Mercurial > repos > bgruening > augustus
comparison augustus.xml @ 0:af307d3285c5 draft
Uploaded
| author | bgruening |
|---|---|
| date | Sat, 06 Jul 2013 10:07:41 -0400 |
| parents | |
| children | e2b822d7408f |
comparison
equal
deleted
inserted
replaced
| -1:000000000000 | 0:af307d3285c5 |
|---|---|
| 1 <tool id="augustus" name="Augustus" version="0.3"> | |
| 2 <description>gene prediction for eukaryotic genomes</description> | |
| 3 <requirements> | |
| 4 <requirement type="package" version="2.7">augustus</requirement> | |
| 5 <requirement type="set_environment">AUGUSTUS_SCRIPT_PATH</requirement> | |
| 6 </requirements> | |
| 7 <command> | |
| 8 ## please set export AUGUSTUS_CONFIG_PATH=/path_to_augustus/augustus/config | |
| 9 ## or use the --AUGUSTUS_CONFIG_PATH=path if you are not installing through the toolshed | |
| 10 ## Augustus writes the protein and coding sequences as comment into the gff/gtf file an external script is used to extract the sequences into additional files | |
| 11 | |
| 12 augustus | |
| 13 --strand=$strand | |
| 14 $noInFrameStop | |
| 15 $gff | |
| 16 $protein | |
| 17 $introns | |
| 18 $start | |
| 19 $stop | |
| 20 $cds | |
| 21 $codingseq | |
| 22 $singlestrand | |
| 23 $input_genome | |
| 24 $mea | |
| 25 $utr | |
| 26 --genemodel=$genemodel | |
| 27 --species=$organism | |
| 28 ##--outfile=$output | |
| 29 | tee $output | |
| 30 #if $protein or $codingseq: | |
| 31 | python \$AUGUSTUS_SCRIPT_PATH/extract_features.py | |
| 32 #if $protein: | |
| 33 --protein $protein_output | |
| 34 #end if | |
| 35 #if $codingseq: | |
| 36 --codingseq $codingseq_output | |
| 37 #end if | |
| 38 #end if | |
| 39 </command> | |
| 40 <inputs> | |
| 41 <param name="input_genome" type="data" format="fasta" label="Genome Sequence"/> | |
| 42 <param name="noInFrameStop" type="boolean" label="Don't report transcripts with in-frame stop codons (--noInFrameStop)" truevalue="--noInFrameStop=true" falsevalue="--noInFrameStop=false" checked="false" help="Otherwise, intron-spanning stop codons could occur" /> | |
| 43 <param name="singlestrand" type="boolean" label="Predict genes independently on each strand, allow overlapping genes on opposite strands (--singlestrand)" truevalue="--singlestrand=true" falsevalue="--singlestrand=false" checked="false" /> | |
| 44 <param name="mea" type="boolean" label="Using the maximum expected accuracy approach (--mea)" truevalue="--mea=1" falsevalue="" checked="false" help="MEA is an alternative decoding approach." /> | |
| 45 <param name="utr" type="boolean" label="Predict the untranslated regions in addition to the coding sequence (--UTR)" truevalue="--UTR=on" falsevalue="--UTR=off" checked="false" help="This currently works only for human, galdieria, toxoplasma and caenorhabditis." /> | |
| 46 | |
| 47 <param name="organism" label="Model Organism" type="select" multiple="false" format="text" help="Choose a specialised trainingset."> | |
| 48 <option value="human">Homo sapiens</option> | |
| 49 <option value="fly">Drosophila melanogaster</option> | |
| 50 <option value="arabidopsis">Arabidopsis thaliana</option> | |
| 51 <option value="brugia ">Brugia malayi</option> | |
| 52 <option value="aedes">Aedes aegypti</option> | |
| 53 <option value="tribolium2012">Tribolium castaneum</option> | |
| 54 <option value="schistosoma">Schistosoma mansoni</option> | |
| 55 <option value="tetrahymena">Tetrahymena thermophila</option> | |
| 56 <option value="galdieria">Galdieria sulphuraria</option> | |
| 57 <option value="maize">Zea mays</option> | |
| 58 <option value="toxoplasma ">Toxoplasma gondii</option> | |
| 59 <option value="caenorhabditis ">Caenorhabditis elegans</option> | |
| 60 <option value="aspergillus_fumigatus">Aspergillus fumigatus</option> | |
| 61 <option value="aspergillus_nidulans ">Aspergillus nidulans</option> | |
