Mercurial > repos > bgruening > augustus
diff augustus.xml @ 0:af307d3285c5 draft
Uploaded
| author | bgruening |
|---|---|
| date | Sat, 06 Jul 2013 10:07:41 -0400 |
| parents | |
| children | e2b822d7408f |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/augustus.xml Sat Jul 06 10:07:41 2013 -0400 @@ -0,0 +1,246 @@ +<tool id="augustus" name="Augustus" version="0.3"> + <description>gene prediction for eukaryotic genomes</description> + <requirements> + <requirement type="package" version="2.7">augustus</requirement> + <requirement type="set_environment">AUGUSTUS_SCRIPT_PATH</requirement> + </requirements> + <command> + ## please set export AUGUSTUS_CONFIG_PATH=/path_to_augustus/augustus/config + ## or use the --AUGUSTUS_CONFIG_PATH=path if you are not installing through the toolshed + ## Augustus writes the protein and coding sequences as comment into the gff/gtf file an external script is used to extract the sequences into additional files + + augustus + --strand=$strand + $noInFrameStop + $gff + $protein + $introns + $start + $stop + $cds + $codingseq + $singlestrand + $input_genome + $mea + $utr + --genemodel=$genemodel + --species=$organism + ##--outfile=$output + | tee $output + #if $protein or $codingseq: + | python \$AUGUSTUS_SCRIPT_PATH/extract_features.py + #if $protein: + --protein $protein_output + #end if + #if $codingseq: + --codingseq $codingseq_output + #end if + #end if + </command> + <inputs> + <param name="input_genome" type="data" format="fasta" label="Genome Sequence"/> + <param name="noInFrameStop" type="boolean" label="Don't report transcripts with in-frame stop codons (--noInFrameStop)" truevalue="--noInFrameStop=true" falsevalue="--noInFrameStop=false" checked="false" help="Otherwise, intron-spanning stop codons could occur" /> + <param name="singlestrand" type="boolean" label="Predict genes independently on each strand, allow overlapping genes on opposite strands (--singlestrand)" truevalue="--singlestrand=true" falsevalue="--singlestrand=false" checked="false" /> + <param name="mea" type="boolean" label="Using the maximum expected accuracy approach (--mea)" truevalue="--mea=1" falsevalue="" checked="false" help="MEA is an alternative decoding approach." /> + <param name="utr" type="boolean" label="Predict the untranslated regions in addition to the coding sequence (--UTR)" truevalue="--UTR=on" falsevalue="--UTR=off" checked="false" help="This currently works only for human, galdieria, toxoplasma and caenorhabditis." /> + + <param name="organism" label="Model Organism" type="select" multiple="false" format="text" help="Choose a specialised trainingset."> + <option value="human">Homo sapiens</option> + <option value="fly">Drosophila melanogaster</option> + <option value="arabidopsis">Arabidopsis thaliana</option> + <option value="brugia ">Brugia malayi</option> + <option value="aedes">Aedes aegypti</option> + <option value="tribolium2012">Tribolium castaneum</option> + <option value="schistosoma">Schistosoma mansoni</option> + <option value="tetrahymena">Tetrahymena thermophila</option> + <option value="galdieria">Galdieria sulphuraria</option> + <option value="maize">Zea mays</option> + <option value="toxoplasma ">Toxoplasma gondii</option> + <option value="caenorhabditis ">Caenorhabditis elegans</option> + <option value="aspergillus_fumigatus">Aspergillus fumigatus</option> + <option value="aspergillus_nidulans ">Aspergillus nidulans</option> + <option value="aspergillus_oryzae ">Aspergillus oryzae</option> + <option value="aspergillus_terreus">Aspergillus terreus</option> + <option value="botrytis_cinerea ">Botrytis cinerea</option> + <option value="candida_albicans ">Candida albicans</option> + <option value="candida_guilliermondii ">Candida guilliermondii</option> + <option value="candida_tropicalis ">Candida tropicalis</option> + <option value="chaetomium_globosum">Chaetomium globosum</option> + <option value="coccidioides_immitis ">Coccidioides immitis</option> + <option value="coprinus ">Coprinus cinereus</option> + <option value="coprinus_cinereus">Coprinus cinereus</option> + <option value="cryptococcus_neoformans_gattii ">Cryptococcus neoformans gattii</option> + <option value="cryptococcus_neoformans_neoformans_B ">Cryptococcus neoformans neoformans</option> + <option value="cryptococcus_neoformans_neoformans_JEC21 ">Cryptococcus neoformans neoformans</option> + <option value="debaryomyces_hansenii">Debaryomyces hansenii</option> + <option value="encephalitozoon_cuniculi_GB">Encephalitozoon