+	.	gene_id "nbis-gene-10"; transcript_id "gene-C7A06_RS00050"; Dbxref "Genbank:WP_001198699.1"; ID "nbis-exon-10"; Name "WP_001198699.1"; Parent "gene-C7A06_RS00050"; gbkey "CDS"; gene "dgoA"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_026238.1"; locus_tag "C7A06_RS00050"; product "2-dehydro-3-deoxy-6-phosphogalactonate aldolase"; protein_id "WP_001198699.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	9761	10378	.	+	0	gene_id "nbis-gene-10"; transcript_id "gene-C7A06_RS00050"; Dbxref "Genbank:WP_001198699.1"; ID "cds-WP_001198699.1"; Name "WP_001198699.1"; Parent "gene-C7A06_RS00050"; gbkey "CDS"; gene "dgoA"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_026238.1"; locus_tag "C7A06_RS00050"; product "2-dehydro-3-deoxy-6-phosphogalactonate aldolase"; protein_id "WP_001198699.1"; transl_table "11";
+NZ_CP027599.1	RefSeq	gene	10375	11523	.	+	.	gene_id "nbis-gene-11"; ID "nbis-gene-11"; Name "dgoD"; gbkey "Gene"; gene "dgoD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00055";
+NZ_CP027599.1	RefSeq	transcript	10375	11523	.	+	.	gene_id "nbis-gene-11"; transcript_id "gene-C7A06_RS00055"; ID "gene-C7A06_RS00055"; Name "dgoD"; Parent "nbis-gene-11"; gbkey "Gene"; gene "dgoD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00055"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	10375	11523	.	+	.	gene_id "nbis-gene-11"; transcript_id "gene-C7A06_RS00055"; Dbxref "Genbank:WP_000705001.1"; ID "nbis-exon-11"; Name "WP_000705001.1"; Ontology_term "GO:0009063" "GO:0008869"; Parent "gene-C7A06_RS00055"; gbkey "CDS"; gene "dgoD"; go_function "galactonate dehydratase activity|0008869||IEA"; go_process "cellular amino acid catabolic process|0009063||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_020077623.1"; locus_tag "C7A06_RS00055"; product "galactonate dehydratase"; protein_id "WP_000705001.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	10375	11523	.	+	0	gene_id "nbis-gene-11"; transcript_id "gene-C7A06_RS00055"; Dbxref "Genbank:WP_000705001.1"; ID "cds-WP_000705001.1"; Name "WP_000705001.1"; Ontology_term "GO:0009063" "GO:0008869"; Parent "gene-C7A06_RS00055"; gbkey "CDS"; gene "dgoD"; go_function "galactonate dehydratase activity|0008869||IEA"; go_process "cellular amino acid catabolic process|0009063||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_020077623.1"; locus_tag "C7A06_RS00055"; product "galactonate dehydratase"; protein_id "WP_000705001.1"; transl_table "11";
\ No newline at end of file
diff -r 000000000000 -r f7c0a0030254 test-data/annotation_unique.gtf
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/annotation_unique.gtf	Tue May 23 13:43:07 2023 +0000
@@ -0,0 +1,13 @@
+##gtf-version 3
+#!gff-spec-version 1.21
+#!processor NCBI annotwriter
+#!genome-build ASM301845v1
+#!genome-build-accession NCBI_Assembly:GCF_003018455.1
+#!annotation-date 05/25/2022 04:54:31
+#!annotation-source NCBI RefSeq 
+##sequence-region NZ_CP027599.1 1 5942969
+##species https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=562
+NZ_CP027599.1	RefSeq	gene	11598	12935	.	+	.	gene_id "nbis-gene-12"; ID "nbis-gene-12"; Name "dgoT"; gbkey "Gene"; gene "dgoT"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00060";
+NZ_CP027599.1	RefSeq	transcript	11598	12935	.	+	.	gene_id "nbis-gene-12"; transcript_id "gene-C7A06_RS00060"; ID "gene-C7A06_RS00060"; Name "dgoT"; Parent "nbis-gene-12"; gbkey "Gene"; gene "dgoT"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00060"; original_biotype "mrna";
+NZ_CP027599.1	Protein Homology	exon	11598	12935	.	+	.	gene_id "nbis-gene-12"; transcript_id "gene-C7A06_RS00060"; Dbxref "Genbank:WP_000253455.1"; ID "nbis-exon-12"; Name "WP_000253455.1"; Parent "gene-C7A06_RS00060"; gbkey "CDS"; gene "dgoT"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709507.1"; locus_tag "C7A06_RS00060"; product "MFS transporter"; protein_id "WP_000253455.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	11598	12935	.	+	0	gene_id "nbis-gene-12"; transcript_id "gene-C7A06_RS00060"; Dbxref "Genbank:WP_000253455.1"; ID "cds-WP_000253455.1"; Name "WP_000253455.1"; Parent "gene-C7A06_RS00060"; gbkey "CDS"; gene "dgoT"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709507.1"; locus_tag "C7A06_RS00060"; product "MFS transporter"; protein_id "WP_000253455.1"; transl_table "11";
diff -r 000000000000 -r f7c0a0030254 test-data/fasta_indexes.loc
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/fasta_indexes.loc	Tue May 23 13:43:07 2023 +0000
@@ -0,0 +1,1 @@
+phix174	phiX174	PhiX174 bacteriophage	${__HERE__}/test-cache/reference.fasta
diff -r 000000000000 -r f7c0a0030254 test-data/genome.fasta.gz
Binary file test-data/genome.fasta.gz has changed
diff -r 000000000000 -r f7c0a0030254 test-data/phix174.fasta
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/phix174.fasta	Tue May 23 13:43:07 2023 +0000
@@ -0,0 +1,2 @@
+>K03455
+TGGAAGGGCTAATTCACTCCCAACGAAGACAAGATATCCTTGATCTGTGGATCTACCACACACAAGGCTACTTCCCTGATTAGCAGAACTACACACCAGGGCCAGGGATCAGATATCCACTGACCTTTGGATGGTGCTACAAGCTAGTACCAGTTGAGCCAGAGAAGTTAGAAGAAGCCAACAAAGGAGAGAACACCAGCTTGTTACACCCTGTGAGCCTGCATGGAATGGATGACCCGGAGAGAGAAGTGTTAGAGTGGAGGTTTGACAGCCGCCTAGCATTTCATCACATGGCCCGAGAGCTGCATCCGGAGTACTTCAAGAACTGCTGACATCGAGCTTGCTACAAGGGACTTTCCGCTGGGGACTTTCCAGGGAGGCGTGGCCTGGGCGGGACTGGGGAGTGGCGAGCCCTCAGATCCTGCATATAAGCAGCTGCTTTTTGCCTGTACTGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTGGCGCCCGAACAGGGACCTGAAAGCGAAAGGGAAACCAGAGGAGCTCTCTCGACGCAGGACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCCAAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAGATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAGAATTAGATCGATGGGAAAAAATTCGGTTAAGGCCAGGGGGAAAGAAAAAATATAAATTAAAACATATAGTATGGGCAAGCAGGGAGCTAGAACGATTCGCAGTTAATCCTGGCCTGTTAGAAACATCAGAAGGCTGTAGACAAATACTGGGACAGCTACAACCATCCCTTCAGACAGGATCAGAAGAACTTAGATCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGGATAGAGATAAAAGACACCAAGGAAGCTTTAGACAAGATAGAGGAAGAGCAAAACAAAAGTAAGAAAAAAGCACAGCAAGCAGCAGCTGACACAGGACACAGCAATCAGGTCAGCCAAAATTACCCTATAGTGCAGAACATCCAGGGGCAAATGGTACATCAGGCCATATCACCTAGAACTTTAAATGCATGGGTAAAAGTAGTAGAAGAGAAGGCTTTCAGCCCAGAAGTGATACCCATGTTTTCAGCATTATCAGAAGGAGCCACCCCACAAGATTTAAACACCATGCTAAACACAGTGGGGGGACATCAAGCAGCCATGCAAATGTTAAAAGAGACCATCAATGAGGAAGCTGCAGAATGGGATAGAGTGCATCCAGTGCATGCAGGGCCTATTGCACCAGGCCAGATGAGAGAACCAAGGGGAAGTGACATAGCAGGAACTACTAGTACCCTTCAGGAACAAATAGGATGGATGACAAATAATCCACCTATCCCAGTAGGAGAAATTTATAAAAGATGGATAATCCTGGGATTAAATAAAATAGTAAGAATGTATAGCCCTACCAGCATTCTGGACATAAGACAAGGACCAAAGGAACCCTTTAGAGACTATGTAGACCGGTTCTATAAAACTCTAAGAGCCGAGCAAGCTTCACAGGAGGTAAAAAATTGGATGACAGAAACCTTGTTGGTCCAAAATGCGAACCCAGATTGTAAGACTATTTTAAAAGCATTGGGACCAGCGGCTACACTAGAAGAAATGATGACAGCATGTCAGGGAGTAGGAGGACCCGGCCATAAGGCAAGAGTTTTGGCTGAAGCAATGAGCCAAGTAACAAATTCAGCTACCATAATGATGCAGAGAGGCAATTTTAGGAACCAAAGAAAGATTGTTAAGTGTTTCAATTGTGGCAAAGAAGGGCACACAGCCAGAAATTGCAGGGCCCCTAGGAAAAAGGGCTGTTGGAAATGTGGAAAGGAAGGACACCAAATGAAAGATTGTACTGAGAGACAGGCTAATTTTTTAGGGAAGATCTGGCCTTCCTACAAGGGAAGGCCAGGGAATTTTCTTCAGAGCAGACCAGAGCCAACAGCCCCACCAGAAGAGAGCTTCAGGTCTGGGGTAGAGACAACAACTCCCCCTCAGAAGCAGGAGCCGATAGACAAGGAACTGTATCCTTTAACTTCCCTCAGGTCACTCTTTGGCAACGACCCCTCGTCACAATAAAGATAGGGGGGCAACTAAAGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATGAGTTTGCCAGGAAGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGATCAGATACTCATAGAAATCTGTGGACATAAAGCTATAGGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGATTGGTTGCACTTTAAATTTTCCCATTAGCCCTATTGAGACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAGTAGAAATTTGTACAGAGATGGAAAAGGAAGGGAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAAGACAGTACTAAATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGTTCAATTAGGAATACCACATCCCGCAGGGTTAAAAAAGAAAAAATCAGTAACAGTACTGGATGTGGGTGATGCATATTTTTCAGTTCCCTTAGATGAAGACTTCAGGAAGTATACTGCATTTACCATACCTAGTATAAACAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTCCAAAGTAGCATGACAAAAATCTTAGAGCCTTTTAGAAAACAAAATCCAGACATAGTTATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAACAAAAATAGAGGAGCTGAGACAACATCTGTTGAGGTGGGGACTTACCACACCAGACAAAAAACATCAGAAAGAACCTCCATTCCTTTGGATGGGTTATGAACTCCATCCTGATAAATGGACAGTACAGCCTATAGTGCTGCCAGAAAAAGACAGCTGGACTGTCAATGACATACAGAAGTTAGTGGGGAAATTGAATTGGGCAAGTCAGATTTACCCAGGGATTAAAGTAAGGCAATTATGTAAACTCCTTAGAGGAACCAAAGCACTAACAGAAGTAATACCACTAACAGAAGAAGCAGAGCTAGAACTGGCAGAAAACAGAGAGATTCTAAAAGAACCAGTACATGGAGTGTATTATGACCCATCAAAAGACTTAATAGCAGAAATACAGAAGCAGGGGCAAGGCCAATGGACATATCAAATTTATCAAGAGCCATTTAAAAATCTGAAAACAGGAAAATATGCAAGAATGAGGGGTGCCCACACTAATGATGTAAAACAATTAACAGAGGCAGTGCAAAAAATAACCACAGAAAGCATAGTAATATGGGGAAAGACTCCTAAATTTAAACTGCCCATACAAAAGGAAACATGGGAAACATGGTGGACAGAGTATTGGCAAGCCACCTGGATTCCTGAGTGGGAGTTTGTTAATACCCCTCCCTTAGTGAAATTATGGTACCAGTTAGAGAAAGAACCCATAGTAGGAGCAGAAACCTTCTATGTAGATGGGGCAGCTAACAGGGAGACTAAATTAGGAAAAGCAGGATATGTTACTAATAGAGGAAGACAAAAAGTTGTCACCCTAACTGACACAACAAATCAGAAGACTGAGTTACAAGCAATTTATCTAGCTTTGCAGGATTCGGGATTAGAAGTAAACATAGTAACAGACTCACAATATGCATTAGGAATCATTCAAGCACAACCAGATCAAAGTGAATCAGAGTTAGTCAATCAAATAATAGAGCAGTTAATAAAAAAGGAAAAGGTCTATCTGGCATGGGTACCAGCACACAAAGGAATTGGAGGAAATGAACAAGTAGATAAATTAGTCAGTGCTGGAATCAGGAAAGTACTATTTTTAGATGGAATAGATAAGGCCCAAGATGAACATGAGAAATATCACAGTAATTGGAGAGCAATGGCTAGTGATTTTAACCTGCCACCTGTAGTAGCAAAAGAAATAGTAGCCAGCTGTGATAAATGTCAGCTAAAAGGAGAAGCCATGCATGGACAAGTAGACTGTAGTCCAGGAATATGGCAACTAGATTGTACACATTTAGAAGGAAAAGTTATCCTGGTAGCAGTTCATGTAGCCAGTGGATATATAGAAGCAGAAGTTATTCCAGCAGAAACAGGGCAGGAAACAGCATATTTTCTTTTAAAATTAGCAGGAAGATGGCCAGTAAAAACAATACATACTGACAATGGCAGCAATTTCACCGGTGCTACGGTTAGGGCCGCCTGTTGGTGGGCGGGAATCAAGCAGGAATTTGGAATTCCCTACAATCCCCAAAGTCAAGGAGTAGTAGAATCTATGAATAAAGAATTAAAGAAAATTATAGGACAGGTAAGAGATCAGGCTGAACATCTTAAGACAGCAGTACAAATGGCAGTATTCATCCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAATAGTAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAACAAATTACAAAAATTCAAAATTTTCGGGTTTATTACAGGGACAGCAGAAATCCACTTTGGAAAGGACCAGCAAAGCTCCTCTGGAAAGGTGAAGGGGCAGTAGTAATACAAGATAATAGTGACATAAAAGTAGTGCCAAGAAGAAAAGCAAAGATCATTAGGGATTATGGAAAACAGATGGCAGGTGATGATTGTGTGGCAAGTAGACAGGATGAGGATTAGAACATGGAAAAGTTTAGTAAAACACCATATGTATGTTTCAGGGAAAGCTAGGGGATGGTTTTATAGACATCACTATGAAAGCCCTCATCCAAGAATAAGTTCAGAAGTACACATCCCACTAGGGGATGCTAGATTGGTAATAACAACATATTGGGGTCTGCATACAGGAGAAAGAGACTGGCATTTGGGTCAGGGAGTCTCCATAGAATGGAGGAAAAAGAGATATAGCACACAAGTAGACCCTGAACTAGCAGACCAACTAATTCATCTGTATTACTTTGACTGTTTTTCAGACTCTGCTATAAGAAAGGCCTTATTAGGACACATAGTTAGCCCTAGGTGTGAATATCAAGCAGGACATAACAAGGTAGGATCTCTACAATACTTGGCACTAGCAGCATTAATAACACCAAAAAAGATAAAGCCACCTTTGCCTAGTGTTACGAAACTGACAGAGGATAGATGGAACAAGCCCCAGAAGACCAAGGGCCACAGAGGGAGCCACACAATGAATGGACACTAGAGCTTTTAGAGGAGCTTAAGAATGAAGCTGTTAGACATTTTCCTAGGATTTGGCTCCATGGCTTAGGGCAACATATCTATGAAACTTATGGGGATACTTGGGCAGGAGTGGAAGCCATAATAAGAATTCTGCAACAACTGCTGTTTATCCATTTTCAGAATTGGGTGTCGACATAGCAGAATAGGCGTTACTCGACAGAGGAGAGCAAGAAATGGAGCCAGTAGATCCTAGACTAGAGCCCTGGAAGCATCCAGGAAGTCAGCCTAAAACTGCTTGTACCAATTGCTATTGTAAAAAGTGTTGCTTTCATTGCCAAGTTTGTTTCATAACAAAAGCCTTAGGCATCTCCTATGGCAGGAAGAAGCGGAGACAGCGACGAAGAGCTCATCAGAACAGTCAGACTCATCAAGCTTCTCTATCAAAGCAGTAAGTAGTACATGTAACGCAACCTATACCAATAGTAGCAATAGTAGCATTAGTAGTAGCAATAATAATAGCAATAGTTGTGTGGTCCATAGTAATCATAGAATATAGGAAAATATTAAGACAAAGAAAAATAGACAGGTTAATTGATAGACTAATAGAAAGAGCAGAAGACAGTGGCAATGAGAGTGAAGGAGAAATATCAGCACTTGTGGAGATGGGGGTGGAGATGGGGCACCATGCTCCTTGGGATGTTGATGATCTGTAGTGCTACAGAAAAATTGTGGGTCACAGTCTATTATGGGGTACCTGTGTGGAAGGAAGCAACCACCACTCTATTTTGTGCATCAGATGCTAAAGCATATGATACAGAGGTACATAATGTTTGGGCCACACATGCCTGTGTACCCACAGACCCCAACCCACAAGAAGTAGTATTGGTAAATGTGACAGAAAATTTTAACATGTGGAAAAATGACATGGTAGAACAGATGCATGAGGATATAATCAGTTTATGGGATCAAAGCCTAAAGCCATGTGTAAAATTAACCCCACTCTGTGTTAGTTTAAAGTGCACTGATTTGAAGAATGATACTAATACCAATAGTAGTAGCGGGAGAATGATAATGGAGAAAGGAGAGATAAAAAACTGCTCTTTCAATATCAGCACAAGCATAAGAGGTAAGGTGCAGAAAGAATATGCATTTTTTTATAAACTTGATATAATACCAATAGATAATGATACTACCAGCTATAAGTTGACAAGTTGTAACACCTCAGTCATTACACAGGCCTGTCCAAAGGTATCCTTTGAGCCAATTCCCATACATTATTGTGCCCCGGCTGGTTTTGCGATTCTAAAATGTAATAATAAGACGTTCAATGGAACAGGACCATGTACAAATGTCAGCACAGTACAATGTACACATGGAATTAGGCCAGTAGTATCAACTCAACTGCTGTTAAATGGCAGTCTAGCAGAAGAAGAGGTAGTAATTAGATCTGTCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTGAACACATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGAATCCGTATCCAGAGAGGACCAGGGAGAGCATTTGTTACAATAGGAAAAATAGGAAATATGAGACAAGCACATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTAGCAAATTAAGAGAACAATTTGGAAATAATAAAACAATAATCTTTAAGCAATCCTCAGGAGGGGACCCAGAAATTGTAACGCACAGTTTTAATTGTGGAGGGGAATTTTTCTACTGTAATTCAACACAACTGTTTAATAGTACTTGGTTTAATAGTACTTGGAGTACTGAAGGGTCAAATAACACTGAAGGAAGTGACACAATCACCCTCCCATGCAGAATAAAACAAATTATAAACATGTGGCAGAAAGTAGGAAAAGCAATGTATGCCCCTCCCATCAGTGGACAAATTAGATGTTCATCAAATATTACAGGGCTGCTATTAACAAGAGATGGTGGTAATAGCAACAATGAGTCCGAGATCTTCAGACCTGGAGGAGGAGATATGAGGGACAATTGGAGAAGTGAATTATATAAATATAAAGTAGTAAAAATTGAACCATTAGGAGTAGCACCCACCAAGGCAAAGAGAAGAGTGGTGCAGAGAGAAAAAAGAGCAGTGGGAATAGGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCCTCAATGACGCTGACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAGCAGCAGAACAATTTGCTGAGGGCTATTGAGGCGCAACAGCATCTGTTGCAACTCACAGTCTGGGGCATCAAGCAGCTCCAGGCAAGAATCCTGGCTGTGGAAAGATACCTAAAGGATCAACAGCTCCTGGGGATTTGGGGTTGCTCTGGAAAACTCATTTGCACCACTGCTGTGCCTTGGAATGCTAGTTGGAGTAATAAATCTCTGGAACAGATTTGGAATCACACGACCTGGATGGAGTGGGACAGAGAAATTAACAATTACACAAGCTTAATACACTCCTTAATTGAAGAATCGCAAAACCAGCAAGAAAAGAATGAACAAGAATTATTGGAATTAGATAAATGGGCAAGTTTGTGGAATTGGTTTAACATAACAAATTGGCTGTGGTATATAAAATTATTCATAATGATAGTAGGAGGCTTGGTAGGTTTAAGAATAGTTTTTGCTGTACTTTCTATAGTGAATAGAGTTAGGCAGGGATATTCACCATTATCGTTTCAGACCCACCTCCCAACCCCGAGGGGACCCGACAGGCCCGAAGGAATAGAAGAAGAAGGTGGAGAGAGAGACAGAGACAGATCCATTCGATTAGTGAACGGATCCTTGGCACTTATCTGGGACGATCTGCGGAGCCTGTGCCTCTTCAGCTACCACCGCTTGAGAGACTTACTCTTGATTGTAACGAGGATTGTGGAACTTCTGGGACGCAGGGGGTGGGAAGCCCTCAAATATTGGTGGAATCTCCTACAGTATTGGAGTCAGGAACTAAAGAATAGTGCTGTTAGCTTGCTCAATGCCACAGCCATAGCAGTAGCTGAGGGGACAGATAGGGTTATAGAAGTAGTACAAGGAGCTTGTAGAGCTATTCGCCACATACCTAGAAGAATAAGACAGGGCTTGGAAAGGATTTTGCTATAAGATGGGTGGCAAGTGGTCAAAAAGTAGTGTGATTGGATGGCCTACTGTAAGGGAAAGAATGAGACGAGCTGAGCCAGCAGCAGATAGGGTGGGAGCAGCATCTCGAGACCTGGAAAAACATGGAGCAATCACAAGTAGCAATACAGCAGCTACCAATGCTGCTTGTGCCTGGCTAGAAGCACAAGAGGAGGAGGAGGTGGGTTTTCCAGTCACACCTCAGGTACCTTTAAGACCAATGACTTACAAGGCAGCTGTAGATCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGAAGGGCTAATTCACTCCCAAAGAAGACAAGATATCCTTGATCTGTGGATCTACCACACACAAGGCTACTTCCCTGATTAGCAGAACTACACACCAGGGCCAGGGGTCAGATATCCACTGACCTTTGGATGGTGCTACAAGCTAGTACCAGTTGAGCCAGATAAGATAGAAGAGGCCAATAAAGGAGAGAACACCAGCTTGTTACACCCTGTGAGCCTGCATGGGATGGATGACCCGGAGAGAGAAGTGTTAGAGTGGAGGTTTGACAGCCGCCTAGCATTTCATCACGTGGCCCGAGAGCTGCATCCGGAGTACTTCAAGAACTGCTGACATCGAGCTTGCTACAAGGGACTTTCCGCTGGGGACTTTCCAGGGAGGCGTGGCCTGGGCGGGACTGGGGAGTGGCGAGCCCTCAGATCCTGCATATAAGCAGCTGCTTTTTGCCTGTACTGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCA
