Mercurial > repos > bgruening > bismark

comparison bismark_mapping/bismark @ 7:fcadce4d9a06 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit b'e6ee273f75fff61d1e419283fa8088528cf59470\n'
author bgruening
date Sat, 06 May 2017 13:18:09 -0400
parents
children
comparison
equal deleted inserted replaced
6:0f8646f22b8d 7:fcadce4d9a06
1 #!/usr/bin/env perl
2 use strict;
3 use warnings;
4 use IO::Handle;
5 use Cwd;
6 $|++;
7 use Getopt::Long;
8 use FindBin qw($Bin);
9 use lib "$Bin/../lib";
10
11 ## This program is Copyright (C) 2010-16, Felix Krueger (felix.krueger@babraham.ac.uk)
12
13 ## This program is free software: you can redistribute it and/or modify
14 ## it under the terms of the GNU General Public License as published by
15 ## the Free Software Foundation, either version 3 of the License, or
16 ## (at your option) any later version.
17
18 ## This program is distributed in the hope that it will be useful,
19 ## but WITHOUT ANY WARRANTY; without even the implied warranty of
20 ## MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
21 ## GNU General Public License for more details.
22
23 ## You should have received a copy of the GNU General Public License
24 ## along with this program. If not, see <http://www.gnu.org/licenses/>.
25
26
27 my $parent_dir = getcwd;
28 my $bismark_version = 'v0.16.3';
29 my $command_line = join (" ",@ARGV);
30
31
32 ### before processing the command line we will replace --solexa1.3-quals with --phred64-quals as the '.' in the option name will cause Getopt::Long to fail
33 foreach my $arg (@ARGV){
34 if ($arg eq '--solexa1.3-quals'){
35 $arg = '--phred64-quals';
36 }
37 }
38 my @filenames; # will be populated by processing the command line
39
40 my ($genome_folder,$CT_index_basename,$GA_index_basename,$path_to_bowtie,$sequence_file_format,$bowtie_options,$directional,$unmapped,$ambiguous,$phred64,$solexa,$output_dir,$bowtie2,$vanilla,$sam_no_hd,$skip,$upto,$temp_dir,$non_bs_mm,$insertion_open,$insertion_extend,$deletion_open,$deletion_extend,$gzip,$bam,$samtools_path,$pbat,$prefix,$old_flag,$basename,$score_min_intercept,$score_min_slope,$bt2_large_index,$multicore,$rg_tag,$rg_id,$rg_sample,$ambig_bam,$cram,$cram_ref,$nucleotide_coverage,$dovetail) = process_command_line();
41
42 my @fhs; # stores alignment process names, bisulfite index location, bowtie filehandles and the number of times sequences produced an alignment
43 my %chromosomes; # stores the chromosome sequences of the mouse genome
44 my %SQ_order; # stores the order of sequences in the reference. This is to produce SAM/BAM files with a known order of chromosomes
45 my %counting; # counting various events
46 my $final_output_filename; # required for the nucleotide coverage report
47 my @pids; # storing the process IDs of child processes in parallel mode
48
49
50 my $seqID_contains_tabs;
51 my $verbose = 0;
52
53 if ($multicore > 1){
54 warn "Running Bismark Parallel version. Number of parallel instances to be spawned: $multicore\n\n";
55 }
56
57
58 sub multi_process_handling{
59
60 my $offset = 1;
61 my $process_id;
62 if ($multicore > 1){
63
64 until ($offset == $multicore){
65 # warn "multicore: $multicore\noffset: $offset\n";
66 my $fork = fork;
67
68 if (defined $fork){
69 if ($fork != 0){
70 $process_id = $fork;
71 push @pids, $process_id;
72 if ($offset < $multicore){
73 ++$offset;
74 # warn "I am the parent process, child pid: $fork\nIncrementing offset counter to: $offset\n\n";
75 }
76 else{
77 # warn "Reached the number of maximum multicores. Proceeeding to processing...\n";
78 }
79 }
80 elsif ($fork == 0){
81 # warn "I am a child process, pid: $fork\nOffset counter is: $offset\nProceeding to processing...\n";
82 $process_id = $fork;
83 last;
84 }
85 }
86 else{
87 die "Forking unsuccessful. Proceeding using a single thread only\n";
88 }
89 }
90
91 # warn "\nThe Thread Identity\n===================\n";
92 if ($process_id){
93 # print "I am the parent process. My children are called:\n";
94 # print join ("\t",@pids),"\n";
95 # print "I am going to process the following line count: $offset\n\n";
96 }
97 elsif($process_id == 0){
98 # warn "I am a child process: Process ID: $process_id\n";
99 # warn "I am going to process the following line count: $offset\n\n";
100 }
101 else{
102 die "Process ID was: '$process_id'\n";
103 }
104 }
105 else{
106 warn "Single-core mode: setting pid to 1\n";
107 $process_id = 1;
108 }
109
110 return ($process_id,$offset);
111 }
112
113
114 sub subset_input_file_FastQ{
115
116 my ($filename,$process_id,$offset) = @_;
117
118 if ($filename =~ /gz$/){
119 open (OFFSET,"gunzip -c $filename |") or die "Couldn't read from file '$filename': $!\n";
120 }
121 else{
122 open (OFFSET,$filename) or die "Couldn't read from file '$filename': $!\n";
123 }
124
125 # warn "offset is $offset\n";
126 my $temp = $filename;
127 $temp .= ".temp.$offset";
128 $temp =~ s/^.*\///; # replacing everything upto and including the last /, i.e. removing file path information
129
130 if ($gzip){
131 $temp .= '.gz';
132 open (TEMPFQ,"| gzip -c - > ${temp_dir}${temp}") or die "Can't write to file ${temp_dir}${temp}: $!\n";
133 }
134 else{
135 open (TEMPFQ,'>',"${temp_dir}${temp}") or die "Failed to write output ${temp_dir}${temp}: $!\n";
136 }
137
138 my $line_count = 0;
139
140 while (1){
141 my $l1 = <OFFSET>;
142 my $l2 = <OFFSET>;
143 my $l3 = <OFFSET>;
144 my $l4 = <OFFSET>;
145
146 last unless ($l4);
147 ++$line_count;
148
149 if ( ($line_count - $offset)%$multicore == 0){
150 # warn "line count: $line_count\noffset: $offset\n";
151 # warn "Modulus: ",($line_count - $offset)%$multicore,"\n";
152 # warn "processing this line $line_count (processID: $process_id with \$offset $offset)\n";
153 print TEMPFQ "$l1$l2$l3$l4";
154 }
155 else{
156 # warn "skipping line $line_count for processID: $process_id with \$offset $offset)\n";
157 next;
158 }
159 }
160
161 close OFFSET or warn $!;
162 close TEMPFQ or warn "Failed to close file handle TEMPFQ: $!\n";
163
164 warn "Finished subdividing $filename for PID: $process_id and offset $offset\n\n";
165
166 return ($temp); # returning the subset filename
167
168 }
169
170 sub subset_input_file_FastA{
171
172 my ($filename,$process_id,$offset) = @_;
173
174 if ($filename =~ /gz$/){
175 open (OFFSET,"gunzip -c $filename |") or die "Couldn't read from file '$filename': $!\n";
176 }
177 else{
178 open (OFFSET,$filename) or die "Couldn't read from file '$filename': $!\n";
179 }
180
181 # warn "offset is $offset\n";
182 my $temp = $filename;
183 $temp .= ".temp.$offset";
184 $temp =~ s/^.*\///; # replacing everything upto and including the last /, i.e. removing file path information
185
186 if ($gzip){
187 $temp .= '.gz';
188 open (TEMPFA,"| gzip -c - > ${temp_dir}${temp}") or die "Can't write to file ${temp_dir}${temp}: $!\n";
189 }
190 else{
191 open (TEMPFA,'>',"${temp_dir}${temp}") or die "Failed to write output ${temp_dir}${temp}: $!\n";
192 }
193
194 warn "Writing temporary infile to $temp\n";
195
196 my $line_count = 0;
197
198 while (1){
199 my $l1 = <OFFSET>;
200 my $l2 = <OFFSET>;
201
202 last unless ($l2);
203 ++$line_count;
204
205 if ( ($line_count - $offset)%$multicore == 0){
206 # warn "line count: $line_count\noffset: $offset\n";
207 # warn "Modulus: ",($line_count - $offset)%$multicore,"\n";
208 # warn "processing this line $line_count (processID: $process_id with \$offset $offset)\n";
209 print TEMPFA "$l1$l2";
210 }
211 else{
212 # warn "skipping line $line_count for processID: $process_id with \$offset $offset)\n";
213 next;
214 }
215 }
216
217 close OFFSET or warn $!;
218 close TEMPFA or warn "Failed to close file handle TEMPFQ: $!\n";
219
220 warn "Finished subdividing $filename for PID: $process_id and offset $offset\n\n";
221
222 return ($temp); # returning the subset filename
223
224 }
225
226 #####
227 #####
228
229 foreach my $filename (@filenames){
230
231 my $original_filename = $filename;
232 my $original_filename_1;
233 my $original_filename_2;
234
235 chdir $parent_dir or die "Unable to move to initial working directory'$parent_dir' $!\n";
236 ### resetting the counting hash and fhs
237 reset_counters_and_fhs($filename);
238 @pids = ();
239 $seqID_contains_tabs = 0;
240
241 ### if 2 or more files are provided we can hold the genome in memory and don't need to read it in a second time
242 unless (%chromosomes){
243 my $cwd = getcwd; # storing the path of the current working directory
244 warn "Current working directory is: $cwd\n\n";
245 read_genome_into_memory($cwd);
246 }
247
248 ### As of version 0.14.0 we support multi-threading. In a first instance we accomplish this by
249 ### splitting the input file(s) into several smaller subfiles and merging the results back at
250 ### the end.
251
252 # get general settings (also for single-threaded use)
253 my ($pid,$offset) = multi_process_handling ();
254
255 my ($single_end,$paired_end);
256 ### PAIRED-END ALIGNMENTS
257 if ($filename =~ ','){
258
259 $single_end = 0;
260 $paired_end = 1;
261
262 my ($C_to_T_infile_1,$G_to_A_infile_1); # to be made from mate1 file
263
264 $fhs[0]->{name} = 'CTread1GAread2CTgenome';
265 $fhs[1]->{name} = 'GAread1CTread2GAgenome';
266 $fhs[2]->{name} = 'GAread1CTread2CTgenome';
267 $fhs[3]->{name} = 'CTread1GAread2GAgenome';
268 warn "\nPaired-end alignments will be performed\n",'='x39,"\n\n";
269
270 my ($filename_1,$filename_2) = (split (/,/,$filename));
271 $original_filename_1 = $filename_1;
272 $original_filename_2 = $filename_2;
273
274 warn "The provided filenames for paired-end alignments are $filename_1 and $filename_2\n";
275
276 ### subsetting the input file(s)
277 unless ($multicore == 1){ # not needed in single-core mode
278 # warn "My PID: $pid\nMy offset: $offset\n";
279 if ($sequence_file_format eq 'FASTA'){
280 my $temp_filename_1 = subset_input_file_FastA($filename_1,$pid,$offset);
281 warn "Using the subset file >${temp_dir}$temp_filename_1< as new in-file 1 (instead of >$filename_1<)\n";
282 $filename_1 = "${temp_dir}$temp_filename_1";
283
284 my $temp_filename_2 = subset_input_file_FastA($filename_2,$pid,$offset);
285 warn "Using the subset file >${temp_dir}$temp_filename_2< as new in-file 2 (instead of >$filename_2<)\n";
286 $filename_2 = "${temp_dir}$temp_filename_2";
287 }
288 else{ # FastQ format, default
289 my $temp_filename_1 = subset_input_file_FastQ($filename_1,$pid,$offset);
290 warn "Using the subset file >${temp_dir}$temp_filename_1< as new in-file 1 (instead of >$filename_1<)\n";
291 $filename_1 = "${temp_dir}$temp_filename_1";
292
293 my $temp_filename_2 = subset_input_file_FastQ($filename_2,$pid,$offset);
294 warn "Using the subset file >${temp_dir}$temp_filename_2< as new in-file 2 (instead of >$filename_2<)\n";
295 $filename_2 = "${temp_dir}$temp_filename_2";
296 }
297 }
298
299 ### additional variables only for paired-end alignments
300 my ($C_to_T_infile_2,$G_to_A_infile_2); # to be made from mate2 file
301
302 ### FastA format
303 if ($sequence_file_format eq 'FASTA'){
304 warn "Input files are in FastA format\n";
305
306 if ($directional){
307 ($C_to_T_infile_1) = biTransformFastAFiles_paired_end ($filename_1,1); # also passing the read number
308 ($G_to_A_infile_2) = biTransformFastAFiles_paired_end ($filename_2,2);
309
310 $fhs[0]->{inputfile_1} = $C_to_T_infile_1;
311 $fhs[0]->{inputfile_2} = $G_to_A_infile_2;
312 $fhs[1]->{inputfile_1} = undef;
313 $fhs[1]->{inputfile_2} = undef;
314 $fhs[2]->{inputfile_1} = undef;
315 $fhs[2]->{inputfile_2} = undef;
316 $fhs[3]->{inputfile_1} = $C_to_T_infile_1;
317 $fhs[3]->{inputfile_2} = $G_to_A_infile_2;
318 }
319 else{
320 ($C_to_T_infile_1,$G_to_A_infile_1) = biTransformFastAFiles_paired_end ($filename_1,1); # also passing the read number
321 ($C_to_T_infile_2,$G_to_A_infile_2) = biTransformFastAFiles_paired_end ($filename_2,2);
322
323 $fhs[0]->{inputfile_1} = $C_to_T_infile_1;
324 $fhs[0]->{inputfile_2} = $G_to_A_infile_2;
325 $fhs[1]->{inputfile_1} = $G_to_A_infile_1;
326 $fhs[1]->{inputfile_2} = $C_to_T_infile_2;
327 $fhs[2]->{inputfile_1} = $G_to_A_infile_1;
328 $fhs[2]->{inputfile_2} = $C_to_T_infile_2;
329 $fhs[3]->{inputfile_1} = $C_to_T_infile_1;
330 $fhs[3]->{inputfile_2} = $G_to_A_infile_2;
331 }
332
333 if ($bowtie2){
334 paired_end_align_fragments_to_bisulfite_genome_fastA_bowtie2 ($C_to_T_infile_1,$G_to_A_infile_1,$C_to_T_infile_2,$G_to_A_infile_2);
335 }
336 else{
337 paired_end_align_fragments_to_bisulfite_genome_fastA ($C_to_T_infile_1,$G_to_A_infile_1,$C_to_T_infile_2,$G_to_A_infile_2);
338 }
339 }
340
341 ### FastQ format
342 else{
343 warn "Input files are in FastQ format\n";
344 if ($directional){
345 if ($bowtie2){
346 ($C_to_T_infile_1) = biTransformFastQFiles_paired_end ($filename_1,1); # also passing the read number
347 ($G_to_A_infile_2) = biTransformFastQFiles_paired_end ($filename_2,2);
348
349 $fhs[0]->{inputfile_1} = $C_to_T_infile_1;
350 $fhs[0]->{inputfile_2} = $G_to_A_infile_2;
351 $fhs[1]->{inputfile_1} = undef;
352 $fhs[1]->{inputfile_2} = undef;
353 $fhs[2]->{inputfile_1} = undef;
354 $fhs[2]->{inputfile_2} = undef;
355 $fhs[3]->{inputfile_1} = $C_to_T_infile_1;
356 $fhs[3]->{inputfile_2} = $G_to_A_infile_2;
357 }
358 else{ # Bowtie 1 alignments
359 if ($gzip){
360 ($C_to_T_infile_1) = biTransformFastQFiles_paired_end_bowtie1_gzip ($filename_1,$filename_2); # passing both reads at the same time
361
362 $fhs[0]->{inputfile_1} = $C_to_T_infile_1; # this file contains both read 1 and read 2 in tab delimited format
363 $fhs[0]->{inputfile_2} = undef; # no longer needed
364 $fhs[1]->{inputfile_1} = undef;
365 $fhs[1]->{inputfile_2} = undef;
366 $fhs[2]->{inputfile_1} = undef;
367 $fhs[2]->{inputfile_2} = undef;
368 $fhs[3]->{inputfile_1} = $C_to_T_infile_1; # this file contains both read 1 and read 2 in tab delimited format
369 $fhs[3]->{inputfile_2} = undef; # no longer needed
370 }
371 else{
372 ($C_to_T_infile_1) = biTransformFastQFiles_paired_end ($filename_1,1); # also passing the read number
373 ($G_to_A_infile_2) = biTransformFastQFiles_paired_end ($filename_2,2);
374
375 $fhs[0]->{inputfile_1} = $C_to_T_infile_1;
376 $fhs[0]->{inputfile_2} = $G_to_A_infile_2;
377 $fhs[1]->{inputfile_1} = undef;
378 $fhs[1]->{inputfile_2} = undef;
379 $fhs[2]->{inputfile_1} = undef;
380 $fhs[2]->{inputfile_2} = undef;
381 $fhs[3]->{inputfile_1} = $C_to_T_infile_1;
382 $fhs[3]->{inputfile_2} = $G_to_A_infile_2;
383 }
384 }
385 }
386 elsif($pbat){ # PBAT-Seq. This works for both Bowtie and Bowtie 2
387 ### At the moment we are only performing alignments only with uncompressed FastQ files
388 ($C_to_T_infile_1,$G_to_A_infile_1) = biTransformFastQFiles_paired_end ($filename_1,1); # also passing the read number
389 ($C_to_T_infile_2,$G_to_A_infile_2) = biTransformFastQFiles_paired_end ($filename_2,2);
390
391 $fhs[0]->{inputfile_1} = undef;
392 $fhs[0]->{inputfile_2} = undef;
393 $fhs[1]->{inputfile_1} = $G_to_A_infile_1;
394 $fhs[1]->{inputfile_2} = $C_to_T_infile_2;
395 $fhs[2]->{inputfile_1} = $G_to_A_infile_1;
396 $fhs[2]->{inputfile_2} = $C_to_T_infile_2;
397 $fhs[3]->{inputfile_1} = undef;
398 $fhs[3]->{inputfile_2} = undef;
399 }
400 else{
401 if ($bowtie2){
402 ($C_to_T_infile_1,$G_to_A_infile_1) = biTransformFastQFiles_paired_end ($filename_1,1); # also passing the read number
403 ($C_to_T_infile_2,$G_to_A_infile_2) = biTransformFastQFiles_paired_end ($filename_2,2);
404
405 $fhs[0]->{inputfile_1} = $C_to_T_infile_1;
406 $fhs[0]->{inputfile_2} = $G_to_A_infile_2;
407 $fhs[1]->{inputfile_1} = $G_to_A_infile_1;
408 $fhs[1]->{inputfile_2} = $C_to_T_infile_2;
409 $fhs[2]->{inputfile_1} = $G_to_A_infile_1;
410 $fhs[2]->{inputfile_2} = $C_to_T_infile_2;
411 $fhs[3]->{inputfile_1} = $C_to_T_infile_1;
412 $fhs[3]->{inputfile_2} = $G_to_A_infile_2;
413 }
414 else{ # Bowtie 1 alignments
415 if ($gzip){
416 ($C_to_T_infile_1,$G_to_A_infile_1) = biTransformFastQFiles_paired_end_bowtie1_gzip ($filename_1,$filename_2); # passing both reads at the same time
417
418 $fhs[0]->{inputfile_1} = $C_to_T_infile_1;
419 $fhs[0]->{inputfile_2} = undef; # not needed for compressed temp files
420 $fhs[1]->{inputfile_1} = $G_to_A_infile_1;
421 $fhs[1]->{inputfile_2} = undef;
422 $fhs[2]->{inputfile_1} = $G_to_A_infile_1;
423 $fhs[2]->{inputfile_2} = undef;
424 $fhs[3]->{inputfile_1} = $C_to_T_infile_1;
425 $fhs[3]->{inputfile_2} = undef; # not needed for compressed temp files
426 }
427 else{ # uncompressed temp files
428 ($C_to_T_infile_1,$G_to_A_infile_1) = biTransformFastQFiles_paired_end ($filename_1,1); # also passing the read number
429 ($C_to_T_infile_2,$G_to_A_infile_2) = biTransformFastQFiles_paired_end ($filename_2,2);
430
431 $fhs[0]->{inputfile_1} = $C_to_T_infile_1;
432 $fhs[0]->{inputfile_2} = $G_to_A_infile_2;
433 $fhs[1]->{inputfile_1} = $G_to_A_infile_1;
434 $fhs[1]->{inputfile_2} = $C_to_T_infile_2;
435 $fhs[2]->{inputfile_1} = $G_to_A_infile_1;
436 $fhs[2]->{inputfile_2} = $C_to_T_infile_2;
437 $fhs[3]->{inputfile_1} = $C_to_T_infile_1;
438 $fhs[3]->{inputfile_2} = $G_to_A_infile_2;
439 }
440 }
441 }
442 if ($bowtie2){
443 paired_end_align_fragments_to_bisulfite_genome_fastQ_bowtie2 ($C_to_T_infile_1,$G_to_A_infile_1,$C_to_T_infile_2,$G_to_A_infile_2);
444 }
445 else{
446 paired_end_align_fragments_to_bisulfite_genome_fastQ ($C_to_T_infile_1,$G_to_A_infile_1,$C_to_T_infile_2,$G_to_A_infile_2);
447 }
448 }
449 start_methylation_call_procedure_paired_ends($filename_1,$filename_2,$C_to_T_infile_1,$G_to_A_infile_1,$C_to_T_infile_2,$G_to_A_infile_2,$pid);
450 }
451
452 ### Else we are performing SINGLE-END ALIGNMENTS
453 else{
454 warn "\nSingle-end alignments will be performed\n",'='x39,"\n\n";
455
456 $single_end = 1;
457 $paired_end = 0;
458
459 ### subsetting the input file(s)
460 unless ($multicore == 1){ # not needed in single-core mode
461 # warn "My PID: $pid\nMy offset: $offset\n";
462 if ($sequence_file_format eq 'FASTA'){
463 my $temp_filename = subset_input_file_FastA($filename,$pid,$offset);
464 warn "Using the subset file >${temp_dir}$temp_filename< as new in-file (instead of >$filename<)\n";
465 $filename = "${temp_dir}$temp_filename";
466 }
467 else{ # FastQ format, default
468 my $temp_filename = subset_input_file_FastQ($filename,$pid,$offset);
469 warn "Using the subset file >${temp_dir}$temp_filename< as new in-file (instead of >$filename<)\n";
470 $filename = "${temp_dir}$temp_filename";
471 }
472 }
473
474 ### Initialising bisulfite conversion filenames
475 my ($C_to_T_infile,$G_to_A_infile);
476
477 ### FastA format
478 if ($sequence_file_format eq 'FASTA'){
479 warn "Input file is in FastA format\n";
480 if ($directional){
481 ($C_to_T_infile) = biTransformFastAFiles ($filename);
482 $fhs[0]->{inputfile} = $fhs[1]->{inputfile} = $C_to_T_infile;
483 }
484 else{
485 ($C_to_T_infile,$G_to_A_infile) = biTransformFastAFiles ($filename);
486 $fhs[0]->{inputfile} = $fhs[1]->{inputfile} = $C_to_T_infile;
487 $fhs[2]->{inputfile} = $fhs[3]->{inputfile} = $G_to_A_infile;
488 }
489
490 ### Creating 4 different bowtie filehandles and storing the first entry
491 if ($bowtie2){
492 single_end_align_fragments_to_bisulfite_genome_fastA_bowtie2 ($C_to_T_infile,$G_to_A_infile);
493 }
494 else{
495 single_end_align_fragments_to_bisulfite_genome_fastA ($C_to_T_infile,$G_to_A_infile);
496 }
497 }
498
499 ## FastQ format
500 else{
501 warn "Input file is in FastQ format\n";
502 if ($directional){
503 ($C_to_T_infile) = biTransformFastQFiles ($filename);
504 $fhs[0]->{inputfile} = $fhs[1]->{inputfile} = $C_to_T_infile;
505 }
506 elsif($pbat){
507 ($G_to_A_infile) = biTransformFastQFiles ($filename);
508 $fhs[0]->{inputfile} = $fhs[1]->{inputfile} = $G_to_A_infile; # PBAT-Seq only uses the G to A converted files
509 }
510 else{
511 ($C_to_T_infile,$G_to_A_infile) = biTransformFastQFiles ($filename);
512 $fhs[0]->{inputfile} = $fhs[1]->{inputfile} = $C_to_T_infile;
513 $fhs[2]->{inputfile} = $fhs[3]->{inputfile} = $G_to_A_infile;
514 }
515
516 ### Creating up to 4 different bowtie filehandles and storing the first entry
517 if ($pbat){
518 if ($bowtie2){ # as of version 0.10.2 we also support PBAT alignments for Bowtie 2
519 single_end_align_fragments_to_bisulfite_genome_fastQ_bowtie2 (undef,$G_to_A_infile);
520 }
521 else{
522 single_end_align_fragments_to_bisulfite_genome_fastQ (undef,$G_to_A_infile);
523 }
524 }
525 elsif ($bowtie2){
526 single_end_align_fragments_to_bisulfite_genome_fastQ_bowtie2 ($C_to_T_infile,$G_to_A_infile);
527 }
528 else{
529 single_end_align_fragments_to_bisulfite_genome_fastQ ($C_to_T_infile,$G_to_A_infile);
530 }
531 }
532
533 start_methylation_call_procedure_single_ends($filename,$C_to_T_infile,$G_to_A_infile,$pid);
534
535 }
536
537 ### MERGING AND DELETING TEMP FILES // TIDYING UP AFTER A MULTICORE PROCESS
538
539 if ($pid){ # only performing this for the parent process
540
541 if ($multicore > 1){
542
543 warn "Now waiting for all child processes to complete\n";
544
545 ### we need to ensure that we wait for all child processes to be finished before continuing
546 # warn "here are the child IDs: @pids\n";
547 # warn "Looping through the child process IDs:\n";
548
549 foreach my $id (@pids){
550 # print "$id\t";
551 my $kid = waitpid ($id,0);
552 # print "Returned: $kid\nExit status: $?\n";
553 unless ($? == 0){
554 warn "\nChild process terminated with exit signal: '$?'\n\n";
555 }
556 }
557
558 # regenerating names for temporary files
559 my @temp_input;
560 my @temp_output;
561 my @temp_reports;
562 my @temp_unmapped_1; # will store single end reads or R1 of paired-end
563 my @temp_unmapped_2;
564 my @temp_ambiguous_1; # will store single end reads or R1 of paired-end
565 my @temp_ambiguous_2;
566 my @temp_ambig_bam;
567
568 for (1..$offset){
569
570 # Temp Input Files
571 if ($single_end){
572 if ($gzip){
573 push @temp_input, "${original_filename}.temp.${_}.gz";
574 }
575 else{
576 push @temp_input, "${original_filename}.temp.${_}";
577 }
578
579 }
580 elsif($paired_end){
581 if ($gzip){
582 push @temp_input, "${original_filename_1}.temp.${_}.gz";
583 push @temp_input, "${original_filename_2}.temp.${_}.gz";
584 }
585 else{
586 push @temp_input, "${original_filename_1}.temp.${_}";
587 push @temp_input, "${original_filename_2}.temp.${_}";
588 }
589 }
590
591 # if files had a prefix we need to specify it
592 my $add_prefix;
593 if (defined $prefix){
594 $add_prefix = "${prefix}.";
595 }
596 else{
597 $add_prefix = '';
598 }
599
600 # Temp Output Files
601 if ($single_end){
602
603 if ($bowtie2){
604 if ($gzip){
605 push @temp_output, "${output_dir}${add_prefix}${original_filename}.temp.${_}.gz_bismark_bt2.bam";
606 push @temp_reports, "${output_dir}${add_prefix}${original_filename}.temp.${_}.gz_bismark_bt2_SE_report.txt";
607 push @temp_ambig_bam, "${output_dir}${add_prefix}${original_filename}.temp.${_}.gz_bismark_bt2.ambig.bam"; # only for Bowtie 2
608 }
609 else{
610 push @temp_output, "${output_dir}${add_prefix}${original_filename}.temp.${_}_bismark_bt2.bam";
611 push @temp_reports, "${output_dir}${add_prefix}${original_filename}.temp.${_}_bismark_bt2_SE_report.txt";
612 push @temp_ambig_bam, "${output_dir}${add_prefix}${original_filename}.temp.${_}_bismark_bt2.ambig.bam"; # only for Bowtie 2
613 }
614 }
615 else{
616 if ($gzip){
617 push @temp_output, "${output_dir}${add_prefix}${original_filename}.temp.${_}.gz_bismark.bam";
618 push @temp_reports, "${output_dir}${add_prefix}${original_filename}.temp.${_}.gz_bismark_SE_report.txt";
619 }
620 else{
621 push @temp_output, "${output_dir}${add_prefix}${original_filename}.temp.${_}_bismark.bam";
622 push @temp_reports, "${output_dir}${add_prefix}${original_filename}.temp.${_}_bismark_SE_report.txt";
623 }
624 }
625
626 if ($unmapped){
627 if ($gzip){
628 push @temp_unmapped_1, "${output_dir}${add_prefix}${original_filename}.temp.${_}.gz_unmapped_reads.fq";
629 }
630 else{
631 push @temp_unmapped_1, "${output_dir}${add_prefix}${original_filename}.temp.${_}_unmapped_reads.fq";
632 }
633 }
634
635 if ($ambiguous){
636 if ($gzip){
637 push @temp_ambiguous_1, "${output_dir}${add_prefix}${original_filename}.temp.${_}.gz_ambiguous_reads.fq";
638 }
639 else{
640 push @temp_ambiguous_1, "${output_dir}${add_prefix}${original_filename}.temp.${_}_ambiguous_reads.fq";
641 }
642 }
643
644 }
645 elsif($paired_end){
646 if ($bowtie2){
647 if ($gzip){
648 push @temp_output, "${output_dir}${add_prefix}${original_filename_1}.temp.${_}.gz_bismark_bt2_pe.bam";
649 push @temp_reports, "${output_dir}${add_prefix}${original_filename_1}.temp.${_}.gz_bismark_bt2_PE_report.txt";
650 push @temp_ambig_bam, "${output_dir}${add_prefix}${original_filename_1}.temp.${_}.gz_bismark_bt2_pe.ambig.bam"; # only for Bowtie 2
651 }
652 else{
653 push @temp_output, "${output_dir}${add_prefix}${original_filename_1}.temp.${_}_bismark_bt2_pe.bam";
654 push @temp_reports, "${output_dir}${add_prefix}${original_filename_1}.temp.${_}_bismark_bt2_PE_report.txt";
655 push @temp_ambig_bam, "${output_dir}${add_prefix}${original_filename_1}.temp.${_}_bismark_bt2_pe.ambig.bam"; # only for Bowtie 2
656 }
657 }
658 else{
659 if ($gzip){
660 push @temp_output, "${output_dir}${add_prefix}${original_filename_1}.temp.${_}.gz_bismark_pe.bam";
661 push @temp_reports, "${output_dir}${add_prefix}${original_filename_1}.temp.${_}.gz_bismark_PE_report.txt";
662 }
663 else{
664 push @temp_output, "${output_dir}${add_prefix}${original_filename_1}.temp.${_}_bismark_pe.bam";
665 push @temp_reports, "${output_dir}${add_prefix}${original_filename_1}.temp.${_}_bismark_PE_report.txt";
666 }
667 }
668
669 if ($unmapped){
670 if ($gzip){
671 push @temp_unmapped_1, "${output_dir}${add_prefix}${original_filename_1}.temp.${_}.gz_unmapped_reads_1.fq";
672 push @temp_unmapped_2, "${output_dir}${add_prefix}${original_filename_2}.temp.${_}.gz_unmapped_reads_2.fq";
673 }
674 else{
675 push @temp_unmapped_1, "${output_dir}${add_prefix}${original_filename_1}.temp.${_}_unmapped_reads_1.fq";
676 push @temp_unmapped_2, "${output_dir}${add_prefix}${original_filename_2}.temp.${_}_unmapped_reads_2.fq";
677 }
678 }
679
680 if ($ambiguous){
681 if ($gzip){
682 push @temp_ambiguous_1, "${output_dir}${add_prefix}${original_filename_1}.temp.${_}.gz_ambiguous_reads_1.fq";
683 push @temp_ambiguous_2, "${output_dir}${add_prefix}${original_filename_2}.temp.${_}.gz_ambiguous_reads_2.fq";
684 }
685 else{
686 push @temp_ambiguous_1, "${output_dir}${add_prefix}${original_filename_1}.temp.${_}_ambiguous_reads_1.fq";
687 push @temp_ambiguous_2, "${output_dir}${add_prefix}${original_filename_2}.temp.${_}_ambiguous_reads_2.fq";
688 }
689 }
690
691 }
692 }
693
694 warn "\n\nRight, cleaning up now...\n\n";
695
696 # deleting temp files;
697 warn "Deleting temporary sequence files...\n";
698 foreach my $temp (@temp_input){
699 #print "$temp\t";
700 $temp =~ s/.*\///; # deleting path information
701 print "${temp_dir}${temp}\t";
702 unlink "${temp_dir}${temp}" or warn "Failed to delete temporary FastQ file ${temp_dir}$temp: $!\n";
703 }
704 print "\n\n";
705
706 # merging temp BAM files
707 if ($single_end){
708 merge_individual_BAM_files(\@temp_output,$original_filename,$single_end);
709 }
710 else{
711 merge_individual_BAM_files(\@temp_output,$original_filename_1,$single_end);
712 }
713
714 # deleting temp BAM files
715 warn "Deleting temporary BAM files...\n";
716 foreach my $temp (@temp_output){
717 # print "$temp\t";
718 $temp =~ s/.*\///; # deleting path information
719 print "${output_dir}${temp}\t";
720 unlink "${output_dir}${temp}" or warn "Failed to delete temporary BAM file ${output_dir}${temp}: $!\n";
721 }
722 print "\n\n";
723
724 ### AMBIGUOUS BAM files
725 if ($ambig_bam){
726
727 # merging temp AMBIG BAM files
728 if ($single_end){
729 merge_individual_ambig_BAM_files(\@temp_ambig_bam,$original_filename,$single_end);
730 }
731 else{
732 merge_individual_ambig_BAM_files(\@temp_ambig_bam,$original_filename_1,$single_end);
733 }
734
735 # deleting temp BAM files
736 warn "Deleting temporary ambiguous BAM files...\n";
737 foreach my $temp (@temp_ambig_bam){
738 # print "$temp\t";
739 $temp =~ s/.*\///; # deleting path information
740 print "${output_dir}${temp}\t";
741 unlink "${output_dir}${temp}" or warn "Failed to delete temporary ambiguous BAM file ${output_dir}${temp}: $!\n";
742 }
743 print "\n\n";
744 }
745
746 if ($unmapped){
747 if ($single_end){
748 merge_individual_unmapped_files(\@temp_unmapped_1,$original_filename,$single_end);
749 }
750 else{
751 merge_individual_unmapped_files(\@temp_unmapped_1,$original_filename_1,$single_end,'_1');
752 merge_individual_unmapped_files(\@temp_unmapped_2,$original_filename_2,$single_end,'_2');
753 }
754
755 # deleting temp unmapped files
756 warn "Deleting temporary unmapped files...\n";
757 foreach my $temp (@temp_unmapped_1){
758 print "$temp\t";
759 unlink "${output_dir}${temp}" or warn "Failed to delete temporary unmapped FastQ file ${output_dir}$temp: $!\n";
760 }
761 if ($paired_end){
762 foreach my $temp (@temp_unmapped_2){
763 print "$temp\t";
764 unlink "${output_dir}${temp}" or warn "Failed to delete temporary unmapped FastQ file ${output_dir}$temp: $!\n";
765 }
766 }
767 print "\n\n";
768
769 }
770
771 if ($ambiguous){
772 if ($single_end){
773 merge_individual_ambiguous_files(\@temp_ambiguous_1,$original_filename,$single_end);
774 }
775 else{
776 merge_individual_ambiguous_files(\@temp_ambiguous_1,$original_filename_1,$single_end,'_1');
777 merge_individual_ambiguous_files(\@temp_ambiguous_2,$original_filename_2,$single_end,'_2');
778 }
779
780 # deleting temp ambiguous files
781 warn "Deleting temporary ambiguous files...\n";
782 foreach my $temp (@temp_ambiguous_1){
783 print "$temp\t";
784 unlink "${output_dir}${temp}" or warn "Failed to delete temporary ambiguous FastQ file ${output_dir}$temp: $!\n";
785 }
786
787 if ($paired_end){
788 foreach my $temp (@temp_ambiguous_2){
789 print "$temp\t";
790 unlink "${output_dir}${temp}" or warn "Failed to delete temporary ambiguous FastQ file ${output_dir}$temp: $!\n";
791 }
792 }
793 print "\n\n";
794 }
795
796 # resetting the counters once more so we can add all data from all temporary reports
797 reset_counters_and_fhs($original_filename);
798
799 ### Merging the Bismark mapping report files
800 if ($single_end){
801 merge_individual_mapping_reports(\@temp_reports,$original_filename,$single_end);
802 print_final_analysis_report_single_end('mock_file1','mock_file_2','mock_pid','mergeThis');
803 }
804 else{
805 merge_individual_mapping_reports(\@temp_reports,$original_filename_1,$single_end,$original_filename_2);
806 print_final_analysis_report_paired_ends('mock_file1','mock_file_2','mock_file3','mock_file_4','mock_pid','mergeThis');
807 }
808
809 # deleting temp report files
810 warn "Deleting temporary report files...\n";
811 foreach my $temp (@temp_reports){
812 print "$temp\t";
813 unlink "${output_dir}${temp}" or warn "Failed to delete temporary report file $output_dir$temp: $!\n";
814 }
815 print "\n\n";
816
817 }
818
819 }
820
821 if ($pid){ # only for the Parent
822 warn "\n====================\nBismark run complete\n====================\n\n";
823
824 if ($nucleotide_coverage){
825 warn "Now calculating observed and expected nucleotide coverage statistics... \n\n";
826 if ($final_output_filename =~ /(bam|cram)|/){
827 my @args;
828 push @args, "--genome $genome_folder";
829 push @args, "--dir '$output_dir'";
830 push @args, "--samtools_path $samtools_path";
831 push @args, $final_output_filename;
832 print "@args","\n"; sleep(3);
833
834 system ("$Bin/bam2nuc @args");
835 warn "Finished bam2nuc calculation ...\n\n";
836
837 }
838 else{
839 warn "Nucleotide coverage statistics are currently only available for BAM or CRAM files\n\n";
840 }
841 }
842
843 }
844
845 }
846
847 sub merge_individual_mapping_reports{
848
849 my ($temp_reports,$original_filename_1,$single_end,$original_filename_2) = @_;
850 my $report_file = $original_filename_1;
851 $report_file =~ s/.*\///; # removing path information
852 $report_file =~ s/(\.fastq\.gz|\.fq\.gz|\.fastq|\.fq)$//; # attempting to remove fastq.gz etc to make filename a little shorter
853
854 if ($prefix){
855 $report_file = "${prefix}.${report_file}";
856 }
857
858 if ($basename){ # Output file basename is set using the -B argument
859 $report_file = ${basename};
860 }
861
862 if ($single_end){
863 if ($bowtie2){
864 $report_file .= '_bismark_bt2_SE_report.txt';
865 }
866 else{
867 $report_file .= '_bismark_SE_report.txt';
868 }
869 }
870 else{
871 if ($bowtie2){
872 $report_file .= '_bismark_bt2_PE_report.txt';
873 }
874 else{
875 $report_file .= '_bismark_PE_report.txt';
876 }
877 }
878 warn "Writing report to ${output_dir}${report_file}\n";
879 open (REPORT,'>',"$output_dir$report_file") or die "Failed to write to ${output_dir}${report_file}: $!\n";
880
881 foreach my $temp(@$temp_reports){
882 $temp =~ s/.*\///; # removing path information
883 }
884
885 warn "Now merging temporary reports @$temp_reports into >>> ${output_dir}${report_file} <<<\n";
886
887 if ($single_end){
888 print REPORT "Bismark report for: $original_filename_1 (version: $bismark_version)\n";
889 }
890 else{ # paired-end
891 print REPORT "Bismark report for: $original_filename_1 and $original_filename_2 (version: $bismark_version)\n";
892 }
893
894
895 my $first = 0;
896
897 foreach my $temp(@$temp_reports){
898 # $temp =~ s/.*\///; # removing path information
899
900 warn "Merging from file >> $temp <<\n";
901 open (IN,"${output_dir}${temp}") or die "Failed to read from temporary mapping report '${output_dir}${temp}'\n";
902
903 ### this is printing the first couple of lines
904 while (<IN>){
905 chomp;
906 if ($_ =~ /^Bismark report/){
907 next;
908 }
909
910 unless ($first){ # only happens for the first run we are processing
911 if ($_ =~ /^Final Alignment/){
912 ++$first;
913 last;
914 }
915 else{
916 print REPORT "$_\n";
917 }
918 }
919 }
920 close IN or warn "Failed to close filehandle\n";
921
922 ### Simon says: You are going to regret this in the future. Just for the record. He might be right...
923 read_alignment_report($temp,$single_end);
924
925 }
926 warn "\n";
927
928 }
929
930 sub read_alignment_report{
931 my ($report,$single_end) = @_;
932
933 my $unique;
934 my $no_aln;
935 my $multiple;
936 my $no_genomic;
937 my $total_seqs;
938 my $bismark_version;
939 my $input_filename;
940
941 my $unique_text;
942 my $no_aln_text;
943 my $multiple_text;
944 my $total_seq_text;
945
946 my $total_C_count;
947 my ($meth_CpG,$meth_CHG,$meth_CHH,$meth_unknown);
948 my ($unmeth_CpG,$unmeth_CHG,$unmeth_CHH,$unmeth_unknown);
949
950 my $number_OT;
951 my $number_CTOT;
952 my $number_CTOB;
953 my $number_OB;
954
955 open (ALN,"${output_dir}${report}") or die "Failed to read from temporary mapping report '$output_dir$report'\n";
956
957 while (<ALN>){
958 chomp;
959
960 ### General Alignment stats
961 if ($_ =~ /^Sequence pairs analysed in total:/ ){ ## Paired-end
962 (undef,$total_seqs) = split /\t/;
963 # warn "Total paired seqs: >> $total_seqs <<\n";
964 }
965 elsif ($_ =~ /^Sequences analysed in total:/ ){ ## Single-end
966 (undef,$total_seqs) = split /\t/;
967 # warn "total single-end seqs >> $total_seqs <<\n";
968 }
969
970 elsif($_ =~ /^Number of paired-end alignments with a unique best hit:/){ ## Paired-end
971 (undef,$unique) = split /\t/;
972 # warn "Unique PE>> $unique <<\n";
973 }
974 elsif($_ =~ /^Number of alignments with a unique best hit from/){ ## Single-end
975 (undef,$unique) = split /\t/;
976 # warn "Unique SE>> $unique <<\n";
977 }
978
979 elsif($_ =~ /^Sequence pairs with no alignments under any condition:/){ ## Paired-end
980 (undef,$no_aln) = split /\t/;
981 # warn "No alignment PE >> $no_aln <<\n";
982 }
983 elsif($_ =~ /^Sequences with no alignments under any condition:/){ ## Single-end
984 (undef,$no_aln) = split /\t/;
985 # warn "No alignments SE>> $no_aln <<\n";
986 }
987
988 elsif($_ =~ /^Sequence pairs did not map uniquely:/){ ## Paired-end
989 (undef,$multiple) = split /\t/;
990 # warn "Multiple alignments PE >> $multiple <<\n";
991 }
992 elsif($_ =~ /^Sequences did not map uniquely:/){ ## Single-end
993 (undef,$multiple) = split /\t/;
994 # warn "Multiple alignments SE >> $multiple <<\n";
995 }
996
997 elsif($_ =~ /^Sequence pairs which were discarded because genomic sequence could not be extracted:/){ ## Paired-end
998 (undef,$no_genomic) = split /\t/;
999 # warn "No genomic sequence PE >> $no_genomic <<\n";
1000 }
1001 elsif($_ =~ /^Sequences which were discarded because genomic sequence could not be extracted:/){ ## Single-end
1002 (undef,$no_genomic) = split /\t/;
1003 # warn "No genomic sequence SE>> $no_genomic <<\n";
1004 }
1005
1006 ### Context Methylation
1007 elsif($_ =~ /^Total number of C/ ){
1008 (undef,$total_C_count) = split /\t/;
1009 # warn "Total number C >> $total_C_count <<\n";
1010 }
1011
1012 elsif($_ =~ /^Total methylated C\'s in CpG context:/ ){
1013 (undef,$meth_CpG) = split /\t/;
1014 # warn "meth CpG >> $meth_CpG <<\n" ;
1015 }
1016 elsif($_ =~ /^Total methylated C\'s in CHG context:/ ){
1017 (undef,$meth_CHG) = split /\t/;
1018 # warn "meth CHG >> $meth_CHG <<\n" ;
1019 }
1020 elsif($_ =~ /^Total methylated C\'s in CHH context:/ ){
1021 (undef,$meth_CHH) = split /\t/;
1022 # warn "meth CHH >> $meth_CHH <<\n" ;
1023 }
1024 elsif($_ =~ /^Total methylated C\'s in Unknown context:/ ){
1025 (undef,$meth_unknown) = split /\t/;
1026 # warn "meth Unknown >> $meth_unknown <<\n" ;
1027 }
1028
1029 elsif($_ =~ /^Total unmethylated C\'s in CpG context:/ or $_ =~ /^Total C to T conversions in CpG context:/){
1030 (undef,$unmeth_CpG) = split /\t/;
1031 # warn "unmeth CpG >> $unmeth_CpG <<\n" ;
1032 }
1033 elsif($_ =~ /^Total unmethylated C\'s in CHG context:/ or $_ =~ /^Total C to T conversions in CHG context:/){
1034 (undef,$unmeth_CHG) = split /\t/;
1035 # warn "unmeth CHG >> $unmeth_CHG <<\n" ;
1036 }
1037 elsif($_ =~ /^Total unmethylated C\'s in CHH context:/ or $_ =~ /^Total C to T conversions in CHH context:/){
1038 (undef,$unmeth_CHH) = split /\t/;
1039 # warn "unmeth CHH >> $unmeth_CHH <<\n";
1040 }
1041 elsif($_ =~ /^Total unmethylated C\'s in Unknown context:/ or $_ =~ /^Total C to T conversions in Unknown context:/){
1042 (undef,$unmeth_unknown) = split /\t/;
1043 # warn "unmeth Unknown >> $unmeth_unknown <<\n" ;
1044 }
1045
1046 ### Strand Origin
1047
1048 elsif($_ =~ /^CT\/GA\/CT:/ ){ ## Paired-end
1049 (undef,$number_OT) = split /\t/;
1050 # warn "Number OT PE>> $number_OT <<\n" ;
1051 }
1052 elsif($_ =~ /^CT\/CT:/ ){ ## Single-end
1053 (undef,$number_OT) = split /\t/;
1054 # warn "Number OT SE>> $number_OT <<\n" ;
1055 }
1056
1057 elsif($_ =~ /^GA\/CT\/CT:/ ){ ## Paired-end
1058 (undef,$number_CTOT) = split /\t/;
1059 # warn "Number CTOT PE >> $number_CTOT <<\n" ;
1060 }
1061 elsif($_ =~ /^GA\/CT:/ ){ ## Single-end
1062 (undef,$number_CTOT) = split /\t/;
1063 # warn "Number CTOT SE >> $number_CTOT <<\n" ;
1064 }
1065
1066 elsif($_ =~ /^GA\/CT\/GA:/ ){ ## Paired-end
1067 (undef,$number_CTOB) = split /\t/;
1068 # warn "Number CTOB PE >> $number_CTOB <<\n" ;
1069 }
1070 elsif($_ =~ /^GA\/GA:/ ){ ## Single-end
1071 (undef,$number_CTOB) = split /\t/;
1072 # warn "Number CTOB SE >> $number_CTOB <<\n";
1073 }
1074
1075 elsif($_ =~ /^CT\/GA\/GA:/ ){ ## Paired-end
1076 (undef,$number_OB) = split /\t/;
1077 # warn "Number OB PE >> $number_OB <<\n";
1078 }
1079 elsif($_ =~ /^CT\/GA:/ ){ ## Single-end
1080 (undef,$number_OB) = split /\t/;
1081 # warn "Number OB SE >> $number_OB <<\n";
1082 }
1083 }
1084
1085 $counting{sequences_count} += $total_seqs;
1086 $counting{unique_best_alignment_count} += $unique;
1087 $counting{no_single_alignment_found} += $no_aln;
1088 $counting{unsuitable_sequence_count} += $multiple;
1089 $counting{genomic_sequence_could_not_be_extracted_count} += $no_genomic;
1090
1091 $counting{total_meCHH_count} += $meth_CHH;
1092 $counting{total_meCHG_count} += $meth_CHG;
1093 $counting{total_meCpG_count} += $meth_CpG;
1094 if ($bowtie2){
1095 $counting{total_meC_unknown_count} += $meth_unknown;
1096 }
1097
1098 $counting{total_unmethylated_CHH_count} += $unmeth_CHH;
1099 $counting{total_unmethylated_CHG_count} += $unmeth_CHG;
1100 $counting{total_unmethylated_CpG_count} += $unmeth_CpG;
1101 if ($bowtie2){
1102 $counting{total_unmethylated_C_unknown_count} += $unmeth_unknown;
1103 }
1104
1105 if ($single_end){
1106 $counting{CT_CT_count} += $number_OT;
1107 $counting{CT_GA_count} += $number_OB;
1108 $counting{GA_CT_count} += $number_CTOT;
1109 $counting{GA_GA_count} += $number_CTOB;
1110 }
1111 else{
1112 # paired-end
1113 $counting{GA_CT_CT_count} += $number_CTOT;
1114 $counting{CT_GA_CT_count} += $number_OT;
1115 $counting{GA_CT_GA_count} += $number_CTOB;
1116 $counting{CT_GA_GA_count} += $number_OB;
1117 }
1118 }
1119
1120 sub merge_individual_ambiguous_files{
1121
1122 my ($temp_ambiguous,$original_filename,$single_end,$paired_information) = @_;
1123 my $ambiguous_file = $original_filename;
1124 $ambiguous_file =~ s/.*\///; # removing path information
1125
1126 if ($prefix){
1127 $ambiguous_file = "${prefix}.${ambiguous_file}";
1128 }
1129
1130 if ($single_end){
1131
1132 if ($basename){ # Output file basename is set using the -B argument
1133 if ($sequence_file_format eq 'FASTQ'){
1134 $ambiguous_file = "${basename}_ambiguous_reads.fq.gz";
1135 }
1136 else{
1137 $ambiguous_file = "${basename}_ambiguous_reads.fa.gz";
1138 }
1139 }
1140 else{
1141 if ($sequence_file_format eq 'FASTQ'){
1142 $ambiguous_file =~ s/$/_ambiguous_reads.fq.gz/;
1143 }
1144 else{
1145 $ambiguous_file =~ s/$/_ambiguous_reads.fa.gz/;
1146 }
1147 }
1148 }
1149 else{ # paired-end
1150
1151 if ($basename){ # Output file basename is set using the -B argument
1152 if ($sequence_file_format eq 'FASTQ'){
1153 $ambiguous_file = "${basename}_ambiguous_reads${paired_information}.fq.gz";
1154 }
1155 else{
1156 $ambiguous_file = "${basename}_ambiguous_reads${paired_information}.fa.gz";
1157 }
1158 }
1159 else{
1160 if ($sequence_file_format eq 'FASTQ'){
1161 $ambiguous_file =~ s/$/_ambiguous_reads${paired_information}.fq.gz/;
1162 }
1163 else{
1164 $ambiguous_file =~ s/$/_ambiguous_reads${paired_information}.fa.gz/;
1165 }
1166 }
1167 }
1168
1169 foreach my $temp(@$temp_ambiguous){
1170 $temp =~ s/.*\///; # removing path information
1171 }
1172
1173 open (AMBIGUOUS,"| gzip -c - > $output_dir$ambiguous_file") or die "Failed to write to $ambiguous_file: $!\n";
1174 warn "Now merging ambiguous sequences @$temp_ambiguous into >>> $output_dir$ambiguous_file <<<\n";
1175
1176 foreach my $temp(@$temp_ambiguous){
1177 warn "Merging from file >> $temp <<\n";
1178 if ($temp =~ /gz$/){
1179 open (IN,"gunzip -c ${output_dir}$temp |") or die "Failed to read from ambiguous temp file '${output_dir}$temp'\n";
1180 }
1181 else{
1182 open (IN,"${output_dir}$temp") or die "Failed to read from ambiguous temp file '${output_dir}$temp'\n";
1183 }
1184
1185 while (<IN>){
1186 print AMBIGUOUS;
1187 }
1188 close IN or warn "Failed to close filehandle\n";
1189 }
1190 warn "\n";
1191
1192 close AMBIGUOUS or warn "Failed to close output filehandle AMBIGUOUS\n\n";
1193 }
1194
1195
1196 sub merge_individual_unmapped_files{
1197
1198 my ($temp_unmapped,$original_filename,$single_end,$paired_information) = @_;
1199 my $unmapped_file = $original_filename;
1200 $unmapped_file =~ s/.*\///; # removing path information
1201
1202 if ($prefix){
1203 $unmapped_file = "${prefix}.${unmapped_file}";
1204 }
1205
1206 if ($single_end){
1207
1208 if ($basename){ # Output file basename is set using the -B argument
1209 if ($sequence_file_format eq 'FASTQ'){
1210 $unmapped_file = "${basename}_unmapped_reads.fq.gz";
1211 }
1212 else{
1213 $unmapped_file = "${basename}_unmapped_reads.fa.gz";
1214 }
1215 }
1216 else{
1217 if ($sequence_file_format eq 'FASTQ'){
1218 $unmapped_file =~ s/$/_unmapped_reads.fq.gz/;
1219 }
1220 else{
1221 $unmapped_file =~ s/$/_unmapped_reads.fa.gz/;
1222 }
1223 }
1224 }
1225 else{ # paired-end
1226
1227 if ($basename){ # Output file basename is set using the -B argument
1228 if ($sequence_file_format eq 'FASTQ'){
1229 $unmapped_file = "${basename}_unmapped_reads${paired_information}.fq.gz";
1230 }
1231 else{
1232 $unmapped_file = "${basename}_unmapped_reads${paired_information}.fa.gz";
1233 }
1234 }
1235 else{
1236 if ($sequence_file_format eq 'FASTQ'){
1237 $unmapped_file =~ s/$/_unmapped_reads${paired_information}.fq.gz/;
1238 }
1239 else{
1240 $unmapped_file =~ s/$/_unmapped_reads${paired_information}.fa.gz/;
1241 }
1242 }
1243 }
1244
1245 foreach my $temp(@$temp_unmapped){
1246 $temp =~ s/.*\///; # removing path information
1247 }
1248
1249 open (UNMAPPED,"| gzip -c - > ${output_dir}${unmapped_file}") or die "Failed to write to ${output_dir}${unmapped_file}: $!\n";
1250 warn "Now merging unmapped sequences @$temp_unmapped into >>> ${output_dir}${unmapped_file} <<<\n";
1251
1252 foreach my $temp(@$temp_unmapped){
1253 warn "Merging from file >> $temp <<\n";
1254 if ($temp =~ /gz$/){
1255 open (IN,"gunzip -c ${output_dir}${temp} |") or die "Failed to read from unmapped temp file '${output_dir}$temp'\n";
1256 }
1257 else{
1258 open (IN,"${output_dir}${temp}") or die "Failed to read from unmapped temp file '${output_dir}${temp}'\n";
1259 }
1260
1261 while (<IN>){
1262 print UNMAPPED;
1263 }
1264 close IN or warn "Failed to close filehandle\n";
1265 }
1266 warn "\n";
1267
1268 close UNMAPPED or warn "Failed to close output filehandle UNMAPPED\n\n";
1269 }
1270
1271
1272 sub merge_individual_BAM_files{
1273
1274 my ($tempbam,$original_filename,$single_end) = @_;
1275 my $merged_name = $original_filename;
1276
1277 #warn "merged name is: $merged_name\n";
1278 $merged_name =~ s/.*\///; # deleting path information
1279 # warn "merged name is: $merged_name\n";
1280 $merged_name =~ s/(\.fastq\.gz|\.fq\.gz|\.fastq|\.fq)$//; # attempting to remove fastq.gz etc to make filename a little shorter
1281 # warn "merged name is: $merged_name\n"; sleep(5);
1282
1283 foreach my $temp_bam(@$tempbam){
1284 $temp_bam =~ s/.*\///; # deleting path information
1285 }
1286
1287 if ($prefix){
1288 $merged_name = "$prefix.$merged_name";
1289 }
1290
1291 if ($single_end){
1292 if ($bowtie2){ # BAM format is the default for Bowtie 2
1293 $merged_name .= '_bismark_bt2.bam';
1294 }
1295 else{ # BAM is the default output
1296 $merged_name .= '_bismark.bam';
1297 }
1298
1299 if ($basename){ # Output file basename is set using the -B argument
1300 $merged_name = "${basename}.bam";
1301 }
1302 }
1303 else{
1304 if ($bowtie2){ # BAM format is the default for Bowtie 2
1305 $merged_name .= '_bismark_bt2_pe.bam';
1306 }
1307 else{ # BAM is the default output
1308 $merged_name .= '_bismark_pe.bam';
1309 }
1310
1311 if ($basename){ # Output file basename is set using the -B argument
1312 $merged_name = "${basename}_pe.bam";
1313 }
1314 }
1315
1316
1317 if ($cram){
1318 $merged_name =~ s/bam$/cram/;
1319 warn "At this stage we write out a single CRAM file and delete all temporary BAM files\n";
1320 warn "Now merging BAM files @$tempbam into >>> $merged_name <<<\n";
1321 $final_output_filename = "${output_dir}${merged_name}";
1322
1323 open (OUT,"| $samtools_path view -h -C -T $cram_ref 2>/dev/null - > ${output_dir}${merged_name}") or die "Failed to write to CRAM file $merged_name: $!\nPlease note that this option requires Samtools version 1.2 or higher!\n\n";
1324 }
1325 else{
1326 $final_output_filename = "${output_dir}${merged_name}";
1327 warn "Now merging BAM files @$tempbam into >>> $merged_name <<<\n";
1328 open (OUT,"| $samtools_path view -bSh 2>/dev/null - > ${output_dir}${merged_name}") or die "Failed to write to $merged_name: $!\n";
1329 }
1330
1331 my $first = 0;
1332
1333 foreach my $temp_bam(@$tempbam){
1334 # $temp_bam =~ s/.*\///; # deleting path information
1335
1336 warn "Merging from file >> $temp_bam <<\n";
1337
1338 if ($first > 0){
1339 open (IN,"$samtools_path view ${output_dir}${temp_bam} |") or die "Failed to read from BAM file ${output_dir}${temp_bam}\n";
1340 }
1341 else{ # only for the first file we print the header as well
1342 open (IN,"$samtools_path view -h ${output_dir}${temp_bam} |") or die "Failed to read from BAM file ${output_dir}${temp_bam}\n";
1343 }
1344
1345 while (<IN>){
1346 print OUT;
1347 }
1348 close IN or warn "Failed to close filehandle\n";
1349 ++$first;
1350 }
1351 warn "\n";
1352
1353 close OUT or warn "Failed to close output filehandle\n\n";
1354
1355 }
1356
1357
1358 sub merge_individual_ambig_BAM_files{
1359
1360 my ($tempbam,$original_filename,$single_end) = @_;
1361 my $merged_name = $original_filename;
1362
1363 # warn "merged name is: $merged_name\n";
1364 $merged_name =~ s/.*\///; # deleting path information
1365 # warn "merged name is: $merged_name\n"; sleep(1);
1366
1367 foreach my $temp_bam(@$tempbam){
1368 $temp_bam =~ s/.*\///; # deleting path information
1369 }
1370
1371 if ($prefix){
1372 $merged_name = "$prefix.$merged_name";
1373 }
1374
1375 if ($single_end){
1376 if ($bowtie2){ # BAM format is the default for Bowtie 2
1377 $merged_name .= '_bismark_bt2.ambig.bam';
1378 }
1379
1380 if ($basename){ # Output file basename is set using the -B argument
1381 $merged_name = "${basename}.ambig.bam";
1382 }
1383 }
1384 else{
1385 if ($bowtie2){ # BAM format is the default for Bowtie 2
1386 $merged_name .= '_bismark_bt2_pe.ambig.bam';
1387 }
1388
1389 if ($basename){ # Output file basename is set using the -B argument
1390 $merged_name = "${basename}_pe.ambig.bam";
1391 }
1392 }
1393
1394 warn "Now merging ambiguous BAM files @$tempbam into >>> $merged_name <<<\n";
1395 open (OUT,"| $samtools_path view -bSh 2>/dev/null - > ${output_dir}${merged_name}") or die "Failed to write to $merged_name: $!\n";
1396 my $first = 0;
1397
1398 foreach my $temp_bam(@$tempbam){
1399 # $temp_bam =~ s/.*\///; # deleting path information
1400
1401 warn "Merging from file >> $temp_bam <<\n";
1402
1403 if ($first > 0){
1404 open (IN,"$samtools_path view ${output_dir}${temp_bam} |") or die "Failed to read from BAM file ${output_dir}${temp_bam}\n";
1405 }
1406 else{ # only for the first file we print the header as well
1407 open (IN,"$samtools_path view -h ${output_dir}${temp_bam} |") or die "Failed to read from BAM file ${output_dir}${temp_bam}\n";
1408 }
1409
1410 while (<IN>){
1411 print OUT;
1412 }
1413 close IN or warn "Failed to close filehandle\n";
1414 ++$first;
1415 }
1416 warn "\n";
1417
1418 close OUT or warn "Failed to close output filehandle\n\n";
1419 }
1420
1421 sub start_methylation_call_procedure_single_ends {
1422 my ($sequence_file,$C_to_T_infile,$G_to_A_infile,$pid) = @_;
1423 my ($dir,$filename);
1424
1425 if ($sequence_file =~ /\//){
1426 ($dir,$filename) = $sequence_file =~ m/(.*\/)(.*)$/;
1427 }
1428 else{
1429 $filename = $sequence_file;
1430 }
1431
1432 ### printing all alignments to a results file
1433 my $outfile = $filename;
1434 # warn "Outfile: $outfile\n";
1435 $outfile =~ s/(\.fastq\.gz|\.fq\.gz|\.fastq|\.fq)$//; # attempting to remove fastq.gz etc to make filename a little shorter
1436 # warn "Outfile: $outfile\n";sleep(5);
1437
1438 if ($prefix){
1439 $outfile = "$prefix.$outfile";
1440 }
1441 if ($bowtie2){ # SAM format is the default for Bowtie 2
1442 $outfile =~ s/$/_bismark_bt2.sam/;
1443 }
1444 elsif ($vanilla){ # vanilla custom Bismark output single-end output (like Bismark versions 0.5.X)
1445 $outfile =~ s/$/_bismark.txt/;
1446 }
1447 else{ # SAM is the default output
1448 $outfile =~ s/$/_bismark.sam/;
1449 }
1450
1451 if ($basename){ # Output file basename is set using the -B argument
1452 $outfile = "${basename}.sam";
1453 }
1454
1455 $bam = 0 unless (defined $bam);
1456
1457 if ($ambig_bam){
1458 my $ambig_bam_out = $outfile;
1459 $ambig_bam_out =~ s/sam$/ambig.bam/;
1460 warn "Ambiguous BAM output: $ambig_bam_out\n";
1461 open (AMBIBAM,"| $samtools_path view -bSh 2>/dev/null - > $output_dir$ambig_bam_out") or die "Failed to write to $ambig_bam_out: $!\n";
1462 }
1463
1464 if ($cram){ ### Samtools is installed, writing out CRAM directly. This qill require Samtools version 1.2 or higher!