cuniculi</option> + <option value="eremothecium_gossypii">Eremothecium gossypii</option> + <option value="fusarium_graminearum ">Fusarium graminearum</option> + <option value="histoplasma_capsulatum ">Histoplasma capsulatum</option> + <option value="(histoplasma)">Histoplasma capsulatum</option> + <option value="kluyveromyces_lactis ">Kluyveromyces lactis</option> + <option value="laccaria_bicolor ">Laccaria bicolor</option> + <option value="lamprey">Petromyzon marinus</option> + <option value="leishmania_tarentolae">Leishmania tarentolae</option> + <option value="lodderomyces_elongisporus">Lodderomyces elongisporus</option> + <option value="magnaporthe_grisea ">Magnaporthe grisea</option> + <option value="neurospora_crassa">Neurospora crassa</option> + <option value="phanerochaete_chrysosporium">Phanerochaete chrysosporium</option> + <option value="pichia_stipitis">Pichia stipitis</option> + <option value="rhizopus_oryzae">Rhizopus oryzae</option> + <option value="saccharomyces_cerevisiae_S288C ">Saccharomyces cerevisiae</option> + <option value="saccharomyces_cerevisiae_rm11-1a_1 ">Saccharomyces cerevisiae</option> + <option value="(saccharomyces)">Saccharomyces cerevisiae</option> + <option value="schizosaccharomyces_pombe">Schizosaccharomyces pombe</option> + <option value="trichinella">Trichinella spiralis</option> + <option value="ustilago_maydis">Ustilago maydis</option> + <option value="yarrowia_lipolytica">Yarrowia lipolytica</option> + <option value="nasonia">Nasonia vitripennis</option> + <option value="tomato">Solanum lycopersicum</option> + <option value="chlamydomonas">Chlamydomonas reinhardtii</option> + <option value="amphimedon">Amphimedon queenslandica</option> + <option value="pneumocystis">Pneumocystis jirovecii</option> + <option value="chicken">Gallus gallus domesticus (chicken)</option> + <option value="cacao">Theobroma cacao (cacao)</option> + <option value="heliconius_melpomene1">Heliconius melpomene</option> + <option value="xenoturbella">Xenoturbella</option> + </param> + + <param name="strand" type="select" multiple="false" format="text" help="Report predicted genes on both strands, just the forward or just the backward strand."> + <option value="both">both</option> + <option value="forward">forward</option> + <option value="backward">backward</option> + </param> + + <param name="genemodel" label="Gene Model" type="select" multiple="false" format="text" help="Gene Model to predict, for more information please refere to the help."> + <option value="complete">complete</option> + <option value="partial">partial</option> + <option value="intronless">intronless</option> + <option value="atleastone">atleastone</option> + <option value="exactlyone">exactlyone</option> + <option value="bacterium">bacterium (beta version)</option> + </param> + + <param name="protein" type="boolean" label="Output predicted protein sequences (--protein)" truevalue="--protein=on" falsevalue="--protein=off" checked="true" /> + <param name="codingseq" type="boolean" label="Output coding sequence as comment in the output file (codingseq)" truevalue="--codingseq=on" falsevalue="--codingseq=off" checked="true" /> + <param name="introns" type="boolean" label="Output predicted intron sequences (--introns)" truevalue="--introns=on" falsevalue="--introns=off" checked="false" /> + <param name="start" type="boolean" label="Output predicted start codons (--start)" truevalue="--start=on" falsevalue="--start=off" checked="false" /> + <param name="stop" type="boolean" label="Output predicted stop codons (--stop)" truevalue="--stop=on" falsevalue="--stop=off" checked="false" /> + <param name="cds" type="boolean" label="Output CDS region (--cds)" truevalue="--cds=on" falsevalue="--cds=off" checked="true" /> + <param name="gff" type="boolean" label="GFF formated output, standard is GTF (--gff3)" truevalue="--gff3=on" falsevalue="--gff3=off" checked="false" /> + + </inputs> + <outputs> + <data format="gtf" name="output" label="${tool.name} on ${on_string}: GTF/GFF"> + <change_format> + <when input="gff" value="--gff3=on" format="gff" /> + </change_format> + </data> + <data format="fasta" name="protein_output" label="${tool.name} on ${on_string}: Protein sequence"> + <filter>protein == True</filter> + </data> + <data format="fasta" name="codingseq_output" label="${tool.name} on ${on_string}: Coding sequence"> + <filter>codingseq == True</filter> + </data> + </outputs> + <tests> + <test> + <param name="input_genome" value="human_augustus.fa" ftype="fasta" /> + <param