annotate test-data/summary.txt @ 21:120b7b35e442 draft default tip

"planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 8fdc76a99a9dcf34549898a208317607afd18798"
author bgruening
date Thu, 22 Apr 2021 17:05:46 +0000
parents 0b656f8c5637
children
Ignore whitespace changes - Everywhere: Within whitespace: At end of lines:
rev   line source
8
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
1 Create a temporary index with the offered files from the user. Utilizing the script: bismark_genome_preparation
13
f211753166bd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit b9780e368b2e46dc541a846519ccc9593226ee0d
bgruening
parents: 8
diff changeset
2 Generating index with: 'bismark_genome_preparation --bowtie2 /tmp/tmpProAS5'
8
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
3 Writing bisulfite genomes out into a single MFA (multi FastA) file
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
4
13
f211753166bd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit b9780e368b2e46dc541a846519ccc9593226ee0d
bgruening
parents: 8
diff changeset
5 Bisulfite Genome Indexer version v0.22.1 (last modified: 14 April 2019)
8
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
6
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
7 Step I - Prepare genome folders - completed
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
8
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
9
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
10
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
11 Total number of conversions performed:
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
12 C->T: 146875
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
13 G->A: 150504
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
14
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
15 Step II - Genome bisulfite conversions - completed
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
16
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
17
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
18 Bismark Genome Preparation - Step III: Launching the Bowtie 2 indexer
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
19 Please be aware that this process can - depending on genome size - take several hours!
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
20 Settings:
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
21 Output files: "BS_CT.*.bt2"
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
22 Line rate: 6 (line is 64 bytes)
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
23 Lines per side: 1 (side is 64 bytes)
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
24 Offset rate: 4 (one in 16)
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
25 FTable chars: 10
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
26 Strings: unpacked
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
27 Max bucket size: default
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
28 Max bucket size, sqrt multiplier: default
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
29 Max bucket size, len divisor: 4
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
30 Difference-cover sample period: 1024
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
31 Endianness: little
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
32 Actual local endianness: little
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
33 Sanity checking: disabled
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
34 Assertions: disabled
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
35 Random seed: 0
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
36 Sizeofs: void*:8, int:4, long:8, size_t:8
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
37 Input files DNA, FASTA:
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
38 genome_mfa.CT_conversion.fa
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
39 Building a SMALL index
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
40 Reading reference sizes
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
41 Time reading reference sizes: 00:00:00
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
42 Calculating joined length
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
43 Writing header
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
44 Reserving space for joined string
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
45 Joining reference sequences
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
46 Time to join reference sequences: 00:00:00
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
47 bmax according to bmaxDivN setting: 189039
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
48 Using parameters --bmax 141780 --dcv 1024
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
49 Doing ahead-of-time memory usage test
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
50 Passed! Constructing with these parameters: --bmax 141780 --dcv 1024
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
51 Constructing suffix-array element generator
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
52 Building DifferenceCoverSample
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
53 Building sPrime
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
54 Building sPrimeOrder
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
55 V-Sorting samples
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
56 V-Sorting samples time: 00:00:00
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
57 Allocating rank array
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
58 Ranking v-sort output
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
59 Ranking v-sort output time: 00:00:00
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
60 Invoking Larsson-Sadakane on ranks
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
61 Invoking Larsson-Sadakane on ranks time: 00:00:00
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
62 Sanity-checking and returning
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
63 Building samples
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
64 Reserving space for 12 sample suffixes
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
65 Generating random suffixes
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
66 QSorting 12 sample offsets, eliminating duplicates
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
67 QSorting sample offsets, eliminating duplicates time: 00:00:00
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
68 Multikey QSorting 12 samples
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
69 (Using difference cover)
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
70 Multikey QSorting samples time: 00:00:00
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
71 Calculating bucket sizes
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
72 Splitting and merging
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
73 Splitting and merging time: 00:00:00
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
74 Avg bucket size: 756159 (target: 141779)
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
75 Converting suffix-array elements to index image
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
