annotate test-data/summary_mate.txt @ 21:120b7b35e442 draft default tip

"planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 8fdc76a99a9dcf34549898a208317607afd18798"
author bgruening
date Thu, 22 Apr 2021 17:05:46 +0000
parents 0b656f8c5637
children
Ignore whitespace changes - Everywhere: Within whitespace: At end of lines:
rev   line source
14
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
1 Create a temporary index with the offered files from the user. Utilizing the script: bismark_genome_preparation
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
2 Generating index with: 'bismark_genome_preparation --bowtie2 /tmp/tmpAHSx4i'
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
3 Writing bisulfite genomes out into a single MFA (multi FastA) file
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
4
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
5 Bisulfite Genome Indexer version v0.22.1 (last modified: 14 April 2019)
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
6
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
7 Step I - Prepare genome folders - completed
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
8
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
9
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
10
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
11 Total number of conversions performed:
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
12 C->T: 146875
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
13 G->A: 150504
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
14
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
15 Step II - Genome bisulfite conversions - completed
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
16
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
17
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
18 Bismark Genome Preparation - Step III: Launching the Bowtie 2 indexer
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
19 Please be aware that this process can - depending on genome size - take several hours!
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
20 Settings:
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
21 Output files: "BS_CT.*.bt2"
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
22 Line rate: 6 (line is 64 bytes)
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
23 Lines per side: 1 (side is 64 bytes)
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
24 Offset rate: 4 (one in 16)
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
25 FTable chars: 10
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
26 Strings: unpacked
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
27 Max bucket size: default
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
28 Max bucket size, sqrt multiplier: default
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
29 Max bucket size, len divisor: 4
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
30 Difference-cover sample period: 1024
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
31 Endianness: little
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
32 Actual local endianness: little
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
33 Sanity checking: disabled
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
34 Assertions: disabled
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
35 Random seed: 0
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
36 Sizeofs: void*:8, int:4, long:8, size_t:8
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
37 Input files DNA, FASTA:
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
38 genome_mfa.CT_conversion.fa
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
39 Building a SMALL index
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
40 Reading reference sizes
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
41 Time reading reference sizes: 00:00:00
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
42 Calculating joined length
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
43 Writing header
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
44 Reserving space for joined string
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
45 Joining reference sequences
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
46 Time to join reference sequences: 00:00:00
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
47 bmax according to bmaxDivN setting: 189039
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
48 Using parameters --bmax 141780 --dcv 1024
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
49 Doing ahead-of-time memory usage test
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
50 Passed! Constructing with these parameters: --bmax 141780 --dcv 1024
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
51 Constructing suffix-array element generator
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
52 Building DifferenceCoverSample
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
53 Building sPrime
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
54 Building sPrimeOrder
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
55 V-Sorting samples
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
56 V-Sorting samples time: 00:00:00
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
57 Allocating rank array
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
58 Ranking v-sort output
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
59 Ranking v-sort output time: 00:00:00
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
60 Invoking Larsson-Sadakane on ranks
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
61 Invoking Larsson-Sadakane on ranks time: 00:00:00
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
62 Sanity-checking and returning
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
63 Building samples
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
64 Reserving space for 12 sample suffixes
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
65 Generating random suffixes
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
66 QSorting 12 sample offsets, eliminating duplicates
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
67 QSorting sample offsets, eliminating duplicates time: 00:00:00
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
68 Multikey QSorting 12 samples
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
69 (Using difference cover)
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
70 Multikey QSorting samples time: 00:00:00
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
71 Calculating bucket sizes
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
72 Splitting and merging
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
73 Splitting and merging time: 00:00:00
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
74 Avg bucket size: 756159 (target: 141779)
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
75 Converting suffix-array elements to index image
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
76 Allocating ftab, absorbFtab
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
77 Entering Ebwt loop
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
78 Getting block 1 of 1
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
79 No samples; assembling all-inclusive block
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
80 Sorting block of length 756159 for bucket 1
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
81 (Using difference cover)
15
0b656f8c5637 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit ec1f38df34e6862abd0b8e7cc0521e25f9933567
bgruening
parents: 14
diff changeset
82 Sorting block time: xxxx
14
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