1465 ### for multicore processing we write out BAM files by default and merge them together as a single CRAM file in the merging step later on.
1466 ### This avoids having to change all the the file endings on the way
1467 if($multicore > 1){
1468 $outfile =~ s/sam$/bam/;
1469 open (OUT,"| $samtools_path view -bSh 2>/dev/null - > $output_dir$outfile") or die "Failed to write to $outfile: $!\n";
1470 }
1471 else{ # single-core mode
1472 $outfile =~ s/sam$/cram/;
1473 $final_output_filename = "${output_dir}${outfile}";
1474 open (OUT,"| $samtools_path view -h -C -T $cram_ref 2>/dev/null - > $output_dir$outfile") or die "Failed to write to CRAM file $outfile: $!\nPlease note that this option requires Samtools version 1.2 or higher!\n\n";
1475 }
1476 }
1477 elsif($bam == 1){ ### Samtools is installed, writing out BAM directly
1478 $outfile =~ s/sam$/bam/;
1479 $final_output_filename = "${output_dir}${outfile}";
1480 open (OUT,"| $samtools_path view -bSh 2>/dev/null - > $output_dir$outfile") or die "Failed to write to $outfile: $!\n";
1481 }
1482 elsif($bam == 2){ ### no Samtools found on system. Using GZIP compression instead
1483 $outfile .= '.gz';
1484 open (OUT,"| gzip -c - > $output_dir$outfile") or die "Failed to write to $outfile: $!\n";
1485 }
1486 else{ # uncompressed ouput, default
1487 open (OUT,'>',"$output_dir$outfile") or die "Failed to write to $outfile: $!\n";
1488 }
1489 warn "\n>>> Writing bisulfite mapping results to $output_dir$outfile <<<\n\n";
1490
1491
1492 sleep(1);
1493
1494 if ($vanilla){
1495 print OUT "Bismark version: $bismark_version\n";
1496 }
1497
1498 ### printing alignment and methylation call summary to a report file
1499 my $reportfile = $filename;
1500 $reportfile =~ s/(\.fastq\.gz|\.fq\.gz|\.fastq|\.fq)$//; # attempting to remove fastq.gz etc to make filename a little shorter
1501
1502 if ($prefix){
1503 $reportfile = "$prefix.$reportfile";
1504 }
1505 if ($bowtie2){
1506 $reportfile =~ s/$/_bismark_bt2_SE_report.txt/;
1507 }
1508 else{
1509 $reportfile =~ s/$/_bismark_SE_report.txt/;
1510 }
1511
1512 if ($basename){ # Output file basename is set using the -B argument
1513 $reportfile = "${basename}_SE_report.txt";
1514 }
1515
1516 open (REPORT,'>',"$output_dir$reportfile") or die "Failed to write to $reportfile: $!\n";
1517 print REPORT "Bismark report for: $sequence_file (version: $bismark_version)\n";
1518
1519 if ($unmapped){
1520 my $unmapped_file = $filename;
1521 if ($prefix){
1522 $unmapped_file = "$prefix.$unmapped_file";
1523 }
1524
1525 if ($basename){ # Output file basename is set using the -B argument
1526 if ($sequence_file_format eq 'FASTQ'){
1527 $unmapped_file = "${basename}_unmapped_reads.fq";
1528 }
1529 else{
1530 $unmapped_file = "${basename}_unmapped_reads.fa";
1531 }
1532 }
1533 else{
1534 if ($sequence_file_format eq 'FASTQ'){
1535 $unmapped_file =~ s/$/_unmapped_reads.fq/;
1536 }
1537 else{
1538 $unmapped_file =~ s/$/_unmapped_reads.fa/;
1539 }
1540 }
1541
1542 if ($multicore > 1){ # multicore runs already output gzipped unmapped files
1543 open (UNMAPPED,'>',"$output_dir$unmapped_file") or die "Failed to write to $unmapped_file: $!\n";
1544 }
1545 else{
1546 $unmapped_file .= '.gz';
1547 open (UNMAPPED,"| gzip -c - > $output_dir$unmapped_file") or die "Failed to write to $unmapped_file: $!\n";
1548 }
1549 warn "Unmapped sequences will be written to $output_dir$unmapped_file\n";
1550 }
1551
1552 if ($ambiguous){
1553 my $ambiguous_file = $filename;
1554
1555 if ($prefix){
1556 $ambiguous_file = "$prefix.$ambiguous_file";
1557 }
1558
1559 if ($basename){ # Output file basename is set using the -B argument
1560 if ($sequence_file_format eq 'FASTQ'){
1561 $ambiguous_file = "${basename}_ambiguous_reads.fq";
1562 }
1563 else{
1564 $ambiguous_file = "${basename}_ambiguous_reads.fa";
1565 }
1566 }
1567 else{
1568 if ($sequence_file_format eq 'FASTQ'){
1569 $ambiguous_file =~ s/$/_ambiguous_reads.fq/;
1570 }
1571 else{
1572 $ambiguous_file =~ s/$/_ambiguous_reads.fa/;
1573 }
1574 }
1575
1576 if ($multicore > 1){ # multicore runs already output gzipped amobiguous files
1577 open (AMBIG,'>',"$output_dir$ambiguous_file") or die "Failed to write to $ambiguous_file: $!\n";
1578 }
1579 else{
1580 $ambiguous_file .= '.gz';
1581 open (AMBIG,"| gzip -c - > $output_dir$ambiguous_file") or die "Failed to write to $ambiguous_file: $!\n";
1582 }
1583 warn "Ambiguously mapping sequences will be written to $output_dir$ambiguous_file\n";
1584 }
1585
1586 if ($directional){
1587 print REPORT "Option '--directional' specified (default mode): alignments to complementary strands (CTOT, CTOB) were ignored (i.e. not performed)\n";
1588 }
1589 elsif ($pbat){
1590 print REPORT "Option '--pbat' specified: alignments to original strands (OT and OB) strands were ignored (i.e. not performed)\n";
1591 }
1592 else{
1593 print REPORT "Option '--non_directional' specified: alignments to all strands were being performed (OT, OB, CTOT, CTOB)\n";
1594 }
1595
1596 if ($bowtie2){
1597 print REPORT "Bismark was run with Bowtie 2 against the bisulfite genome of $genome_folder with the specified options: $bowtie_options\n\n";
1598 }
1599 else{
1600 print REPORT "Bismark was run with Bowtie against the bisulfite genome of $genome_folder with the specified options: $bowtie_options\n\n";
1601 }
1602
1603
1604 unless ($vanilla or $sam_no_hd){
1605 generate_SAM_header();
1606 }
1607
1608 ### Input file is in FastA format
1609 if ($sequence_file_format eq 'FASTA'){
1610 process_single_end_fastA_file_for_methylation_call($sequence_file,$C_to_T_infile,$G_to_A_infile,$pid);
1611 }
1612 ### Input file is in FastQ format
1613 else{
1614 process_single_end_fastQ_file_for_methylation_call($sequence_file,$C_to_T_infile,$G_to_A_infile,$pid);
1615 }
1616 }
1617
1618 sub start_methylation_call_procedure_paired_ends {
1619 my ($sequence_file_1,$sequence_file_2,$C_to_T_infile_1,$G_to_A_infile_1,$C_to_T_infile_2,$G_to_A_infile_2,$pid) = @_;
1620 my ($dir_1,$filename_1);
1621
1622 if ($sequence_file_1 =~ /\//){
1623 ($dir_1,$filename_1) = $sequence_file_1 =~ m/(.*\/)(.*)$/;
1624 }
1625 else{
1626 $filename_1 = $sequence_file_1;
1627 }
1628
1629 my ($dir_2,$filename_2);
1630
1631 if ($sequence_file_2 =~ /\//){
1632 ($dir_2,$filename_2) = $sequence_file_2 =~ m/(.*\/)(.*)$/;
1633 }
1634 else{
1635 $filename_2 = $sequence_file_2;
1636 }
1637
1638 ### printing all alignments to a results file
1639 my $outfile = $filename_1;
1640 # warn "Outfile: $outfile\n";
1641 $outfile =~ s/(\.fastq\.gz|\.fq\.gz|\.fastq|\.fq)$//; # attempting to remove fastq.gz etc to make filename a little shorter
1642 # warn "Outfile: $outfile\n";sleep(5);
1643
1644 if ($prefix){
1645 $outfile = "$prefix.$outfile";
1646 }
1647 if ($bowtie2){ # SAM format is the default Bowtie 2 output
1648 $outfile =~ s/$/_bismark_bt2_pe.sam/;
1649 }
1650 elsif ($vanilla){ # vanilla custom Bismark paired-end output (like Bismark versions 0.5.X)
1651 $outfile =~ s/$/_bismark_pe.txt/;
1652 }
1653 else{ # SAM format is the default Bowtie 1 output
1654 $outfile =~ s/$/_bismark_pe.sam/;
1655 }
1656
1657
1658 if ($basename){ # Output file basename is set using the -B argument
1659 $outfile = "${basename}_pe.sam";
1660 }
1661
1662 if ($ambig_bam){
1663 my $ambig_bam_out = $outfile;
1664 $ambig_bam_out =~ s/sam$/ambig.bam/;
1665 warn "Ambiguous BAM output: $ambig_bam_out\n";
1666 open (AMBIBAM,"| $samtools_path view -bSh 2>/dev/null - > $output_dir$ambig_bam_out") or die "Failed to write to $ambig_bam_out: $!\n";
1667 }
1668
1669 $bam = 0 unless (defined $bam);
1670
1671 if ($cram){ ### Samtools is installed, writing out CRAM directly. This qill require Samtools version 1.2 or higher!
1672 if ($multicore > 1){
1673 $outfile =~ s/sam$/bam/;
1674 open (OUT,"| $samtools_path view -bSh 2>/dev/null - > $output_dir$outfile") or die "Failed to write to $outfile: $!\n";
1675 }
1676 else{ # single-core mode
1677 $outfile =~ s/sam$/cram/;
1678 $final_output_filename = "${output_dir}${outfile}";
1679 open (OUT,"| $samtools_path view -h -C -T $cram_ref 2>/dev/null - > $output_dir$outfile") or die "Failed to write to CRAM file $outfile: $!\nPlease note that this option requires Samtools version 1.2 or higher!\n\n";
1680 }
1681 }
1682 elsif ($bam == 1){ ### Samtools is installed, writing out BAM directly
1683 $outfile =~ s/sam$/bam/;
1684 $final_output_filename = "${output_dir}${outfile}";
1685 open (OUT,"| $samtools_path view -bSh 2>/dev/null - > $output_dir$outfile") or die "Failed to write to $outfile: $!\n";
1686 }
1687 elsif($bam == 2){ ### no Samtools found on system. Using GZIP compression instead
1688 $outfile .= '.gz';
1689 open (OUT,"| gzip -c - > $output_dir$outfile") or die "Failed to write to $outfile: $!\n";
1690 }
1691 else{ # uncompressed ouput, default
1692 open (OUT,'>',"$output_dir$outfile") or die "Failed to write to $outfile: $!\n";
1693 }
1694
1695 warn "\n>>> Writing bisulfite mapping results to $outfile <<<\n\n";
1696 sleep(1);
1697
1698 if ($vanilla){
1699 print OUT "Bismark version: $bismark_version\n";
1700 }
1701
1702 ### printing alignment and methylation call summary to a report file
1703 my $reportfile = $filename_1;
1704 $reportfile =~ s/(\.fastq\.gz|\.fq\.gz|\.fastq|\.fq)$//; # attempting to remove fastq.gz etc to make filename a little shorter
1705
1706 if ($prefix){
1707 $reportfile = "$prefix.$reportfile";
1708 }
1709
1710 if ($bowtie2){
1711 $reportfile =~ s/$/_bismark_bt2_PE_report.txt/;
1712 }
1713 else{
1714 $reportfile =~ s/$/_bismark_PE_report.txt/;
1715 }
1716
1717 if ($basename){ # Output file basename is set using the -B argument
1718 $reportfile = "${basename}_PE_report.txt";
1719 }
1720
1721 open (REPORT,'>',"$output_dir$reportfile") or die "Failed to write to $reportfile: $!\n";
1722 print REPORT "Bismark report for: $sequence_file_1 and $sequence_file_2 (version: $bismark_version)\n";
1723
1724 if ($bowtie2){
1725 print REPORT "Bismark was run with Bowtie 2 against the bisulfite genome of $genome_folder with the specified options: $bowtie_options\n";
1726 }
1727 else{
1728 print REPORT "Bismark was run with Bowtie against the bisulfite genome of $genome_folder with the specified options: $bowtie_options\n";
1729 }
1730
1731
1732 ### Unmapped read output
1733 if ($unmapped){
1734 my $unmapped_1 = $filename_1;
1735 my $unmapped_2 = $filename_2;
1736
1737 if ($prefix){
1738 $unmapped_1 = "$prefix.$unmapped_1";
1739 $unmapped_2 = "$prefix.$unmapped_2";
1740 }
1741
1742 if ($basename){ # Output file basename is set using the -B argument
1743 if ($sequence_file_format eq 'FASTQ'){
1744 $unmapped_1 = "${basename}_unmapped_reads_1.fq";
1745 $unmapped_2 = "${basename}_unmapped_reads_2.fq";
1746 }
1747 else{
1748 $unmapped_1 = "${basename}_unmapped_reads_1.fa";
1749 $unmapped_2 = "${basename}_unmapped_reads_2.fa";
1750 }
1751 }
1752 else{
1753 if ($sequence_file_format eq 'FASTQ'){
1754 $unmapped_1 =~ s/$/_unmapped_reads_1.fq/;
1755 $unmapped_2 =~ s/$/_unmapped_reads_2.fq/;
1756 }
1757 else{
1758 $unmapped_1 =~ s/$/_unmapped_reads_1.fa/;
1759 $unmapped_2 =~ s/$/_unmapped_reads_2.fa/;
1760 }
1761 }
1762
1763 if ($multicore > 1){ # unmapped files are merged into .gz files in multicore runs anyway
1764 open (UNMAPPED_1,'>',"$output_dir$unmapped_1") or die "Failed to write to $unmapped_1: $!\n";
1765 open (UNMAPPED_2,'>',"$output_dir$unmapped_2") or die "Failed to write to $unmapped_2: $!\n";
1766 }
1767 else{
1768 $unmapped_1 .= '.gz';
1769 $unmapped_2 .= '.gz';
1770 open (UNMAPPED_1,"| gzip -c - > $output_dir$unmapped_1") or die "Failed to write to $unmapped_1: $!\n";
1771 open (UNMAPPED_2,"| gzip -c - > $output_dir$unmapped_2") or die "Failed to write to $unmapped_2: $!\n";
1772 }
1773 warn "Unmapped sequences will be written to $unmapped_1 and $unmapped_2\n";
1774 }
1775
1776 if ($ambiguous){
1777 my $amb_1 = $filename_1;
1778 my $amb_2 = $filename_2;
1779
1780 if ($prefix){
1781 $amb_1 = "$prefix.$amb_1";
1782 $amb_2 = "$prefix.$amb_2";
1783 }
1784
1785 if ($basename){ # Output file basename is set using the -B argument
1786 if ($sequence_file_format eq 'FASTQ'){
1787 $amb_1 = "${basename}_ambiguous_reads_1.fq";
1788 $amb_2 = "${basename}_ambiguous_reads_2.fq";
1789 }
1790 else{
1791 $amb_1 = "${basename}_ambiguous_reads_1.fa";
1792 $amb_2 = "${basename}_ambiguous_reads_2.fa";
1793 }
1794 }
1795 else{
1796 if ($sequence_file_format eq 'FASTQ'){
1797 $amb_1 =~ s/$/_ambiguous_reads_1.fq/;
1798 $amb_2 =~ s/$/_ambiguous_reads_2.fq/;
1799 }
1800 else{
1801 $amb_1 =~ s/$/_ambiguous_reads_1.fa/;
1802 $amb_2 =~ s/$/_ambiguous_reads_2.fa/;
1803 }
1804 }
1805
1806 if ($multicore > 1){ # ambiguous files are merged into .gz files in multicore runs anyway
1807 open (AMBIG_1,'>',"$output_dir$amb_1") or die "Failed to write to $amb_1: $!\n";
1808 open (AMBIG_2,'>',"$output_dir$amb_2") or die "Failed to write to $amb_2: $!\n";
1809 }
1810 else{
1811 $amb_1 .= '.gz';
1812 $amb_2 .= '.gz';
1813 open (AMBIG_1,"| gzip -c - > $output_dir$amb_1") or die "Failed to write to $amb_1: $!\n";
1814 open (AMBIG_2,"| gzip -c - > $output_dir$amb_2") or die "Failed to write to $amb_2: $!\n";
1815 }
1816 warn "Ambiguously mapping sequences will be written to $amb_1 and $amb_2\n";
1817 }
1818
1819 if ($directional){
1820 print REPORT "Option '--directional' specified (default mode): alignments to complementary strands (CTOT, CTOB) were ignored (i.e. not performed)\n\n";
1821 }
1822 elsif ($pbat){
1823 print REPORT "Option '--pbat' specified: alignments to original strands (OT, OB) were ignored (i.e. not performed)\n\n";
1824 }
1825 else{
1826 print REPORT "Option '--non_directional' specified: alignments to all strands were being performed (OT, OB, CTOT, CTOB)\n\n";
1827 }
1828
1829
1830
1831 unless ($vanilla or $sam_no_hd){
1832 generate_SAM_header();
1833 }
1834
1835 ### Input files are in FastA format
1836 if ($sequence_file_format eq 'FASTA'){
1837 process_fastA_files_for_paired_end_methylation_calls($sequence_file_1,$sequence_file_2,$C_to_T_infile_1,$G_to_A_infile_1,$C_to_T_infile_2,$G_to_A_infile_2,$pid);
1838 }
1839 ### Input files are in FastQ format
1840 else{
1841 process_fastQ_files_for_paired_end_methylation_calls($sequence_file_1,$sequence_file_2,$C_to_T_infile_1,$G_to_A_infile_1,$C_to_T_infile_2,$G_to_A_infile_2,$pid);
1842 }
1843 }
1844
1845 sub print_final_analysis_report_single_end{
1846 my ($C_to_T_infile,$G_to_A_infile,$pid,$merge_multi) = @_;
1847
1848 if ($merge_multi){
1849 warn "Printing a final merged alignment report for all individual sub-reports\n\n";
1850 }
1851 else{
1852 ### All sequences from the original sequence file have been analysed now
1853 ### deleting temporary C->T or G->A infiles
1854
1855 if ($directional){
1856 my $deletion_successful = unlink "$temp_dir$C_to_T_infile";
1857 if ($deletion_successful == 1){
1858 warn "\nSuccessfully deleted the temporary file $temp_dir$C_to_T_infile\n\n";
1859 }
1860 else{
1861 warn "Could not delete temporary file $C_to_T_infile properly $!\n";
1862 }
1863 }
1864 elsif ($pbat){
1865 my $deletion_successful = unlink "$temp_dir$G_to_A_infile";
1866 if ($deletion_successful == 1){
1867 warn "\nSuccessfully deleted the temporary file $temp_dir$G_to_A_infile\n\n";
1868 }
1869 else{
1870 warn "Could not delete temporary file $G_to_A_infile properly $!\n";
1871 }
1872 }
1873 else{
1874 my $deletion_successful = unlink "$temp_dir$C_to_T_infile","$temp_dir$G_to_A_infile";
1875 if ($deletion_successful == 2){
1876 warn "\nSuccessfully deleted the temporary files $temp_dir$C_to_T_infile and $temp_dir$G_to_A_infile\n\n";
1877 }
1878 else{
1879 warn "Could not delete temporary files properly $!\n";
1880 }
1881 }
1882 }
1883
1884 ### printing a final report for the alignment procedure
1885 print REPORT "Final Alignment report\n",'='x22,"\n";
1886 warn "Final Alignment report\n",'='x22,"\n";
1887 # foreach my $index (0..$#fhs){
1888 # print "$fhs[$index]->{name}\n";
1889 # print "$fhs[$index]->{seen}\talignments on the correct strand in total\n";
1890 # print "$fhs[$index]->{wrong_strand}\talignments were discarded (nonsensical alignments)\n\n";
1891 # }
1892
1893 ### printing a final report for the methylation call procedure
1894 warn "Sequences analysed in total:\t$counting{sequences_count}\n";
1895 print REPORT "Sequences analysed in total:\t$counting{sequences_count}\n";
1896 my $percent_alignable_sequences;
1897
1898 if ($counting{sequences_count} == 0){
1899 $percent_alignable_sequences = 0;
1900 }
1901 else{
1902 $percent_alignable_sequences = sprintf ("%.1f",$counting{unique_best_alignment_count}*100/$counting{sequences_count});
1903 }
1904
1905 warn "Number of alignments with a unique best hit from the different alignments:\t$counting{unique_best_alignment_count}\nMapping efficiency:\t${percent_alignable_sequences}%\n\n";
1906 print REPORT "Number of alignments with a unique best hit from the different alignments:\t$counting{unique_best_alignment_count}\nMapping efficiency:\t${percent_alignable_sequences}%\n";
1907
1908 ### percentage of low complexity reads overruled because of low complexity (thereby creating a bias for highly methylated reads),
1909 ### only calculating the percentage if there were any overruled alignments
1910 if ($counting{low_complexity_alignments_overruled_count}){
1911 my $percent_overruled_low_complexity_alignments = sprintf ("%.1f",$counting{low_complexity_alignments_overruled_count}*100/$counting{sequences_count});
1912 # print REPORT "Number of low complexity alignments which were overruled to have a unique best hit rather than discarding them:\t$counting{low_complexity_alignments_overruled_count}\t(${percent_overruled_low_complexity_alignments}%)\n";
1913 }
1914
1915 print "Sequences with no alignments under any condition:\t$counting{no_single_alignment_found}\n";
1916 print "Sequences did not map uniquely:\t$counting{unsuitable_sequence_count}\n";
1917 print "Sequences which were discarded because genomic sequence could not be extracted:\t$counting{genomic_sequence_could_not_be_extracted_count}\n\n";
1918 print "Number of sequences with unique best (first) alignment came from the bowtie output:\n";
1919 print join ("\n","CT/CT:\t$counting{CT_CT_count}\t((converted) top strand)","CT/GA:\t$counting{CT_GA_count}\t((converted) bottom strand)","GA/CT:\t$counting{GA_CT_count}\t(complementary to (converted) top strand)","GA/GA:\t$counting{GA_GA_count}\t(complementary to (converted) bottom strand)"),"\n\n";
1920
1921 print REPORT "Sequences with no alignments under any condition:\t$counting{no_single_alignment_found}\n";
1922 print REPORT "Sequences did not map uniquely:\t$counting{unsuitable_sequence_count}\n";
1923 print REPORT "Sequences which were discarded because genomic sequence could not be extracted:\t$counting{genomic_sequence_could_not_be_extracted_count}\n\n";
1924 print REPORT "Number of sequences with unique best (first) alignment came from the bowtie output:\n";
1925 print REPORT join ("\n","CT/CT:\t$counting{CT_CT_count}\t((converted) top strand)","CT/GA:\t$counting{CT_GA_count}\t((converted) bottom strand)","GA/CT:\t$counting{GA_CT_count}\t(complementary to (converted) top strand)","GA/GA:\t$counting{GA_GA_count}\t(complementary to (converted) bottom strand)"),"\n\n";
1926
1927 if ($directional){
1928 print "Number of alignments to (merely theoretical) complementary strands being rejected in total:\t$counting{alignments_rejected_count}\n\n";
1929 print REPORT "Number of alignments to (merely theoretical) complementary strands being rejected in total:\t$counting{alignments_rejected_count}\n\n";
1930 }
1931
1932 ### detailed information about Cs analysed
1933 warn "Final Cytosine Methylation Report\n",'='x33,"\n";
1934 my $total_number_of_C = $counting{total_meCHH_count}+$counting{total_meCHG_count}+$counting{total_meCpG_count}+$counting{total_unmethylated_CHH_count}+$counting{total_unmethylated_CHG_count}+$counting{total_unmethylated_CpG_count};
1935 warn "Total number of C's analysed:\t$total_number_of_C\n\n";
1936 warn "Total methylated C's in CpG context:\t$counting{total_meCpG_count}\n";
1937 warn "Total methylated C's in CHG context:\t$counting{total_meCHG_count}\n";
1938 warn "Total methylated C's in CHH context:\t$counting{total_meCHH_count}\n";
1939 if ($bowtie2){
1940 warn "Total methylated C's in Unknown context:\t$counting{total_meC_unknown_count}\n";
1941 }
1942 warn "\n";
1943
1944 warn "Total unmethylated C's in CpG context:\t$counting{total_unmethylated_CpG_count}\n";
1945 warn "Total unmethylated C's in CHG context:\t$counting{total_unmethylated_CHG_count}\n";
1946 warn "Total unmethylated C's in CHH context:\t$counting{total_unmethylated_CHH_count}\n";
1947 if ($bowtie2){
1948 warn "Total unmethylated C's in Unknown context:\t$counting{total_unmethylated_C_unknown_count}\n";
1949 }
1950 warn "\n";
1951
1952 print REPORT "Final Cytosine Methylation Report\n",'='x33,"\n";
1953 print REPORT "Total number of C's analysed:\t$total_number_of_C\n\n";
1954
1955 print REPORT "Total methylated C's in CpG context:\t$counting{total_meCpG_count}\n";
1956 print REPORT "Total methylated C's in CHG context:\t$counting{total_meCHG_count}\n";
1957 print REPORT "Total methylated C's in CHH context:\t$counting{total_meCHH_count}\n";
1958 if ($bowtie2){
1959 print REPORT "Total methylated C's in Unknown context:\t$counting{total_meC_unknown_count}\n";
1960 }
1961 print REPORT "\n";
1962
1963 print REPORT "Total unmethylated C's in CpG context:\t$counting{total_unmethylated_CpG_count}\n";
1964 print REPORT "Total unmethylated C's in CHG context:\t$counting{total_unmethylated_CHG_count}\n";
1965 print REPORT "Total unmethylated C's in CHH context:\t$counting{total_unmethylated_CHH_count}\n";
1966 if ($bowtie2){
1967 print REPORT "Total unmethylated C's in Unknown context:\t$counting{total_unmethylated_C_unknown_count}\n";
1968 }
1969 print REPORT "\n";
1970
1971 my $percent_meCHG;
1972 if (($counting{total_meCHG_count}+$counting{total_unmethylated_CHG_count}) > 0){
1973 $percent_meCHG = sprintf("%.1f",100*$counting{total_meCHG_count}/($counting{total_meCHG_count}+$counting{total_unmethylated_CHG_count}));
1974 }
1975
1976 my $percent_meCHH;
1977 if (($counting{total_meCHH_count}+$counting{total_unmethylated_CHH_count}) > 0){
1978 $percent_meCHH = sprintf("%.1f",100*$counting{total_meCHH_count}/($counting{total_meCHH_count}+$counting{total_unmethylated_CHH_count}));
1979 }
1980
1981 my $percent_meCpG;
1982 if (($counting{total_meCpG_count}+$counting{total_unmethylated_CpG_count}) > 0){
1983 $percent_meCpG = sprintf("%.1f",100*$counting{total_meCpG_count}/($counting{total_meCpG_count}+$counting{total_unmethylated_CpG_count}));
1984 }
1985
1986 my $percent_meC_unknown;
1987 if (($counting{total_meC_unknown_count}+$counting{total_unmethylated_C_unknown_count}) > 0){
1988 $percent_meC_unknown = sprintf("%.1f",100*$counting{total_meC_unknown_count}/($counting{total_meC_unknown_count}+$counting{total_unmethylated_C_unknown_count}));
1989 }
1990
1991
1992 ### printing methylated CpG percentage if applicable
1993 if ($percent_meCpG){
1994 warn "C methylated in CpG context:\t${percent_meCpG}%\n";
1995 print REPORT "C methylated in CpG context:\t${percent_meCpG}%\n";
1996 }
1997 else{
1998 warn "Can't determine percentage of methylated Cs in CpG context if value was 0\n";
1999 print REPORT "Can't determine percentage of methylated Cs in CpG context if value was 0\n";
2000 }
2001
2002 ### printing methylated C percentage (CHG context) if applicable
2003 if ($percent_meCHG){
2004 warn "C methylated in CHG context:\t${percent_meCHG}%\n";
2005 print REPORT "C methylated in CHG context:\t${percent_meCHG}%\n";
2006 }
2007 else{
2008 warn "Can't determine percentage of methylated Cs in CHG context if value was 0\n";
2009 print REPORT "Can't determine percentage of methylated Cs in CHG context if value was 0\n";
2010 }
2011
2012 ### printing methylated C percentage (CHH context) if applicable
2013 if ($percent_meCHH){
2014 warn "C methylated in CHH context:\t${percent_meCHH}%\n";
2015 print REPORT "C methylated in CHH context:\t${percent_meCHH}%\n";
2016 }
2017 else{
2018 warn "Can't determine percentage of methylated Cs in CHH context if value was 0\n";
2019 print REPORT "Can't determine percentage of methylated Cs in CHH context if value was 0\n";
2020 }
2021
2022 ### printing methylated C percentage (Unknown C context) if applicable
2023 if ($bowtie2){
2024 if ($percent_meC_unknown){
2025 warn "C methylated in Unknown context (CN or CHN):\t${percent_meC_unknown}%\n";
2026 print REPORT "C methylated in Unknown context (CN or CHN):\t${percent_meC_unknown}%\n";
2027 }
2028 else{
2029 warn "Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0\n";
2030 print REPORT "Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0\n";
2031 }
2032 }
2033 print REPORT "\n\n";
2034 warn "\n\n";
2035
2036 if ($seqID_contains_tabs){
2037 warn "The sequence IDs in the provided file contain tab-stops which might prevent sequence alignments. If this happened, please replace all tab characters within the seqID field with spaces before running Bismark.\n\n";
2038 print REPORT "The sequence IDs in the provided file contain tab-stops which might prevent sequence alignments. If this happened, please replace all tab characters within the seqID field with spaces before running Bismark.\n\n";
2039 }
2040 }
2041
2042
2043 sub print_final_analysis_report_paired_ends{
2044 my ($C_to_T_infile_1,$G_to_A_infile_1,$C_to_T_infile_2,$G_to_A_infile_2,$pid,$merge_multi) = @_;
2045
2046 if ($merge_multi){
2047 warn "Printing a final merged alignment report for all individual sub-reports\n\n";
2048 }
2049 else{
2050 ### All sequences from the original sequence file have been analysed now, therefore deleting temporary C->T or G->A infiles
2051 if ($directional){
2052 if ($G_to_A_infile_2){
2053 my $deletion_successful = unlink "$temp_dir$C_to_T_infile_1","$temp_dir$G_to_A_infile_2";
2054 if ($deletion_successful == 2){
2055 warn "\nSuccessfully deleted the temporary files $temp_dir$C_to_T_infile_1 and $temp_dir$G_to_A_infile_2\n\n";
2056 }
2057 else{
2058 warn "Could not delete temporary files $temp_dir$C_to_T_infile_1 and $temp_dir$G_to_A_infile_2 properly: $!\n";
2059 }
2060 }
2061 else{ # for paired-end FastQ infiles with Bowtie1 there is only one file to delete
2062 my $deletion_successful = unlink "$temp_dir$C_to_T_infile_1";
2063 if ($deletion_successful == 1){
2064 warn "\nSuccessfully deleted the temporary file $temp_dir$C_to_T_infile_1\n\n";
2065 }
2066 else{
2067 warn "Could not delete temporary file $temp_dir$C_to_T_infile_1 properly: $!\n";
2068 }
2069 }
2070 }
2071 else{
2072 if ($G_to_A_infile_2 and $C_to_T_infile_2){
2073 my $deletion_successful = unlink "$temp_dir$C_to_T_infile_1","$temp_dir$G_to_A_infile_1","$temp_dir$C_to_T_infile_2","$temp_dir$G_to_A_infile_2";
2074 if ($deletion_successful == 4){
2075 warn "\nSuccessfully deleted the temporary files $temp_dir$C_to_T_infile_1, $temp_dir$G_to_A_infile_1, $temp_dir$C_to_T_infile_2 and $temp_dir$G_to_A_infile_2\n\n";
2076 }
2077 else{
2078 warn "Could not delete temporary files properly: $!\n";
2079 }
2080 }
2081 else{ # for paired-end FastQ infiles with Bowtie1 there are only two files to delete
2082 my $deletion_successful = unlink "$temp_dir$C_to_T_infile_1","$temp_dir$G_to_A_infile_1";
2083 if ($deletion_successful == 2){
2084 warn "\nSuccessfully deleted the temporary files $temp_dir$C_to_T_infile_1 and $temp_dir$G_to_A_infile_1\n\n";
2085 }
2086 else{
2087 warn "Could not delete temporary files properly: $!\n";
2088 }
2089 }
2090 }
2091 }
2092
2093 ### printing a final report for the alignment procedure
2094 warn "Final Alignment report\n",'='x22,"\n";
2095 print REPORT "Final Alignment report\n",'='x22,"\n";
2096 # foreach my $index (0..$#fhs){
2097 # print "$fhs[$index]->{name}\n";
2098 # print "$fhs[$index]->{seen}\talignments on the correct strand in total\n";
2099 # print "$fhs[$index]->{wrong_strand}\talignments were discarded (nonsensical alignments)\n\n";
2100 # }
2101
2102 ### printing a final report for the methylation call procedure
2103 warn "Sequence pairs analysed in total:\t$counting{sequences_count}\n";
2104 print REPORT "Sequence pairs analysed in total:\t$counting{sequences_count}\n";
2105
2106 my $percent_alignable_sequence_pairs;
2107 if ($counting{sequences_count} == 0){
2108 $percent_alignable_sequence_pairs = 0;
2109 }
2110 else{
2111 $percent_alignable_sequence_pairs = sprintf ("%.1f",$counting{unique_best_alignment_count}*100/$counting{sequences_count});
2112 }
2113 print "Number of paired-end alignments with a unique best hit:\t$counting{unique_best_alignment_count}\nMapping efficiency:\t${percent_alignable_sequence_pairs}%\n\n";
2114 print REPORT "Number of paired-end alignments with a unique best hit:\t$counting{unique_best_alignment_count}\nMapping efficiency:\t${percent_alignable_sequence_pairs}% \n";
2115
2116 print "Sequence pairs with no alignments under any condition:\t$counting{no_single_alignment_found}\n";
2117 print "Sequence pairs did not map uniquely:\t$counting{unsuitable_sequence_count}\n";
2118 print "Sequence pairs which were discarded because genomic sequence could not be extracted:\t$counting{genomic_sequence_could_not_be_extracted_count}\n\n";
2119 print "Number of sequence pairs with unique best (first) alignment came from the bowtie output:\n";
2120 print join ("\n","CT/GA/CT:\t$counting{CT_GA_CT_count}\t((converted) top strand)","GA/CT/CT:\t$counting{GA_CT_CT_count}\t(complementary to (converted) top strand)","GA/CT/GA:\t$counting{GA_CT_GA_count}\t(complementary to (converted) bottom strand)","CT/GA/GA:\t$counting{CT_GA_GA_count}\t((converted) bottom strand)"),"\n\n";
2121
2122
2123 print REPORT "Sequence pairs with no alignments under any condition:\t$counting{no_single_alignment_found}\n";
2124 print REPORT "Sequence pairs did not map uniquely:\t$counting{unsuitable_sequence_count}\n";
2125 print REPORT "Sequence pairs which were discarded because genomic sequence could not be extracted:\t$counting{genomic_sequence_could_not_be_extracted_count}\n\n";
2126 print REPORT "Number of sequence pairs with unique best (first) alignment came from the bowtie output:\n";
2127 print REPORT join ("\n","CT/GA/CT:\t$counting{CT_GA_CT_count}\t((converted) top strand)","GA/CT/CT:\t$counting{GA_CT_CT_count}\t(complementary to (converted) top strand)","GA/CT/GA:\t$counting{GA_CT_GA_count}\t(complementary to (converted) bottom strand)","CT/GA/GA:\t$counting{CT_GA_GA_count}\t((converted) bottom strand)"),"\n\n";
2128 ### detailed information about Cs analysed
2129
2130 if ($directional){
2131 print "Number of alignments to (merely theoretical) complementary strands being rejected in total:\t$counting{alignments_rejected_count}\n\n";
2132 print REPORT "Number of alignments to (merely theoretical) complementary strands being rejected in total:\t$counting{alignments_rejected_count}\n\n";
2133 }
2134
2135 warn "Final Cytosine Methylation Report\n",'='x33,"\n";
2136 print REPORT "Final Cytosine Methylation Report\n",'='x33,"\n";
2137
2138 my $total_number_of_C = $counting{total_meCHG_count}+ $counting{total_meCHH_count}+$counting{total_meCpG_count}+$counting{total_unmethylated_CHG_count}+$counting{total_unmethylated_CHH_count}+$counting{total_unmethylated_CpG_count};
2139 warn "Total number of C's analysed:\t$total_number_of_C\n\n";
2140 warn "Total methylated C's in CpG context:\t$counting{total_meCpG_count}\n";
2141 warn "Total methylated C's in CHG context:\t$counting{total_meCHG_count}\n";
2142 warn "Total methylated C's in CHH context:\t$counting{total_meCHH_count}\n";
2143 if ($bowtie2){
2144 warn "Total methylated C's in Unknown context:\t$counting{total_meC_unknown_count}\n";
2145 }
2146 warn "\n";
2147
2148 warn "Total unmethylated C's in CpG context:\t$counting{total_unmethylated_CpG_count}\n";
2149 warn "Total unmethylated C's in CHG context:\t$counting{total_unmethylated_CHG_count}\n";
2150 warn "Total unmethylated C's in CHH context:\t$counting{total_unmethylated_CHH_count}\n";
2151 if ($bowtie2){
2152 warn "Total unmethylated C's in Unknown context:\t$counting{total_unmethylated_C_unknown_count}\n";
2153 }
2154 warn "\n";
2155
2156 print REPORT "Total number of C's analysed:\t$total_number_of_C\n\n";
2157 print REPORT "Total methylated C's in CpG context:\t$counting{total_meCpG_count}\n";
2158 print REPORT "Total methylated C's in CHG context:\t$counting{total_meCHG_count}\n";
2159 print REPORT "Total methylated C's in CHH context:\t$counting{total_meCHH_count}\n";
2160 if ($bowtie2){
2161 print REPORT "Total methylated C's in Unknown context:\t$counting{total_meC_unknown_count}\n\n";
2162 }
2163 print REPORT "\n";
2164
2165 print REPORT "Total unmethylated C's in CpG context:\t$counting{total_unmethylated_CpG_count}\n";
2166 print REPORT "Total unmethylated C's in CHG context:\t$counting{total_unmethylated_CHG_count}\n";
2167 print REPORT "Total unmethylated C's in CHH context:\t$counting{total_unmethylated_CHH_count}\n";
2168 if ($bowtie2){
2169 print REPORT "Total unmethylated C's in Unknown context:\t$counting{total_unmethylated_C_unknown_count}\n\n";
2170 }
2171 print REPORT "\n";
2172
2173 my $percent_meCHG;
2174 if (($counting{total_meCHG_count}+$counting{total_unmethylated_CHG_count}) > 0){
2175 $percent_meCHG = sprintf("%.1f",100*$counting{total_meCHG_count}/($counting{total_meCHG_count}+$counting{total_unmethylated_CHG_count}));
2176 }
2177
2178 my $percent_meCHH;
2179 if (($counting{total_meCHH_count}+$counting{total_unmethylated_CHH_count}) > 0){
2180 $percent_meCHH = sprintf("%.1f",100*$counting{total_meCHH_count}/($counting{total_meCHH_count}+$counting{total_unmethylated_CHH_count}));
2181 }
2182
2183 my $percent_meCpG;
2184 if (($counting{total_meCpG_count}+$counting{total_unmethylated_CpG_count}) > 0){
2185 $percent_meCpG = sprintf("%.1f",100*$counting{total_meCpG_count}/($counting{total_meCpG_count}+$counting{total_unmethylated_CpG_count}));
2186 }
2187
2188 my $percent_meC_unknown;
2189 if (($counting{total_meC_unknown_count}+$counting{total_unmethylated_C_unknown_count}) > 0){
2190 $percent_meC_unknown = sprintf("%.1f",100*$counting{total_meC_unknown_count}/($counting{total_meC_unknown_count}+$counting{total_unmethylated_C_unknown_count}));
2191 }
2192
2193
2194 ### printing methylated CpG percentage if applicable
2195 if ($percent_meCpG){
2196 warn "C methylated in CpG context:\t${percent_meCpG}%\n";
2197 print REPORT "C methylated in CpG context:\t${percent_meCpG}%\n";
2198 }
2199 else{
2200 warn "Can't determine percentage of methylated Cs in CpG context if value was 0\n";
2201 print REPORT "Can't determine percentage of methylated Cs in CpG context if value was 0\n";
2202 }
2203
2204 ### printing methylated C percentage in CHG context if applicable
2205 if ($percent_meCHG){
2206 warn "C methylated in CHG context:\t${percent_meCHG}%\n";
2207 print REPORT "C methylated in CHG context:\t${percent_meCHG}%\n";
2208 }
2209 else{
2210 warn "Can't determine percentage of methylated Cs in CHG context if value was 0\n";
2211 print REPORT "Can't determine percentage of methylated Cs in CHG context if value was 0\n";
2212 }
2213
2214 ### printing methylated C percentage in CHH context if applicable
2215 if ($percent_meCHH){
2216 warn "C methylated in CHH context:\t${percent_meCHH}%\n";
2217 print REPORT "C methylated in CHH context:\t${percent_meCHH}%\n";
2218 }
2219 else{
2220 warn "Can't determine percentage of methylated Cs in CHH context if value was 0\n";
2221 print REPORT "Can't determine percentage of methylated Cs in CHH context if value was 0\n";
2222 }
2223
2224 ### printing methylated C percentage (Unknown C context) if applicable
2225 if ($bowtie2){
2226 if ($percent_meC_unknown){
2227 warn "C methylated in unknown context (CN or CHN):\t${percent_meC_unknown}%\n";
2228 print REPORT "C methylated in unknown context (CN or CHN):\t${percent_meC_unknown}%\n";
2229 }
2230 else{
2231 warn "Can't determine percentage of methylated Cs in unknown context (CN or CHN) if value was 0\n";
2232 print REPORT "Can't determine percentage of methylated Cs in unknown context (CN or CHN) if value was 0\n";
2233 }
2234 }
2235 print REPORT "\n\n";
2236 warn "\n\n";
2237
2238 }
2239
2240 sub process_single_end_fastA_file_for_methylation_call{
2241 my ($sequence_file,$C_to_T_infile,$G_to_A_infile,$pid) = @_;
2242 ### this is a FastA sequence file; we need the actual sequence to compare it against the genomic sequence in order to make a methylation call.
2243 ### Now reading in the sequence file sequence by sequence and see if the current sequence was mapped to one (or both) of the converted genomes in either
2244 ### the C->T or G->A version
2245
2246 ### gzipped version of the infile
2247 if ($sequence_file =~ /\.gz$/){
2248 open (IN,"gunzip -c $sequence_file |") or die $!;
2249 }
2250 else{
2251 open (IN,$sequence_file) or die $!;
2252 }
2253
2254 my $count = 0;
2255
2256 warn "\nReading in the sequence file $sequence_file\n";
2257 while (1) {
2258 # last if ($counting{sequences_count} > 100);
2259 my $identifier = <IN>;
2260 my $sequence = <IN>;
2261 last unless ($identifier and $sequence);
2262
2263 $identifier = fix_IDs($identifier); # this is to avoid problems with truncated read ID when they contain white spaces
2264
2265 ++$count;
2266
2267 if ($skip){
2268 next unless ($count > $skip);
2269 }
2270 if ($upto){
2271 last if ($count > $upto);
2272 }
2273
2274 $counting{sequences_count}++;
2275 if ($counting{sequences_count}%1000000==0) {
2276 warn "Processed $counting{sequences_count} sequences so far\n";
2277 }
2278 chomp $sequence;
2279 chomp $identifier;
2280
2281 $identifier =~ s/^>//; # deletes the > at the beginning of FastA headers
2282
2283 my $return;
2284 if ($bowtie2){
2285 $return = check_bowtie_results_single_end_bowtie2 (uc$sequence,$identifier);
2286 }
2287 else{
2288 $return = check_bowtie_results_single_end(uc$sequence,$identifier); # default Bowtie 1
2289 }
2290
2291 unless ($return){
2292 $return = 0;
2293 }
2294
2295 # print the sequence to ambiguous.out if --ambiguous was specified
2296 if ($ambiguous and $return == 2){
2297 print AMBIG ">$identifier\n";
2298 print AMBIG "$sequence\n";
2299 }
2300
2301 # print the sequence to <unmapped.out> file if --un was specified
2302 elsif ($unmapped and $return == 1){
2303 print UNMAPPED ">$identifier\n";
2304 print UNMAPPED "$sequence\n";
2305 }
2306 }
2307 print "Processed $counting{sequences_count} sequences in total\n\n";
2308
2309 close OUT or warn "Failed to close filehandle OUT: $!\n";
2310
2311 print_final_analysis_report_single_end($C_to_T_infile,$G_to_A_infile,$pid);
2312
2313 }
2314
2315 sub process_single_end_fastQ_file_for_methylation_call{
2316
2317 my ($sequence_file,$C_to_T_infile,$G_to_A_infile,$pid) = @_;
2318
2319 ### this is the Illumina sequence file; we need the actual sequence to compare it against the genomic sequence in order to make a methylation call.
2320 ### Now reading in the sequence file sequence by sequence and see if the current sequence was mapped to one (or both) of the converted genomes in either
2321 ### the C->T or G->A version
2322
2323 ### gzipped version of the infile
2324 if ($sequence_file =~ /\.gz$/){
2325 open (IN,"gunzip -c $sequence_file |") or die $!;
2326 }
2327 else{
2328 open (IN,$sequence_file) or die $!;
2329 }
2330
2331 my $count = 0;
2332
2333 warn "\nReading in the sequence file $sequence_file\n";
2334 while (1) {
2335 my $identifier = <IN>;
2336 my $sequence = <IN>;
2337 my $identifier_2 = <IN>;
2338 my $quality_value = <IN>;
2339 last unless ($identifier and $sequence and $identifier_2 and $quality_value);
2340
2341 $identifier = fix_IDs($identifier); # this is to avoid problems with truncated read ID when they contain white spaces
2342
2343 ++$count;
2344
2345 if ($skip){
2346 next unless ($count > $skip);
2347 }
2348 if ($upto){
2349 last if ($count > $upto);
2350 }
2351
2352 $counting{sequences_count}++;
2353
2354 if ($counting{sequences_count}%1000000==0) {
2355 warn "Processed $counting{sequences_count} sequences so far\n";
2356 }
2357 chomp $sequence;
2358 chomp $identifier;
2359 chomp $quality_value;
2360
2361 $identifier =~ s/^\@//; # deletes the @ at the beginning of Illumin FastQ headers
2362
2363 my $return;
2364 if ($bowtie2){
2365 $return = check_bowtie_results_single_end_bowtie2 (uc$sequence,$identifier,$quality_value);
2366 }
2367 else{
2368 $return = check_bowtie_results_single_end(uc$sequence,$identifier,$quality_value); # default Bowtie 1
2369 }
2370
2371 unless ($return){
2372 $return = 0;
2373 }
2374
2375 # print the sequence to ambiguous.out if --ambiguous was specified
2376 if ($ambiguous and $return == 2){
2377 print AMBIG "\@$identifier\n";
2378 print AMBIG "$sequence\n";
2379 print AMBIG $identifier_2;
2380 print AMBIG "$quality_value\n";
2381 }
2382
2383 # print the sequence to <unmapped.out> file if --un was specified
2384 elsif ($unmapped and $return == 1){
2385 print UNMAPPED "\@$identifier\n";
2386 print UNMAPPED "$sequence\n";
2387 print UNMAPPED $identifier_2;
2388 print UNMAPPED "$quality_value\n";
2389 }
2390 }
2391 print "Processed $counting{sequences_count} sequences in total\n\n";
2392
2393 close OUT or warn "Failed to close filehandle OUT: $!\n";
2394
2395 print_final_analysis_report_single_end($C_to_T_infile,$G_to_A_infile,$pid);
2396 if ($ambig_bam){
2397 close AMBIBAM or warn "Had trouble closing filehandle AMBIBAM: $!\n";
2398 }
2399 }
2400
2401 sub process_fastA_files_for_paired_end_methylation_calls{
2402 my ($sequence_file_1,$sequence_file_2,$C_to_T_infile_1,$G_to_A_infile_1,$C_to_T_infile_2,$G_to_A_infile_2,$pid) = @_;
2403 ### Processing the two FastA sequence files; we need the actual sequences of both reads to compare them against the genomic sequence in order to
2404 ### make a methylation call. The sequence idetifier per definition needs to be the same for a sequence pair used for paired-end mapping.
2405 ### Now reading in the sequence files sequence by sequence and see if the current sequences produced an alignment to one (or both) of the
2406 ### converted genomes (either the C->T or G->A version)
2407
2408 ### gzipped version of the infiles
2409 if ($sequence_file_1 =~ /\.gz$/ and $sequence_file_2 =~ /\.gz$/){
2410 open (IN1,"gunzip -c $sequence_file_1 |") or die "Failed to open gunzip -c pipe to $sequence_file_1 $!\n";
2411 open (IN2,"gunzip -c $sequence_file_2 |") or die "Failed to open gunzip -c pipe to $sequence_file_2 $!\n";
2412 }
2413 else{
2414 open (IN1,$sequence_file_1) or die $!;
2415 open (IN2,$sequence_file_2) or die $!;
2416 }
2417
2418 warn "\nReading in the sequence files $sequence_file_1 and $sequence_file_2\n";
2419 ### Both files are required to have the exact same number of sequences, therefore we can process the sequences jointly one by one
2420
2421 my $count = 0;
2422
2423 while (1) {
2424 # reading from the first input file
2425 my $identifier_1 = <IN1>;
2426 my $sequence_1 = <IN1>;
2427 # reading from the second input file
2428 my $identifier_2 = <IN2>;
2429 my $sequence_2 = <IN2>;
2430 last unless ($identifier_1 and $sequence_1 and $identifier_2 and $sequence_2);
2431
2432 $identifier_1 = fix_IDs($identifier_1); # this is to avoid problems with truncated read ID when they contain white spaces
2433 $identifier_2 = fix_IDs($identifier_2);
2434
2435 ++$count;
2436
2437 if ($skip){
2438 next unless ($count > $skip);
2439 }
2440 if ($upto){
2441 last if ($count > $upto);
2442 }
2443
2444 $counting{sequences_count}++;
2445 if ($counting{sequences_count}%1000000==0) {
2446 warn "Processed $counting{sequences_count} sequence pairs so far\n";
2447 }
2448 my $orig_identifier_1 = $identifier_1;
2449 my $orig_identifier_2 = $identifier_2;
2450
2451 chomp $sequence_1;
2452 chomp $identifier_1;
2453 chomp $sequence_2;
2454 chomp $identifier_2;
2455
2456 $identifier_1 =~ s/^>//; # deletes the > at the beginning of FastA headers
2457
2458 my $return;
2459 if ($bowtie2){
2460 $return = check_bowtie_results_paired_ends_bowtie2 (uc$sequence_1,uc$sequence_2,$identifier_1);
2461 }
2462 else{
2463 $return = check_bowtie_results_paired_ends (uc$sequence_1,uc$sequence_2,$identifier_1);
2464 }
2465
2466 unless ($return){
2467 $return = 0;
2468 }
2469
2470 # print the sequences to ambiguous_1 and _2 if --ambiguous was specified
2471 if ($ambiguous and $return == 2){
2472 print AMBIG_1 $orig_identifier_1;
2473 print AMBIG_1 "$sequence_1\n";
2474 print AMBIG_2 $orig_identifier_2;
2475 print AMBIG_2 "$sequence_2\n";
2476 }
2477
2478 # print the sequences to unmapped_1.out and unmapped_2.out if --un was specified
2479 elsif ($unmapped and $return == 1){
2480 print UNMAPPED_1 $orig_identifier_1;
2481 print UNMAPPED_1 "$sequence_1\n";
2482 print UNMAPPED_2 $orig_identifier_2;
2483 print UNMAPPED_2 "$sequence_2\n";
2484 }
2485 }
2486
2487 warn "Processed $counting{sequences_count} sequences in total\n\n";
2488
2489 close OUT or die $!;
2490
2491 print_final_analysis_report_paired_ends($C_to_T_infile_1,$G_to_A_infile_1,$C_to_T_infile_2,$G_to_A_infile_2,$pid);
2492
2493 }
2494
2495 sub process_fastQ_files_for_paired_end_methylation_calls{
2496 my ($sequence_file_1,$sequence_file_2,$C_to_T_infile_1,$G_to_A_infile_1,$C_to_T_infile_2,$G_to_A_infile_2,$pid) = @_;
2497 ### Processing the two Illumina sequence files; we need the actual sequence of both reads to compare them against the genomic sequence in order to
2498 ### make a methylation call. The sequence identifier per definition needs to be same for a sequence pair used for paired-end alignments.