76 Allocating ftab, absorbFtab
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
77 Entering Ebwt loop
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
78 Getting block 1 of 1
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
79 No samples; assembling all-inclusive block
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
80 Sorting block of length 756159 for bucket 1
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
81 (Using difference cover)
15
0b656f8c5637 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit ec1f38df34e6862abd0b8e7cc0521e25f9933567
bgruening
parents: 13
diff changeset
82 Sorting block time: xxxx
8
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
83 Returning block of 756160 for bucket 1
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
84 Exited Ebwt loop
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
85 fchr[A]: 0
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
86 fchr[C]: 235897
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
87 fchr[G]: 235897
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
88 fchr[T]: 386401
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
89 fchr[$]: 756159
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
90 Exiting Ebwt::buildToDisk()
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
91 Returning from initFromVector
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
92 Wrote 4446745 bytes to primary EBWT file: BS_CT.1.bt2
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
93 Wrote 189044 bytes to secondary EBWT file: BS_CT.2.bt2
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
94 Re-opening _in1 and _in2 as input streams
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
95 Returning from Ebwt constructor
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
96 Headers:
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
97 len: 756159
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
98 bwtLen: 756160
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
99 sz: 189040
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
100 bwtSz: 189040
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
101 lineRate: 6
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
102 offRate: 4
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
103 offMask: 0xfffffff0
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
104 ftabChars: 10
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
105 eftabLen: 20
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
106 eftabSz: 80
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
107 ftabLen: 1048577
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
108 ftabSz: 4194308
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
109 offsLen: 47260
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
110 offsSz: 189040
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
111 lineSz: 64
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
112 sideSz: 64
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
113 sideBwtSz: 48
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
114 sideBwtLen: 192
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
115 numSides: 3939
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
116 numLines: 3939
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
117 ebwtTotLen: 252096
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
118 ebwtTotSz: 252096
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
119 color: 0
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
120 reverse: 0
15
0b656f8c5637 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit ec1f38df34e6862abd0b8e7cc0521e25f9933567
bgruening
parents: 13
diff changeset
121 Total time for call to driver() for forward index: xxxx
8
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
122 Reading reference sizes
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
123 Time reading reference sizes: 00:00:00
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
124 Calculating joined length
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
125 Writing header
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
126 Reserving space for joined string
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
127 Joining reference sequences
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
128 Time to join reference sequences: 00:00:00
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
129 Time to reverse reference sequence: 00:00:00
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
130 bmax according to bmaxDivN setting: 189039
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
131 Using parameters --bmax 141780 --dcv 1024
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
132 Doing ahead-of-time memory usage test
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
133 Passed! Constructing with these parameters: --bmax 141780 --dcv 1024
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
134 Constructing suffix-array element generator
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
135 Building DifferenceCoverSample
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
136 Building sPrime
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
137 Building sPrimeOrder
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
138 V-Sorting samples
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
139 V-Sorting samples time: 00:00:00
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
140 Allocating rank array
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
141 Ranking v-sort output
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
142 Ranking v-sort output time: 00:00:00
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
143 Invoking Larsson-Sadakane on ranks
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
144 Invoking Larsson-Sadakane on ranks time: 00:00:00
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
145 Sanity-checking and returning
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
146 Building samples
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
147 Reserving space for 12 sample suffixes
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
148 Generating random suffixes
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
149 QSorting 12 sample offsets, eliminating duplicates
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
150 QSorting sample offsets, eliminating duplicates time: 00:00:00
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
151 Multikey QSorting 12 samples
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
152 (Using difference cover)
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
153 Multikey QSorting samples time: 00:00:00
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
154 Calculating bucket sizes
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
155 Splitting and merging
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
156 Splitting and merging time: 00:00:00
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
157 Avg bucket size: 756159 (target: 141779)
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
158 Converting suffix-array elements to index image
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
159 Allocating ftab, absorbFtab