name="organism" value="human" /> + <param name="utr" value="--UTR=on" /> + <output name="output" file="human_augustus_utr-on.gtf" ftype="gtf" lines_diff="2"/> + </test> + <test> + <param name="input_genome" value="human_augustus.fa" ftype="fasta" /> + <param name="organism" value="human" /> + <param name="utr" value="--UTR=on" /> + <param name="gff" value="--gff3=on" /> + <output name="output" file="human_augustus_utr-on.gff" ftype="gff3" lines_diff="2"/> + </test> + <test> + <param name="input_genome" value="arabidopsis_augustus.fa" ftype="fasta" /> + <param name="organism" value="arabidopsis" /> + <param name="singlestrand" value="--singlestrand=true" /> + <param name="mea" value="--mea=1" /> + <output name="output" file="arabidopsis_augustus_utr-off_singlestrand-on_mea-on.gtf" ftype="gtf" lines_diff="2"/> + </test> + <test> + <param name="input_genome" value="human_augustus.fa" ftype="fasta" /> + <param name="organism" value="human" /> + <param name="protein" value="--protein=on" /> + <param name="codingseq" value="--codingseq=on" /> + <param name="introns" value="--introns=on" /> + <param name="cds" value="--cds=on" /> + <output name="output" file="human_augustus_protein_codingseq_introns_cds_main.gtf" ftype="gff" lines_diff="2"/> + <output name="codingseq_output" file="human_augustus_protein_codingseq_introns_cds_codingseq.fasta" ftype="fasta" /> + <output name="protein_output" file="human_augustus_protein_codingseq_introns_cds_protein.fasta" ftype="fasta" /> + </test> + </tests> + <help> + +**What it does** + +AUGUSTUS is a gene prediction program for eukaryotes written by Mario Stanke and Oliver Keller. +It can be used as an ab initio program, which means it bases its prediction purely on the +sequence. AUGUSTUS may also incorporate hints on the gene structure coming from extrinsic sources +such as EST, MS/MS, protein alignments and synthenic genomic alignments. + +----- + +**Parameters** + +Gene Model:: + + partial : allow prediction of incomplete genes at the sequence boundaries (default) + intronless : only predict single-exon genes like in prokaryotes and some eukaryotes + complete : only predict complete genes + atleastone : predict at least one complete gene + exactlyone : predict exactly one complete gene + + + +**Example** + +Suppose you have the following DNA formatted sequences:: + + >Seq1 + cccgcggagcgggtaccacatcgctgcgcgatgtgcgagcgaacacccgggctgcgcccg + ggtgttgcgctcccgctccgcgggagcgctggcgggacgctgcgcgtcccgctcaccaag + cccgcttcgcgggcttggtgacgctccgtccgctgcgcttccggagttgcggggcttcgc + cccgctaaccctgggcctcgcttcgctccgccttgggcctgcggcgggtccgctgcgctc + ccccgcctcaagggcccttccggctgcgcctccaggacccaaccgcttgcgcgggcctgg + +Running this tool will produce this:: + + # ----- prediction on sequence number 1 (length = 1992969, name = scaffold1|size1992969) ----- + # + # Constraints/Hints: + # (none) + # Predicted genes for sequence number 1 on both strands + # start gene g1 + scaffold1|size1992969 AUGUSTUS gene 17453 19382 0.11 + . g6 + scaffold1|size1992969 AUGUSTUS transcript 17453 19382 0.11 + . g6.t1 + scaffold1|size1992969 AUGUSTUS start_codon 17453 17455 . + 0 transcript_id "g6.t1"; gene_id "g6"; + scaffold1|size1992969 AUGUSTUS intron 17615 17660 0.38 + . transcript_id "g6.t1"; gene_id "g6"; + scaffold1|size1992969 AUGUSTUS intron 17708 17772 0.54 + . transcript_id "g6.t1"; gene_id "g6"; + scaffold1|size1992969 AUGUSTUS intron 17902 18035 0.58 + . transcript_id "g6.t1"; gene_id "g6"; + scaffold1|size1992969 AUGUSTUS intron 18313 18367 0.99 + . transcript_id "g6.t1"; gene_id "g6"; + scaffold1|size1992969 AUGUSTUS intron 19014 19080 0.44 + . transcript_id "g6.t1"; gene_id "g6"; + scaffold1|size1992969 AUGUSTUS CDS 17453 17614 0.55 + 0 transcript_id "g6.t1"; gene_id "g6"; + scaffold1|size1992969 AUGUSTUS CDS 17661 17707 0.38 + 0 transcript_id "g6.t1"; gene_id "g6"; + scaffold1|size1992969 AUGUSTUS CDS 17773 17901 0.54 + 1 transcript_id "g6.t1"; gene_id "g6"; + scaffold1|size1992969 AUGUSTUS CDS 18036 18312 0.52 + 1 transcript_id "g6.t1"; gene_id "g6"; + scaffold1|size1992969 AUGUSTUS CDS 18368 19013 0.99 + 0 transcript_id "g6.t1"; gene_id "g6"; + scaffold1|size1992969 AUGUSTUS CDS 19081 19379 0.31 + 2 transcript_id "g6.t1"; gene_id "g6"; + scaffold1|size1992969 AUGUSTUS stop_codon 19380 19382 . + 0 transcript_id "g6.t1"; gene_id "g6"; + + +**References** + +Mario Stanke and Stephan Waack (2003) +Gene Prediction with a Hidden-Markov Model and a new Intron Submodel. +Bioinformatics, Vol. 19, Suppl. 2, pages ii215-ii225 + + + </help> +</tool>