diff -r 000000000000 -r f7c0a0030254 test-data/phix174.gff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/phix174.gff	Tue May 23 13:43:07 2023 +0000
@@ -0,0 +1,2 @@
+##gff-version 3
+K03455	data	gene	2	2669	.	.	.	ID=1
diff -r 000000000000 -r f7c0a0030254 test-data/test-cache/reference.fasta
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test-cache/reference.fasta	Tue May 23 13:43:07 2023 +0000
@@ -0,0 +1,2 @@
+>K03455
+TGGAAGGGCTAATTCACTCCCAACGAAGACAAGATATCCTTGATCTGTGGATCTACCACACACAAGGCTACTTCCCTGATTAGCAGAACTACACACCAGGGCCAGGGATCAGATATCCACTGACCTTTGGATGGTGCTACAAGCTAGTACCAGTTGAGCCAGAGAAGTTAGAAGAAGCCAACAAAGGAGAGAACACCAGCTTGTTACACCCTGTGAGCCTGCATGGAATGGATGACCCGGAGAGAGAAGTGTTAGAGTGGAGGTTTGACAGCCGCCTAGCATTTCATCACATGGCCCGAGAGCTGCATCCGGAGTACTTCAAGAACTGCTGACATCGAGCTTGCTACAAGGGACTTTCCGCTGGGGACTTTCCAGGGAGGCGTGGCCTGGGCGGGACTGGGGAGTGGCGAGCCCTCAGATCCTGCATATAAGCAGCTGCTTTTTGCCTGTACTGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTGGCGCCCGAACAGGGACCTGAAAGCGAAAGGGAAACCAGAGGAGCTCTCTCGACGCAGGACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCCAAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAGATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAGAATTAGATCGATGGGAAAAAATTCGGTTAAGGCCAGGGGGAAAGAAAAAATATAAATTAAAACATATAGTATGGGCAAGCAGGGAGCTAGAACGATTCGCAGTTAATCCTGGCCTGTTAGAAACATCAGAAGGCTGTAGACAAATACTGGGACAGCTACAACCATCCCTTCAGACAGGATCAGAAGAACTTAGATCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGGATAGAGATAAAAGACACCAAGGAAGCTTTAGACAAGATAGAGGAAGAGCAAAACAAAAGTAAGAAAAAAGCACAGCAAGCAGCAGCTGACACAGGACACAGCAATCAGGTCAGCCAAAATTACCCTATAGTGCAGAACATCCAGGGGCAAATGGTACATCAGGCCATATCACCTAGAACTTTAAATGCATGGGTAAAAGTAGTAGAAGAGAAGGCTTTCAGCCCAGAAGTGATACCCATGTTTTCAGCATTATCAGAAGGAGCCACCCCACAAGATTTAAACACCATGCTAAACACAGTGGGGGGACATCAAGCAGCCATGCAAATGTTAAAAGAGACCATCAATGAGGAAGCTGCAGAATGGGATAGAGTGCATCCAGTGCATGCAGGGCCTATTGCACCAGGCCAGATGAGAGAACCAAGGGGAAGTGACATAGCAGGAACTACTAGTACCCTTCAGGAACAAATAGGATGGATGACAAATAATCCACCTATCCCAGTAGGAGAAATTTATAAAAGATGGATAATCCTGGGATTAAATAAAATAGTAAGAATGTATAGCCCTACCAGCATTCTGGACATAAGACAAGGACCAAAGGAACCCTTTAGAGACTATGTAGACCGGTTCTATAAAACTCTAAGAGCCGAGCAAGCTTCACAGGAGGTAAAAAATTGGATGACAGAAACCTTGTTGGTCCAAAATGCGAACCCAGATTGTAAGACTATTTTAAAAGCATTGGGACCAGCGGCTACACTAGAAGAAATGATGACAGCATGTCAGGGAGTAGGAGGACCCGGCCATAAGGCAAGAGTTTTGGCTGAAGCAATGAGCCAAGTAACAAATTCAGCTACCATAATGATGCAGAGAGGCAATTTTAGGAACCAAAGAAAGATTGTTAAGTGTTTCAATTGTGGCAAAGAAGGGCACACAGCCAGAAATTGCAGGGCCCCTAGGAAAAAGGGCTGTTGGAAATGTGGAAAGGAAGGACACCAAATGAAAGATTGTACTGAGAGACAGGCTAATTTTTTAGGGAAGATCTGGCCTTCCTACAAGGGAAGGCCAGGGAATTTTCTTCAGAGCAGACCAGAGCCAACAGCCCCACCAGAAGAGAGCTTCAGGTCTGGGGTAGAGACAACAACTCCCCCTCAGAAGCAGGAGCCGATAGACAAGGAACTGTATCCTTTAACTTCCCTCAGGTCACTCTTTGGCAACGACCCCTCGTCACAATAAAGATAGGGGGGCAACTAAAGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATGAGTTTGCCAGGAAGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGATCAGATACTCATAGAAATCTGTGGACATAAAGCTATAGGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGATTGGTTGCACTTTAAATTTTCCCATTAGCCCTATTGAGACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAGTAGAAATTTGTACAGAGATGGAAAAGGAAGGGAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAAGACAGTACTAAATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGTTCAATTAGGAATACCACATCCCGCAGGGTTAAAAAAGAAAAAATCAGTAACAGTACTGGATGTGGGTGATGCATATTTTTCAGTTCCCTTAGATGAAGACTTCAGGAAGTATACTGCATTTACCATACCTAGTATAAACAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTCCAAAGTAGCATGACAAAAATCTTAGAGCCTTTTAGAAAACAAAATCCAGACATAGTTATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAACAAAAATAGAGGAGCTGAGACAACATCTGTTGAGGTGGGGACTTACCACACCAGACAAAAAACATCAGAAAGAACCTCCATTCCTTTGGATGGGTTATGAACTCCATCCTGATAAATGGACAGTACAGCCTATAGTGCTGCCAGAAAAAGACAGCTGGACTGTCAATGACATACAGAAGTTAGTGGGGAAATTGAATTGGGCAAGTCAGATTTACCCAGGGATTAAAGTAAGGCAATTATGTAAACTCCTTAGAGGAACCAAAGCACTAACAGAAGTAATACCACTAACAGAAGAAGCAGAGCTAGAACTGGCAGAAAACAGAGAGATTCTAAAAGAACCAGTACATGGAGTGTATTATGACCCATCAAAAGACTTAATAGCAGAAATACAGAAGCAGGGGCAAGGCCAATGGACATATCAAATTTATCAAGAGCCATTTAAAAATCTGAAAACAGGAAAATATGCAAGAATGAGGGGTGCCCACACTAATGATGTAAAACAATTAACAGAGGCAGTGCAAAAAATAACCACAGAAAGCATAGTAATATGGGGAAAGACTCCTAAATTTAAACTGCCCATACAAAAGGAAACATGGGAAACATGGTGGACAGAGTATTGGCAAGCCACCTGGATTCCTGAGTGGGAGTTTGTTAATACCCCTCCCTTAGTGAAATTATGGTACCAGTTAGAGAAAGAACCCATAGTAGGAGCAGAAACCTTCTATGTAGATGGGGCAGCTAACAGGGAGACTAAATTAGGAAAAGCAGGATATGTTACTAATAGAGGAAGACAAAAAGTTGTCACCCTAACTGACACAACAAATCAGAAGACTGAGTTACAAGCAATTTATCTAGCTTTGCAGGATTCGGGATTAGAAGTAAACATAGTAACAGACTCACAATATGCATTAGGAATCATTCAAGCACAACCAGATCAAAGTGAATCAGAGTTAGTCAATCAAATAATAGAGCAGTTAATAAAAAAGGAAAAGGTCTATCTGGCATGGGTACCAGCACACAAAGGAATTGGAGGAAATGAACAAGTAGATAAATTAGTCAGTGCTGGAATCAGGAAAGTACTATTTTTAGATGGAATAGATAAGGCCCAAGATGAACATGAGAAATATCACAGTAATTGGAGAGCAATGGCTAGTGATTTTAACCTGCCACCTGTAGTAGCAAAAGAAATAGTAGCCAGCTGTGATAAATGTCAGCTAAAAGGAGAAGCCATGCATGGACAAGTAGACTGTAGTCCAGGAATATGGCAACTAGATTGTACACATTTAGAAGGAAAAGTTATCCTGGTAGCAGTTCATGTAGCCAGTGGATATATAGAAGCAGAAGTTATTCCAGCAGAAACAGGGCAGGAAACAGCATATTTTCTTTTAAAATTAGCAGGAAGATGGCCAGTAAAAACAATACATACTGACAATGGCAGCAATTTCACCGGTGCTACGGTTAGGGCCGCCTGTTGGTGGGCGGGAATCAAGCAGGAATTTGGAATTCCCTACAATCCCCAAAGTCAAGGAGTAGTAGAATCTATGAATAAAGAATTAAAGAAAATTATAGGACAGGTAAGAGATCAGGCTGAACATCTTAAGACAGCAGTACAAATGGCAGTATTCATCCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAATAGTAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAACAAATTACAAAAATTCAAAATTTTCGGGTTTATTACAGGGACAGCAGAAATCCACTTTGGAAAGGACCAGCAAAGCTCCTCTGGAAAGGTGAAGGGGCAGTAGTAATACAAGATAATAGTGACATAAAAGTAGTGCCAAGAAGAAAAGCAAAGATCATTAGGGATTATGGAAAACAGATGGCAGGTGATGATTGTGTGGCAAGTAGACAGGATGAGGATTAGAACATGGAAAAGTTTAGTAAAACACCATATGTATGTTTCAGGGAAAGCTAGGGGATGGTTTTATAGACATCACTATGAAAGCCCTCATCCAAGAATAAGTTCAGAAGTACACATCCCACTAGGGGATGCTAGATTGGTAATAACAACATATTGGGGTCTGCATACAGGAGAAAGAGACTGGCATTTGGGTCAGGGAGTCTCCATAGAATGGAGGAAAAAGAGATATAGCACACAAGTAGACCCTGAACTAGCAGACCAACTAATTCATCTGTATTACTTTGACTGTTTTTCAGACTCTGCTATAAGAAAGGCCTTATTAGGACACATAGTTAGCCCTAGGTGTGAATATCAAGCAGGACATAACAAGGTAGGATCTCTACAATACTTGGCACTAGCAGCATTAATAACACCAAAAAAGATAAAGCCACCTTTGCCTAGTGTTACGAAACTGACAGAGGATAGATGGAACAAGCCCCAGAAGACCAAGGGCCACAGAGGGAGCCACACAATGAATGGACACTAGAGCTTTTAGAGGAGCTTAAGAATGAAGCTGTTAGACATTTTCCTAGGATTTGGCTCCATGGCTTAGGGCAACATATCTATGAAACTTATGGGGATACTTGGGCAGGAGTGGAAGCCATAATAAGAATTCTGCAACAACTGCTGTTTATCCATTTTCAGAATTGGGTGTCGACATAGCAGAATAGGCGTTACTCGACAGAGGAGAGCAAGAAATGGAGCCAGTAGATCCTAGACTAGAGCCCTGGAAGCATCCAGGAAGTCAGCCTAAAACTGCTTGTACCAATTGCTATTGTAAAAAGTGTTGCTTTCATTGCCAAGTTTGTTTCATAACAAAAGCCTTAGGCATCTCCTATGGCAGGAAGAAGCGGAGACAGCGACGAAGAGCTCATCAGAACAGTCAGACTCATCAAGCTTCTCTATCAAAGCAGTAAGTAGTACATGTAACGCAACCTATACCAATAGTAGCAATAGTAGCATTAGTAGTAGCAATAATAATAGCAATAGTTGTGTGGTCCATAGTAATCATAGAATATAGGAAAATATTAAGACAAAGAAAAATAGACAGGTTAATTGATAGACTAATAGAAAGAGCAGAAGACAGTGGCAATGAGAGTGAAGGAGAAATATCAGCACTTGTGGAGATGGGGGTGGAGATGGGGCACCATGCTCCTTGGGATGTTGATGATCTGTAGTGCTACAGAAAAATTGTGGGTCACAGTCTATTATGGGGTACCTGTGTGGAAGGAAGCAACCACCACTCTATTTTGTGCATCAGATGCTAAAGCATATGATACAGAGGTACATAATGTTTGGGCCACACATGCCTGTGTACCCACAGACCCCAACCCACAAGAAGTAGTATTGGTAAATGTGACAGAAAATTTTAACATGTGGAAAAATGACATGGTAGAACAGATGCATGAGGATATAATCAGTTTATGGGATCAAAGCCTAAAGCCATGTGTAAAATTAACCCCACTCTGTGTTAGTTTAAAGTGCACTGATTTGAAGAATGATACTAATACCAATAGTAGTAGCGGGAGAATGATAATGGAGAAAGGAGAGATAAAAAACTGCTCTTTCAATATCAGCACAAGCATAAGAGGTAAGGTGCAGAAAGAATATGCATTTTTTTATAAACTTGATATAATACCAATAGATAATGATACTACCAGCTATAAGTTGACAAGTTGTAACACCTCAGTCATTACACAGGCCTGTCCAAAGGTATCCTTTGAGCCAATTCCCATACATTATTGTGCCCCGGCTGGTTTTGCGATTCTAAAATGTAATAATAAGACGTTCAATGGAACAGGACCATGTACAAATGTCAGCACAGTACAATGTACACATGGAATTAGGCCAGTAGTATCAACTCAACTGCTGTTAAATGGCAGTCTAGCAGAAGAAGAGGTAGTAATTAGATCTGTCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTGAACACATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGAATCCGTATCCAGAGAGGACCAGGGAGAGCATTTGTTACAATAGGAAAAATAGGAAATATGAGACAAGCACATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTAGCAAATTAAGAGAACAATTTGGAAATAATAAAACAATAATCTTTAAGCAATCCTCAGGAGGGGACCCAGAAATTGTAACGCACAGTTTTAATTGTGGAGGGGAATTTTTCTACTGTAATTCAACACAACTGTTTAATAGTACTTGGTTTAATAGTACTTGGAGTACTGAAGGGTCAAATAACACTGAAGGAAGTGACACAATCACCCTCCCATGCAGAATAAAACAAATTATAAACATGTGGCAGAAAGTAGGAAAAGCAATGTATGCCCCTCCCATCAGTGGACAAATTAGATGTTCATCAAATATTACAGGGCTGCTATTAACAAGAGATGGTGGTAATAGCAACAATGAGTCCGAGATCTTCAGACCTGGAGGAGGAGATATGAGGGACAATTGGAGAAGTGAATTATATAAATATAAAGTAGTAAAAATTGAACCATTAGGAGTAGCACCCACCAAGGCAAAGAGAAGAGTGGTGCAGAGAGAAAAAAGAGCAGTGGGAATAGGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCCTCAATGACGCTGACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAGCAGCAGAACAATTTGCTGAGGGCTATTGAGGCGCAACAGCATCTGTTGCAACTCACAGTCTGGGGCATCAAGCAGCTCCAGGCAAGAATCCTGGCTGTGGAAAGATACCTAAAGGATCAACAGCTCCTGGGGATTTGGGGTTGCTCTGGAAAACTCATTTGCACCACTGCTGTGCCTTGGAATGCTAGTTGGAGTAATAAATCTCTGGAACAGATTTGGAATCACACGACCTGGATGGAGTGGGACAGAGAAATTAACAATTACACAAGCTTAATACACTCCTTAATTGAAGAATCGCAAAACCAGCAAGAAAAGAATGAACAAGAATTATTGGAATTAGATAAATGGGCAAGTTTGTGGAATTGGTTTAACATAACAAATTGGCTGTGGTATATAAAATTATTCATAATGATAGTAGGAGGCTTGGTAGGTTTAAGAATAGTTTTTGCTGTACTTTCTATAGTGAATAGAGTTAGGCAGGGATATTCACCATTATCGTTTCAGACCCACCTCCCAACCCCGAGGGGACCCGACAGGCCCGAAGGAATAGAAGAAGAAGGTGGAGAGAGAGACAGAGACAGATCCATTCGATTAGTGAACGGATCCTTGGCACTTATCTGGGACGATCTGCGGAGCCTGTGCCTCTTCAGCTACCACCGCTTGAGAGACTTACTCTTGATTGTAACGAGGATTGTGGAACTTCTGGGACGCAGGGGGTGGGAAGCCCTCAAATATTGGTGGAATCTCCTACAGTATTGGAGTCAGGAACTAAAGAATAGTGCTGTTAGCTTGCTCAATGCCACAGCCATAGCAGTAGCTGAGGGGACAGATAGGGTTATAGAAGTAGTACAAGGAGCTTGTAGAGCTATTCGCCACATACCTAGAAGAATAAGACAGGGCTTGGAAAGGATTTTGCTATAAGATGGGTGGCAAGTGGTCAAAAAGTAGTGTGATTGGATGGCCTACTGTAAGGGAAAGAATGAGACGAGCTGAGCCAGCAGCAGATAGGGTGGGAGCAGCATCTCGAGACCTGGAAAAACATGGAGCAATCACAAGTAGCAATACAGCAGCTACCAATGCTGCTTGTGCCTGGCTAGAAGCACAAGAGGAGGAGGAGGTGGGTTTTCCAGTCACACCTCAGGTACCTTTAAGACCAATGACTTACAAGGCAGCTGTAGATCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGAAGGGCTAATTCACTCCCAAAGAAGACAAGATATCCTTGATCTGTGGATCTACCACACACAAGGCTACTTCCCTGATTAGCAGAACTACACACCAGGGCCAGGGGTCAGATATCCACTGACCTTTGGATGGTGCTACAAGCTAGTACCAGTTGAGCCAGATAAGATAGAAGAGGCCAATAAAGGAGAGAACACCAGCTTGTTACACCCTGTGAGCCTGCATGGGATGGATGACCCGGAGAGAGAAGTGTTAGAGTGGAGGTTTGACAGCCGCCTAGCATTTCATCACGTGGCCCGAGAGCTGCATCCGGAGTACTTCAAGAACTGCTGACATCGAGCTTGCTACAAGGGACTTTCCGCTGGGGACTTTCCAGGGAGGCGTGGCCTGGGCGGGACTGGGGAGTGGCGAGCCCTCAGATCCTGCATATAAGCAGCTGCTTTTTGCCTGTACTGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCA
diff -r 000000000000 -r f7c0a0030254 test-data/test-cache/reference.fasta.fai
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test-cache/reference.fasta.fai	Tue May 23 13:43:07 2023 +0000
@@ -0,0 +1,1 @@
+K03455	9719	8	9719	9720
diff -r 000000000000 -r f7c0a0030254 test-data/test-cache/reference.fasta.index
Binary file test-data/test-cache/reference.fasta.index has changed
diff -r 000000000000 -r f7c0a0030254 test-data/test01_plot1.pdf
Binary file test-data/test01_plot1.pdf has changed
diff -r 000000000000 -r f7c0a0030254 test-data/test01_plot2.pdf
Binary file test-data/test01_plot2.pdf has changed
diff -r 000000000000 -r f7c0a0030254 test-data/test01_stats.txt
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test01_stats.txt	Tue May 23 13:43:07 2023 +0000
@@ -0,0 +1,80 @@
+--------------------------------------------------------------------------------
+
+Compute transcript with isoforms if any
+
+Number of gene                               379
+Number of transcript                         379
+Number of cds                                376
+Number of exon                               379
+Number of exon in cds                        376
+Number gene overlapping                      62
+Number of single exon gene                   379
+Number of single exon transcript             379
+mean transcripts per gene                    1.0
+mean cdss per transcript                     1.0
+mean exons per transcript                    1.0
+mean exons per cds                           1.0
+Total gene length                            342644
+Total transcript length                      342644
+Total cds length                             342338
+Total exon length                            342644
+mean gene length                             904
+mean transcript length                       904
+mean cds length                              910
+mean exon length                             904
+mean cds piece length                        910
+% of genome covered by gene                  33.1
+% of genome covered by transcript            33.1
+% of genome covered by cds                   33.1
+% of genome covered by exon                  33.1
+Longest gene                                 9499
+Longest transcript                           9499
+Longest cds                                  9499
+Longest exon                                 9499
+Longest cds piece                            9499