2499 ### Now reading in the sequence files sequence by sequence and see if the current sequences produced a paired-end alignment to one (or both)
2500 ### of the converted genomes (either C->T or G->A version)
2501
2502 ### gzipped version of the infiles
2503 if ($sequence_file_1 =~ /\.gz$/ and $sequence_file_2 =~ /\.gz$/){
2504 open (IN1,"gunzip -c $sequence_file_1 |") or die "Failed to open gunzip -c pipe to $sequence_file_1 $!\n";
2505 open (IN2,"gunzip -c $sequence_file_2 |") or die "Failed to open gunzip -c pipe to $sequence_file_2 $!\n";
2506 }
2507 else{
2508 open (IN1,$sequence_file_1) or die $!;
2509 open (IN2,$sequence_file_2) or die $!;
2510 }
2511
2512 my $count = 0;
2513
2514 warn "\nReading in the sequence files $sequence_file_1 and $sequence_file_2\n";
2515 ### Both files are required to have the exact same number of sequences, therefore we can process the sequences jointly one by one
2516 while (1) {
2517 # reading from the first input file
2518 my $identifier_1 = <IN1>;
2519 my $sequence_1 = <IN1>;
2520 my $ident_1 = <IN1>; # not needed
2521 my $quality_value_1 = <IN1>; # not needed
2522 # reading from the second input file
2523 my $identifier_2 = <IN2>;
2524 my $sequence_2 = <IN2>;
2525 my $ident_2 = <IN2>; # not needed
2526 my $quality_value_2 = <IN2>; # not needed
2527 last unless ($identifier_1 and $sequence_1 and $quality_value_1 and $identifier_2 and $sequence_2 and $quality_value_2);
2528 $identifier_1 = fix_IDs($identifier_1); # this is to avoid problems with truncated read ID when they contain white spaces
2529 $identifier_2 = fix_IDs($identifier_2);
2530
2531 ++$count;
2532
2533 if ($skip){
2534 next unless ($count > $skip);
2535 }
2536 if ($upto){
2537 last if ($count > $upto);
2538 }
2539
2540 $counting{sequences_count}++;
2541 if ($counting{sequences_count}%1000000==0) {
2542 warn "Processed $counting{sequences_count} sequence pairs so far\n";
2543 }
2544
2545 my $orig_identifier_1 = $identifier_1;
2546 my $orig_identifier_2 = $identifier_2;
2547
2548 chomp $sequence_1;
2549 chomp $identifier_1;
2550 chomp $sequence_2;
2551 chomp $identifier_2;
2552 chomp $quality_value_1;
2553 chomp $quality_value_2;
2554
2555 $identifier_1 =~ s/^\@//; # deletes the @ at the beginning of the FastQ ID
2556
2557 my $return;
2558 if ($bowtie2){
2559 $return = check_bowtie_results_paired_ends_bowtie2 (uc$sequence_1,uc$sequence_2,$identifier_1,$quality_value_1,$quality_value_2);
2560 }
2561 else{
2562 $return = check_bowtie_results_paired_ends (uc$sequence_1,uc$sequence_2,$identifier_1,$quality_value_1,$quality_value_2);
2563 }
2564
2565 unless ($return){
2566 $return = 0;
2567 }
2568
2569 # print the sequences to ambiguous_1 and _2 if --ambiguous was specified
2570 if ($ambiguous and $return == 2){
2571 # seq_1
2572 print AMBIG_1 $orig_identifier_1;
2573 print AMBIG_1 "$sequence_1\n";
2574 print AMBIG_1 $ident_1;
2575 print AMBIG_1 "$quality_value_1\n";
2576 # seq_2
2577 print AMBIG_2 $orig_identifier_2;
2578 print AMBIG_2 "$sequence_2\n";
2579 print AMBIG_2 $ident_2;
2580 print AMBIG_2 "$quality_value_2\n";
2581 }
2582
2583 # print the sequences to unmapped_1.out and unmapped_2.out if --un was specified
2584 elsif ($unmapped and $return == 1){
2585 # seq_1
2586 print UNMAPPED_1 $orig_identifier_1;
2587 print UNMAPPED_1 "$sequence_1\n";
2588 print UNMAPPED_1 $ident_1;
2589 print UNMAPPED_1 "$quality_value_1\n";
2590 # seq_2
2591 print UNMAPPED_2 $orig_identifier_2;
2592 print UNMAPPED_2 "$sequence_2\n";
2593 print UNMAPPED_2 $ident_2;
2594 print UNMAPPED_2 "$quality_value_2\n";
2595 }
2596 }
2597
2598 warn "Processed $counting{sequences_count} sequences in total\n\n";
2599
2600 close OUT or warn "Failed to close filehandle OUT: $!\n\n";
2601 if ($ambig_bam){
2602 close AMBIBAM or warn "Had trouble closing filehandle AMBIBAM: $!\n\n";
2603 }
2604
2605 print_final_analysis_report_paired_ends($C_to_T_infile_1,$G_to_A_infile_1,$C_to_T_infile_2,$G_to_A_infile_2,$pid);
2606
2607 }
2608
2609 sub check_bowtie_results_single_end{
2610 my ($sequence,$identifier,$quality_value) = @_;
2611
2612 unless ($quality_value){ # FastA sequences get assigned a quality value of Phred 40 throughout
2613 $quality_value = 'I'x(length$sequence);
2614 }
2615
2616 my %mismatches = ();
2617 ### reading from the bowtie output files to see if this sequence aligned to a bisulfite converted genome
2618 foreach my $index (0..$#fhs){
2619
2620 ### skipping this index if the last alignment has been set to undefined already (i.e. end of bowtie output)
2621 next unless ($fhs[$index]->{last_line} and defined $fhs[$index]->{last_seq_id});
2622 ### if the sequence we are currently looking at produced an alignment we are doing various things with it
2623 if ($fhs[$index]->{last_seq_id} eq $identifier) {
2624 ###############################################################
2625 ### STEP I Now processing the alignment stored in last_line ###
2626 ###############################################################
2627 my $valid_alignment_found_1 = decide_whether_single_end_alignment_is_valid($index,$identifier);
2628 ### sequences can fail at this point if there was only 1 seq in the wrong orientation, or if there were 2 seqs, both in the wrong orientation
2629 ### we only continue to extract useful information about this alignment if 1 was returned
2630 if ($valid_alignment_found_1 == 1){
2631 ### Bowtie outputs which made it this far are in the correct orientation, so we can continue to analyse the alignment itself
2632 ### need to extract the chromosome number from the bowtie output (which is either XY_cf (complete forward) or XY_cr (complete reverse)
2633 my ($id,$strand,$mapped_chromosome,$position,$bowtie_sequence,$mismatch_info) = (split (/\t/,$fhs[$index]->{last_line},-1))[0,1,2,3,4,7];
2634
2635 unless($mismatch_info){
2636 $mismatch_info = '';
2637 }
2638
2639 chomp $mismatch_info;
2640 my $chromosome;
2641 if ($mapped_chromosome =~ s/_(CT|GA)_converted$//){
2642 $chromosome = $mapped_chromosome;
2643 }
2644 else{
2645 die "Chromosome number extraction failed for $mapped_chromosome\n";
2646 }
2647 ### Now extracting the number of mismatches to the converted genome
2648 my $number_of_mismatches;
2649 if ($mismatch_info eq ''){
2650 $number_of_mismatches = 0;
2651 }
2652 elsif ($mismatch_info =~ /^\d/){
2653 my @mismatches = split (/,/,$mismatch_info);
2654 $number_of_mismatches = scalar @mismatches;
2655 }
2656 else{
2657 die "Something weird is going on with the mismatch field:\t>>> $mismatch_info <<<\n";
2658 }
2659 ### creating a composite location variable from $chromosome and $position and storing the alignment information in a temporary hash table
2660 my $alignment_location = join (":",$chromosome,$position);
2661 ### If a sequence aligns to exactly the same location twice the sequence does either not contain any C or G, or all the Cs (or Gs on the reverse
2662 ### strand) were methylated and therefore protected. It is not needed to overwrite the same positional entry with a second entry for the same
2663 ### location (the genomic sequence extraction and methylation would not be affected by this, only the thing which would change is the index
2664 ### number for the found alignment)
2665 unless (exists $mismatches{$number_of_mismatches}->{$alignment_location}){
2666 $mismatches{$number_of_mismatches}->{$alignment_location}->{seq_id}=$id;
2667 $mismatches{$number_of_mismatches}->{$alignment_location}->{bowtie_sequence}=$bowtie_sequence;
2668 $mismatches{$number_of_mismatches}->{$alignment_location}->{index}=$index;
2669 $mismatches{$number_of_mismatches}->{$alignment_location}->{chromosome}=$chromosome;
2670 $mismatches{$number_of_mismatches}->{$alignment_location}->{position}=$position;
2671 }
2672 $number_of_mismatches = undef;
2673 ##################################################################################################################################################
2674 ### STEP II Now reading in the next line from the bowtie filehandle. The next alignment can either be a second alignment of the same sequence or a
2675 ### a new sequence. In either case we will store the next line in @fhs ->{last_line}. In case the alignment is already the next entry, a 0 will
2676 ### be returned as $valid_alignment_found and it will then be processed in the next round only.
2677 ##################################################################################################################################################
2678 my $newline = $fhs[$index]->{fh}-> getline();
2679 if ($newline){
2680 my ($seq_id) = split (/\t/,$newline);
2681 $fhs[$index]->{last_seq_id} = $seq_id;
2682 $fhs[$index]->{last_line} = $newline;
2683 }
2684 else {
2685 # assigning undef to last_seq_id and last_line and jumping to the next index (end of bowtie output)
2686 $fhs[$index]->{last_seq_id} = undef;
2687 $fhs[$index]->{last_line} = undef;
2688 next;
2689 }
2690 my $valid_alignment_found_2 = decide_whether_single_end_alignment_is_valid($index,$identifier);
2691 ### we only continue to extract useful information about this second alignment if 1 was returned
2692 if ($valid_alignment_found_2 == 1){
2693 ### If the second Bowtie output made it this far it is in the correct orientation, so we can continue to analyse the alignment itself
2694 ### need to extract the chromosome number from the bowtie output (which is either XY_cf (complete forward) or XY_cr (complete reverse)
2695 my ($id,$strand,$mapped_chromosome,$position,$bowtie_sequence,$mismatch_info) = (split (/\t/,$fhs[$index]->{last_line},-1))[0,1,2,3,4,7];
2696 unless($mismatch_info){
2697 $mismatch_info = '';
2698 }
2699 chomp $mismatch_info;
2700
2701 my $chromosome;
2702 if ($mapped_chromosome =~ s/_(CT|GA)_converted$//){
2703 $chromosome = $mapped_chromosome;
2704 }
2705 else{
2706 die "Chromosome number extraction failed for $mapped_chromosome\n";
2707 }
2708
2709 ### Now extracting the number of mismatches to the converted genome
2710 my $number_of_mismatches;
2711 if ($mismatch_info eq ''){
2712 $number_of_mismatches = 0;
2713 }
2714 elsif ($mismatch_info =~ /^\d/){
2715 my @mismatches = split (/,/,$mismatch_info);
2716 $number_of_mismatches = scalar @mismatches;
2717 }
2718 else{
2719 die "Something weird is going on with the mismatch field\n";
2720 }
2721 ### creating a composite location variable from $chromosome and $position and storing the alignment information in a temporary hash table
2722 ### extracting the chromosome number from the bowtie output (see above)
2723 my $alignment_location = join (":",$chromosome,$position);
2724 ### In the special case that two differently converted sequences align against differently converted genomes, but to the same position
2725 ### with the same number of mismatches (or perfect matches), the chromosome, position and number of mismatches are the same. In this
2726 ### case we are not writing the same entry out a second time.
2727 unless (exists $mismatches{$number_of_mismatches}->{$alignment_location}){
2728 $mismatches{$number_of_mismatches}->{$alignment_location}->{seq_id}=$id;
2729 $mismatches{$number_of_mismatches}->{$alignment_location}->{bowtie_sequence}=$bowtie_sequence;
2730 $mismatches{$number_of_mismatches}->{$alignment_location}->{index}=$index;
2731 $mismatches{$number_of_mismatches}->{$alignment_location}->{chromosome}=$chromosome;
2732 $mismatches{$number_of_mismatches}->{$alignment_location}->{position}=$position;
2733 }
2734 ####################################################################################################################################
2735 #### STEP III Now reading in one more line which has to be the next alignment to be analysed. Adding it to @fhs ->{last_line} ###
2736 ####################################################################################################################################
2737 $newline = $fhs[$index]->{fh}-> getline();
2738 if ($newline){
2739 my ($seq_id) = split (/\t/,$newline);
2740 die "The same seq ID occurred more than twice in a row\n" if ($seq_id eq $identifier);
2741 $fhs[$index]->{last_seq_id} = $seq_id;
2742 $fhs[$index]->{last_line} = $newline;
2743 next;
2744 }
2745 else {
2746 # assigning undef to last_seq_id and last_line and jumping to the next index (end of bowtie output)
2747 $fhs[$index]->{last_seq_id} = undef;
2748 $fhs[$index]->{last_line} = undef;
2749 next;
2750 }
2751 ### still within the 2nd sequence in correct orientation found
2752 }
2753 ### still withing the 1st sequence in correct orientation found
2754 }
2755 ### still within the if (last_seq_id eq identifier) condition
2756 }
2757 ### still within foreach index loop
2758 }
2759 ### if there was not a single alignment found for a certain sequence we will continue with the next sequence in the sequence file
2760 unless(%mismatches){
2761 $counting{no_single_alignment_found}++;
2762 if ($unmapped){
2763 return 1; ### We will print this sequence out as unmapped sequence if --un unmapped.out has been specified
2764 }
2765 else{
2766 return;
2767 }
2768 }
2769 #######################################################################################################################################################
2770 #######################################################################################################################################################
2771 ### We are now looking if there is a unique best alignment for a certain sequence. This means we are sorting in ascending order and look at the ###
2772 ### sequence with the lowest amount of mismatches. If there is only one single best position we are going to store the alignment information in the ###
2773 ### meth_call variables, if there are multiple hits with the same amount of (lowest) mismatches we are discarding the sequence altogether ###
2774 #######################################################################################################################################################
2775 #######################################################################################################################################################
2776 ### Going to use the variable $sequence_fails as a memory if a sequence could not be aligned uniquely (set to 1 then)
2777 my $sequence_fails = 0;
2778 ### Declaring an empty hash reference which will store all information we need for the methylation call
2779 my $methylation_call_params; # hash reference!
2780 ### sorting in ascending order
2781 foreach my $mismatch_number (sort {$a<=>$b} keys %mismatches){
2782
2783 ### if there is only 1 entry in the hash with the lowest number of mismatches we accept it as the best alignment
2784 if (scalar keys %{$mismatches{$mismatch_number}} == 1){
2785 for my $unique_best_alignment (keys %{$mismatches{$mismatch_number}}){
2786 $methylation_call_params->{$identifier}->{bowtie_sequence} = $mismatches{$mismatch_number}->{$unique_best_alignment}->{bowtie_sequence};
2787 $methylation_call_params->{$identifier}->{chromosome} = $mismatches{$mismatch_number}->{$unique_best_alignment}->{chromosome};
2788 $methylation_call_params->{$identifier}->{position} = $mismatches{$mismatch_number}->{$unique_best_alignment}->{position};
2789 $methylation_call_params->{$identifier}->{index} = $mismatches{$mismatch_number}->{$unique_best_alignment}->{index};
2790 $methylation_call_params->{$identifier}->{number_of_mismatches} = $mismatch_number;
2791 }
2792 }
2793 elsif (scalar keys %{$mismatches{$mismatch_number}} == 3){
2794 ### If there are 3 sequences with the same number of lowest mismatches we can discriminate 2 cases: (i) all 3 alignments are unique best hits and
2795 ### come from different alignments processes (== indices) or (ii) one sequence alignment (== index) will give a unique best alignment, whereas a
2796 ### second one will produce 2 (or potentially many) alignments for the same sequence but in a different conversion state or against a different genome
2797 ### version (or both). This becomes especially relevant for highly converted sequences in which all Cs have been converted to Ts in the bisulfite
2798 ### reaction. E.g.
2799 ### CAGTCACGCGCGCGCG will become
2800 ### TAGTTATGTGTGTGTG in the CT transformed version, which will ideally still give the correct alignment in the CT->CT alignment condition.
2801 ### If the same read will then become G->A transformed as well however, the resulting sequence will look differently and potentially behave
2802 ### differently in a GA->GA alignment and this depends on the methylation state of the original sequence!:
2803 ### G->A conversion:
2804 ### highly methylated: CAATCACACACACACA
2805 ### highly converted : TAATTATATATATATA <== this sequence has a reduced complexity (only 2 bases left and not 3), and it is more likely to produce
2806 ### an alignment with a low complexity genomic region than the one above. This would normally lead to the entire sequence being kicked out as the
2807 ### there will be 3 alignments with the same number of lowest mismatches!! This in turn means that highly methylated and thereby not converted
2808 ### sequences are more likely to pass the alignment step, thereby creating a bias for methylated reads compared to their non-methylated counterparts.
2809 ### We do not want any bias, whatsover. Therefore if we have 1 sequence producing a unique best alignment and the second and third conditions
2810 ### producing alignments only after performing an additional (theoretical) conversion we want to keep the best alignment with the lowest number of
2811 ### additional transliterations performed. Thus we want to have a look at the level of complexity of the sequences producing the alignment.
2812 ### In the above example the number of transliterations required to transform the actual sequence
2813 ### to the C->T version would be TAGTTATGTGTGTGTG -> TAGTTATGTGTGTGTG = 0; (assuming this gives the correct alignment)
2814 ### in the G->A case it would be TAGTTATGTGTGTGTG -> TAATTATATATATATA = 6; (assuming this gives multiple wrong alignments)
2815 ### if the sequence giving a unique best alignment required a lower number of transliterations than the second best sequence yielding alignments
2816 ### while requiring a much higher number of transliterations, we are going to accept the unique best alignment with the lowest number of performed
2817 ### transliterations. As a threshold which does scale we will start with the number of tranliterations of the lowest best match x 2 must still be
2818 ### smaller than the number of tranliterations of the second best sequence. Everything will be flagged with $sequence_fails = 1 and discarded.
2819 my @three_candidate_seqs;
2820 foreach my $composite_location (keys (%{$mismatches{$mismatch_number}}) ){
2821 my $transliterations_performed;
2822 if ($mismatches{$mismatch_number}->{$composite_location}->{index} == 0 or $mismatches{$mismatch_number}->{$composite_location}->{index} == 1){
2823 $transliterations_performed = determine_number_of_transliterations_performed($sequence,'CT');
2824 }
2825 elsif ($mismatches{$mismatch_number}->{$composite_location}->{index} == 2 or $mismatches{$mismatch_number}->{$composite_location}->{index} == 3){
2826 $transliterations_performed = determine_number_of_transliterations_performed($sequence,'GA');
2827 }
2828 else{
2829 die "unexpected index number range $!\n";
2830 }
2831 push @three_candidate_seqs,{
2832 index =>$mismatches{$mismatch_number}->{$composite_location}->{index},
2833 bowtie_sequence => $mismatches{$mismatch_number}->{$composite_location}->{bowtie_sequence},
2834 mismatch_number => $mismatch_number,
2835 chromosome => $mismatches{$mismatch_number}->{$composite_location}->{chromosome},
2836 position => $mismatches{$mismatch_number}->{$composite_location}->{position},
2837 seq_id => $mismatches{$mismatch_number}->{$composite_location}->{seq_id},
2838 transliterations_performed => $transliterations_performed,
2839 };
2840 }
2841 ### sorting in ascending order for the lowest number of transliterations performed
2842 @three_candidate_seqs = sort {$a->{transliterations_performed} <=> $b->{transliterations_performed}} @three_candidate_seqs;
2843 my $first_array_element = $three_candidate_seqs[0]->{transliterations_performed};
2844 my $second_array_element = $three_candidate_seqs[1]->{transliterations_performed};
2845 my $third_array_element = $three_candidate_seqs[2]->{transliterations_performed};
2846 # print "$first_array_element\t$second_array_element\t$third_array_element\n";
2847 if (($first_array_element*2) < $second_array_element){
2848 $counting{low_complexity_alignments_overruled_count}++;
2849 ### taking the index with the unique best hit and over ruling low complexity alignments with 2 hits
2850 $methylation_call_params->{$identifier}->{bowtie_sequence} = $three_candidate_seqs[0]->{bowtie_sequence};
2851 $methylation_call_params->{$identifier}->{chromosome} = $three_candidate_seqs[0]->{chromosome};
2852 $methylation_call_params->{$identifier}->{position} = $three_candidate_seqs[0]->{position};
2853 $methylation_call_params->{$identifier}->{index} = $three_candidate_seqs[0]->{index};
2854 $methylation_call_params->{$identifier}->{number_of_mismatches} = $mismatch_number;
2855 # print "Overruled low complexity alignments! Using $first_array_element and disregarding $second_array_element and $third_array_element\n";
2856 }
2857 else{
2858 $sequence_fails = 1;
2859 }
2860 }
2861 else{
2862 $sequence_fails = 1;
2863 }
2864 ### after processing the alignment with the lowest number of mismatches we exit
2865 last;
2866 }
2867 ### skipping the sequence completely if there were multiple alignments with the same amount of lowest mismatches found at different positions
2868 if ($sequence_fails == 1){
2869 $counting{unsuitable_sequence_count}++;
2870 if ($ambiguous){
2871 return 2; # => exits to next sequence, and prints it out to multiple_alignments.out if --ambiguous has been specified
2872 }
2873 if ($unmapped){
2874 return 1; # => exits to next sequence, and prints it out to unmapped.out if --un has been specified
2875 }
2876 else{
2877 return 0; # => exits to next sequence (default)
2878 }
2879 }
2880
2881 ### --DIRECTIONAL
2882 ### If the option --directional has been specified the user wants to consider only alignments to the original top strand or the original bottom strand. We will therefore
2883 ### discard all alignments to strands complementary to the original strands, as they should not exist in reality due to the library preparation protocol
2884 if ($directional){
2885 if ( ($methylation_call_params->{$identifier}->{index} == 2) or ($methylation_call_params->{$identifier}->{index} == 3) ){
2886 # warn "Alignment rejected! (index was: $methylation_call_params->{$identifier}->{index})\n";
2887 $counting{alignments_rejected_count}++;
2888 return 0;
2889 }
2890 }
2891
2892 ### If the sequence has not been rejected so far it will have a unique best alignment
2893 $counting{unique_best_alignment_count}++;
2894 extract_corresponding_genomic_sequence_single_end($identifier,$methylation_call_params);
2895
2896 ### check test to see if the genomic sequence we extracted has the same length as the observed sequence+2, and only then we perform the methylation call
2897 if (length($methylation_call_params->{$identifier}->{unmodified_genomic_sequence}) != length($sequence)+2){
2898 warn "Chromosomal sequence could not be extracted for\t$identifier\t$methylation_call_params->{$identifier}->{chromosome}\t$methylation_call_params->{$identifier}->{position}\n";
2899 $counting{genomic_sequence_could_not_be_extracted_count}++;
2900 return 0;
2901 }
2902
2903 ### otherwise we are set to perform the actual methylation call
2904 $methylation_call_params->{$identifier}->{methylation_call} = methylation_call($identifier,$sequence,$methylation_call_params->{$identifier}->{unmodified_genomic_sequence},$methylation_call_params->{$identifier}->{read_conversion});
2905
2906 print_bisulfite_mapping_result_single_end($identifier,$sequence,$methylation_call_params,$quality_value);
2907 return 0; ## otherwise 1 will be returned by default, which would print the sequence to unmapped.out
2908 }
2909
2910 sub check_bowtie_results_single_end_bowtie2{
2911 my ($sequence,$identifier,$quality_value) = @_;
2912
2913 unless ($quality_value){ # FastA sequences get assigned a quality value of Phred 40 throughout
2914 $quality_value = 'I'x(length$sequence);
2915 }
2916
2917 # as of version Bowtie 2 2.0.0 beta7, when input reads are unpaired, Bowtie 2 no longer removes the trailing /1 or /2 from the read name.
2918 # $identifier =~ s/\/[1234567890]+$//; # some sequencers don't just have /1 or /2 at the end of read IDs
2919 # print "sequence $sequence\nid $identifier\nquality: '$quality_value'\n";
2920
2921 my $alignment_ambiguous = 0;
2922 my $first_ambig_alignment; # storing the first ambiguous alignment so it can be written out in case '--ambig_bam' was specified
2923 my $best_AS_so_far; ## we need to keep a memory of the best alignment score so far
2924 my $amb_same_thread = 0; ## if a reads primary and secondary alignments have the same alignment score we set this to true.
2925
2926 my %alignments = ();
2927
2928 ### reading from the Bowtie 2 output filehandles
2929 foreach my $index (0..$#fhs){
2930 # print "Index: $index\n";
2931 # print "$fhs[$index]->{last_line}\n";
2932 # print "$fhs[$index]->{last_seq_id}\n";
2933 # sleep (1);
2934 ### skipping this index if the last alignment has been set to undefined already (i.e. end of bowtie output)
2935 next unless ($fhs[$index]->{last_line} and defined $fhs[$index]->{last_seq_id});
2936
2937 ### if the sequence we are currently looking at produced an alignment we are doing various things with it
2938 # print "last seq id: $fhs[$index]->{last_seq_id} and identifier: $identifier\n";
2939
2940 if ($fhs[$index]->{last_seq_id} eq $identifier) {
2941 # SAM format specifications for Bowtie 2
2942 # (1) Name of read that aligned
2943 # (2) Sum of all applicable flags. Flags relevant to Bowtie are:
2944 # 1 The read is one of a pair
2945 # 2 The alignment is one end of a proper paired-end alignment
2946 # 4 The read has no reported alignments
2947 # 8 The read is one of a pair and has no reported alignments
2948 # 16 The alignment is to the reverse reference strand
2949 # 32 The other mate in the paired-end alignment is aligned to the reverse reference strand
2950 # 64 The read is mate 1 in a pair
2951 # 128 The read is mate 2 in a pair
2952 # 256 The read has multiple mapping states
2953 # (3) Name of reference sequence where alignment occurs (unmapped reads have a *)
2954 # (4) 1-based offset into the forward reference strand where leftmost character of the alignment occurs (0 for unmapped reads)
2955 # (5) Mapping quality (255 means MAPQ is not available)
2956 # (6) CIGAR string representation of alignment (* if unavailable)
2957 # (7) Name of reference sequence where mate's alignment occurs. Set to = if the mate's reference sequence is the same as this alignment's, or * if there is no mate.
2958 # (8) 1-based offset into the forward reference strand where leftmost character of the mate's alignment occurs. Offset is 0 if there is no mate.
2959 # (9) Inferred fragment size. Size is negative if the mate's alignment occurs upstream of this alignment. Size is 0 if there is no mate.
2960 # (10) Read sequence (reverse-complemented if aligned to the reverse strand)
2961 # (11) ASCII-encoded read qualities (reverse-complemented if the read aligned to the reverse strand). The encoded quality values are on the Phred quality scale and the encoding is ASCII-offset by 33 (ASCII char !), similarly to a FASTQ file.
2962 # (12) Optional fields. Fields are tab-separated. bowtie2 outputs zero or more of these optional fields for each alignment, depending on the type of the alignment:
2963 # AS:i:<N> Alignment score. Can be negative. Can be greater than 0 in --local mode (but not in --end-to-end mode). Only present if SAM record is for an aligned read.
2964 # XS:i:<N> Alignment score for second-best alignment. Can be negative. Can be greater than 0 in --local mode (but not in --end-to-end mode). Only present if the SAM record is for an aligned read and more than one alignment was found for the read.
2965 # YS:i:<N> Alignment score for opposite mate in the paired-end alignment. Only present if the SAM record is for a read that aligned as part of a paired-end alignment.
2966 # XN:i:<N> The number of ambiguous bases in the reference covering this alignment. Only present if SAM record is for an aligned read.
2967 # XM:i:<N> The number of mismatches in the alignment. Only present if SAM record is for an aligned read.
2968 # XO:i:<N> The number of gap opens, for both read and reference gaps, in the alignment. Only present if SAM record is for an aligned read.
2969 # XG:i:<N> The number of gap extensions, for both read and reference gaps, in the alignment. Only present if SAM record is for an aligned read.
2970 # NM:i:<N> The edit distance; that is, the minimal number of one-nucleotide edits (substitutions, insertions and deletions) needed to transform the read string into the reference string. Only present if SAM record is for an aligned read.
2971 # YF:Z:<N> String indicating reason why the read was filtered out. See also: Filtering. Only appears for reads that were filtered out.
2972 # MD:Z:<S> A string representation of the mismatched reference bases in the alignment. See SAM format specification for details. Only present if SAM record is for an aligned read.
2973
2974 my ($id,$flag,$mapped_chromosome,$position,$mapping_quality,$cigar,$bowtie_sequence,$qual) = (split (/\t/,$fhs[$index]->{last_line}))[0,1,2,3,4,5,9,10];
2975
2976 ### If a sequence has no reported alignments there will be a single output line with a bit-wise flag value of 4. We can store the next alignment and move on to the next Bowtie 2 instance
2977 if ($flag == 4){
2978 ## reading in the next alignment, which must be the next sequence
2979 my $newline = $fhs[$index]->{fh}-> getline();
2980 if ($newline){
2981 chomp $newline;
2982 my ($seq_id) = split (/\t/,$newline);
2983 $fhs[$index]->{last_seq_id} = $seq_id;
2984 $fhs[$index]->{last_line} = $newline;
2985 if ($seq_id eq $identifier){
2986 die "Sequence with ID $identifier did not produce any alignment, but next seq-ID was also $fhs[$index]->{last_seq_id}!\n";
2987 }
2988 next; # next instance
2989 }
2990 else{
2991 # assigning undef to last_seq_id and last_line and jumping to the next index (end of Bowtie 2 output)
2992 $fhs[$index]->{last_seq_id} = undef;
2993 $fhs[$index]->{last_line} = undef;
2994 next;
2995 }
2996 }
2997
2998 # if there are one or more proper alignments we can extract the chromosome number
2999 my $chromosome;
3000 if ($mapped_chromosome =~ s/_(CT|GA)_converted$//){
3001 $chromosome = $mapped_chromosome;
3002 }
3003 else{
3004 die "Chromosome number extraction failed for $mapped_chromosome\n";
3005 }
3006
3007 ### We will use the optional field to determine the best alignment. Later on we extract the number of mismatches and/or indels from the CIGAR string
3008 my ($alignment_score,$second_best,$MD_tag);
3009 my @fields = split (/\t/,$fhs[$index]->{last_line});
3010
3011 foreach (11..$#fields){
3012 if ($fields[$_] =~ /AS:i:(.*)/){
3013 $alignment_score = $1;
3014 }
3015 elsif ($fields[$_] =~ /XS:i:(.*)/){
3016 $second_best = $1;
3017 }
3018 elsif ($fields[$_] =~ /MD:Z:(.*)/){
3019 $MD_tag = $1;
3020 }
3021 }
3022
3023 my $overwrite = 0; # If we get 2 alignments to the very same position, e.g. to OT with and AS of -156 and to CTOB with and AS of 0 we need the latter to trump the former, else
3024 # the read will be assigned to the wrong strand which may result in incorrect methylation calls.
3025 # this was brought to our attention by Sylvain Foret (ANU Canberra), 13 April 2016
3026
3027 if (!defined $best_AS_so_far){
3028 $best_AS_so_far = $alignment_score;
3029 $overwrite++;
3030 # warn "First alignment score, setting \$best_AS_so_far to $best_AS_so_far\n";
3031 if ($ambig_bam){ # also setting the first_ambig_alignment
3032 $first_ambig_alignment = $fhs[$index]->{last_line};
3033 $first_ambig_alignment =~ s/_(CT|GA)_converted//;
3034 # warn "$first_ambig_alignment\n"; sleep(1);
3035 }
3036 }
3037 else{
3038 if ($alignment_score >= $best_AS_so_far){ # AS are generally negative with a maximum of 0;
3039 # 19 07 2016: changed this to >= so that equally good alignments are also added. Ambiguous alignments from different threads will be identified later on
3040 $best_AS_so_far = $alignment_score;
3041 $overwrite++;
3042 # warn "Found better or equal alignment score ($alignment_score), setting \$best_AS_so_far to $best_AS_so_far\n";
3043
3044 # 22 07 2016: resetting the ambiguous score within same thread only if the current alignment is really better than the previous one
3045 if ($alignment_score > $best_AS_so_far){
3046 # warn "Resetting amb within thread value to 0\n";
3047 $amb_same_thread = 0;
3048
3049 if ($ambig_bam){ # also setting a new first_ambig_alignment
3050 $first_ambig_alignment = $fhs[$index]->{last_line};
3051 $first_ambig_alignment =~ s/_(CT|GA)_converted//;
3052 # warn "$first_ambig_alignment\n"; sleep(1);
3053 }
3054 }
3055 }
3056 else{
3057 # warn "Current alignment (AS $alignment_score) isn't better than the best so far ($best_AS_so_far). Not changing anything\n";
3058 }
3059 }
3060
3061 # warn "First best alignment_score is: '$alignment_score'\n";
3062 # warn "MD tag is: '$MD_tag'\n";
3063 die "Failed to extract alignment score ($alignment_score) and MD tag ($MD_tag) from line $fhs[$index]->{last_line}!\n" unless (defined $alignment_score and defined $MD_tag);
3064
3065 if (defined $second_best){
3066 # warn "second best alignment_score is: '$second_best'\n\n";
3067
3068 # If the first alignment score is the same as the alignment score of the second best hit we keep a memory of this
3069 if ($alignment_score == $second_best){
3070
3071 # checking to see if this read produced the best alignment
3072 if ($alignment_score == $best_AS_so_far){ # yes this read is the best one so far, however it is ambiguous
3073 # warn "Read is ambiguous within the same thread, or otherwise as good as the best one so far. Setting \$amb_same_thread to 1 for currently best AS: $best_AS_so_far\n";
3074 $amb_same_thread = 1;
3075 }
3076 else{
3077 # warn "This read has a worse alignments score than the best alignment so far and will be ignored even though it is ambiguous in itself\n";
3078 }
3079
3080 ### if there is a better alignment later on -> fine. If not, the read will get booted altogether
3081
3082 ## need to read and discard all additional ambiguous reads until we reach the next sequence
3083 until ($fhs[$index]->{last_seq_id} ne $identifier){
3084 my $newline = $fhs[$index]->{fh}-> getline();
3085 if ($newline){
3086 chomp $newline;
3087 my ($seq_id) = split (/\t/,$newline);
3088 $fhs[$index]->{last_seq_id} = $seq_id;
3089 $fhs[$index]->{last_line} = $newline;
3090 }
3091 else{
3092 # assigning undef to last_seq_id and last_line and jumping to the next index (end of Bowtie 2 output)
3093 $fhs[$index]->{last_seq_id} = undef;
3094 $fhs[$index]->{last_line} = undef;
3095 last; # break free in case we have reached the end of the alignment output
3096 }
3097 }
3098 # warn "Index: $index\tThe current Seq-ID is $identifier, skipped all ambiguous sequences until the next ID which is: $fhs[$index]->{last_seq_id}\n";
3099 }
3100 else{ # the next best alignment has a lower alignment score than the current read, so we can safely store the current alignment
3101
3102 my $alignment_location = join (":",$chromosome,$position);
3103
3104 ### If a sequence aligns to exactly the same location with a perfect match twice the sequence does either not contain any C or G, or all the Cs (or Gs on the reverse
3105 ### strand) were methylated and therefore protected. Alternatively it will align better in one condition than in the other. In any case, it is not needed to overwrite
3106 ### the same positional entry with a second entry for the same location, as the genomic sequence extraction and methylation call would not be affected by this. The only
3107 ### thing which would change is the index number for the found alignment). We will continue to assign these alignments to the first indexes 0 and 1, i.e. OT and OB
3108
3109 if ($overwrite){
3110 $alignments{$alignment_location}->{seq_id} = $id;
3111 $alignments{$alignment_location}->{alignment_score} = $alignment_score;
3112 $alignments{$alignment_location}->{alignment_score_second_best} = $second_best;
3113 $alignments{$alignment_location}->{bowtie_sequence} = $bowtie_sequence;
3114 $alignments{$alignment_location}->{index} = $index;
3115 $alignments{$alignment_location}->{chromosome} = $chromosome;
3116 $alignments{$alignment_location}->{position} = $position;
3117 $alignments{$alignment_location}->{CIGAR} = $cigar;
3118 $alignments{$alignment_location}->{MD_tag} = $MD_tag;
3119 }
3120
3121 ### now reading and discarding all (inferior) alignments of this sequencing read until we hit the next sequence
3122 until ($fhs[$index]->{last_seq_id} ne $identifier){
3123 my $newline = $fhs[$index]->{fh}-> getline();
3124 if ($newline){
3125 chomp $newline;
3126 my ($seq_id) = split (/\t/,$newline);
3127 $fhs[$index]->{last_seq_id} = $seq_id;
3128 $fhs[$index]->{last_line} = $newline;
3129 }
3130 else{
3131 # assigning undef to last_seq_id and last_line and jumping to the next index (end of Bowtie 2 output)
3132 $fhs[$index]->{last_seq_id} = undef;
3133 $fhs[$index]->{last_line} = undef;
3134 last; # break free in case we have reached the end of the alignment output
3135 }
3136 }
3137 # warn "Index: $index\tThe current Seq-ID is $identifier, skipped all ambiguous sequences until the next ID which is: $fhs[$index]->{last_seq_id}\n";
3138 }
3139 }
3140 else{ # there is no second best hit, so we can just store this one and read in the next sequence
3141
3142 my $alignment_location = join (":",$chromosome,$position);
3143 # warn "There is no second best hit. Overwrite status: $overwrite\n";
3144 ### If a sequence aligns to exactly the same location with a perfect match twice the sequence does either not contain any C or G, or all the Cs (or Gs on the reverse
3145 ### strand) were methylated and therefore protected. Alternatively it will align better in one condition than in the other. In any case, it is not needed to overwrite
3146 ### the same positional entry with a second entry for the same location, as the genomic sequence extraction and methylation call would not be affected by this. The only
3147 ### thing which would change is the index number for the found alignment). We will continue to assign these alignments to the first indexes 0 and 1, i.e. OT and OB
3148
3149 if ($overwrite){
3150 $alignments{$alignment_location}->{seq_id} = $id;
3151 $alignments{$alignment_location}->{alignment_score} = $alignment_score;
3152 $alignments{$alignment_location}->{alignment_score_second_best} = undef;
3153 $alignments{$alignment_location}->{bowtie_sequence} = $bowtie_sequence;
3154 $alignments{$alignment_location}->{index} = $index;
3155 $alignments{$alignment_location}->{chromosome} = $chromosome;
3156 $alignments{$alignment_location}->{position} = $position;
3157 $alignments{$alignment_location}->{MD_tag} = $MD_tag;
3158 $alignments{$alignment_location}->{CIGAR} = $cigar;
3159 }
3160
3161 my $newline = $fhs[$index]->{fh}-> getline();
3162 if ($newline){
3163 chomp $newline;
3164 my ($seq_id) = split (/\t/,$newline);
3165 $fhs[$index]->{last_seq_id} = $seq_id;
3166 $fhs[$index]->{last_line} = $newline;
3167 if ($seq_id eq $identifier){
3168 die "Sequence with ID $identifier did not have a second best alignment, but next seq-ID was also $fhs[$index]->{last_seq_id}!\n";
3169 }
3170 }
3171 else{
3172 # assigning undef to last_seq_id and last_line and jumping to the next index (end of Bowtie 2 output)
3173 $fhs[$index]->{last_seq_id} = undef;
3174 $fhs[$index]->{last_line} = undef;
3175 }
3176 }
3177 }
3178 }
3179
3180 ### If there were several equally good alignments for the best alignment score we will boot the read
3181 if ($amb_same_thread){
3182 $alignment_ambiguous = 1;
3183 # warn "\$alignment_ambiguous now: $alignment_ambiguous\n";
3184 }
3185 else{
3186 # warn "alignment won't be considered ambiguous. This time....\n";
3187 }
3188
3189 ### if the read produced several ambiguous alignments already now can returning already now. If --ambiguous or --unmapped was specified the read sequence will be printed out.
3190 if ($alignment_ambiguous == 1){
3191 $counting{unsuitable_sequence_count}++;
3192 ### report that the sequence has multiple hits with bitwise flag 256. We can print the sequence to the result file straight away and skip everything else
3193 # my $ambiguous_read_output = join("\t",$identifier,'256','*','0','0','*','*','0','0',$sequence,$quality_value);
3194 # print "$ambiguous_read_output\n";
3195
3196 if ($ambig_bam){
3197 # warn "Sequence is ambiguous, printing out BAM file:\n";
3198 print AMBIBAM "$first_ambig_alignment\n";
3199 }
3200
3201 if ($ambiguous){
3202 return 2; # => exits to next sequence, and prints it out to _ambiguous_reads.txt if '--ambiguous' was specified
3203 }
3204 elsif ($unmapped){
3205 return 1; # => exits to next sequence, and prints it out to _unmapped_reads.txt if '--unmapped' but not '--ambiguous' was specified
3206 }
3207 else{
3208 return 0;
3209 }
3210 }
3211
3212 ### if there was no alignment found for a certain sequence at all we continue with the next sequence in the sequence file
3213 unless(%alignments){
3214 $counting{no_single_alignment_found}++;
3215 # my $unmapped_read_output = join("\t",$identifier,'4','*','0','0','*','*','0','0',$sequence,$quality_value);
3216 # print "$unmapped_read_output\n";
3217 if ($unmapped){
3218 return 1; # => exits to next sequence, and prints it out to _unmapped_reads.txt if '--unmapped' was specified
3219 }
3220 else{
3221 return 0; # default
3222 }
3223 }
3224
3225 #######################################################################################################################################################
3226
3227 ### If the sequence was not rejected so far we are now looking if there is a unique best alignment among all alignment instances. If there is only one
3228 ### single best position we are going to store the alignment information in the $meth_call variable. If there are multiple hits with the same (highest)
3229 ### alignment score we are discarding the sequence altogether.
3230 ### For end-to-end alignments the maximum alignment score can be 0, each mismatch can receive penalties up to 6, and each gap receives penalties for
3231 ### opening (5) and extending (3 per bp) the gap.
3232
3233 #######################################################################################################################################################
3234
3235 my $methylation_call_params; # hash reference which will store all information we need for the methylation call
3236 my $sequence_fails = 0; # Going to use $sequence_fails as a 'memory' if a sequence could not be aligned uniquely (set to 1 then)
3237
3238 ### print contents of %alignments for debugging
3239 # if (scalar keys %alignments > 1){
3240 # print "\n******\n";
3241 # foreach my $alignment_location (sort {$a cmp $b} keys %alignments){
3242 # print "Loc: $alignment_location\n";
3243 # print "ID: $alignments{$alignment_location}->{seq_id}\n";
3244 # print "AS: $alignments{$alignment_location}->{alignment_score}\n";
3245 # print "Seq: $alignments{$alignment_location}->{bowtie_sequence}\n";
3246 # print "Index $alignments{$alignment_location}->{index}\n";
3247 # print "Chr: $alignments{$alignment_location}->{chromosome}\n";
3248 # print "pos: $alignments{$alignment_location}->{position}\n";
3249 # print "MD: $alignments{$alignment_location}->{MD_tag}\n\n";
3250 # }
3251 # print "\n******\n";
3252 # }
3253
3254 ### if there is only 1 entry in the hash with we accept it as the best alignment
3255 if (scalar keys %alignments == 1){
3256 for my $unique_best_alignment (keys %alignments){
3257 $methylation_call_params->{$identifier}->{bowtie_sequence} = $alignments{$unique_best_alignment}->{bowtie_sequence};
3258 $methylation_call_params->{$identifier}->{chromosome} = $alignments{$unique_best_alignment}->{chromosome};
3259 $methylation_call_params->{$identifier}->{position} = $alignments{$unique_best_alignment}->{position};
3260 $methylation_call_params->{$identifier}->{index} = $alignments{$unique_best_alignment}->{index};
3261 $methylation_call_params->{$identifier}->{alignment_score} = $alignments{$unique_best_alignment}->{alignment_score};
3262 $methylation_call_params->{$identifier}->{alignment_score_second_best} = $alignments{$unique_best_alignment}->{alignment_score_second_best};
3263 $methylation_call_params->{$identifier}->{MD_tag} = $alignments{$unique_best_alignment}->{MD_tag};
3264 $methylation_call_params->{$identifier}->{CIGAR} = $alignments{$unique_best_alignment}->{CIGAR};
3265 }
3266 }
3267
3268 ### otherwise we are going to find out if there is a best match among the multiple alignments, or whether there are 2 or more equally good alignments (in which case
3269 ### we boot the sequence altogether
3270 elsif (scalar keys %alignments >= 2 and scalar keys %alignments <= 4){
3271 my $best_alignment_score;
3272 my $best_alignment_location;
3273 foreach my $alignment_location (sort {$alignments{$b}->{alignment_score} <=> $alignments{$a}->{alignment_score}} keys %alignments){
3274 # print "$alignments{$alignment_location}->{alignment_score}\n";
3275 unless (defined $best_alignment_score){
3276 $best_alignment_score = $alignments{$alignment_location}->{alignment_score};
3277 $best_alignment_location = $alignment_location;
3278 # print "setting best alignment score: $best_alignment_score\n";
3279 }
3280 else{
3281 ### if the second best alignment has the same alignment score as the first one, the sequence will get booted
3282 if ($alignments{$alignment_location}->{alignment_score} == $best_alignment_score){
3283 # warn "Same alignment score, the sequence will get booted!\n";
3284 $sequence_fails = 1;
3285 last; # exiting after the second alignment since we know that the sequence has ambiguous alignments
3286 }
3287 ### else we are going to store the best alignment for further processing
3288 else{
3289 $methylation_call_params->{$identifier}->{bowtie_sequence} = $alignments{$best_alignment_location}->{bowtie_sequence};
3290 $methylation_call_params->{$identifier}->{chromosome} = $alignments{$best_alignment_location}->{chromosome};
3291 $methylation_call_params->{$identifier}->{position} = $alignments{$best_alignment_location}->{position};
3292 $methylation_call_params->{$identifier}->{index} = $alignments{$best_alignment_location}->{index};
3293 $methylation_call_params->{$identifier}->{alignment_score} = $alignments{$best_alignment_location}->{alignment_score};
3294 $methylation_call_params->{$identifier}->{MD_tag} = $alignments{$best_alignment_location}->{MD_tag};
3295 $methylation_call_params->{$identifier}->{CIGAR} = $alignments{$best_alignment_location}->{CIGAR};
3296 if (defined $alignments{$best_alignment_location}->{alignment_score_second_best} and $alignments{$best_alignment_location}-> {alignment_score_second_best} > $alignments{$alignment_location}->{alignment_score}) {
3297 $methylation_call_params->{$identifier}->{alignment_score_second_best} = $alignments{$best_alignment_location}->{alignment_score_second_best};
3298 }
3299 else {
3300 $methylation_call_params->{$identifier}->{alignment_score_second_best} = $alignments{$alignment_location}->{alignment_score};
3301 }
3302 last; # exiting after processing the second alignment since the sequence produced a unique best alignment
3303 }
3304 }
3305 }
3306 }
3307 else{
3308 die "There are too many potential hits for this sequence (1-4 expected, but found: ",scalar keys %alignments,")\n";;
3309 }
3310
3311 ### skipping the sequence completely if there were multiple alignments with the same best alignment score at different positions
3312 if ($sequence_fails == 1){
3313 $counting{unsuitable_sequence_count}++;
3314
3315 ### report that the sequence has multiple hits with bitwise flag 256. We can print the sequence to the result file straight away and skip everything else
3316 # my $ambiguous_read_output = join("\t",$identifier,'256','*','0','0','*','*','0','0',$sequence,$quality_value);
3317 # print OUT "$ambiguous_read_output\n";
3318
3319 if ($ambiguous){
3320 return 2; # => exits to next sequence, and prints it out (in FastQ format) to _ambiguous_reads.txt if '--ambiguous' was specified
3321 }
3322 elsif ($unmapped){
3323 return 1; # => exits to next sequence, and prints it out (in FastQ format) to _unmapped_reads.txt if '--unmapped' but not '--ambiguous' was specified
3324 }
3325 else{
3326 return 0; # => exits to next sequence (default)
3327 }
3328 }
3329
3330 ### --DIRECTIONAL
3331 ### If the option --directional has been specified the user wants to consider only alignments to the original top strand or the original bottom strand. We will therefore
3332 ### discard all alignments to strands complementary to the original strands, as they should not exist in reality due to the library preparation protocol
3333 if ($directional){
3334 if ( ($methylation_call_params->{$identifier}->{index} == 2) or ($methylation_call_params->{$identifier}->{index} == 3) ){
3335 # warn "Alignment rejected! (index was: $methylation_call_params->{$identifier}->{index})\n";
3336 $counting{alignments_rejected_count}++;
3337 return 0;
3338 }
3339 }
3340
3341 ### If the sequence has not been rejected so far it has a unique best alignment
3342 $counting{unique_best_alignment_count}++;
3343
3344 ### Now we need to extract a genomic sequence that exactly corresponds to the reported alignment. This potentially means that we need to deal with insertions or deletions as well
3345 extract_corresponding_genomic_sequence_single_end_bowtie2 ($identifier,$methylation_call_params);
3346
3347 ### check test to see if the genomic sequence we extracted has the same length as the observed sequence+2, and only then we perform the methylation call
3348 if (length($methylation_call_params->{$identifier}->{unmodified_genomic_sequence}) != length($sequence)+2){
3349 warn "Chromosomal sequence could not be extracted for\t$identifier\t$methylation_call_params->{$identifier}->{chromosome}\t$methylation_call_params->{$identifier}->{position}\n";
3350 $counting{genomic_sequence_could_not_be_extracted_count}++;
3351 return 0;
3352 }
3353
3354 # Compute MAPQ value
3355 $methylation_call_params->{$identifier}->{mapq} = calc_mapq (length($sequence), undef,
3356 $methylation_call_params->{$identifier}->{alignment_score},
3357 $methylation_call_params->{$identifier}->{alignment_score_second_best});
3358
3359
3360
3361 ### otherwise we are set to perform the actual methylation call
3362 $methylation_call_params->{$identifier}->{methylation_call} = methylation_call($identifier,$sequence,$methylation_call_params->{$identifier}->{unmodified_genomic_sequence},$methylation_call_params->{$identifier}->{read_conversion});
3363 print_bisulfite_mapping_result_single_end_bowtie2 ($identifier,$sequence,$methylation_call_params,$quality_value);
3364 return 0; ## if a sequence got this far we do not want to print it to unmapped or ambiguous.out
3365 }
3366
3367
3368 sub determine_number_of_transliterations_performed{
3369 my ($sequence,$read_conversion) = @_;
3370 my $number_of_transliterations;
3371 if ($read_conversion eq 'CT'){
3372 $number_of_transliterations = $sequence =~ tr/C/T/;
3373 }
3374 elsif ($read_conversion eq 'GA'){
3375 $number_of_transliterations = $sequence =~ tr/G/A/;
3376 }
3377 else{
3378 die "Read conversion mode of the read was not specified $!\n";
3379 }
3380 return $number_of_transliterations;
3381 }
3382
3383 sub decide_whether_single_end_alignment_is_valid{
3384 my ($index,$identifier) = @_;
3385
3386 # extracting from Bowtie 1 format
3387 my ($id,$strand) = (split (/\t/,$fhs[$index]->{last_line}))[0,1];
3388
3389 ### ensuring that the entry is the correct sequence
3390 if (($id eq $fhs[$index]->{last_seq_id}) and ($id eq $identifier)){
3391 ### checking the orientation of the alignment. We need to discriminate between 8 different conditions, however only 4 of them are theoretically
3392 ### sensible alignments
3393 my $orientation = ensure_sensical_alignment_orientation_single_end ($index,$strand);
3394 ### If the orientation was correct can we move on
3395 if ($orientation == 1){
3396 return 1; ### 1st possibility for a sequence to pass
3397 }
3398 ### If the alignment was in the wrong orientation we need to read in a new line
3399 elsif($orientation == 0){
3400 my $newline = $fhs[$index]->{fh}->getline();
3401 if ($newline){
3402 ($id,$strand) = (split (/\t/,$newline))[0,1];
3403
3404 ### ensuring that the next entry is still the correct sequence
3405 if ($id eq $identifier){
3406 ### checking orientation again
3407 $orientation = ensure_sensical_alignment_orientation_single_end ($index,$strand);
3408 ### If the orientation was correct can we move on
3409 if ($orientation == 1){
3410 $fhs[$index]->{last_seq_id} = $id;
3411 $fhs[$index]->{last_line} = $newline;
3412 return 1; ### 2nd possibility for a sequence to pass
3413 }
3414 ### If the alignment was in the wrong orientation again we need to read in yet another new line and store it in @fhs
3415 elsif ($orientation == 0){
3416 $newline = $fhs[$index]->{fh}->getline();
3417 if ($newline){
3418 my ($seq_id) = split (/\t/,$newline);
3419 ### check if the next line still has the same seq ID (must not happen), and if not overwrite the current seq-ID and bowtie output with
3420 ### the same fields of the just read next entry
3421 die "Same seq ID 3 or more times in a row!(should be 2 max) $!" if ($seq_id eq $identifier);
3422 $fhs[$index]->{last_seq_id} = $seq_id;
3423 $fhs[$index]->{last_line} = $newline;
3424 return 0; # not processing anything this round as the alignment currently stored in last_line was in the wrong orientation
3425 }
3426 else{
3427 # assigning undef to last_seq_id and last_line (end of bowtie output)
3428 $fhs[$index]->{last_seq_id} = undef;
3429 $fhs[$index]->{last_line} = undef;
3430 return 0; # not processing anything as the alignment currently stored in last_line was in the wrong orientation
3431 }
3432 }
3433 else{
3434 die "The orientation of the alignment must be either correct or incorrect\n";
3435 }
3436 }
3437 ### the sequence we just read in is already the next sequence to be analysed -> store it in @fhs
3438 else{
3439 $fhs[$index]->{last_seq_id} = $id;
3440 $fhs[$index]->{last_line} = $newline;
3441 return 0; # processing the new alignment result only in the next round
3442 }
3443 }
3444 else {
3445 # assigning undef to last_seq_id and last_line (end of bowtie output)
3446 $fhs[$index]->{last_seq_id} = undef;
3447 $fhs[$index]->{last_line} = undef;
3448 return 0; # not processing anything as the alignment currently stored in last_line was in the wrong orientation
3449 }
3450 }
3451 else{
3452 die "The orientation of the alignment must be either correct or incorrect\n";
3453 }
3454 }
3455 ### the sequence stored in @fhs as last_line is already the next sequence to be analysed -> analyse next round
3456 else{
3457 return 0;
3458 }
3459 }
3460 #########################
3461 ### BOWTIE 1 | PAIRED-END
3462 #########################
3463
3464 sub check_bowtie_results_paired_ends{
3465 my ($sequence_1,$sequence_2,$identifier,$quality_value_1,$quality_value_2) = @_;
3466
3467 ### quality values are not given for FastA files, so they are initialised with a Phred quality of 40
3468 unless ($quality_value_1){
3469 $quality_value_1 = 'I'x(length$sequence_1);
3470 }
3471 unless ($quality_value_2){
3472 $quality_value_2 = 'I'x(length$sequence_2);
3473 }
3474
3475 # warn "$identifier\n$fhs[0]->{last_seq_id}\n$fhs[1]->{last_seq_id}\n$fhs[2]->{last_seq_id}\n$fhs[3]->{last_seq_id}\n\n";
3476 # sleep (1);
3477 my %mismatches = ();
3478 ### reading from the bowtie output files to see if this sequence pair aligned to a bisulfite converted genome
3479
3480
3481 ### for paired end reads we are reporting alignments to the OT strand first (index 0), then the OB strand (index 3!!), similiar to the single end way.
3482 ### alignments to the complementary strands are reported afterwards (CTOT got index 1, and CTOB got index 2).
3483 ### This is needed so that alignments which either contain no single C or G or reads which contain only protected Cs are reported to the original strands (OT and OB)
3484 ### Before the complementary strands. Remember that it does not make any difference for the methylation calls, but it will matter if alignment to the complementary
3485 ### strands are not being reported by specifying --directional
3486
3487 foreach my $index (0,3,1,2){
3488 ### skipping this index if the last alignment has been set to undefined already (i.e. end of bowtie output)
3489 next unless ($fhs[$index]->{last_line_1} and $fhs[$index]->{last_line_2} and defined $fhs[$index]->{last_seq_id});
3490 ### if the sequence pair we are currently looking at produced an alignment we are doing various things with it
3491 if ($fhs[$index]->{last_seq_id} eq $identifier) {
3492 # print "$identifier\n$fhs[$index]->{last_seq_id}\n\n";
3493
3494 ##################################################################################
3495 ### STEP I Processing the entry which is stored in last_line_1 and last_line_2 ###
3496 ##################################################################################
3497 my $valid_alignment_found = decide_whether_paired_end_alignment_is_valid($index,$identifier);
3498 ### sequences can fail at this point if there was only 1 alignment in the wrong orientation, or if there were 2 aligments both in the wrong
3499 ### orientation. We only continue to extract useful information about this alignment if 1 was returned
3500 if ($valid_alignment_found == 1){
3501 ### Bowtie outputs which made it this far are in the correct orientation, so we can continue to analyse the alignment itself.