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
160 Entering Ebwt loop
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
161 Getting block 1 of 1
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
162 No samples; assembling all-inclusive block
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
163 Sorting block of length 756159 for bucket 1
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
164 (Using difference cover)
15
0b656f8c5637 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit ec1f38df34e6862abd0b8e7cc0521e25f9933567
bgruening
parents: 13
diff changeset
165 Sorting block time: xxxx
8
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
166 Returning block of 756160 for bucket 1
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
167 Exited Ebwt loop
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
168 fchr[A]: 0
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
169 fchr[C]: 235897
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
170 fchr[G]: 235897
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
171 fchr[T]: 386401
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
172 fchr[$]: 756159
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
173 Exiting Ebwt::buildToDisk()
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
174 Returning from initFromVector
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
175 Wrote 4446745 bytes to primary EBWT file: BS_CT.rev.1.bt2
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
176 Wrote 189044 bytes to secondary EBWT file: BS_CT.rev.2.bt2
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
177 Re-opening _in1 and _in2 as input streams
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
178 Returning from Ebwt constructor
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
179 Headers:
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
180 len: 756159
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
181 bwtLen: 756160
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
182 sz: 189040
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
183 bwtSz: 189040
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
184 lineRate: 6
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
185 offRate: 4
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
186 offMask: 0xfffffff0
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
187 ftabChars: 10
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
188 eftabLen: 20
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
189 eftabSz: 80
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
190 ftabLen: 1048577
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
191 ftabSz: 4194308
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
192 offsLen: 47260
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
193 offsSz: 189040
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
194 lineSz: 64
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
195 sideSz: 64
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
196 sideBwtSz: 48
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
197 sideBwtLen: 192
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
198 numSides: 3939
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
199 numLines: 3939
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
200 ebwtTotLen: 252096
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
201 ebwtTotSz: 252096
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
202 color: 0
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
203 reverse: 1
13
f211753166bd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit b9780e368b2e46dc541a846519ccc9593226ee0d
bgruening
parents: 8
diff changeset
204 Total time for backward call to driver() for mirror index: 00:00:01
8
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
205 Settings:
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
206 Output files: "BS_GA.*.bt2"
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
207 Line rate: 6 (line is 64 bytes)
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
208 Lines per side: 1 (side is 64 bytes)
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
209 Offset rate: 4 (one in 16)
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
210 FTable chars: 10
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
211 Strings: unpacked
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
212 Max bucket size: default
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
213 Max bucket size, sqrt multiplier: default
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
214 Max bucket size, len divisor: 4
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
215 Difference-cover sample period: 1024
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
216 Endianness: little
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
217 Actual local endianness: little
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
218 Sanity checking: disabled
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
219 Assertions: disabled
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
220 Random seed: 0
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
221 Sizeofs: void*:8, int:4, long:8, size_t:8
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
222 Input files DNA, FASTA:
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
223 genome_mfa.GA_conversion.fa
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
224 Building a SMALL index
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
225 Reading reference sizes
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
226 Time reading reference sizes: 00:00:00
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
227 Calculating joined length
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
228 Writing header
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
229 Reserving space for joined string
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
230 Joining reference sequences
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
231 Time to join reference sequences: 00:00:00
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
232 bmax according to bmaxDivN setting: 189039
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
233 Using parameters --bmax 141780 --dcv 1024
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
234 Doing ahead-of-time memory usage test
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
235 Passed! Constructing with these parameters: --bmax 141780 --dcv 1024
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
236 Constructing suffix-array element generator
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
237 Building DifferenceCoverSample
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
238 Building sPrime
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
239 Building sPrimeOrder
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
240 V-Sorting samples
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
241 V-Sorting samples time: 00:00:00
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
242 Allocating rank array
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
243 Ranking v-sort output
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