+Shortest gene                                54
+Shortest transcript                          54
+Shortest cds                                 54
+Shortest exon                                54
+Shortest cds piece                           54
+
+Re-compute transcript without isoforms asked. We remove shortest isoforms if any
+
+Number of gene                               379
+Number of transcript                         379
+Number of cds                                376
+Number of exon                               379
+Number of exon in cds                        376
+Number gene overlapping                      62
+Number of single exon gene                   379
+Number of single exon transcript             379
+mean transcripts per gene                    1.0
+mean cdss per transcript                     1.0
+mean exons per transcript                    1.0
+mean exons per cds                           1.0
+Total gene length                            342644
+Total transcript length                      342644
+Total cds length                             342338
+Total exon length                            342644
+mean gene length                             904
+mean transcript length                       904
+mean cds length                              910
+mean exon length                             904
+mean cds piece length                        910
+% of genome covered by gene                  33.1
+% of genome covered by transcript            33.1
+% of genome covered by cds                   33.1
+% of genome covered by exon                  33.1
+Longest gene                                 9499
+Longest transcript                           9499
+Longest cds                                  9499
+Longest exon                                 9499
+Longest cds piece                            9499
+Shortest gene                                54
+Shortest transcript                          54
+Shortest cds                                 54
+Shortest exon                                54
+Shortest cds piece                           54
+
+--------------------------------------------------------------------------------
+
diff -r 000000000000 -r f7c0a0030254 test-data/test02.fasta
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test02.fasta	Tue May 23 13:43:07 2023 +0000
@@ -0,0 +1,183 @@
+>nbis-gene-2 seq_id=NZ_CP027599.1 type=gene 5'extra=10nt 3'extra=20nt
+TCGTAAACCTATGAAATTTACCGTAGAACGTGAGCATTTATTAAAACCGCTACAACAGGT
+GAGCGGTCCGTTAGGTGGTCGTCCTACGCTACCGATTCTCGGTAATCTGCTGTTACAGGT
+TGCTGACGGTACGTTGTCGCTGACCGGTACTGATCTCGAGATGGAAATGGTGGCACGTGT
+TGCGCTGGTTCAGCCACACGAGCCAGGAGCGACGACCGTTCCGGCGCGCAAATTCTTTGA
+TATCTGCCGTGGTCTGCCTGAAGGCGCGGAAATTGCCGTGCAGCTGGAAGGTGAACGGAT
+GCTGGTACGCTCCGGGCGTAGCCGTTTTTCGCTGTCTACCCTGCCAGCGGCGGATTTCCC
+GAACCTCGATGACTGGCAGAGTGAAGTCGAATTTACCCTGCCGCAGGCAACGATGAAGCG
+TCTGATTGAAGCGACCCAGTTTTCGATGGCGCATCAGGACGTTCGCTATTACTTAAATGG
+TATGCTGTTTGAAACCGAAGGTGAAGAACTGCGCACCGTGGCAACCGACGGCCACCGTCT
+GGCGGTCTGTTCAATGCCAATTGGTCAATCTTTGCCAAGCCATTCGGTGATCGTACCGCG
+TAAAGGCGTGATTGAACTGATGCGTATGCTCGACGGCGGCGACAATCCGCTGCGCGTGCA
+GATTGGCAGCAACAATATTCGCGCCCACGTTGGCGACTTTATCTTCACCTCCAAACTGGT
+GGATGGTCGCTTCCCGGATTACCGCCGCGTTCTGCCGAAGAATCCGGACAAACATCTGGA
+AGCTGGCTGCGATCTGCTCAAGCAGGCGTTTGCCCGTGCGGCAATTCTCTCTAACGAGAA
+ATTCCGCGGCGTGCGCCTGTATGTCAGCGAAAACCAGCTGAAAATCACCGCCAACAACCC
+GGAACAGGAAGAAGCGGAAGAGATCCTCGACGTTACCTATAGCGGTGCGGAGATGGAAAT
+CGGCTTCAACGTCAGCTATGTGCTGGATGTTCTGAACGCGCTGAAATGCGAAAACGTCCG
+CATGATGCTGACCGATTCGGTTTCCAGCGTGCAGATTGAAGATGCCGCATCACAGTCGGC
+TGCCTATGTTGTCATGCCAATGAGACTGTAATGTCCCTCACCCGCTTGTTG
+>nbis-gene-3 seq_id=NZ_CP027599.1 type=gene 5'extra=10nt 3'extra=20nt
+TGAGACTGTAATGTCCCTCACCCGCTTGTTGATCCGCGATTTCCGCAACATTGAAACCGC
+GGATCTCGCTTTATCTCCCGGCTTTAACTTTCTGGTAGGTGCCAACGGCAGTGGCAAAAC
+CAGCGTGCTGGAAGCCATCTATACGCTCGGCCATGGTCGGGCGTTTCGCAGTTTGCAGAT
+TGGTCGCGTCATTCGCCATGAGCAGGAGGCATTTGTTCTCCATGGGCGATTACAGGGCGA
+AGAGCGCGAGACGGCGATTGGCTTAACCAAGGACAAACAGGGCGACAGCAAAGTCCGCAT
+CGACGGTACTGACGGGCATAAAGTCGCGGAACTGGCGCACCTGATGCCAATGCAGCTGAT
+AACGCCAGAAGGGTTTACTTTACTCAACGGCGGCCCCAAATACAGAAGAGCATTCCTCGA
+CTGGGGATGCTTTCACAACGAACCCGGATTTTTCACCGCCTGGAGCAATCTCAAGCGATT
+GCTCAAGCAGCGCAATGCGGCGCTGCGCCAGGTGACACGTTACGAACAGCTACGCCCGTG
+GGATAAAGAACTGATCCCGCTGGCGGAGCAAATCAGCACCTGGCGCGCGGAGTATAGCGC
+CGGTATCGCGGCCGATATGGCCGATACCTGTAAGCAATTTCTCCCTGAGTTTTCTCTGAC
+TTTCTCTTTCCAGCGCGGCTGGGAGAAAGAGACAGAATATGCTGAGGTGCTGGAACGTAA
+TTTTGAACGCGATCGCCAGCTAACCTACACCGCGCATGGCCCGCATAAAGCGGACTTACG
+CATTCGCGCCGACGGTGCGCCGGTGGAAGATACCTTATCGCGTGGGCAGCTTAAGCTGTT
+GATGTGCGCCTTACGTCTGGCGCAAGGAGAGTTCCTCACCCGTGAAAGCGGGCGGCGGTG
+TCTCTACCTGATAGATGATTTTGCCTCTGAGCTTGATGATGAGCGTCGTGGGTTGCTTGC
+CAGCCGCTTAAAAGCGACGCAATCACAGGTCTTTGTCAGCGCGATCAGTGCTGAACACGT
+TATAGACATGTCGGACGAAAATTCGAAGATGTTTACCGTGGAAAAGGGTAAAATAACGGA
+TTAACCCAAGTATAAATGAGCGAG
+>nbis-gene-4 seq_id=NZ_CP027599.1 type=gene 5'extra=10nt 3'extra=20nt
+AGAAACGTTGATGTCGAATTCTTATGACTCCTCCAGTATCAAAGTCCTGAAAGGGCTGGA
+TGCGGTGCGTAAGCGCCCGGGTATGTATATCGGCGACACGGATGACGGCACCGGTCTGCA
+CCACATGGTATTCGAGGTGGTAGATAACGCTATCGACGAAGCGCTCGCGGGTCACTGTAA
+AGAAATTATCGTCACCATTCACGCCGACAACTCTGTCTCTGTACAGGATGACGGGCGCGG
+CATTCCGACCGGTATTCACCCGGAAGAGGGCGTATCGGCGGCGGAAGTGATCATGACCGT
+TCTGCACGCAGGCGGTAAATTCGACGATAACTCCTATAAAGTGTCCGGCGGTCTGCACGG
+CGTTGGTGTTTCGGTAGTAAACGCCCTGTCGCAAAAACTGGAGCTGGTTATCCAGCGCGA
+GGGTAAAATTCACCGTCAGATCTACGAACACGGTGTACCGCAGGCCCCGCTGGCGGTTAC
+CGGCGAGACTGAAAAAACCGGCACCATGGTGCGTTTCTGGCCTAGCCTCGAAACTTTCAC
+CAATGTGACCGAGTTCGAATATGAAATTCTGGCGAAACGTCTGCGTGAGTTGTCGTTCCT
+CAACTCCGGCGTTTCCATTCGTCTGCGCGACAAGCGCGACGGCAAAGAAGACCACTTCCA
+CTATGAAGGCGGCATCAAGGCGTTCGTTGAATATCTGAACAAGAACAAAACGCCGATCCA
+CCCGAATATCTTCTACTTCTCCACTGAAAAAGACGGTATTGGCGTCGAAGTGGCGTTGCA
+GTGGAACGATGGCTTCCAGGAAAACATCTACTGCTTTACCAACAACATTCCGCAGCGTGA
+CGGCGGTACTCACCTGGCAGGCTTCCGTGCGGCGATGACCCGTACCCTGAACGCCTACAT
+GGACAAAGAAGGCTACAGCAAAAAAGCCAAAGTTAGCGCCACCGGTGACGATGCGCGTGA
+AGGCCTGATTGCGGTCGTTTCCGTGAAAGTGCCGGACCCGAAATTCTCCTCCCAGACCAA
+AGACAAACTGGTTTCTTCTGAGGTGAAATCAGCGGTTGAACAGCAGATGAACGAACTGCT
+GGCAGAATACCTGCTGGAAAACCCAACCGACGCGAAAATCGTGGTTGGCAAAATTATCGA
+TGCTGCCCGTGCCCGTGAAGCGGCGCGTCGCGCGCGTGAAATGACCCGCCGTAAAGGTGC
+GCTCGACTTAGCGGGCCTGCCGGGCAAACTGGCAGACTGCCAGGAACGCGATCCGGCGCT
+TTCCGAACTGTACTTGGTGGAAGGGGACTCCGCGGGCGGCTCTGCGAAGCAGGGGCGTAA
+CCGCAAGAACCAGGCGATTCTGCCGCTGAAGGGTAAAATCCTCAACGTCGAGAAAGCGCG
+CTTCGATAAGATGCTCTCTTCTCAGGAAGTGGCGACGCTTATCACCGCGCTTGGCTGTGG
+TATCGGTCGTGACGAGTACAACCCGGACAAACTGCGTTATCACAGCATCATCATCATGAC
+CGATGCGGACGTCGACGGCTCGCACATTCGTACGCTGCTGTTGACCTTCTTCTATCGTCA
+GATGCCGGAAATCGTTGAACGCGGTCACGTCTACATCGCTCAGCCGCCGCTGTACAAAGT
+GAAGAAAGGCAAGCAGGAACAGTACATTAAAGACGACGAAGCGATGGATCAGTACCAGAT
+CTCTATCGCGCTGGATGGCGCAACGCTGCACACCAACGCCAGCGCACCGGCATTGGCTGG
+CGAAGCGTTAGAGAAATTGGTGTCTGAGTACAACGCGACGCAGAAAATGATCAACCGCAT
+GGAGCGTCGTTATCCGAAAGCAATGCTGAAAGAGCTTATCTATCAGCCGACGCTGACGGA
+AGCCGACCTCTCTGATGAGCAGACCGTTACCCGCTGGGTGAACGCGCTGGTCAGCGAACT
+GAACGACAAAGAACAGCACGGCAGCCAGTGGAAGTTTGATGTCCACACCAATGCCGAACA
+AAACCTGTTCGAGCCGATTGTTCGCGTGCGTACCCACGGTGTGGATACTGACTATCCGCT
+GGATCACGAGTTTATCACCGGTGGCGAATATCGTCGTATCTGCACGCTGGGTGAGAAACT
+GCGTGGCTTGCTGGAAGAAGATGCGTTTATCGAACGTGGCGAGCGTCGTCAGCCGGTAGC
+CAGCTTCGAGCAGGCGCTGGACTGGCTGGTGAAAGAGTCCCGTCGCGGCCTCTCCATCCA
+GCGTTATAAAGGTCTGGGCGAGATGAACCCGGAACAGCTGTGGGAAACCACCATGGACCC
+GGAAAGCCGTCGTATGCTGCGCGTTACCGTTAAGGATGCGATTGCCGCTGACCAGTTGTT
+CACCACGCTGATGGGCGACGCCGTTGAACCGCGCCGTGCGTTTATTGAAGAGAACGCCCT
+GAAAGCGGCGAATATCGATATTTAATGGCGCTAACCATGCGAGCG
+>nbis-gene-5 seq_id=NZ_CP027599.1 type=gene 5'extra=10nt 3'extra=20nt
+GGTGATTATCATGGGGCTTTTTGATGAAGTTGTCGGTGCCTTTCTGAAAGGCGATGCGGG
+GAAATATCAGGCTATTTTAAGTTGGGTTGAGGAGCAGGGCGGCATTCAGGTGCTGCTGGA
+AAAACTGCAAAGTGGCGGCTTAGGGGCCATTCTCTCAACCTGGCTGAGTAATCAACAGGG
+CAATCAATCGGTTAGTGGCGAGCAACTGGAATCGGCGCTCGGCACAAATGCGGTGTCCGA
+TCTTGGACAAAAACTTGGCGTGGATACCAGTACAGCTTCCAGTTTACTGGCAGAACAATT
+GCCGAAGATTATTGATGCGCTCTCACCGCAAGGTGAAGTGTCTCCACAAGCCAATAACGA
+TCTGCTTTCCGCAGGCATGGAACTGCTGAAAGGGAAACTCTTCCGCTAAGCAAATGGGGA
+GCATGCAAC
+>nbis-gene-6 seq_id=NZ_CP027599.1 type=gene 5'extra=10nt 3'extra=20nt
+TGGGGAACTCATGGCTATCAAACTCATTGCTATCGATATGGATGGCACCCTTCTGCTACC
+CGATCACACCATTTCACCCGCCGTTAAAAATGCGATTGCCGCAGCTCGCGCCCGTGGCGT
+GAATGTCGTGCTAACGACGGGTCGCCCTTATGCAGGTGTTCACAATTACCTGAAAGAGCT
+GCATATGGAACTGCCGGGCGACTACTGCATTACTTATAACGGCGCGCTGGTACAGAAGGC
+CGCTGATGGTAGCACCGTGGCGCAAACCGCTCTCAGCTATGACGACTACCGTTTCCTGGA
+AAAACTCTCTCGCGAAGTCGGTTCTCATTTCCACGCCCTGGACCGCACCACGCTGTACAC
+CGCCAACCGTGATATCAGCTACTACACGGTGCATGAATCCTTCGTTGCCACAATTCCGCT
+GGTGTTCTGCGAAGCGGAGAAAATGGACCCCAATACCCAGTTCCTGAAAGTGATGATGAT
+TGATGAACCCGCCATCCTCGACCAGGCTATCGCGCGTATTCCGCAGGAAGTGAAAGAGAA
+ATATACCGTGCTGAAAAGTGCGCCGTACTTCCTCGAAATCCTCGATAAACGCGTTAACAA
+AGGTACGGGGGTGAAATCACTGGCCGACGTGTTAGGTATTAAACCGGAAGAAATCATGGC
+GATTGGCGATCAGGAAAACGACATCGCAATGATTGAATATGCAGGCGTCGGTGTGGCGAT
+GGATAACGCTATTCCTTCGGTGAAAGAAGTGGCGAACTTTGTCACCAAATCCAACCTTGA
+AGATGGCGTGGCGTTTGCTATTGAGAAGTATGTGCTGAATTAATCAGTGGACGGGCAAAC
+AGC
+>nbis-gene-7 seq_id=NZ_CP027599.1 type=gene 3'extra=20nt 5'extra=10nt
+AGGATTAATCATGAAGTTGAATTTTAAGGGATTTTTTAAGGCTGCCGGTTTATTCCCACT
+GGCGCTGATGCTTTCAGGCTGTATCTCGTATGCTCTGGTTTCCCATACCGCAAAGGGTAG
+TTCAGGAAAGTATCAATCGCAGTCAGACACCATCACTGGGCTATCGCAGGCAAAAGATAG
+TAATGGAACAAAAGGCTATGTTTTTGTAGGGGAATCGCTGGATTACCTTATCACTGATGG
+TGCCGATGACATCGTTAAGATGCTCAATGATCCAGCACTTAACCGGCACAATATTCAGGT
+TGCCGATGACGCAAGATTTGTTTTAAATGCGGGGAAAAAGAAATTTACCGGCACAATATC
+GCTTTACTACCACTGGAATAACGAAGAAGAAAAGGCACTGGCAACGCATTATGGTTTTGC
+CTGTGGTGTTCAACACTGTACCAGGTCACTGGAAAACCTAAAAGGCACAATCCATGAGAA
+AAATAAAAACATGGATTACTCAAAGGTGATGGCGTTCTATCATCCGTTTAAAGTGCGATT
+TTATGAATACTATTCACCCAGAGGCATTCCGGATGGTGTTTCCGCAGCATTACTGCCAGT
+GACTGTTACGCTGGACATCATTACTGCACCGCTGCAATTTCTGGTTGTATATGCAGTAAA
+CCAATAATCAGTAAGCGGGCAAACGCG
+>nbis-gene-8 seq_id=NZ_CP027599.1 type=gene 5'extra=10nt 3'extra=20nt
+AGGACTCTCCATGACTCTCAATAAAACCGATCGCATTGTCATTACGCTGGGTAAACAGAT
+TGTTCACGGCAAATACGTACCTGGCTCGCCACTTCCGGCTGAGGCGGAGCTCTGTGAAGA
+GTTTGCAACCTCGCGCAACATCATCCGTGAGGTGTTCCGTTCGTTGATGGCGAAACGGCT
+GATTGAAATGAAACGTTATCGCGGCGCGTTTGTGGCACCGCGTAACCAGTGGAATTACCT
+CGACACTGACGTACTGCAATGGGTGCTGGAAAACGACTACGACCCACGGCTTATCAGTGC
+CATGAGCGAAGTGCGAAATCTGGTGGAACCGGCGATTGCCCGTTGGGCAGCAGAGCGCGC
+GACTTCCAGCGATCTGGCGCAGATTGAATCGGCGCTGAACGAGATGATTGCCAACAATCA
+GGACCGCGAAGCGTTTAACGAAGCGGATATTCGCTACCACGAGGCGGTGCTGCAGTCGGT
+ACATAACCCGGTGTTACAGCAACTTAGCATTGCGATCAGTTCGTTGCAGCGGGCGGTTTT
+TGAACGAACCTGGATGGGCGATGAGGCCAACATGCCGCAAACGCTCCAGGAACATAAGGC
+GCTGTTCGATGCAATACGGCATCAGGACGGCGATGCGGCAGAGCAGGCGGCGCTTACCAT
+GATCGCCAGCTCGACACGAAGGTTAAAGGAAATCACATGACAGCTCGCTACATCGCAATT
+>nbis-gene-9 seq_id=NZ_CP027599.1 type=gene 5'extra=10nt 3'extra=20nt
+AGGAAATCACATGACAGCTCGCTACATCGCAATTGACTGGGGATCGACCAATCTTCGCGC
+CTGGCTTTATCAGGGCGACCACTGCCTGGAGAGCAGGCAATCAGAAGCAGGCGTCACGCG
+CCTGAACGGAAAATCTCCGGCTGCGGTGTTAGCAGAAGTCACGACCGACTGGCGTGAAGA
+GAATACGCCAGTGGTAATGGCAGGAATGGTCGGCAGCAATGTCGGCTGGAAAGTTGCTCC
+GTATTTATCTGTTCCTGCCCGTTTTTCGTCTATTGGCGAACAATTAACGTCTGTTGGCGA
+CAATATCTGGATTATTCCCGGATTATGCGTCTCTCATGACGATAACCACAATGTGATGCG
+CGGCGAAGAAACACAATTGATCGGCGCGCGAACTCTGGCTCCTTCCTCTCTTTATGTTAT
+GCCCGGTACGCATTGCAAATGGGTGCAGGCCGATAGCCAGCAAATCAACGATTTTCGCAC
+CGTGATGACCGGTGAATTACATCATTTACTGTTAAATCACTCATTGATTGGCGCAGGTTT
+GCCGCCGCAGGAAAACTCTGCCGATGCCTTCGCGGCTGGCCTTGAGCGCGGCCTTAATGC
+GCCCGCCATATTGCCGCAGCTTTTTGAAGTTCGCGCCTCGCATGTGCTGGGAACACTTCC
+CCGCGAACAGGTCAGCGAATTTCTCTCTGGTTTGTTGATTGGCGCAGAGGTTGCCAGTAT
+GCGCGACTATGTGACCCATCAACACGCCATCACCCTTGTCGCCGGAACATCGCTGACCGC
+GCGCTACCAGCAAGCCTTTCAGGCGATGGGTTGCGACGTGACGGCGGTGGCGGGCGACAC
+GGCATTTCAGGCTGGTATAAGGAGCATCGCTCATGCAGTGGCAAACTAAACTTCCGCTGA
+TCGCCATTT
+>nbis-gene-10 seq_id=NZ_CP027599.1 type=gene 5'extra=10nt 3'extra=20nt
+AGCATCGCTCATGCAGTGGCAAACTAAACTTCCGCTGATCGCCATTTTGCGCGGCATTAA
+GCCCGACGAGGCGCTGGCGCATGTTGGCGCGGTGATTGACGCCGGGTTCGACGCGGTTGA
+AATCCCGCTGAATTCCCCACAATGGGAGCAAAGCATTCCCGCCATCGTTGATGCGTATGG
+CGACAAGGCGTTGATTGGCGCAGGTACGGTACTGAAACCTGAACAGGTCGATGCGCTCGC
+CAGGATGGGTTGTCAGCTCATCGTTACGCCCAATATCCATAGTGAAGTGATCCGCCGTGC
+GGTGGGCTACGGCATGACCGTCTGCCCCGGCTGCGCGACGGCGACCGAAGCCTTTACCGC
+GCTCGAAGCGGGCGCGCAGGCGCTGAAAATATTTCCGTCATCGGCTTTTGGTCCGCAATA
+CATCAAAGCGTTAAAAGCGGTATTGCCATCGGACATCGCAGTCTTTGCCGTTGGCGGCGT
+GACGCCAGAAAACCTGGCGCAGTGGATAGACGCAGGTTGTGCTGGGGCGGGCTTAGGCAG
+CGATCTCTATCGCGCCGGGCAGTCCGTAGAACGCACCGCGCAGCAGGCAGCAGCATTTGT
+TAAGGCGTATCGAGAGGCAGTGCAATGAAAATCACCAAAATTACCACG
+>nbis-gene-11 seq_id=NZ_CP027599.1 type=gene 5'extra=10nt 3'extra=20nt
+AGGCAGTGCAATGAAAATCACCAAAATTACCACGTATCGTTTACCTCCCCGCTGGATGTT
+CCTGAAAATTGAAACCGATGAAGGCGTGGTCGGTTGGGGCGAGCCCGTGATTGAAGGCCG
+CGCCCGTACGGTGGAAGCGGCAGTTCACGAGCTGGGTGACTATTTGATTGGTCAGGATCC
+TTCGCGCATCAATGACTTATGGCAAGTGATGTATCGCGCCGGATTTTATCGTGGCGGTCC
+AATCCTGATGAGCGCCATTGCCGGGATCGACCAGGCGTTATGGGATATCAAAGGCAAAGT
+GCTGAATGCGCCGGTCTGGCAACTGATGGGCGGCCTGGTTCGCGACAAAATTAAAGCCTA
+CAGTTGGGTCGGCGGCGATCGTCCGGCGGATGTTATCGACGGCATTAAAACCCTGCGCGA
+AATCGGCTTCGATACCTTCAAACTGAACGGTTGTGAAGAACTGGGGCTAATTGATAACTC
+CCGCGCGGTAGATGCGGCAGTCAACACCGTGGCACAAATTCGTGAAGCTTTTGGCAATCA
+GATTGAGTTTGGTCTTGATTTCCACGGTCGCGTCAGCGCGCCAATGGCGAAAGTGCTGAT
+TAAAGAACTGGAGCCGTATCGCCCGCTGTTTATTGAAGAGCCGGTGCTGGCGGAACAAGC
+CGAATACTACCCGAAATTGGCGGCACAAACGCATATTCCACTGGCGGCAGGTGAGCGCAT
+GTTCTCACGTTTCGATTTTAAACGCGTGCTGGAGGCAGGCGGTATTTCGATTCTGCAACC
+GGATCTCTCCCATGCAGGCGGTATTACCGAATGCTACAAAATTGCTGGAATGGCAGAAGC
+CTATGATGTGACCCTTGCGCCGCACTGTCCGCTCGGACCGATTGCACTGGCAGCTTGCCT
+GCATATCGACTTTGTTTCCTATAACGCGGTACTTCAGGAACAAAGTATGGGCATTCATTA
+CAACAAAGGCGCGGAGTTACTCGACTTTGTGAAAAACAAAGAAGACTTCAGTATGGTTGG
+CGGCTTCTTTAAACCGTTAACGAAACCGGGCTTAGGTGTGGAAATCGACGAAGCTAAAGT