| 62 <option value="aspergillus_oryzae ">Aspergillus oryzae</option> | |
| 63 <option value="aspergillus_terreus">Aspergillus terreus</option> | |
| 64 <option value="botrytis_cinerea ">Botrytis cinerea</option> | |
| 65 <option value="candida_albicans ">Candida albicans</option> | |
| 66 <option value="candida_guilliermondii ">Candida guilliermondii</option> | |
| 67 <option value="candida_tropicalis ">Candida tropicalis</option> | |
| 68 <option value="chaetomium_globosum">Chaetomium globosum</option> | |
| 69 <option value="coccidioides_immitis ">Coccidioides immitis</option> | |
| 70 <option value="coprinus ">Coprinus cinereus</option> | |
| 71 <option value="coprinus_cinereus">Coprinus cinereus</option> | |
| 72 <option value="cryptococcus_neoformans_gattii ">Cryptococcus neoformans gattii</option> | |
| 73 <option value="cryptococcus_neoformans_neoformans_B ">Cryptococcus neoformans neoformans</option> | |
| 74 <option value="cryptococcus_neoformans_neoformans_JEC21 ">Cryptococcus neoformans neoformans</option> | |
| 75 <option value="debaryomyces_hansenii">Debaryomyces hansenii</option> | |
| 76 <option value="encephalitozoon_cuniculi_GB">Encephalitozoon cuniculi</option> | |
| 77 <option value="eremothecium_gossypii">Eremothecium gossypii</option> | |
| 78 <option value="fusarium_graminearum ">Fusarium graminearum</option> | |
| 79 <option value="histoplasma_capsulatum ">Histoplasma capsulatum</option> | |
| 80 <option value="(histoplasma)">Histoplasma capsulatum</option> | |
| 81 <option value="kluyveromyces_lactis ">Kluyveromyces lactis</option> | |
| 82 <option value="laccaria_bicolor ">Laccaria bicolor</option> | |
| 83 <option value="lamprey">Petromyzon marinus</option> | |
| 84 <option value="leishmania_tarentolae">Leishmania tarentolae</option> | |
| 85 <option value="lodderomyces_elongisporus">Lodderomyces elongisporus</option> | |
| 86 <option value="magnaporthe_grisea ">Magnaporthe grisea</option> | |
| 87 <option value="neurospora_crassa">Neurospora crassa</option> | |
| 88 <option value="phanerochaete_chrysosporium">Phanerochaete chrysosporium</option> | |
| 89 <option value="pichia_stipitis">Pichia stipitis</option> | |
| 90 <option value="rhizopus_oryzae">Rhizopus oryzae</option> | |
| 91 <option value="saccharomyces_cerevisiae_S288C ">Saccharomyces cerevisiae</option> | |
| 92 <option value="saccharomyces_cerevisiae_rm11-1a_1 ">Saccharomyces cerevisiae</option> | |
| 93 <option value="(saccharomyces)">Saccharomyces cerevisiae</option> | |
| 94 <option value="schizosaccharomyces_pombe">Schizosaccharomyces pombe</option> | |
| 95 <option value="trichinella">Trichinella spiralis</option> | |
| 96 <option value="ustilago_maydis">Ustilago maydis</option> | |
| 97 <option value="yarrowia_lipolytica">Yarrowia lipolytica</option> | |
| 98 <option value="nasonia">Nasonia vitripennis</option> | |
| 99 <option value="tomato">Solanum lycopersicum</option> | |
| 100 <option value="chlamydomonas">Chlamydomonas reinhardtii</option> | |
| 101 <option value="amphimedon">Amphimedon queenslandica</option> | |
| 102 <option value="pneumocystis">Pneumocystis jirovecii</option> | |
| 103 <option value="chicken">Gallus gallus domesticus (chicken)</option> | |
| 104 <option value="cacao">Theobroma cacao (cacao)</option> | |
| 105 <option value="heliconius_melpomene1">Heliconius melpomene</option> | |
| 106 <option value="xenoturbella">Xenoturbella</option> | |
| 107 </param> | |
| 108 | |
| 109 <param name="strand" type="select" multiple="false" format="text" help="Report predicted genes on both strands, just the forward or just the backward strand."> | |
| 110 <option value="both">both</option> | |
| 111 <option value="forward">forward</option> | |
| 112 <option value="backward">backward</option> | |
| 113 </param> | |
| 114 | |