83 Returning block of 756160 for bucket 1
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
84 Exited Ebwt loop
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
85 fchr[A]: 0
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
86 fchr[C]: 235897
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
87 fchr[G]: 235897
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
88 fchr[T]: 386401
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
89 fchr[$]: 756159
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
90 Exiting Ebwt::buildToDisk()
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
91 Returning from initFromVector
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
92 Wrote 4446745 bytes to primary EBWT file: BS_CT.1.bt2
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
93 Wrote 189044 bytes to secondary EBWT file: BS_CT.2.bt2
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
94 Re-opening _in1 and _in2 as input streams
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
95 Returning from Ebwt constructor
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
96 Headers:
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
97 len: 756159
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
98 bwtLen: 756160
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
99 sz: 189040
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
100 bwtSz: 189040
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
101 lineRate: 6
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
102 offRate: 4
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
103 offMask: 0xfffffff0
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
104 ftabChars: 10
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
105 eftabLen: 20
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
106 eftabSz: 80
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
107 ftabLen: 1048577
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
108 ftabSz: 4194308
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
109 offsLen: 47260
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
110 offsSz: 189040
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
111 lineSz: 64
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
112 sideSz: 64
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
113 sideBwtSz: 48
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
114 sideBwtLen: 192
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
115 numSides: 3939
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
116 numLines: 3939
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
117 ebwtTotLen: 252096
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
118 ebwtTotSz: 252096
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
119 color: 0
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
120 reverse: 0
15
0b656f8c5637 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit ec1f38df34e6862abd0b8e7cc0521e25f9933567
bgruening
parents: 14
diff changeset
121 Total time for call to driver() for forward index: xxxx
14
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
122 Reading reference sizes
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
123 Time reading reference sizes: 00:00:00
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
124 Calculating joined length
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
125 Writing header
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
126 Reserving space for joined string
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
127 Joining reference sequences
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
128 Time to join reference sequences: 00:00:00
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
129 Time to reverse reference sequence: 00:00:00
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
130 bmax according to bmaxDivN setting: 189039
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
131 Using parameters --bmax 141780 --dcv 1024
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
132 Doing ahead-of-time memory usage test
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
133 Passed! Constructing with these parameters: --bmax 141780 --dcv 1024
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
134 Constructing suffix-array element generator
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
135 Building DifferenceCoverSample
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
136 Building sPrime
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
137 Building sPrimeOrder
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
138 V-Sorting samples
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
139 V-Sorting samples time: 00:00:00
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
140 Allocating rank array
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
141 Ranking v-sort output
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
142 Ranking v-sort output time: 00:00:00
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
143 Invoking Larsson-Sadakane on ranks
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
144 Invoking Larsson-Sadakane on ranks time: 00:00:00
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
145 Sanity-checking and returning
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
146 Building samples
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
147 Reserving space for 12 sample suffixes
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
148 Generating random suffixes
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
149 QSorting 12 sample offsets, eliminating duplicates
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
150 QSorting sample offsets, eliminating duplicates time: 00:00:00
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
151 Multikey QSorting 12 samples
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
152 (Using difference cover)
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
153 Multikey QSorting samples time: 00:00:00
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
154 Calculating bucket sizes
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
155 Splitting and merging
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
156 Splitting and merging time: 00:00:00
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
157 Avg bucket size: 756159 (target: 141779)
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
158 Converting suffix-array elements to index image
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
159 Allocating ftab, absorbFtab
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
160 Entering Ebwt loop
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
161 Getting block 1 of 1
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
162 No samples; assembling all-inclusive block
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
163 Sorting block of length 756159 for bucket 1
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
164 (Using difference cover)
15
0b656f8c5637 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit ec1f38df34e6862abd0b8e7cc0521e25f9933567
bgruening
parents: 14
diff changeset
165 Sorting block time: xxxx
14
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
166 Returning block of 756160 for bucket 1
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
167 Exited Ebwt loop
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
168 fchr[A]: 0
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
169 fchr[C]: 235897
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
170 fchr[G]: 235897
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
171 fchr[T]: 386401
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
172 fchr[$]: 756159