244 Ranking v-sort output time: 00:00:00
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
245 Invoking Larsson-Sadakane on ranks
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
246 Invoking Larsson-Sadakane on ranks time: 00:00:00
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
247 Sanity-checking and returning
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
248 Building samples
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
249 Reserving space for 12 sample suffixes
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
250 Generating random suffixes
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
251 QSorting 12 sample offsets, eliminating duplicates
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
252 QSorting sample offsets, eliminating duplicates time: 00:00:00
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
253 Multikey QSorting 12 samples
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
254 (Using difference cover)
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
255 Multikey QSorting samples time: 00:00:00
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
256 Calculating bucket sizes
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
257 Splitting and merging
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
258 Splitting and merging time: 00:00:00
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
259 Avg bucket size: 756159 (target: 141779)
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
260 Converting suffix-array elements to index image
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
261 Allocating ftab, absorbFtab
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
262 Entering Ebwt loop
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
263 Getting block 1 of 1
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
264 No samples; assembling all-inclusive block
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
265 Sorting block of length 756159 for bucket 1
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
266 (Using difference cover)
15
0b656f8c5637 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit ec1f38df34e6862abd0b8e7cc0521e25f9933567
bgruening
parents: 13
diff changeset
267 Sorting block time: xxxx
8
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
268 Returning block of 756160 for bucket 1
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
269 Exited Ebwt loop
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
270 fchr[A]: 0
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
271 fchr[C]: 386401
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
272 fchr[G]: 533276
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
273 fchr[T]: 533276
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
274 fchr[$]: 756159
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
275 Exiting Ebwt::buildToDisk()
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
276 Returning from initFromVector
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
277 Wrote 4446745 bytes to primary EBWT file: BS_GA.1.bt2
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
278 Wrote 189044 bytes to secondary EBWT file: BS_GA.2.bt2
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
279 Re-opening _in1 and _in2 as input streams
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
280 Returning from Ebwt constructor
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
281 Headers:
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
282 len: 756159
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
283 bwtLen: 756160
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
284 sz: 189040
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
285 bwtSz: 189040
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
286 lineRate: 6
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
287 offRate: 4
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
288 offMask: 0xfffffff0
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
289 ftabChars: 10
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
290 eftabLen: 20
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
291 eftabSz: 80
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
292 ftabLen: 1048577
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
293 ftabSz: 4194308
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
294 offsLen: 47260
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
295 offsSz: 189040
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
296 lineSz: 64
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
297 sideSz: 64
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
298 sideBwtSz: 48
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
299 sideBwtLen: 192
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
300 numSides: 3939
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
301 numLines: 3939
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
302 ebwtTotLen: 252096
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
303 ebwtTotSz: 252096
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
304 color: 0
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
305 reverse: 0
15
0b656f8c5637 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit ec1f38df34e6862abd0b8e7cc0521e25f9933567
bgruening
parents: 13
diff changeset
306 Total time for call to driver() for forward index: xxxx
8
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
307 Reading reference sizes
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
308 Time reading reference sizes: 00:00:00
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
309 Calculating joined length
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
310 Writing header
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
311 Reserving space for joined string
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
312 Joining reference sequences
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
313 Time to join reference sequences: 00:00:00
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
314 Time to reverse reference sequence: 00:00:00
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
315 bmax according to bmaxDivN setting: 189039
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
316 Using parameters --bmax 141780 --dcv 1024
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
317 Doing ahead-of-time memory usage test
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
318 Passed! Constructing with these parameters: --bmax 141780 --dcv 1024
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
319 Constructing suffix-array element generator
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
320 Building DifferenceCoverSample
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
321 Building sPrime
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
322 Building sPrimeOrder
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
323 V-Sorting samples
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
324 V-Sorting samples time: 00:00:00
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
325 Allocating rank array
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
326 Ranking v-sort output
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
327 Ranking v-sort output time: 00:00:00