+TATTGAGTTCAGTAAAAATGCCCCGGACTGGCGTAATCCGCTCTGGCGTCATGAAGATAA
+CAGCGTAGCAGAGTGGTAATTCCTGCCACGTAAGCCCCT
diff -r 000000000000 -r f7c0a0030254 test-data/test02_plot.pdf
Binary file test-data/test02_plot.pdf has changed
diff -r 000000000000 -r f7c0a0030254 test-data/test03.txt
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test03.txt	Tue May 23 13:43:07 2023 +0000
@@ -0,0 +1,28 @@
+usage: /home/laptop/miniconda3/envs/mulled-v1-d5d9956f5cc87a70e05e5aa3970eaf3637ef7e96fa1e50da0f6646fabcdc59e1/bin/agat_sp_compare_two_annotations.pl --gff1 annotation1.gtf --gff2 annotation2.gtf --output temp_output
+Results of number of genes from file1 that overlap genes from file2:
+
+----------------------------------------------------------------------------------------------
+|                                    gene@transcript@cds                                     |
+----------------------------------------------------------------------------------------------
+|        annotation1.gtf       |        annotation2.gtf       |        Number of cases       |
+----------------------------------------------------------------------------------------------
+|              1               |              0               |              366             |
+|              1               |              1               |              4               |
+|              2               |              2               |              3               |
+----------------------------------------------------------------------------------------------
+Number gene in annotation1: 376
+Number gene in annotation2: 10
+
+
+----------------------------------------------------------------------------------------------
+|                                    gene@transcript@exon                                    |
+----------------------------------------------------------------------------------------------
+|        annotation1.gtf       |        annotation2.gtf       |        Number of cases       |
+----------------------------------------------------------------------------------------------
+|              1               |              0               |              3               |
+----------------------------------------------------------------------------------------------
+Number gene in annotation1: 3
+Number gene in annotation2: 0
+
+
+
diff -r 000000000000 -r f7c0a0030254 test-data/test04.gff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test04.gff	Tue May 23 13:43:07 2023 +0000
@@ -0,0 +1,54 @@
+##gff-version 3
+##gtf-version 3
+#!gff-spec-version 1.21
+#!processor NCBI annotwriter
+#!genome-build ASM301845v1
+#!genome-build-accession NCBI_Assembly:GCF_003018455.1
+#!annotation-date 05/25/2022 04:54:31
+#!annotation-source NCBI RefSeq 
+##sequence-region NZ_CP027599.1 1 5942969
+##species https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=562
+NZ_CP027599.1	RefSeq	gene	1052	2152	.	+	.	ID=nbis-gene-2;Name=dnaN;gbkey=Gene;gene=dnaN;gene_biotype=protein_coding;gene_id=nbis-gene-2;locus_tag=C7A06_RS00010
+NZ_CP027599.1	RefSeq	transcript	1052	2152	.	+	.	ID=gene-C7A06_RS00010;Parent=nbis-gene-2;Name=dnaN;gbkey=Gene;gene=dnaN;gene_biotype=protein_coding;gene_id=nbis-gene-2;locus_tag=C7A06_RS00010;original_biotype=mrna;transcript_id=gene-C7A06_RS00010
+NZ_CP027599.1	Protein Homology	exon	1052	2152	.	+	.	ID=nbis-exon-2;Parent=gene-C7A06_RS00010;Dbxref=Genbank:WP_000673464.1;Name=WP_000673464.1;Ontology_term=GO:0006260,GO:0003887,GO:0009360;gbkey=CDS;gene=dnaN;gene_id=nbis-gene-2;go_component=DNA polymerase III complex|0009360||IEA;go_function=DNA-directed DNA polymerase activity|0003887||IEA;go_process=DNA replication|0006260||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_006177590.1;locus_tag=C7A06_RS00010;product=DNA polymerase III subunit beta;protein_id=WP_000673464.1;transcript_id=gene-C7A06_RS00010;transl_table=11
+NZ_CP027599.1	Protein Homology	CDS	1052	2152	.	+	0	ID=cds-WP_000673464.1;Parent=gene-C7A06_RS00010;Dbxref=Genbank:WP_000673464.1;Name=WP_000673464.1;Ontology_term=GO:0006260,GO:0003887,GO:0009360;gbkey=CDS;gene=dnaN;gene_id=nbis-gene-2;go_component=DNA polymerase III complex|0009360||IEA;go_function=DNA-directed DNA polymerase activity|0003887||IEA;go_process=DNA replication|0006260||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_006177590.1;locus_tag=C7A06_RS00010;product=DNA polymerase III subunit beta;protein_id=WP_000673464.1;transcript_id=gene-C7A06_RS00010;transl_table=11
+NZ_CP027599.1	RefSeq	gene	2152	3225	.	+	.	ID=nbis-gene-3;Name=recF;gbkey=Gene;gene=recF;gene_biotype=protein_coding;gene_id=nbis-gene-3;locus_tag=C7A06_RS00015
+NZ_CP027599.1	RefSeq	transcript	2152	3225	.	+	.	ID=gene-C7A06_RS00015;Parent=nbis-gene-3;Name=recF;gbkey=Gene;gene=recF;gene_biotype=protein_coding;gene_id=nbis-gene-3;locus_tag=C7A06_RS00015;original_biotype=mrna;transcript_id=gene-C7A06_RS00015
+NZ_CP027599.1	Protein Homology	exon	2152	3225	.	+	.	ID=nbis-exon-3;Parent=gene-C7A06_RS00015;Dbxref=Genbank:WP_000060112.1;Name=WP_000060112.1;Ontology_term=GO:0006281,GO:0003697,GO:0005524;gbkey=CDS;gene=recF;gene_id=nbis-gene-3;go_function=single-stranded DNA binding|0003697||IEA,ATP binding|0005524||IEA;go_process=DNA repair|0006281||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121479.1;locus_tag=C7A06_RS00015;product=DNA replication/repair protein RecF;protein_id=WP_000060112.1;transcript_id=gene-C7A06_RS00015;transl_table=11
+NZ_CP027599.1	Protein Homology	CDS	2152	3225	.	+	0	ID=cds-WP_000060112.1;Parent=gene-C7A06_RS00015;Dbxref=Genbank:WP_000060112.1;Name=WP_000060112.1;Ontology_term=GO:0006281,GO:0003697,GO:0005524;gbkey=CDS;gene=recF;gene_id=nbis-gene-3;go_function=single-stranded DNA binding|0003697||IEA,ATP binding|0005524||IEA;go_process=DNA repair|0006281||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121479.1;locus_tag=C7A06_RS00015;product=DNA replication/repair protein RecF;protein_id=WP_000060112.1;transcript_id=gene-C7A06_RS00015;transl_table=11
+NZ_CP027599.1	RefSeq	gene	3254	5668	.	+	.	ID=nbis-gene-4;Name=gyrB;gbkey=Gene;gene=gyrB;gene_biotype=protein_coding;gene_id=nbis-gene-4;locus_tag=C7A06_RS00020
+NZ_CP027599.1	RefSeq	transcript	3254	5668	.	+	.	ID=gene-C7A06_RS00020;Parent=nbis-gene-4;Name=gyrB;gbkey=Gene;gene=gyrB;gene_biotype=protein_coding;gene_id=nbis-gene-4;locus_tag=C7A06_RS00020;original_biotype=mrna;transcript_id=gene-C7A06_RS00020
+NZ_CP027599.1	Protein Homology	exon	3254	5668	.	+	.	ID=nbis-exon-4;Parent=gene-C7A06_RS00020;Dbxref=Genbank:WP_000072067.1;Name=WP_000072067.1;Ontology_term=GO:0006265,GO:0003918,GO:0009330;gbkey=CDS;gene=gyrB;gene_id=nbis-gene-4;go_component=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) complex|0009330||IEA;go_function=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) activity|0003918||IEA;go_process=DNA topological change|0006265||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121480.1;locus_tag=C7A06_RS00020;product=DNA topoisomerase (ATP-hydrolyzing) subunit B;protein_id=WP_000072067.1;transcript_id=gene-C7A06_RS00020;transl_table=11
+NZ_CP027599.1	Protein Homology	CDS	3254	5668	.	+	0	ID=cds-WP_000072067.1;Parent=gene-C7A06_RS00020;Dbxref=Genbank:WP_000072067.1;Name=WP_000072067.1;Ontology_term=GO:0006265,GO:0003918,GO:0009330;gbkey=CDS;gene=gyrB;gene_id=nbis-gene-4;go_component=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) complex|0009330||IEA;go_function=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) activity|0003918||IEA;go_process=DNA topological change|0006265||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121480.1;locus_tag=C7A06_RS00020;product=DNA topoisomerase (ATP-hydrolyzing) subunit B;protein_id=WP_000072067.1;transcript_id=gene-C7A06_RS00020;transl_table=11
+NZ_CP027599.1	RefSeq	gene	5908	6306	.	+	.	ID=nbis-gene-5;Name=yidB;gbkey=Gene;gene=yidB;gene_biotype=protein_coding;gene_id=nbis-gene-5;locus_tag=C7A06_RS00025
+NZ_CP027599.1	RefSeq	transcript	5908	6306	.	+	.	ID=gene-C7A06_RS00025;Parent=nbis-gene-5;Name=yidB;gbkey=Gene;gene=yidB;gene_biotype=protein_coding;gene_id=nbis-gene-5;locus_tag=C7A06_RS00025;original_biotype=mrna;transcript_id=gene-C7A06_RS00025
+NZ_CP027599.1	Protein Homology	exon	5908	6306	.	+	.	ID=nbis-exon-5;Parent=gene-C7A06_RS00025;Dbxref=Genbank:WP_000522208.1;Name=WP_000522208.1;gbkey=CDS;gene=yidB;gene_id=nbis-gene-5;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418153.4;locus_tag=C7A06_RS00025;product=YidB family protein;protein_id=WP_000522208.1;transcript_id=gene-C7A06_RS00025;transl_table=11
+NZ_CP027599.1	Protein Homology	CDS	5908	6306	.	+	0	ID=cds-WP_000522208.1;Parent=gene-C7A06_RS00025;Dbxref=Genbank:WP_000522208.1;Name=WP_000522208.1;gbkey=CDS;gene=yidB;gene_id=nbis-gene-5;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418153.4;locus_tag=C7A06_RS00025;product=YidB family protein;protein_id=WP_000522208.1;transcript_id=gene-C7A06_RS00025;transl_table=11
+NZ_CP027599.1	RefSeq	gene	6421	7233	.	+	.	ID=nbis-gene-6;Name=yidA;gbkey=Gene;gene=yidA;gene_biotype=protein_coding;gene_id=nbis-gene-6;locus_tag=C7A06_RS00030
+NZ_CP027599.1	RefSeq	transcript	6421	7233	.	+	.	ID=gene-C7A06_RS00030;Parent=nbis-gene-6;Name=yidA;gbkey=Gene;gene=yidA;gene_biotype=protein_coding;gene_id=nbis-gene-6;locus_tag=C7A06_RS00030;original_biotype=mrna;transcript_id=gene-C7A06_RS00030
+NZ_CP027599.1	Protein Homology	exon	6421	7233	.	+	.	ID=nbis-exon-6;Parent=gene-C7A06_RS00030;Dbxref=Genbank:WP_000985541.1;Name=WP_000985541.1;Ontology_term=GO:0016787;gbkey=CDS;gene=yidA;gene_id=nbis-gene-6;go_function=hydrolase activity|0016787||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418152.1;locus_tag=C7A06_RS00030;product=sugar-phosphatase;protein_id=WP_000985541.1;transcript_id=gene-C7A06_RS00030;transl_table=11
+NZ_CP027599.1	Protein Homology	CDS	6421	7233	.	+	0	ID=cds-WP_000985541.1;Parent=gene-C7A06_RS00030;Dbxref=Genbank:WP_000985541.1;Name=WP_000985541.1;Ontology_term=GO:0016787;gbkey=CDS;gene=yidA;gene_id=nbis-gene-6;go_function=hydrolase activity|0016787||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418152.1;locus_tag=C7A06_RS00030;product=sugar-phosphatase;protein_id=WP_000985541.1;transcript_id=gene-C7A06_RS00030;transl_table=11
+NZ_CP027599.1	RefSeq	gene	7279	7935	.	-	.	ID=nbis-gene-7;Name=C7A06_RS00035;gbkey=Gene;gene_biotype=protein_coding;gene_id=nbis-gene-7;locus_tag=C7A06_RS00035
+NZ_CP027599.1	RefSeq	transcript	7279	7935	.	-	.	ID=gene-C7A06_RS00035;Parent=nbis-gene-7;Name=C7A06_RS00035;gbkey=Gene;gene_biotype=protein_coding;gene_id=nbis-gene-7;locus_tag=C7A06_RS00035;original_biotype=mrna;transcript_id=gene-C7A06_RS00035
+NZ_CP027599.1	Protein Homology	exon	7279	7935	.	-	.	ID=nbis-exon-7;Parent=gene-C7A06_RS00035;Dbxref=Genbank:WP_000772931.1;Name=WP_000772931.1;gbkey=CDS;gene_id=nbis-gene-7;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709504.1;locus_tag=C7A06_RS00035;product=hypothetical protein;protein_id=WP_000772931.1;transcript_id=gene-C7A06_RS00035;transl_table=11
+NZ_CP027599.1	Protein Homology	CDS	7279	7935	.	-	0	ID=cds-WP_000772931.1;Parent=gene-C7A06_RS00035;Dbxref=Genbank:WP_000772931.1;Name=WP_000772931.1;gbkey=CDS;gene_id=nbis-gene-7;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709504.1;locus_tag=C7A06_RS00035;product=hypothetical protein;protein_id=WP_000772931.1;transcript_id=gene-C7A06_RS00035;transl_table=11
+NZ_CP027599.1	RefSeq	gene	8213	8902	.	+	.	ID=nbis-gene-8;Name=dgoR;gbkey=Gene;gene=dgoR;gene_biotype=protein_coding;gene_id=nbis-gene-8;locus_tag=C7A06_RS00040
+NZ_CP027599.1	RefSeq	transcript	8213	8902	.	+	.	ID=gene-C7A06_RS00040;Parent=nbis-gene-8;Name=dgoR;gbkey=Gene;gene=dgoR;gene_biotype=protein_coding;gene_id=nbis-gene-8;locus_tag=C7A06_RS00040;original_biotype=mrna;transcript_id=gene-C7A06_RS00040
+NZ_CP027599.1	Protein Homology	exon	8213	8902	.	+	.	ID=nbis-exon-8;Parent=gene-C7A06_RS00040;Dbxref=Genbank:WP_000174305.1;Name=WP_000174305.1;gbkey=CDS;gene=dgoR;gene_id=nbis-gene-8;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709505.1;locus_tag=C7A06_RS00040;product=D-galactonate utilization transcriptional regulator DgoR;protein_id=WP_000174305.1;transcript_id=gene-C7A06_RS00040;transl_table=11
+NZ_CP027599.1	Protein Homology	CDS	8213	8902	.	+	0	ID=cds-WP_000174305.1;Parent=gene-C7A06_RS00040;Dbxref=Genbank:WP_000174305.1;Name=WP_000174305.1;gbkey=CDS;gene=dgoR;gene_id=nbis-gene-8;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709505.1;locus_tag=C7A06_RS00040;product=D-galactonate utilization transcriptional regulator DgoR;protein_id=WP_000174305.1;transcript_id=gene-C7A06_RS00040;transl_table=11
+NZ_CP027599.1	RefSeq	gene	8899	9777	.	+	.	ID=nbis-gene-9;Name=dgoK;gbkey=Gene;gene=dgoK;gene_biotype=protein_coding;gene_id=nbis-gene-9;locus_tag=C7A06_RS00045
+NZ_CP027599.1	RefSeq	transcript	8899	9777	.	+	.	ID=gene-C7A06_RS00045;Parent=nbis-gene-9;Name=dgoK;gbkey=Gene;gene=dgoK;gene_biotype=protein_coding;gene_id=nbis-gene-9;locus_tag=C7A06_RS00045;original_biotype=mrna;transcript_id=gene-C7A06_RS00045
+NZ_CP027599.1	Protein Homology	exon	8899	9777	.	+	.	ID=nbis-exon-9;Parent=gene-C7A06_RS00045;Dbxref=Genbank:WP_000127112.1;Name=WP_000127112.1;gbkey=CDS;gene=dgoK;gene_id=nbis-gene-9;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709506.1;locus_tag=C7A06_RS00045;product=2-dehydro-3-deoxygalactonokinase;protein_id=WP_000127112.1;transcript_id=gene-C7A06_RS00045;transl_table=11