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
173 Exiting Ebwt::buildToDisk()
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
174 Returning from initFromVector
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
175 Wrote 4446745 bytes to primary EBWT file: BS_CT.rev.1.bt2
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
176 Wrote 189044 bytes to secondary EBWT file: BS_CT.rev.2.bt2
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
177 Re-opening _in1 and _in2 as input streams
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
178 Returning from Ebwt constructor
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
179 Headers:
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
180 len: 756159
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
181 bwtLen: 756160
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
182 sz: 189040
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
183 bwtSz: 189040
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
184 lineRate: 6
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
185 offRate: 4
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
186 offMask: 0xfffffff0
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
187 ftabChars: 10
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
188 eftabLen: 20
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
189 eftabSz: 80
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
190 ftabLen: 1048577
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
191 ftabSz: 4194308
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
192 offsLen: 47260
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
193 offsSz: 189040
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
194 lineSz: 64
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
195 sideSz: 64
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
196 sideBwtSz: 48
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
197 sideBwtLen: 192
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
198 numSides: 3939
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
199 numLines: 3939
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
200 ebwtTotLen: 252096
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
201 ebwtTotSz: 252096
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
202 color: 0
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
203 reverse: 1
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
204 Total time for backward call to driver() for mirror index: 00:00:01
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
205 Settings:
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
206 Output files: "BS_GA.*.bt2"
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
207 Line rate: 6 (line is 64 bytes)
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
208 Lines per side: 1 (side is 64 bytes)
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
209 Offset rate: 4 (one in 16)
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
210 FTable chars: 10
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
211 Strings: unpacked
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
212 Max bucket size: default
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
213 Max bucket size, sqrt multiplier: default
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
214 Max bucket size, len divisor: 4
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
215 Difference-cover sample period: 1024
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
216 Endianness: little
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
217 Actual local endianness: little
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
218 Sanity checking: disabled
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
219 Assertions: disabled
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
220 Random seed: 0
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
221 Sizeofs: void*:8, int:4, long:8, size_t:8
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
222 Input files DNA, FASTA:
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
223 genome_mfa.GA_conversion.fa
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
224 Building a SMALL index
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
225 Reading reference sizes
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
226 Time reading reference sizes: 00:00:00
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
227 Calculating joined length
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
228 Writing header
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
229 Reserving space for joined string
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
230 Joining reference sequences
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
231 Time to join reference sequences: 00:00:00
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
232 bmax according to bmaxDivN setting: 189039
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
233 Using parameters --bmax 141780 --dcv 1024
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
234 Doing ahead-of-time memory usage test
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
235 Passed! Constructing with these parameters: --bmax 141780 --dcv 1024
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
236 Constructing suffix-array element generator
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
237 Building DifferenceCoverSample
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
238 Building sPrime
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
239 Building sPrimeOrder
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
240 V-Sorting samples
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
241 V-Sorting samples time: 00:00:00
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
242 Allocating rank array
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
243 Ranking v-sort output
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
244 Ranking v-sort output time: 00:00:00
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
245 Invoking Larsson-Sadakane on ranks
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
246 Invoking Larsson-Sadakane on ranks time: 00:00:00
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
247 Sanity-checking and returning
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
248 Building samples
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
249 Reserving space for 12 sample suffixes
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
250 Generating random suffixes
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
251 QSorting 12 sample offsets, eliminating duplicates
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
252 QSorting sample offsets, eliminating duplicates time: 00:00:00
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
253 Multikey QSorting 12 samples
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
254 (Using difference cover)
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
255 Multikey QSorting samples time: 00:00:00
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
256 Calculating bucket sizes
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
257 Splitting and merging
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
258 Splitting and merging time: 00:00:00
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
259 Avg bucket size: 756159 (target: 141779)
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
260 Converting suffix-array elements to index image
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
261 Allocating ftab, absorbFtab
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
262 Entering Ebwt loop
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
263 Getting block 1 of 1