3502 ### we store the useful information in %mismatches
3503 my ($id_1,$strand_1,$mapped_chromosome_1,$position_1,$bowtie_sequence_1,$mismatch_info_1) = (split (/\t/,$fhs[$index]->{last_line_1},-1))[0,1,2,3,4,7];
3504 my ($id_2,$strand_2,$mapped_chromosome_2,$position_2,$bowtie_sequence_2,$mismatch_info_2) = (split (/\t/,$fhs[$index]->{last_line_2},-1))[0,1,2,3,4,7];
3505 chomp $mismatch_info_1;
3506 chomp $mismatch_info_2;
3507
3508 ### need to extract the chromosome number from the bowtie output (which is either XY_CT_converted or XY_GA_converted
3509 my ($chromosome_1,$chromosome_2);
3510 if ($mapped_chromosome_1 =~ s/_(CT|GA)_converted$//){
3511 $chromosome_1 = $mapped_chromosome_1;
3512 }
3513 else{
3514 die "Chromosome number extraction failed for $mapped_chromosome_1\n";
3515 }
3516 if ($mapped_chromosome_2 =~ s/_(CT|GA)_converted$//){
3517 $chromosome_2 = $mapped_chromosome_2;
3518 }
3519 else{
3520 die "Chromosome number extraction failed for $mapped_chromosome_2\n";
3521 }
3522
3523 ### Now extracting the number of mismatches to the converted genome
3524 my $number_of_mismatches_1;
3525 my $number_of_mismatches_2;
3526 if ($mismatch_info_1 eq ''){
3527 $number_of_mismatches_1 = 0;
3528 }
3529 elsif ($mismatch_info_1 =~ /^\d/){
3530 my @mismatches = split (/,/,$mismatch_info_1);
3531 $number_of_mismatches_1 = scalar @mismatches;
3532 }
3533 else{
3534 die "Something weird is going on with the mismatch field\n";
3535 }
3536 if ($mismatch_info_2 eq ''){
3537 $number_of_mismatches_2 = 0;
3538 }
3539 elsif ($mismatch_info_2 =~ /^\d/){
3540 my @mismatches = split (/,/,$mismatch_info_2);
3541 $number_of_mismatches_2 = scalar @mismatches;
3542 }
3543 else{
3544 die "Something weird is going on with the mismatch field\n";
3545 }
3546 ### To decide whether a sequence pair has a unique best alignment we will look at the lowest sum of mismatches from both alignments
3547 my $sum_of_mismatches = $number_of_mismatches_1+$number_of_mismatches_2;
3548 ### creating a composite location variable from $chromosome and $position and storing the alignment information in a temporary hash table
3549 die "Position 1 is higher than position 2" if ($position_1 > $position_2);
3550 die "Paired-end alignments need to be on the same chromosome\n" unless ($chromosome_1 eq $chromosome_2);
3551 my $alignment_location = join(":",$chromosome_1,$position_1,$position_2);
3552 ### If a sequence aligns to exactly the same location twice the sequence does either not contain any C or G, or all the Cs (or Gs on the reverse
3553 ### strand) were methylated and therefore protected. It is not needed to overwrite the same positional entry with a second entry for the same
3554 ### location (the genomic sequence extraction and methylation would not be affected by this, only the thing which would change is the index
3555 ### number for the found alignment)
3556 unless (exists $mismatches{$sum_of_mismatches}->{$alignment_location}){
3557 $mismatches{$sum_of_mismatches}->{$alignment_location}->{seq_id}=$id_1; # either is fine
3558 $mismatches{$sum_of_mismatches}->{$alignment_location}->{bowtie_sequence_1}=$bowtie_sequence_1;
3559 $mismatches{$sum_of_mismatches}->{$alignment_location}->{bowtie_sequence_2}=$bowtie_sequence_2;
3560 $mismatches{$sum_of_mismatches}->{$alignment_location}->{index}=$index;
3561 $mismatches{$sum_of_mismatches}->{$alignment_location}->{chromosome}=$chromosome_1; # either is fine
3562 $mismatches{$sum_of_mismatches}->{$alignment_location}->{start_seq_1}=$position_1;
3563 $mismatches{$sum_of_mismatches}->{$alignment_location}->{start_seq_2}=$position_2;
3564 $mismatches{$sum_of_mismatches}->{$alignment_location}->{number_of_mismatches_1} = $number_of_mismatches_1;
3565 $mismatches{$sum_of_mismatches}->{$alignment_location}->{number_of_mismatches_2} = $number_of_mismatches_2;
3566 }
3567 ###################################################################################################################################################
3568 ### STEP II Now reading in the next 2 lines from the bowtie filehandle. If there are 2 next lines in the alignments filehandle it can either ###
3569 ### be a second alignment of the same sequence pair or a new sequence pair. In any case we will just add it to last_line_1 and last_line _2. ###
3570 ### If it is the alignment of the next sequence pair, 0 will be returned as $valid_alignment_found, so it will not be processed any further in ###
3571 ### this round ###
3572 ###################################################################################################################################################
3573 my $newline_1 = $fhs[$index]->{fh}-> getline();
3574 my $newline_2 = $fhs[$index]->{fh}-> getline();
3575
3576 if ($newline_1 and $newline_2){
3577 my ($seq_id_1) = split (/\t/,$newline_1);
3578 my ($seq_id_2) = split (/\t/,$newline_2);
3579
3580 if ($seq_id_1 =~ s/\/1$//){ # removing the read /1 tag
3581 $fhs[$index]->{last_seq_id} = $seq_id_1;
3582 }
3583 elsif ($seq_id_2 =~ s/\/1$//){ # removing the read /1 tag
3584 $fhs[$index]->{last_seq_id} = $seq_id_2;
3585 }
3586 else{
3587 die "Either read 1 or read 2 needs to end on '/1'\n";
3588 }
3589
3590 $fhs[$index]->{last_line_1} = $newline_1;
3591 $fhs[$index]->{last_line_2} = $newline_2;
3592 }
3593 else {
3594 # assigning undef to last_seq_id and both last_lines and jumping to the next index (end of bowtie output)
3595 $fhs[$index]->{last_seq_id} = undef;
3596 $fhs[$index]->{last_line_1} = undef;
3597 $fhs[$index]->{last_line_2} = undef;
3598 next; # jumping to the next index
3599 }
3600 ### Now processing the entry we just stored in last_line_1 and last_line_2
3601 $valid_alignment_found = decide_whether_paired_end_alignment_is_valid($index,$identifier);
3602 ### only processing the alignment further if 1 was returned. 0 will be returned either if the alignment is already the next sequence pair to
3603 ### be analysed or if it was a second alignment of the current sequence pair but in the wrong orientation
3604 if ($valid_alignment_found == 1){
3605 ### we store the useful information in %mismatches
3606 ($id_1,$strand_1,$mapped_chromosome_1,$position_1,$bowtie_sequence_1,$mismatch_info_1) = (split (/\t/,$fhs[$index]->{last_line_1}))[0,1,2,3,4,7];
3607 ($id_2,$strand_2,$mapped_chromosome_2,$position_2,$bowtie_sequence_2,$mismatch_info_2) = (split (/\t/,$fhs[$index]->{last_line_2}))[0,1,2,3,4,7];
3608 chomp $mismatch_info_1;
3609 chomp $mismatch_info_2;
3610 ### need to extract the chromosome number from the bowtie output (which is either _CT_converted or _GA_converted)
3611 if ($mapped_chromosome_1 =~ s/_(CT|GA)_converted$//){
3612 $chromosome_1 = $mapped_chromosome_1;
3613 }
3614 else{
3615 die "Chromosome number extraction failed for $mapped_chromosome_1\n";
3616 }
3617 if ($mapped_chromosome_2 =~ s/_(CT|GA)_converted$//){
3618 $chromosome_2 = $mapped_chromosome_2;
3619 }
3620 else{
3621 die "Chromosome number extraction failed for $mapped_chromosome_2\n";
3622 }
3623
3624 $number_of_mismatches_1='';
3625 $number_of_mismatches_2='';
3626 ### Now extracting the number of mismatches to the converted genome
3627 if ($mismatch_info_1 eq ''){
3628 $number_of_mismatches_1 = 0;
3629 }
3630 elsif ($mismatch_info_1 =~ /^\d/){
3631 my @mismatches = split (/,/,$mismatch_info_1);
3632 $number_of_mismatches_1 = scalar @mismatches;
3633 }
3634 else{
3635 die "Something weird is going on with the mismatch field\n";
3636 }
3637 if ($mismatch_info_2 eq ''){
3638 $number_of_mismatches_2 = 0;
3639 }
3640 elsif ($mismatch_info_2 =~ /^\d/){
3641 my @mismatches = split (/,/,$mismatch_info_2);
3642 $number_of_mismatches_2 = scalar @mismatches;
3643 }
3644 else{
3645 die "Something weird is going on with the mismatch field\n";
3646 }
3647 ### To decide whether a sequence pair has a unique best alignment we will look at the lowest sum of mismatches from both alignments
3648 $sum_of_mismatches = $number_of_mismatches_1+$number_of_mismatches_2;
3649 ### creating a composite location variable from $chromosome and $position and storing the alignment information in a temporary hash table
3650 die "position 1 is greater than position 2" if ($position_1 > $position_2);
3651 die "Paired-end alignments need to be on the same chromosome\n" unless ($chromosome_1 eq $chromosome_2);
3652 $alignment_location = join(":",$chromosome_1,$position_1,$position_2);
3653 ### If a sequence aligns to exactly the same location twice the sequence does either not contain any C or G, or all the Cs (or Gs on the reverse
3654 ### strand) were methylated and therefore protected. It is not needed to overwrite the same positional entry with a second entry for the same
3655 ### location (the genomic sequence extraction and methylation would not be affected by this, only the thing which would change is the index
3656 ### number for the found alignment)
3657 unless (exists $mismatches{$sum_of_mismatches}->{$alignment_location}){
3658 $mismatches{$sum_of_mismatches}->{$alignment_location}->{seq_id}=$id_1; # either is fine
3659 $mismatches{$sum_of_mismatches}->{$alignment_location}->{bowtie_sequence_1}=$bowtie_sequence_1;
3660 $mismatches{$sum_of_mismatches}->{$alignment_location}->{bowtie_sequence_2}=$bowtie_sequence_2;
3661 $mismatches{$sum_of_mismatches}->{$alignment_location}->{index}=$index;
3662 $mismatches{$sum_of_mismatches}->{$alignment_location}->{chromosome}=$chromosome_1; # either is fine
3663 $mismatches{$sum_of_mismatches}->{$alignment_location}->{start_seq_1}=$position_1;
3664 $mismatches{$sum_of_mismatches}->{$alignment_location}->{start_seq_2}=$position_2;
3665 $mismatches{$sum_of_mismatches}->{$alignment_location}->{number_of_mismatches_1} = $number_of_mismatches_1;
3666 $mismatches{$sum_of_mismatches}->{$alignment_location}->{number_of_mismatches_2} = $number_of_mismatches_2;
3667 }
3668 ###############################################################################################################################################
3669 ### STEP III Now reading in two more lines. These have to be the next entry and we will just add assign them to last_line_1 and last_line_2 ###
3670 ###############################################################################################################################################
3671 $newline_1 = $fhs[$index]->{fh}-> getline();
3672 $newline_2 = $fhs[$index]->{fh}-> getline();
3673
3674 if ($newline_1 and $newline_2){
3675 my ($seq_id_1) = split (/\t/,$newline_1);
3676 my ($seq_id_2) = split (/\t/,$newline_2);
3677
3678 if ($seq_id_1 =~ s/\/1$//){ # removing the read /1 tag
3679 $fhs[$index]->{last_seq_id} = $seq_id_1;
3680 }
3681 if ($seq_id_2 =~ s/\/1$//){ # removing the read /1 tag
3682 $fhs[$index]->{last_seq_id} = $seq_id_2;
3683 }
3684 $fhs[$index]->{last_line_1} = $newline_1;
3685 $fhs[$index]->{last_line_2} = $newline_2;
3686 }
3687 else {
3688 # assigning undef to last_seq_id and both last_lines and jumping to the next index (end of bowtie output)
3689 $fhs[$index]->{last_seq_id} = undef;
3690 $fhs[$index]->{last_line_1} = undef;
3691 $fhs[$index]->{last_line_2} = undef;
3692 next; # jumping to the next index
3693 }
3694 ### within the 2nd sequence pair alignment in correct orientation found
3695 }
3696 ### within the 1st sequence pair alignment in correct orientation found
3697 }
3698 ### still within the (last_seq_id eq identifier) condition
3699 }
3700 ### still within foreach index loop
3701 }
3702 ### if there was no single alignment found for a certain sequence we will continue with the next sequence in the sequence file
3703 unless(%mismatches){
3704 $counting{no_single_alignment_found}++;
3705 return 1; ### We will print this sequence out as unmapped sequence if --un unmapped.out has been specified
3706 }
3707 ### Going to use the variable $sequence_pair_fails as a 'memory' if a sequence could not be aligned uniquely (set to 1 then)
3708 my $sequence_pair_fails = 0;
3709 ### Declaring an empty hash reference which will store all information we need for the methylation call
3710 my $methylation_call_params; # hash reference!
3711 ### We are now looking if there is a unique best alignment for a certain sequence. This means we are sorting in ascending order and look at the
3712 ### sequence with the lowest amount of mismatches. If there is only one single best position we are going to store the alignment information in the
3713 ### meth_call variables, if there are multiple hits with the same amount of (lowest) mismatches we are discarding the sequence altogether
3714 foreach my $mismatch_number (sort {$a<=>$b} keys %mismatches){
3715 #dev print "Number of mismatches: $mismatch_number\t$identifier\t$sequence_1\t$sequence_2\n";
3716 foreach my $entry (keys (%{$mismatches{$mismatch_number}}) ){
3717 #dev print "$mismatch_number\t$entry\t$mismatches{$mismatch_number}->{$entry}->{index}\n";
3718 # print join("\t",$mismatch_number,$mismatches{$mismatch_number}->{$entry}->{seq_id},$sequence,$mismatches{$mismatch_number}->{$entry}->{bowtie_sequence},$mismatches{$mismatch_number}->{$entry}->{chromosome},$mismatches{$mismatch_number}->{$entry}->{position},$mismatches{$mismatch_number}->{$entry}->{index}),"\n";
3719 }
3720 if (scalar keys %{$mismatches{$mismatch_number}} == 1){
3721 # print "Unique best alignment for sequence pair $sequence_1\t$sequence_1\n";
3722 for my $unique_best_alignment (keys %{$mismatches{$mismatch_number}}){
3723 $methylation_call_params->{$identifier}->{seq_id} = $identifier;
3724 $methylation_call_params->{$identifier}->{bowtie_sequence_1} = $mismatches{$mismatch_number}->{$unique_best_alignment}->{bowtie_sequence_1};
3725 $methylation_call_params->{$identifier}->{bowtie_sequence_2} = $mismatches{$mismatch_number}->{$unique_best_alignment}->{bowtie_sequence_2};
3726 $methylation_call_params->{$identifier}->{chromosome} = $mismatches{$mismatch_number}->{$unique_best_alignment}->{chromosome};
3727 $methylation_call_params->{$identifier}->{start_seq_1} = $mismatches{$mismatch_number}->{$unique_best_alignment}->{start_seq_1};
3728 $methylation_call_params->{$identifier}->{start_seq_2} = $mismatches{$mismatch_number}->{$unique_best_alignment}->{start_seq_2};
3729 $methylation_call_params->{$identifier}->{alignment_end} = ($mismatches{$mismatch_number}->{$unique_best_alignment}->{start_seq_2}+length($mismatches{$mismatch_number}->{$unique_best_alignment}->{bowtie_sequence_2}));
3730 $methylation_call_params->{$identifier}->{index} = $mismatches{$mismatch_number}->{$unique_best_alignment}->{index};
3731 $methylation_call_params->{$identifier}->{number_of_mismatches_1} = $mismatches{$mismatch_number}->{$unique_best_alignment}->{number_of_mismatches_1};
3732 $methylation_call_params->{$identifier}->{number_of_mismatches_2} = $mismatches{$mismatch_number}->{$unique_best_alignment}->{number_of_mismatches_2};
3733 }
3734 }
3735 else{
3736 $sequence_pair_fails = 1;
3737 }
3738 ### after processing the alignment with the lowest number of mismatches we exit
3739 last;
3740 }
3741 ### skipping the sequence completely if there were multiple alignments with the same amount of lowest mismatches found at different positions
3742 if ($sequence_pair_fails == 1){
3743 $counting{unsuitable_sequence_count}++;
3744 if ($ambiguous){
3745 return 2; # => exits to next sequence pair, and prints both seqs out to multiple_alignments_1 and -2 if --ambiguous has been specified
3746 }
3747 if ($unmapped){
3748 return 1; # => exits to next sequence pair, and prints both seqs out to unmapped_1 and _2 if --un has been specified
3749 }
3750 else{
3751 return 0; # => exits to next sequence (default)
3752 }
3753 }
3754
3755 ### --DIRECTIONAL
3756 ### If the option --directional has been specified the user wants to consider only alignments to the original top strand or the original bottom strand. We will therefore
3757 ### discard all alignments to strands complementary to the original strands, as they should not exist in reality due to the library preparation protocol
3758 if ($directional){
3759 if ( ($methylation_call_params->{$identifier}->{index} == 1) or ($methylation_call_params->{$identifier}->{index} == 2) ){
3760 # warn "Alignment rejected! (index was: $methylation_call_params->{$identifier}->{index})\n";
3761 $counting{alignments_rejected_count}++;
3762 return 0;
3763 }
3764 }
3765
3766 ### If the sequence has not been rejected so far it does have a unique best alignment
3767 $counting{unique_best_alignment_count}++;
3768 extract_corresponding_genomic_sequence_paired_ends($identifier,$methylation_call_params);
3769
3770 ### check test to see if the genomic sequences we extracted has the same length as the observed sequences +2, and only then we perform the methylation call
3771 if (length($methylation_call_params->{$identifier}->{unmodified_genomic_sequence_1}) != length($sequence_1)+2){
3772 warn "Chromosomal sequence could not be extracted for\t$identifier\t$methylation_call_params->{$identifier}->{chromosome}\t$methylation_call_params->{$identifier}->{start_seq_1}\n";
3773 $counting{genomic_sequence_could_not_be_extracted_count}++;
3774 return 0;
3775 }
3776 if (length($methylation_call_params->{$identifier}->{unmodified_genomic_sequence_2}) != length($sequence_2)+2){
3777 warn "Chromosomal sequence could not be extracted for\t$identifier\t$methylation_call_params->{$identifier}->{chromosome}\t$methylation_call_params->{$identifier}->{start_seq_2}\n";
3778 $counting{genomic_sequence_could_not_be_extracted_count}++;
3779 return 0;
3780 }
3781
3782 ### otherwise we are set to perform the actual methylation call
3783 $methylation_call_params->{$identifier}->{methylation_call_1} = methylation_call($identifier,$sequence_1,$methylation_call_params->{$identifier}->{unmodified_genomic_sequence_1},$methylation_call_params->{$identifier}->{read_conversion_1});
3784 $methylation_call_params->{$identifier}->{methylation_call_2} = methylation_call($identifier,$sequence_2,$methylation_call_params->{$identifier}->{unmodified_genomic_sequence_2},$methylation_call_params->{$identifier}->{read_conversion_2});
3785
3786 print_bisulfite_mapping_results_paired_ends($identifier,$sequence_1,$sequence_2,$methylation_call_params,$quality_value_1,$quality_value_2);
3787 return 0; ## otherwise 1 will be returned by default, which would print the sequence pair to unmapped_1 and _2
3788 }
3789
3790 #########################
3791 ### BOWTIE 2 | PAIRED-END
3792 #########################
3793
3794 sub check_bowtie_results_paired_ends_bowtie2{
3795 my ($sequence_1,$sequence_2,$identifier,$quality_value_1,$quality_value_2) = @_;
3796
3797 ### quality values are not given for FastA files, so they are initialised with a Phred quality of 40
3798 unless ($quality_value_1){
3799 $quality_value_1 = 'I'x(length$sequence_1);
3800 }
3801
3802 unless ($quality_value_2){
3803 $quality_value_2 = 'I'x(length$sequence_2);
3804 }
3805 # print "$identifier\n$fhs[0]->{last_seq_id}\n$fhs[1]->{last_seq_id}\n$fhs[2]->{last_seq_id}\n$fhs[3]->{last_seq_id}\n\n";
3806
3807 my %alignments;
3808 my $alignment_ambiguous = 0;
3809
3810 my $first_ambig_alignment_line1; # storing the first ambiguous alignment so it can be written out in case '--ambig_bam' was specified R1
3811 my $first_ambig_alignment_line2; # R2
3812
3813 my $best_AS_so_far; ## we need to keep a memory of the best alignment score so far
3814 my $amb_same_thread = 0; ## if a read's primary and secondary alignments have the same alignment score we set this to true.
3815
3816 ### reading from the Bowtie 2 output filehandles
3817
3818 ### for paired end reads we are reporting alignments to the OT strand first (index 0), then the OB strand (index 3!!), similiar to the single end way.
3819 ### alignments to the complementary strands are reported afterwards (CTOT got index 1, and CTOB got index 2).
3820 ### This is needed so that alignments which either contain no single C or G or reads which contain only protected Cs are reported to the original strands (OT and OB)
3821 ### Before the complementary strands. Remember that it does not make any difference for the methylation calls, but it will matter if alignments to the complementary
3822 ### strands are not being reported when '--directional' is specified
3823
3824 foreach my $index (0,3,1,2){
3825 ### skipping this index if the last alignment has been set to undefined already (i.e. end of bowtie output)
3826 next unless ($fhs[$index]->{last_line_1} and $fhs[$index]->{last_line_2} and defined $fhs[$index]->{last_seq_id});
3827
3828 ### if the sequence pair we are currently looking at produced an alignment we are doing various things with it
3829 if ($fhs[$index]->{last_seq_id} eq $identifier) {
3830
3831 my ($id_1,$flag_1,$mapped_chromosome_1,$position_1,$mapping_quality_1,$cigar_1,$bowtie_sequence_1,$qual_1) = (split (/\t/,$fhs[$index]->{last_line_1}))[0,1,2,3,4,5,9,10];
3832 my ($id_2,$flag_2,$mapped_chromosome_2,$position_2,$mapping_quality_2,$cigar_2,$bowtie_sequence_2,$qual_2) = (split (/\t/,$fhs[$index]->{last_line_2}))[0,1,2,3,4,5,9,10];
3833 # print "Index: $index\t$fhs[$index]->{last_line_1}\n";
3834 # print "Index: $index\t$fhs[$index]->{last_line_2}\n";
3835 # print join ("\t",$id_1,$flag_1,$mapped_chromosome_1,$position_1,$mapping_quality_1,$cigar_1,$bowtie_sequence_1,$qual_1),"\n";
3836 # print join ("\t",$id_2,$flag_2,$mapped_chromosome_2,$position_2,$mapping_quality_2,$cigar_2,$bowtie_sequence_2,$qual_2),"\n";
3837 $id_1 =~ s/\/1$//;
3838 $id_2 =~ s/\/2$//;
3839
3840 # SAM format specifications for Bowtie 2
3841 # (1) Name of read that aligned
3842 # (2) Sum of all applicable flags. Flags relevant to Bowtie are:
3843 # 1 The read is one of a pair
3844 # 2 The alignment is one end of a proper paired-end alignment
3845 # 4 The read has no reported alignments
3846 # 8 The read is one of a pair and has no reported alignments
3847 # 16 The alignment is to the reverse reference strand
3848 # 32 The other mate in the paired-end alignment is aligned to the reverse reference strand
3849 # 64 The read is mate 1 in a pair
3850 # 128 The read is mate 2 in a pair
3851 # 256 The read has multiple mapping states
3852 # (3) Name of reference sequence where alignment occurs (unmapped reads have a *)
3853 # (4) 1-based offset into the forward reference strand where leftmost character of the alignment occurs (0 for unmapped reads)
3854 # (5) Mapping quality (255 means MAPQ is not available)
3855 # (6) CIGAR string representation of alignment (* if unavailable)
3856 # (7) Name of reference sequence where mate's alignment occurs. Set to = if the mate's reference sequence is the same as this alignment's, or * if there is no mate.
3857 # (8) 1-based offset into the forward reference strand where leftmost character of the mate's alignment occurs. Offset is 0 if there is no mate.
3858 # (9) Inferred fragment size. Size is negative if the mate's alignment occurs upstream of this alignment. Size is 0 if there is no mate.
3859 # (10) Read sequence (reverse-complemented if aligned to the reverse strand)
3860 # (11) ASCII-encoded read qualities (reverse-complemented if the read aligned to the reverse strand). The encoded quality values are on the Phred quality scale and the encoding is ASCII-offset by 33 (ASCII char !), similarly to a FASTQ file.
3861 # (12) Optional fields. Fields are tab-separated. bowtie2 outputs zero or more of these optional fields for each alignment, depending on the type of the alignment:
3862 # AS:i:<N> Alignment score. Can be negative. Can be greater than 0 in --local mode (but not in --end-to-end mode). Only present if SAM record is for an aligned read.
3863 # XS:i:<N> Alignment score for second-best alignment. Can be negative. Can be greater than 0 in --local mode (but not in --end-to-end mode). Only present if the SAM record is for an aligned read and more than one alignment was found for the read.
3864 # YS:i:<N> Alignment score for opposite mate in the paired-end alignment. Only present if the SAM record is for a read that aligned as part of a paired-end alignment.
3865 # XN:i:<N> The number of ambiguous bases in the reference covering this alignment. Only present if SAM record is for an aligned read.
3866 # XM:i:<N> The number of mismatches in the alignment. Only present if SAM record is for an aligned read.
3867 # XO:i:<N> The number of gap opens, for both read and reference gaps, in the alignment. Only present if SAM record is for an aligned read.
3868 # XG:i:<N> The number of gap extensions, for both read and reference gaps, in the alignment. Only present if SAM record is for an aligned read.
3869 # NM:i:<N> The edit distance; that is, the minimal number of one-nucleotide edits (substitutions, insertions and deletions) needed to transform the read string into the reference string. Only present if SAM record is for an aligned read.
3870 # YF:Z:<N> String indicating reason why the read was filtered out. See also: Filtering. Only appears for reads that were filtered out.
3871 # MD:Z:<S> A string representation of the mismatched reference bases in the alignment. See SAM format specification for details. Only present if SAM record is for an aligned read.
3872
3873 ### If a sequence has no reported alignments there will be a single output line per sequence with a bit-wise flag value of 77 for read 1 (1+4+8+64), or 141 for read 2 (1+4+8+128).
3874 ### We can store the next alignment and move on to the next Bowtie 2 instance
3875 if ($flag_1 == 77 and $flag_2 == 141){
3876 ## reading in the next alignment, which must be the next sequence
3877 my $newline_1 = $fhs[$index]->{fh}-> getline();
3878 my $newline_2 = $fhs[$index]->{fh}-> getline();
3879
3880 if ($newline_1 and $newline_2){
3881 chomp $newline_1;
3882 chomp $newline_2;
3883 my ($seq_id_1) = split (/\t/,$newline_1);
3884 my ($seq_id_2) = split (/\t/,$newline_2);
3885 $seq_id_1 =~ s/\/1$//;
3886 $seq_id_2 =~ s/\/2$//;
3887 $fhs[$index]->{last_seq_id} = $seq_id_1;
3888 $fhs[$index]->{last_line_1} = $newline_1;
3889 $fhs[$index]->{last_line_2} = $newline_2;
3890
3891 # print "current sequence ($identifier) did not map, reading in next sequence\n";
3892 # print "$index\t$fhs[$index]->{last_seq_id}\n";
3893 # print "$index\t$fhs[$index]->{last_line_1}\n";
3894 # print "$index\t$fhs[$index]->{last_line_2}\n";
3895 next; # next instance
3896 }
3897 else{
3898 # assigning undef to last_seq_id and last_line and jumping to the next index (end of Bowtie 2 output)
3899 $fhs[$index]->{last_seq_id} = undef;
3900 $fhs[$index]->{last_line_1} = undef;
3901 $fhs[$index]->{last_line_2} = undef;
3902 next;
3903 }
3904 }
3905
3906 ### If there are one or more proper alignments we can extract the chromosome number
3907 my ($chromosome_1,$chromosome_2);
3908 if ($mapped_chromosome_1 =~ s/_(CT|GA)_converted$//){
3909 $chromosome_1 = $mapped_chromosome_1;
3910 }
3911 else{
3912 die "Chromosome number extraction failed for $mapped_chromosome_1\n";
3913 }
3914 if ($mapped_chromosome_2 =~ s/_(CT|GA)_converted$//){
3915 $chromosome_2 = $mapped_chromosome_2;
3916 }
3917 else{
3918 die "Chromosome number extraction failed for $mapped_chromosome_2\n";
3919 }
3920
3921 die "Paired-end alignments need to be on the same chromosome\n" unless ($chromosome_1 eq $chromosome_2);
3922
3923 ### We will use the optional fields to determine the best alignments. Later on we extract the number of mismatches and/or indels from the CIGAR string
3924 my ($alignment_score_1,$alignment_score_2,$second_best_1,$second_best_2,$MD_tag_1,$MD_tag_2);
3925
3926 my @fields_1 = split (/\t/,$fhs[$index]->{last_line_1});
3927 my @fields_2 = split (/\t/,$fhs[$index]->{last_line_2});
3928
3929 foreach (11..$#fields_1){
3930 if ($fields_1[$_] =~ /AS:i:(.*)/){
3931 $alignment_score_1 = $1;
3932 }
3933 elsif ($fields_1[$_] =~ /XS:i:(.*)/){
3934 $second_best_1 = $1;
3935 }
3936 elsif ($fields_1[$_] =~ /MD:Z:(.*)/){
3937 $MD_tag_1 = $1;
3938 }
3939 }
3940
3941 foreach (11..$#fields_2){
3942 if ($fields_2[$_] =~ /AS:i:(.*)/){
3943 $alignment_score_2 = $1;
3944 }
3945 elsif ($fields_2[$_] =~ /XS:i:(.*)/){
3946 $second_best_2 = $1;
3947 }
3948 elsif ($fields_2[$_] =~ /MD:Z:(.*)/){
3949 $MD_tag_2 = $1;
3950 }
3951 }
3952
3953 die "Failed to extract alignment score 1 ($alignment_score_1) and MD tag ($MD_tag_1)!\nlast alignment 1: $fhs[$index]->{last_line_1}\nlast alignment 2: $fhs[$index]->{last_line_2}\n" unless (defined $alignment_score_1 and defined $MD_tag_1);
3954 die "Failed to extract alignment score 2 ($alignment_score_2) and MD tag ($MD_tag_2)!\nlast alignment 1: $fhs[$index]->{last_line_1}\nlast alignment 2: $fhs[$index]->{last_line_2}\n" unless (defined $alignment_score_2 and defined $MD_tag_2);
3955
3956 # warn "First read 1 alignment score is: '$alignment_score_1'\n";
3957 # warn "First read 2 alignment score is: '$alignment_score_2'\n";
3958 # warn "MD tag 1 is: '$MD_tag_1'\n";
3959 # warn "MD tag 2 is: '$MD_tag_2'\n";
3960
3961 ### To decide whether a sequence pair has a unique best alignment we will look at the highest sum of alignment scores from both alignments
3962 my $sum_of_alignment_scores_1 = $alignment_score_1 + $alignment_score_2 ;
3963 # warn "sum of alignment scores: $sum_of_alignment_scores_1\n\n"; sleep(1);
3964
3965 my $overwrite = 0; # If there are 2 alternative alignments to the same position, e.g. OT with 50 mismatches and CTOB with 0 mismatches, the CTOB one trumps the OT one.
3966 # introduced 13 April 2016 as a suggestion by Sylvain Foret, ANU Canberra
3967
3968 if (!defined $best_AS_so_far){
3969 $overwrite = 1;
3970 $best_AS_so_far = $sum_of_alignment_scores_1;
3971 # warn "First alignment score, setting \$best_AS_so_far to $best_AS_so_far\n";
3972 if ($ambig_bam){ # also setting the first_ambig_alignment
3973 # Read 1
3974 $first_ambig_alignment_line1 = $fhs[$index]->{last_line_1};
3975 $first_ambig_alignment_line1 =~ s/_(CT|GA)_converted//;
3976 # Read 2
3977 $first_ambig_alignment_line2 = $fhs[$index]->{last_line_2};
3978 $first_ambig_alignment_line2 =~ s/_(CT|GA)_converted//;
3979 # warn "$first_ambig_alignment_line1\n$first_ambig_alignment_line2\n\n"; sleep(1);
3980 }
3981 }
3982 else{
3983 if ($sum_of_alignment_scores_1 >= $best_AS_so_far){ # AS are generally negative with a maximum of 0
3984 # 19 07 2016 Changed to >= so that equally good alignments to different positions get added as well. Ambiguous alignments are identified and removed later.
3985 $best_AS_so_far = $sum_of_alignment_scores_1;
3986 $overwrite = 1;
3987
3988 # warn "Found better or equal sum of alignment scores ($sum_of_alignment_scores_1), setting \$best_AS_so_far to $best_AS_so_far\n";
3989 # resetting the ambiguous within thread memory (if applicable at all) only if the current alignment is really better than the previous one.
3990 # 22 07 2016: ambiguous score within same thread only resets if the current alignment is really better than the previous one
3991 if ($sum_of_alignment_scores_1 > $best_AS_so_far){
3992 # warn "Resetting amb within thread value to 0\n";
3993 $amb_same_thread = 0;
3994
3995 if ($ambig_bam){ # also setting a new first_ambig_alignment
3996 # Read 1
3997 $first_ambig_alignment_line1 = $fhs[$index]->{last_line_1};
3998 $first_ambig_alignment_line1 =~ s/_(CT|GA)_converted//;
3999 # Read 2
4000 $first_ambig_alignment_line2 = $fhs[$index]->{last_line_2};
4001 $first_ambig_alignment_line2 =~ s/_(CT|GA)_converted//;
4002 # warn "$first_ambig_alignment_line1\n$first_ambig_alignment_line2\n\n"; sleep(1);
4003 }
4004 }
4005 }
4006 else{
4007 # warn "current alignment (AS $sum_of_alignment_scores) isn't better than the best so far ($best_AS_so_far). Not changing anything\n";
4008 }
4009 }
4010
4011 if (defined $second_best_1 and defined $second_best_2){
4012 my $sum_of_alignment_scores_second_best = $second_best_1 + $second_best_2;
4013 # warn "Second best alignment_score_1 is: '$second_best_1'\n";
4014 # warn "Second best alignment_score_2 is: '$second_best_2'\n";
4015 # warn "Second best alignment sum of alignment scores is: '$sum_of_alignment_scores_second_best'\n";
4016
4017 # If the first alignment score for the first read pair is the same as the alignment score of the second best hit we we keep a memory of this
4018 if ($sum_of_alignment_scores_1 == $sum_of_alignment_scores_second_best){
4019
4020 # checking to see if this read pair produced the best alignment
4021 if ($sum_of_alignment_scores_1 == $best_AS_so_far){ # yes this is the best read pair so far, either within the thread or between threads, however it is ambiguous
4022 # warn "Read pair is ambiguous within the same thread, or otherwise as good as the best one so far. Setting \$amb_same_thread to 1 for currently best AS: $best_AS_so_far\n";
4023 $amb_same_thread = 1;
4024 }
4025 else{
4026 # warn "This read pair has a worse alignment score than the best alignment so far and will be ignored even though it is ambiguous in itself\n";
4027 }
4028
4029 ### if there is a better alignment later on -> fine. If not, the read will get booted altogether one way or another
4030
4031 ## need to read and discard all additional ambiguous reads until we reach the next sequence
4032 until ($fhs[$index]->{last_seq_id} ne $identifier){
4033 my $newline_1 = $fhs[$index]->{fh}-> getline();
4034 my $newline_2 = $fhs[$index]->{fh}-> getline();
4035 if ($newline_1 and $newline_2){
4036 chomp $newline_1;
4037 chomp $newline_2;
4038 my ($seq_id_1) = split (/\t/,$newline_1);
4039 my ($seq_id_2) = split (/\t/,$newline_2);
4040 $seq_id_1 =~ s/\/1$//;
4041 $seq_id_2 =~ s/\/2$//;
4042 # print "New Seq IDs:\t$seq_id_1\t$seq_id_2\n";
4043
4044 $fhs[$index]->{last_seq_id} = $seq_id_1;
4045 $fhs[$index]->{last_line_1} = $newline_1;
4046 $fhs[$index]->{last_line_2} = $newline_2;
4047 }
4048 else{
4049 # assigning undef to last_seq_id and last_line and jumping to the next index (end of Bowtie 2 output)
4050 $fhs[$index]->{last_seq_id} = undef;
4051 $fhs[$index]->{last_line_1} = undef;
4052 $fhs[$index]->{last_line_2} = undef;
4053 last; # break free if the end of the alignment output was reached
4054 }
4055 }
4056 # if ($fhs[$index]->{last_seq_id}){
4057 # warn "Index: $index\tThis Seq-ID is $identifier, skipped all ambiguous sequences until the next ID which is: $fhs[$index]->{last_seq_id}\n";
4058 # }
4059 }
4060 else{ # the next best alignment has a lower alignment score than the current read, so we can safely store the current alignment
4061
4062 my $alignment_location;
4063 if ($position_1 <= $position_2){
4064 $alignment_location = join(":",$chromosome_1,$position_1,$position_2);
4065 }
4066 elsif($position_2 < $position_1){
4067 $alignment_location = join(":",$chromosome_1,$position_2,$position_1);
4068 }
4069
4070 ### If a sequence aligns to exactly the same location twice the sequence does either not contain any C or G, or all the Cs (or Gs on the reverse
4071 ### strand) were methylated and therefore protected. Alternatively it will align better in one condition than in the other. In any case, it is not needed to overwrite
4072 ### the same positional entry with a second entry for the same location, as the genomic sequence extraction and methylation call would not be affected by this. The only
4073 ### thing which would change is the index number for the found alignment). We will continue to assign these alignments to the first indexes 0 and 3, i.e. OT and OB
4074
4075 if ($overwrite){ # see comment above at "my $overwrite = ..."
4076 #unless (exists $alignments{$alignment_location}){
4077 $alignments{$alignment_location}->{seq_id} = $id_1;
4078 $alignments{$alignment_location}->{alignment_score_1} = $alignment_score_1;
4079 $alignments{$alignment_location}->{alignment_score_2} = $alignment_score_2;
4080 $alignments{$alignment_location}->{sum_of_alignment_scores} = $sum_of_alignment_scores_1;
4081 $alignments{$alignment_location}->{sum_of_alignment_scores_second_best} = $sum_of_alignment_scores_second_best;
4082 $alignments{$alignment_location}->{bowtie_sequence_1} = $bowtie_sequence_1;
4083 $alignments{$alignment_location}->{bowtie_sequence_2} = $bowtie_sequence_2;
4084 $alignments{$alignment_location}->{index} = $index;
4085 $alignments{$alignment_location}->{chromosome} = $chromosome_1; # either is fine
4086 $alignments{$alignment_location}->{position_1} = $position_1;
4087 $alignments{$alignment_location}->{position_2} = $position_2;
4088 $alignments{$alignment_location}->{mismatch_info_1} = $MD_tag_1;
4089 $alignments{$alignment_location}->{mismatch_info_2} = $MD_tag_2;
4090 $alignments{$alignment_location}->{CIGAR_1} = $cigar_1;
4091 $alignments{$alignment_location}->{CIGAR_2} = $cigar_2;
4092 $alignments{$alignment_location}->{flag_1} = $flag_1;
4093 $alignments{$alignment_location}->{flag_2} = $flag_2;
4094 # warn "added best of several alignments to \%alignments hash\n";
4095 }
4096
4097 ### now reading and discarding all (inferior) alignments of this read pair until we hit the next sequence
4098 until ($fhs[$index]->{last_seq_id} ne $identifier){
4099 my $newline_1 = $fhs[$index]->{fh}-> getline();
4100 my $newline_2 = $fhs[$index]->{fh}-> getline();
4101 if ($newline_1 and $newline_2){
4102 chomp $newline_1;
4103 chomp $newline_2;
4104 my ($seq_id_1) = split (/\t/,$newline_1);
4105 my ($seq_id_2) = split (/\t/,$newline_2);
4106 $seq_id_1 =~ s/\/1$//;
4107 $seq_id_2 =~ s/\/2$//;
4108 # print "New Seq IDs:\t$seq_id_1\t$seq_id_2\n";
4109
4110 $fhs[$index]->{last_seq_id} = $seq_id_1;
4111 $fhs[$index]->{last_line_1} = $newline_1;
4112 $fhs[$index]->{last_line_2} = $newline_2;
4113 }
4114 else{
4115 # assigning undef to last_seq_id and last_line_1 and _2 and jumping to the next index (end of Bowtie 2 output)
4116 $fhs[$index]->{last_seq_id} = undef;
4117 $fhs[$index]->{last_line_1} = undef;
4118 $fhs[$index]->{last_line_2} = undef;
4119 last; # break free if the end of the alignment output was reached
4120 }
4121 }
4122 # if($fhs[$index]->{last_seq_id}){
4123 # warn "Index: $index\tThis Seq-ID is $identifier, skipped all other alignments until the next ID was reached which is: $fhs[$index]->{last_seq_id}\n";
4124 # }
4125 }
4126 }
4127 else{ # there is no second best hit, so we can just store this one and read in the next sequence
4128
4129 my $alignment_location = join(":",$chromosome_1,$position_1,$position_2);
4130 # print "$alignment_location\n";
4131 ### If a sequence aligns to exactly the same location with a perfect match twice the sequence does either not contain any C or G, or all the Cs (or Gs on the reverse
4132 ### strand) were methylated and therefore protected. Alternatively it will align better in one condition than in the other. In any case, it is not needed to overwrite
4133 ### the same positional entry with a second entry for the same location, as the genomic sequence extraction and methylation call would not be affected by this. The only
4134 ### thing which would change is the index number for the found alignment). We will continue to assign these alignments to the first indexes 0 and 3, i.e. OT and OB
4135
4136 #unless (exists $alignments{$alignment_location}){ # see comment above at my $overwrite = ...
4137 if ($overwrite){
4138 $alignments{$alignment_location}->{seq_id} = $id_1;
4139 $alignments{$alignment_location}->{alignment_score_1} = $alignment_score_1;
4140 $alignments{$alignment_location}->{alignment_score_2} = $alignment_score_2;
4141 $alignments{$alignment_location}->{sum_of_alignment_scores} = $sum_of_alignment_scores_1;
4142 $alignments{$alignment_location}->{sum_of_alignment_scores_second_best} = undef;
4143 $alignments{$alignment_location}->{bowtie_sequence_1} = $bowtie_sequence_1;
4144 $alignments{$alignment_location}->{bowtie_sequence_2} = $bowtie_sequence_2;
4145 $alignments{$alignment_location}->{index} = $index;
4146 $alignments{$alignment_location}->{chromosome} = $chromosome_1; # either is fine
4147 $alignments{$alignment_location}->{position_1} = $position_1;
4148 $alignments{$alignment_location}->{position_2} = $position_2;
4149 $alignments{$alignment_location}->{mismatch_info_1} = $MD_tag_1;
4150 $alignments{$alignment_location}->{mismatch_info_2} = $MD_tag_2;
4151 $alignments{$alignment_location}->{CIGAR_1} = $cigar_1;
4152 $alignments{$alignment_location}->{CIGAR_2} = $cigar_2;
4153 $alignments{$alignment_location}->{flag_1} = $flag_1;
4154 $alignments{$alignment_location}->{flag_2} = $flag_2;
4155 # warn "added unique alignment to \%alignments hash\n";
4156 }
4157
4158 # Now reading and storing the next read pair
4159 my $newline_1 = $fhs[$index]->{fh}-> getline();
4160 my $newline_2 = $fhs[$index]->{fh}-> getline();
4161 if ($newline_1 and $newline_2){
4162 chomp $newline_1;
4163 chomp $newline_2;
4164 # print "$newline_1\n";
4165 # print "$newline_2\n";
4166 my ($seq_id_1) = split (/\t/,$newline_1);
4167 my ($seq_id_2) = split (/\t/,$newline_2);
4168 $seq_id_1 =~ s/\/1$//;
4169 $seq_id_2 =~ s/\/2$//;
4170 # print "New Seq IDs:\t$seq_id_1\t$seq_id_2\n";
4171
4172 $fhs[$index]->{last_seq_id} = $seq_id_1;
4173 $fhs[$index]->{last_line_1} = $newline_1;
4174 $fhs[$index]->{last_line_2} = $newline_2;
4175
4176 if ($seq_id_1 eq $identifier){
4177 die "Sequence with ID $identifier did not have a second best alignment, but next seq-ID was also $fhs[$index]->{last_seq_id}!\n";
4178 }
4179 }
4180 else{
4181 # assigning undef to last_seq_id and last_line_1 and _2 and jumping to the next index (end of Bowtie 2 output)
4182 $fhs[$index]->{last_seq_id} = undef;
4183 $fhs[$index]->{last_line_1} = undef;
4184 $fhs[$index]->{last_line_2} = undef;
4185 }
4186 }
4187 }
4188 }
4189
4190 ### If there were several equally good alignments for the best alignment score we will boot the read
4191 if ($amb_same_thread){
4192 # warn "\$alignment_ambiguous now: $alignment_ambiguous\n";
4193 $alignment_ambiguous = 1;
4194 # warn "\$alignment_ambiguous now: $alignment_ambiguous\n";
4195 }
4196 else{
4197 # warn "alignment won't be considered ambiguous. This time....\n";
4198 }
4199
4200
4201 ### if the read produced several ambiguous alignments for a single instance of Bowtie 2 we can return already now. If --ambiguous was specified the read sequence will be printed out in FastQ format
4202 if ($alignment_ambiguous == 1){
4203 $counting{unsuitable_sequence_count}++;
4204 ### report that the sequence pair has multiple hits with bitwise flag 256. We can print the sequence to the result file straight away and skip everything else
4205 # my $ambiguous_read_1 = join("\t",$identifier.'/1','256','*','0','0','*','*','0','0',$sequence_1,$quality_value_1);
4206 # my $ambiguous_read_2 = join("\t",$identifier.'/2','256','*','0','0','*','*','0','0',$sequence_2,$quality_value_2);
4207 # print "$ambiguous_read_1\n";
4208 # print "$ambiguous_read_2\n";
4209
4210 if ($ambig_bam){
4211 # warn "Sequence is ambiguous, printing out to ambiguous BAM file:\n";
4212 # replacing the first /1\t in the ID of R1
4213 # warn "Was\n$first_ambig_alignment_line1\n$first_ambig_alignment_line2\n";
4214 $first_ambig_alignment_line1 =~ s/\/1\t/\t/;
4215 $first_ambig_alignment_line2 =~ s/\/2\t/\t/;
4216 # warn "Is:\n$first_ambig_alignment_line1\n$first_ambig_alignment_line2\n\n";
4217
4218 print AMBIBAM "$first_ambig_alignment_line1\n$first_ambig_alignment_line2\n";
4219 # print "$first_ambig_alignment_line1\n$first_ambig_alignment_line2\n";
4220 }
4221
4222 if ($ambiguous){
4223 return 2; # => exits to next sequence pair, and prints it out to _ambiguous_reads_1.txt and _ambiguous_reads_2.txt if '--ambiguous' was specified
4224 }
4225 elsif ($unmapped){
4226 return 1; # => exits to next sequence pair, and prints it out to _unmapped_reads_1.txt and _unmapped_reads_2.txt if '--unmapped' but not '--ambiguous' was specified
4227 }
4228 else{
4229 return 0;
4230 }
4231 }
4232
4233 ### if no alignment was found for a certain sequence at all we continue with the next sequence in the sequence file
4234 unless (%alignments){
4235 $counting{no_single_alignment_found}++;
4236
4237 # my $unmapped_read_1 = join("\t",$identifier.'/1','77','*','0','0','*','*','0','0',$sequence_1,$quality_value_1);
4238 # my $unmapped_read_2 = join("\t",$identifier.'/2','141','*','0','0','*','*','0','0',$sequence_2,$quality_value_2);
4239 # print "$unmapped_read_1\n";
4240 # print "$unmapped_read_2\n";
4241 if ($unmapped){
4242 return 1; # => exits to next sequence pair, and prints it out to _unmapped_reads_1.txt and _unmapped_read_2.txt if '--unmapped' was specified
4243 }
4244 else{
4245 return 0;
4246 }
4247 }
4248
4249 #######################################################################################################################################################
4250
4251 ### If the sequence pair was not rejected so far we are now looking if there is a unique best alignment among all alignment instances. If there is only one
4252 ### single best position we are going to store the alignment information in the $meth_call variable. If there are multiple hits with the same (highest)
4253 ### alignment score we are discarding the sequence pair altogether.
4254 ### For end-to-end alignments the maximum alignment score is 0, each mismatch receives a penalty of 6, and each gap receives penalties for opening (5)
4255 ### and extending (3 per bp) the gap.
4256
4257 #######################################################################################################################################################
4258
4259 ### Declaring an empty hash reference which will store all information we need for the methylation call
4260 my $methylation_call_params; # hash reference
4261 my $sequence_pair_fails = 0; # using $sequence_pair_fails as a 'memory' if a sequence could not be aligned uniquely (set to 1 then)
4262
4263 ### print contents of %alignments for debugging
4264 ## if (scalar keys %alignments >= 1){
4265 # print "\n******\n";
4266 # foreach my $alignment_location (sort {$a cmp $b} keys %alignments){
4267 # print "Loc: $alignment_location\n";
4268 # print "ID: $alignments{$alignment_location}->{seq_id}\n";
4269 # print "AS_1: $alignments{$alignment_location}->{alignment_score_1}\n";
4270 # print "AS_2: $alignments{$alignment_location}->{alignment_score_2}\n";
4271 # print "Seq_1: $alignments{$alignment_location}->{bowtie_sequence_1}\n";
4272 # print "Seq_2: $alignments{$alignment_location}->{bowtie_sequence_2}\n";
4273 # print "Index $alignments{$alignment_location}->{index}\n";
4274 # print "Chr: $alignments{$alignment_location}->{chromosome}\n";
4275 # print "Pos_1: $alignments{$alignment_location}->{position_1}\n";
4276 # print "Pos_2: $alignments{$alignment_location}->{position_2}\n";
4277 # print "CIGAR_1: $alignments{$alignment_location}->{CIGAR_1}\n";
4278 # print "CIGAR_2: $alignments{$alignment_location}->{CIGAR_2}\n";
4279 # print "MD_1: $alignments{$alignment_location}->{mismatch_info_1}\n";
4280 # print "MD_2: $alignments{$alignment_location}->{mismatch_info_2}\n";
4281 # print "Flag 1: $alignments{$alignment_location}->{flag_1}\n";
4282 # print "Flag 2: $alignments{$alignment_location}->{flag_2}\n";
4283 # }
4284 # print "\n******\n";
4285 # }
4286
4287 ### if there is only 1 entry in the %alignments hash we accept it as the best alignment
4288 if (scalar keys %alignments == 1){
4289 for my $unique_best_alignment (keys %alignments){
4290 $methylation_call_params->{$identifier}->{bowtie_sequence_1} = $alignments{$unique_best_alignment}->{bowtie_sequence_1};
4291 $methylation_call_params->{$identifier}->{bowtie_sequence_2} = $alignments{$unique_best_alignment}->{bowtie_sequence_2};
4292 $methylation_call_params->{$identifier}->{chromosome} = $alignments{$unique_best_alignment}->{chromosome};
4293 $methylation_call_params->{$identifier}->{position_1} = $alignments{$unique_best_alignment}->{position_1};
4294 $methylation_call_params->{$identifier}->{position_2} = $alignments{$unique_best_alignment}->{position_2};
4295 $methylation_call_params->{$identifier}->{index} = $alignments{$unique_best_alignment}->{index};
4296 $methylation_call_params->{$identifier}->{alignment_score_1} = $alignments{$unique_best_alignment}->{alignment_score_1};
4297 $methylation_call_params->{$identifier}->{alignment_score_2} = $alignments{$unique_best_alignment}->{alignment_score_2};
4298 $methylation_call_params->{$identifier}->{sum_of_alignment_scores} = $alignments{$unique_best_alignment}->{sum_of_alignment_scores};
4299 $methylation_call_params->{$identifier}->{sum_of_alignment_scores_second_best} = $alignments{$unique_best_alignment}->{sum_of_alignment_scores_second_best};
4300 $methylation_call_params->{$identifier}->{mismatch_info_1} = $alignments{$unique_best_alignment}->{mismatch_info_1};
4301 $methylation_call_params->{$identifier}->{mismatch_info_2} = $alignments{$unique_best_alignment}->{mismatch_info_2};
4302 $methylation_call_params->{$identifier}->{CIGAR_1} = $alignments{$unique_best_alignment}->{CIGAR_1};
4303 $methylation_call_params->{$identifier}->{CIGAR_2} = $alignments{$unique_best_alignment}->{CIGAR_2};
4304 $methylation_call_params->{$identifier}->{flag_1} = $alignments{$unique_best_alignment}->{flag_1};
4305 $methylation_call_params->{$identifier}->{flag_2} = $alignments{$unique_best_alignment}->{flag_2};
4306 }
4307 }
4308
4309 ### otherwise we are going to find out if there is a best match among the multiple alignments, or whether there are 2 or more equally good alignments (in which case
4310 ### we boot the sequence pair altogether)
4311 elsif (scalar keys %alignments >= 2 and scalar keys %alignments <= 4){
4312 my $best_sum_of_alignment_scores;
4313 my $best_alignment_location;
4314 foreach my $alignment_location (sort {$alignments{$b}->{sum_of_alignment_scores} <=> $alignments{$a}->{sum_of_alignment_scores}} keys %alignments){
4315
4316 # warn "$alignments{$alignment_location}->{sum_of_alignment_scores}\n"; sleep(1);
4317
4318 unless (defined $best_sum_of_alignment_scores){
4319 $best_sum_of_alignment_scores = $alignments{$alignment_location}->{sum_of_alignment_scores};
4320 $best_alignment_location = $alignment_location;
4321 # print "setting best alignment score to: $best_sum_of_alignment_scores\n";
4322 }
4323 else{
4324 ### if the second best alignment has the same sum of alignment scores as the first one, the sequence pair will get booted
4325 if ($alignments{$alignment_location}->{sum_of_alignment_scores} == $best_sum_of_alignment_scores){
4326 # warn "Same sum of alignment scores for 2 different alignments, the sequence pair will get booted!\n";
4327 $sequence_pair_fails = 1;
4328 last; # exiting since we know that the sequence has ambiguous alignments
4329 }
4330 ### else we are going to store the best alignment for further processing
4331 else{
4332 $methylation_call_params->{$identifier}->{bowtie_sequence_1} = $alignments{$best_alignment_location}->{bowtie_sequence_1};
4333 $methylation_call_params->{$identifier}->{bowtie_sequence_2} = $alignments{$best_alignment_location}->{bowtie_sequence_2};
4334 $methylation_call_params->{$identifier}->{chromosome} = $alignments{$best_alignment_location}->{chromosome};
4335 $methylation_call_params->{$identifier}->{position_1} = $alignments{$best_alignment_location}->{position_1};
4336 $methylation_call_params->{$identifier}->{position_2} = $alignments{$best_alignment_location}->{position_2};
4337 $methylation_call_params->{$identifier}->{index} = $alignments{$best_alignment_location}->{index};
4338 $methylation_call_params->{$identifier}->{alignment_score_1} = $alignments{$best_alignment_location}->{alignment_score_1};
4339 $methylation_call_params->{$identifier}->{alignment_score_2} = $alignments{$best_alignment_location}->{alignment_score_2};
4340 $methylation_call_params->{$identifier}->{sum_of_alignment_scores} = $alignments{$best_alignment_location}->{sum_of_alignment_scores};
4341 $methylation_call_params->{$identifier}->{mismatch_info_1} = $alignments{$best_alignment_location}->{mismatch_info_1};
4342 $methylation_call_params->{$identifier}->{mismatch_info_2} = $alignments{$best_alignment_location}->{mismatch_info_2};
4343 $methylation_call_params->{$identifier}->{CIGAR_1} = $alignments{$best_alignment_location}->{CIGAR_1};
4344 $methylation_call_params->{$identifier}->{CIGAR_2} = $alignments{$best_alignment_location}->{CIGAR_2};
4345 $methylation_call_params->{$identifier}->{flag_1} = $alignments{$best_alignment_location}->{flag_1};
4346 $methylation_call_params->{$identifier}->{flag_2} = $alignments{$best_alignment_location}->{flag_2};
4347
4348 if (defined $alignments{$best_alignment_location}->{sum_of_alignment_scores_second_best} and ( $alignments{$best_alignment_location}->{sum_of_alignment_scores_second_best} > $alignments{$alignment_location}->{sum_of_alignment_scores} )) {
4349 $methylation_call_params->{$identifier}->{sum_of_alignment_scores_second_best} = $alignments{$best_alignment_location}->{sum_of_alignment_scores_second_best};
4350 }
4351 else {
4352 $methylation_call_params->{$identifier}->{sum_of_alignment_scores_second_best} = $alignments{$alignment_location}->{sum_of_alignment_scores};
4353 }
4354
4355 last; # exiting since the sequence produced a unique best alignment
4356 }
4357 }
4358 }
4359 }
4360 else{
4361 die "There are too many potential hits for this sequence pair (1-4 expected, but found: '",scalar keys %alignments,"')\n";;
4362 }
4363
4364 ### skipping the sequence completely if there were multiple alignments with the same best sum of alignment scores at different positions
4365 if ($sequence_pair_fails == 1){
4366 $counting{unsuitable_sequence_count}++;
4367
4368 ### report that the sequence has multiple hits with bitwise flag 256. We can print the sequence to the result file straight away and skip everything else
4369 # my $ambiguous_read_1 = join("\t",$identifier.'/1','256','*','0','0','*','*','0','0',$sequence_1,$quality_value_1);
4370 # my $ambiguous_read_2 = join("\t",$identifier.'/2','256','*','0','0','*','*','0','0',$sequence_2,$quality_value_2);
4371 # warn "$ambiguous_read_1\n";
4372 # warn "$ambiguous_read_2\n";
4373
4374 if ($ambiguous){
4375 return 2; # => exits to next sequence pair, and prints it out (in FastQ format) to _ambiguous_reads_1.txt and _ambiguous_reads_2.txt if '--ambiguous' was specified
4376 }
4377 elsif ($unmapped){
4378 return 1; # => exits to next sequence pair, and prints it out (in FastQ format) to _unmapped_reads_1.txt and _unmapped_reads_2.txt if '--unmapped' but not '--ambiguous' was specified
4379 }
4380 else{
4381 return 0; # => exits to next sequence pair (default)
4382 }
4383 }
4384
4385 ### --DIRECTIONAL
4386 ### If the option --directional has been specified the user wants to consider only alignments to the original top strand or the original bottom strand. We will therefore
4387 ### discard all alignments to strands complementary to the original strands, as they should not exist in reality due to the library preparation protocol
4388 if ($directional){
4389 if ( ($methylation_call_params->{$identifier}->{index} == 1) or ($methylation_call_params->{$identifier}->{index} == 2) ){
4390 # warn "Alignment rejected! (index was: $methylation_call_params->{$identifier}->{index})\n";
4391 $counting{alignments_rejected_count}++;
4392 return 0;
4393 }
4394 }
4395
4396 ### If the sequence pair has not been rejected so far it does have a unique best alignment
4397 $counting{unique_best_alignment_count}++;
4398 extract_corresponding_genomic_sequence_paired_ends_bowtie2($identifier,$methylation_call_params);
4399
4400 ### check to see if the genomic sequences we extracted has the same length as the observed sequences +2, and only then we perform the methylation call
4401 if (length($methylation_call_params->{$identifier}->{unmodified_genomic_sequence_1}) != length($sequence_1)+2){
4402 warn "Chromosomal sequence could not be extracted for\t$identifier\t$methylation_call_params->{$identifier}->{chromosome}\t$methylation_call_params->{$identifier}->{position_1}\n";
4403 $counting{genomic_sequence_could_not_be_extracted_count}++;
4404 return 0;
4405 }
4406 if (length($methylation_call_params->{$identifier}->{unmodified_genomic_sequence_2}) != length($sequence_2)+2){
4407 warn "Chromosomal sequence could not be extracted for\t$identifier\t$methylation_call_params->{$identifier}->{chromosome}\t$methylation_call_params->{$identifier}->{position_2}\n";
4408 $counting{genomic_sequence_could_not_be_extracted_count}++;
4409 return 0;
4410 }
4411
4412 ### Compute MAPQ value
4413 $methylation_call_params->{$identifier}->{mapq} = calc_mapq (length($sequence_1), length($sequence_2),
4414 $methylation_call_params->{$identifier}->{sum_of_alignment_scores},
4415 $methylation_call_params->{$identifier}->{sum_of_alignment_scores_second_best});
4416
4417
4418 ### now we are set to perform the actual methylation call
4419 $methylation_call_params->{$identifier}->{methylation_call_1} = methylation_call($identifier,$sequence_1,$methylation_call_params->{$identifier}->{unmodified_genomic_sequence_1},$methylation_call_params->{$identifier}->{read_conversion_1});
4420 $methylation_call_params->{$identifier}->{methylation_call_2} = methylation_call($identifier,$sequence_2,$methylation_call_params->{$identifier}->{unmodified_genomic_sequence_2},$methylation_call_params->{$identifier}->{read_conversion_2});
4421 # warn "$methylation_call_params->{$identifier}->{read_conversion_2}\n";
4422 # warn " $sequence_2\n";
4423 # warn "$methylation_call_params->{$identifier}->{unmodified_genomic_sequence_2}\n";
4424 # warn " $methylation_call_params->{$identifier}->{methylation_call_2}\n";
4425
4426 print_bisulfite_mapping_results_paired_ends_bowtie2($identifier,$sequence_1,$sequence_2,$methylation_call_params,$quality_value_1,$quality_value_2);
4427 return 0; ## otherwise 1 will be returned by default, which would print the sequence pair to unmapped_1 and _2
4428 }
4429
4430 ###
4431
4432 # Compute MAPQ value for a read or read pair as in Bowtie2-2.2.2 (specifically, V2 of the MAPQ calculator: "class BowtieMapq2")
4433 # assuming end-to-end alignment with the default calculation of the minimum alignment score
4434
4435 sub calc_mapq {
4436 my ($read1Len, $read2Len, $AS_best, $AS_secBest) = @_;
4437
4438 my $scMin = $score_min_intercept + $score_min_slope * $read1Len;
4439 ### read2Len is only defined for paired-end reads, so for single-end mode we can just a score min value for read 1
4440 if (defined $read2Len){
4441 $scMin += $score_min_intercept + $score_min_slope * $read2Len;
4442 }
4443
4444 my $diff = abs$scMin; # scores can vary by up to this much (since max AS is 0 for end-to-end alignment)
4445 my $bestOver = $AS_best - $scMin;
4446
4447 if (!defined $AS_secBest) {
4448 if ($bestOver >= $diff * 0.8) { return 42; }
4449 elsif ($bestOver >= $diff * 0.7) { return 40; }
4450 elsif ($bestOver >= $diff * 0.6) { return 24; }
4451 elsif ($bestOver >= $diff * 0.5) { return 23; }
4452 elsif ($bestOver >= $diff * 0.4) { return 8; }
4453 elsif ($bestOver >= $diff * 0.3) { return 3; }
4454 else { return 0; }
4455 } else {
4456 my $bestDiff = abs(abs($AS_best) - abs($AS_secBest));
4457 if ($bestDiff >= $diff * 0.9) {
4458 if ($bestOver == $diff) {
4459 return 39;
4460 } else {
4461 return 33;
4462 }
4463 } elsif ($bestDiff >= $diff * 0.8) {
4464 if ($bestOver == $diff) {
4465 return 38;
4466 } else {
4467 return 27;
4468 }
4469 } elsif ($bestDiff >= $diff * 0.7) {
4470 if ($bestOver == $diff) {
4471 return 37;
4472 } else {
4473 return 26;
4474 }
4475 } elsif ($bestDiff >= $diff * 0.6) {
4476 if ($bestOver == $diff) {
4477 return 36;
4478 } else {
4479 return 22;
4480 }
4481 } elsif ($bestDiff >= $diff * 0.5) {
4482 if ($bestOver == $diff) {
4483 return 35;
4484 } elsif ($bestOver >= $diff * 0.84) {
4485 return 25;
4486 } elsif ($bestOver >= $diff * 0.68) {
4487 return 16;
4488 } else {
4489 return 5;
4490 }
4491 } elsif ($bestDiff >= $diff * 0.4) {
4492 if ($bestOver == $diff) {
4493 return 34;
4494 } elsif ($bestOver >= $diff * 0.84) {
4495 return 21;
4496 } elsif ($bestOver >= $diff * 0.68) {
4497 return 14;
4498 } else {
4499 return 4;
4500 }
4501 } elsif ($bestDiff >= $diff * 0.3) {
4502 if ($bestOver == $diff) {
4503 return 32;
4504 } elsif ($bestOver >= $diff * 0.88) {
4505 return 18;
4506 } elsif ($bestOver >= $diff * 0.67) {
4507 return 15;
4508 } else {
4509 return 3;
4510 }
4511 } elsif ($bestDiff >= $diff * 0.2) {
4512 if ($bestOver == $diff) {
4513 return 31;
4514 } elsif ($bestOver >= $diff * 0.88) {
4515 return 17;
4516 } elsif ($bestOver >= $diff * 0.67) {
4517 return 11;
4518 } else {
4519 return 0;
4520 }
4521 } elsif ($bestDiff >= $diff * 0.1) {
4522 if ($bestOver == $diff) {
4523 return 30;
4524 } elsif ($bestOver >= $diff * 0.88) {
4525 return 12;
4526 } elsif ($bestOver >= $diff * 0.67) {
4527 return 7;
4528 } else {
4529 return 0;
4530 }
4531 } elsif ($bestDiff > 0) {
4532 if ($bestOver >= $diff * 0.67) {
4533 return 6;
4534 } else {
4535 return 2;
4536 }
4537 } else {
4538 if ($bestOver >= $diff * 0.67) {
4539 return 1;
4540 } else {
4541 return 0;
4542 }
4543 }
4544 }
4545 }
4546
4547
4548 ###
4549
4550 sub decide_whether_paired_end_alignment_is_valid{
4551 my ($index,$identifier) = @_;
4552 my ($id_1,$strand_1,$mapped_chromosome_1,$position_1,$bowtie_sequence_1,$mismatch_info_1) = (split (/\t/,$fhs[$index]->{last_line_1},-1))[0,1,2,3,4,7];
4553 my ($id_2,$strand_2,$mapped_chromosome_2,$position_2,$bowtie_sequence_2,$mismatch_info_2) = (split (/\t/,$fhs[$index]->{last_line_2},-1))[0,1,2,3,4,7];
4554 chomp $mismatch_info_1;
4555 chomp $mismatch_info_2;
4556 my $seq_id_1 = $id_1;
4557 my $seq_id_2 = $id_2;
4558 $seq_id_1 =~ s/\/1$//; # removing the read /1
4559 $seq_id_2 =~ s/\/1$//; # removing the read /1
4560
4561 ### ensuring that the current entry is the correct sequence
4562 if ($seq_id_1 eq $identifier or $seq_id_2 eq $identifier){
4563 ### checking the orientation of the alignment. We need to discriminate between 8 different conditions, however only 4 of them are theoretically
4564 ### sensible alignments
4565 my $orientation = ensure_sensical_alignment_orientation_paired_ends ($index,$id_1,$strand_1,$id_2,$strand_2);
4566 ### If the orientation was correct can we move on
4567 if ($orientation == 1){
4568 return 1; ### 1st possibility for A SEQUENCE-PAIR TO PASS
4569 }
4570 ### If the alignment was in the wrong orientation we need to read in two new lines
4571 elsif($orientation == 0){
4572 my $newline_1 = $fhs[$index]->{fh}->getline();
4573 my $newline_2 = $fhs[$index]->{fh}->getline();
4574 if ($newline_1 and $newline_2){
4575 ### extract detailed information about the alignment again (from $newline_1 and $newline_2 this time)
4576 ($id_1,$strand_1) = (split (/\t/,$newline_1))[0,1];
4577 ($id_2,$strand_2) = (split (/\t/,$newline_2))[0,1];
4578
4579 my $seqid;
4580 $seq_id_1 = $id_1;
4581 $seq_id_2 = $id_2;
4582 # we need to capture the first read (ending on /1)
4583 if ($seq_id_1 =~ s/\/1$//){ # removing the read /1 tag
4584 $seqid = $seq_id_1;
4585 }
4586 elsif ($seq_id_2 =~ s/\/1$//){ # removing the read /1 tag
4587 $seqid = $seq_id_2;
4588 }
4589 else{
4590 die "One of the two reads needs to end on /1!!";
4591 }
4592
4593 ### ensuring that the next entry is still the correct sequence
4594 if ($seq_id_1 eq $identifier or $seq_id_2 eq $identifier){
4595 ### checking orientation again
4596 $orientation = ensure_sensical_alignment_orientation_paired_ends ($index,$id_1,$strand_1,$id_2,$strand_2);
4597 ### If the orientation was correct can we move on
4598 if ($orientation == 1){
4599 ### Writing the current sequence to last_line_1 and last_line_2
4600 $fhs[$index]->{last_seq_id} = $seqid;
4601 $fhs[$index]->{last_line_1} = $newline_1;
4602 $fhs[$index]->{last_line_2} = $newline_2;
4603 return 1; ### 2nd possibility for a SEQUENCE-PAIR TO PASS
4604 }
4605 ### If the alignment was in the wrong orientation again we need to read in yet another 2 new lines and store them in @fhs (this must be
4606 ### the next entry)
4607 elsif ($orientation == 0){
4608 $newline_1 = $fhs[$index]->{fh}->getline();
4609 $newline_2 = $fhs[$index]->{fh}->getline();
4610 if ($newline_1 and $newline_2){
4611 ($seq_id_1) = split (/\t/,$newline_1);
4612 ($seq_id_2) = split (/\t/,$newline_2);
4613
4614 $seqid = '';
4615 if ($seq_id_1 =~ s/\/1$//){ # removing the read /1 tag
4616 $seqid = $seq_id_1;
4617 }
4618 elsif ($seq_id_2 =~ s/\/1$//){ # removing the read /1 tag
4619 $seqid = $seq_id_2;
4620 }
4621 else{
4622 die "One of the two reads needs to end on /1!!";
4623 }
4624
4625 ### check if the next 2 lines still have the same seq ID (must not happen), and if not overwrite the current seq-ID and bowtie output with
4626 ### the same fields of the just read next entry
4627 die "Same seq ID 3 or more times in a row!(should be 2 max)" if ($seqid eq $identifier);
4628 $fhs[$index]->{last_seq_id} = $seqid;
4629 $fhs[$index]->{last_line_1} = $newline_1;
4630 $fhs[$index]->{last_line_2} = $newline_2;
4631 return 0; # not processing anything this round as the alignment currently stored in last_line_1 and _2 was in the wrong orientation
4632 }
4633 else {
4634 ### assigning undef to last_seq_id and last_line (end of bowtie output)
4635 $fhs[$index]->{last_seq_id} = undef;
4636 $fhs[$index]->{last_line_1} = undef;
4637 $fhs[$index]->{last_line_2} = undef;
4638 return 0; # not processing anything as the alignment currently stored in last_line_1 and _2 was in the wrong orientation
4639 }
4640 }
4641 else{
4642 die "The orientation of the alignment must be either correct or incorrect\n";
4643 }
4644 }
4645 ### the sequence pair we just read in is already the next sequence pair to be analysed -> store it in @fhs
4646 else{
4647 $fhs[$index]->{last_seq_id} = $seqid;
4648 $fhs[$index]->{last_line_1} = $newline_1;
4649 $fhs[$index]->{last_line_2} = $newline_2;
4650 return 0; # processing the new alignment result only in the next round
4651 }
4652 }
4653 else {
4654 # assigning undef to last_seq_id and both last_lines (end of bowtie output)
4655 $fhs[$index]->{last_seq_id} = undef;
4656 $fhs[$index]->{last_line_1} = undef;
4657 $fhs[$index]->{last_line_2} = undef;
4658 return 0; # not processing anything as the alignment currently stored in last_line_1 and _2 was in the wrong orientation
4659 }
4660 }
4661 else{
4662 die "The orientation of the alignment must be either correct or incorrect\n";
4663 }
4664 }
4665 ### the sequence pair stored in @fhs as last_line_1 and last_line_2 is already the next sequence pair to be analysed -> analyse next round
4666 else{
4667 return 0;
4668 }
4669 }
4670
4671 ### EXTRACT GENOMIC SEQUENCE | BOWTIE 1 | PAIRED-END
4672
4673 sub extract_corresponding_genomic_sequence_paired_ends {
4674 my ($sequence_identifier,$methylation_call_params) = @_;
4675 ### A bisulfite sequence pair for 1 location in the genome can theoretically be on any of the 4 possible converted strands. We are also giving the
4676 ### sequence a 'memory' of the conversion we are expecting which we will need later for the methylation call
4677 my $alignment_read_1;
4678 my $alignment_read_2;
4679 my $read_conversion_info_1;
4680 my $read_conversion_info_2;
4681 my $genome_conversion;
4682
4683 ### Now extracting the same sequence from the mouse genomic sequence, +2 extra bases at oone of the ends so that we can also make a CpG, CHG or CHH methylation call
4684 ### if the C happens to be at the first or last position of the actually observed sequence
4685 my $non_bisulfite_sequence_1;
4686 my $non_bisulfite_sequence_2;
4687
4688 ### all alignments reported by bowtie have the + alignment first and the - alignment as the second one irrespective of whether read 1 or read 2 was
4689 ### the + alignment. We however always read in sequences read 1 then read 2, so if read 2 is the + alignment we need to swap the extracted genomic
4690 ### sequences around!