+NZ_CP027599.1	Protein Homology	CDS	8899	9777	.	+	0	ID=cds-WP_000127112.1;Parent=gene-C7A06_RS00045;Dbxref=Genbank:WP_000127112.1;Name=WP_000127112.1;gbkey=CDS;gene=dgoK;gene_id=nbis-gene-9;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709506.1;locus_tag=C7A06_RS00045;product=2-dehydro-3-deoxygalactonokinase;protein_id=WP_000127112.1;transcript_id=gene-C7A06_RS00045;transl_table=11
+NZ_CP027599.1	RefSeq	gene	9761	10378	.	+	.	ID=nbis-gene-10;Name=dgoA;gbkey=Gene;gene=dgoA;gene_biotype=protein_coding;gene_id=nbis-gene-10;locus_tag=C7A06_RS00050
+NZ_CP027599.1	RefSeq	transcript	9761	10378	.	+	.	ID=gene-C7A06_RS00050;Parent=nbis-gene-10;Name=dgoA;gbkey=Gene;gene=dgoA;gene_biotype=protein_coding;gene_id=nbis-gene-10;locus_tag=C7A06_RS00050;original_biotype=mrna;transcript_id=gene-C7A06_RS00050
+NZ_CP027599.1	Protein Homology	exon	9761	10378	.	+	.	ID=nbis-exon-10;Parent=gene-C7A06_RS00050;Dbxref=Genbank:WP_001198699.1;Name=WP_001198699.1;gbkey=CDS;gene=dgoA;gene_id=nbis-gene-10;inference=COORDINATES: similar to AA sequence:RefSeq:YP_026238.1;locus_tag=C7A06_RS00050;product=2-dehydro-3-deoxy-6-phosphogalactonate aldolase;protein_id=WP_001198699.1;transcript_id=gene-C7A06_RS00050;transl_table=11
+NZ_CP027599.1	Protein Homology	CDS	9761	10378	.	+	0	ID=cds-WP_001198699.1;Parent=gene-C7A06_RS00050;Dbxref=Genbank:WP_001198699.1;Name=WP_001198699.1;gbkey=CDS;gene=dgoA;gene_id=nbis-gene-10;inference=COORDINATES: similar to AA sequence:RefSeq:YP_026238.1;locus_tag=C7A06_RS00050;product=2-dehydro-3-deoxy-6-phosphogalactonate aldolase;protein_id=WP_001198699.1;transcript_id=gene-C7A06_RS00050;transl_table=11
+NZ_CP027599.1	RefSeq	gene	10375	11523	.	+	.	ID=nbis-gene-11;Name=dgoD;gbkey=Gene;gene=dgoD;gene_biotype=protein_coding;gene_id=nbis-gene-11;locus_tag=C7A06_RS00055
+NZ_CP027599.1	RefSeq	transcript	10375	11523	.	+	.	ID=gene-C7A06_RS00055;Parent=nbis-gene-11;Name=dgoD;gbkey=Gene;gene=dgoD;gene_biotype=protein_coding;gene_id=nbis-gene-11;locus_tag=C7A06_RS00055;original_biotype=mrna;transcript_id=gene-C7A06_RS00055
+NZ_CP027599.1	Protein Homology	exon	10375	11523	.	+	.	ID=nbis-exon-11;Parent=gene-C7A06_RS00055;Dbxref=Genbank:WP_000705001.1;Name=WP_000705001.1;Ontology_term=GO:0009063,GO:0008869;gbkey=CDS;gene=dgoD;gene_id=nbis-gene-11;go_function=galactonate dehydratase activity|0008869||IEA;go_process=cellular amino acid catabolic process|0009063||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_020077623.1;locus_tag=C7A06_RS00055;product=galactonate dehydratase;protein_id=WP_000705001.1;transcript_id=gene-C7A06_RS00055;transl_table=11
+NZ_CP027599.1	Protein Homology	CDS	10375	11523	.	+	0	ID=cds-WP_000705001.1;Parent=gene-C7A06_RS00055;Dbxref=Genbank:WP_000705001.1;Name=WP_000705001.1;Ontology_term=GO:0009063,GO:0008869;gbkey=CDS;gene=dgoD;gene_id=nbis-gene-11;go_function=galactonate dehydratase activity|0008869||IEA;go_process=cellular amino acid catabolic process|0009063||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_020077623.1;locus_tag=C7A06_RS00055;product=galactonate dehydratase;protein_id=WP_000705001.1;transcript_id=gene-C7A06_RS00055;transl_table=11
+NZ_CP027599.1	RefSeq	gene	11598	12935	.	+	.	ID=nbis-gene-12;Name=dgoT;gbkey=Gene;gene=dgoT;gene_biotype=protein_coding;gene_id=nbis-gene-12;locus_tag=C7A06_RS00060
+NZ_CP027599.1	RefSeq	transcript	11598	12935	.	+	.	ID=gene-C7A06_RS00060;Parent=nbis-gene-12;Name=dgoT;gbkey=Gene;gene=dgoT;gene_biotype=protein_coding;gene_id=nbis-gene-12;locus_tag=C7A06_RS00060;original_biotype=mrna;transcript_id=gene-C7A06_RS00060
+NZ_CP027599.1	Protein Homology	exon	11598	12935	.	+	.	ID=nbis-exon-12;Parent=gene-C7A06_RS00060;Dbxref=Genbank:WP_000253455.1;Name=WP_000253455.1;gbkey=CDS;gene=dgoT;gene_id=nbis-gene-12;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709507.1;locus_tag=C7A06_RS00060;product=MFS transporter;protein_id=WP_000253455.1;transcript_id=gene-C7A06_RS00060;transl_table=11
+NZ_CP027599.1	Protein Homology	CDS	11598	12935	.	+	0	ID=cds-WP_000253455.1;Parent=gene-C7A06_RS00060;Dbxref=Genbank:WP_000253455.1;Name=WP_000253455.1;gbkey=CDS;gene=dgoT;gene_id=nbis-gene-12;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709507.1;locus_tag=C7A06_RS00060;product=MFS transporter;protein_id=WP_000253455.1;transcript_id=gene-C7A06_RS00060;transl_table=11
diff -r 000000000000 -r f7c0a0030254 test-data/test05.gtf
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test05.gtf	Tue May 23 13:43:07 2023 +0000
@@ -0,0 +1,32 @@
+##gtf-version 2
+##gtf-version 3
+#!gff-spec-version 1.21
+#!processor NCBI annotwriter
+#!genome-build ASM301845v1
+#!genome-build-accession NCBI_Assembly:GCF_003018455.1
+#!annotation-date 05/25/2022 04:54:31
+#!annotation-source NCBI RefSeq 
+##sequence-region NZ_CP027599.1 1 5942969
+##species https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=562
+NZ_CP027599.1	Protein Homology	exon	1052	2152	.	+	.	gene_id "nbis-gene-2"; transcript_id "gene-C7A06_RS00010"; Dbxref "Genbank:WP_000673464.1"; ID "nbis-exon-2"; Name "WP_000673464.1"; Ontology_term "GO:0006260" "GO:0003887" "GO:0009360"; Parent "gene-C7A06_RS00010"; gbkey "CDS"; gene "dnaN"; go_component "DNA polymerase III complex|0009360||IEA"; go_function "DNA-directed DNA polymerase activity|0003887||IEA"; go_process "DNA replication|0006260||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_006177590.1"; locus_tag "C7A06_RS00010"; product "DNA polymerase III subunit beta"; protein_id "WP_000673464.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	1052	2152	.	+	0	gene_id "nbis-gene-2"; transcript_id "gene-C7A06_RS00010"; Dbxref "Genbank:WP_000673464.1"; ID "cds-WP_000673464.1"; Name "WP_000673464.1"; Ontology_term "GO:0006260" "GO:0003887" "GO:0009360"; Parent "gene-C7A06_RS00010"; gbkey "CDS"; gene "dnaN"; go_component "DNA polymerase III complex|0009360||IEA"; go_function "DNA-directed DNA polymerase activity|0003887||IEA"; go_process "DNA replication|0006260||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_006177590.1"; locus_tag "C7A06_RS00010"; product "DNA polymerase III subunit beta"; protein_id "WP_000673464.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	exon	2152	3225	.	+	.	gene_id "nbis-gene-3"; transcript_id "gene-C7A06_RS00015"; Dbxref "Genbank:WP_000060112.1"; ID "nbis-exon-3"; Name "WP_000060112.1"; Ontology_term "GO:0006281" "GO:0003697" "GO:0005524"; Parent "gene-C7A06_RS00015"; gbkey "CDS"; gene "recF"; go_function "single-stranded DNA binding|0003697||IEA" "ATP binding|0005524||IEA"; go_process "DNA repair|0006281||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005121479.1"; locus_tag "C7A06_RS00015"; product "DNA replication/repair protein RecF"; protein_id "WP_000060112.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	2152	3225	.	+	0	gene_id "nbis-gene-3"; transcript_id "gene-C7A06_RS00015"; Dbxref "Genbank:WP_000060112.1"; ID "cds-WP_000060112.1"; Name "WP_000060112.1"; Ontology_term "GO:0006281" "GO:0003697" "GO:0005524"; Parent "gene-C7A06_RS00015"; gbkey "CDS"; gene "recF"; go_function "single-stranded DNA binding|0003697||IEA" "ATP binding|0005524||IEA"; go_process "DNA repair|0006281||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005121479.1"; locus_tag "C7A06_RS00015"; product "DNA replication/repair protein RecF"; protein_id "WP_000060112.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	exon	3254	5668	.	+	.	gene_id "nbis-gene-4"; transcript_id "gene-C7A06_RS00020"; Dbxref "Genbank:WP_000072067.1"; ID "nbis-exon-4"; Name "WP_000072067.1"; Ontology_term "GO:0006265" "GO:0003918" "GO:0009330"; Parent "gene-C7A06_RS00020"; gbkey "CDS"; gene "gyrB"; go_component "DNA topoisomerase type II (double strand cut, ATP-hydrolyzing) complex|0009330||IEA"; go_function "DNA topoisomerase type II (double strand cut, ATP-hydrolyzing) activity|0003918||IEA"; go_process "DNA topological change|0006265||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005121480.1"; locus_tag "C7A06_RS00020"; product "DNA topoisomerase (ATP-hydrolyzing) subunit B"; protein_id "WP_000072067.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	3254	5668	.	+	0	gene_id "nbis-gene-4"; transcript_id "gene-C7A06_RS00020"; Dbxref "Genbank:WP_000072067.1"; ID "cds-WP_000072067.1"; Name "WP_000072067.1"; Ontology_term "GO:0006265" "GO:0003918" "GO:0009330"; Parent "gene-C7A06_RS00020"; gbkey "CDS"; gene "gyrB"; go_component "DNA topoisomerase type II (double strand cut, ATP-hydrolyzing) complex|0009330||IEA"; go_function "DNA topoisomerase type II (double strand cut, ATP-hydrolyzing) activity|0003918||IEA"; go_process "DNA topological change|0006265||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005121480.1"; locus_tag "C7A06_RS00020"; product "DNA topoisomerase (ATP-hydrolyzing) subunit B"; protein_id "WP_000072067.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	exon	5908	6306	.	+	.	gene_id "nbis-gene-5"; transcript_id "gene-C7A06_RS00025"; Dbxref "Genbank:WP_000522208.1"; ID "nbis-exon-5"; Name "WP_000522208.1"; Parent "gene-C7A06_RS00025"; gbkey "CDS"; gene "yidB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418153.4"; locus_tag "C7A06_RS00025"; product "YidB family protein"; protein_id "WP_000522208.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	5908	6306	.	+	0	gene_id "nbis-gene-5"; transcript_id "gene-C7A06_RS00025"; Dbxref "Genbank:WP_000522208.1"; ID "cds-WP_000522208.1"; Name "WP_000522208.1"; Parent "gene-C7A06_RS00025"; gbkey "CDS"; gene "yidB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418153.4"; locus_tag "C7A06_RS00025"; product "YidB family protein"; protein_id "WP_000522208.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	exon	6421	7233	.	+	.	gene_id "nbis-gene-6"; transcript_id "gene-C7A06_RS00030"; Dbxref "Genbank:WP_000985541.1"; ID "nbis-exon-6"; Name "WP_000985541.1"; Ontology_term "GO:0016787"; Parent "gene-C7A06_RS00030"; gbkey "CDS"; gene "yidA"; go_function "hydrolase activity|0016787||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418152.1"; locus_tag "C7A06_RS00030"; product "sugar-phosphatase"; protein_id "WP_000985541.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	6421	7233	.	+	0	gene_id "nbis-gene-6"; transcript_id "gene-C7A06_RS00030"; Dbxref "Genbank:WP_000985541.1"; ID "cds-WP_000985541.1"; Name "WP_000985541.1"; Ontology_term "GO:0016787"; Parent "gene-C7A06_RS00030"; gbkey "CDS"; gene "yidA"; go_function "hydrolase activity|0016787||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418152.1"; locus_tag "C7A06_RS00030"; product "sugar-phosphatase"; protein_id "WP_000985541.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	exon	7279	7935	.	-	.	gene_id "nbis-gene-7"; transcript_id "gene-C7A06_RS00035"; Dbxref "Genbank:WP_000772931.1"; ID "nbis-exon-7"; Name "WP_000772931.1"; Parent "gene-C7A06_RS00035"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709504.1"; locus_tag "C7A06_RS00035"; product "hypothetical protein"; protein_id "WP_000772931.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	7279	7935	.	-	0	gene_id "nbis-gene-7"; transcript_id "gene-C7A06_RS00035"; Dbxref "Genbank:WP_000772931.1"; ID "cds-WP_000772931.1"; Name "WP_000772931.1"; Parent "gene-C7A06_RS00035"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709504.1"; locus_tag "C7A06_RS00035"; product "hypothetical protein"; protein_id "WP_000772931.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	exon	8213	8902	.	+	.	gene_id "nbis-gene-8"; transcript_id "gene-C7A06_RS00040"; Dbxref "Genbank:WP_000174305.1"; ID "nbis-exon-8"; Name "WP_000174305.1"; Parent "gene-C7A06_RS00040"; gbkey "CDS"; gene "dgoR"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709505.1"; locus_tag "C7A06_RS00040"; product "D-galactonate utilization transcriptional regulator DgoR"; protein_id "WP_000174305.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	8213	8902	.	+	0	gene_id "nbis-gene-8"; transcript_id "gene-C7A06_RS00040"; Dbxref "Genbank:WP_000174305.1"; ID "cds-WP_000174305.1"; Name "WP_000174305.1"; Parent "gene-C7A06_RS00040"; gbkey "CDS"; gene "dgoR"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709505.1"; locus_tag "C7A06_RS00040"; product "D-galactonate utilization transcriptional regulator DgoR"; protein_id "WP_000174305.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	exon	8899	9777	.	+	.	gene_id "nbis-gene-9"; transcript_id "gene-C7A06_RS00045"; Dbxref "Genbank:WP_000127112.1"; ID "nbis-exon-9"; Name "WP_000127112.1"; Parent "gene-C7A06_RS00045"; gbkey "CDS"; gene "dgoK"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709506.1"; locus_tag "C7A06_RS00045"; product "2-dehydro-3-deoxygalactonokinase"; protein_id "WP_000127112.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	8899	9777	.	+	0	gene_id "nbis-gene-9"; transcript_id "gene-C7A06_RS00045"; Dbxref "Genbank:WP_000127112.1"; ID "cds-WP_000127112.1"; Name "WP_000127112.1"; Parent "gene-C7A06_RS00045"; gbkey "CDS"; gene "dgoK"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709506.1"; locus_tag "C7A06_RS00045"; product "2-dehydro-3-deoxygalactonokinase"; protein_id "WP_000127112.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	exon	9761	10378	.	+	.	gene_id "nbis-gene-10"; transcript_id "gene-C7A06_RS00050"; Dbxref "Genbank:WP_001198699.1"; ID "nbis-exon-10"; Name "WP_001198699.1"; Parent "gene-C7A06_RS00050"; gbkey "CDS"; gene "dgoA"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_026238.1"; locus_tag "C7A06_RS00050"; product "2-dehydro-3-deoxy-6-phosphogalactonate aldolase"; protein_id "WP_001198699.