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
264 No samples; assembling all-inclusive block
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
265 Sorting block of length 756159 for bucket 1
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
266 (Using difference cover)
15
0b656f8c5637 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit ec1f38df34e6862abd0b8e7cc0521e25f9933567
bgruening
parents: 14
diff changeset
267 Sorting block time: xxxx
14
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
268 Returning block of 756160 for bucket 1
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
269 Exited Ebwt loop
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
270 fchr[A]: 0
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
271 fchr[C]: 386401
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
272 fchr[G]: 533276
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
273 fchr[T]: 533276
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
274 fchr[$]: 756159
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
275 Exiting Ebwt::buildToDisk()
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
276 Returning from initFromVector
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
277 Wrote 4446745 bytes to primary EBWT file: BS_GA.1.bt2
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
278 Wrote 189044 bytes to secondary EBWT file: BS_GA.2.bt2
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
279 Re-opening _in1 and _in2 as input streams
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
280 Returning from Ebwt constructor
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
281 Headers:
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
282 len: 756159
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
283 bwtLen: 756160
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
284 sz: 189040
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
285 bwtSz: 189040
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
286 lineRate: 6
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
287 offRate: 4
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
288 offMask: 0xfffffff0
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
289 ftabChars: 10
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
290 eftabLen: 20
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
291 eftabSz: 80
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
292 ftabLen: 1048577
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
293 ftabSz: 4194308
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
294 offsLen: 47260
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
295 offsSz: 189040
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
296 lineSz: 64
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
297 sideSz: 64
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
298 sideBwtSz: 48
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
299 sideBwtLen: 192
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
300 numSides: 3939
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
301 numLines: 3939
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
302 ebwtTotLen: 252096
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
303 ebwtTotSz: 252096
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
304 color: 0
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
305 reverse: 0
15
0b656f8c5637 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit ec1f38df34e6862abd0b8e7cc0521e25f9933567
bgruening
parents: 14
diff changeset
306 Total time for call to driver() for forward index: xxxx
14
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
307 Reading reference sizes
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
308 Time reading reference sizes: 00:00:00
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
309 Calculating joined length
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
310 Writing header
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
311 Reserving space for joined string
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
312 Joining reference sequences
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
313 Time to join reference sequences: 00:00:00
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
314 Time to reverse reference sequence: 00:00:00
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
315 bmax according to bmaxDivN setting: 189039
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
316 Using parameters --bmax 141780 --dcv 1024
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
317 Doing ahead-of-time memory usage test
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
318 Passed! Constructing with these parameters: --bmax 141780 --dcv 1024
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
319 Constructing suffix-array element generator
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
320 Building DifferenceCoverSample
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
321 Building sPrime
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
322 Building sPrimeOrder
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
323 V-Sorting samples
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
324 V-Sorting samples time: 00:00:00
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
325 Allocating rank array
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
326 Ranking v-sort output
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
327 Ranking v-sort output time: 00:00:00
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
328 Invoking Larsson-Sadakane on ranks
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
329 Invoking Larsson-Sadakane on ranks time: 00:00:00
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
330 Sanity-checking and returning
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
331 Building samples
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
332 Reserving space for 12 sample suffixes
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
333 Generating random suffixes
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
334 QSorting 12 sample offsets, eliminating duplicates
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
335 QSorting sample offsets, eliminating duplicates time: 00:00:00
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
336 Multikey QSorting 12 samples
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
337 (Using difference cover)
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
338 Multikey QSorting samples time: 00:00:00
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
339 Calculating bucket sizes
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
340 Splitting and merging
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
341 Splitting and merging time: 00:00:00
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
342 Avg bucket size: 756159 (target: 141779)
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
343 Converting suffix-array elements to index image
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
344 Allocating ftab, absorbFtab
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
345 Entering Ebwt loop
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
346 Getting block 1 of 1
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
347 No samples; assembling all-inclusive block
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
348 Sorting block of length 756159 for bucket 1
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
349 (Using difference cover)
15
0b656f8c5637 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit ec1f38df34e6862abd0b8e7cc0521e25f9933567
bgruening
parents: 14
diff changeset
350 Sorting block time: xxxx
14
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