4691 ### results from CT converted read 1 plus GA converted read 2 vs. CT converted genome (+/- orientation alignments are reported only)
4692 if ($methylation_call_params->{$sequence_identifier}->{index} == 0){
4693 ### [Index 0, sequence originated from (converted) forward strand]
4694 $counting{CT_GA_CT_count}++;
4695 $alignment_read_1 = '+';
4696 $alignment_read_2 = '-';
4697 $read_conversion_info_1 = 'CT';
4698 $read_conversion_info_2 = 'GA';
4699 $genome_conversion = 'CT';
4700 ### SEQUENCE 1 (this is always the forward hit, in this case it is read 1)
4701 ### for hits on the forward strand we need to capture 2 extra bases at the 3' end
4702
4703 $non_bisulfite_sequence_1 = substr ($chromosomes{$methylation_call_params->{$sequence_identifier}->{chromosome}},$methylation_call_params->{$sequence_identifier}->{start_seq_1},length($methylation_call_params->{$sequence_identifier}->{bowtie_sequence_1})+2); ##CHH change
4704
4705 ### SEQUENCE 2 (this will always be on the reverse strand, in this case it is read 2)
4706 ### As the second conversion is GA we need to capture 1 base 3', so that it is a 5' base after reverse complementation
4707 if (length($chromosomes{$methylation_call_params->{$sequence_identifier}->{chromosome}}) > $methylation_call_params->{$sequence_identifier}->{start_seq_2}+length($methylation_call_params->{$sequence_identifier}->{bowtie_sequence_2})+1){ ## CHH change to +1
4708
4709 $non_bisulfite_sequence_2 = substr ($chromosomes{$methylation_call_params->{$sequence_identifier}->{chromosome}},($methylation_call_params->{$sequence_identifier}->{start_seq_2}),length($methylation_call_params->{$sequence_identifier}->{bowtie_sequence_2})+2);
4710 ### the reverse strand sequence needs to be reverse complemented
4711 $non_bisulfite_sequence_2 = reverse_complement($non_bisulfite_sequence_2);
4712 }
4713 else{
4714 $non_bisulfite_sequence_2 = '';
4715 }
4716 }
4717
4718 ### results from GA converted read 1 plus CT converted read 2 vs. GA converted genome (+/- orientation alignments are reported only)
4719 elsif ($methylation_call_params->{$sequence_identifier}->{index} == 1){
4720 ### [Index 1, sequence originated from complementary to (converted) reverse strand]
4721 $counting{GA_CT_GA_count}++;
4722 $alignment_read_1 = '+';
4723 $alignment_read_2 = '-';
4724 $read_conversion_info_1 = 'GA';
4725 $read_conversion_info_2 = 'CT';
4726 $genome_conversion = 'GA';
4727
4728 ### SEQUENCE 1 (this is always the forward hit, in this case it is read 1)
4729 ### as we need to make the methylation call for the base 5' of the first base (GA conversion!) we need to capture 2 extra bases at the 5' end
4730 if ($methylation_call_params->{$sequence_identifier}->{start_seq_1}-1 > 0){ ## CHH change to -1
4731 $non_bisulfite_sequence_1 = substr ($chromosomes{$methylation_call_params->{$sequence_identifier}->{chromosome}},$methylation_call_params->{$sequence_identifier}->{start_seq_1}-2,length($methylation_call_params->{$sequence_identifier}->{bowtie_sequence_1})+2); ### CHH change to -2/+2
4732 }
4733 else{
4734 $non_bisulfite_sequence_1 = '';
4735 }
4736
4737 ### SEQUENCE 2 (this will always be on the reverse strand, in this case it is read 2)
4738 ### As we are doing a CT comparison for the reverse strand we are taking 2 bases extra at the 5' end, so it is a 3' base after reverse complementation
4739 $non_bisulfite_sequence_2 = substr ($chromosomes{$methylation_call_params->{$sequence_identifier}->{chromosome}},($methylation_call_params->{$sequence_identifier}->{start_seq_2})-2,length($methylation_call_params->{$sequence_identifier}->{bowtie_sequence_2})+2); ### CHH change to -2/+2
4740 ### the reverse strand sequence needs to be reverse complemented
4741 $non_bisulfite_sequence_2 = reverse_complement($non_bisulfite_sequence_2);
4742 }
4743
4744 ### results from GA converted read 1 plus CT converted read 2 vs. CT converted genome (-/+ orientation alignments are reported only)
4745 elsif ($methylation_call_params->{$sequence_identifier}->{index} == 2){
4746 ### [Index 2, sequence originated from the complementary to (converted) forward strand]
4747 $counting{GA_CT_CT_count}++;
4748 $alignment_read_1 = '-';
4749 $alignment_read_2 = '+';
4750 $read_conversion_info_1 = 'GA';
4751 $read_conversion_info_2 = 'CT';
4752 $genome_conversion = 'CT';
4753
4754 ### Here we switch the sequence information round!! non_bisulfite_sequence_1 will later correspond to the read 1!!!!
4755 ### SEQUENCE 1 (this is always the forward hit, in this case it is READ 2), read 1 is in - orientation on the reverse strand
4756 ### As read 1 is GA converted we need to capture 2 extra 3' bases which will be 2 extra 5' base after reverse complementation
4757 $non_bisulfite_sequence_1 = substr ($chromosomes{$methylation_call_params->{$sequence_identifier}->{chromosome}},($methylation_call_params->{$sequence_identifier}->{start_seq_2}),length($methylation_call_params->{$sequence_identifier}->{bowtie_sequence_2})+2); ### CHH change to +2
4758 ### the reverse strand sequence needs to be reverse complemented
4759 $non_bisulfite_sequence_1 = reverse_complement($non_bisulfite_sequence_1);
4760
4761 ### SEQUENCE 2 (this will always be on the reverse strand, in this case it is READ 1)
4762 ### non_bisulfite_sequence_2 will later correspond to the read 2!!!!
4763 ### Read 2 is CT converted so we need to capture 2 extra 3' bases
4764 if (length($chromosomes{$methylation_call_params->{$sequence_identifier}->{chromosome}}) > ($methylation_call_params->{$sequence_identifier}->{start_seq_1})+length($methylation_call_params->{$sequence_identifier}->{bowtie_sequence_1})+1){ ## CHH change to +1
4765 $non_bisulfite_sequence_2 = substr ($chromosomes{$methylation_call_params->{$sequence_identifier}->{chromosome}},($methylation_call_params->{$sequence_identifier}->{start_seq_1}),length($methylation_call_params->{$sequence_identifier}->{bowtie_sequence_1})+2); ## CHH changed from +1 to +2
4766 }
4767 else{
4768 $non_bisulfite_sequence_2 = '';
4769 }
4770 }
4771
4772 ### results from CT converted read 1 plus GA converted read 2 vs. GA converted genome (-/+ orientation alignments are reported only)
4773 elsif ($methylation_call_params->{$sequence_identifier}->{index} == 3){
4774 ### [Index 3, sequence originated from the (converted) reverse strand]
4775 $counting{CT_GA_GA_count}++;
4776 $alignment_read_1 = '-';
4777 $alignment_read_2 = '+';
4778 $read_conversion_info_1 = 'CT';
4779 $read_conversion_info_2 = 'GA';
4780 $genome_conversion = 'GA';
4781
4782 ### Here we switch the sequence information round!! non_bisulfite_sequence_1 will later correspond to the read 1!!!!
4783 ### SEQUENCE 1 (this is always the forward hit, in this case it is READ 2), read 1 is in - orientation on the reverse strand
4784 ### As read 1 is CT converted we need to capture 2 extra 5' bases which will be 2 extra 3' base after reverse complementation
4785 if ( ($methylation_call_params->{$sequence_identifier}->{start_seq_2}-1) > 0){ ## CHH changed to -1
4786 $non_bisulfite_sequence_1 = substr ($chromosomes{$methylation_call_params->{$sequence_identifier}->{chromosome}},($methylation_call_params->{$sequence_identifier}->{start_seq_2})-2,length($methylation_call_params->{$sequence_identifier}->{bowtie_sequence_2})+2); ### CHH changed to -2/+2
4787 ### the reverse strand sequence needs to be reverse complemented
4788 $non_bisulfite_sequence_1 = reverse_complement($non_bisulfite_sequence_1);
4789 }
4790 else{
4791 $non_bisulfite_sequence_1 = '';
4792 }
4793
4794 ### SEQUENCE 2 (this will always be on the reverse strand, in this case it is READ 1)
4795 ### non_bisulfite_sequence_2 will later correspond to the read 2!!!!
4796 ### Read 2 is GA converted so we need to capture 2 extra 5' bases
4797 $non_bisulfite_sequence_2 = substr ($chromosomes{$methylation_call_params->{$sequence_identifier}->{chromosome}},($methylation_call_params->{$sequence_identifier}->{start_seq_1})-2,length($methylation_call_params->{$sequence_identifier}->{bowtie_sequence_1})+2); ### CHH changed to -2/+2
4798 }
4799 else{
4800 die "Too many bowtie result filehandles\n";
4801 }
4802 ### the alignment_strand information is needed to determine which strand of the genomic sequence we are comparing the read against,
4803 ### the read_conversion information is needed to know whether we are looking for C->T or G->A substitutions
4804
4805 $methylation_call_params->{$sequence_identifier}->{alignment_read_1} = $alignment_read_1;
4806 $methylation_call_params->{$sequence_identifier}->{alignment_read_2} = $alignment_read_2;
4807 $methylation_call_params->{$sequence_identifier}->{genome_conversion} = $genome_conversion;
4808 $methylation_call_params->{$sequence_identifier}->{read_conversion_1} = $read_conversion_info_1;
4809 $methylation_call_params->{$sequence_identifier}->{read_conversion_2} = $read_conversion_info_2;
4810 $methylation_call_params->{$sequence_identifier}->{unmodified_genomic_sequence_1} = $non_bisulfite_sequence_1;
4811 $methylation_call_params->{$sequence_identifier}->{unmodified_genomic_sequence_2} = $non_bisulfite_sequence_2;
4812 }
4813
4814 ### EXTRACT GENOMIC SEQUENCE BOWTIE 2 | PAIRED-END
4815
4816 sub extract_corresponding_genomic_sequence_paired_ends_bowtie2{
4817 my ($sequence_identifier,$methylation_call_params) = @_;
4818 ### A bisulfite sequence pair for 1 location in the genome can theoretically be on any of the 4 possible converted strands. We are also giving the
4819 ### sequence a 'memory' of the conversion we are expecting which we will need later for the methylation call
4820
4821 my $cigar_1 = $methylation_call_params->{$sequence_identifier}->{CIGAR_1};
4822 my $cigar_2 = $methylation_call_params->{$sequence_identifier}->{CIGAR_2};
4823 my $flag_1 = $methylation_call_params->{$sequence_identifier}->{flag_1};
4824 my $flag_2 = $methylation_call_params->{$sequence_identifier}->{flag_2};
4825
4826 my $contains_deletion_1 = 0;
4827 my $contains_deletion_2 = 0;
4828 if ($cigar_1 =~ /D/){
4829 $contains_deletion_1 = 1;
4830 if ($verbose){ warn "$cigar_1\n$methylation_call_params->{$sequence_identifier}->{mismatch_info_1}\n";}
4831 }
4832 if ($cigar_2 =~ /D/){
4833 $contains_deletion_2 = 1;
4834 if ($verbose){ warn "$cigar_2\n$methylation_call_params->{$sequence_identifier}->{mismatch_info_2}\n";}
4835 }
4836
4837 # warn "$cigar_1\t$cigar_2\t$flag_1\t$flag_2\n";
4838 ### We are now extracting the corresponding genomic sequence, +2 extra bases at the end (or start) so that we can also make a CpG methylation call and
4839 ### in addition make differential calls for Cs in CHG or CHH context if the C happens to be at the last (or first) position of the actually observed sequence
4840
4841 ### the alignment_strand information is needed to determine which strand of the genomic sequence we are comparing the read against,
4842 ### the read_conversion information is needed to know whether we are looking for C->T or G->A substitutions
4843 my $alignment_read_1;
4844 my $alignment_read_2;
4845 my $read_conversion_info_1;
4846 my $read_conversion_info_2;
4847 my $genome_conversion;
4848
4849 ### Now extracting the same sequence from the mouse genomic sequence, +2 extra bases at one of the ends so that we can also make a CpG, CHG or CHH methylation call
4850 ### if the C happens to be at the last position of the actually observed sequence
4851 my $non_bisulfite_sequence_1 = '';
4852 my $non_bisulfite_sequence_2 = '';
4853 my $genomic_seq_for_MD_tag_1 = ''; # this sequence contains potential deletions in the genome as well so that we can generate a proper MD tag for the SAM output
4854 my $genomic_seq_for_MD_tag_2 = '';
4855
4856 ### Positions in SAM format are 1 based, so we need to subract 1 when getting substrings
4857 my $pos_1 = $methylation_call_params->{$sequence_identifier}->{position_1}-1;
4858 my $pos_2 = $methylation_call_params->{$sequence_identifier}->{position_2}-1;
4859
4860 # parsing CIGAR 1 string
4861 my @len_1 = split (/\D+/,$cigar_1); # storing the length per operation
4862 my @ops_1 = split (/\d+/,$cigar_1); # storing the operation
4863 shift @ops_1; # remove the empty first element
4864 die "CIGAR 1 string contained a non-matching number of lengths and operations\n" unless (scalar @len_1 == scalar @ops_1);
4865 # parsing CIGAR 2 string
4866 my @len_2 = split (/\D+/,$cigar_2); # storing the length per operation
4867 my @ops_2 = split (/\d+/,$cigar_2); # storing the operation
4868 shift @ops_2; # remove the empty first element
4869 die "CIGAR 2 string contained a non-matching number of lengths and operations\n" unless (scalar @len_2 == scalar @ops_2);
4870
4871 my $indels_1 = 0; # adding these to the hemming distance value (needed for the NM field in the final SAM output
4872 my $indels_2 = 0;
4873
4874 ### Extracting read 1 genomic sequence ###
4875
4876 # extracting 2 additional bp at the 5' end (read 1)
4877 if ( ($methylation_call_params->{$sequence_identifier}->{index} == 1) or ($methylation_call_params->{$sequence_identifier}->{index} == 3) ){
4878 # checking if the substring will be valid or if we can't extract the sequence because we are right at the edge of a chromosome
4879 unless ( ($pos_1-2) > 0){# exiting with en empty genomic sequence otherwise
4880 $methylation_call_params->{$sequence_identifier}->{unmodified_genomic_sequence_1} = $non_bisulfite_sequence_1;
4881 $methylation_call_params->{$sequence_identifier}->{genomic_seq_for_MD_tag_1} = $genomic_seq_for_MD_tag_1;
4882 return;
4883 }
4884 $non_bisulfite_sequence_1 .= substr ($chromosomes{$methylation_call_params->{$sequence_identifier}->{chromosome}},$pos_1-2,2);
4885 }
4886
4887 foreach (0..$#len_1){
4888 if ($ops_1[$_] eq 'M'){
4889 # extracting genomic sequence
4890 $non_bisulfite_sequence_1 .= substr ($chromosomes{$methylation_call_params->{$sequence_identifier}->{chromosome}},$pos_1,$len_1[$_]);
4891 if ($contains_deletion_1){
4892 $genomic_seq_for_MD_tag_1 .= substr ($chromosomes{$methylation_call_params->{$sequence_identifier}->{chromosome}},$pos_1,$len_1[$_]);
4893 }
4894 # warn "$non_bisulfite_sequence_1\n";
4895 # adjusting position
4896 $pos_1 += $len_1[$_];
4897 }
4898 elsif ($ops_1[$_] eq 'I'){ # insertion in the read sequence
4899 # we simply add padding Xs instead of finding genomic sequence. This will not be used to infer methylation calls, and we can later ignore it for the generation of the MD;Z: tag
4900 $non_bisulfite_sequence_1 .= 'X' x $len_1[$_];
4901 if ($contains_deletion_1){
4902 $genomic_seq_for_MD_tag_1 .= 'X' x $len_1[$_];
4903 }
4904 # warn "$non_bisulfite_sequence_1\n";
4905 # position doesn't need adjusting
4906
4907 ### 03 06 2014: In fact we don't need to add anything to the hemming distance for insertions since we use padding Xs which will fail a base by base comparison in hemming_dist()
4908 # indels_1 += $len_1[$_]; # adding to $indels_1 to determine the hemming distance (= single base mismatches, insertions or deletions) for the SAM output
4909 }
4910 elsif ($ops_1[$_] eq 'D'){ # deletion in the read sequence
4911 # we do not add any genomic sequence but only adjust the position
4912 # we do however need to add the genomic sequence to $genomic_seq_for_MD-tag so we can create a proper MD tag later
4913 if ($contains_deletion_1){
4914 $genomic_seq_for_MD_tag_1 .= substr ($chromosomes{$methylation_call_params->{$sequence_identifier}->{chromosome}},$pos_1,$len_1[$_]);
4915 }
4916 # warn "Just adjusting the position by: ",$len_1[$_],"bp\n";
4917 $pos_1 += $len_1[$_];
4918 $indels_1 += $len_1[$_]; # adding to $indels_1 to determine the hemming distance (= single base mismatches, insertions or deletions) for the SAM output
4919 }
4920 elsif($cigar_1 =~ tr/[NSHPX=]//){ # if these (for standard mapping) illegal characters exist we die
4921 die "The CIGAR 1 string contained illegal CIGAR operations in addition to 'M', 'I' and 'D': $cigar_1\n";
4922 }
4923 else{
4924 die "The CIGAR 1 string contained undefined CIGAR operations in addition to 'M', 'I' and 'D': $cigar_1\n";
4925 }
4926 }
4927
4928 ### 3' end of read 1
4929 if ( ($methylation_call_params->{$sequence_identifier}->{index} == 0) or ($methylation_call_params->{$sequence_identifier}->{index} == 2) ){
4930 ## checking if the substring will be valid or if we can't extract the sequence because we are right at the edge of a chromosome
4931 unless (length($chromosomes{$methylation_call_params->{$sequence_identifier}->{chromosome}}) >= $pos_1+2){# exiting with en empty genomic sequence otherwise
4932 $methylation_call_params->{$sequence_identifier}->{unmodified_genomic_sequence_1} = $non_bisulfite_sequence_1;
4933 return;
4934 }
4935
4936 $non_bisulfite_sequence_1 .= substr ($chromosomes{$methylation_call_params->{$sequence_identifier}->{chromosome}},$pos_1,2);
4937 }
4938
4939
4940 ### Extracting read 2 genomic sequence ###
4941
4942 ### 5' end of read 2
4943 if ( ($methylation_call_params->{$sequence_identifier}->{index} == 1) or ($methylation_call_params->{$sequence_identifier}->{index} == 3) ){
4944 ## checking if the substring will be valid or if we can't extract the sequence because we are right at the edge of a chromosome
4945 unless ( ($pos_2-2) >= 0){# exiting with en empty genomic sequence otherwise
4946 $methylation_call_params->{$sequence_identifier}->{unmodified_genomic_sequence_1} = $non_bisulfite_sequence_1;
4947 $methylation_call_params->{$sequence_identifier}->{unmodified_genomic_sequence_2} = $non_bisulfite_sequence_2;
4948 $methylation_call_params->{$sequence_identifier}->{genomic_seq_for_MD_tag_2} = $genomic_seq_for_MD_tag_2;
4949 return;
4950 }
4951 $non_bisulfite_sequence_2 .= substr ($chromosomes{$methylation_call_params->{$sequence_identifier}->{chromosome}},$pos_2-2,2);
4952 }
4953
4954 foreach (0..$#len_2){
4955 if ($ops_2[$_] eq 'M'){
4956 # extracting genomic sequence
4957 $non_bisulfite_sequence_2 .= substr ($chromosomes{$methylation_call_params->{$sequence_identifier}->{chromosome}},$pos_2,$len_2[$_]);
4958 if ($contains_deletion_2){
4959 $genomic_seq_for_MD_tag_2 .= substr ($chromosomes{$methylation_call_params->{$sequence_identifier}->{chromosome}},$pos_2,$len_2[$_]);
4960 }
4961 # warn "$non_bisulfite_sequence_2\n";
4962 # adjusting position
4963 $pos_2 += $len_2[$_];
4964 }
4965 elsif ($ops_2[$_] eq 'I'){ # insertion in the read sequence
4966 # we simply add padding Xs instead of finding genomic sequence. This will not be used to infer methylation calls and we can ignore this later during the generation of the MD:Z: tag
4967 $non_bisulfite_sequence_2 .= 'X' x $len_2[$_];
4968 if ($contains_deletion_2){
4969 $genomic_seq_for_MD_tag_2 .= 'X' x $len_2[$_];
4970 }
4971 # warn "$non_bisulfite_sequence_2\n";
4972 # position doesn't need adjusting
4973
4974 ### 03 06 2014: In fact we don't need to add anything to the hemming distance for insertions since we use padding Xs which will fail a base by base comparison in hemming_dist()
4975 # $indels_2 += $len_2[$_]; # adding to $indels_1 to determine the hemming distance (= single base mismatches, insertions or deletions) for the SAM output
4976 }
4977 elsif ($ops_2[$_] eq 'D'){ # deletion in the read sequence
4978 # we do not add any genomic sequence but only adjust the position
4979 # we do however need to add the genomic sequence to $genomic_seq_for_MD-tag so we can create a proper MD tag later
4980 if ($contains_deletion_2){
4981 $genomic_seq_for_MD_tag_2 .= substr ($chromosomes{$methylation_call_params->{$sequence_identifier}->{chromosome}},$pos_2,$len_2[$_]);
4982 }
4983 # warn "Just adjusting the position by: ",$len_2[$_],"bp\n";
4984 $pos_2 += $len_2[$_];
4985 $indels_2 += $len_2[$_]; # adding to $indels_1 to determine the hemming distance (= single base mismatches, insertions or deletions) for the SAM output
4986 }
4987 elsif($cigar_2 =~ tr/[NSHPX=]//){ # if these (for standard mapping) illegal characters exist we die
4988 die "The CIGAR 2 string contained illegal CIGAR operations in addition to 'M', 'I' and 'D': $cigar_2\n";
4989 }
4990 else{
4991 die "The CIGAR 2 string contained undefined CIGAR operations in addition to 'M', 'I' and 'D': $cigar_2\n";
4992 }
4993 }
4994
4995 ### 3' end of read 2
4996 if ( ($methylation_call_params->{$sequence_identifier}->{index} == 0) or ($methylation_call_params->{$sequence_identifier}->{index} == 2) ){
4997 ## checking if the substring will be valid or if we can't extract the sequence because we are right at the edge of a chromosome
4998 unless (length($chromosomes{$methylation_call_params->{$sequence_identifier}->{chromosome}}) >= $pos_2+2){# exiting with en empty genomic sequence otherwise
4999 # need to set read 1 as well now to prevent warning
5000 # warn "'$non_bisulfite_sequence_1'\n'$non_bisulfite_sequence_2'\n\n";
5001 # sleep(5);
5002 $methylation_call_params->{$sequence_identifier}->{unmodified_genomic_sequence_1} = $non_bisulfite_sequence_1;
5003 $methylation_call_params->{$sequence_identifier}->{unmodified_genomic_sequence_2} = $non_bisulfite_sequence_2;
5004 return;
5005 }
5006 $non_bisulfite_sequence_2 .= substr ($chromosomes{$methylation_call_params->{$sequence_identifier}->{chromosome}},$pos_2,2);
5007 }
5008
5009 ### all paired-end alignments reported by Bowtie 2 have the Read 1 alignment first and the Read 2 alignment as the second one irrespective of whether read 1 or read 2 was
5010 ### the + alignment. We also read in sequences read 1 then read 2 so they should correspond perfectly
5011
5012 ### results from CT converted read 1 plus GA converted read 2 vs. CT converted genome (+/- orientation alignments are reported only)
5013 if ($methylation_call_params->{$sequence_identifier}->{index} == 0){
5014 ### [Index 0, sequence originated from (converted) forward strand]
5015 $counting{CT_GA_CT_count}++;
5016 $alignment_read_1 = '+';
5017 $alignment_read_2 = '-';
5018 $read_conversion_info_1 = 'CT';
5019 $read_conversion_info_2 = 'GA';
5020 $genome_conversion = 'CT';
5021 ### Read 1 is always the forward hit
5022 ### Read 2 is will always on the reverse strand, so it needs to be reverse complemented
5023 $non_bisulfite_sequence_2 = reverse_complement($non_bisulfite_sequence_2);
5024 if ($contains_deletion_2){
5025 $genomic_seq_for_MD_tag_2 = reverse_complement($genomic_seq_for_MD_tag_2);
5026 }
5027 }
5028
5029 ### results from GA converted read 1 plus CT converted read 2 vs. GA converted genome (+/- orientation alignments are reported only)
5030 elsif ($methylation_call_params->{$sequence_identifier}->{index} == 1){
5031 ### [Index 1, sequence originated from complementary to (converted) bottom strand]
5032 $counting{GA_CT_GA_count}++;
5033 $alignment_read_1 = '+';
5034 $alignment_read_2 = '-';
5035 $read_conversion_info_1 = 'GA';
5036 $read_conversion_info_2 = 'CT';
5037 $genome_conversion = 'GA';
5038 ### Read 1 is always the forward hit
5039 ### Read 2 is will always on the reverse strand, so it needs to be reverse complemented
5040 $non_bisulfite_sequence_2 = reverse_complement($non_bisulfite_sequence_2);
5041 if ($contains_deletion_2){
5042 $genomic_seq_for_MD_tag_2 = reverse_complement($genomic_seq_for_MD_tag_2);
5043 }
5044 }
5045
5046 ### results from GA converted read 1 plus CT converted read 2 vs. CT converted genome (-/+ orientation alignments are reported only)
5047 elsif ($methylation_call_params->{$sequence_identifier}->{index} == 2){
5048 ### [Index 2, sequence originated from the complementary to (converted) top strand]
5049 $counting{GA_CT_CT_count}++;
5050 $alignment_read_1 = '-';
5051 $alignment_read_2 = '+';
5052 $read_conversion_info_1 = 'GA';
5053 $read_conversion_info_2 = 'CT';
5054 $genome_conversion = 'CT';
5055
5056 ### Read 1 (the reverse strand) genomic sequence needs to be reverse complemented
5057 $non_bisulfite_sequence_1 = reverse_complement($non_bisulfite_sequence_1);
5058 if ($contains_deletion_1){
5059 $genomic_seq_for_MD_tag_1 = reverse_complement($genomic_seq_for_MD_tag_1);
5060 }
5061 }
5062
5063 ### results from CT converted read 1 plus GA converted read 2 vs. GA converted genome (-/+ orientation alignments are reported only)
5064 elsif ($methylation_call_params->{$sequence_identifier}->{index} == 3){
5065 ### [Index 3, sequence originated from the (converted) reverse strand]
5066 $counting{CT_GA_GA_count}++;
5067 $alignment_read_1 = '-';
5068 $alignment_read_2 = '+';
5069 $read_conversion_info_1 = 'CT';
5070 $read_conversion_info_2 = 'GA';
5071 $genome_conversion = 'GA';
5072 ### Read 1 (the reverse strand) genomic sequence needs to be reverse complemented
5073 $non_bisulfite_sequence_1 = reverse_complement($non_bisulfite_sequence_1);
5074 if ($contains_deletion_1){
5075 $genomic_seq_for_MD_tag_1 = reverse_complement($genomic_seq_for_MD_tag_1);
5076 }
5077 }
5078 else{
5079 die "Too many bowtie result filehandles\n";
5080 }
5081 ### the alignment_strand information is needed to determine which strand of the genomic sequence we are comparing the read against,
5082 ### the read_conversion information is needed to know whether we are looking for C->T or G->A substitutions
5083
5084 $methylation_call_params->{$sequence_identifier}->{alignment_read_1} = $alignment_read_1;
5085 $methylation_call_params->{$sequence_identifier}->{alignment_read_2} = $alignment_read_2;
5086 $methylation_call_params->{$sequence_identifier}->{genome_conversion} = $genome_conversion;
5087 $methylation_call_params->{$sequence_identifier}->{read_conversion_1} = $read_conversion_info_1;
5088 $methylation_call_params->{$sequence_identifier}->{read_conversion_2} = $read_conversion_info_2;
5089 $methylation_call_params->{$sequence_identifier}->{unmodified_genomic_sequence_1} = $non_bisulfite_sequence_1;
5090 $methylation_call_params->{$sequence_identifier}->{unmodified_genomic_sequence_2} = $non_bisulfite_sequence_2;
5091 $methylation_call_params->{$sequence_identifier}->{genomic_seq_for_MD_tag_1} = $genomic_seq_for_MD_tag_1;
5092 $methylation_call_params->{$sequence_identifier}->{genomic_seq_for_MD_tag_2} = $genomic_seq_for_MD_tag_2;
5093
5094 ## the end position of a read is stored in $pos
5095 $methylation_call_params->{$sequence_identifier}->{end_position_1} = $pos_1;
5096 $methylation_call_params->{$sequence_identifier}->{end_position_2} = $pos_2;
5097 $methylation_call_params->{$sequence_identifier}->{indels_1} = $indels_1;
5098 $methylation_call_params->{$sequence_identifier}->{indels_2} = $indels_2;
5099 }
5100
5101 ##########################################
5102 ### PRINT SINGLE END RESULTS: Bowtie 1 ###
5103 ##########################################
5104
5105 sub print_bisulfite_mapping_result_single_end{
5106 my ($identifier,$sequence,$methylation_call_params,$quality_value)= @_;
5107
5108 ### we will output the FastQ quality in Sanger encoding (Phred 33 scale)
5109 if ($phred64){
5110 $quality_value = convert_phred64_quals_to_phred33($quality_value);
5111 }
5112 elsif ($solexa){
5113 $quality_value = convert_solexa_quals_to_phred33($quality_value);
5114 }
5115
5116 ### We will add +1 bp to the starting position of single-end reads, as Bowtie 1 reports the index and not the bp position.
5117 $methylation_call_params->{$identifier}->{position} += 1;
5118
5119 ### writing every uniquely mapped read and its methylation call to the output file
5120 if ($vanilla){
5121 my $bowtie1_output = join("\t",$identifier,$methylation_call_params->{$identifier}->{alignment_strand},$methylation_call_params->{$identifier}->{chromosome},$methylation_call_params->{$identifier}->{position},$methylation_call_params->{$identifier}->{end_position},$sequence,$methylation_call_params->{$identifier}->{unmodified_genomic_sequence},$methylation_call_params->{$identifier}->{methylation_call},$methylation_call_params->{$identifier}->{read_conversion},$methylation_call_params->{$identifier}->{genome_conversion},$quality_value);
5122 print OUT "$bowtie1_output\n";
5123 }
5124 else{ # SAM output, default since Bismark v1.0.0
5125 single_end_SAM_output($identifier,$sequence,$methylation_call_params,$quality_value); # at the end of the script
5126 }
5127 }
5128
5129 ##########################################
5130 ### PRINT SINGLE END RESULTS: Bowtie 2 ###
5131 ##########################################
5132
5133 sub print_bisulfite_mapping_result_single_end_bowtie2{
5134 my ($identifier,$sequence,$methylation_call_params,$quality_value)= @_;
5135
5136 ### we will output the FastQ quality in Sanger encoding (Phred 33 scale)
5137 if ($phred64){
5138 $quality_value = convert_phred64_quals_to_phred33($quality_value);
5139 }
5140 elsif ($solexa){
5141 $quality_value = convert_solexa_quals_to_phred33($quality_value);
5142 }
5143
5144 ### writing every mapped read and its methylation call to the SAM output file (unmapped and ambiguous reads were already printed)
5145 single_end_SAM_output($identifier,$sequence,$methylation_call_params,$quality_value); # at the end of the script
5146 }
5147
5148 ##########################################
5149 ### PRINT PAIRED END ESULTS: Bowtie 1 ###
5150 ##########################################
5151
5152 sub print_bisulfite_mapping_results_paired_ends{
5153 my ($identifier,$sequence_1,$sequence_2,$methylation_call_params,$quality_value_1,$quality_value_2)= @_;
5154
5155 ### we will output the FastQ quality in Sanger encoding (Phred 33 scale)
5156 if ($phred64){
5157 $quality_value_1 = convert_phred64_quals_to_phred33($quality_value_1);
5158 $quality_value_2 = convert_phred64_quals_to_phred33($quality_value_2);
5159 }
5160 elsif ($solexa){
5161 $quality_value_1 = convert_solexa_quals_to_phred33($quality_value_1);
5162 $quality_value_2 = convert_solexa_quals_to_phred33($quality_value_2);
5163 }
5164
5165 ### We will add +1 bp to the start position of paired-end reads, as Bowtie 1 reports the index and not the bp position. (End position is already 1-based)
5166 $methylation_call_params->{$identifier}->{start_seq_1} += 1;
5167
5168 ### writing every single aligned read and its methylation call to the output file
5169 if ($vanilla){
5170 my $bowtie1_output_paired_end = join("\t",$identifier,$methylation_call_params->{$identifier}->{alignment_read_1},$methylation_call_params->{$identifier}->{chromosome},$methylation_call_params->{$identifier}->{start_seq_1},$methylation_call_params->{$identifier}->{alignment_end},$sequence_1,$methylation_call_params->{$identifier}->{unmodified_genomic_sequence_1},$methylation_call_params->{$identifier}->{methylation_call_1},$sequence_2,$methylation_call_params->{$identifier}->{unmodified_genomic_sequence_2},$methylation_call_params->{$identifier}->{methylation_call_2},$methylation_call_params->{$identifier}->{read_conversion_1},$methylation_call_params->{$identifier}->{genome_conversion},$quality_value_1,$quality_value_2);
5171 print OUT "$bowtie1_output_paired_end\n";
5172 }
5173 else{ # SAM output, default since Bismark v1.0.0
5174 paired_end_SAM_output($identifier,$sequence_1,$sequence_2,$methylation_call_params,$quality_value_1,$quality_value_2); # at the end of the script
5175 }
5176
5177 }
5178
5179 ##########################################
5180 ### PRINT PAIRED END ESULTS: Bowtie 2 ###
5181 ##########################################
5182
5183 sub print_bisulfite_mapping_results_paired_ends_bowtie2{
5184 my ($identifier,$sequence_1,$sequence_2,$methylation_call_params,$quality_value_1,$quality_value_2)= @_;
5185
5186 ### we will output the FastQ quality in Sanger encoding (Phred 33 scale)
5187 if ($phred64){
5188 $quality_value_1 = convert_phred64_quals_to_phred33($quality_value_1);
5189 $quality_value_2 = convert_phred64_quals_to_phred33($quality_value_2);
5190 }
5191 elsif ($solexa){
5192 $quality_value_1 = convert_solexa_quals_to_phred33($quality_value_1);
5193 $quality_value_2 = convert_solexa_quals_to_phred33($quality_value_2);
5194 }
5195
5196 ### writing every single aligned read and its methylation call to the output file (unmapped and ambiguous reads were already printed)
5197 paired_end_SAM_output($identifier,$sequence_1,$sequence_2,$methylation_call_params,$quality_value_1,$quality_value_2); # at the end of the script
5198
5199 }
5200
5201
5202 sub convert_phred64_quals_to_phred33{
5203
5204 my $qual = shift;
5205 my @quals = split (//,$qual);
5206 my @new_quals;
5207
5208 foreach my $index (0..$#quals){
5209 my $phred_score = convert_phred64_quality_string_into_phred_score ($quals[$index]);
5210 my $phred33_quality_string = convert_phred_score_into_phred33_quality_string ($phred_score);
5211 $new_quals[$index] = $phred33_quality_string;
5212 }
5213
5214 my $phred33_quality = join ("",@new_quals);
5215 return $phred33_quality;
5216 }
5217
5218 sub convert_solexa_quals_to_phred33{
5219
5220 my $qual = shift;
5221 my @quals = split (//,$qual);
5222 my @new_quals;
5223
5224 foreach my $index (0..$#quals){
5225 my $phred_score = convert_solexa_pre1_3_quality_string_into_phred_score ($quals[$index]);
5226 my $phred33_quality_string = convert_phred_score_into_phred33_quality_string ($phred_score);
5227 $new_quals[$index] = $phred33_quality_string;
5228 }
5229
5230 my $phred33_quality = join ("",@new_quals);
5231 return $phred33_quality;
5232 }
5233
5234 sub convert_phred_score_into_phred33_quality_string{
5235 my $qual = shift;
5236 $qual = chr($qual+33);
5237 return $qual;
5238 }
5239
5240 sub convert_phred64_quality_string_into_phred_score{
5241 my $string = shift;
5242 my $qual = ord($string)-64;
5243 return $qual;
5244 }
5245
5246 sub convert_solexa_pre1_3_quality_string_into_phred_score{
5247 ### We will just use 59 as the offset here as all Phred Scores between 10 and 40 look exactly the same, there is only a minute difference for values between 0 and 10
5248 my $string = shift;
5249 my $qual = ord($string)-59;
5250 return $qual;
5251 }
5252
5253
5254 sub extract_corresponding_genomic_sequence_single_end {
5255 my ($sequence_identifier,$methylation_call_params) = @_;
5256 ### A bisulfite sequence for 1 location in the genome can theoretically be any of the 4 possible converted strands. We are also giving the
5257 ### sequence a 'memory' of the conversion we are expecting which we will need later for the methylation call
5258
5259 ### the alignment_strand information is needed to determine which strand of the genomic sequence we are comparing the read against,
5260 ### the read_conversion information is needed to know whether we are looking for C->T or G->A substitutions
5261 my $alignment_strand;
5262 my $read_conversion_info;
5263 my $genome_conversion;
5264 ### Also extracting the corresponding genomic sequence, +2 extra bases at the end so that we can also make a CpG methylation call and
5265 ### in addition make differential calls for Cs non-CpG context, which will now be divided into CHG and CHH methylation,
5266 ### if the C happens to be at the last position of the actually observed sequence
5267 my $non_bisulfite_sequence;
5268 ### depending on the conversion we want to make need to capture 1 extra base at the 3' end
5269
5270 my $pbat_index_modifier = 0;
5271
5272 if ($pbat){
5273 $pbat_index_modifier += 2; # (we are simply not running indexes 0 or 1!
5274 }
5275
5276 ### results from CT converted read vs. CT converted genome (+ orientation alignments are reported only)
5277 if ( ($methylation_call_params->{$sequence_identifier}->{index} + $pbat_index_modifier) == 0){
5278 ### [Index 0, sequence originated from (converted) forward strand]
5279 $counting{CT_CT_count}++;
5280 $alignment_strand = '+';
5281 $read_conversion_info = 'CT';
5282 $genome_conversion = 'CT';
5283
5284 ## checking if the substring will be valid or if we can't extract the sequence because we are right at the edge of a chromosome
5285 if (length($chromosomes{$methylation_call_params->{$sequence_identifier}->{chromosome}}) > $methylation_call_params->{$sequence_identifier}->{position}+length($methylation_call_params->{$sequence_identifier}->{bowtie_sequence})+1){ ## CHH changed to +1
5286 ### + 2 extra base at the 3' end
5287 $non_bisulfite_sequence = substr ($chromosomes{$methylation_call_params->{$sequence_identifier}->{chromosome}},$methylation_call_params->{$sequence_identifier}->{position},length($methylation_call_params->{$sequence_identifier}->{bowtie_sequence})+2); ## CHH changed to +2
5288 }
5289 else{
5290 $non_bisulfite_sequence = '';
5291 }
5292 }
5293
5294 ### results from CT converted reads vs. GA converted genome (- orientation alignments are reported only)
5295 elsif ( ($methylation_call_params->{$sequence_identifier}->{index} + $pbat_index_modifier) == 1){
5296 ### [Index 1, sequence originated from (converted) reverse strand]
5297 $counting{CT_GA_count}++;
5298 $alignment_strand = '-';
5299 $read_conversion_info = 'CT';
5300 $genome_conversion = 'GA';
5301
5302 ## checking if the substring will be valid or if we can't extract the sequence because we are right at the edge of a chromosome
5303 if ($methylation_call_params->{$sequence_identifier}->{position}-2 >= 0){ ## CHH changed to -2 # 02 02 2012 Changed this to >= from >
5304 ### Extracting 2 extra 5' bases on forward strand which will become 2 extra 3' bases after reverse complementation
5305 $non_bisulfite_sequence = substr ($chromosomes{$methylation_call_params->{$sequence_identifier}->{chromosome}},$methylation_call_params->{$sequence_identifier}->{position}-2,length($methylation_call_params->{$sequence_identifier}->{bowtie_sequence})+2); ## CHH changed to -2/+2
5306 ## reverse complement!
5307 $non_bisulfite_sequence = reverse_complement($non_bisulfite_sequence);
5308 }
5309 else{
5310 $non_bisulfite_sequence = '';
5311 }
5312 }
5313
5314 ### results from GA converted reads vs. CT converted genome (- orientation alignments are reported only)
5315 elsif ( ($methylation_call_params->{$sequence_identifier}->{index} + $pbat_index_modifier) == 2){
5316 ### [Index 2, sequence originated from complementary to (converted) forward strand]
5317 $counting{GA_CT_count}++;
5318 $alignment_strand = '-';
5319 $read_conversion_info = 'GA';
5320 $genome_conversion = 'CT';
5321
5322 ### +2 extra bases on the forward strand 3', which will become 2 extra 5' bases after reverse complementation
5323 ## checking if the substring will be valid or if we can't extract the sequence because we are right at the edge of a chromosome
5324 if (length($chromosomes{$methylation_call_params->{$sequence_identifier}->{chromosome}}) > $methylation_call_params->{$sequence_identifier}->{position}+length($methylation_call_params->{$sequence_identifier}->{bowtie_sequence})+1){ ## changed to +1 on 02 02 2012
5325 $non_bisulfite_sequence = substr ($chromosomes{$methylation_call_params->{$sequence_identifier}->{chromosome}},$methylation_call_params->{$sequence_identifier}->{position},length($methylation_call_params->{$sequence_identifier}->{bowtie_sequence})+2); ## CHH changed to +2
5326 ## reverse complement!
5327 $non_bisulfite_sequence = reverse_complement($non_bisulfite_sequence);
5328 }
5329 else{
5330 $non_bisulfite_sequence = '';
5331 }
5332 }
5333
5334 ### results from GA converted reads vs. GA converted genome (+ orientation alignments are reported only)
5335 elsif ( ($methylation_call_params->{$sequence_identifier}->{index} + $pbat_index_modifier) == 3){
5336 ### [Index 3, sequence originated from complementary to (converted) reverse strand]
5337 $counting{GA_GA_count}++;
5338 $alignment_strand = '+';
5339 $read_conversion_info = 'GA';
5340 $genome_conversion = 'GA';
5341
5342 ## checking if the substring will be valid or if we can't extract the sequence because we are right at the edge of a chromosome
5343 if ($methylation_call_params->{$sequence_identifier}->{position}-2 >= 0){ ## CHH changed to +2 # 02 02 2012 Changed this to >= from >
5344 ### +2 extra base at the 5' end as we are nominally checking the converted reverse strand
5345 $non_bisulfite_sequence = substr ($chromosomes{$methylation_call_params->{$sequence_identifier}->{chromosome}},$methylation_call_params->{$sequence_identifier}->{position}-2,length($methylation_call_params->{$sequence_identifier}->{bowtie_sequence})+2); ## CHH changed to -2/+2
5346 }
5347 else{
5348 $non_bisulfite_sequence = '';
5349 }
5350 }
5351 else{
5352 die "Too many bowtie result filehandles\n";
5353 }
5354
5355 $methylation_call_params->{$sequence_identifier}->{alignment_strand} = $alignment_strand;
5356 $methylation_call_params->{$sequence_identifier}->{read_conversion} = $read_conversion_info;
5357 $methylation_call_params->{$sequence_identifier}->{genome_conversion} = $genome_conversion;
5358 $methylation_call_params->{$sequence_identifier}->{unmodified_genomic_sequence} = $non_bisulfite_sequence;
5359
5360 ### at this point we can also determine the end position of a read
5361 $methylation_call_params->{$sequence_identifier}->{end_position} = $methylation_call_params->{$sequence_identifier}->{position}+length($methylation_call_params->{$sequence_identifier}->{bowtie_sequence});
5362 }
5363
5364
5365 sub extract_corresponding_genomic_sequence_single_end_bowtie2{
5366 my ($sequence_identifier,$methylation_call_params) = @_;
5367
5368 my $MD_tag = $methylation_call_params->{$sequence_identifier}->{MD_tag};
5369 my $cigar = $methylation_call_params->{$sequence_identifier}->{CIGAR};
5370
5371 my $contains_deletion = 0;
5372 if ($cigar =~ /D/){
5373 $contains_deletion = 1;
5374 # warn "$cigar\n$MD_tag\n";
5375 }
5376 ### A bisulfite sequence for 1 location in the genome can theoretically be any of the 4 possible converted strands. We are also giving the
5377 ### sequence a 'memory' of the conversion we are expecting which we will need later for the methylation call
5378
5379 ### the alignment_strand information is needed to determine which strand of the genomic sequence we are comparing the read against,
5380 ### the read_conversion information is needed to know whether we are looking for C->T or G->A substitutions
5381 my $alignment_strand;
5382 my $read_conversion_info;
5383 my $genome_conversion;
5384
5385 ### We are now extracting the corresponding genomic sequence, +2 extra bases at the end (or start) so that we can also make a CpG methylation call and
5386 ### in addition make differential calls for Cs in CHG or CHH context if the C happens to be at the last (or first) position of the actually observed sequence
5387 my $non_bisulfite_sequence = '';
5388 my $genomic_seq_for_MD_tag = ''; # this sequence contains potential deletions in the genome as well so that we can generate a proper MD tag for the SAM output
5389
5390 ### Positions in SAM format are 1 based, so we need to subract 1 when getting substrings
5391 my $pos = $methylation_call_params->{$sequence_identifier}->{position}-1;
5392
5393 # parsing CIGAR string
5394 my @len = split (/\D+/,$cigar); # storing the length per operation
5395 my @ops = split (/\d+/,$cigar); # storing the operation
5396 shift @ops; # remove the empty first element
5397 die "CIGAR string contained a non-matching number of lengths and operations\n" unless (scalar @len == scalar @ops);
5398
5399 my $pbat_index_modifier = 0;
5400
5401 if ($pbat){
5402 $pbat_index_modifier += 2; # (we are simply not running indexes 0 or 1!