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
328 Invoking Larsson-Sadakane on ranks
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
329 Invoking Larsson-Sadakane on ranks time: 00:00:00
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
330 Sanity-checking and returning
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
331 Building samples
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
332 Reserving space for 12 sample suffixes
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
333 Generating random suffixes
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
334 QSorting 12 sample offsets, eliminating duplicates
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
335 QSorting sample offsets, eliminating duplicates time: 00:00:00
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
336 Multikey QSorting 12 samples
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
337 (Using difference cover)
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
338 Multikey QSorting samples time: 00:00:00
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
339 Calculating bucket sizes
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
340 Splitting and merging
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
341 Splitting and merging time: 00:00:00
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
342 Avg bucket size: 756159 (target: 141779)
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
343 Converting suffix-array elements to index image
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
344 Allocating ftab, absorbFtab
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
345 Entering Ebwt loop
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
346 Getting block 1 of 1
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
347 No samples; assembling all-inclusive block
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
348 Sorting block of length 756159 for bucket 1
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
349 (Using difference cover)
15
0b656f8c5637 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit ec1f38df34e6862abd0b8e7cc0521e25f9933567
bgruening
parents: 13
diff changeset
350 Sorting block time: xxxx
8
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
351 Returning block of 756160 for bucket 1
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
352 Exited Ebwt loop
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
353 fchr[A]: 0
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
354 fchr[C]: 386401
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
355 fchr[G]: 533276
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
356 fchr[T]: 533276
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
357 fchr[$]: 756159
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
358 Exiting Ebwt::buildToDisk()
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
359 Returning from initFromVector
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
360 Wrote 4446745 bytes to primary EBWT file: BS_GA.rev.1.bt2
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
361 Wrote 189044 bytes to secondary EBWT file: BS_GA.rev.2.bt2
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
362 Re-opening _in1 and _in2 as input streams
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
363 Returning from Ebwt constructor
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
364 Headers:
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
365 len: 756159
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
366 bwtLen: 756160
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
367 sz: 189040
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
368 bwtSz: 189040
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
369 lineRate: 6
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
370 offRate: 4
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
371 offMask: 0xfffffff0
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
372 ftabChars: 10
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
373 eftabLen: 20
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
374 eftabSz: 80
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
375 ftabLen: 1048577
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
376 ftabSz: 4194308
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
377 offsLen: 47260
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
378 offsSz: 189040
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
379 lineSz: 64
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
380 sideSz: 64
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
381 sideBwtSz: 48
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
382 sideBwtLen: 192
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
383 numSides: 3939
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
384 numLines: 3939
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
385 ebwtTotLen: 252096
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
386 ebwtTotSz: 252096
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
387 color: 0
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
388 reverse: 1
13
f211753166bd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit b9780e368b2e46dc541a846519ccc9593226ee0d
bgruening
parents: 8
diff changeset
389 Total time for backward call to driver() for mirror index: 00:00:01
f211753166bd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit b9780e368b2e46dc541a846519ccc9593226ee0d
bgruening
parents: 8
diff changeset
390 Running bismark with: 'bismark --bam --gzip --temp_dir /tmp/tmpvcY9eC -o /tmp/tmpvcY9eC/results --quiet --fastq -L 20 -D 15 -R 2 --un --ambiguous /tmp/tmpProAS5 input_1.fq.gz'
f211753166bd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit b9780e368b2e46dc541a846519ccc9593226ee0d
bgruening
parents: 8
diff changeset
391 Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.3.5])
8
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
392 Output format is BAM (default)
13
f211753166bd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit b9780e368b2e46dc541a846519ccc9593226ee0d
bgruening
parents: 8
diff changeset
393 Alignments will be written out in BAM format. Samtools found here: '/home/abretaud/miniconda3/envs/mulled-v1-9f2317dbfb405ed6926c55752e5c11678eee3256a6ea680d1c0f912251153030/bin/samtools'
f211753166bd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit b9780e368b2e46dc541a846519ccc9593226ee0d
bgruening
parents: 8
diff changeset
394 Reference genome folder provided is /tmp/tmpProAS5/ (absolute path is '/tmp/tmpProAS5/)'
8
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
395 FastQ format specified
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
396
13
f211753166bd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit b9780e368b2e46dc541a846519ccc9593226ee0d
bgruening
parents: 8
diff changeset
397 Input files to be analysed (in current folder '/tmp/tmpq6T4hb/job_working_directory/000/4/working'):
f211753166bd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit b9780e368b2e46dc541a846519ccc9593226ee0d
bgruening
parents: 8
diff changeset
398 input_1.fq.gz
8
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
399 Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!)