351 Returning block of 756160 for bucket 1
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
352 Exited Ebwt loop
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
353 fchr[A]: 0
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
354 fchr[C]: 386401
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
355 fchr[G]: 533276
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
356 fchr[T]: 533276
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
357 fchr[$]: 756159
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
358 Exiting Ebwt::buildToDisk()
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
359 Returning from initFromVector
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
360 Wrote 4446745 bytes to primary EBWT file: BS_GA.rev.1.bt2
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
361 Wrote 189044 bytes to secondary EBWT file: BS_GA.rev.2.bt2
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
362 Re-opening _in1 and _in2 as input streams
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
363 Returning from Ebwt constructor
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
364 Headers:
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
365 len: 756159
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
366 bwtLen: 756160
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
367 sz: 189040
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
368 bwtSz: 189040
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
369 lineRate: 6
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
370 offRate: 4
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
371 offMask: 0xfffffff0
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
372 ftabChars: 10
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
373 eftabLen: 20
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
374 eftabSz: 80
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
375 ftabLen: 1048577
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
376 ftabSz: 4194308
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
377 offsLen: 47260
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
378 offsSz: 189040
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
379 lineSz: 64
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
380 sideSz: 64
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
381 sideBwtSz: 48
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
382 sideBwtLen: 192
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
383 numSides: 3939
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
384 numLines: 3939
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
385 ebwtTotLen: 252096
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
386 ebwtTotSz: 252096
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
387 color: 0
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
388 reverse: 1
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
389 Total time for backward call to driver() for mirror index: 00:00:01
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
390 Running bismark with: 'bismark --bam --gzip --temp_dir /tmp/tmp86syD7 -o /tmp/tmp86syD7/results --quiet --fastq -L 20 -D 15 -R 2 --un --ambiguous /tmp/tmpAHSx4i -1 input1_fq_1.fq -2 input1_fq_2.fq -I 0 -X 500'
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
391 Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.3.5])
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
392 Output format is BAM (default)
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
393 Alignments will be written out in BAM format. Samtools found here: '/home/abretaud/miniconda3/envs/mulled-v1-9f2317dbfb405ed6926c55752e5c11678eee3256a6ea680d1c0f912251153030/bin/samtools'
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
394 Reference genome folder provided is /tmp/tmpAHSx4i/ (absolute path is '/tmp/tmpAHSx4i/)'
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
395 FastQ format specified
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
396
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
397 Input files to be analysed (in current folder '/tmp/tmpFC2FCZ/job_working_directory/000/4/working'):
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
398 input1_fq_1.fq
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
399 input1_fq_2.fq
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
400 Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!)
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
401 Created output directory /tmp/tmp86syD7/results/!
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
402
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
403 Output will be written into the directory: /tmp/tmp86syD7/results/
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
404
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
405 Using temp directory: /tmp/tmp86syD7
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
406 Temporary files will be written into the directory: /tmp/tmp86syD7/
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
407 Setting parallelization to single-threaded (default)
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
408
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
409 Summary of all aligner options: -q -L 20 -D 15 -R 2 --score-min L,0,-0.2 --ignore-quals --no-mixed --no-discordant --dovetail --minins 0 --maxins 500 --quiet
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
410 Current working directory is: /tmp/tmpFC2FCZ/job_working_directory/000/4/working
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
411
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
412 Now reading in and storing sequence information of the genome specified in: /tmp/tmpAHSx4i/
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
413
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
414 chr chrY_JH584300_random (182347 bp)
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
415 chr chrY_JH584301_random (259875 bp)
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
416 chr chrY_JH584302_random (155838 bp)
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
417 chr chrY_JH584303_random (158099 bp)
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
418
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
419 Single-core mode: setting pid to 1
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
420
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
421 Paired-end alignments will be performed
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
422 =======================================
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
423
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
424 The provided filenames for paired-end alignments are input1_fq_1.fq and input1_fq_2.fq
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
425 Input files are in FastQ format
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
426 Writing a C -> T converted version of the input file input1_fq_1.fq to /tmp/tmp86syD7/input1_fq_1.fq_C_to_T.fastq.gz
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
427
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
428 Created C -> T converted version of the FastQ file input1_fq_1.fq (1000 sequences in total)
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
429
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
430 Writing a G -> A converted version of the input file input1_fq_2.fq to /tmp/tmp86syD7/input1_fq_2.fq_G_to_A.fastq.gz
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
431
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
432 Created G -> A converted version of the FastQ file input1_fq_2.fq (1000 sequences in total)
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
433