5403 }
5404
5405 ### If the sequence aligns best as CT converted reads vs. GA converted genome (OB, index 1) or GA converted reads vs. GA converted genome (CTOB, index 3)
5406 if ( (($methylation_call_params->{$sequence_identifier}->{index} + $pbat_index_modifier) == 1) or (($methylation_call_params->{$sequence_identifier}->{index} + $pbat_index_modifier) == 3) ){
5407 ## checking if the substring will be valid or if we can't extract the sequence because we are right at the edge of a chromosome
5408 unless ( ($pos-2) >= 0){ # exiting with en empty genomic sequence otherwise
5409 $methylation_call_params->{$sequence_identifier}->{unmodified_genomic_sequence} = $non_bisulfite_sequence;
5410 $methylation_call_params->{$sequence_identifier}->{genomic_seq_for_MD_tag} = $genomic_seq_for_MD_tag;
5411 return;
5412 }
5413 $non_bisulfite_sequence .= substr ($chromosomes{$methylation_call_params->{$sequence_identifier}->{chromosome}},$pos-2,2);
5414 }
5415
5416 my $indels = 0;
5417
5418 foreach (0..$#len){
5419 if ($ops[$_] eq 'M'){
5420 #extracting genomic sequence
5421 $non_bisulfite_sequence .= substr ($chromosomes{$methylation_call_params->{$sequence_identifier}->{chromosome}},$pos,$len[$_]);
5422 if ($contains_deletion){
5423 $genomic_seq_for_MD_tag .= substr ($chromosomes{$methylation_call_params->{$sequence_identifier}->{chromosome}},$pos,$len[$_]);
5424 }
5425 # adjusting position
5426 $pos += $len[$_];
5427 }
5428 elsif ($ops[$_] eq 'I'){ # insertion in the read sequence
5429 # we simply add padding Xs instead of finding genomic sequence. This will not be used to infer methylation calls and we can later ignore it better during the generation of the MD:Z-tag
5430 $non_bisulfite_sequence .= 'X' x $len[$_];
5431 if ($contains_deletion){
5432 $genomic_seq_for_MD_tag .= 'X' x $len[$_];
5433 }
5434 # warn "$non_bisulfite_sequence\n";
5435 # position doesn't need to be adjusting
5436
5437 ### 03 06 2014: In fact we don't need to add anything to the hemming distance for insertions since we use padding Xs which will fail the base by base comparison in hemming_dist()
5438 # $indels += $len[$_]; # adding this to $indels so we can determine the hemming distance for the SAM output (= single-base substitutions (mismatches, insertions, deletions)
5439 }
5440 elsif ($ops[$_] eq 'D'){ # deletion in the read sequence
5441 # we do not add any genomic sequence but only adjust the position
5442
5443 # we do however add the genomic sequence to the $genomic_sequence for MD-tag determination if the CIGAR string contained a deletion
5444 if ($contains_deletion){
5445 $genomic_seq_for_MD_tag .= substr ($chromosomes{$methylation_call_params->{$sequence_identifier}->{chromosome}},$pos,$len[$_]);
5446 }
5447 $pos += $len[$_];
5448 $indels += $len[$_]; # adding this to $indels so we can determine the hemming distance for the SAM output (= single-base substitutions (mismatches, insertions, deletions)
5449 }
5450 elsif($cigar =~ tr/[NSHPX=]//){ # if these (for standard mapping) illegal characters exist we die
5451 die "The CIGAR string contained illegal CIGAR operations in addition to 'M', 'I' and 'D': $cigar\n";
5452 }
5453 else{
5454 die "The CIGAR string contained undefined CIGAR operations in addition to 'M', 'I' and 'D': $cigar\n";
5455 }
5456 }
5457
5458 ### If the sequence aligns best as CT converted reads vs. CT converted genome (OT, index 0) or GA converted reads vs. CT converted genome (CTOT, index 2)
5459 if ( ( ($methylation_call_params->{$sequence_identifier}->{index} + $pbat_index_modifier) == 0) or ( ($methylation_call_params->{$sequence_identifier}->{index} + $pbat_index_modifier) == 2) ){
5460 ## checking if the substring will be valid or if we can't extract the sequence because we are right at the edge of a chromosome
5461 unless (length($chromosomes{$methylation_call_params->{$sequence_identifier}->{chromosome}}) >= $pos+2){ # exiting with en empty genomic sequence otherwise
5462 $methylation_call_params->{$sequence_identifier}->{unmodified_genomic_sequence} = $non_bisulfite_sequence;
5463 $methylation_call_params->{$sequence_identifier}->{genomic_seq_for_MD_tag} = $genomic_seq_for_MD_tag;
5464 return;
5465 }
5466 $non_bisulfite_sequence .= substr ($chromosomes{$methylation_call_params->{$sequence_identifier}->{chromosome}},$pos,2);
5467 # print "$methylation_call_params->{$sequence_identifier}->{bowtie_sequence}\n$non_bisulfite_sequence\n";
5468 }
5469
5470
5471 ### results from CT converted read vs. CT converted genome (+ orientation alignments are reported only)
5472 if ( ($methylation_call_params->{$sequence_identifier}->{index} + $pbat_index_modifier) == 0){
5473 ### [Index 0, sequence originated from (converted) forward strand]
5474 $counting{CT_CT_count}++;
5475 $alignment_strand = '+';
5476 $read_conversion_info = 'CT';
5477 $genome_conversion = 'CT';
5478 }
5479
5480 ### results from CT converted reads vs. GA converted genome (- orientation alignments are reported only)
5481 elsif ( ($methylation_call_params->{$sequence_identifier}->{index} + $pbat_index_modifier) == 1){
5482 ### [Index 1, sequence originated from (converted) reverse strand]
5483 $counting{CT_GA_count}++;
5484 $alignment_strand = '-';
5485 $read_conversion_info = 'CT';
5486 $genome_conversion = 'GA';
5487
5488 ### reverse complement!
5489 $non_bisulfite_sequence = reverse_complement($non_bisulfite_sequence);
5490 if ($contains_deletion){
5491 $genomic_seq_for_MD_tag = reverse_complement($genomic_seq_for_MD_tag);
5492 }
5493 }
5494
5495 ### results from GA converted reads vs. CT converted genome (- orientation alignments are reported only)
5496 elsif ( ($methylation_call_params->{$sequence_identifier}->{index} + $pbat_index_modifier) == 2){
5497 ### [Index 2, sequence originated from complementary to (converted) forward strand]
5498 $counting{GA_CT_count}++;
5499 $alignment_strand = '-';
5500 $read_conversion_info = 'GA';
5501 $genome_conversion = 'CT';
5502
5503 ### reverse complement!
5504 $non_bisulfite_sequence = reverse_complement($non_bisulfite_sequence);
5505 if ($contains_deletion){
5506 $genomic_seq_for_MD_tag = reverse_complement($genomic_seq_for_MD_tag);
5507 }
5508 }
5509
5510 ### results from GA converted reads vs. GA converted genome (+ orientation alignments are reported only)
5511 elsif ( ($methylation_call_params->{$sequence_identifier}->{index} + $pbat_index_modifier) == 3){
5512 ### [Index 3, sequence originated from complementary to (converted) reverse strand]
5513 $counting{GA_GA_count}++;
5514 $alignment_strand = '+';
5515 $read_conversion_info = 'GA';
5516 $genome_conversion = 'GA';
5517
5518 }
5519 else{
5520 die "Too many Bowtie 2 result filehandles\n";
5521 }
5522
5523 $methylation_call_params->{$sequence_identifier}->{alignment_strand} = $alignment_strand;
5524 $methylation_call_params->{$sequence_identifier}->{read_conversion} = $read_conversion_info;
5525 $methylation_call_params->{$sequence_identifier}->{genome_conversion} = $genome_conversion;
5526 $methylation_call_params->{$sequence_identifier}->{unmodified_genomic_sequence} = $non_bisulfite_sequence;
5527 $methylation_call_params->{$sequence_identifier}->{genomic_seq_for_MD_tag} = $genomic_seq_for_MD_tag;
5528
5529 # if ($contains_deletion){
5530 # warn "non-bis: $methylation_call_params->{$sequence_identifier}->{unmodified_genomic_sequence}\n";
5531 # warn "MD-seq: $methylation_call_params->{$sequence_identifier}->{genomic_seq_for_MD_tag}\n";
5532 # }
5533
5534 ### the end position of a read is stored in $pos
5535 $methylation_call_params->{$sequence_identifier}->{end_position} = $pos;
5536 $methylation_call_params->{$sequence_identifier}->{indels} = $indels;
5537 }
5538
5539 ### METHYLATION CALL
5540
5541 sub methylation_call{
5542 my ($identifier,$sequence_actually_observed,$genomic_sequence,$read_conversion) = @_;
5543 ### splitting both the actually observed sequence and the genomic sequence up into single bases so we can compare them one by one
5544 my @seq = split(//,$sequence_actually_observed);
5545 my @genomic = split(//,$genomic_sequence);
5546 # print join ("\n",$identifier,$sequence_actually_observed,$genomic_sequence,$read_conversion),"\n";
5547 ### Creating a match-string with different characters for non-cytosine bases (disregarding mismatches here), methyl-Cs or non-methyl Cs in either
5548 ### CpG, CHH or CHG context
5549
5550 #################################################################
5551 ### . for bases not involving cytosines ###
5552 ### X for methylated C in CHG context (was protected) ###
5553 ### x for not methylated C in CHG context (was converted) ###
5554 ### H for methylated C in CHH context (was protected) ###
5555 ### h for not methylated C in CHH context (was converted) ###
5556 ### Z for methylated C in CpG context (was protected) ###
5557 ### z for not methylated C in CpG context (was converted) ###
5558 ### U for methylated C in unknown context (was protected) ###
5559 ### u for not methylated C in unknwon context (was converted) ###
5560 #################################################################
5561
5562 my @match =();
5563 warn "length of \@seq: ",scalar @seq,"\tlength of \@genomic: ",scalar @genomic,"\n" unless (scalar @seq eq (scalar@genomic-2)); ## CHH changed to -2
5564 my $methyl_CHH_count = 0;
5565 my $methyl_CHG_count = 0;
5566 my $methyl_CpG_count = 0;
5567 my $methyl_C_unknown_count = 0;
5568 my $unmethylated_CHH_count = 0;
5569 my $unmethylated_CHG_count = 0;
5570 my $unmethylated_CpG_count = 0;
5571 my $unmethylated_C_unknown_count = 0;
5572
5573 if ($read_conversion eq 'CT'){
5574 for my $index (0..$#seq) {
5575 if ($seq[$index] eq $genomic[$index]) {
5576 ### The residue can only be a C if it was not converted to T, i.e. protected my methylation
5577 if ($genomic[$index] eq 'C') {
5578 ### If the residue is a C we want to know if it was in CpG context or in any other context
5579 my $downstream_base = $genomic[$index+1];
5580
5581 if ($downstream_base eq 'G'){
5582 ++$methyl_CpG_count;
5583 push @match,'Z'; # protected C, methylated, in CpG context
5584 }
5585 elsif ($downstream_base eq 'N'){ # if the downstream base was an N we cannot really be sure about the sequence context (as it might have been a CG)
5586 ++$methyl_C_unknown_count;
5587 push @match,'U'; # protected C, methylated, in Unknown context
5588 }
5589 else {
5590 ### C in not in CpG-context, determining the second downstream base context
5591 my $second_downstream_base = $genomic[$index+2];
5592
5593 if ($second_downstream_base eq 'G'){
5594 ++$methyl_CHG_count;
5595 push @match,'X'; # protected C, methylated, in CHG context
5596 }
5597 elsif ($second_downstream_base eq 'N'){
5598 ++$methyl_C_unknown_count; # if the second downstream base was an N we cannot really be sure about the sequence context (as it might have been a CHH or CHG)
5599 push @match,'U'; # protected C, methylated, in Unknown context
5600 }
5601 else{
5602 ++$methyl_CHH_count;
5603 push @match,'H'; # protected C, methylated, in CHH context
5604 }
5605 }
5606 }
5607 else {
5608 push @match, '.';
5609 }
5610 }
5611 elsif ($seq[$index] ne $genomic[$index]) {
5612 ### for the methylation call we are only interested in mismatches involving cytosines (in the genomic sequence) which were converted into Ts
5613 ### in the actually observed sequence
5614 if ($genomic[$index] eq 'C' and $seq[$index] eq 'T') {
5615 ### If the residue was converted to T we want to know if it was in CpG, CHG or CHH context
5616 my $downstream_base = $genomic[$index+1];
5617
5618 if ($downstream_base eq 'G'){
5619 ++$unmethylated_CpG_count;
5620 push @match,'z'; # converted C, not methylated, in CpG context
5621 }
5622 elsif ($downstream_base eq 'N'){ # if the downstream base was an N we cannot really be sure about the sequence context (as it might have been a CG)
5623 ++$unmethylated_C_unknown_count;
5624 push @match,'u'; # converted C, not methylated, in Unknown context
5625 }
5626 else{
5627 ### C in not in CpG-context, determining the second downstream base context
5628 my $second_downstream_base = $genomic[$index+2];
5629
5630 if ($second_downstream_base eq 'G'){
5631 ++$unmethylated_CHG_count;
5632 push @match,'x'; # converted C, not methylated, in CHG context
5633 }
5634 elsif ($second_downstream_base eq 'N'){
5635 ++$unmethylated_C_unknown_count; # if the second downstream base was an N we cannot really be sure about the sequence context (as it might have been a CHH or CHG)
5636 push @match,'u'; # converted C, not methylated, in Unknown context
5637 }
5638 else{
5639 ++$unmethylated_CHH_count;
5640 push @match,'h'; # converted C, not methylated, in CHH context
5641 }
5642 }
5643 }
5644 ### all other mismatches are not of interest for a methylation call
5645 else {
5646 push @match,'.';
5647 }
5648 }
5649 else{
5650 die "There can be only 2 possibilities\n";
5651 }
5652 }
5653 }
5654 elsif ($read_conversion eq 'GA'){
5655 # print join ("\n",'***',$identifier,$sequence_actually_observed,$genomic_sequence,$read_conversion,'***'),"\n";
5656
5657 for my $index (0..$#seq) {
5658 if ($seq[$index] eq $genomic[$index+2]) {
5659 ### The residue can only be a G if the C on the other strand was not converted to T, i.e. protected my methylation
5660 if ($genomic[$index+2] eq 'G') {
5661 ### If the residue is a G we want to know if the C on the other strand was in CpG, CHG or CHH context, therefore we need
5662 ### to look if the base upstream is a C
5663
5664 my $upstream_base = $genomic[$index+1];
5665
5666 if ($upstream_base eq 'C'){
5667 ++$methyl_CpG_count;
5668 push @match,'Z'; # protected C on opposing strand, methylated, in CpG context
5669 }
5670 elsif ($upstream_base eq 'N'){ # if the upstream base was an N we cannot really be sure about the sequence context (as it might have been a CG)
5671 ++$methyl_C_unknown_count;
5672 push @match,'U'; # protected C on opposing strand, methylated, in Unknown context
5673 }
5674 else{
5675 ### C in not in CpG-context, determining the second upstream base context
5676 my $second_upstream_base = $genomic[$index];
5677
5678 if ($second_upstream_base eq 'C'){
5679 ++$methyl_CHG_count;
5680 push @match,'X'; # protected C on opposing strand, methylated, in CHG context
5681 }
5682 elsif ($second_upstream_base eq 'N'){
5683 ++$methyl_C_unknown_count; # if the second upstream base was an N we cannot really be sure about the sequence context (as it might have been a CHH or CHG)
5684 push @match,'U'; # protected C, methylated, in Unknown context
5685 }
5686 else{
5687 ++$methyl_CHH_count;
5688 push @match,'H'; # protected C on opposing strand, methylated, in CHH context
5689 }
5690 }
5691 }
5692 else{
5693 push @match, '.';
5694 }
5695 }
5696 elsif ($seq[$index] ne $genomic[$index+2]) {
5697 ### for the methylation call we are only interested in mismatches involving cytosines (in the genomic sequence) which were converted to Ts
5698 ### on the opposing strand, so G to A conversions in the actually observed sequence
5699 if ($genomic[$index+2] eq 'G' and $seq[$index] eq 'A') {
5700 ### If the C residue on the opposing strand was converted to T then we will see an A in the currently observed sequence. We want to know if
5701 ### the C on the opposing strand was it was in CpG, CHG or CHH context, therefore we need to look one (or two) bases upstream!
5702
5703 my $upstream_base = $genomic[$index+1];
5704
5705 if ($upstream_base eq 'C'){
5706 ++$unmethylated_CpG_count;
5707 push @match,'z'; # converted C on opposing strand, not methylated, in CpG context
5708 }
5709 elsif ($upstream_base eq 'N'){ # if the upstream base was an N we cannot really be sure about the sequence context (as it might have been a CG)
5710 ++$unmethylated_C_unknown_count;
5711 push @match,'u'; # converted C on opposing strand, not methylated, in Unknown context
5712 }
5713 else{
5714 ### C in not in CpG-context, determining the second upstream base context
5715 my $second_upstream_base = $genomic[$index];
5716
5717 if ($second_upstream_base eq 'C'){
5718 ++$unmethylated_CHG_count;
5719 push @match,'x'; # converted C on opposing strand, not methylated, in CHG context
5720 }
5721 elsif ($second_upstream_base eq 'N'){
5722 ++$unmethylated_C_unknown_count; # if the second upstream base was an N we cannot really be sure about the sequence context (as it might have been a CHH or CHG)
5723 push @match,'u'; # converted C on opposing strand, not methylated, in Unknown context
5724 }
5725 else{
5726 ++$unmethylated_CHH_count;
5727 push @match,'h'; # converted C on opposing strand, not methylated, in CHH context
5728 }
5729 }
5730 }
5731 ### all other mismatches are not of interest for a methylation call
5732 else {
5733 push @match,'.';
5734 }
5735 }
5736 else{
5737 die "There can be only 2 possibilities\n";
5738 }
5739 }
5740 }
5741 else{
5742 die "Strand conversion info is required to perform a methylation call\n";
5743 }
5744
5745 my $methylation_call = join ("",@match);
5746
5747 $counting{total_meCHH_count} += $methyl_CHH_count;
5748 $counting{total_meCHG_count} += $methyl_CHG_count;
5749 $counting{total_meCpG_count} += $methyl_CpG_count;
5750 $counting{total_meC_unknown_count} += $methyl_C_unknown_count;
5751 $counting{total_unmethylated_CHH_count} += $unmethylated_CHH_count;
5752 $counting{total_unmethylated_CHG_count} += $unmethylated_CHG_count;
5753 $counting{total_unmethylated_CpG_count} += $unmethylated_CpG_count;
5754 $counting{total_unmethylated_C_unknown_count} += $unmethylated_C_unknown_count;
5755
5756 # print "\n$sequence_actually_observed\n$genomic_sequence\n",@match,"\n$read_conversion\n\n";
5757
5758 return $methylation_call;
5759 }
5760
5761 sub read_genome_into_memory{
5762
5763 ## working directoy
5764 my $cwd = shift;
5765
5766 ## reading in and storing the specified genome in the %chromosomes hash
5767 chdir ($genome_folder) or die "Can't move to $genome_folder: $!";
5768 warn "Now reading in and storing sequence information of the genome specified in: $genome_folder\n\n";
5769
5770 my @chromosome_filenames = <*.fa>;
5771
5772 ### if there aren't any genomic files with the extension .fa we will look for files with the extension .fasta
5773 unless (@chromosome_filenames){
5774 @chromosome_filenames = <*.fasta>;
5775 }
5776
5777 unless (@chromosome_filenames){
5778 die "The specified genome folder $genome_folder does not contain any sequence files in FastA format (with .fa or .fasta file extensions)\n";
5779 }
5780
5781 my $SQ_count = 0;
5782
5783 foreach my $chromosome_filename (@chromosome_filenames){
5784
5785 open (CHR_IN,$chromosome_filename) or die "Failed to read from sequence file $chromosome_filename $!\n";
5786 ### first line needs to be a fastA header
5787 my $first_line = <CHR_IN>;
5788 chomp $first_line;
5789 $first_line =~ s/\r//;
5790 ### Extracting chromosome name from the FastA header
5791 my $chromosome_name = extract_chromosome_name($first_line);
5792 my $sequence;
5793
5794 while (<CHR_IN>){
5795 chomp;
5796 $_ =~ s/\r//; # removing carriage returns if present
5797 if ($_ =~ /^>/){
5798
5799 ### storing the previous chromosome in the %chromosomes hash, only relevant for Multi-Fasta-Files (MFA)
5800 if (exists $chromosomes{$chromosome_name}){
5801 print "chr $chromosome_name (",length $sequence ," bp)\n";
5802 die "Exiting because chromosome name already exists. Please make sure all chromosomes have a unique name!\n";
5803 }
5804 else {
5805 if (length($sequence) == 0){
5806 warn "Chromosome $chromosome_name in the multi-fasta file $chromosome_filename did not contain any sequence information!\n";
5807 }
5808 print "chr $chromosome_name (",length $sequence ," bp)\n";
5809 $chromosomes{$chromosome_name} = $sequence;
5810 $SQ_order{$SQ_count} = $chromosome_name;
5811
5812 ++$SQ_count;
5813
5814 }
5815 ### resetting the sequence variable
5816 $sequence = '';
5817 ### setting new chromosome name
5818 $chromosome_name = extract_chromosome_name($_);
5819 }
5820 else{
5821 $sequence .= uc$_;
5822 }
5823 }
5824
5825 ### Processing last chromosome of a multi Fasta File or the only entry in case of single entry FastA files
5826
5827 if (exists $chromosomes{$chromosome_name}){
5828 print "chr $chromosome_name (",length $sequence ," bp)\t";
5829 die "Exiting because chromosome name already exists. Please make sure all chromosomes have a unique name.\n";
5830 }
5831 else{
5832 if (length($sequence) == 0){
5833 warn "Chromosome $chromosome_name in the file $chromosome_filename did not contain any sequence information!\n";
5834 }
5835
5836 ++$SQ_count;
5837
5838 print "chr $chromosome_name (",length $sequence ," bp)\n";
5839 $chromosomes{$chromosome_name} = $sequence;
5840 $SQ_order{$SQ_count} = $chromosome_name;
5841 }
5842 }
5843 print "\n";
5844 chdir $cwd or die "Failed to move to directory $cwd\n";
5845
5846 ### If no single multi-FastA genome file was specified explicitely we will generate one here and write it to the output directory
5847 if ($cram){
5848 unless (defined $cram_ref){
5849 warn "Reconstituting a single multi-FastA genome file as CRAM reference (you may specify such a file using --cram_ref <file> explicitely to prevent this behaviour)\n";
5850
5851 $cram_ref = "${output_dir}Bismark_genome_CRAM_reference.mfa";
5852 warn "Writing multi-FastA file to $cram_ref\n";
5853 open (REF,'>',"$cram_ref") or die "Failed to write to file $cram_ref\n";
5854 foreach my $chr(keys %chromosomes){
5855 print REF ">$chr\n$chromosomes{$chr}\n";
5856 }
5857 warn "Complete\n";
5858 close REF or warn "Failed to close filehandle REF: $!\n";
5859 }
5860
5861 }
5862
5863
5864
5865 }
5866
5867 sub extract_chromosome_name {
5868 ## Bowtie seems to extract the first string after the inition > in the FASTA file, so we are doing this as well
5869 my $fasta_header = shift;
5870 if ($fasta_header =~ s/^>//){
5871 my ($chromosome_name) = split (/\s+/,$fasta_header);
5872 return $chromosome_name;
5873 }
5874 else{
5875 die "The specified chromosome ($fasta_header) file doesn't seem to be in FASTA format as required!\n";
5876 }
5877 }
5878
5879 sub reverse_complement{
5880 my $sequence = shift;
5881 $sequence =~ tr/CATG/GTAC/;
5882 $sequence = reverse($sequence);
5883 return $sequence;
5884 }
5885
5886 sub biTransformFastAFiles {
5887 my $file = shift;
5888 my ($dir,$filename);
5889 if ($file =~ /\//){
5890 ($dir,$filename) = $file =~ m/(.*\/)(.*)$/;
5891 }
5892 else{
5893 $filename = $file;
5894 }
5895
5896 ### gzipped version of the infile
5897 if ($file =~ /\.gz$/){
5898 open (IN,"gunzip -c $file |") or die "Couldn't read from file $file: $!\n";
5899 }
5900 else{
5901 open (IN,$file) or die "Couldn't read from file $file: $!\n";
5902 }
5903
5904 if ($skip){
5905 warn "Skipping the first $skip reads from $file\n";
5906 sleep (1);
5907 }
5908 if ($upto){
5909 warn "Processing reads up to sequence no. $upto from $file\n";
5910 sleep (1);
5911 }
5912
5913 my $C_to_T_infile = my $G_to_A_infile = $filename;
5914
5915 if ($gzip){
5916 $C_to_T_infile =~ s/$/_C_to_T.fa.gz/;
5917 $G_to_A_infile =~ s/$/_G_to_A.fa.gz/;
5918 }
5919 else{
5920 $C_to_T_infile =~ s/$/_C_to_T.fa/;
5921 $G_to_A_infile =~ s/$/_G_to_A.fa/;
5922 }
5923
5924 if ($prefix){
5925 # warn "Prefixing $prefix:\nold: $C_to_T_infile\nold: $G_to_A_infile\n\n";
5926 $C_to_T_infile = "$prefix.$C_to_T_infile";
5927 $G_to_A_infile = "$prefix.$G_to_A_infile";
5928 # warn "Prefixing $prefix:\nnew: $C_to_T_infile\nnew: $G_to_A_infile\n\n";
5929 }
5930
5931 warn "Writing a C -> T converted version of the input file $filename to $temp_dir$C_to_T_infile\n";
5932
5933 if ($gzip){
5934 open (CTOT,"| gzip -c - > ${temp_dir}${C_to_T_infile}") or die "Can't write to file: $!\n";
5935 }
5936 else{
5937 open (CTOT,'>',"$temp_dir$C_to_T_infile") or die "Couldn't write to file $!\n";
5938 }
5939
5940 unless ($directional){
5941 warn "Writing a G -> A converted version of the input file $filename to $temp_dir$G_to_A_infile\n";
5942 if ($gzip){
5943 open (GTOA,"| gzip -c - > ${temp_dir}${G_to_A_infile}") or die "Can't write to file: $!\n";
5944 }
5945 else{
5946 open (GTOA,'>',"$temp_dir$G_to_A_infile") or die "Couldn't write to file $!\n";
5947 }
5948 }
5949
5950 my $count = 0;
5951
5952 while (1){
5953 my $header = <IN>;
5954 my $sequence= <IN>;
5955 last unless ($header and $sequence);
5956
5957 $header = fix_IDs($header); # this is to avoid problems with truncated read ID when they contain white spaces
5958
5959 ++$count;
5960
5961 if ($skip){
5962 next unless ($count > $skip);
5963 }
5964 if ($upto){
5965 last if ($count > $upto);
5966 }
5967
5968 $sequence = uc$sequence; # make input file case insensitive
5969
5970 # detecting if the input file contains tab stops, as this is likely to result in no alignments
5971 if (index($header,"\t") != -1){
5972 $seqID_contains_tabs++;
5973 }
5974
5975 ### small check if the sequence seems to be in FastA format
5976 die "Input file doesn't seem to be in FastA format at sequence $count: $!\n" unless ($header =~ /^>.*/);
5977
5978 my $sequence_C_to_T = $sequence;
5979 $sequence_C_to_T =~ tr/C/T/;
5980 print CTOT "$header$sequence_C_to_T";
5981
5982 unless ($directional){
5983 my $sequence_G_to_A = $sequence;
5984 $sequence_G_to_A =~ tr/G/A/;
5985 print GTOA "$header$sequence_G_to_A";
5986 }
5987 }
5988 close CTOT or die "Failed to close filehandle $!\n";
5989
5990 if ($directional){
5991 warn "\nCreated C -> T converted versions of the FastA file $filename ($count sequences in total)\n\n";
5992 }
5993 else{
5994 close GTOA or die "Failed to close filehandle $!\n";
5995 warn "\nCreated C -> T as well as G -> A converted versions of the FastA file $filename ($count sequences in total)\n\n";
5996 }
5997 return ($C_to_T_infile,$G_to_A_infile);
5998 }
5999
6000 sub biTransformFastAFiles_paired_end {
6001 my ($file,$read_number) = @_;
6002
6003 if ($gzip){
6004 warn "GZIP compression of temporary files is not supported for paired-end FastA data. Continuing to write uncompressed files\n";
6005 sleep (2);
6006 }
6007
6008 my ($dir,$filename);
6009 if ($file =~ /\//){
6010 ($dir,$filename) = $file =~ m/(.*\/)(.*)$/;
6011 }
6012 else{
6013 $filename = $file;
6014 }
6015
6016 ### gzipped version of the infile
6017 if ($file =~ /\.gz$/){
6018 open (IN,"gunzip -c $file |") or die "Couldn't read from file $file: $!\n";
6019 }
6020 else{
6021 open (IN,$file) or die "Couldn't read from file $file: $!\n";
6022 }
6023
6024 if ($skip){
6025 warn "Skipping the first $skip reads from $file\n";
6026 sleep (1);
6027 }
6028 if ($upto){
6029 warn "Processing reads up to sequence no. $upto from $file\n";
6030 sleep (1);
6031 }
6032
6033 my $C_to_T_infile = my $G_to_A_infile = $filename;
6034
6035 $C_to_T_infile =~ s/$/_C_to_T.fa/;
6036 $G_to_A_infile =~ s/$/_G_to_A.fa/;
6037
6038 if ($prefix){
6039 # warn "Prefixing $prefix:\nold: $C_to_T_infile\nold: $G_to_A_infile\n\n";
6040 $C_to_T_infile = "$prefix.$C_to_T_infile";
6041 $G_to_A_infile = "$prefix.$G_to_A_infile";
6042 # warn "Prefixing $prefix:\nnew: $C_to_T_infile\nnew: $G_to_A_infile\n\n";
6043 }
6044
6045 if ($directional){
6046 if ($read_number == 1){
6047 warn "Writing a C -> T converted version of the input file $filename to $temp_dir$C_to_T_infile\n";
6048 open (CTOT,'>',"$temp_dir$C_to_T_infile") or die "Couldn't write to file $!\n";
6049 }
6050 elsif ($read_number == 2){
6051 warn "Writing a G -> A converted version of the input file $filename to $temp_dir$G_to_A_infile\n";
6052 open (GTOA,'>',"$temp_dir$G_to_A_infile") or die "Couldn't write to file $!\n";
6053 }
6054 else{
6055 die "Read number needs to be 1 or 2, but was: $read_number\n\n";
6056 }
6057 }
6058 else{ # all four strand output
6059 warn "Writing a C -> T converted version of the input file $filename to $temp_dir$C_to_T_infile\n";
6060 warn "Writing a G -> A converted version of the input file $filename to $temp_dir$G_to_A_infile\n";
6061 open (CTOT,'>',"$temp_dir$C_to_T_infile") or die "Couldn't write to file $!\n";
6062 open (GTOA,'>',"$temp_dir$G_to_A_infile") or die "Couldn't write to file $!\n";
6063 }
6064
6065 my $count = 0;
6066
6067 while (1){
6068 my $header = <IN>;
6069 my $sequence= <IN>;
6070 last unless ($header and $sequence);
6071
6072 $header = fix_IDs($header); # this is to avoid problems with truncated read ID when they contain white spaces
6073
6074 ++$count;
6075
6076 if ($skip){
6077 next unless ($count > $skip);
6078 }
6079 if ($upto){
6080 last if ($count > $upto);
6081 }
6082
6083 $sequence = uc$sequence; # make input file case insensitive
6084
6085 # detecting if the input file contains tab stops, as this is likely to result in no alignments
6086 if (index($header,"\t") != -1){
6087 $seqID_contains_tabs++;
6088 }
6089
6090 ## small check if the sequence seems to be in FastA format
6091 die "Input file doesn't seem to be in FastA format at sequence $count: $!\n" unless ($header =~ /^>/);
6092
6093 if ($read_number == 1){
6094 if ($bowtie2){
6095 $header =~ s/$/\/1\/1/;
6096 }
6097 else{
6098 $header =~ s/$/\/1/;
6099 }
6100 }
6101 elsif ($read_number == 2){
6102 if ($bowtie2){
6103 $header =~ s/$/\/2\/2/;
6104 }
6105 else{
6106 $header =~ s/$/\/2/;
6107 }
6108 }
6109 else{
6110 die "Read number needs to be 1 or 2, but was: $read_number\n\n";
6111 }
6112 my $sequence_C_to_T = my $sequence_G_to_A = $sequence;
6113
6114 $sequence_C_to_T =~ tr/C/T/;
6115 $sequence_G_to_A =~ tr/G/A/;
6116
6117 if ($directional){
6118
6119 if ($read_number == 1){
6120 print CTOT "$header$sequence_C_to_T";
6121 }
6122 elsif ($read_number == 2){
6123 print GTOA "$header$sequence_G_to_A";
6124 }
6125 }
6126 else{
6127 print CTOT "$header$sequence_C_to_T";
6128 print GTOA "$header$sequence_G_to_A";
6129 }
6130 }
6131
6132 if ($directional){
6133 if ($read_number == 1){
6134 warn "\nCreated C -> T converted version of the FastA file $filename ($count sequences in total)\n\n";
6135 }
6136 else{
6137 warn "\nCreated G -> A converted version of the FastA file $filename ($count sequences in total)\n\n";
6138 }
6139 }
6140 else{
6141 warn "\nCreated C -> T as well as G -> A converted versions of the FastA file $filename ($count sequences in total)\n\n";
6142 }
6143
6144 if ($directional){
6145 if ($read_number == 1){
6146 return ($C_to_T_infile);
6147 }
6148 else{
6149 return ($G_to_A_infile);
6150 }
6151 }
6152 else{
6153 return ($C_to_T_infile,$G_to_A_infile);
6154 }
6155 }
6156
6157
6158 sub biTransformFastQFiles {
6159 my $file = shift;
6160 my ($dir,$filename);
6161 if ($file =~ /\//){
6162 ($dir,$filename) = $file =~ m/(.*\/)(.*)$/;
6163 }
6164 else{
6165 $filename = $file;
6166 }
6167
6168 ### gzipped version of the infile
6169 if ($file =~ /\.gz$/){
6170 open (IN,"gunzip -c $file |") or die "Couldn't read from file $file: $!\n";
6171 }
6172 else{
6173 open (IN,$file) or die "Couldn't read from file $file: $!\n";
6174 }
6175
6176 if ($skip){
6177 warn "Skipping the first $skip reads from $file\n";
6178 sleep (1);
6179 }
6180 if ($upto){
6181 warn "Processing reads up to sequence no. $upto from $file\n";
6182 sleep (1);
6183 }
6184
6185 my $C_to_T_infile = my $G_to_A_infile = $filename;
6186
6187 if ($prefix){
6188 # warn "Prefixing $prefix:\nold: $C_to_T_infile\nold: $G_to_A_infile\n\n";
6189 $C_to_T_infile = "$prefix.$C_to_T_infile";
6190 $G_to_A_infile = "$prefix.$G_to_A_infile";
6191 # warn "Prefixing $prefix:\nnew: $C_to_T_infile\nnew: $G_to_A_infile\n\n";
6192 }
6193
6194 if ($pbat){ # PBAT-Seq
6195 if ($gzip){
6196 $G_to_A_infile =~ s/$/_G_to_A.fastq.gz/;
6197 }
6198 else{
6199 $G_to_A_infile =~ s/$/_G_to_A.fastq/;
6200 }
6201
6202 warn "Writing a G -> A converted version of the input file $filename to $temp_dir$G_to_A_infile\n";
6203
6204 if ($gzip){
6205 open (GTOA,"| gzip -c - > ${temp_dir}${G_to_A_infile}") or die "Can't write to file: $!\n";
6206 }
6207 else{
6208 open (GTOA,'>',"$temp_dir$G_to_A_infile") or die "Couldn't write to file $!\n";
6209 }
6210 }
6211 else{ # directional or non-directional
6212 if ($gzip){
6213 $C_to_T_infile =~ s/$/_C_to_T.fastq.gz/;
6214 }
6215 else{
6216 $C_to_T_infile =~ s/$/_C_to_T.fastq/;
6217 }
6218
6219 warn "Writing a C -> T converted version of the input file $filename to $temp_dir$C_to_T_infile\n";
6220
6221 if ($gzip){
6222 open (CTOT,"| gzip -c - > ${temp_dir}${C_to_T_infile}") or die "Can't write to file: $!\n";
6223 }
6224 else{
6225 open (CTOT,'>',"$temp_dir$C_to_T_infile") or die "Couldn't write to file $!\n"; # uncompressed option
6226 }
6227
6228 unless ($directional){
6229 if ($gzip){
6230 $G_to_A_infile =~ s/$/_G_to_A.fastq.gz/;
6231 }
6232 else{
6233 $G_to_A_infile =~ s/$/_G_to_A.fastq/;
6234 }
6235
6236 warn "Writing a G -> A converted version of the input file $filename to $temp_dir$G_to_A_infile\n";
6237
6238 if ($gzip){
6239 open (GTOA,"| gzip -c - > ${temp_dir}${G_to_A_infile}") or die "Can't write to file: $!\n";
6240 }
6241 else{
6242 open (GTOA,'>',"$temp_dir$G_to_A_infile") or die "Couldn't write to file $!\n";
6243 }
6244 }
6245 }
6246
6247 my $count = 0;
6248 while (1){
6249 my $identifier = <IN>;
6250 my $sequence = <IN>;
6251 my $identifier2 = <IN>;
6252 my $quality_score = <IN>;
6253 last unless ($identifier and $sequence and $identifier2 and $quality_score);
6254
6255 $identifier = fix_IDs($identifier); # this is to avoid problems with truncated read ID when they contain white spaces
6256
6257 ++$count;
6258
6259 if ($skip){
6260 next unless ($count > $skip);
6261 }
6262 if ($upto){
6263 last if ($count > $upto);
6264 }
6265
6266 $sequence = uc$sequence; # make input file case insensitive
6267
6268 # detecting if the input file contains tab stops, as this is likely to result in no alignments
6269 if (index($identifier,"\t") != -1){
6270 $seqID_contains_tabs++;
6271 }
6272
6273 ## small check if the sequence file appears to be a FastQ file
6274 if ($count == 1){
6275 if ($identifier !~ /^\@/ or $identifier2 !~ /^\+/){
6276 die "Input file doesn't seem to be in FastQ format at sequence $count: $!\n";
6277 }
6278 }
6279
6280 if ($pbat){
6281 my $sequence_G_to_A = $sequence;
6282 $sequence_G_to_A =~ tr/G/A/;
6283 print GTOA join ('',$identifier,$sequence_G_to_A,$identifier2,$quality_score);
6284 }
6285 else{ # directional or non-directional
6286 my $sequence_C_to_T = $sequence;
6287 $sequence_C_to_T =~ tr/C/T/;
6288 print CTOT join ('',$identifier,$sequence_C_to_T,$identifier2,$quality_score);
6289
6290 unless ($directional){
6291 my $sequence_G_to_A = $sequence;
6292 $sequence_G_to_A =~ tr/G/A/;
6293 print GTOA join ('',$identifier,$sequence_G_to_A,$identifier2,$quality_score);
6294 }
6295 }
6296 }
6297
6298 if ($directional){
6299 close CTOT or die "Failed to close filehandle $!\n";
6300 warn "\nCreated C -> T converted version of the FastQ file $filename ($count sequences in total)\n\n";
6301 }
6302 elsif($pbat){
6303 warn "\nCreated G -> A converted version of the FastQ file $filename ($count sequences in total)\n\n";
6304 close GTOA or die "Failed to close filehandle $!\n";
6305 return ($G_to_A_infile);
6306 }
6307 else{
6308 close CTOT or die "Failed to close filehandle $!\n";
6309 close GTOA or die "Failed to close filehandle $!\n";
6310 warn "\nCreated C -> T as well as G -> A converted versions of the FastQ file $filename ($count sequences in total)\n\n";
6311 }
6312
6313 return ($C_to_T_infile,$G_to_A_infile);
6314 }
6315
6316 sub biTransformFastQFiles_paired_end {
6317 my ($file,$read_number) = @_;
6318 my ($dir,$filename);
6319
6320 if ($file =~ /\//){
6321 ($dir,$filename) = $file =~ m/(.*\/)(.*)$/;
6322 }
6323 else{
6324 $filename = $file;
6325 }
6326
6327 ### gzipped version of the infile
6328 if ($file =~ /\.gz$/){
6329 open (IN,"gunzip -c $file |") or die "Couldn't read from file $file: $!\n";
6330 }
6331 else{
6332 open (IN,$file) or die "Couldn't read from file $file: $!\n";
6333 }
6334
6335 if ($skip){
6336 warn "Skipping the first $skip reads from $file\n";
6337 sleep (1);
6338 }
6339 if ($upto){
6340 warn "Processing reads up to sequence no. $upto from $file\n";
6341 sleep (1);
6342 }
6343
6344 my $C_to_T_infile = my $G_to_A_infile = $filename;
6345
6346 if ($gzip){
6347 $C_to_T_infile =~ s/$/_C_to_T.fastq.gz/;
6348 $G_to_A_infile =~ s/$/_G_to_A.fastq.gz/;
6349 }
6350 else{
6351 $C_to_T_infile =~ s/$/_C_to_T.fastq/;
6352 $G_to_A_infile =~ s/$/_G_to_A.fastq/;
6353 }
6354
6355 if ($prefix){
6356 # warn "Prefixing $prefix:\nold: $C_to_T_infile\nold: $G_to_A_infile\n\n";
6357 $C_to_T_infile = "$prefix.$C_to_T_infile";
6358 $G_to_A_infile = "$prefix.$G_to_A_infile";
6359 # warn "Prefixing $prefix:\nnew: $C_to_T_infile\nnew: $G_to_A_infile\n\n";
6360 }
6361
6362 if ($directional){
6363 if ($read_number == 1){
6364 warn "Writing a C -> T converted version of the input file $filename to $temp_dir$C_to_T_infile\n";
6365 if ($gzip){
6366 open (CTOT,"| gzip -c - > ${temp_dir}${C_to_T_infile}") or die "Can't write to file: $!\n";
6367 }
6368 else{
6369 open (CTOT,'>',"$temp_dir$C_to_T_infile") or die "Couldn't write to file $!\n";
6370 }
6371 }
6372 elsif ($read_number == 2){
6373 warn "Writing a G -> A converted version of the input file $filename to $temp_dir$G_to_A_infile\n";
6374 if ($gzip){
6375 open (GTOA,"| gzip -c - > ${temp_dir}${G_to_A_infile}") or die "Can't write to file: $!\n";
6376 }
6377 else{
6378 open (GTOA,'>',"$temp_dir$G_to_A_infile") or die "Couldn't write to file $!\n";
6379 }
6380 }
6381 else{
6382 die "Read number needs to be 1 or 2, but was $read_number!\n\n";
6383 }
6384 }
6385 else{
6386 warn "Writing a C -> T converted version of the input file $filename to $temp_dir$C_to_T_infile\n";
6387 warn "Writing a G -> A converted version of the input file $filename to $temp_dir$G_to_A_infile\n";
6388 if ($gzip){
6389 open (CTOT,"| gzip -c - > ${temp_dir}${C_to_T_infile}") or die "Can't write to file: $!\n";
6390 open (GTOA,"| gzip -c - > ${temp_dir}${G_to_A_infile}") or die "Can't write to file: $!\n";
6391 }
6392 else{
6393 open (CTOT,'>',"$temp_dir$C_to_T_infile") or die "Couldn't write to file $!\n";
6394 open (GTOA,'>',"$temp_dir$G_to_A_infile") or die "Couldn't write to file $!\n";
6395 }
6396 }
6397
6398 my $count = 0;
6399 while (1){
6400 my $identifier = <IN>;
6401 my $sequence = <IN>;
6402 my $identifier2 = <IN>;
6403 my $quality_score = <IN>;
6404 last unless ($identifier and $sequence and $identifier2 and $quality_score);
6405 ++$count;
6406
6407 $identifier = fix_IDs($identifier); # this is to avoid problems with truncated read ID when they contain white spaces
6408
6409 if ($skip){
6410 next unless ($count > $skip);
6411 }
6412 if ($upto){
6413 last if ($count > $upto);
6414 }
6415
6416 $sequence= uc$sequence; # make input file case insensitive
6417
6418 ## small check if the sequence file appears to be a FastQ file
6419 if ($count == 1){
6420 if ($identifier !~ /^\@/ or $identifier2 !~ /^\+/){
6421 die "Input file doesn't seem to be in FastQ format at sequence $count: $!\n";
6422 }
6423 }
6424 my $sequence_C_to_T = my $sequence_G_to_A = $sequence;
6425
6426 if ($read_number == 1){
6427 if ($bowtie2){
6428 $identifier =~ s/$/\/1\/1/;
6429 }
6430 else{
6431 $identifier =~ s/$/\/1/;
6432 }
6433 }
6434 elsif ($read_number == 2){
6435 if ($bowtie2){
6436 $identifier =~ s/$/\/2\/2/;
6437 }
6438 else{
6439 $identifier =~ s/$/\/2/;
6440 }
6441 }
6442 else{
6443 die "Read number needs to be 1 or 2\n";
6444 }
6445
6446 $sequence_C_to_T =~ tr/C/T/;
6447 $sequence_G_to_A =~ tr/G/A/;
6448
6449 if ($directional){
6450 if ($read_number == 1){
6451 print CTOT join ('',$identifier,$sequence_C_to_T,$identifier2,$quality_score);
6452 }
6453 else{
6454 print GTOA join ('',$identifier,$sequence_G_to_A,$identifier2,$quality_score);
6455 }
6456 }
6457 else{
6458 print CTOT join ('',$identifier,$sequence_C_to_T,$identifier2,$quality_score);
6459 print GTOA join ('',$identifier,$sequence_G_to_A,$identifier2,$quality_score);
6460 }
6461 }
6462
6463 if ($directional){
6464 if ($read_number == 1){
6465 warn "\nCreated C -> T converted version of the FastQ file $filename ($count sequences in total)\n\n";
6466 }
6467 else{
6468 warn "\nCreated G -> A converted version of the FastQ file $filename ($count sequences in total)\n\n";
6469 }
6470 }
6471 else{
6472 warn "\nCreated C -> T as well as G -> A converted versions of the FastQ file $filename ($count sequences in total)\n\n";
6473 }
6474 if ($directional){
6475 if ($read_number == 1){
6476 close CTOT or die "Failed to close filehandle $!\n";
6477 return ($C_to_T_infile);
6478 }
6479 else{
6480 close GTOA or die "Failed to close filehandle $!\n";
6481 return ($G_to_A_infile);
6482 }
6483 }
6484 else{
6485 close CTOT or die "Failed to close filehandle $!\n";
6486 close GTOA or die "Failed to close filehandle $!\n";
6487 return ($C_to_T_infile,$G_to_A_infile);
6488 }
6489 }
6490
6491
6492 ### SPECIAL BOWTIE 1 PAIRED-END FORMAT FOR GZIPPED OUTPUT FILES
6493
6494 sub biTransformFastQFiles_paired_end_bowtie1_gzip {
6495 my ($file_1,$file_2) = @_;
6496 my ($dir,$filename);
6497
6498 if ($file_1 =~ /\//){
6499 ($dir,$filename) = $file_1 =~ m/(.*\/)(.*)$/;
6500 }
6501 else{
6502 $filename = $file_1;
6503 }
6504
6505 ### gzipped version of infile 1
6506 if ($file_1 =~ /\.gz$/){
6507 open (IN_1,"gunzip -c $file_1 |") or die "Couldn't read from file $file_1: $!\n";
6508 }
6509 else{
6510 open (IN_1,$file_1) or die "Couldn't read from file $file_1: $!\n";
6511 }
6512 ### gzipped version of infile 2
6513 if ($file_2 =~ /\.gz$/){
6514 open (IN_2,"gunzip -c $file_2 |") or die "Couldn't read from file $file_2: $!\n";
6515 }
6516 else{
6517 open (IN_2,$file_2) or die "Couldn't read from file $file_2: $!\n";
6518 }
6519
6520
6521 if ($skip){
6522 warn "Skipping the first $skip reads from $file_1 and $file_2\n";
6523 sleep (1);
6524 }
6525 if ($upto){
6526 warn "Processing reads up to sequence no. $upto from $file_1 and $file_2\n";
6527 sleep (1);
6528 }
6529
6530 my $CT_plus_GA_infile = my $GA_plus_CT_infile = $filename;
6531
6532 if ($prefix){
6533 # warn "Prefixing $prefix:\nold: $CT_plus_GA_infile\nold: $GA_plus_CT_infile\n\n";
6534 $CT_plus_GA_infile = "$prefix.$CT_plus_GA_infile";
6535 $GA_plus_CT_infile = "$prefix.$GA_plus_CT_infile";
6536 # warn "Prefixing $prefix:\nnew: $CT_plus_GA_infile\nnew: $GA_plus_CT_infile\n\n";
6537 }
6538
6539 $CT_plus_GA_infile =~ s/$/.CT_plus_GA.fastq.gz/;
6540 $GA_plus_CT_infile =~ s/$/.GA_plus_CT.fastq.gz/;
6541 # warn "Prefixing $prefix:\nnew: $CT_plus_GA_infile\nnew: $GA_plus_CT_infile\n\n";
6542
6543 warn "Writing a C -> T converted version of $file_1 and a G -> A converted version of $file_2 to $temp_dir$CT_plus_GA_infile\n";
6544 open (CTPLUSGA,"| gzip -c - > ${temp_dir}${CT_plus_GA_infile}") or die "Can't write to file: $!\n";
6545 # open (CTPLUSGA,'>',"$temp_dir$CT_plus_GA_infile") or die "Couldn't write to file $!\n";
6546
6547 unless ($directional){
6548 print "Writing a G -> A converted version of $file_1 and a C -> T converted version of $file_2 to $temp_dir$GA_plus_CT_infile\n";
6549 open (GAPLUSCT,"| gzip -c - > ${temp_dir}${GA_plus_CT_infile}") or die "Can't write to file: $!\n";
6550 }
6551
6552 ### for Bowtie 1 we need to write a single gzipped file with 1 line per pair of sequences in the the following format:
6553 ### <seq-ID> <sequence #1 mate> <quality #1 mate> <sequence #2 mate> <quality #2 mate>
6554
6555 my $count = 0;
6556 while (1){
6557 my $identifier_1 = <IN_1>;
6558 my $sequence_1 = <IN_1>;
6559 my $identifier2_1 = <IN_1>;
6560 my $quality_score_1 = <IN_1>;
6561
6562 my $identifier_2 = <IN_2>;
6563 my $sequence_2 = <IN_2>;
6564 my $identifier2_2 = <IN_2>;
6565 my $quality_score_2 = <IN_2>;
6566
6567 last unless ($identifier_1 and $sequence_1 and $identifier2_1 and $quality_score_1 and $identifier_2 and $sequence_2 and $identifier2_2 and $quality_score_2);
6568
6569 ++$count;
6570
6571 ## small check if the sequence file appears to be a FastQ file
6572 if ($count == 1){
6573 if ($identifier_1 !~ /^\@/ or $identifier2_1 !~ /^\+/){
6574 die "Input file 1 doesn't seem to be in FastQ format at sequence $count: $!\n";
6575 }
6576 if ($identifier_2 !~ /^\@/ or $identifier2_2 !~ /^\+/){
6577 die "Input file 2 doesn't seem to be in FastQ format at sequence $count: $!\n";
6578 }
6579 }
6580
6581 $identifier_1 = fix_IDs($identifier_1); # this is to avoid problems with truncated read ID when they contain white spaces
6582 chomp $identifier_1;
6583 chomp $sequence_1;
6584 chomp $sequence_2;
6585 chomp $quality_score_1;
6586 chomp $quality_score_2;
6587
6588 $identifier_1 =~ s/^\@//;
6589 $identifier_1 =~ s/$/\/1/; #adding an extra /1 to the end which is being removed by Bowtie otherwise (which leads to no sequences alignments whatsoever)
6590
6591 if ($skip){
6592 next unless ($count > $skip);
6593 }
6594 if ($upto){
6595 last if ($count > $upto);
6596 }
6597
6598 $sequence_1 = uc$sequence_1; # make input file 1 case insensitive
6599 $sequence_2 = uc$sequence_2; # make input file 2 case insensitive
6600
6601 # print "$identifier_1\t$sequence_1\t$quality_score_1\t$sequence_2\t$quality_score_2\n";
6602 my $sequence_1_C_to_T = $sequence_1;
6603 my $sequence_2_G_to_A = $sequence_2;
6604 $sequence_1_C_to_T =~ tr/C/T/;
6605 $sequence_2_G_to_A =~ tr/G/A/;
6606
6607 print CTPLUSGA "$identifier_1\t$sequence_1_C_to_T\t$quality_score_1\t$sequence_2_G_to_A\t$quality_score_2\n";
6608
6609 unless ($directional){
6610 my $sequence_1_G_to_A = $sequence_1;
6611 my $sequence_2_C_to_T = $sequence_2;
6612 $sequence_1_G_to_A =~ tr/G/A/;
6613 $sequence_2_C_to_T =~ tr/C/T/;
6614 print GAPLUSCT "$identifier_1\t$sequence_1_G_to_A\t$quality_score_1\t$sequence_2_C_to_T\t$quality_score_2\n";
6615 }
6616 }
6617
6618 close CTPLUSGA or die "Couldn't close filehandle\n";
6619 warn "\nCreated C -> T converted version of FastQ file '$file_1' and G -> A converted version of FastQ file '$file_2' ($count sequences in total)\n";
6620
6621 if ($directional){
6622 warn "\n";
6623 return ($CT_plus_GA_infile);
6624 }
6625 else{
6626 close GAPLUSCT or die "Couldn't close filehandle\n";
6627 warn "Created G -> A converted version of FastQ file '$file_1' and C -> T converted version of FastQ file '$file_2' ($count sequences in total)\n\n";
6628 return ($CT_plus_GA_infile,$GA_plus_CT_infile);
6629 }
6630 }
6631
6632
6633 sub fix_IDs{
6634 my $id = shift;
6635 $id =~ s/[ \t]+/_/g; # replace spaces or tabs with underscores
6636 return $id;
6637 }
6638
6639 sub ensure_sensical_alignment_orientation_single_end{
6640 my $index = shift; # index number if the sequence produced an alignment
6641 my $strand = shift;
6642 ### setting $orientation to 1 if it is in the correct orientation, and leave it 0 if it is the nonsensical wrong one
6643 my $orientation = 0;
6644 ##############################################################################################################
6645 ## FORWARD converted read against FORWARD converted genome (read: C->T.....C->T.. genome:C->T.......C->T)
6646 ## here we only want reads in the forward (+) orientation
6647 if ($fhs[$index]->{name} eq 'CTreadCTgenome') {
6648 ### if the alignment is (+) we count it, and return 1 for a correct orientation
6649 if ($strand eq '+') {
6650 $fhs[$index]->{seen}++;
6651 $orientation = 1;
6652 return $orientation;
6653 }
6654 ### if the orientation equals (-) the alignment is nonsensical
6655 elsif ($strand eq '-') {
6656 $fhs[$index]->{wrong_strand}++;
6657 return $orientation;
6658 }
6659 }
6660 ###############################################################################################################
6661 ## FORWARD converted read against reverse converted genome (read: C->T.....C->T.. genome: G->A.......G->A)
6662 ## here we only want reads in the forward (-) orientation
6663 elsif ($fhs[$index]->{name} eq 'CTreadGAgenome') {
6664 ### if the alignment is (-) we count it and return 1 for a correct orientation
6665 if ($strand eq '-') {
6666 $fhs[$index]->{seen}++;
6667 $orientation = 1;
6668 return $orientation;
6669 }
6670 ### if the orientation equals (+) the alignment is nonsensical
6671 elsif ($strand eq '+') {
6672 $fhs[$index]->{wrong_strand}++;
6673 return $orientation;
6674 }
6675 }
6676 ###############################################################################################################
6677 ## Reverse converted read against FORWARD converted genome (read: G->A.....G->A.. genome: C->T.......C->T)
6678 ## here we only want reads in the forward (-) orientation
6679 elsif ($fhs[$index]->{name} eq 'GAreadCTgenome') {
6680 ### if the alignment is (-) we count it and return 1 for a correct orientation
6681 if ($strand eq '-') {
6682 $fhs[$index]->{seen}++;
6683 $orientation = 1;
6684 return $orientation;
6685 }
6686 ### if the orientation equals (+) the alignment is nonsensical
6687 elsif ($strand eq '+') {
6688 $fhs[$index]->{wrong_strand}++;
6689 return $orientation;
6690 }
6691 }
6692 ###############################################################################################################
6693 ## Reverse converted read against reverse converted genome (read: G->A.....G->A.. genome: G->A.......G->A)
6694 ## here we only want reads in the forward (+) orientation
6695 elsif ($fhs[$index]->{name} eq 'GAreadGAgenome') {
6696 ### if the alignment is (+) we count it and return 1 for a correct orientation
6697 if ($strand eq '+') {
6698 $fhs[$index]->{seen}++;
6699 $orientation = 1;
6700 return $orientation;
6701 }
6702 ### if the orientation equals (-) the alignment is nonsensical
6703 elsif ($strand eq '-') {
6704 $fhs[$index]->{wrong_strand}++;
6705 return $orientation;
6706 }
6707 } else{
6708 die "One of the above conditions must be true\n";
6709 }
6710 }
6711
6712 sub ensure_sensical_alignment_orientation_paired_ends{
6713 my ($index,$id_1,$strand_1,$id_2,$strand_2) = @_; # index number if the sequence produced an alignment
6714 ### setting $orientation to 1 if it is in the correct orientation, and leave it 0 if it is the nonsensical wrong one
6715 my $orientation = 0;
6716 ##############################################################################################################
6717 ## [Index 0, sequence originated from (converted) forward strand]
6718 ## CT converted read 1
6719 ## GA converted read 2
6720 ## CT converted genome
6721 ## here we only want read 1 in (+) orientation and read 2 in (-) orientation
6722 if ($fhs[$index]->{name} eq 'CTread1GAread2CTgenome') {
6723 ### if the paired-end alignment is read1 (+) and read2 (-) we count it, and return 1 for a correct orientation
6724 if ($id_1 =~ /1$/ and $strand_1 eq '+' and $id_2 =~ /2$/ and $strand_2 eq '-') {
6725 $fhs[$index]->{seen}++;
6726 $orientation = 1;
6727 return $orientation;
6728 }
6729 ### if the read 2 is in (+) orientation and read 1 in (-) the alignment is nonsensical
6730 elsif ($id_1 =~ /2$/ and $strand_1 eq '+' and $id_2 =~ /1$/ and $strand_2 eq '-') {
6731 $fhs[$index]->{wrong_strand}++;
6732 return $orientation;
6733 }
6734 else{
6735 die "id1: $id_1\tid2: $id_2\tThis should be impossible\n";
6736 }
6737 }
6738 ###############################################################################################################
6739 ## [Index 1, sequence originated from (converted) reverse strand]
6740 ## GA converted read 1
6741 ## CT converted read 2
6742 ## GA converted genome
6743 ## here we only want read 1 in (+) orientation and read 2 in (-) orientation
6744 elsif ($fhs[$index]->{name} eq 'GAread1CTread2GAgenome') {
6745 ### if the paired-end alignment is read1 (+) and read2 (-) we count it, and return 1 for a correct orientation
6746 if ($id_1 =~ /1$/ and $strand_1 eq '+' and $id_2 =~ /2$/ and $strand_2 eq '-') {
6747 $fhs[$index]->{seen}++;
6748 $orientation = 1;
6749 return $orientation;
6750 }
6751 ### if the read 2 is in (+) orientation and read 1 in (-) the alignment is nonsensical
6752 elsif ($id_1 =~ /2$/ and $strand_1 eq '+' and $id_2 =~ /1$/ and $strand_2 eq '-') {
6753 $fhs[$index]->{wrong_strand}++;
6754 return $orientation;
6755 }
6756 else{
6757 die "id1: $id_1\tid2: $id_2\tThis should be impossible\n";
6758 }
6759 }
6760 ###############################################################################################################
6761 ## [Index 2, sequence originated from complementary to (converted) forward strand]
6762 ## GA converted read 1
6763 ## CT converted read 2
6764 ## CT converted genome
6765 ## here we only want read 1 in (-) orientation and read 2 in (+) orientation
6766 elsif ($fhs[$index]->{name} eq 'GAread1CTread2CTgenome') {
6767 ### if the paired-end alignment is read1 (-) and read2 (+) we count it, and return 1 for a correct orientation
6768 if ($id_1 =~ /2$/ and $strand_1 eq '+' and $id_2 =~ /1$/ and $strand_2 eq '-') {
6769 $fhs[$index]->{seen}++;
6770 $orientation = 1;
6771 return $orientation;
6772 }
6773 ### if the read 2 is in (+) orientation and read 1 in (-) the alignment is nonsensical
6774 elsif ($id_1 =~ /1$/ and $strand_1 eq '+' and $id_2 =~ /2$/ and $strand_2 eq '-') {
6775 $fhs[$index]->{wrong_strand}++;
6776 return $orientation;
6777 }
6778 else{
6779 die "id1: $id_1\tid2: $id_2\tThis should be impossible\n";
6780 }
6781 }
6782 ###############################################################################################################
6783 ## [Index 3, sequence originated from complementary to (converted) reverse strand]
6784 ## CT converted read 1
6785 ## GA converted read 2
6786 ## GA converted genome
6787 ## here we only want read 1 in (+) orientation and read 2 in (-) orientation
6788 elsif ($fhs[$index]->{name} eq 'CTread1GAread2GAgenome') {
6789 ### if the paired-end alignment is read1 (-) and read2 (+) we count it, and return 1 for a correct orientation
6790 if ($id_1 =~ /2$/ and $strand_1 eq '+' and $id_2 =~ /1$/ and $strand_2 eq '-') {
6791 $fhs[$index]->{seen}++;
6792 $orientation = 1;
6793 return $orientation;
6794 }
6795 ### if the read 2 is in (+) orientation and read 1 in (-) the alignment is nonsensical
6796 elsif ($id_1 =~ /1$/ and $strand_1 eq '+' and $id_2 =~ /2$/ and $strand_2 eq '-') {
6797 $fhs[$index]->{wrong_strand}++;
6798 return $orientation;
6799 }
6800 else{
6801 die "id1: $id_1\tid2: $id_2\tThis should be impossible\n";
6802 }
6803 }
6804 else{
6805 die "One of the above conditions must be true\n";
6806 }
6807 }
6808
6809 #####################################################################################################################################################
6810
6811 ### Bowtie 1 (default) | PAIRED-END | FASTA
6812
6813 sub paired_end_align_fragments_to_bisulfite_genome_fastA {
6814
6815 my ($C_to_T_infile_1,$G_to_A_infile_1,$C_to_T_infile_2,$G_to_A_infile_2) = @_;
6816
6817 if ($directional){
6818 warn "Input files are $C_to_T_infile_1 and $G_to_A_infile_2 (FastA)\n";
6819 }
6820 else{
6821 warn "Input files are $C_to_T_infile_1 and $G_to_A_infile_1 and $C_to_T_infile_2 and $G_to_A_infile_2 (FastA)\n";
6822 }
6823
6824 ## Now starting up to 4 instances of Bowtie feeding in the converted sequence files and reading in the first line of the bowtie output, and storing it in the
6825 ## data structure above
6826 if ($directional){
6827 warn "Now running 2 instances of Bowtie against the bisulfite genome of $genome_folder with the specified options: $bowtie_options\n\n";
6828 }
6829 else{
6830 warn "Now running 4 individual instances of Bowtie against the bisulfite genome of $genome_folder with the specified options: $bowtie_options\n\n";
6831 }
6832
6833 foreach my $fh (@fhs) {
6834
6835 if ($directional){
6836 unless ($fh->{inputfile_1}){
6837 $fh->{last_seq_id} = undef;
6838 $fh->{last_line_1} = undef;
6839 $fh->{last_line_2} = undef;
6840 next;
6841 }
6842 }
6843
6844 my $bt_options = $bowtie_options;
6845 if ($fh->{name} eq 'CTread1GAread2CTgenome' or $fh->{name} eq 'GAread1CTread2GAgenome'){
6846 $bt_options .= ' --norc'; ### ensuring the alignments are only reported in a sensible manner
6847 }
6848 else {
6849 $bt_options .= ' --nofw';
6850 }
6851
6852 warn "Now starting a Bowtie paired-end alignment for $fh->{name} (reading in sequences from $temp_dir$fh->{inputfile_1} and $temp_dir$fh->{inputfile_2}, with the options: $bt_options)\n";
6853 open ($fh->{fh},"$path_to_bowtie $bt_options $fh->{bisulfiteIndex} -1 $temp_dir$fh->{inputfile_1} -2 $temp_dir$fh->{inputfile_2} |") or die "Can't open pipe to bowtie: $!";
6854
6855 my $line_1 = $fh->{fh}->getline();
6856 my $line_2 = $fh->{fh}->getline();
6857
6858 # if Bowtie produces an alignment we store the first line of the output
6859 if ($line_1 and $line_2) {
6860 chomp $line_1;
6861 chomp $line_2;
6862 my $id_1 = (split(/\t/,$line_1))[0]; # this is the first element of the first bowtie output line (= the sequence identifier)
6863 my $id_2 = (split(/\t/,$line_2))[0]; # this is the first element of the second bowtie output line
6864
6865 ### Bowtie always reports the alignment with the smaller chromosomal position first. This can be either sequence 1 or sequence 2.