13
f211753166bd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit b9780e368b2e46dc541a846519ccc9593226ee0d
bgruening
parents: 8
diff changeset
400 Created output directory /tmp/tmpvcY9eC/results/!
8
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
401
13
f211753166bd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit b9780e368b2e46dc541a846519ccc9593226ee0d
bgruening
parents: 8
diff changeset
402 Output will be written into the directory: /tmp/tmpvcY9eC/results/
8
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
403
13
f211753166bd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit b9780e368b2e46dc541a846519ccc9593226ee0d
bgruening
parents: 8
diff changeset
404 Using temp directory: /tmp/tmpvcY9eC
f211753166bd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit b9780e368b2e46dc541a846519ccc9593226ee0d
bgruening
parents: 8
diff changeset
405 Temporary files will be written into the directory: /tmp/tmpvcY9eC/
8
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
406 Setting parallelization to single-threaded (default)
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
407
13
f211753166bd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit b9780e368b2e46dc541a846519ccc9593226ee0d
bgruening
parents: 8
diff changeset
408 Summary of all aligner options: -q -L 20 -D 15 -R 2 --score-min L,0,-0.2 --ignore-quals --quiet
f211753166bd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit b9780e368b2e46dc541a846519ccc9593226ee0d
bgruening
parents: 8
diff changeset
409 Current working directory is: /tmp/tmpq6T4hb/job_working_directory/000/4/working
8
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
410
13
f211753166bd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit b9780e368b2e46dc541a846519ccc9593226ee0d
bgruening
parents: 8
diff changeset
411 Now reading in and storing sequence information of the genome specified in: /tmp/tmpProAS5/
8
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
412
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
413 chr chrY_JH584300_random (182347 bp)
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
414 chr chrY_JH584301_random (259875 bp)
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
415 chr chrY_JH584302_random (155838 bp)
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
416 chr chrY_JH584303_random (158099 bp)
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
417
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
418 Single-core mode: setting pid to 1
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
419
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
420 Single-end alignments will be performed
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
421 =======================================
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
422
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
423 Input file is in FastQ format
13
f211753166bd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit b9780e368b2e46dc541a846519ccc9593226ee0d
bgruening
parents: 8
diff changeset
424 Writing a C -> T converted version of the input file input_1.fq.gz to /tmp/tmpvcY9eC/input_1.fq.gz_C_to_T.fastq.gz
8
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
425
13
f211753166bd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit b9780e368b2e46dc541a846519ccc9593226ee0d
bgruening
parents: 8
diff changeset
426 Created C -> T converted version of the FastQ file input_1.fq.gz (44115 sequences in total)
8
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
427
13
f211753166bd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit b9780e368b2e46dc541a846519ccc9593226ee0d
bgruening
parents: 8
diff changeset
428 Input file is input_1.fq.gz_C_to_T.fastq.gz (FastQ)
8
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
429
13
f211753166bd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit b9780e368b2e46dc541a846519ccc9593226ee0d
bgruening
parents: 8
diff changeset
430 Now running 2 instances of Bowtie 2 against the bisulfite genome of /tmp/tmpProAS5/ with the specified options: -q -L 20 -D 15 -R 2 --score-min L,0,-0.2 --ignore-quals --quiet
8
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
431
13
f211753166bd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit b9780e368b2e46dc541a846519ccc9593226ee0d
bgruening
parents: 8
diff changeset
432 Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from /tmp/tmpvcY9eC/input_1.fq.gz_C_to_T.fastq.gz with options -q -L 20 -D 15 -R 2 --score-min L,0,-0.2 --ignore-quals --quiet --norc)
f211753166bd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit b9780e368b2e46dc541a846519ccc9593226ee0d
bgruening
parents: 8
diff changeset
433 Using Bowtie 2 index: /tmp/tmpProAS5/Bisulfite_Genome/CT_conversion/BS_CT
8
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
434
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
435 Found first alignment: 1_1 4 * 0 0 * * 0 0 TTGTATATATTAGATAAATTAATTTTTTTTGTTTGTATGTTAAATTTTTTAATTAATTTATTAATATTTTGTGAATTTTTAGATA AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEAEEEEEE YT:Z:UU
13
f211753166bd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit b9780e368b2e46dc541a846519ccc9593226ee0d
bgruening
parents: 8
diff changeset
436 Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from /tmp/tmpvcY9eC/input_1.fq.gz_C_to_T.fastq.gz with options -q -L 20 -D 15 -R 2 --score-min L,0,-0.2 --ignore-quals --quiet --nofw)
f211753166bd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit b9780e368b2e46dc541a846519ccc9593226ee0d
bgruening
parents: 8
diff changeset
437 Using Bowtie 2 index: /tmp/tmpProAS5/Bisulfite_Genome/GA_conversion/BS_GA
8
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
438
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