| 115 <param name="genemodel" label="Gene Model" type="select" multiple="false" format="text" help="Gene Model to predict, for more information please refere to the help."> | |
| 116 <option value="complete">complete</option> | |
| 117 <option value="partial">partial</option> | |
| 118 <option value="intronless">intronless</option> | |
| 119 <option value="atleastone">atleastone</option> | |
| 120 <option value="exactlyone">exactlyone</option> | |
| 121 <option value="bacterium">bacterium (beta version)</option> | |
| 122 </param> | |
| 123 | |
| 124 <param name="protein" type="boolean" label="Output predicted protein sequences (--protein)" truevalue="--protein=on" falsevalue="--protein=off" checked="true" /> | |
| 125 <param name="codingseq" type="boolean" label="Output coding sequence as comment in the output file (codingseq)" truevalue="--codingseq=on" falsevalue="--codingseq=off" checked="true" /> | |
| 126 <param name="introns" type="boolean" label="Output predicted intron sequences (--introns)" truevalue="--introns=on" falsevalue="--introns=off" checked="false" /> | |
| 127 <param name="start" type="boolean" label="Output predicted start codons (--start)" truevalue="--start=on" falsevalue="--start=off" checked="false" /> | |
| 128 <param name="stop" type="boolean" label="Output predicted stop codons (--stop)" truevalue="--stop=on" falsevalue="--stop=off" checked="false" /> | |
| 129 <param name="cds" type="boolean" label="Output CDS region (--cds)" truevalue="--cds=on" falsevalue="--cds=off" checked="true" /> | |
| 130 <param name="gff" type="boolean" label="GFF formated output, standard is GTF (--gff3)" truevalue="--gff3=on" falsevalue="--gff3=off" checked="false" /> | |
| 131 | |
| 132 </inputs> | |
| 133 <outputs> | |
| 134 <data format="gtf" name="output" label="${tool.name} on ${on_string}: GTF/GFF"> | |
| 135 <change_format> | |
| 136 <when input="gff" value="--gff3=on" format="gff" /> | |
| 137 </change_format> | |
| 138 </data> | |
| 139 <data format="fasta" name="protein_output" label="${tool.name} on ${on_string}: Protein sequence"> | |
| 140 <filter>protein == True</filter> | |
| 141 </data> | |
| 142 <data format="fasta" name="codingseq_output" label="${tool.name} on ${on_string}: Coding sequence"> | |
| 143 <filter>codingseq == True</filter> | |
| 144 </data> | |
| 145 </outputs> | |
| 146 <tests> | |
| 147 <test> | |
| 148 <param name="input_genome" value="human_augustus.fa" ftype="fasta" /> | |
| 149 <param name="organism" value="human" /> | |
| 150 <param name="utr" value="--UTR=on" /> | |
| 151 <output name="output" file="human_augustus_utr-on.gtf" ftype="gtf" lines_diff="2"/> | |
| 152 </test> | |
| 153 <test> | |
| 154 <param name="input_genome" value="human_augustus.fa" ftype="fasta" /> | |
| 155 <param name="organism" value="human" /> | |
| 156 <param name="utr" value="--UTR=on" /> | |
| 157 <param name="gff" value="--gff3=on" /> | |
| 158 <output name="output" file="human_augustus_utr-on.gff" ftype="gff3" lines_diff="2"/> | |
| 159 </test> | |
| 160 <test> | |
| 161 <param name="input_genome" value="arabidopsis_augustus.fa" ftype="fasta" /> | |
| 162 <param name="organism" value="arabidopsis" /> | |
| 163 <param name="singlestrand" value="--singlestrand=true" /> | |
| 164 <param name="mea" value="--mea=1" /> | |
| 165 <output name="output" file="arabidopsis_augustus_utr-off_singlestrand-on_mea-on.gtf" ftype="gtf" lines_diff="2"/> | |
| 166 </test> | |
| 167 <test> | |
| 168 <param name="input_genome" value="human_augustus.fa" ftype="fasta" /> | |
| 169 <param name="organism" value="human" /> | |
| 170 <param name="protein" value="--protein=on" /> | |
| 171 <param name="codingseq" value="--codingseq=on" /> | |
| 172 <param name="introns" value="--introns=on" /> | |
| 173 <param name="cds" value="--cds=on" /> | |
| 174 <output name="output" file="human_augustus_protein_codingseq_introns_cds_main.gtf" ftype="gff" lines_diff="2"/> | |