6866 ### We will thus identify which sequence was read 1 and store this ID as last_seq_id
6867
6868 if ($id_1 =~ s/\/1$//){ # removing the read 1 tag if present
6869 $fh->{last_seq_id} = $id_1;
6870 }
6871 elsif ($id_2 =~ s/\/1$//){ # removing the read 1 tag if present
6872 $fh->{last_seq_id} = $id_2;
6873 }
6874 else{
6875 die "Either the first or the second id need to be read 1! ID1 was: $id_1; ID2 was: $id_2\n";
6876 }
6877
6878 $fh->{last_line_1} = $line_1; # this contains either read 1 or read 2
6879 $fh->{last_line_2} = $line_2; # this contains either read 1 or read 2
6880 warn "Found first alignment:\n$fh->{last_line_1}\n$fh->{last_line_2}\n";
6881 }
6882 # otherwise we just initialise last_seq_id and last_lines as undefined
6883 else {
6884 warn "Found no alignment, assigning undef to last_seq_id and last_lines\n";
6885 $fh->{last_seq_id} = undef;
6886 $fh->{last_line_1} = undef;
6887 $fh->{last_line_2} = undef;
6888 }
6889 }
6890 }
6891
6892 ### Bowtie 2 | PAIRED-END | FASTA
6893
6894 sub paired_end_align_fragments_to_bisulfite_genome_fastA_bowtie2 {
6895 my ($C_to_T_infile_1,$G_to_A_infile_1,$C_to_T_infile_2,$G_to_A_infile_2) = @_;
6896 if ($directional){
6897 warn "Input files are $C_to_T_infile_1 and $G_to_A_infile_2 (FastA)\n";
6898 }
6899 else{
6900 warn "Input files are $C_to_T_infile_1 and $G_to_A_infile_1 and $C_to_T_infile_2 and $G_to_A_infile_2 (FastA)\n";
6901 }
6902
6903 ## Now starting up to 4 instances of Bowtie feeding in the converted sequence files and reading in the first line of the bowtie output, and storing it in the
6904 ## data structure above
6905 if ($directional){
6906 warn "Now running 2 instances of Bowtie 2 against the bisulfite genome of $genome_folder with the specified options: $bowtie_options\n\n";
6907 }
6908 else{
6909 warn "Now running 4 individual instances of Bowtie 2 against the bisulfite genome of $genome_folder with the specified options: $bowtie_options\n\n";
6910 }
6911
6912 foreach my $fh (@fhs) {
6913
6914 if ($directional){
6915 unless ($fh->{inputfile_1}){
6916 $fh->{last_seq_id} = undef;
6917 $fh->{last_line_1} = undef;
6918 $fh->{last_line_2} = undef;
6919 next;
6920 }
6921 }
6922
6923 my $bt2_options = $bowtie_options;
6924 if ($fh->{name} eq 'CTread1GAread2CTgenome' or $fh->{name} eq 'GAread1CTread2GAgenome'){
6925 $bt2_options .= ' --norc'; ### ensuring the alignments are only reported in a sensible manner
6926 }
6927 else {
6928 $bt2_options .= ' --nofw';
6929 }
6930
6931 warn "Now starting a Bowtie 2 paired-end alignment for $fh->{name} (reading in sequences from $temp_dir$fh->{inputfile_1} and $temp_dir$fh->{inputfile_2}, with the options: $bt2_options))\n";
6932 open ($fh->{fh},"$path_to_bowtie $bt2_options -x $fh->{bisulfiteIndex} -1 $temp_dir$fh->{inputfile_1} -2 $temp_dir$fh->{inputfile_2} |") or die "Can't open pipe to bowtie: $!";
6933
6934 ### Bowtie 2 outputs out SAM format, so we need to skip everything until the first sequence
6935 while (1){
6936 $_ = $fh->{fh}->getline();
6937 if ($_) {
6938 last unless ($_ =~ /^\@/); # SAM headers start with @
6939 }
6940 else{
6941 last; # no alignment output
6942 }
6943 }
6944
6945 my $line_1 = $_;
6946 my $line_2 = $fh->{fh}->getline();
6947
6948 # if Bowtie produces an alignment we store the first line of the output
6949 if ($line_1 and $line_2) {
6950 chomp $line_1;
6951 chomp $line_2;
6952 my $id_1 = (split(/\t/,$line_1))[0]; # this is the first element of the first bowtie output line (= the sequence identifier)
6953 my $id_2 = (split(/\t/,$line_2))[0]; # this is the first element of the second bowtie output line
6954
6955 ### Bowtie always reports the alignment with the smaller chromosomal position first. This can be either sequence 1 or sequence 2.
6956 ### We will thus identify which sequence was read 1 and store this ID as last_seq_id
6957
6958 if ($id_1 =~ s/\/1$//){ # removing the read 1 /1 tag if present (remember that Bowtie2 clips off /1 or /2 line endings itself, so we added /1/1 or /2/2 to start with
6959 $fh->{last_seq_id} = $id_1;
6960 }
6961 elsif ($id_2 =~ s/\/1$//){ # removing the read 1 /2 tag if present
6962 $fh->{last_seq_id} = $id_2;
6963 }
6964 else{
6965 warn "Either the first or the second id need to be read 1! ID1 was: $id_1; ID2 was: $id_2\n";
6966 }
6967
6968 $fh->{last_line_1} = $line_1; # this contains either read 1 or read 2
6969 $fh->{last_line_2} = $line_2; # this contains either read 1 or read 2
6970 warn "Found first alignment:\n$fh->{last_line_1}\n$fh->{last_line_2}\n";
6971 }
6972 # otherwise we just initialise last_seq_id and last_lines as undefined
6973 else {
6974 warn "Found no alignment, assigning undef to last_seq_id and last_lines\n";
6975 $fh->{last_seq_id} = undef;
6976 $fh->{last_line_1} = undef;
6977 $fh->{last_line_2} = undef;
6978 }
6979 }
6980 }
6981
6982 ### Bowtie 1 (default) | PAIRED-END | FASTQ
6983
6984 sub paired_end_align_fragments_to_bisulfite_genome_fastQ {
6985 my ($C_to_T_infile_1,$G_to_A_infile_1,$C_to_T_infile_2,$G_to_A_infile_2) = @_;
6986
6987 if ($directional){
6988 warn "Input file is $C_to_T_infile_1 and $G_to_A_infile_2 (FastQ)\n";
6989 }
6990 elsif($pbat){
6991 warn "Input file is $G_to_A_infile_1 and $C_to_T_infile_2 (FastQ; PBAT-Seq)\n";
6992 }
6993 else{
6994 warn "Input files are $C_to_T_infile_1 and $G_to_A_infile_2 and $G_to_A_infile_1 and $C_to_T_infile_2 (non-directional; FastQ)\n";
6995 }
6996
6997 ## Now starting up to 4 instances of Bowtie feeding in the converted sequence files and reading in the first line of the bowtie output, and storing it in the data structure above
6998 if ($directional or $pbat){
6999 warn "Now running 2 instances of Bowtie against the bisulfite genome of $genome_folder with the specified options: $bowtie_options\n\n";
7000 }
7001 else{
7002 warn "Now running 4 individual instances of Bowtie against the bisulfite genome of $genome_folder with the specified options: $bowtie_options\n\n";
7003 }
7004
7005 foreach my $fh (@fhs) {
7006
7007 if ($directional or $pbat){
7008 unless ($fh->{inputfile_1}){
7009 $fh->{last_seq_id} = undef;
7010 $fh->{last_line_1} = undef;
7011 $fh->{last_line_2} = undef;
7012 next; # skipping unwanted filehandles
7013 }
7014 }
7015
7016 my $bt_options = $bowtie_options;
7017 if ($fh->{name} eq 'CTread1GAread2CTgenome' or $fh->{name} eq 'GAread1CTread2GAgenome'){
7018 $bt_options .= ' --norc'; ### ensuring the alignments are only reported in a sensible manner
7019 }
7020 else {
7021 $bt_options .= ' --nofw';
7022 }
7023
7024 if ($gzip){
7025 warn "Now starting a Bowtie paired-end alignment for $fh->{name} (reading in sequences from ${temp_dir}$fh->{inputfile_1}, with the options: $bt_options)\n";
7026 open ($fh->{fh},"gunzip -c ${temp_dir}$fh->{inputfile_1} | $path_to_bowtie $bt_options $fh->{bisulfiteIndex} --12 - |") or die "Can't open pipe to bowtie: $!";
7027 }
7028 else{
7029 warn "Now starting a Bowtie paired-end alignment for $fh->{name} (reading in sequences from ${temp_dir}$fh->{inputfile_1} and ${temp_dir}$fh->{inputfile_2}, with the options: $bt_options))\n";
7030 sleep(5);
7031 open ($fh->{fh},"$path_to_bowtie $bt_options $fh->{bisulfiteIndex} -1 $temp_dir$fh->{inputfile_1} -2 $temp_dir$fh->{inputfile_2} |") or die "Can't open pipe to bowtie: $!";
7032 }
7033
7034 my $line_1 = $fh->{fh}->getline();
7035 my $line_2 = $fh->{fh}->getline();
7036
7037 # if Bowtie produces an alignment we store the first line of the output
7038 if ($line_1 and $line_2) {
7039 chomp $line_1;
7040 chomp $line_2;
7041 ### Bowtie always reports the alignment with the smaller chromosomal position first. This can be either sequence 1 or sequence 2.
7042 ### We will thus identify which sequence was read 1 and store this ID as last_seq_id
7043
7044 my $id_1 = (split(/\t/,$line_1))[0]; # this is the first element of the first bowtie output line (= the sequence identifier)
7045 my $id_2 = (split(/\t/,$line_2))[0]; # this is the first element of the second bowtie output line
7046
7047 if ($id_1 =~ s/\/1$//){ # removing the read 1 tag if present
7048 $fh->{last_seq_id} = $id_1;
7049 }
7050 elsif ($id_2 =~ s/\/1$//){ # removing the read 1 tag if present
7051 $fh->{last_seq_id} = $id_2;
7052 }
7053 else{
7054 die "Either the first or the second id need to be read 1! ID1 was: $id_1; ID2 was: $id_2\n";
7055 }
7056
7057 $fh->{last_line_1} = $line_1; # this contains read 1 or read 2
7058 $fh->{last_line_2} = $line_2; # this contains read 1 or read 2
7059 warn "Found first alignment:\n$fh->{last_line_1}\n$fh->{last_line_2}\n";
7060 }
7061
7062 # otherwise we just initialise last_seq_id and last_lines as undefined
7063 else {
7064 warn "Found no alignment, assigning undef to last_seq_id and last_lines\n";
7065 $fh->{last_seq_id} = undef;
7066 $fh->{last_line_1} = undef;
7067 $fh->{last_line_2} = undef;
7068 }
7069 }
7070 }
7071
7072 ### Bowtie 2 | PAIRED-END | FASTQ
7073
7074 sub paired_end_align_fragments_to_bisulfite_genome_fastQ_bowtie2 {
7075
7076 my ($C_to_T_infile_1,$G_to_A_infile_1,$C_to_T_infile_2,$G_to_A_infile_2) = @_;
7077 if ($directional){
7078 warn "Input files are $C_to_T_infile_1 and $G_to_A_infile_2 (FastQ)\n";
7079 }
7080 elsif ($pbat){
7081 warn "Input files are $G_to_A_infile_1 and $C_to_T_infile_2 (FastQ)\n";
7082 }
7083 else{
7084 warn "Input files are $C_to_T_infile_1 and $G_to_A_infile_1 and $C_to_T_infile_2 and $G_to_A_infile_2 (FastQ)\n";
7085 }
7086
7087 ## Now starting up 4 instances of Bowtie 2 feeding in the converted sequence files and reading in the first line of the bowtie output, and storing it in the
7088 ## data structure above
7089 if ($directional or $pbat){
7090 warn "Now running 2 instances of Bowtie 2 against the bisulfite genome of $genome_folder with the specified options: $bowtie_options\n\n";
7091 }
7092 else{
7093 warn "Now running 4 individual instances of Bowtie 2 against the bisulfite genome of $genome_folder with the specified options: $bowtie_options\n\n";
7094 }
7095
7096 foreach my $fh (@fhs) {
7097
7098 if ($directional or $pbat){ # skipping unwanted filehandles
7099 unless ($fh->{inputfile_1}){
7100 $fh->{last_seq_id} = undef;
7101 $fh->{last_line_1} = undef;
7102 $fh->{last_line_2} = undef;
7103 next;
7104 }
7105 }
7106
7107 my $bt2_options = $bowtie_options;
7108 if ($fh->{name} eq 'CTread1GAread2CTgenome' or $fh->{name} eq 'GAread1CTread2GAgenome'){
7109 $bt2_options .= ' --norc'; ### ensuring the alignments are only reported in a sensible manner
7110 }
7111 else {
7112 $bt2_options .= ' --nofw';
7113 }
7114
7115 warn "Now starting a Bowtie 2 paired-end alignment for $fh->{name} (reading in sequences from $temp_dir$fh->{inputfile_1} and $temp_dir$fh->{inputfile_2}, with the options: $bt2_options))\n";
7116 open ($fh->{fh},"$path_to_bowtie $bt2_options -x $fh->{bisulfiteIndex} -1 $temp_dir$fh->{inputfile_1} -2 $temp_dir$fh->{inputfile_2} |") or die "Can't open pipe to bowtie: $!";
7117
7118 ### Bowtie 2 outputs out SAM format, so we need to skip everything until the first sequence
7119 while (1){
7120 $_ = $fh->{fh}->getline();
7121 if ($_) {
7122 last unless ($_ =~ /^\@/); # SAM headers start with @
7123 }
7124 else{
7125 last; # no alignment output
7126 }
7127 }
7128
7129 my $line_1 = $_;
7130 my $line_2 = $fh->{fh}->getline();
7131
7132 # if Bowtie produces an alignment we store the first line of the output
7133 if ($line_1 and $line_2) {
7134 chomp $line_1;
7135 chomp $line_2;
7136 ### Bowtie always reports the alignment with the smaller chromosomal position first. This can be either sequence 1 or sequence 2.
7137 ### We will thus identify which sequence was read 1 and store this ID as last_seq_id
7138
7139 my $id_1 = (split(/\t/,$line_1))[0]; # this is the first element of the first bowtie output line (= the sequence identifier)
7140 my $id_2 = (split(/\t/,$line_2))[0]; # this is the first element of the second bowtie output line
7141
7142 if ($id_1 =~ s/\/1$//){ # removing the read 1 tag if present (remember that Bowtie2 clips off /1 or /2 line endings itself, so we added /1/1 or /2/2 to start with
7143 $fh->{last_seq_id} = $id_1;
7144 }
7145 elsif ($id_2 =~ s/\/1$//){ # removing the read 1 tag if present
7146 $fh->{last_seq_id} = $id_2;
7147 }
7148 else{
7149 die "Either the first or the second id need to be read 1! ID1 was: $id_1; ID2 was: $id_2\n";
7150 }
7151
7152 $fh->{last_line_1} = $line_1; # this contains read 1 or read 2
7153 $fh->{last_line_2} = $line_2; # this contains read 1 or read 2
7154 warn "Found first alignment:\n$fh->{last_line_1}\n$fh->{last_line_2}\n";
7155 }
7156
7157 # otherwise we just initialise last_seq_id and last_lines as undefined
7158 else {
7159 warn "Found no alignment, assigning undef to last_seq_id and last_lines\n";
7160 $fh->{last_seq_id} = undef;
7161 $fh->{last_line_1} = undef;
7162 $fh->{last_line_2} = undef;
7163 }
7164 }
7165 }
7166
7167 #####################################################################################################################################################
7168
7169 ### Bowtie 1 (default) | SINGLE-END | FASTA
7170 sub single_end_align_fragments_to_bisulfite_genome_fastA {
7171 my ($C_to_T_infile,$G_to_A_infile) = @_;
7172 if ($directional){
7173 warn "Input file is $C_to_T_infile (FastA)\n";
7174 }
7175 else{
7176 warn "Input files are $C_to_T_infile and $G_to_A_infile (FastA)\n";
7177 }
7178
7179 ## Now starting up to 4 instances of Bowtie feeding in the converted sequence files and reading in the first line of the bowtie output, and storing it in
7180 ## data structure above
7181 if ($directional){
7182 warn "Now running 2 instances of Bowtie against the bisulfite genome of $genome_folder with the specified options: $bowtie_options\n\n";
7183 }
7184 else{
7185 warn "Now running 4 individual instances of Bowtie against the bisulfite genome of $genome_folder with the specified options: $bowtie_options\n\n";
7186 }
7187
7188 foreach my $fh (@fhs) {
7189
7190 my $bt_options = $bowtie_options;
7191 if ($fh->{name} eq 'CTreadCTgenome' or $fh->{name} eq 'GAreadGAgenome'){
7192 $bt_options .= ' --norc'; ### ensuring the alignments are only reported in a sensible manner
7193 }
7194 else {
7195 $bt_options .= ' --nofw';
7196 }
7197
7198 warn "Now starting the Bowtie aligner for $fh->{name} (reading in sequences from $temp_dir$fh->{inputfile} with options: $bt_options)\n";
7199 if ($gzip){
7200 open ($fh->{fh},"gunzip -c $temp_dir$fh->{inputfile} | $path_to_bowtie $bt_options $fh->{bisulfiteIndex} - |") or die "Can't open pipe to bowtie: $!";
7201 }
7202 else{
7203 open ($fh->{fh},"$path_to_bowtie $bt_options $fh->{bisulfiteIndex} $temp_dir$fh->{inputfile} |") or die "Can't open pipe to bowtie: $!"; # command for uncompressed data
7204 }
7205
7206 # if Bowtie produces an alignment we store the first line of the output
7207 $_ = $fh->{fh}->getline();
7208 if ($_) {
7209 chomp;
7210 my $id = (split(/\t/))[0]; # this is the first element of the bowtie output (= the sequence identifier)
7211 $fh->{last_seq_id} = $id;
7212 $fh->{last_line} = $_;
7213 warn "Found first alignment:\t$fh->{last_line}\n";
7214 }
7215 # otherwise we just initialise last_seq_id and last_line as undefined
7216 else {
7217 warn "Found no alignment, assigning undef to last_seq_id and last_line\n";
7218 $fh->{last_seq_id} = undef;
7219 $fh->{last_line} = undef;
7220 }
7221 }
7222 }
7223
7224 ### Bowtie 2 | SINGLE-END | FASTA
7225 sub single_end_align_fragments_to_bisulfite_genome_fastA_bowtie2 {
7226 my ($C_to_T_infile,$G_to_A_infile) = @_;
7227 if ($directional){
7228 warn "Input file is $C_to_T_infile (FastA)\n";
7229 }
7230 else{
7231 warn "Input files are $C_to_T_infile and $G_to_A_infile (FastA)\n";
7232 }
7233
7234 ## Now starting up to 4 instances of Bowtie feeding in the converted sequence files and reading in the first line of the bowtie output, and storing it in
7235 ## data structure above
7236 if ($directional){
7237 warn "Now running 2 instances of Bowtie 2 against the bisulfite genome of $genome_folder with the specified options: $bowtie_options\n\n";
7238 }
7239 else{
7240 warn "Now running 4 individual instances of Bowtie 2 against the bisulfite genome of $genome_folder with the specified options: $bowtie_options\n\n";
7241 }
7242
7243 foreach my $fh (@fhs) {
7244
7245 my $bt2_options = $bowtie_options;
7246 if ($fh->{name} eq 'CTreadCTgenome' or $fh->{name} eq 'GAreadGAgenome'){
7247 $bt2_options .= ' --norc'; ### ensuring the alignments are only reported in a sensible manner
7248 }
7249 else {
7250 $bt2_options .= ' --nofw';
7251 }
7252
7253 warn "Now starting the Bowtie 2 aligner for $fh->{name} (reading in sequences from $temp_dir$fh->{inputfile} with options: $bt2_options)\n";
7254 open ($fh->{fh},"$path_to_bowtie $bt2_options -x $fh->{bisulfiteIndex} -U $temp_dir$fh->{inputfile} |") or die "Can't open pipe to bowtie 2: $!";
7255
7256 ### Bowtie 2 outputs out SAM format, so we need to skip everything until the first sequence
7257 while (1){
7258 $_ = $fh->{fh}->getline();
7259 if ($_) {
7260 last unless ($_ =~ /^\@/); # SAM headers start with @
7261 }
7262 else{
7263 last; # no alignment output
7264 }
7265 }
7266
7267 # Bowtie 2 outputs a result line even for sequences without any alignments. We thus store the first line of the output
7268 if ($_) {
7269 chomp;
7270 my $id = (split(/\t/))[0]; # this is the first element of the Bowtie output (= the sequence identifier)
7271 $fh->{last_seq_id} = $id;
7272 $fh->{last_line} = $_;
7273 warn "Found first alignment:\t$fh->{last_line}\n";
7274 }
7275 # otherwise we just initialise last_seq_id and last_line as undefinded. This should only happen at the end of a file for Bowtie 2 output
7276 else {
7277 warn "Found no alignment, assigning undef to last_seq_id and last_line\n";
7278 $fh->{last_seq_id} = undef;
7279 $fh->{last_line} = undef;
7280 }
7281 }
7282 }
7283
7284
7285 ### Bowtie 1 (default) | SINGLE-END | FASTQ
7286 sub single_end_align_fragments_to_bisulfite_genome_fastQ {
7287 my ($C_to_T_infile,$G_to_A_infile) = @_;
7288 if ($directional){
7289 warn "Input file is $C_to_T_infile (FastQ)\n";
7290 }
7291 elsif($pbat){
7292 warn "Input file is $G_to_A_infile (FastQ)\n";
7293 }
7294 else{
7295 warn "Input files are $C_to_T_infile and $G_to_A_infile (FastQ)\n";
7296 }
7297
7298
7299 ## Now starting up to 4 instances of Bowtie feeding in the converted sequence files and reading in the first line of the bowtie output, and storing it in
7300 ## the data structure above
7301 if ($directional or $pbat){
7302 warn "Now running 2 instances of Bowtie against the bisulfite genome of $genome_folder with the specified options: $bowtie_options\n\n";
7303 }
7304 else{
7305 warn "Now running 4 individual instances of Bowtie against the bisulfite genome of $genome_folder with the specified options: $bowtie_options\n\n";
7306 }
7307
7308 foreach my $fh (@fhs) {
7309 my $bt_options = $bowtie_options;
7310 if ($fh->{name} eq 'CTreadCTgenome' or $fh->{name} eq 'GAreadGAgenome'){
7311 $bt_options .= ' --norc'; ### ensuring the alignments are only reported in a sensible manner
7312 }
7313 else {
7314 $bt_options .= ' --nofw';
7315 }
7316
7317 warn "Now starting the Bowtie aligner for $fh->{name} (reading in sequences from $temp_dir$fh->{inputfile} with options: $bt_options)\n";
7318 sleep (5);
7319
7320 if ($gzip){
7321 open ($fh->{fh},"gunzip -c $temp_dir$fh->{inputfile} | $path_to_bowtie $bowtie_options $fh->{bisulfiteIndex} - |") or die "Can't open pipe to bowtie: $!";
7322 }
7323 else{
7324 open ($fh->{fh},"$path_to_bowtie $bowtie_options $fh->{bisulfiteIndex} $temp_dir$fh->{inputfile} |") or die "Can't open pipe to bowtie: $!"; # command for uncompressed data
7325 }
7326
7327 # if Bowtie produces an alignment we store the first line of the output
7328 $_ = $fh->{fh}->getline();
7329 if ($_) {
7330 chomp;
7331 my $id = (split(/\t/))[0]; # this is the first element of the Bowtie output (= the sequence identifier)
7332 $fh->{last_seq_id} = $id;
7333 $fh->{last_line} = $_;
7334 warn "Found first alignment:\t$fh->{last_line}\n";
7335 }
7336 # otherwise we just initialise last_seq_id and last_line as undefined
7337 else {
7338 warn "Found no alignment, assigning undef to last_seq_id and last_line\n";
7339 $fh->{last_seq_id} = undef;
7340 $fh->{last_line} = undef;
7341 }
7342 }
7343 }
7344
7345 ### Bowtie 2 | SINGLE-END | FASTQ
7346 sub single_end_align_fragments_to_bisulfite_genome_fastQ_bowtie2 {
7347
7348 my ($C_to_T_infile,$G_to_A_infile) = @_;
7349 if ($directional){
7350 warn "Input file is $C_to_T_infile (FastQ)\n\n";
7351 }
7352 elsif ($pbat){
7353 warn "Input file is $G_to_A_infile (FastQ)\n\n";
7354 }
7355 else{
7356 warn "Input files are $C_to_T_infile and $G_to_A_infile (FastQ)\n\n";
7357 }
7358
7359 ## Now starting up to 4 instances of Bowtie 2 feeding in the converted sequence files and reading in the first line of the bowtie output, and storing it in
7360 ## the data structure above
7361 if ($directional or $pbat){
7362 warn "Now running 2 instances of Bowtie 2 against the bisulfite genome of $genome_folder with the specified options: $bowtie_options\n\n";
7363 }
7364 else{
7365 warn "Now running 4 individual instances of Bowtie 2 against the bisulfite genome of $genome_folder with the specified options: $bowtie_options\n\n";
7366 }
7367
7368 foreach my $fh (@fhs) {
7369 my $bt2_options = $bowtie_options;
7370 if ($fh->{name} eq 'CTreadCTgenome' or $fh->{name} eq 'GAreadGAgenome'){
7371 $bt2_options .= ' --norc'; ### ensuring the alignments are only reported in a sensible manner
7372 }
7373 else {
7374 $bt2_options .= ' --nofw';
7375 }
7376 warn "Now starting the Bowtie 2 aligner for $fh->{name} (reading in sequences from $temp_dir$fh->{inputfile} with options $bt2_options)\n";
7377 warn "Using Bowtie 2 index: $fh->{bisulfiteIndex}\n\n";
7378
7379 open ($fh->{fh},"$path_to_bowtie $bt2_options -x $fh->{bisulfiteIndex} -U $temp_dir$fh->{inputfile} |") or die "Can't open pipe to bowtie: $!";
7380 ### Bowtie 2 outputs out SAM format, so we need to skip everything until the first sequence
7381 while (1){
7382 $_ = $fh->{fh}->getline();
7383 # warn "$_\n";
7384 # sleep(1);
7385 if ($_) {
7386 last unless ($_ =~ /^\@/); # SAM headers start with @
7387 }
7388 else {
7389 last;
7390 }
7391 }
7392
7393 # Bowtie 2 outputs a result line even for sequences without any alignments. We thus store the first line of the output
7394 if ($_) {
7395 chomp;
7396 my $id = (split(/\t/))[0]; # this is the first element of the Bowtie 2 output (= the sequence identifier)
7397 $fh->{last_seq_id} = $id;
7398 $fh->{last_line} = $_;
7399 warn "Found first alignment:\t$fh->{last_line}\n";
7400 # warn "storing $id and\n$_\n";
7401 }
7402 # otherwise we just initialise last_seq_id and last_line as undefined. This should only happen at the end of a file for Bowtie 2 output
7403 else {
7404 warn "Found no alignment, assigning undef to last_seq_id and last_line\n";
7405 $fh->{last_seq_id} = undef;
7406 $fh->{last_line} = undef;
7407 }
7408 }
7409 }
7410
7411 ###########################################################################################################################################
7412
7413 sub reset_counters_and_fhs{
7414 my $filename = shift;
7415 %counting=(
7416 total_meCHH_count => 0,
7417 total_meCHG_count => 0,
7418 total_meCpG_count => 0,
7419 total_meC_unknown_count => 0,
7420 total_unmethylated_CHH_count => 0,
7421 total_unmethylated_CHG_count => 0,
7422 total_unmethylated_CpG_count => 0,
7423 total_unmethylated_C_unknown_count => 0,
7424 sequences_count => 0,
7425 no_single_alignment_found => 0,
7426 unsuitable_sequence_count => 0,
7427 genomic_sequence_could_not_be_extracted_count => 0,
7428 unique_best_alignment_count => 0,
7429 low_complexity_alignments_overruled_count => 0,
7430 CT_CT_count => 0, #(CT read/CT genome, original top strand)
7431 CT_GA_count => 0, #(CT read/GA genome, original bottom strand)
7432 GA_CT_count => 0, #(GA read/CT genome, complementary to original top strand)
7433 GA_GA_count => 0, #(GA read/GA genome, complementary to original bottom strand)
7434 CT_GA_CT_count => 0, #(CT read1/GA read2/CT genome, original top strand)
7435 GA_CT_GA_count => 0, #(GA read1/CT read2/GA genome, complementary to original bottom strand)
7436 GA_CT_CT_count => 0, #(GA read1/CT read2/CT genome, complementary to original top strand)
7437 CT_GA_GA_count => 0, #(CT read1/GA read2/GA genome, original bottom strand)
7438 alignments_rejected_count => 0, # only relevant if --directional was specified
7439 );
7440
7441 if ($directional){
7442 if ($filename =~ ','){ # paired-end files
7443 @fhs=(
7444 { name => 'CTreadCTgenome',
7445 strand_identity => 'con ori forward',
7446 bisulfiteIndex => $CT_index_basename,
7447 seen => 0,
7448 wrong_strand => 0,
7449 },
7450 { name => 'CTreadGAgenome',
7451 strand_identity => 'con ori reverse',
7452 bisulfiteIndex => $GA_index_basename,
7453 seen => 0,
7454 wrong_strand => 0,
7455 },
7456 { name => 'GAreadCTgenome',
7457 strand_identity => 'compl ori con forward',
7458 bisulfiteIndex => $CT_index_basename,
7459 seen => 0,
7460 wrong_strand => 0,
7461 },
7462 { name => 'GAreadGAgenome',
7463 strand_identity => 'compl ori con reverse',
7464 bisulfiteIndex => $GA_index_basename,
7465 seen => 0,
7466 wrong_strand => 0,
7467 },
7468 );
7469 }
7470 else{ # single-end files
7471 @fhs=(
7472 { name => 'CTreadCTgenome',
7473 strand_identity => 'con ori forward',
7474 bisulfiteIndex => $CT_index_basename,
7475 seen => 0,
7476 wrong_strand => 0,
7477 },
7478 { name => 'CTreadGAgenome',
7479 strand_identity => 'con ori reverse',
7480 bisulfiteIndex => $GA_index_basename,
7481 seen => 0,
7482 wrong_strand => 0,
7483 },
7484 );
7485 }
7486 }
7487 elsif($pbat){
7488 if ($filename =~ ','){ # paired-end files
7489 @fhs=(
7490 { name => 'CTreadCTgenome',
7491 strand_identity => 'con ori forward',
7492 bisulfiteIndex => $CT_index_basename,
7493 seen => 0,
7494 wrong_strand => 0,
7495 },
7496 { name => 'CTreadGAgenome',
7497 strand_identity => 'con ori reverse',
7498 bisulfiteIndex => $GA_index_basename,
7499 seen => 0,
7500 wrong_strand => 0,
7501 },
7502 { name => 'GAreadCTgenome',
7503 strand_identity => 'compl ori con forward',
7504 bisulfiteIndex => $CT_index_basename,
7505 seen => 0,
7506 wrong_strand => 0,
7507 },
7508 { name => 'GAreadGAgenome',
7509 strand_identity => 'compl ori con reverse',
7510 bisulfiteIndex => $GA_index_basename,
7511 seen => 0,
7512 wrong_strand => 0,
7513 },
7514 );
7515 }
7516 else{ # single-end files
7517 @fhs=(
7518 { name => 'GAreadCTgenome',
7519 strand_identity => 'compl ori con forward',
7520 bisulfiteIndex => $CT_index_basename,
7521 seen => 0,
7522 wrong_strand => 0,
7523 },
7524 { name => 'GAreadGAgenome',
7525 strand_identity => 'compl ori con reverse',
7526 bisulfiteIndex => $GA_index_basename,
7527 seen => 0,
7528 wrong_strand => 0,
7529 },
7530 );
7531 }
7532 }
7533 else{
7534 @fhs=(
7535 { name => 'CTreadCTgenome',
7536 strand_identity => 'con ori forward',
7537 bisulfiteIndex => $CT_index_basename,
7538 seen => 0,
7539 wrong_strand => 0,
7540 },
7541 { name => 'CTreadGAgenome',
7542 strand_identity => 'con ori reverse',
7543 bisulfiteIndex => $GA_index_basename,
7544 seen => 0,
7545 wrong_strand => 0,
7546 },
7547 { name => 'GAreadCTgenome',
7548 strand_identity => 'compl ori con forward',
7549 bisulfiteIndex => $CT_index_basename,
7550 seen => 0,
7551 wrong_strand => 0,
7552 },
7553 { name => 'GAreadGAgenome',
7554 strand_identity => 'compl ori con reverse',
7555 bisulfiteIndex => $GA_index_basename,
7556 seen => 0,
7557 wrong_strand => 0,
7558 },
7559 );
7560 }
7561 }
7562
7563
7564 sub process_command_line{
7565 my @bowtie_options;
7566 my $help;
7567 my $mates1;
7568 my $mates2;
7569 my $path_to_bowtie;
7570 my $fastq;
7571 my $fasta;
7572 my $skip;
7573 my $qupto;
7574 my $phred64;
7575 my $phred33;
7576 my $solexa;
7577 my $mismatches;
7578 my $seed_length;
7579 my $best;
7580 my $sequence_format;
7581 my $version;
7582 my $quiet;
7583 my $chunk;
7584 my $non_directional;
7585 my $ceiling;
7586 my $maxins;
7587 my $minins;
7588 my $unmapped;
7589 my $multi_map;
7590 my $output_dir;
7591 my $bowtie2;
7592 my $vanilla;
7593 my $sam_no_hd;
7594 my $seed_extension_fails;
7595 my $reseed_repetitive_seeds;
7596 my $most_valid_alignments;
7597 my $score_min;
7598 my $parallel;
7599 my $temp_dir;
7600 my $rdg;
7601 my $rfg;
7602 my $non_bs_mm;
7603 my $samtools_path;
7604 my $bam;
7605 my $gzip;
7606 my $pbat;
7607 my $prefix;
7608 my $old_flag;
7609 my $basename;
7610 my $sam;
7611 my $multicore;
7612 my $bowtie1;
7613 my $rg_tag;
7614 my $rg_id;
7615 my $rg_sample;
7616 my $genome_folder;
7617 my $singles;
7618 my $ambig_bam;
7619 my $cram;
7620 my $cram_ref;
7621 my $nucleotide_coverage;
7622 my $dovetail;
7623
7624 my $command_line = GetOptions ('help|man' => \$help,
7625 '1=s' => \$mates1,
7626 '2=s' => \$mates2,
7627 'path_to_bowtie=s' => \$path_to_bowtie,
7628 'genome_folder=s' => \$genome_folder,
7629 'f|fasta' => \$fasta,
7630 'q|fastq' => \$fastq,
7631 's|skip=i' => \$skip,
7632 'u|upto=i' => \$qupto,
7633 'phred33-quals' => \$phred33,
7634 'phred64-quals|solexa1' => \$phred64,
7635 'solexa-quals' => \$solexa,
7636 'n|seedmms=i' => \$mismatches,
7637 'l|seedlen=i' => \$seed_length,
7638 'no_best' => \$best,
7639 'version' => \$version,
7640 'quiet' => \$quiet,
7641 'chunkmbs=i' => \$chunk,
7642 'non_directional' => \$non_directional,
7643 'I|minins=i' => \$minins,
7644 'X|maxins=i' => \$maxins,
7645 'e|maqerr=i' => \$ceiling,
7646 'un|unmapped' => \$unmapped,
7647 'ambiguous' => \$multi_map,
7648 'o|output_dir=s' => \$output_dir,
7649 'bowtie2' => \$bowtie2,
7650 'bowtie1' => \$bowtie1,
7651 'vanilla' => \$vanilla,
7652 'sam-no-hd' => \$sam_no_hd,
7653 'D=i' => \$seed_extension_fails,
7654 'R=i' => \$reseed_repetitive_seeds,
7655 'score_min=s' => \$score_min,
7656 'most_valid_alignments=i' => \$most_valid_alignments,
7657 'p=i' => \$parallel,
7658 'temp_dir=s' => \$temp_dir,
7659 'rdg=s' => \$rdg,
7660 'rfg=s' => \$rfg,
7661 'non_bs_mm' => \$non_bs_mm,
7662 'samtools_path=s' => \$samtools_path,
7663 'bam' => \$bam,
7664 'gzip' => \$gzip,
7665 'pbat' => \$pbat,
7666 'prefix=s' => \$prefix,
7667 'old_flag' => \$old_flag,
7668 'B|basename=s' => \$basename,
7669 'sam' => \$sam,
7670 'multicore=i' => \$multicore,
7671 'rg_tag' => \$rg_tag,
7672 'rg_id=s' => \$rg_id,
7673 'rg_sample=s' => \$rg_sample,
7674 'se|single_end=s' => \$singles,
7675 'ambig_bam' => \$ambig_bam,
7676 'cram' => \$cram,
7677 'cram_ref=s' => \$cram_ref,
7678 'nucleotide_coverage' => \$nucleotide_coverage,
7679 'dovetail' => \$dovetail,
7680 );
7681
7682
7683 ### EXIT ON ERROR if there were errors with any of the supplied options
7684 unless ($command_line){
7685 die "Please respecify command line options\n";
7686 }
7687 ### HELPFILE
7688 if ($help){
7689 print_helpfile();
7690 exit;
7691 }
7692 if ($version){
7693 print << "VERSION";
7694
7695
7696 Bismark - Bisulfite Mapper and Methylation Caller.
7697
7698 Bismark Version: $bismark_version
7699 Copyright 2010-15 Felix Krueger, Babraham Bioinformatics
7700 www.bioinformatics.babraham.ac.uk/projects/
7701
7702
7703 VERSION
7704 exit;
7705 }
7706
7707
7708 ##########################
7709 ### PROCESSING OPTIONS ###
7710 ##########################
7711
7712 if ($bowtie1){
7713 $bowtie2 = 0;
7714 }
7715 else{ # Bowtie 2 is now the default mode (as of 27 July 2015)
7716 $bowtie2 = 1;
7717 }
7718
7719 unless ($sam_no_hd){
7720 $sam_no_hd =0;
7721 }
7722
7723 ### PATH TO BOWTIE
7724 ### if a special path to Bowtie 1/2 was specified we will use that one, otherwise it is assumed that Bowtie 1/2 is in the PATH
7725 if ($path_to_bowtie){
7726 unless ($path_to_bowtie =~ /\/$/){
7727 $path_to_bowtie =~ s/$/\//;
7728 }
7729 if (-d $path_to_bowtie){
7730 if ($bowtie2){
7731 $path_to_bowtie = "${path_to_bowtie}bowtie2";
7732 }
7733 else{
7734 $path_to_bowtie = "${path_to_bowtie}bowtie";
7735 }
7736 }
7737 else{
7738 die "The path to bowtie provided ($path_to_bowtie) is invalid (not a directory)!\n";
7739 }
7740 }
7741 else{
7742 if ($bowtie2){
7743 $path_to_bowtie = 'bowtie2';
7744 warn "Path to Bowtie 2 specified as: $path_to_bowtie\n"; }
7745 else{
7746 $path_to_bowtie = 'bowtie';
7747 warn "Path to Bowtie specified as: $path_to_bowtie\n";
7748 }
7749 }
7750
7751
7752 if ($sam){
7753 warn "Output format manually set as SAM\n";
7754 }
7755 elsif($cram){
7756 warn "Output format set to CRAM\n";
7757 if (defined $cram_ref){
7758 warn "CRAM reference given as: '$cram_ref'\n\n";
7759 unless (-e $cram_ref){
7760 die "There is a problem with the CRAM reference '$cram_ref': $!\n\n";
7761 }
7762
7763 # determining full path information for the cram reference
7764 if ($cram_ref =~/\//){
7765 if (chdir $cram_ref){
7766 my $absolute_cram_ref_folder = getcwd; ## making the genome folder path absolute
7767 unless ($absolute_cram_ref_folder =~/\/$/){
7768 $absolute_cram_ref_folder =~ s/$/\//;
7769 }
7770 }
7771 }
7772 }
7773 else{
7774 warn "CRAM reference not specified explicitely, regenerating from FastA reference files\n\n";
7775 }
7776 }
7777 else{
7778 $bam = 1;
7779 warn "Output format is BAM (default)\n";
7780 }
7781
7782 ### OUTPUT REQUESTED AS BAM FILE (default)
7783 if ($bam or $cram){
7784 if ($vanilla){
7785 die "Specifying BAM output is not compatible with \"--vanilla\" format. Please respecify\n\n";
7786 }
7787
7788 ### PATH TO SAMTOOLS
7789 if (defined $samtools_path){
7790 # if Samtools was specified as full command
7791 if ($samtools_path =~ /samtools$/){
7792 if (-e $samtools_path){
7793 # Samtools executable found
7794 }
7795 else{
7796 die "Could not find an installation of Samtools at the location $samtools_path. Please respecify\n";
7797 }
7798 }
7799 else{
7800 unless ($samtools_path =~ /\/$/){
7801 $samtools_path =~ s/$/\//;
7802 }
7803 $samtools_path .= 'samtools';
7804 if (-e $samtools_path){
7805 # Samtools executable found
7806 }
7807 else{
7808 die "Could not find an installation of Samtools at the location $samtools_path. Please respecify\n";
7809 }
7810 }
7811
7812 warn "Alignments will be written out in BAM format. Samtools path provided as: '$samtools_path'\n";
7813 $bam = 1;
7814 }
7815 # Check whether Samtools is in the PATH if no path was supplied by the user
7816 else{
7817 if (!system "which samtools >/dev/null 2>&1"){ # STDOUT is binned, STDERR is redirected to STDOUT. Returns 0 if samtools is in the PATH
7818 $samtools_path = `which samtools`;
7819 chomp $samtools_path;
7820 warn "Alignments will be written out in BAM format. Samtools found here: '$samtools_path'\n"; sleep(1);
7821 $bam = 1;
7822 }
7823 }
7824
7825 unless (defined $samtools_path){
7826 $bam = 2;
7827 warn "Did not find Samtools on the system. Alignments will be compressed with GZIP instead (.sam.gz)\n";
7828 }
7829 sleep (1);
7830 }
7831
7832 ### OPTION AMBIGUOUS BAM
7833 if ($ambig_bam){
7834 unless ($bowtie2){
7835 die "The option --ambig_bam is only available for Bowtie2 alignments\n";
7836 }
7837 }
7838
7839
7840 ####################################
7841 ### PROCESSING ARGUMENTS
7842
7843 ### GENOME FOLDER
7844 if (defined $genome_folder){ # 25 11 2015 The genome folder may now also be defined with the option --genome_folder
7845 # warn "Genome folder specified with --genome_folder $genome_folder\n";
7846 }
7847 else{
7848 $genome_folder = shift @ARGV; # mandatory
7849 }
7850
7851 unless ($genome_folder){
7852 warn "Genome folder was not specified!\n";
7853 print_helpfile();
7854 exit;
7855 }
7856
7857 ### checking that the genome folder, all subfolders and the required bowtie index files exist
7858 unless ($genome_folder =~/\/$/){
7859 $genome_folder =~ s/$/\//;
7860 }
7861
7862 if (chdir $genome_folder){
7863 my $absolute_genome_folder = getcwd; ## making the genome folder path absolute
7864 unless ($absolute_genome_folder =~/\/$/){
7865 $absolute_genome_folder =~ s/$/\//;
7866 }
7867 warn "Reference genome folder provided is $genome_folder\t(absolute path is '$absolute_genome_folder)'\n";
7868 $genome_folder = $absolute_genome_folder;
7869 }
7870 else{
7871 die "Failed to move to $genome_folder: $!\nUSAGE: bismark [options] <genome_folder> {-1 <mates1> -2 <mates2> | <singles>} [<hits>] (--help for more details)\n";
7872 }
7873
7874 my $CT_dir = "${genome_folder}Bisulfite_Genome/CT_conversion/";
7875 my $GA_dir = "${genome_folder}Bisulfite_Genome/GA_conversion/";
7876
7877 my $bt2_small_index_present = 1;
7878 my $bt2_large_index_present = 1;
7879
7880 my $bt_small_index_present = 1;
7881 my $bt_large_index_present = 1;
7882
7883 if ($bowtie2){ ### Bowtie 2
7884
7885 ### Checking for small indixes first (ending in .bt2)
7886
7887 # checking the integrity of $CT_dir
7888 chdir $CT_dir or die "Failed to move to directory $CT_dir: $!\n";
7889
7890 my @CT_bowtie_index = ('BS_CT.1.bt2','BS_CT.2.bt2','BS_CT.3.bt2','BS_CT.4.bt2','BS_CT.rev.1.bt2','BS_CT.rev.2.bt2');
7891 foreach my $file(@CT_bowtie_index){
7892 unless (-f $file){
7893 warn "The Bowtie 2 index of the C->T converted genome seems to be faulty or non-existant ('$file'). Please run the bismark_genome_preparation before running Bismark\n";
7894 $bt2_small_index_present = 0;
7895 }
7896 }
7897 # checking the integrity of $GA_dir
7898 chdir $GA_dir or die "Failed to move to directory $GA_dir: $!\n";
7899 my @GA_bowtie_index = ('BS_GA.1.bt2','BS_GA.2.bt2','BS_GA.3.bt2','BS_GA.4.bt2','BS_GA.rev.1.bt2','BS_GA.rev.2.bt2');
7900
7901 foreach my $file(@GA_bowtie_index){
7902 unless (-f $file){
7903 warn "The Bowtie 2 index of the G->A converted genome seems to be faulty or non-existant ('$file'). Please run bismark_genome_preparation before running Bismark\n";
7904 $bt2_small_index_present = 0;
7905 }
7906 }
7907
7908 ### Using the small index preferentially
7909 if ($bt2_small_index_present){
7910 $bt2_large_index_present = 0;
7911 }
7912 else{ # only checking for large indexes if the 'normal' one can't be found
7913 warn "\nCouldn't find a traditional small Bowtie 2 index for the genome specified (ending in .bt2). Now searching for a large index instead (64-bit index ending in .bt2l)...\n";
7914
7915 ### If no small small indexes were found we look for large indexes (64-bit indexes, ending in .bt2l)
7916
7917 # checking the integrity of $CT_dir
7918 chdir $CT_dir or die "Failed to move to directory $CT_dir: $!\n";
7919
7920 @CT_bowtie_index = ('BS_CT.1.bt2l','BS_CT.2.bt2l','BS_CT.3.bt2l','BS_CT.4.bt2l','BS_CT.rev.1.bt2l','BS_CT.rev.2.bt2l');
7921 foreach my $file(@CT_bowtie_index){
7922 unless (-f $file){
7923 die "The Bowtie 2 index of the C->T converted genome seems to be faulty or non-existant ('$file'). Please run the bismark_genome_preparation before running Bismark\n";
7924 $bt2_large_index_present = 0; }
7925 }
7926
7927 ### checking the integrity of $GA_dir
7928 chdir $GA_dir or die "Failed to move to directory $GA_dir: $!\n";
7929 @GA_bowtie_index = ('BS_GA.1.bt2l','BS_GA.2.bt2l','BS_GA.3.bt2l','BS_GA.4.bt2l','BS_GA.rev.1.bt2l','BS_GA.rev.2.bt2l');
7930
7931 foreach my $file(@GA_bowtie_index){
7932 unless (-f $file){
7933 die "The Bowtie 2 index of the G->A converted genome seems to be faulty or non-existant ('$file'). Please run bismark_genome_preparation before running Bismark\n";
7934 $bt2_large_index_present = 0;
7935 }
7936 }
7937
7938 if ($bt2_large_index_present){
7939 warn "64-bit large genome Bowtie 2 index found...\n";
7940 }
7941 else{
7942 die "Failed to detect either a standard (.bt2) or 64-bit (.bt2l) Bowtie 2 index for the genome specified. Please run the bismark_genome_preparation before launching Bismark\n\n";
7943 }
7944 }
7945
7946 }
7947
7948 else{ ### Bowtie 1
7949 ### Checking for small indixes first (ending in .ebwt)
7950 ### checking the integrity of $CT_dir
7951 chdir $CT_dir or die "Failed to move to directory $CT_dir: $!\n";
7952 my @CT_bowtie_index = ('BS_CT.1.ebwt','BS_CT.2.ebwt','BS_CT.3.ebwt','BS_CT.4.ebwt','BS_CT.rev.1.ebwt','BS_CT.rev.2.ebwt');
7953 foreach my $file(@CT_bowtie_index){
7954 unless (-f $file){
7955 warn "The Bowtie index of the C->T converted genome seems to be faulty ($file doesn't exist). Please run bismark_genome_preparation --bowtie1 before running Bismark.\n";
7956 $bt_small_index_present = 0;
7957 }
7958 }
7959
7960 ### checking the integrity of $GA_dir
7961 chdir $GA_dir or die "Failed to move to directory $GA_dir: $!\n";
7962 my @GA_bowtie_index = ('BS_GA.1.ebwt','BS_GA.2.ebwt','BS_GA.3.ebwt','BS_GA.4.ebwt','BS_GA.rev.1.ebwt','BS_GA.rev.2.ebwt');
7963 foreach my $file(@GA_bowtie_index){
7964 unless (-f $file){
7965 warn "The Bowtie index of the G->A converted genome seems to be faulty ($file doesn't exist). Please run bismark_genome_preparation --bowtie1 before running Bismark.\n";
7966 $bt_small_index_present = 0;
7967 }
7968 }
7969
7970 ### Using the small index preferentially
7971 if ($bt_small_index_present){
7972 $bt_large_index_present = 0;
7973 }
7974 else{ # only checking for large indexes if the 'normal' one can't be found
7975 warn "\nCouldn't find a traditional small Bowtie index for the genome specified (ending in .ebwt). Now searching for a large index instead (64-bit index ending in .ebwtl)...\n";
7976
7977 ### If no small small indexes were found we look for large indexes (64-bit indexes, ending in .ebwtl)
7978
7979 ### checking the integrity of $CT_dir
7980 chdir $CT_dir or die "Failed to move to directory $CT_dir: $!\n";
7981 my @CT_bowtie_index = ('BS_CT.1.ebwtl','BS_CT.2.ebwtl','BS_CT.3.ebwtl','BS_CT.4.ebwtl','BS_CT.rev.1.ebwtl','BS_CT.rev.2.ebwtl');
7982 foreach my $file(@CT_bowtie_index){
7983 unless (-f $file){
7984 warn "The Bowtie index of the C->T converted genome seems to be faulty ($file doesn't exist). Please run bismark_genome_preparation --bowtie1 before running Bismark.\n";
7985 $bt_large_index_present = 0;
7986 }
7987 }
7988
7989 ### checking the integrity of $GA_dir
7990 chdir $GA_dir or die "Failed to move to directory $GA_dir: $!\n";
7991 my @GA_bowtie_index = ('BS_GA.1.ebwtl','BS_GA.2.ebwtl','BS_GA.3.ebwtl','BS_GA.4.ebwtl','BS_GA.rev.1.ebwtl','BS_GA.rev.2.ebwtl');
7992 foreach my $file(@GA_bowtie_index){
7993 unless (-f $file){
7994 warn "The Bowtie index of the G->A converted genome seems to be faulty ($file doesn't exist). Please run bismark_genome_preparation --bowtie1 before running Bismark.\n";
7995 $bt_large_index_present = 0;
7996 }
7997 }
7998
7999 if ($bt_large_index_present){
8000 warn "64-bit large genome Bowtie index found...\n";
8001 }
8002 else{
8003 die "Failed to detect either a standard (.ebwt) or 64-bit (.ebwtl) Bowtie index for the genome specified. Please run the bismark_genome_preparation --bowtie1 before launching Bismark\n\n";
8004 }
8005 }
8006
8007 }
8008
8009 my $CT_index_basename = "${CT_dir}BS_CT";
8010 my $GA_index_basename = "${GA_dir}BS_GA";
8011
8012 ### INPUT OPTIONS
8013
8014 ### SEQUENCE FILE FORMAT
8015 ### exits if both fastA and FastQ were specified
8016 if ($fasta and $fastq){
8017 die "Only one sequence filetype can be specified (fastA or fastQ)\n";
8018 }
8019
8020 ### unless fastA is specified explicitely, fastQ sequence format is expected by default
8021 if ($fasta){
8022 print "FastA format specified\n";
8023 $sequence_format = 'FASTA';
8024 push @bowtie_options, '-f';
8025 }
8026 elsif ($fastq){
8027 print "FastQ format specified\n";
8028 $sequence_format = 'FASTQ';
8029 push @bowtie_options, '-q';
8030 }
8031 else{
8032 $fastq = 1;
8033 print "FastQ format assumed (by default)\n";
8034 $sequence_format = 'FASTQ';
8035 push @bowtie_options, '-q';
8036 }
8037
8038 ### SKIP
8039 if ($skip){
8040 warn "Skipping the first $skip reads from the input file\n";
8041 # push @bowtie_options,"-s $skip";
8042 }
8043
8044 ### UPTO
8045 if ($qupto){
8046 warn "Processing sequences up to read no. $qupto from the input file\n";
8047 if ($bowtie2){
8048 # push @bowtie_options,"--upto $qupto"; ## slightly changed for Bowtie 2
8049 }
8050 else{
8051 # push @bowtie_options,"--qupto $qupto";
8052 }
8053 }
8054
8055 ### QUALITY VALUES
8056 if (($phred33 and $phred64) or ($phred33 and $solexa) or ($phred64 and $solexa)){
8057 die "You can only specify one type of quality value at a time! (--phred33-quals or --phred64-quals or --solexa-quals)";
8058 }
8059 if ($phred33){ ## if nothing else is specified $phred33 will be used as default by both Bowtie 1 and 2.