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	9761	10378	.	+	0	gene_id "nbis-gene-10"; transcript_id "gene-C7A06_RS00050"; Dbxref "Genbank:WP_001198699.1"; ID "cds-WP_001198699.1"; Name "WP_001198699.1"; Parent "gene-C7A06_RS00050"; gbkey "CDS"; gene "dgoA"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_026238.1"; locus_tag "C7A06_RS00050"; product "2-dehydro-3-deoxy-6-phosphogalactonate aldolase"; protein_id "WP_001198699.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	exon	10375	11523	.	+	.	gene_id "nbis-gene-11"; transcript_id "gene-C7A06_RS00055"; Dbxref "Genbank:WP_000705001.1"; ID "nbis-exon-11"; Name "WP_000705001.1"; Ontology_term "GO:0009063" "GO:0008869"; Parent "gene-C7A06_RS00055"; gbkey "CDS"; gene "dgoD"; go_function "galactonate dehydratase activity|0008869||IEA"; go_process "cellular amino acid catabolic process|0009063||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_020077623.1"; locus_tag "C7A06_RS00055"; product "galactonate dehydratase"; protein_id "WP_000705001.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	10375	11523	.	+	0	gene_id "nbis-gene-11"; transcript_id "gene-C7A06_RS00055"; Dbxref "Genbank:WP_000705001.1"; ID "cds-WP_000705001.1"; Name "WP_000705001.1"; Ontology_term "GO:0009063" "GO:0008869"; Parent "gene-C7A06_RS00055"; gbkey "CDS"; gene "dgoD"; go_function "galactonate dehydratase activity|0008869||IEA"; go_process "cellular amino acid catabolic process|0009063||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_020077623.1"; locus_tag "C7A06_RS00055"; product "galactonate dehydratase"; protein_id "WP_000705001.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	exon	11598	12935	.	+	.	gene_id "nbis-gene-12"; transcript_id "gene-C7A06_RS00060"; Dbxref "Genbank:WP_000253455.1"; ID "nbis-exon-12"; Name "WP_000253455.1"; Parent "gene-C7A06_RS00060"; gbkey "CDS"; gene "dgoT"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709507.1"; locus_tag "C7A06_RS00060"; product "MFS transporter"; protein_id "WP_000253455.1"; transl_table "11";
+NZ_CP027599.1	Protein Homology	CDS	11598	12935	.	+	0	gene_id "nbis-gene-12"; transcript_id "gene-C7A06_RS00060"; Dbxref "Genbank:WP_000253455.1"; ID "cds-WP_000253455.1"; Name "WP_000253455.1"; Parent "gene-C7A06_RS00060"; gbkey "CDS"; gene "dgoT"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709507.1"; locus_tag "C7A06_RS00060"; product "MFS transporter"; protein_id "WP_000253455.1"; transl_table "11";
diff -r 000000000000 -r f7c0a0030254 test-data/test06.gff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test06.gff	Tue May 23 13:43:07 2023 +0000
@@ -0,0 +1,50 @@
+##gff-version 3
+##gtf-version 3
+#!gff-spec-version 1.21
+#!processor NCBI annotwriter
+#!genome-build ASM301845v1
+#!genome-build-accession NCBI_Assembly:GCF_003018455.1
+#!annotation-date 05/25/2022 04:54:31
+#!annotation-source NCBI RefSeq 
+##sequence-region NZ_CP027599.1 1 5942969
+##species https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=562
+NZ_CP027599.1	RefSeq	gene	1052	2152	.	+	.	ID=nbis-gene-2;Name=dnaN;gbkey=Gene;gene=dnaN;gene_biotype=protein_coding;gene_id=nbis-gene-2;locus_tag=C7A06_RS00010
+NZ_CP027599.1	RefSeq	transcript	1052	2152	.	+	.	ID=gene-C7A06_RS00010;Parent=nbis-gene-2;Name=dnaN;gbkey=Gene;gene=dnaN;gene_biotype=protein_coding;gene_id=nbis-gene-2;locus_tag=C7A06_RS00010;original_biotype=mrna;transcript_id=gene-C7A06_RS00010
+NZ_CP027599.1	Protein Homology	exon	1052	2152	.	+	.	ID=nbis-exon-2;Parent=gene-C7A06_RS00010;Dbxref=Genbank:WP_000673464.1;Name=WP_000673464.1;Ontology_term=GO:0006260,GO:0003887,GO:0009360;gbkey=CDS;gene=dnaN;gene_id=nbis-gene-2;go_component=DNA polymerase III complex|0009360||IEA;go_function=DNA-directed DNA polymerase activity|0003887||IEA;go_process=DNA replication|0006260||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_006177590.1;locus_tag=C7A06_RS00010;product=DNA polymerase III subunit beta;protein_id=WP_000673464.1;transcript_id=gene-C7A06_RS00010;transl_table=11
+NZ_CP027599.1	Protein Homology	CDS	1052	2152	.	+	0	ID=cds-WP_000673464.1;Parent=gene-C7A06_RS00010;Dbxref=Genbank:WP_000673464.1;Name=WP_000673464.1;Ontology_term=GO:0006260,GO:0003887,GO:0009360;gbkey=CDS;gene=dnaN;gene_id=nbis-gene-2;go_component=DNA polymerase III complex|0009360||IEA;go_function=DNA-directed DNA polymerase activity|0003887||IEA;go_process=DNA replication|0006260||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_006177590.1;locus_tag=C7A06_RS00010;product=DNA polymerase III subunit beta;protein_id=WP_000673464.1;transcript_id=gene-C7A06_RS00010;transl_table=11
+NZ_CP027599.1	RefSeq	gene	2152	3225	.	+	.	ID=nbis-gene-3;Name=recF;gbkey=Gene;gene=recF;gene_biotype=protein_coding;gene_id=nbis-gene-3;locus_tag=C7A06_RS00015
+NZ_CP027599.1	RefSeq	transcript	2152	3225	.	+	.	ID=gene-C7A06_RS00015;Parent=nbis-gene-3;Name=recF;gbkey=Gene;gene=recF;gene_biotype=protein_coding;gene_id=nbis-gene-3;locus_tag=C7A06_RS00015;original_biotype=mrna;transcript_id=gene-C7A06_RS00015
+NZ_CP027599.1	Protein Homology	exon	2152	3225	.	+	.	ID=nbis-exon-3;Parent=gene-C7A06_RS00015;Dbxref=Genbank:WP_000060112.1;Name=WP_000060112.1;Ontology_term=GO:0006281,GO:0003697,GO:0005524;gbkey=CDS;gene=recF;gene_id=nbis-gene-3;go_function=single-stranded DNA binding|0003697||IEA,ATP binding|0005524||IEA;go_process=DNA repair|0006281||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121479.1;locus_tag=C7A06_RS00015;product=DNA replication/repair protein RecF;protein_id=WP_000060112.1;transcript_id=gene-C7A06_RS00015;transl_table=11
+NZ_CP027599.1	Protein Homology	CDS	2152	3225	.	+	0	ID=cds-WP_000060112.1;Parent=gene-C7A06_RS00015;Dbxref=Genbank:WP_000060112.1;Name=WP_000060112.1;Ontology_term=GO:0006281,GO:0003697,GO:0005524;gbkey=CDS;gene=recF;gene_id=nbis-gene-3;go_function=single-stranded DNA binding|0003697||IEA,ATP binding|0005524||IEA;go_process=DNA repair|0006281||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121479.1;locus_tag=C7A06_RS00015;product=DNA replication/repair protein RecF;protein_id=WP_000060112.1;transcript_id=gene-C7A06_RS00015;transl_table=11
+NZ_CP027599.1	RefSeq	gene	3254	5668	.	+	.	ID=nbis-gene-4;Name=gyrB;gbkey=Gene;gene=gyrB;gene_biotype=protein_coding;gene_id=nbis-gene-4;locus_tag=C7A06_RS00020
+NZ_CP027599.1	RefSeq	transcript	3254	5668	.	+	.	ID=gene-C7A06_RS00020;Parent=nbis-gene-4;Name=gyrB;gbkey=Gene;gene=gyrB;gene_biotype=protein_coding;gene_id=nbis-gene-4;locus_tag=C7A06_RS00020;original_biotype=mrna;transcript_id=gene-C7A06_RS00020
+NZ_CP027599.1	Protein Homology	exon	3254	5668	.	+	.	ID=nbis-exon-4;Parent=gene-C7A06_RS00020;Dbxref=Genbank:WP_000072067.1;Name=WP_000072067.1;Ontology_term=GO:0006265,GO:0003918,GO:0009330;gbkey=CDS;gene=gyrB;gene_id=nbis-gene-4;go_component=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) complex|0009330||IEA;go_function=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) activity|0003918||IEA;go_process=DNA topological change|0006265||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121480.1;locus_tag=C7A06_RS00020;product=DNA topoisomerase (ATP-hydrolyzing) subunit B;protein_id=WP_000072067.1;transcript_id=gene-C7A06_RS00020;transl_table=11
+NZ_CP027599.1	Protein Homology	CDS	3254	5668	.	+	0	ID=cds-WP_000072067.1;Parent=gene-C7A06_RS00020;Dbxref=Genbank:WP_000072067.1;Name=WP_000072067.1;Ontology_term=GO:0006265,GO:0003918,GO:0009330;gbkey=CDS;gene=gyrB;gene_id=nbis-gene-4;go_component=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) complex|0009330||IEA;go_function=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) activity|0003918||IEA;go_process=DNA topological change|0006265||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121480.1;locus_tag=C7A06_RS00020;product=DNA topoisomerase (ATP-hydrolyzing) subunit B;protein_id=WP_000072067.1;transcript_id=gene-C7A06_RS00020;transl_table=11
+NZ_CP027599.1	RefSeq	gene	5908	6306	.	+	.	ID=nbis-gene-5;Name=yidB;gbkey=Gene;gene=yidB;gene_biotype=protein_coding;gene_id=nbis-gene-5;locus_tag=C7A06_RS00025
+NZ_CP027599.1	RefSeq	transcript	5908	6306	.	+	.	ID=gene-C7A06_RS00025;Parent=nbis-gene-5;Name=yidB;gbkey=Gene;gene=yidB;gene_biotype=protein_coding;gene_id=nbis-gene-5;locus_tag=C7A06_RS00025;original_biotype=mrna;transcript_id=gene-C7A06_RS00025
+NZ_CP027599.1	Protein Homology	exon	5908	6306	.	+	.	ID=nbis-exon-5;Parent=gene-C7A06_RS00025;Dbxref=Genbank:WP_000522208.1;Name=WP_000522208.1;gbkey=CDS;gene=yidB;gene_id=nbis-gene-5;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418153.4;locus_tag=C7A06_RS00025;product=YidB family protein;protein_id=WP_000522208.1;transcript_id=gene-C7A06_RS00025;transl_table=11
+NZ_CP027599.1	Protein Homology	CDS	5908	6306	.	+	0	ID=cds-WP_000522208.1;Parent=gene-C7A06_RS00025;Dbxref=Genbank:WP_000522208.1;Name=WP_000522208.1;gbkey=CDS;gene=yidB;gene_id=nbis-gene-5;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418153.4;locus_tag=C7A06_RS00025;product=YidB family protein;protein_id=WP_000522208.1;transcript_id=gene-C7A06_RS00025;transl_table=11
+NZ_CP027599.1	RefSeq	gene	6421	7233	.	+	.	ID=nbis-gene-6;Name=yidA;gbkey=Gene;gene=yidA;gene_biotype=protein_coding;gene_id=nbis-gene-6;locus_tag=C7A06_RS00030
+NZ_CP027599.1	RefSeq	transcript	6421	7233	.	+	.	ID=gene-C7A06_RS00030;Parent=nbis-gene-6;Name=yidA;gbkey=Gene;gene=yidA;gene_biotype=protein_coding;gene_id=nbis-gene-6;locus_tag=C7A06_RS00030;original_biotype=mrna;transcript_id=gene-C7A06_RS00030
+NZ_CP027599.1	Protein Homology	exon	6421	7233	.	+	.	ID=nbis-exon-6;Parent=gene-C7A06_RS00030;Dbxref=Genbank:WP_000985541.1;Name=WP_000985541.1;Ontology_term=GO:0016787;gbkey=CDS;gene=yidA;gene_id=nbis-gene-6;go_function=hydrolase activity|0016787||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418152.1;locus_tag=C7A06_RS00030;product=sugar-phosphatase;protein_id=WP_000985541.1;transcript_id=gene-C7A06_RS00030;transl_table=11
+NZ_CP027599.1	Protein Homology	CDS	6421	7233	.	+	0	ID=cds-WP_000985541.1;Parent=gene-C7A06_RS00030;Dbxref=Genbank:WP_000985541.1;Name=WP_000985541.1;Ontology_term=GO:0016787;gbkey=CDS;gene=yidA;gene_id=nbis-gene-6;go_function=hydrolase activity|0016787||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418152.1;locus_tag=C7A06_RS00030;product=sugar-phosphatase;protein_id=WP_000985541.1;transcript_id=gene-C7A06_RS00030;transl_table=11
+NZ_CP027599.1	RefSeq	gene	7279	7935	.	-	.	ID=nbis-gene-7;Name=C7A06_RS00035;gbkey=Gene;gene_biotype=protein_coding;gene_id=nbis-gene-7;locus_tag=C7A06_RS00035
+NZ_CP027599.1	RefSeq	transcript	7279	7935	.	-	.	ID=gene-C7A06_RS00035;Parent=nbis-gene-7;Name=C7A06_RS00035;gbkey=Gene;gene_biotype=protein_coding;gene_id=nbis-gene-7;locus_tag=C7A06_RS00035;original_biotype=mrna;transcript_id=gene-C7A06_RS00035
+NZ_CP027599.1	Protein Homology	exon	7279	7935	.	-	.	ID=nbis-exon-7;Parent=gene-C7A06_RS00035;Dbxref=Genbank:WP_000772931.1;Name=WP_000772931.1;gbkey=CDS;gene_id=nbis-gene-7;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709504.1;locus_tag=C7A06_RS00035;product=hypothetical protein;protein_id=WP_000772931.1;transcript_id=gene-C7A06_RS00035;transl_table=11
+NZ_CP027599.1	Protein Homology	CDS	7279	7935	.	-	0	ID=cds-WP_000772931.1;Parent=gene-C7A06_RS00035;Dbxref=Genbank:WP_000772931.1;Name=WP_000772931.1;gbkey=CDS;gene_id=nbis-gene-7;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709504.1;locus_tag=C7A06_RS00035;product=hypothetical protein;protein_id=WP_000772931.1;transcript_id=gene-C7A06_RS00035;transl_table=11
+NZ_CP027599.1	RefSeq	gene	8213	8902	.	+	.	ID=nbis-gene-8;Name=dgoR;gbkey=Gene;gene=dgoR;gene_biotype=protein_coding;gene_id=nbis-gene-8;locus_tag=C7A06_RS00040
+NZ_CP027599.1	RefSeq	transcript	8213	8902	.	+	.	ID=gene-C7A06_RS00040;Parent=nbis-gene-8;Name=dgoR;gbkey=Gene;gene=dgoR;gene_biotype=protein_coding;gene_id=nbis-gene-8;locus_tag=C7A06_RS00040;original_biotype=mrna;transcript_id=gene-C7A06_RS00040
+NZ_CP027599.1	Protein Homology	exon	8213	8902	.	+	.	ID=nbis-exon-8;Parent=gene-C7A06_RS00040;Dbxref=Genbank:WP_000174305.1;Name=WP_000174305.1;gbkey=CDS;gene=dgoR;gene_id=nbis-gene-8;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709505.1;locus_tag=C7A06_RS00040;product=D-galactonate utilization transcriptional regulator DgoR;protein_id=WP_000174305.1;transcript_id=gene-C7A06_RS00040;transl_table=11
+NZ_CP027599.1	Protein Homology	CDS	8213	8902	.	+	0	ID=cds-WP_000174305.1;Parent=gene-C7A06_RS00040;Dbxref=Genbank:WP_000174305.1;Name=WP_000174305.1;gbkey=CDS;gene=dgoR;gene_id=nbis-gene-8;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709505.1;locus_tag=C7A06_RS00040;product=D-galactonate utilization transcriptional regulator DgoR;protein_id=WP_000174305.1;transcript_id=gene-C7A06_RS00040;transl_table=11
+NZ_CP027599.1	RefSeq	gene	8899	9777	.	+	.	ID=nbis-gene-9;Name=dgoK;gbkey=Gene;gene=dgoK;gene_biotype=protein_coding;gene_id=nbis-gene-9;locus_tag=C7A06_RS00045
+NZ_CP027599.1	RefSeq	transcript	8899	9777	.	+	.	ID=gene-C7A06_RS00045;Parent=nbis-gene-9;Name=dgoK;gbkey=Gene;gene=dgoK;gene_biotype=protein_coding;gene_id=nbis-gene-9;locus_tag=C7A06_RS00045;original_biotype=mrna;transcript_id=gene-C7A06_RS00045
+NZ_CP027599.1	Protein Homology	exon	8899	9777	.	+	.	ID=nbis-exon-9;Parent=gene-C7A06_RS00045;Dbxref=Genbank:WP_000127112.1;Name=WP_000127112.1;gbkey=CDS;gene=dgoK;gene_id=nbis-gene-9;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709506.1;locus_tag=C7A06_RS00045;product=2-dehydro-3-deoxygalactonokinase;protein_id=WP_000127112.1;transcript_id=gene-C7A06_RS00045;transl_table=11