| 175 <output name="codingseq_output" file="human_augustus_protein_codingseq_introns_cds_codingseq.fasta" ftype="fasta" /> | |
| 176 <output name="protein_output" file="human_augustus_protein_codingseq_introns_cds_protein.fasta" ftype="fasta" /> | |
| 177 </test> | |
| 178 </tests> | |
| 179 <help> | |
| 180 | |
| 181 **What it does** | |
| 182 | |
| 183 AUGUSTUS is a gene prediction program for eukaryotes written by Mario Stanke and Oliver Keller. | |
| 184 It can be used as an ab initio program, which means it bases its prediction purely on the | |
| 185 sequence. AUGUSTUS may also incorporate hints on the gene structure coming from extrinsic sources | |
| 186 such as EST, MS/MS, protein alignments and synthenic genomic alignments. | |
| 187 | |
| 188 ----- | |
| 189 | |
| 190 **Parameters** | |
| 191 | |
| 192 Gene Model:: | |
| 193 | |
| 194 partial : allow prediction of incomplete genes at the sequence boundaries (default) | |
| 195 intronless : only predict single-exon genes like in prokaryotes and some eukaryotes | |
| 196 complete : only predict complete genes | |
| 197 atleastone : predict at least one complete gene | |
| 198 exactlyone : predict exactly one complete gene | |
| 199 | |
| 200 | |
| 201 | |
| 202 **Example** | |
| 203 | |
| 204 Suppose you have the following DNA formatted sequences:: | |
| 205 | |
| 206 >Seq1 | |
| 207 cccgcggagcgggtaccacatcgctgcgcgatgtgcgagcgaacacccgggctgcgcccg | |
| 208 ggtgttgcgctcccgctccgcgggagcgctggcgggacgctgcgcgtcccgctcaccaag | |
| 209 cccgcttcgcgggcttggtgacgctccgtccgctgcgcttccggagttgcggggcttcgc | |
| 210 cccgctaaccctgggcctcgcttcgctccgccttgggcctgcggcgggtccgctgcgctc | |
| 211 ccccgcctcaagggcccttccggctgcgcctccaggacccaaccgcttgcgcgggcctgg | |
| 212 | |
| 213 Running this tool will produce this:: | |
| 214 | |
| 215 # ----- prediction on sequence number 1 (length = 1992969, name = scaffold1|size1992969) ----- | |
| 216 # | |
| 217 # Constraints/Hints: | |
| 218 # (none) | |
| 219 # Predicted genes for sequence number 1 on both strands | |
| 220 # start gene g1 | |
| 221 scaffold1|size1992969 AUGUSTUS gene 17453 19382 0.11 + . g6 | |
| 222 scaffold1|size1992969 AUGUSTUS transcript 17453 19382 0.11 + . g6.t1 | |
| 223 scaffold1|size1992969 AUGUSTUS start_codon 17453 17455 . + 0 transcript_id "g6.t1"; gene_id "g6"; | |
| 224 scaffold1|size1992969 AUGUSTUS intron 17615 17660 0.38 + . transcript_id "g6.t1"; gene_id "g6"; | |
| 225 scaffold1|size1992969 AUGUSTUS intron 17708 17772 0.54 + . transcript_id "g6.t1"; gene_id "g6"; | |
| 226 scaffold1|size1992969 AUGUSTUS intron 17902 18035 0.58 + . transcript_id "g6.t1"; gene_id "g6"; | |
| 227 scaffold1|size1992969 AUGUSTUS intron 18313 18367 0.99 + . transcript_id "g6.t1"; gene_id "g6"; | |
| 228 scaffold1|size1992969 AUGUSTUS intron 19014 19080 0.44 + . transcript_id "g6.t1"; gene_id "g6"; | |
| 229 scaffold1|size1992969 AUGUSTUS CDS 17453 17614 0.55 + 0 transcript_id "g6.t1"; gene_id "g6"; | |
| 230 scaffold1|size1992969 AUGUSTUS CDS 17661 17707 0.38 + 0 transcript_id "g6.t1"; gene_id "g6"; | |
| 231 scaffold1|size1992969 AUGUSTUS CDS 17773 17901 0.54 + 1 transcript_id "g6.t1"; gene_id "g6"; | |
| 232 scaffold1|size1992969 AUGUSTUS CDS 18036 18312 0.52 + 1 transcript_id "g6.t1"; gene_id "g6"; | |
| 233 scaffold1|size1992969 AUGUSTUS CDS 18368 19013 0.99 + 0 transcript_id "g6.t1"; gene_id "g6"; | |
| 234 scaffold1|size1992969 AUGUSTUS CDS 19081 19379 0.31 + 2 transcript_id "g6.t1"; gene_id "g6"; | |
| 235 scaffold1|size1992969 AUGUSTUS stop_codon 19380 19382 . + 0 transcript_id "g6.t1"; gene_id "g6"; | |
| 236 | |
| 237 | |
| 238 **References** | |
| 239 | |
| 240 Mario Stanke and Stephan Waack (2003) | |
| 241 Gene Prediction with a Hidden-Markov Model and a new Intron Submodel. | |
| 242 Bioinformatics, Vol. 19, Suppl. 2, pages ii215-ii225 | |
| 243 | |
| 244 | |
| 245 </help> | |
| 246 </tool> |