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
434 Input files are input1_fq_1.fq_C_to_T.fastq.gz and input1_fq_2.fq_G_to_A.fastq.gz (FastQ)
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
435 Now running 2 instances of Bowtie 2 against the bisulfite genome of /tmp/tmpAHSx4i/ with the specified options: -q -L 20 -D 15 -R 2 --score-min L,0,-0.2 --ignore-quals --no-mixed --no-discordant --dovetail --minins 0 --maxins 500 --quiet
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
436
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
437 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/tmp86syD7/input1_fq_1.fq_C_to_T.fastq.gz and /tmp/tmp86syD7/input1_fq_2.fq_G_to_A.fastq.gz, with the options: -q -L 20 -D 15 -R 2 --score-min L,0,-0.2 --ignore-quals --no-mixed --no-discordant --dovetail --minins 0 --maxins 500 --quiet --norc))
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
438 Found first alignment:
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
439 1_1/1 77 * 0 0 * * 0 0 TTGTATATATTAGATAAATTAATTTTTTTTGTTTGTATGTTAAATTTTTTAATTAATTTATTAATATTTTGTGAATTTTTAGATA AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEAEEEEEE YT:Z:UP
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
440 1_1/2 141 * 0 0 * * 0 0 TTATATATATTAAATAAATTAATTTTTTTTATTTATATATTAAATTTTTTAATTAATTTATTAATATTTTATAAATTTTTAAATA AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEAEEEEEE YT:Z:UP
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
441 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/tmp86syD7/input1_fq_1.fq_C_to_T.fastq.gz and /tmp/tmp86syD7/input1_fq_2.fq_G_to_A.fastq.gz, with the options: -q -L 20 -D 15 -R 2 --score-min L,0,-0.2 --ignore-quals --no-mixed --no-discordant --dovetail --minins 0 --maxins 500 --quiet --nofw))
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
442 Found first alignment:
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
443 1_1/1 77 * 0 0 * * 0 0 TTGTATATATTAGATAAATTAATTTTTTTTGTTTGTATGTTAAATTTTTTAATTAATTTATTAATATTTTGTGAATTTTTAGATA AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEAEEEEEE YT:Z:UP
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
444 1_1/2 141 * 0 0 * * 0 0 TTATATATATTAAATAAATTAATTTTTTTTATTTATATATTAAATTTTTTAATTAATTTATTAATATTTTATAAATTTTTAAATA AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEAEEEEEE YT:Z:UP
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
445
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
446 >>> Writing bisulfite mapping results to input1_fq_1_bismark_bt2_pe.bam <<<
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
447
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
448 Unmapped sequences will be written to input1_fq_1.fq_unmapped_reads_1.fq.gz and input1_fq_2.fq_unmapped_reads_2.fq.gz
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
449 Ambiguously mapping sequences will be written to input1_fq_1.fq_ambiguous_reads_1.fq.gz and input1_fq_2.fq_ambiguous_reads_2.fq.gz
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
450
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
451 Reading in the sequence files input1_fq_1.fq and input1_fq_2.fq
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
452 Processed 1000 sequences in total
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
453
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
454
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
455 Successfully deleted the temporary files /tmp/tmp86syD7/input1_fq_1.fq_C_to_T.fastq.gz and /tmp/tmp86syD7/input1_fq_2.fq_G_to_A.fastq.gz
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
456
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
457 Final Alignment report
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
458 ======================
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
459 Sequence pairs analysed in total: 1000
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
460 Number of paired-end alignments with a unique best hit: 0
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
461 Mapping efficiency: 0.0%
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
462
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
463 Sequence pairs with no alignments under any condition: 1000
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
464 Sequence pairs did not map uniquely: 0
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
465 Sequence pairs which were discarded because genomic sequence could not be extracted: 0
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
466
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
467 Number of sequence pairs with unique best (first) alignment came from the bowtie output:
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
468 CT/GA/CT: 0 ((converted) top strand)
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
469 GA/CT/CT: 0 (complementary to (converted) top strand)
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
470 GA/CT/GA: 0 (complementary to (converted) bottom strand)
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
471 CT/GA/GA: 0 ((converted) bottom strand)
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
472
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
473 Number of alignments to (merely theoretical) complementary strands being rejected in total: 0
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
474
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
475 Final Cytosine Methylation Report
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
476 =================================
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
477 Total number of C's analysed: 0
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
478
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
479 Total methylated C's in CpG context: 0
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
480 Total methylated C's in CHG context: 0
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
481 Total methylated C's in CHH context: 0
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
482 Total methylated C's in Unknown context: 0
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
483
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
484 Total unmethylated C's in CpG context: 0
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
485 Total unmethylated C's in CHG context: 0
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
486 Total unmethylated C's in CHH context: 0
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
487 Total unmethylated C's in Unknown context: 0
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
488
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
489 Can't determine percentage of methylated Cs in CpG context if value was 0
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
490 Can't determine percentage of methylated Cs in CHG context if value was 0
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
491 Can't determine percentage of methylated Cs in CHH context if value was 0
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
492 Can't determine percentage of methylated Cs in unknown context (CN or CHN) if value was 0
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
493
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
494
15
0b656f8c5637 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit ec1f38df34e6862abd0b8e7cc0521e25f9933567
bgruening
parents: 14
diff changeset
495 Bismark completed in xxxx
14
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
496
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
497 ====================
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
498 Bismark run complete
b6aa3b6ba129 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
bgruening
parents:
diff changeset
499 ====================