+NZ_CP027599.1	Protein Homology	CDS	8899	9777	.	+	0	ID=cds-WP_000127112.1;Parent=gene-C7A06_RS00045;Dbxref=Genbank:WP_000127112.1;Name=WP_000127112.1;gbkey=CDS;gene=dgoK;gene_id=nbis-gene-9;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709506.1;locus_tag=C7A06_RS00045;product=2-dehydro-3-deoxygalactonokinase;protein_id=WP_000127112.1;transcript_id=gene-C7A06_RS00045;transl_table=11
+NZ_CP027599.1	RefSeq	gene	9761	10378	.	+	.	ID=nbis-gene-10;Name=dgoA;gbkey=Gene;gene=dgoA;gene_biotype=protein_coding;gene_id=nbis-gene-10;locus_tag=C7A06_RS00050
+NZ_CP027599.1	RefSeq	transcript	9761	10378	.	+	.	ID=gene-C7A06_RS00050;Parent=nbis-gene-10;Name=dgoA;gbkey=Gene;gene=dgoA;gene_biotype=protein_coding;gene_id=nbis-gene-10;locus_tag=C7A06_RS00050;original_biotype=mrna;transcript_id=gene-C7A06_RS00050
+NZ_CP027599.1	Protein Homology	exon	9761	10378	.	+	.	ID=nbis-exon-10;Parent=gene-C7A06_RS00050;Dbxref=Genbank:WP_001198699.1;Name=WP_001198699.1;gbkey=CDS;gene=dgoA;gene_id=nbis-gene-10;inference=COORDINATES: similar to AA sequence:RefSeq:YP_026238.1;locus_tag=C7A06_RS00050;product=2-dehydro-3-deoxy-6-phosphogalactonate aldolase;protein_id=WP_001198699.1;transcript_id=gene-C7A06_RS00050;transl_table=11
+NZ_CP027599.1	Protein Homology	CDS	9761	10378	.	+	0	ID=cds-WP_001198699.1;Parent=gene-C7A06_RS00050;Dbxref=Genbank:WP_001198699.1;Name=WP_001198699.1;gbkey=CDS;gene=dgoA;gene_id=nbis-gene-10;inference=COORDINATES: similar to AA sequence:RefSeq:YP_026238.1;locus_tag=C7A06_RS00050;product=2-dehydro-3-deoxy-6-phosphogalactonate aldolase;protein_id=WP_001198699.1;transcript_id=gene-C7A06_RS00050;transl_table=11
+NZ_CP027599.1	RefSeq	gene	10375	11523	.	+	.	ID=nbis-gene-11;Name=dgoD;gbkey=Gene;gene=dgoD;gene_biotype=protein_coding;gene_id=nbis-gene-11;locus_tag=C7A06_RS00055
+NZ_CP027599.1	RefSeq	transcript	10375	11523	.	+	.	ID=gene-C7A06_RS00055;Parent=nbis-gene-11;Name=dgoD;gbkey=Gene;gene=dgoD;gene_biotype=protein_coding;gene_id=nbis-gene-11;locus_tag=C7A06_RS00055;original_biotype=mrna;transcript_id=gene-C7A06_RS00055
+NZ_CP027599.1	Protein Homology	exon	10375	11523	.	+	.	ID=nbis-exon-11;Parent=gene-C7A06_RS00055;Dbxref=Genbank:WP_000705001.1;Name=WP_000705001.1;Ontology_term=GO:0009063,GO:0008869;gbkey=CDS;gene=dgoD;gene_id=nbis-gene-11;go_function=galactonate dehydratase activity|0008869||IEA;go_process=cellular amino acid catabolic process|0009063||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_020077623.1;locus_tag=C7A06_RS00055;product=galactonate dehydratase;protein_id=WP_000705001.1;transcript_id=gene-C7A06_RS00055;transl_table=11
+NZ_CP027599.1	Protein Homology	CDS	10375	11523	.	+	0	ID=cds-WP_000705001.1;Parent=gene-C7A06_RS00055;Dbxref=Genbank:WP_000705001.1;Name=WP_000705001.1;Ontology_term=GO:0009063,GO:0008869;gbkey=CDS;gene=dgoD;gene_id=nbis-gene-11;go_function=galactonate dehydratase activity|0008869||IEA;go_process=cellular amino acid catabolic process|0009063||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_020077623.1;locus_tag=C7A06_RS00055;product=galactonate dehydratase;protein_id=WP_000705001.1;transcript_id=gene-C7A06_RS00055;transl_table=11
diff -r 000000000000 -r f7c0a0030254 test-data/test07.tabular
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test07.tabular	Tue May 23 13:43:07 2023 +0000
@@ -0,0 +1,41 @@
+##gff-version 3
+NZ_CP027599.1	RefSeq	gene	1052	2152	.	+	.	
+NZ_CP027599.1	RefSeq	transcript	1052	2152	.	+	.	
+NZ_CP027599.1	Protein Homology	exon	1052	2152	.	+	.	
+NZ_CP027599.1	Protein Homology	CDS	1052	2152	.	+	0	
+NZ_CP027599.1	RefSeq	gene	2152	3225	.	+	.	
+NZ_CP027599.1	RefSeq	transcript	2152	3225	.	+	.	
+NZ_CP027599.1	Protein Homology	exon	2152	3225	.	+	.	
+NZ_CP027599.1	Protein Homology	CDS	2152	3225	.	+	0	
+NZ_CP027599.1	RefSeq	gene	3254	5668	.	+	.	
+NZ_CP027599.1	RefSeq	transcript	3254	5668	.	+	.	
+NZ_CP027599.1	Protein Homology	exon	3254	5668	.	+	.	
+NZ_CP027599.1	Protein Homology	CDS	3254	5668	.	+	0	
+NZ_CP027599.1	RefSeq	gene	5908	6306	.	+	.	
+NZ_CP027599.1	RefSeq	transcript	5908	6306	.	+	.	
+NZ_CP027599.1	Protein Homology	exon	5908	6306	.	+	.	
+NZ_CP027599.1	Protein Homology	CDS	5908	6306	.	+	0	
+NZ_CP027599.1	RefSeq	gene	6421	7233	.	+	.	
+NZ_CP027599.1	RefSeq	transcript	6421	7233	.	+	.	
+NZ_CP027599.1	Protein Homology	exon	6421	7233	.	+	.	
+NZ_CP027599.1	Protein Homology	CDS	6421	7233	.	+	0	
+NZ_CP027599.1	RefSeq	gene	7279	7935	.	-	.	
+NZ_CP027599.1	RefSeq	transcript	7279	7935	.	-	.	
+NZ_CP027599.1	Protein Homology	exon	7279	7935	.	-	.	
+NZ_CP027599.1	Protein Homology	CDS	7279	7935	.	-	0	
+NZ_CP027599.1	RefSeq	gene	8213	8902	.	+	.	
+NZ_CP027599.1	RefSeq	transcript	8213	8902	.	+	.	
+NZ_CP027599.1	Protein Homology	exon	8213	8902	.	+	.	
+NZ_CP027599.1	Protein Homology	CDS	8213	8902	.	+	0	
+NZ_CP027599.1	RefSeq	gene	8899	9777	.	+	.	
+NZ_CP027599.1	RefSeq	transcript	8899	9777	.	+	.	
+NZ_CP027599.1	Protein Homology	exon	8899	9777	.	+	.	
+NZ_CP027599.1	Protein Homology	CDS	8899	9777	.	+	0	
+NZ_CP027599.1	RefSeq	gene	9761	10378	.	+	.	
+NZ_CP027599.1	RefSeq	transcript	9761	10378	.	+	.	
+NZ_CP027599.1	Protein Homology	exon	9761	10378	.	+	.	
+NZ_CP027599.1	Protein Homology	CDS	9761	10378	.	+	0	
+NZ_CP027599.1	RefSeq	gene	10375	11523	.	+	.	
+NZ_CP027599.1	RefSeq	transcript	10375	11523	.	+	.	
+NZ_CP027599.1	Protein Homology	exon	10375	11523	.	+	.	
+NZ_CP027599.1	Protein Homology	CDS	10375	11523	.	+	0	
diff -r 000000000000 -r f7c0a0030254 test-data/test09.txt
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test09.txt	Tue May 23 13:43:07 2023 +0000
@@ -0,0 +1,80 @@
+--------------------------------------------------------------------------------
+
+Compute transcript with isoforms if any
+
+Number of gene                               10
+Number of transcript                         10
+Number of cds                                10
+Number of exon                               10
+Number of exon in cds                        10
+Number gene overlapping                      4
+Number of single exon gene                   10
+Number of single exon transcript             10
+mean transcripts per gene                    1.0
+mean cdss per transcript                     1.0
+mean exons per transcript                    1.0
+mean exons per cds                           1.0
+Total gene length                            9795
+Total transcript length                      9795
+Total cds length                             9795
+Total exon length                            9795
+mean gene length                             979
+mean transcript length                       979
+mean cds length                              979
+mean exon length                             979
+mean cds piece length                        979
+% of genome covered by gene                  0.9
+% of genome covered by transcript            0.9
+% of genome covered by cds                   0.9
+% of genome covered by exon                  0.9
+Longest gene                                 2415
+Longest transcript                           2415
+Longest cds                                  2415
+Longest exon                                 2415
+Longest cds piece                            2415
+Shortest gene                                399
+Shortest transcript                          399
+Shortest cds                                 399
+Shortest exon                                399
+Shortest cds piece                           399
+
+Re-compute transcript without isoforms asked. We remove shortest isoforms if any
+
+Number of gene                               10
+Number of transcript                         10
+Number of cds                                10
+Number of exon                               10
+Number of exon in cds                        10
+Number gene overlapping                      4
+Number of single exon gene                   10
+Number of single exon transcript             10
+mean transcripts per gene                    1.0
+mean cdss per transcript                     1.0
+mean exons per transcript                    1.0
+mean exons per cds                           1.0
+Total gene length                            9795
+Total transcript length                      9795
+Total cds length                             9795
+Total exon length                            9795
+mean gene length                             979
+mean transcript length                       979
+mean cds length                              979
+mean exon length                             979
+mean cds piece length                        979
+% of genome covered by gene                  0.9
+% of genome covered by transcript            0.9
+% of genome covered by cds                   0.9
+% of genome covered by exon                  0.9
+Longest gene                                 2415
+Longest transcript                           2415
+Longest cds                                  2415
+Longest exon                                 2415
+Longest cds piece                            2415
+Shortest gene                                399
+Shortest transcript                          399
+Shortest cds                                 399
+Shortest exon                                399
+Shortest cds piece                           399
+
+--------------------------------------------------------------------------------
+
diff -r 000000000000 -r f7c0a0030254 test-data/test10.gff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test10.gff	Tue May 23 13:43:07 2023 +0000
@@ -0,0 +1,51 @@
+##gff-version 3
+##gtf-version 3
+#!gff-spec-version 1.21
+#!processor NCBI annotwriter
+#!genome-build ASM301845v1
+#!genome-build-accession NCBI_Assembly:GCF_003018455.1
+#!annotation-date 05/25/2022 04:54:31
+#!annotation-source NCBI RefSeq 
+##sequence-region NZ_CP027599.1 1 5942969
+##species https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=562
+NZ_CP027599.1	RefSeq	gene	1052	3225	.	+	.	ID=nbis-gene-2;Name=dnaN,recF;gbkey=Gene;gene=dnaN,recF;gene_biotype=protein_coding;gene_id=nbis-gene-2,nbis-gene-3;locus_tag=C7A06_RS00010,C7A06_RS00015
+NZ_CP027599.1	RefSeq	transcript	1052	2152	.	+	.	ID=gene-C7A06_RS00010;Parent=nbis-gene-2;Name=dnaN;gbkey=Gene;gene=dnaN;gene_biotype=protein_coding;gene_id=nbis-gene-2;locus_tag=C7A06_RS00010;original_biotype=mrna;transcript_id=gene-C7A06_RS00010
+NZ_CP027599.1	Protein Homology	exon	1052	2152	.	+	.	ID=nbis-exon-2;Parent=gene-C7A06_RS00010;Dbxref=Genbank:WP_000673464.1;Name=WP_000673464.1;Ontology_term=GO:0006260,GO:0003887,GO:0009360;gbkey=CDS;gene=dnaN;gene_id=nbis-gene-2;go_component=DNA polymerase III complex|0009360||IEA;go_function=DNA-directed DNA polymerase activity|0003887||IEA;go_process=DNA replication|0006260||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_006177590.1;locus_tag=C7A06_RS00010;product=DNA polymerase III subunit beta;protein_id=WP_000673464.1;transcript_id=gene-C7A06_RS00010;transl_table=11
+NZ_CP027599.1	Protein Homology	CDS	1052	2152	.	+	0	ID=cds-WP_000673464.1;Parent=gene-C7A06_RS00010;Dbxref=Genbank:WP_000673464.1;Name=WP_000673464.1;Ontology_term=GO:0006260,GO:0003887,GO:0009360;gbkey=CDS;gene=dnaN;gene_id=nbis-gene-2;go_component=DNA polymerase III complex|0009360||IEA;go_function=DNA-directed DNA polymerase activity|0003887||IEA;go_process=DNA replication|0006260||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_006177590.1;locus_tag=C7A06_RS00010;product=DNA polymerase III subunit beta;protein_id=WP_000673464.1;transcript_id=gene-C7A06_RS00010;transl_table=11
+NZ_CP027599.1	RefSeq	transcript	2152	3225	.	+	.	ID=gene-C7A06_RS00015;Parent=nbis-gene-2;Name=recF;gbkey=Gene;gene=recF;gene_biotype=protein_coding;gene_id=nbis-gene-3;locus_tag=C7A06_RS00015;original_biotype=mrna;transcript_id=gene-C7A06_RS00015
+NZ_CP027599.1	Protein Homology	exon	2152	3225	.	+	.	ID=nbis-exon-3;Parent=gene-C7A06_RS00015;Dbxref=Genbank:WP_000060112.1;Name=WP_000060112.1;Ontology_term=GO:0006281,GO:0003697,GO:0005524;gbkey=CDS;gene=recF;gene_id=nbis-gene-3;go_function=single-stranded DNA binding|0003697||IEA,ATP binding|0005524||IEA;go_process=DNA repair|0006281||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121479.1;locus_tag=C7A06_RS00015;product=DNA replication/repair protein RecF;protein_id=WP_000060112.1;transcript_id=gene-C7A06_RS00015;transl_table=11
+NZ_CP027599.1	Protein Homology	CDS	2152	3225	.	+	0	ID=cds-WP_000060112.1;Parent=gene-C7A06_RS00015;Dbxref=Genbank:WP_000060112.1;Name=WP_000060112.1;Ontology_term=GO:0006281,GO:0003697,GO:0005524;gbkey=CDS;gene=recF;gene_id=nbis-gene-3;go_function=single-stranded DNA binding|0003697||IEA,ATP binding|0005524||IEA;go_process=DNA repair|0006281||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121479.1;locus_tag=C7A06_RS00015;product=DNA replication/repair protein RecF;protein_id=WP_000060112.1;transcript_id=gene-C7A06_RS00015;transl_table=11
+NZ_CP027599.1	RefSeq	gene	3254	5668	.	+	.	ID=nbis-gene-4;Name=gyrB;gbkey=Gene;gene=gyrB;gene_biotype=protein_coding;gene_id=nbis-gene-4;locus_tag=C7A06_RS00020
+NZ_CP027599.1	RefSeq	transcript	3254	5668	.	+	.	ID=gene-C7A06_RS00020;Parent=nbis-gene-4;Name=gyrB;gbkey=Gene;gene=gyrB;gene_biotype=protein_coding;gene_id=nbis-gene-4;locus_tag=C7A06_RS00020;original_biotype=mrna;transcript_id=gene-C7A06_RS00020