439 Found first alignment: 1_1 4 * 0 0 * * 0 0 TTGTATATATTAGATAAATTAATTTTTTTTGTTTGTATGTTAAATTTTTTAATTAATTTATTAATATTTTGTGAATTTTTAGATA AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEAEEEEEE YT:Z:UU
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
440
13
f211753166bd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit b9780e368b2e46dc541a846519ccc9593226ee0d
bgruening
parents: 8
diff changeset
441 >>> Writing bisulfite mapping results to /tmp/tmpvcY9eC/results/input_1_bismark_bt2.bam <<<
8
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
442
13
f211753166bd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit b9780e368b2e46dc541a846519ccc9593226ee0d
bgruening
parents: 8
diff changeset
443 Unmapped sequences will be written to /tmp/tmpvcY9eC/results/input_1.fq.gz_unmapped_reads.fq.gz
f211753166bd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit b9780e368b2e46dc541a846519ccc9593226ee0d
bgruening
parents: 8
diff changeset
444 Ambiguously mapping sequences will be written to /tmp/tmpvcY9eC/results/input_1.fq.gz_ambiguous_reads.fq.gz
8
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
445
13
f211753166bd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit b9780e368b2e46dc541a846519ccc9593226ee0d
bgruening
parents: 8
diff changeset
446 Reading in the sequence file input_1.fq.gz
8
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
447 Processed 44115 sequences in total
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
448
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
449
13
f211753166bd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit b9780e368b2e46dc541a846519ccc9593226ee0d
bgruening
parents: 8
diff changeset
450 Successfully deleted the temporary file /tmp/tmpvcY9eC/input_1.fq.gz_C_to_T.fastq.gz
8
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
451
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
452 Final Alignment report
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
453 ======================
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
454 Sequences analysed in total: 44115
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
455 Number of alignments with a unique best hit from the different alignments: 554
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
456 Mapping efficiency: 1.3%
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
457
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
458 Sequences with no alignments under any condition: 43115
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
459 Sequences did not map uniquely: 446
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
460 Sequences which were discarded because genomic sequence could not be extracted: 0
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
461
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
462 Number of sequences with unique best (first) alignment came from the bowtie output:
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
463 CT/CT: 230 ((converted) top strand)
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
464 CT/GA: 324 ((converted) bottom strand)
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
465 GA/CT: 0 (complementary to (converted) top strand)
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
466 GA/GA: 0 (complementary to (converted) bottom strand)
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
467
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
468 Number of alignments to (merely theoretical) complementary strands being rejected in total: 0
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
469
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
470 Final Cytosine Methylation Report
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
471 =================================
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
472 Total number of C's analysed: 8563
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
473
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
474 Total methylated C's in CpG context: 245
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
475 Total methylated C's in CHG context: 51
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
476 Total methylated C's in CHH context: 114
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
477 Total methylated C's in Unknown context: 1
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
478
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
479 Total unmethylated C's in CpG context: 133
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
480 Total unmethylated C's in CHG context: 1762
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
481 Total unmethylated C's in CHH context: 6258
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
482 Total unmethylated C's in Unknown context: 5
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
483
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
484 C methylated in CpG context: 64.8%
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
485 C methylated in CHG context: 2.8%
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
486 C methylated in CHH context: 1.8%
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
487 C methylated in Unknown context (CN or CHN): 16.7%
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
488
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
489
15
0b656f8c5637 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit ec1f38df34e6862abd0b8e7cc0521e25f9933567
bgruening
parents: 13
diff changeset
490 Bismark completed in xxxx
8
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
491
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
492 ====================
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
493 Bismark run complete
9bfe38410155 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 51299fa62f0566a4a897b1c149db564631282fff
bgruening
parents:
diff changeset
494 ====================