+NZ_CP027599.1	Protein Homology	exon	3254	5668	.	+	.	ID=nbis-exon-4;Parent=gene-C7A06_RS00020;Dbxref=Genbank:WP_000072067.1;Name=WP_000072067.1;Ontology_term=GO:0006265,GO:0003918,GO:0009330;gbkey=CDS;gene=gyrB;gene_id=nbis-gene-4;go_component=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) complex|0009330||IEA;go_function=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) activity|0003918||IEA;go_process=DNA topological change|0006265||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121480.1;locus_tag=C7A06_RS00020;product=DNA topoisomerase (ATP-hydrolyzing) subunit B;protein_id=WP_000072067.1;transcript_id=gene-C7A06_RS00020;transl_table=11
+NZ_CP027599.1	Protein Homology	CDS	3254	5668	.	+	0	ID=cds-WP_000072067.1;Parent=gene-C7A06_RS00020;Dbxref=Genbank:WP_000072067.1;Name=WP_000072067.1;Ontology_term=GO:0006265,GO:0003918,GO:0009330;gbkey=CDS;gene=gyrB;gene_id=nbis-gene-4;go_component=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) complex|0009330||IEA;go_function=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) activity|0003918||IEA;go_process=DNA topological change|0006265||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121480.1;locus_tag=C7A06_RS00020;product=DNA topoisomerase (ATP-hydrolyzing) subunit B;protein_id=WP_000072067.1;transcript_id=gene-C7A06_RS00020;transl_table=11
+NZ_CP027599.1	RefSeq	gene	5908	6306	.	+	.	ID=nbis-gene-5;Name=yidB;gbkey=Gene;gene=yidB;gene_biotype=protein_coding;gene_id=nbis-gene-5;locus_tag=C7A06_RS00025
+NZ_CP027599.1	RefSeq	transcript	5908	6306	.	+	.	ID=gene-C7A06_RS00025;Parent=nbis-gene-5;Name=yidB;gbkey=Gene;gene=yidB;gene_biotype=protein_coding;gene_id=nbis-gene-5;locus_tag=C7A06_RS00025;original_biotype=mrna;transcript_id=gene-C7A06_RS00025
+NZ_CP027599.1	Protein Homology	exon	5908	6306	.	+	.	ID=nbis-exon-5;Parent=gene-C7A06_RS00025;Dbxref=Genbank:WP_000522208.1;Name=WP_000522208.1;gbkey=CDS;gene=yidB;gene_id=nbis-gene-5;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418153.4;locus_tag=C7A06_RS00025;product=YidB family protein;protein_id=WP_000522208.1;transcript_id=gene-C7A06_RS00025;transl_table=11
+NZ_CP027599.1	Protein Homology	CDS	5908	6306	.	+	0	ID=cds-WP_000522208.1;Parent=gene-C7A06_RS00025;Dbxref=Genbank:WP_000522208.1;Name=WP_000522208.1;gbkey=CDS;gene=yidB;gene_id=nbis-gene-5;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418153.4;locus_tag=C7A06_RS00025;product=YidB family protein;protein_id=WP_000522208.1;transcript_id=gene-C7A06_RS00025;transl_table=11
+NZ_CP027599.1	RefSeq	gene	6421	7233	.	+	.	ID=nbis-gene-6;Name=yidA;gbkey=Gene;gene=yidA;gene_biotype=protein_coding;gene_id=nbis-gene-6;locus_tag=C7A06_RS00030
+NZ_CP027599.1	RefSeq	transcript	6421	7233	.	+	.	ID=gene-C7A06_RS00030;Parent=nbis-gene-6;Name=yidA;gbkey=Gene;gene=yidA;gene_biotype=protein_coding;gene_id=nbis-gene-6;locus_tag=C7A06_RS00030;original_biotype=mrna;transcript_id=gene-C7A06_RS00030
+NZ_CP027599.1	Protein Homology	exon	6421	7233	.	+	.	ID=nbis-exon-6;Parent=gene-C7A06_RS00030;Dbxref=Genbank:WP_000985541.1;Name=WP_000985541.1;Ontology_term=GO:0016787;gbkey=CDS;gene=yidA;gene_id=nbis-gene-6;go_function=hydrolase activity|0016787||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418152.1;locus_tag=C7A06_RS00030;product=sugar-phosphatase;protein_id=WP_000985541.1;transcript_id=gene-C7A06_RS00030;transl_table=11
+NZ_CP027599.1	Protein Homology	CDS	6421	7233	.	+	0	ID=cds-WP_000985541.1;Parent=gene-C7A06_RS00030;Dbxref=Genbank:WP_000985541.1;Name=WP_000985541.1;Ontology_term=GO:0016787;gbkey=CDS;gene=yidA;gene_id=nbis-gene-6;go_function=hydrolase activity|0016787||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418152.1;locus_tag=C7A06_RS00030;product=sugar-phosphatase;protein_id=WP_000985541.1;transcript_id=gene-C7A06_RS00030;transl_table=11
+NZ_CP027599.1	RefSeq	gene	7279	7935	.	-	.	ID=nbis-gene-7;Name=C7A06_RS00035;gbkey=Gene;gene_biotype=protein_coding;gene_id=nbis-gene-7;locus_tag=C7A06_RS00035
+NZ_CP027599.1	RefSeq	transcript	7279	7935	.	-	.	ID=gene-C7A06_RS00035;Parent=nbis-gene-7;Name=C7A06_RS00035;gbkey=Gene;gene_biotype=protein_coding;gene_id=nbis-gene-7;locus_tag=C7A06_RS00035;original_biotype=mrna;transcript_id=gene-C7A06_RS00035
+NZ_CP027599.1	Protein Homology	exon	7279	7935	.	-	.	ID=nbis-exon-7;Parent=gene-C7A06_RS00035;Dbxref=Genbank:WP_000772931.1;Name=WP_000772931.1;gbkey=CDS;gene_id=nbis-gene-7;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709504.1;locus_tag=C7A06_RS00035;product=hypothetical protein;protein_id=WP_000772931.1;transcript_id=gene-C7A06_RS00035;transl_table=11
+NZ_CP027599.1	Protein Homology	CDS	7279	7935	.	-	0	ID=cds-WP_000772931.1;Parent=gene-C7A06_RS00035;Dbxref=Genbank:WP_000772931.1;Name=WP_000772931.1;gbkey=CDS;gene_id=nbis-gene-7;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709504.1;locus_tag=C7A06_RS00035;product=hypothetical protein;protein_id=WP_000772931.1;transcript_id=gene-C7A06_RS00035;transl_table=11
+NZ_CP027599.1	RefSeq	gene	8213	9777	.	+	.	ID=nbis-gene-8;Name=dgoR,dgoK;gbkey=Gene;gene=dgoR,dgoK;gene_biotype=protein_coding;gene_id=nbis-gene-8,nbis-gene-9;locus_tag=C7A06_RS00040,C7A06_RS00045
+NZ_CP027599.1	RefSeq	transcript	8213	8902	.	+	.	ID=gene-C7A06_RS00040;Parent=nbis-gene-8;Name=dgoR;gbkey=Gene;gene=dgoR;gene_biotype=protein_coding;gene_id=nbis-gene-8;locus_tag=C7A06_RS00040;original_biotype=mrna;transcript_id=gene-C7A06_RS00040
+NZ_CP027599.1	Protein Homology	exon	8213	8902	.	+	.	ID=nbis-exon-8;Parent=gene-C7A06_RS00040;Dbxref=Genbank:WP_000174305.1;Name=WP_000174305.1;gbkey=CDS;gene=dgoR;gene_id=nbis-gene-8;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709505.1;locus_tag=C7A06_RS00040;product=D-galactonate utilization transcriptional regulator DgoR;protein_id=WP_000174305.1;transcript_id=gene-C7A06_RS00040;transl_table=11
+NZ_CP027599.1	Protein Homology	CDS	8213	8902	.	+	0	ID=cds-WP_000174305.1;Parent=gene-C7A06_RS00040;Dbxref=Genbank:WP_000174305.1;Name=WP_000174305.1;gbkey=CDS;gene=dgoR;gene_id=nbis-gene-8;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709505.1;locus_tag=C7A06_RS00040;product=D-galactonate utilization transcriptional regulator DgoR;protein_id=WP_000174305.1;transcript_id=gene-C7A06_RS00040;transl_table=11
+NZ_CP027599.1	RefSeq	transcript	8899	9777	.	+	.	ID=gene-C7A06_RS00045;Parent=nbis-gene-8;Name=dgoK;gbkey=Gene;gene=dgoK;gene_biotype=protein_coding;gene_id=nbis-gene-9;locus_tag=C7A06_RS00045;original_biotype=mrna;transcript_id=gene-C7A06_RS00045
+NZ_CP027599.1	Protein Homology	exon	8899	9777	.	+	.	ID=nbis-exon-9;Parent=gene-C7A06_RS00045;Dbxref=Genbank:WP_000127112.1;Name=WP_000127112.1;gbkey=CDS;gene=dgoK;gene_id=nbis-gene-9;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709506.1;locus_tag=C7A06_RS00045;product=2-dehydro-3-deoxygalactonokinase;protein_id=WP_000127112.1;transcript_id=gene-C7A06_RS00045;transl_table=11
+NZ_CP027599.1	Protein Homology	CDS	8899	9777	.	+	0	ID=cds-WP_000127112.1;Parent=gene-C7A06_RS00045;Dbxref=Genbank:WP_000127112.1;Name=WP_000127112.1;gbkey=CDS;gene=dgoK;gene_id=nbis-gene-9;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709506.1;locus_tag=C7A06_RS00045;product=2-dehydro-3-deoxygalactonokinase;protein_id=WP_000127112.1;transcript_id=gene-C7A06_RS00045;transl_table=11
+NZ_CP027599.1	RefSeq	gene	9761	11523	.	+	.	ID=nbis-gene-10;Name=dgoA,dgoD;gbkey=Gene;gene=dgoA,dgoD;gene_biotype=protein_coding;gene_id=nbis-gene-10,nbis-gene-11;locus_tag=C7A06_RS00050,C7A06_RS00055
+NZ_CP027599.1	RefSeq	transcript	9761	10378	.	+	.	ID=gene-C7A06_RS00050;Parent=nbis-gene-10;Name=dgoA;gbkey=Gene;gene=dgoA;gene_biotype=protein_coding;gene_id=nbis-gene-10;locus_tag=C7A06_RS00050;original_biotype=mrna;transcript_id=gene-C7A06_RS00050
+NZ_CP027599.1	Protein Homology	exon	9761	10378	.	+	.	ID=nbis-exon-10;Parent=gene-C7A06_RS00050;Dbxref=Genbank:WP_001198699.1;Name=WP_001198699.1;gbkey=CDS;gene=dgoA;gene_id=nbis-gene-10;inference=COORDINATES: similar to AA sequence:RefSeq:YP_026238.1;locus_tag=C7A06_RS00050;product=2-dehydro-3-deoxy-6-phosphogalactonate aldolase;protein_id=WP_001198699.1;transcript_id=gene-C7A06_RS00050;transl_table=11
+NZ_CP027599.1	Protein Homology	CDS	9761	10378	.	+	0	ID=cds-WP_001198699.1;Parent=gene-C7A06_RS00050;Dbxref=Genbank:WP_001198699.1;Name=WP_001198699.1;gbkey=CDS;gene=dgoA;gene_id=nbis-gene-10;inference=COORDINATES: similar to AA sequence:RefSeq:YP_026238.1;locus_tag=C7A06_RS00050;product=2-dehydro-3-deoxy-6-phosphogalactonate aldolase;protein_id=WP_001198699.1;transcript_id=gene-C7A06_RS00050;transl_table=11
+NZ_CP027599.1	RefSeq	transcript	10375	11523	.	+	.	ID=gene-C7A06_RS00055;Parent=nbis-gene-10;Name=dgoD;gbkey=Gene;gene=dgoD;gene_biotype=protein_coding;gene_id=nbis-gene-11;locus_tag=C7A06_RS00055;original_biotype=mrna;transcript_id=gene-C7A06_RS00055
+NZ_CP027599.1	Protein Homology	exon	10375	11523	.	+	.	ID=nbis-exon-11;Parent=gene-C7A06_RS00055;Dbxref=Genbank:WP_000705001.1;Name=WP_000705001.1;Ontology_term=GO:0009063,GO:0008869;gbkey=CDS;gene=dgoD;gene_id=nbis-gene-11;go_function=galactonate dehydratase activity|0008869||IEA;go_process=cellular amino acid catabolic process|0009063||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_020077623.1;locus_tag=C7A06_RS00055;product=galactonate dehydratase;protein_id=WP_000705001.1;transcript_id=gene-C7A06_RS00055;transl_table=11
+NZ_CP027599.1	Protein Homology	CDS	10375	11523	.	+	0	ID=cds-WP_000705001.1;Parent=gene-C7A06_RS00055;Dbxref=Genbank:WP_000705001.1;Name=WP_000705001.1;Ontology_term=GO:0009063,GO:0008869;gbkey=CDS;gene=dgoD;gene_id=nbis-gene-11;go_function=galactonate dehydratase activity|0008869||IEA;go_process=cellular amino acid catabolic process|0009063||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_020077623.1;locus_tag=C7A06_RS00055;product=galactonate dehydratase;protein_id=WP_000705001.1;transcript_id=gene-C7A06_RS00055;transl_table=11
+NZ_CP027599.1	RefSeq	gene	11598	12935	.	+	.	ID=nbis-gene-12;Name=dgoT;gbkey=Gene;gene=dgoT;gene_biotype=protein_coding;gene_id=nbis-gene-12;locus_tag=C7A06_RS00060
+NZ_CP027599.1	RefSeq	transcript	11598	12935	.	+	.	ID=gene-C7A06_RS00060;Parent=nbis-gene-12;Name=dgoT;gbkey=Gene;gene=dgoT;gene_biotype=protein_coding;gene_id=nbis-gene-12;locus_tag=C7A06_RS00060;original_biotype=mrna;transcript_id=gene-C7A06_RS00060
+NZ_CP027599.1	Protein Homology	exon	11598	12935	.	+	.	ID=nbis-exon-12;Parent=gene-C7A06_RS00060;Dbxref=Genbank:WP_000253455.1;Name=WP_000253455.1;gbkey=CDS;gene=dgoT;gene_id=nbis-gene-12;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709507.1;locus_tag=C7A06_RS00060;product=MFS transporter;protein_id=WP_000253455.1;transcript_id=gene-C7A06_RS00060;transl_table=11
+NZ_CP027599.1	Protein Homology	CDS	11598	12935	.	+	0	ID=cds-WP_000253455.1;Parent=gene-C7A06_RS00060;Dbxref=Genbank:WP_000253455.1;Name=WP_000253455.1;gbkey=CDS;gene=dgoT;gene_id=nbis-gene-12;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709507.1;locus_tag=C7A06_RS00060;product=MFS transporter;protein_id=WP_000253455.1;transcript_id=gene-C7A06_RS00060;transl_table=11
diff -r 000000000000 -r f7c0a0030254 tool-data/fasta_indexes.loc.sample
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool-data/fasta_indexes.loc.sample	Tue May 23 13:43:07 2023 +0000
@@ -0,0 +1,29 @@
+#This is a sample file distributed with Galaxy that enables tools
+#to use a directory of Samtools indexed sequences data files.  You will need
+#to create these data files and then create a fasta_indexes.loc file
+#similar to this one (store it in this directory) that points to
+#the directories in which those files are stored. The fasta_indexes.loc
+#file has this format (white space characters are TAB characters):
+#
+# <unique_build_id>	<dbkey>	<display_name>	<file_base_path>
+#
+#So, for example, if you had hg19 Canonical indexed stored in
+#
+# /depot/data2/galaxy/hg19/sam/,
+#
+#then the fasta_indexes.loc entry would look like this:
+#
+#hg19canon	hg19	Human (Homo sapiens): hg19 Canonical	/depot/data2/galaxy/hg19/sam/hg19canon.fa
+#
+#and your /depot/data2/galaxy/hg19/sam/ directory
+#would contain hg19canon.fa and hg19canon.fa.fai files.
+#
+#Your fasta_indexes.loc file should include an entry per line for
+#each index set you have stored.  The file in the path does actually
+#exist, but it should never be directly used. Instead, the name serves
+#as a prefix for the index file.  For example:
+#
+#hg18canon	hg18	Human (Homo sapiens): hg18 Canonical	/depot/data2/galaxy/hg18/sam/hg18canon.fa
+#hg18full	hg18	Human (Homo sapiens): hg18 Full	/depot/data2/galaxy/hg18/sam/hg18full.fa
+#hg19canon	hg19	Human (Homo sapiens): hg19 Canonical	/depot/data2/galaxy/hg19/sam/hg19canon.fa
+#hg19full	hg19	Human (Homo sapiens): hg19 Full	/depot/data2/galaxy/hg19/sam/hg19full.fa
diff -r 000000000000 -r f7c0a0030254 tool_data_table_conf.xml.sample
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_data_table_conf.xml.sample	Tue May 23 13:43:07 2023 +0000
@@ -0,0 +1,7 @@
+<tables>
+    <!-- Location of SAMTools indexes for FASTA files -->
+    <table name="fasta_indexes" comment_char="#">
+        <columns>value, dbkey, name, path</columns>
+        <file path="tool-data/fasta_indexes.loc" />
+    </table>
+</tables>
diff -r 000000000000 -r f7c0a0030254 tool_data_table_conf.xml.test
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_data_table_conf.xml.test	Tue May 23 13:43:07 2023 +0000
@@ -0,0 +1,7 @@
+<tables>
+    <!-- Locations of FASTA index ffiles for testing -->
+    <table name="fasta_indexes" comment_char="#">
+        <columns>value, dbkey, name, path</columns>
+        <file path="${__HERE__}/test-data/fasta_indexes.loc" />
+    </table>
+</tables>