8060 # Phred quality values work only when -q is specified
8061 unless ($fastq){
8062 die "Phred quality values works only when -q (FASTQ) is specified\n";
8063 }
8064 if ($bowtie2){
8065 push @bowtie_options,"--phred33";
8066 }
8067 else{
8068 push @bowtie_options,"--phred33-quals";
8069 }
8070 }
8071 if ($phred64){
8072 # Phred quality values work only when -q is specified
8073 unless ($fastq){
8074 die "Phred quality values work only when -q (FASTQ) is specified\n";
8075 }
8076 if ($bowtie2){
8077 push @bowtie_options,"--phred64";
8078 }
8079 else{
8080 push @bowtie_options,"--phred64-quals";
8081 }
8082 }
8083 else{
8084 $phred64 = 0;
8085 }
8086
8087 if ($solexa){
8088 if ($bowtie2){
8089 die "The option '--solexa-quals' is not compatible with Bowtie 2. Please respecify!\n";
8090 }
8091 # Solexa to Phred value conversion works only when -q is specified
8092 unless ($fastq){
8093 die "Conversion from Solexa to Phred quality values works only when -q (FASTQ) is specified\n";
8094 }
8095 push @bowtie_options,"--solexa-quals";
8096 }
8097 else{
8098 $solexa = 0;
8099 }
8100
8101 ### ALIGNMENT OPTIONS
8102
8103 ### MISMATCHES
8104 if (defined $mismatches){
8105 if ($bowtie2){
8106 if ($mismatches == 0 or $mismatches == 1){
8107 push @bowtie_options,"-N $mismatches";
8108 }
8109 else{
8110 die "Please set the number of multiseed mismatches for Bowtie 2 with '-N <int>' (where <int> can be 0 or 1)\n";
8111 }
8112 }
8113 else{
8114 if ($mismatches >= 0 and $mismatches <= 3){
8115 push @bowtie_options,"-n $mismatches";
8116 }
8117 else{
8118 die "Please set the number of seed mismatches for Bowtie 1 with '-n <int>' (where <int> can be 0,1,2 or 3)\n";
8119 }
8120 }
8121 }
8122 else{
8123 unless ($bowtie2){
8124 push @bowtie_options,"-n 1"; # setting -n to 1 by default (for use with Bowtie only) because it is much quicker than the default mode of -n 2
8125 }
8126 }
8127
8128 ### SEED LENGTH
8129 if (defined $seed_length){
8130 if ($bowtie2){
8131 push @bowtie_options,"-L $seed_length";
8132 }
8133 else{
8134 push @bowtie_options,"-l $seed_length";
8135 }
8136 }
8137
8138 ### MISMATCH CEILING
8139 if (defined $ceiling){
8140 die "The option '-e' is not compatible with Bowtie 2. Please respecify options\n" if ($bowtie2);
8141 push @bowtie_options,"-e $ceiling";
8142 }
8143
8144
8145 ### BOWTIE 2 EFFORT OPTIONS
8146
8147 ### CONSECUTIVE SEED EXTENSION FAILS
8148 if (defined $seed_extension_fails){
8149 die "The option '-D <int>' is only available when using Bowtie 2\n\n" unless ($bowtie2);
8150 push @bowtie_options,"-D $seed_extension_fails";
8151 }
8152
8153 ### RE-SEEDING REPETITIVE SEEDS
8154 if (defined $reseed_repetitive_seeds){
8155 die "The option '-R <int>' is only available when using Bowtie 2\n\n" unless ($bowtie2);
8156 push @bowtie_options,"-R $reseed_repetitive_seeds";
8157 }
8158
8159
8160 ### BOWTIE 2 SCORING OPTIONS
8161
8162 my ($score_min_intercept, $score_min_slope);
8163
8164 if ($score_min){
8165 die "The option '--score_min <func>' is only available when using Bowtie 2\n\n" unless ($bowtie2);
8166
8167 unless ($score_min =~ /^L,(.+),(.+)$/){
8168 die "The option '--score_min <func>' needs to be in the format <L,value,value> . Please consult \"setting up functions\" in the Bowtie 2 manual for further information\n\n";
8169 }
8170 ($score_min_intercept, $score_min_slope) = ($1, $2);
8171 push @bowtie_options,"--score-min L,$score_min_intercept,$score_min_slope"; # default setting, more stringent than normal Bowtie2
8172 }
8173 else{
8174 if ($bowtie2){
8175 ($score_min_intercept, $score_min_slope) = (0, -0.2);
8176 push @bowtie_options,"--score-min L,$score_min_intercept,$score_min_slope"; # default setting, more stringent than normal Bowtie2
8177 }
8178 }
8179
8180 ### BOWTIE 2 READ GAP OPTIONS
8181 my ($insertion_open,$insertion_extend,$deletion_open,$deletion_extend);
8182
8183 if ($rdg){
8184 die "The option '--rdg <int1>,<int2>' is only available when using Bowtie 2\n\n" unless ($bowtie2);
8185 if ($rdg =~ /^(\d+),(\d+)$/){
8186 $deletion_open = $1;
8187 $deletion_extend = $2;
8188 }
8189 else{
8190 die "The option '--rdg <int1>,<int2>' needs to be in the format <integer,integer> . Please consult \"setting up functions\" in the Bowtie 2 manual for further information\n\n";
8191 }
8192 push @bowtie_options,"--rdg $rdg";
8193 }
8194 else{
8195 $deletion_open = 5;
8196 $deletion_extend = 3;
8197 }
8198
8199 ### BOWTIE 2 REFERENCE GAP OPTIONS
8200 if ($rfg){
8201 die "The option '--rfg <int1>,<int2>' is only available when using Bowtie 2\n\n" unless ($bowtie2);
8202 if ($rfg =~ /^(\d+),(\d+)$/){
8203 $insertion_open = $1;
8204 $insertion_extend = $2;
8205 }
8206 else{
8207 die "The option '--rfg <int1>,<int2>' needs to be in the format <integer,integer> . Please consult \"setting up functions\" in the Bowtie 2 manual for further information\n\n";
8208 }
8209 push @bowtie_options,"--rfg $rfg";
8210 }
8211 else{
8212 $insertion_open = 5;
8213 $insertion_extend = 3;
8214 }
8215
8216
8217 ### BOWTIE 2 PARALLELIZATION OPTIONS
8218 if (defined $parallel){
8219 die "The parallelization switch '-p' only works for Bowtie 2. Please respecify!" unless ($bowtie2);
8220 }
8221 if ($bowtie2){
8222 if ($parallel){
8223 die "Please select a value for -p of 2 or more!\n" unless ($parallel > 1);
8224 if ($parallel > 4){
8225 warn "Attention: using more than 4 cores per alignment thread has been reported to have diminishing returns. If possible try to limit -p to a value of 4\n"; sleep(2);
8226 }
8227 push @bowtie_options,"-p $parallel";
8228 push @bowtie_options,'--reorder'; ## re-orders the bowtie 2 output so that it does match the input files. This is abolutely required for parallelization to work.
8229 print "Each Bowtie 2 instance is going to be run with $parallel threads. Please monitor performance closely and tune down if needed!\n";
8230 sleep (2);
8231 }
8232 }
8233
8234 ### REPORTING OPTIONS
8235
8236 if ($bowtie2){
8237 push @bowtie_options,'--ignore-quals'; ## All mismatches will receive penalty for mismatches as if they were of high quality, which is 6 by default
8238
8239 ### Option -M is deprecated since Bowtie 2 version 2.0.0 beta7. I'll leave this option commented out for a while
8240 if(defined $most_valid_alignments){
8241
8242 warn "\nThe option -M is now deprecated (as of Bowtie 2 version 2.0.0 beta7). What used to be called -M mode is still the default mode. Use the -D and -R options to adjust the effort expended to find valid alignments.\n\n";
8243 }
8244 }
8245 else{ # Because of the way Bismark works we will always use the reporting option -k 2 (report up to 2 valid alignments) for Bowtie 1
8246 push @bowtie_options,'-k 2';
8247 }
8248
8249 ### --BEST
8250 if ($bowtie2){
8251 if ($best){ # Bowtie 2 does away with the concept of --best, so one can also not select --no-best when Bowtie 2 is to be used
8252 die "The option '--no-best' is not compatible with Bowtie 2. Please respecify options\n";
8253 }
8254 }
8255 else{
8256 # --best is the default option for Bowtie 1, specifying --no-best can turn it off (e.g. to speed up alignment process)
8257 unless ($best){
8258 push @bowtie_options,'--best';
8259 }
8260 }
8261
8262 ### VANILLA BISMARK (BOWTIE 1) OUTPUT
8263 if ($vanilla){
8264 if ($bowtie2){
8265 die "The options --bowtie2 and the --vanilla are not compatible. Please respecify!\n\n";
8266 }
8267 }
8268 else{
8269 $vanilla = 0;
8270 }
8271
8272 ### PAIRED-END MAPPING
8273 if ($mates1){
8274
8275 if (defined $singles){ # if --single_end has been set explicitely
8276 die "You cannot set --single_end and supply files in paired-end format (-1 <mates1> -2 <mates2>). Please respecify!\n";
8277 }
8278
8279 my @mates1 = (split (/,/,$mates1));
8280 die "Paired-end mapping requires the format: -1 <mates1> -2 <mates2>, please respecify!\n" unless ($mates2);
8281 my @mates2 = (split(/,/,$mates2));
8282 unless (scalar @mates1 == scalar @mates2){
8283 die "Paired-end mapping requires the same amounnt of mate1 and mate2 files, please respecify! (format: -1 <mates1> -2 <mates2>)\n";
8284 }
8285 while (1){
8286 my $mate1 = shift @mates1;
8287 my $mate2 = shift @mates2;
8288 last unless ($mate1 and $mate2);
8289 push @filenames,"$mate1,$mate2";
8290 }
8291 if ($bowtie2){
8292 push @bowtie_options,'--no-mixed'; ## By default Bowtie 2 is not looking for single-end alignments if it can't find concordant or discordant alignments
8293 push @bowtie_options,'--no-discordant';## By default Bowtie 2 is not looking for discordant alignments if it can't find concordant ones
8294
8295 if ($pbat){
8296 $dovetail = 1; # setting the option $dovetail for PBAT paired-end alignments
8297 }
8298
8299 if ($dovetail){
8300 if ($old_flag){
8301 die "The option --dovetail may only be specified with the current SAM FLAG values. Please respecify...\n";
8302 }
8303 push @bowtie_options,'--dovetail'; ## 07 03 2016 Adding the option --dovetail, mainly for PBAT alignments
8304 }
8305 }
8306
8307 if ($old_flag){
8308 warn "\nUsing FLAG values for paired-end SAM output used up to Bismark v0.8.2. In addition, paired-end sequences will have /1 and /2 appended to their read IDs\n\n" unless($vanilla);
8309 sleep(3);
8310 }
8311 }
8312 elsif ($mates2){
8313 die "Paired-end mapping requires the format: -1 <mates1> -2 <mates2>, please respecify!\n";
8314 }
8315
8316 ### SINGLE-END MAPPING
8317 # Single-end mapping will be performed if no mate pairs for paired-end mapping have been specified
8318
8319 unless ($mates1 and $mates2){
8320 if (defined $singles){ # if --single_end has been set explicitely
8321 warn "Mapping set to single-end mode (user defined). File names need to be separated by commas [,] or colons [:]! Supplied file names are: $singles\n";
8322 $singles =~ s/:/,/g; # replacing colons (:) with commas
8323 }
8324 else{
8325 $singles = join (',',@ARGV);
8326 unless ($singles){
8327 die "\nNo filename supplied! Please specify one or more files for single-end Bismark mapping!\n";
8328 }
8329 $singles =~ s/\s/,/g; # replacing spaces with commas
8330 }
8331
8332 @filenames = (split(/,/,$singles));
8333 warn "\nFiles to be analysed:\n";
8334 warn "@filenames\n\n";
8335 sleep (3);
8336 }
8337
8338 ### MININUM INSERT SIZE (PAIRED-END ONLY)
8339 if (defined $minins){
8340 die "-I/--minins can only be used for paired-end mapping!\n\n" if ($singles);
8341 push @bowtie_options,"--minins $minins";
8342 }
8343
8344 ### MAXIMUM INSERT SIZE (PAIRED-END ONLY)
8345 if (defined $maxins){
8346 die "-X/--maxins can only be used for paired-end mapping!\n\n" if ($singles);
8347 push @bowtie_options,"--maxins $maxins";
8348 }
8349 else{
8350 unless ($singles){
8351 push @bowtie_options,'--maxins 500';
8352 }
8353 }
8354
8355 ### QUIET prints nothing besides alignments (suppresses warnings)
8356 if ($quiet){
8357 push @bowtie_options,'--quiet';
8358 }
8359
8360 ### CHUNKMBS needed to be increased to avoid memory exhaustion warnings for Bowtie 1, particularly for --best (and paired-end) alignments
8361 unless ($bowtie2){ # Bowtie 2 does not have a chunkmbs option
8362 if (defined $chunk){
8363 push @bowtie_options,"--chunkmbs $chunk";
8364 }
8365 else{
8366 push @bowtie_options,'--chunkmbs 512'; ## setting the default to 512MB (up from 64 default)
8367 }
8368 }
8369
8370
8371 ### SUMMARY OF ALL BOWTIE OPTIONS
8372 my $bowtie_options = join (' ',@bowtie_options);
8373
8374
8375 ### STRAND-SPECIFIC LIBRARIES
8376 my $directional;
8377 if ($non_directional){
8378 die "A library can only be specified to be either non-directional or a PBAT-Seq library. Please respecify!\n\n" if ($pbat);
8379 warn "Library was specified to be not strand-specific (non-directional), therefore alignments to all four possible bisulfite strands (OT, CTOT, OB and CTOB) will be reported\n";
8380 sleep (1);
8381 $directional = 0;
8382 }
8383 elsif($pbat){
8384 die "The option --pbat is currently not compatible with --gzip. Please run alignments with uncompressed temporary files, i.e. lose the option --gzip\n" if ($gzip);
8385 die "The option --pbat is currently only working with FastQ files. Please respecify (i.e. lose the option -f)!\n" if ($fasta);
8386
8387 warn "Library was specified as PBAT-Seq (Post-Bisulfite Adapter Tagging), only performing alignments to the complementary strands (CTOT and CTOB)\n";
8388 sleep (1);
8389 $directional = 0;
8390 }
8391 else{
8392 warn "Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!)\n";
8393 sleep (1);
8394 $directional = 1; # default behaviour
8395 }
8396
8397 ### UNMAPPEDSEQUENCE OUTPUT
8398 $unmapped = 0 unless ($unmapped);
8399
8400 ### AMBIGUOUS ALIGNMENT SEQUENCE OUTPUT
8401 $multi_map = 0 unless ($multi_map);
8402
8403
8404 ### OUTPUT DIRECTORY
8405
8406 chdir $parent_dir or die "Failed to move back to current working directory\n";
8407 if ($output_dir){
8408 unless ($output_dir =~ /\/$/){
8409 $output_dir =~ s/$/\//;
8410 }
8411
8412 if (chdir $output_dir){
8413 $output_dir = getcwd; # making the path absolute
8414 unless ($output_dir =~ /\/$/){
8415 $output_dir =~ s/$/\//;
8416 }
8417 }
8418 else{
8419 mkdir $output_dir or die "Unable to create directory $output_dir $!\n";
8420 warn "Created output directory $output_dir!\n\n";
8421 chdir $output_dir or die "Failed to move to $output_dir\n";
8422 $output_dir = getcwd; # making the path absolute
8423 unless ($output_dir =~ /\/$/){
8424 $output_dir =~ s/$/\//;
8425 }
8426 }
8427 warn "Output will be written into the directory: $output_dir\n";
8428 }
8429 else{
8430 $output_dir = '';
8431 }
8432
8433 ### TEMPORARY DIRECTORY for C->T and G->A transcribed files
8434
8435 chdir $parent_dir or die "Failed to move back to current working directory\n";
8436 if ($temp_dir){
8437 warn "\nUsing temp directory: $temp_dir\n";
8438 unless ($temp_dir =~ /\/$/){
8439 $temp_dir =~ s/$/\//;
8440 }
8441
8442 if (chdir $temp_dir){
8443 $temp_dir = getcwd; # making the path absolute
8444 unless ($temp_dir =~ /\/$/){
8445 $temp_dir =~ s/$/\//;
8446 }
8447 }
8448 else{
8449 mkdir $temp_dir or die "Unable to create directory $temp_dir $!\n";
8450 warn "Created temporary directory $temp_dir!\n\n";
8451 chdir $temp_dir or die "Failed to move to $temp_dir\n";
8452 $temp_dir = getcwd; # making the path absolute
8453 unless ($temp_dir =~ /\/$/){
8454 $temp_dir =~ s/$/\//;
8455 }
8456 }
8457 warn "Temporary files will be written into the directory: $temp_dir\n";
8458 }
8459 else{
8460 $temp_dir = '';
8461 }
8462
8463 ### OPTIONAL NON-BS MISMATCH OUTPUT AS EXTRA COLUMN IN SAM FILE
8464 if ($non_bs_mm){
8465 if ($vanilla){
8466 die "Option '--non_bs_mm' may only be specified for output in SAM format. Please respecify!\n";
8467 }
8468 }
8469
8470 ### PREFIX FOR OUTPUT FILES
8471 if ($prefix){
8472 # removing trailing dots
8473
8474 $prefix =~ s/\.+$//;
8475
8476 warn "Using the following prefix for output files: $prefix\n\n";
8477 sleep(1);
8478 }
8479
8480 if (defined $multicore){
8481 unless ($multicore > 0){
8482 die "Core usage needs to be set to 1 or more (currently selected $multicore). Please respecify!\n";
8483 }
8484 if ($multicore > 20){
8485 warn "Core usage currently set to more than 20 threads. This might fail horribly but let's see how it goes... (set value: $multicore)\n\n";
8486 }
8487 if ($sam){
8488 die "The multicore function currently requires the output to be in BAM format, so please lose either option --sam or --multi\n";
8489 }
8490 }
8491 else{
8492 $multicore = 1; # default. Single-thread mode
8493 warn "Setting parallelization to single-threaded (default)\n\n";
8494 }
8495
8496 if ($basename and $multicore > 1){
8497 die "Specifying --basename in conjuction with --multicore is currently not supported (but we are aiming to fix this soon). Please lose either --basename or --multicore to proceed\n\n";
8498 }
8499
8500 # Read Group Tags for the @RG header
8501 if (defined $rg_sample){
8502 if (defined $rg_id){
8503 warn "--rg_id set to '$rg_id', setting --rg_tag to TRUE\n";
8504 $rg_tag++; # implicitely setting $rg_tag as well
8505 }
8506 else{
8507 die "--rg_sample cannot be specified without without setting --rg_id. Please set both or none (which would result in the default name 'SAMPLE' for both)\n";
8508 }
8509 }
8510
8511 if ($rg_tag){ # either true because of --rg_tag, or because --rg_id/--rg_sample were defined as well
8512 unless (defined $rg_id){
8513 $rg_id = 'SAMPLE';
8514 }
8515 unless (defined $rg_sample){
8516 $rg_sample = 'SAMPLE';
8517 }
8518 }
8519
8520 return ($genome_folder,$CT_index_basename,$GA_index_basename,$path_to_bowtie,$sequence_format,$bowtie_options,$directional,$unmapped,$multi_map,$phred64,$solexa,$output_dir,$bowtie2,$vanilla,$sam_no_hd,$skip,$qupto,$temp_dir,$non_bs_mm,$insertion_open,$insertion_extend,$deletion_open,$deletion_extend,$gzip,$bam,$samtools_path,$pbat,$prefix,$old_flag,$basename,$score_min_intercept,$score_min_slope,$bt2_large_index_present,$multicore,$rg_tag,$rg_id,$rg_sample,$ambig_bam,$cram,$cram_ref,$nucleotide_coverage,$dovetail);
8521 }
8522
8523
8524
8525 sub generate_SAM_header{
8526
8527 print OUT "\@HD\tVN:1.0\tSO:unsorted\n"; # @HD = header, VN = version, SO = sort order
8528 if ($ambig_bam){
8529 print AMBIBAM "\@HD\tVN:1.0\tSO:unsorted\n";
8530 }
8531
8532 # Unordered printing of @SQ headers
8533 # foreach my $chr (keys %chromosomes){
8534 # my $length = length ($chromosomes{$chr});
8535 # print "\@SQ\tSN:$chr\tLN:$length\n";
8536 # print OUT "\@SQ\tSN:$chr\tLN:$length\n"; # @SQ = sequence, SN = seq name, LN = length
8537 # }
8538
8539 foreach my $chr (sort {$a<=>$b} keys %SQ_order){
8540 # warn "$chr\t$SQ_order{$chr}\n";
8541 my $length = length ($chromosomes{$SQ_order{$chr}});
8542 print OUT "\@SQ\tSN:$SQ_order{$chr}\tLN:$length\n"; # @SQ = sequence, SN = seq name, LN = length
8543 if ($ambig_bam){
8544 print AMBIBAM "\@SQ\tSN:$SQ_order{$chr}\tLN:$length\n";
8545 }
8546 }
8547
8548 # 18 11 2015: Added @RG as a header line if --rg_tag or --rg_id/--rg_sample were set as well
8549 if ($rg_tag){
8550 print OUT "\@RG\tPL:ILLUMINA\tID:$rg_id\tSM:$rg_sample\n"; # @RG = Read Group, PL = Platform, ID: required, SM: sample, can be a description
8551 }
8552
8553 print OUT "\@PG\tID:Bismark\tVN:$bismark_version\tCL:\"bismark $command_line\"\n"; # @PG = program, ID = unique identifier, PN = program name name, VN = program version
8554 if ($ambig_bam){
8555 print AMBIBAM "\@PG\tID:Bismark\tVN:$bismark_version\tCL:\"bismark $command_line\"\n";
8556 }
8557 }
8558
8559 ### I would like to thank the following individuals for their valuable contributions to the Bismark SAM output format:
8560 ### O. Tam (2010), C. Whelan (2011), E. Vidal (2011), T. McBryan (2011), P. Hickey (2011), A. Dei Rossi (2014)
8561
8562 sub single_end_SAM_output{
8563
8564 my ($id,$actual_seq,$methylation_call_params,$qual) = @_;
8565 my $strand = $methylation_call_params->{$id}->{alignment_strand};
8566 my $chr = $methylation_call_params->{$id}->{chromosome};
8567 my $start = $methylation_call_params->{$id}->{position};
8568 my $stop = $methylation_call_params->{$id}->{end_position};
8569 my $ref_seq = $methylation_call_params->{$id}->{unmodified_genomic_sequence};
8570 my $methcall = $methylation_call_params->{$id}->{methylation_call};
8571 my $read_conversion = $methylation_call_params->{$id}->{read_conversion};
8572 my $genome_conversion = $methylation_call_params->{$id}->{genome_conversion};
8573 my $number_of_mismatches;
8574
8575 if ($bowtie2){
8576 $number_of_mismatches= $methylation_call_params->{$id}->{alignment_score};
8577 }
8578 else{
8579 $number_of_mismatches= $methylation_call_params->{$id}->{number_of_mismatches};
8580 }
8581
8582 ### This is a description of the bitwise FLAG field which needs to be set for the SAM file taken from: "The SAM Format Specification (v1.4-r985), September 7, 2011"
8583 ## FLAG: bitwise FLAG. Each bit is explained in the following table:
8584 ## Bit Description Comment Value
8585 ## 0x1 template has multiple segments in sequencing 0: single-end 1: paired end value: 2**0 ( 1)
8586 ## 0x2 each segment properly aligned according to the aligner true only for paired-end alignments value: 2**1 ( 2)
8587 ## 0x4 segment unmapped --- ---
8588 ## 0x8 next segment in the template unmapped --- ---
8589 ## 0x10 SEQ being reverse complemented value: 2**4 ( 16)
8590 ## 0x20 SEQ of the next segment in the template being reversed value: 2**5 ( 32)
8591 ## 0x40 the first segment in the template read 1 value: 2**6 ( 64)
8592 ## 0x80 the last segment in the template read 2 value: 2**7 (128)
8593 ## 0x100 secondary alignment --- ---
8594 ## 0x200 not passing quality controls --- ---
8595 ## 0x400 PCR or optical duplicate --- ---
8596
8597 #####
8598
8599 my $flag; # FLAG variable used for SAM format.
8600 if ($strand eq "+"){
8601 if ($read_conversion eq 'CT' and $genome_conversion eq 'CT'){
8602 $flag = 0; # 0 for "+" strand (OT)
8603 }
8604 elsif ($read_conversion eq 'GA' and $genome_conversion eq 'GA'){
8605 $flag = 16; # 16 for "-" strand (CTOB, yields information for the original bottom strand)
8606 }
8607 else{
8608 die "Unexpected strand and read/genome conversion: strand: $strand, read conversion: $read_conversion, genome_conversion: $genome_conversion\n\n";
8609 }
8610 }
8611 elsif ($strand eq "-"){
8612 if ($read_conversion eq 'CT' and $genome_conversion eq 'GA'){
8613 $flag = 16; # 16 for "-" strand (OB)
8614 }
8615 elsif ($read_conversion eq 'GA' and $genome_conversion eq 'CT'){
8616 $flag = 0; # 0 for "+" strand (CTOT, yields information for the original top strand)
8617 }
8618 else{
8619 die "Unexpected strand and read/genome conversion: strand: $strand, read conversion: $read_conversion, genome_conversion: $genome_conversion\n\n";
8620 }
8621 }
8622 else{
8623 die "Unexpected strand information: $strand\n\n";
8624 }
8625
8626 #####
8627
8628 my $mapq;
8629
8630 if ($bowtie2){
8631 $mapq = $methylation_call_params->{$id}->{mapq};
8632 }
8633 else{
8634 $mapq = 255; # Mapping quality is unavailable for use with Bowtie
8635 }
8636
8637 #####
8638
8639 my $cigar;
8640 if ($bowtie2){
8641 $cigar = $methylation_call_params->{$id}->{CIGAR}; # Actual CIGAR string reported by Bowtie 2
8642 }
8643 else{
8644 $cigar = length($actual_seq) . "M"; # Bowtie 1 output does not contain indels (only matches and mismatches)
8645 }
8646
8647 #####
8648
8649 my $rnext = "*"; # Paired-end variable
8650
8651 #####
8652
8653 my $pnext = 0; # Paired-end variable
8654
8655 #####
8656
8657 my $tlen = 0; # Paired-end variable
8658
8659 #####
8660
8661 if ($read_conversion eq 'CT'){
8662 $ref_seq = substr($ref_seq, 0, length($ref_seq) - 2); # Removes additional nucleotides from the 3' end. This only works for the original top or bottom strands
8663 }
8664 else{
8665 $ref_seq = substr($ref_seq, 2, length($ref_seq) - 2); # Removes additional nucleotides from the 5' end. This works for the complementary strands in non-directional libraries
8666 }
8667
8668 if ($strand eq '-'){
8669 $actual_seq = revcomp($actual_seq); # Sequence represented on the forward genomic strand
8670 $ref_seq = revcomp($ref_seq); # Required for comparison with actual sequence
8671 if ($cigar =~ /D/){
8672 $methylation_call_params->{$id}->{genomic_seq_for_MD_tag} = revcomp( $methylation_call_params->{$id}->{genomic_seq_for_MD_tag} );
8673 }
8674 $qual = reverse $qual; # if the sequence was reverse-complemented the quality string needs to be reversed as well
8675 }
8676
8677 #####
8678
8679 my $hemming_dist = hemming_dist($actual_seq,$ref_seq); # Edit distance to the reference, i.e. minimal number of one-nucleotide edits needed to transform the read string
8680 # into the reference string. hemming_dist()
8681 if ($bowtie2){
8682 $hemming_dist += $methylation_call_params->{$id}->{indels}; # Adding the number of inserted/deleted bases which we parsed while getting the genomic sequence
8683 }
8684
8685 my $NM_tag = "NM:i:$hemming_dist"; # Optional tag NM: edit distance based on nucleotide differences
8686
8687 #####
8688
8689 my $MD_tag = make_mismatch_string($actual_seq, $ref_seq,$cigar,$methylation_call_params->{$id}->{genomic_seq_for_MD_tag}); # Optional tag MD: string providing mismatched reference bases in the alignment (this does include indel information)
8690 # my $XX_tag = make_mismatch_string($actual_seq, $ref_seq); # Optional tag XX: string providing mismatched reference bases in the alignment (NO indel information!)
8691
8692 #####
8693
8694 my $XM_tag; # Optional tag XM: Methylation Call String
8695 if ($strand eq '+'){
8696 $XM_tag = "XM:Z:$methcall";
8697 }
8698 elsif ($strand eq '-'){
8699 $XM_tag = 'XM:Z:'.reverse $methcall; # if the sequence was reverse-complemented the methylation call string needs to be reversed as well
8700 }
8701
8702 #####
8703
8704 my $XR_tag = "XR:Z:$read_conversion"; # Optional tag XR: Read Conversion
8705
8706 #####
8707
8708 my $XG_tag = "XG:Z:$genome_conversion"; # Optional tag XG: Genome Conversion
8709
8710 #####
8711
8712 # Optionally calculating number of mismatches for Bowtie 2 alignments
8713
8714 if ($non_bs_mm) {
8715 if ($bowtie2) {
8716
8717 $number_of_mismatches =~ s/-//; # removing the minus sign
8718
8719 ### if Bowtie 2 was used we need to analyse the CIGAR string whether the read contained any indels to determine the number of mismatches
8720 if ($cigar =~ /(D|I)/) {
8721 # warn "$cigar\n";
8722
8723 # parsing CIGAR string
8724 my @len = split (/\D+/,$cigar); # storing the length per operation
8725 my @ops = split (/\d+/,$cigar); # storing the operation
8726 shift @ops; # remove the empty first element
8727 die "CIGAR string contained a non-matching number of lengths and operations\n" unless (scalar @len == scalar @ops);
8728
8729 foreach (0..$#len) {
8730 if ($ops[$_] eq 'M') {
8731 # warn "skipping\n";
8732 next; # irrelevant
8733 }
8734 elsif ($ops[$_] eq 'I') { # insertion in the read sequence
8735 $number_of_mismatches -= $insertion_open;
8736 $number_of_mismatches -= $len[$_] * $insertion_extend;
8737 # warn "Insertion: Subtracting $ops[$_], length $len[$_], open: $insertion_open, extend: $insertion_extend\n";
8738 }
8739 elsif ($ops[$_] eq 'D') { # deletion in the read sequence
8740 $number_of_mismatches -= $deletion_open;
8741 $number_of_mismatches -= $len[$_] * $deletion_extend;
8742 # warn "Deletion: Subtracting $ops[$_], length $len[$_], open: $deletion_open, extend: $deletion_extend\n";
8743 }
8744 elsif ($cigar =~ tr/[NSHPX=]//) { # if these (for standard mapping) illegal characters exist we die
8745 die "The CIGAR string contained illegal CIGAR operations in addition to 'M', 'I' and 'D': $cigar\n";
8746 }
8747 else {
8748 die "The CIGAR string contained undefined CIGAR operations in addition to 'M', 'I' and 'D': $cigar\n";
8749 }
8750 }
8751 # warn "Alignment score $number_of_mismatches\n";
8752 # print "Mismatches $number_of_mismatches\n\n";
8753 }
8754 ### Now we have InDel corrected alignment scores
8755
8756 ### if the actual sequence contained Ns we need to adjust the number of mismatches. Ns receive a penalty of -1, but normal mismatches receive -6. This might still break if the
8757 ### sequence contained more than 5 Ns, but this should occur close to never
8758
8759 my $seq_N_count = $number_of_mismatches % 6; # modulo 6 will return the integer rest after the division
8760 # warn "N count: $seq_N_count\n";
8761 $number_of_mismatches = int ($number_of_mismatches / 6) + $seq_N_count;
8762 # warn "MM $number_of_mismatches\n";
8763 }
8764 }
8765
8766 ####
8767
8768 my $XA_tag = "XA:Z:$number_of_mismatches";
8769
8770 ####
8771
8772 my $read_group; # optional
8773 if ($rg_tag){
8774 $read_group = "RG:Z:$rg_id";
8775 }
8776
8777 ####
8778
8779 # SAM format: QNAME, FLAG, RNAME, 1-based POS, MAPQ, CIGAR, RNEXT, PNEXT, TLEN, SEQ, QUAL, optional fields
8780 ### optionally print number of non-bisulfite mismatches
8781 if ($non_bs_mm){
8782 if ($rg_tag){
8783 print OUT join("\t",($id,$flag,$chr,$start,$mapq,$cigar,$rnext,$pnext,$tlen,$actual_seq,$qual,$NM_tag,$MD_tag,$XM_tag,$XR_tag,$XG_tag,$XA_tag,$read_group)),"\n";
8784 }
8785 else{
8786 print OUT join("\t",($id,$flag,$chr,$start,$mapq,$cigar,$rnext,$pnext,$tlen,$actual_seq,$qual,$NM_tag,$MD_tag,$XM_tag,$XR_tag,$XG_tag,$XA_tag)),"\n";
8787 }
8788 }
8789 else{ # default
8790 # SAM format: QNAME, FLAG, RNAME, 1-based POS, MAPQ, CIGAR, RNEXT, PNEXT, TLEN, SEQ, QUAL, optional fields
8791 if ($rg_tag){
8792 print OUT join("\t",($id,$flag,$chr,$start,$mapq,$cigar,$rnext,$pnext,$tlen,$actual_seq,$qual,$NM_tag,$MD_tag,$XM_tag,$XR_tag,$XG_tag,$read_group)),"\n";
8793 }
8794 else{
8795 print OUT join("\t",($id,$flag,$chr,$start,$mapq,$cigar,$rnext,$pnext,$tlen,$actual_seq,$qual,$NM_tag,$MD_tag,$XM_tag,$XR_tag,$XG_tag)),"\n";
8796 }
8797 }
8798 }
8799
8800 sub paired_end_SAM_output{
8801
8802 my ($id,$actual_seq_1,$actual_seq_2,$methylation_call_params,$qual_1,$qual_2) = @_;
8803 my $strand_1 = $methylation_call_params->{$id}->{alignment_read_1}; # Bowtie 1 only reports the read 1 alignment strand
8804 my $strand_2 = $methylation_call_params->{$id}->{alignment_read_2};
8805 my $chr = $methylation_call_params->{$id}->{chromosome};
8806 my $ref_seq_1 = $methylation_call_params->{$id}->{unmodified_genomic_sequence_1};
8807 my $ref_seq_2 = $methylation_call_params->{$id}->{unmodified_genomic_sequence_2};
8808 my $methcall_1 = $methylation_call_params->{$id}->{methylation_call_1};
8809 my $methcall_2 = $methylation_call_params->{$id}->{methylation_call_2};
8810 my $read_conversion_1 = $methylation_call_params->{$id}->{read_conversion_1};
8811 my $read_conversion_2 = $methylation_call_params->{$id}->{read_conversion_2};
8812 my $genome_conversion = $methylation_call_params->{$id}->{genome_conversion};
8813
8814 my $id_1;
8815 my $id_2;
8816
8817 if ($old_flag){
8818 $id_1 = $id.'/1';
8819 $id_2 = $id.'/2';
8820 }
8821 else{
8822 $id_1 = $id; # appending /1 or /2 confuses some downstream programs such as Picard
8823 $id_2 = $id;
8824 }
8825
8826 # Allows all degenerate nucleotide sequences in reference genome
8827 # die "Reference sequence ($ref_seq_1) contains invalid nucleotides!\n" if $ref_seq_1 =~ /[^ACTGNRYMKSWBDHVX]/i; # X are padded nucleotides in case of insertions in the read
8828 # die "Reference sequence ($ref_seq_2) contains invalid nucleotides!\n" if $ref_seq_2 =~ /[^ACTGNRYMKSWBDHVX]/i;
8829
8830 my $index; # used to store the srand origin of the alignment in a less convoluted way
8831
8832 if ($read_conversion_1 eq 'CT' and $genome_conversion eq 'CT'){
8833 $index = 0; ## this is OT (original top strand)
8834 }
8835 elsif ($read_conversion_1 eq 'GA' and $genome_conversion eq 'GA'){
8836 $index = 1; ## this is CTOB (complementary to OB)
8837 }
8838 elsif ($read_conversion_1 eq 'GA' and $genome_conversion eq 'CT'){
8839 $index = 2; ## this is CTOT (complementary to OT)
8840 }
8841 elsif ($read_conversion_1 eq 'CT' and $genome_conversion eq 'GA'){
8842 $index = 3; ## this is OB (original bottom)
8843 }
8844 else {
8845 die "Unexpected combination of read 1 and genome conversion: $read_conversion_1 / $genome_conversion\n";
8846 }
8847
8848 my $number_of_mismatches_1;
8849 my $number_of_mismatches_2;
8850
8851 if ($bowtie2){ # Bowtie 2 reports always as read 1 then read 2, so this is fine
8852 $number_of_mismatches_1 = $methylation_call_params->{$id}->{alignment_score_1}; # only needed for custom allele-specific output, not the default!
8853 $number_of_mismatches_2 = $methylation_call_params->{$id}->{alignment_score_2};
8854 }
8855 else{ # Bowtie 1 reports always the leftmost read first. That means we have to reverse the strings if the first read aligned in reverse orientation
8856 if ($index == 2 or $index == 3){ # CTOT or OB
8857 $number_of_mismatches_1 = $methylation_call_params->{$id}->{number_of_mismatches_2}; # only needed for custom allele-specific output, not the default!
8858 $number_of_mismatches_2 = $methylation_call_params->{$id}->{number_of_mismatches_1};
8859 }
8860 else{ # if the first read aligned in forward direction it is like for Bowtie 2
8861 $number_of_mismatches_1 = $methylation_call_params->{$id}->{number_of_mismatches_1}; # only needed for custom allele-specific output, not the default!
8862 $number_of_mismatches_2 = $methylation_call_params->{$id}->{number_of_mismatches_2};
8863 }
8864 }
8865
8866
8867
8868 ### we need to remove 2 bp of the genomic sequence as we were extracting read + 2bp long fragments to make a methylation call at the
8869 ### first or last position.
8870
8871 if ($index == 0 or $index == 3){ # OT or OB
8872 $ref_seq_1 = substr($ref_seq_1,0,length($ref_seq_1)-2);
8873 $ref_seq_2 = substr($ref_seq_2,2,length($ref_seq_2)-2);
8874 }
8875 else{ # CTOT or CTOB
8876 $ref_seq_1 = substr($ref_seq_1,2,length($ref_seq_1)-2);
8877 $ref_seq_2 = substr($ref_seq_2,0,length($ref_seq_2)-2);
8878 }
8879
8880 #####
8881
8882 my $start_read_1;
8883 my $start_read_2;
8884 # adjusting end positions
8885
8886 if ($bowtie2){
8887 $start_read_1 = $methylation_call_params->{$id}->{position_1};
8888 $start_read_2 = $methylation_call_params->{$id}->{position_2};
8889 }
8890 else{ # Bowtie 1 output. $strand_1 stores the alignment of Read 1
8891 if ($strand_1 eq '+'){ # Read 1 aligns to the + strand
8892 $start_read_1 = $methylation_call_params->{$id}->{start_seq_1};
8893 $start_read_2 = $methylation_call_params->{$id}->{alignment_end} - length ($actual_seq_2) + 1;
8894 }
8895 else{ # read 1 is on the - strand
8896 $start_read_1 = $methylation_call_params->{$id}->{alignment_end} - length ($actual_seq_1) + 1;
8897 $start_read_2 = $methylation_call_params->{$id}->{start_seq_1};
8898 }
8899 }
8900
8901 #####
8902
8903 my $end_read_1;
8904 my $end_read_2;
8905 # adjusting end positions
8906
8907 if ($bowtie2){
8908 $end_read_1 = $methylation_call_params->{$id}->{end_position_1};
8909 $end_read_2 = $methylation_call_params->{$id}->{end_position_2};
8910 }
8911 else{ # Bowtie 1 output. $strand_1 stores the alignment of Read 1
8912 if ($strand_1 eq '+'){ # Read 1 aligns to the + strand
8913 $end_read_1 = $methylation_call_params->{$id}->{start_seq_1} + length ($actual_seq_1)-1;
8914 $end_read_2 = $methylation_call_params->{$id}->{alignment_end};
8915 }
8916 else{
8917 $end_read_1 = $methylation_call_params->{$id}->{alignment_end};
8918 $end_read_2 = $methylation_call_params->{$id}->{start_seq_1} + length ($actual_seq_2)-1;
8919 }
8920 }
8921
8922 #####
8923
8924 ### This is a description of the bitwise FLAG field which needs to be set for the SAM file taken from: "The SAM Format Specification (v1.4-r985), September 7, 2011"
8925 ## FLAG: bitwise FLAG. Each bit is explained in the following table:
8926 ## Bit Description Comment Value
8927 ## 0x1 template having multiple segments in sequencing 0: single-end 1: paired end value: 2^^0 ( 1)
8928 ## 0x2 each segment properly aligned according to the aligner true only for paired-end alignments value: 2^^1 ( 2)
8929 ## 0x4 segment unmapped --- ---
8930 ## 0x8 next segment in the template unmapped --- ---
8931 ## 0x10 SEQ being reverse complemented - strand alignment value: 2^^4 ( 16)
8932 ## 0x20 SEQ of the next segment in the template being reversed + strand alignment value: 2^^5 ( 32)
8933 ## 0x40 the first segment in the template read 1 value: 2^^6 ( 64)
8934 ## 0x80 the last segment in the template read 2 value: 2^^7 (128)
8935 ## 0x100 secondary alignment --- ---
8936 ## 0x200 not passing quality controls --- ---
8937 ## 0x400 PCR or optical duplicate --- ---
8938
8939 ### As the FLAG value do not consider that there might be 4 different bisulfite strands of DNA, we are trying to make FLAG tags which take the strand identity into account
8940
8941 # strands OT and CTOT will be treated as aligning to the top strand (both sequences are scored as aligning to the top strand)
8942 # strands OB and CTOB will be treated as aligning to the bottom strand (both sequences are scored as reverse complemented sequences)
8943
8944 my $flag_1; # FLAG variable used for SAM format
8945 my $flag_2;
8946
8947 ### The new default FLAG values were changed on 21 07 2015, so that reads do not ignored as discordant reads by the new SeqMonk BAM import
8948 ### In essence we are going to flip the R1 R2 flags around for CTOT and CTOB reads. We still report the first and second read in the same
8949 ### order and only change the actual FLAG value. This should not affect the methylation extraction in any way
8950
8951 if ($index == 0){ # OT
8952 unless ($old_flag){
8953 $flag_1 = 99; # Read 1 is on the + strand and Read 2 is reversed (1+2+32+64)
8954 $flag_2 = 147; # Read 2 is reverse complemented but informative for the OT (1+2+16+128)
8955 }
8956 else{
8957 $flag_1 = 67; # Read 1 is on the + strand (1+2+64) (Read 2 is technically reverse-complemented, but we do not score it)
8958 $flag_2 = 131; # Read 2 is on - strand but informative for the OT (1+2+128)
8959 }
8960 }
8961 elsif ($index == 1){ # CTOB
8962 unless($old_flag){
8963 $flag_1 = 163; # Read 1 is on the forward strand (CTOB) and Read 2 is reverse complemented but we swap round the FLAG
8964 # for R1 and R2 so that we don't end up with discordant pairs
8965 # So Read 1 gets Paired read, mapped in proper pair, mate is reversed and second in pair (1+2+32+128)
8966 $flag_2 = 83; # Read 2 gets Read paired, mapped in proper pair, first in pair and Read 2 is reversed (1+2+16+64)
8967 }
8968 else{
8969 $flag_1 = 115; # Read 1 is on the + strand, we score for OB (1+2+16+32+64)
8970 $flag_2 = 179; # Read 2 is on the - strand (1+2+16+32+128)
8971 }
8972 }
8973 elsif ($index == 2){ # CTOT
8974 unless ($old_flag){
8975 $flag_1 = 147; # Read 1 is reverse complemented (CTOT) and Read 2 is the forward read
8976 # but we swap round the FLAG for R1 and R2 so that we do not end up with discordant pairs
8977 # So Read 1 gets Read paired, read mapped in proper pair, read reverse complemented and second in pair (1+2+32+128)
8978 $flag_2 = 99; # Read 2 gets Read paired, read mapped in proper pair, mate reverse strand and First in Pair (1+2+32+64)
8979 }
8980 else{
8981 $flag_1 = 67; # Read 1 is on the - strand (CTOT) strand, but we score it for OT (1+2+64)
8982 $flag_2 = 131; # Read 2 is on the + strand, score it for OT (1+2+128)
8983 }
8984 }
8985 elsif ($index == 3){ # OB
8986 unless ($old_flag){
8987 $flag_1 = 83; # Read 1 is on the - strand, mapped in proper pair and Read 1 is reversed (1+2+16+64)
8988 $flag_2 = 163; # Read 2 is on the - strand, mapped in proper pair and Read 1 is reversed (1+2+32+128)
8989 }
8990 else{
8991 $flag_1 = 115; # Read 1 is on the - strand, we score for OB (1+2+16+32+64)
8992 $flag_2 = 179; # Read 2 is on the + strand (1+2+16+32+128)
8993 }
8994 }
8995
8996 #####
8997
8998 my $mapq;
8999
9000 if ($bowtie2){
9001 $mapq = $methylation_call_params->{$id}->{mapq};
9002 }
9003 else{
9004 $mapq = 255; # Mapping quality is unavailable for use with Bowtie
9005 }
9006
9007 #####
9008
9009 my $cigar_1;
9010 my $cigar_2;
9011
9012 if ($bowtie2){
9013 $cigar_1 = $methylation_call_params->{$id}->{CIGAR_1}; # Actual CIGAR string reported by Bowtie 2
9014 $cigar_2 = $methylation_call_params->{$id}->{CIGAR_2};
9015 }
9016 else{
9017 $cigar_1 = length($actual_seq_1) . "M"; # Assume no indels for Bowtie 1 mapping (only matches and mismatches)
9018 $cigar_2 = length($actual_seq_2) . "M";
9019 }
9020
9021 #####
9022
9023 my $rnext = '='; # Chromosome of mate; applies to both reads
9024
9025 #####
9026
9027 my $pnext_1 = $start_read_2; # Leftmost position of mate
9028 my $pnext_2 = $start_read_1;
9029
9030 #####
9031
9032 my $tlen_1; # signed observed Template LENgth (or inferred fragment size)
9033 my $tlen_2;
9034
9035 if ($bowtie2){
9036
9037 if ($start_read_1 <= $start_read_2){
9038
9039 # Read 1 alignment is leftmost
9040
9041 if ($end_read_2 >= $end_read_1){
9042
9043 if ($flag_1 == 83 and $dovetail){ # R1 has a reverse orientation
9044 # -----------------> read 2 reads are dovetailing, that is one mate alignment extends past the beginning of the other
9045 # <------------------- read 1 such that the wrong mate begins upstream
9046 # warn "FLAG 1: $flag_1\nFLAG 2: $flag_2\n";
9047 # warn "Reads are dovetailing\n";
9048 $tlen_1 = $start_read_1 - $end_read_2 - 1; # Read 1 still receives a - sign even though it is the leftmost one
9049 $tlen_2 = $end_read_2 - $start_read_1 + 1; # Read 2 receives a + sign,
9050 # warn "TLEN 1: $tlen_1\nTLEN 2: $tlen_2\n";
9051 }
9052 else{
9053 # -------------> read 1 reads not overlapping
9054 # <---------- read 2
9055 # or
9056 # -------------------> read 1 reads overlapping
9057 # <------------------- read 2
9058 # or
9059 # -------------------------> read 1
9060 # <----------------------- read 2 read 2 contained within read 1
9061 # or
9062 # -------------------------> read 1 reads 1 and 2 exactly overlapping
9063 # <------------------------- read 2
9064 #
9065
9066 $tlen_1 = $end_read_2 - $start_read_1 + 1; # Leftmost read has a + sign,
9067 $tlen_2 = $start_read_1 - $end_read_2 - 1; # Rightmost read has a - sign
9068 # warn "Reads are non/overlapping\nTLEN 1: $tlen_1\nTLEN 2: $tlen_2\n";
9069 }
9070 }
9071 elsif ($end_read_2 < $end_read_1){
9072
9073 # -------------------------> read 1
9074 # <----------- read 2 read 2 contained within read 1
9075 #
9076 # or
9077 #
9078 # -------------------------> read 1
9079 # <------------------------ read 2 read 2 contained within read 1
9080
9081 # start and end of read 2 are fully contained within read 1, using the length of read 1 for the TLEN variable
9082 $tlen_1 = $end_read_1 - $start_read_1 + 1; # Set to length of read 1 Leftmost read has a + sign,
9083 $tlen_2 = ($end_read_1 - $start_read_1 + 1) * -1; # Set to length of read 1 Rightmost read has a - sign. well this is debatable. Changed this
9084 ### as a request by frozenlyse on SeqAnswers on 24 July 2013
9085 }
9086
9087 }
9088
9089 elsif ($start_read_2 < $start_read_1){
9090
9091 # Read 2 alignment is leftmost
9092
9093 if ($end_read_1 >= $end_read_2){
9094
9095 # Read 2 alignment is leftmost
9096 if ($flag_1 == 99 and $dovetail){ # R1 has a forward orientation
9097
9098 # -----------------> read 1 reads are dovetailing, that is one mate alignment extends past the beginning of the other
9099 # <------------------- read 2 such that the wrong mate begins upstream
9100
9101 # warn "FLAG 1: $flag_1\nFLAG 2: $flag_2\n";
9102 # warn "Reads are dovetailing\n";
9103 $tlen_1 = $end_read_1 - $start_read_2 + 1; # Read 1 still receives a + sign even though it is not leftmost
9104 $tlen_2 = $start_read_2 - $end_read_1 - 1;
9105 # warn "TLEN 1: $tlen_1\nTLEN 2: $tlen_2\n";
9106 }
9107 else{
9108 # -------------> read 2 reads not overlapping
9109 # <---------- read 1
9110 # or
9111 # -------------------------> read 2 reads overlapping
9112 # <------------------------- read 1
9113 # or
9114 # -------------------------> read 2
9115 # <----------------------- read 1 read 1 contained within read 2
9116 # or
9117 # -------------------------> read 2
9118 # <----------------------- read 1 read 1 contained within read 2
9119 # warn "FLAG 1: $flag_1\nFLAG 2: $flag_2\n";
9120 # warn "Read 2 has a forward orientation\n";
9121 $tlen_2 = $end_read_1 - $start_read_2 + 1; # Leftmost read has a + sign,
9122 $tlen_1 = $start_read_2 - $end_read_1 - 1; # Rightmost read has a - sign
9123 }
9124 }
9125 elsif ($end_read_1 < $end_read_2){
9126
9127 # -------------------------> read 2
9128 # <----------- read 1 read 1 contained within read 2
9129 #
9130 # or
9131 #
9132 # -------------------------> read 2
9133 # <------------------------ read 1 read 1 contained within read 2
9134
9135 # start and end of read 1 are fully contained within read 2, using the length of read 2 for the TLEN variable
9136 $tlen_1 = ($end_read_2 - $start_read_2 + 1) * -1; # Set to length of read 2 Shorter read receives a - sign,
9137 $tlen_2 = $end_read_2 - $start_read_2 + 1; # Set to length of read 2 Longer read receives a +. Well this is debatable. Changed this
9138 ### as a request by frozenlyse on SeqAnswers on 24 July 2013
9139 }
9140 }
9141 }
9142
9143 else{ # Bowtie 1
9144
9145 if ($end_read_2 >= $end_read_1){
9146 # Read 1 alignment is leftmost
9147 # -------------------------> read 1
9148 # <------------------------- read 2
9149 # this is the most extreme case for Bowtie 1 alignments, reads do not contain each other, also no dovetailing
9150
9151 $tlen_1 = $end_read_2 - $start_read_1 + 1; # Leftmost read has a + sign,
9152 $tlen_2 = $start_read_1 - $end_read_2 - 1; # Rightmost read has a - sign
9153 }
9154 else{
9155 # Read 2 alignment is leftmost
9156 # -------------------------> read 2
9157 # <------------------------- read 1
9158 # this is the most extreme case for Bowtie 1 alignments, reads do not contain each other, also no dovetailing
9159
9160 $tlen_2 = $end_read_1 - $start_read_2 + 1; # Leftmost read has a + sign,
9161 $tlen_1 = $start_read_2 - $end_read_1 - 1; # Rightmost read has a - sign
9162 }
9163 }
9164
9165 #####
9166
9167 # adjusting the strand of the sequence before we use them to generate mismatch strings
9168 if ($strand_1 eq '-'){
9169 $actual_seq_1 = revcomp($actual_seq_1); # Sequence represented on the forward genomic strand
9170 $ref_seq_1 = revcomp($ref_seq_1); # Required for comparison with actual sequence
9171 if ($cigar_1 =~ /D/){
9172 $methylation_call_params->{$id}->{genomic_seq_for_MD_tag_1} = revcomp( $methylation_call_params->{$id}->{genomic_seq_for_MD_tag_1} );
9173 }
9174 $qual_1 = reverse $qual_1; # we need to reverse the quality string as well
9175 }
9176 if ($strand_2 eq '-'){
9177 $actual_seq_2 = revcomp($actual_seq_2); # Mate sequence represented on the forward genomic strand
9178 $ref_seq_2 = revcomp($ref_seq_2); # Required for comparison with actual sequence
9179 if ($cigar_2 =~ /D/){
9180 $methylation_call_params->{$id}->{genomic_seq_for_MD_tag_2} = revcomp( $methylation_call_params->{$id}->{genomic_seq_for_MD_tag_2} );
9181 }
9182 $qual_2 = reverse $qual_2; # If the sequence gets reverse complemented we reverse the quality string as well
9183 }
9184
9185 # print "$actual_seq_1\n$ref_seq_1\n\n";
9186 # print "$actual_seq_2\n$ref_seq_2\n\n";
9187
9188 #####
9189
9190 my $hemming_dist_1 = hemming_dist($actual_seq_1,$ref_seq_1); # Minimal number of one-nucleotide edits needed to transform the read string into the reference sequence
9191 my $hemming_dist_2 = hemming_dist($actual_seq_2,$ref_seq_2);
9192 if ($bowtie2){
9193 $hemming_dist_1 += $methylation_call_params->{$id}->{indels_1}; # Adding the number of inserted/deleted bases which we parsed while getting the genomic sequence
9194 $hemming_dist_2 += $methylation_call_params->{$id}->{indels_2}; # Adding the number of inserted/deleted bases which we parsed while getting the genomic sequence
9195 }
9196 my $NM_tag_1 = "NM:i:$hemming_dist_1"; # Optional tag NM: edit distance based on nucleotide differences
9197 my $NM_tag_2 = "NM:i:$hemming_dist_2"; # Optional tag NM: edit distance based on nucleotide differences
9198
9199 #####
9200
9201 my $MD_tag_1 = make_mismatch_string($actual_seq_1,$ref_seq_1,$cigar_1,$methylation_call_params->{$id}->{genomic_seq_for_MD_tag_1}); # Optional tag MD: String providing mismatched reference bases in the alignment (including indel information)
9202 my $MD_tag_2 = make_mismatch_string($actual_seq_2,$ref_seq_2,$cigar_2,$methylation_call_params->{$id}->{genomic_seq_for_MD_tag_2});
9203
9204 # my $XX_tag_1 = make_mismatch_string($actual_seq_1,$ref_seq_1); # Optional tag XX: String providing mismatched reference bases in the alignment (NO indel information!)
9205 # my $XX_tag_2 = make_mismatch_string($actual_seq_2,$ref_seq_2);
9206
9207 #####
9208
9209 my $XM_tag_1; # Optional tag XM: Methylation call string
9210 my $XM_tag_2;
9211
9212 if ($strand_1 eq '-'){
9213 $XM_tag_1 = 'XM:Z:'.reverse $methcall_1; # Needs to be reversed if the sequence was reverse complemented
9214 }
9215 else{
9216 $XM_tag_1 = "XM:Z:$methcall_1";
9217 }
9218
9219 if ($strand_2 eq '-'){
9220 $XM_tag_2 = 'XM:Z:'.reverse $methcall_2; # Needs to be reversed if the sequence was reverse complemented
9221 }
9222 else{
9223 $XM_tag_2 = "XM:Z:$methcall_2";
9224 }
9225
9226 #####
9227
9228 my $XR_tag_1 = "XR:Z:$read_conversion_1"; # Optional tag XR: Read 1 conversion state
9229 my $XR_tag_2 = "XR:Z:$read_conversion_2"; # Optional tag XR: Read 2 conversion state
9230
9231 #####
9232
9233 my $XG_tag = "XG:Z:$genome_conversion"; # Optional tag XG: Genome Conversion state; valid for both reads
9234
9235 #####
9236
9237 # Optionally calculating number of mismatches for Bowtie 2 alignments
9238
9239 if ($non_bs_mm) {
9240 if ($bowtie2) {
9241
9242 $number_of_mismatches_1 =~ s/-//; # removing the minus sign
9243 $number_of_mismatches_2 =~ s/-//;
9244
9245 ### if Bowtie 2 was used we need to analyse the CIGAR strings whether the reads contained any indels to determine the number of mismatches
9246
9247 ### CIGAR 1
9248 if ($cigar_1 =~ /(D|I)/) {
9249 # warn "$cigar_1\n";
9250
9251 # parsing CIGAR string
9252 my @len = split (/\D+/,$cigar_1); # storing the length per operation
9253 my @ops = split (/\d+/,$cigar_1); # storing the operation
9254 shift @ops; # remove the empty first element
9255 die "CIGAR string '$cigar_1' contained a non-matching number of lengths and operations\n" unless (scalar @len == scalar @ops);
9256
9257 foreach (0..$#len) {
9258 if ($ops[$_] eq 'M') {
9259 # warn "skipping\n";
9260 next; # irrelevant
9261 }
9262 elsif ($ops[$_] eq 'I') { # insertion in the read sequence
9263 $number_of_mismatches_1 -= $insertion_open;
9264 $number_of_mismatches_1 -= $len[$_] * $insertion_extend;
9265 # warn "Insertion: Subtracting $ops[$_], length $len[$_], open: $insertion_open, extend: $insertion_extend\n";
9266 }
9267 elsif ($ops[$_] eq 'D') { # deletion in the read sequence
9268 $number_of_mismatches_1 -= $deletion_open;
9269 $number_of_mismatches_1 -= $len[$_] * $deletion_extend;
9270 # warn "Deletion: Subtracting $ops[$_], length $len[$_], open: $deletion_open, extend: $deletion_extend\n";
9271 }
9272 elsif ($cigar_1 =~ tr/[NSHPX=]//) { # if these (for standard mapping) illegal characters exist we die
9273 die "The CIGAR string contained illegal CIGAR operations in addition to 'M', 'I' and 'D': $cigar_1\n";
9274 }
9275 else {
9276 die "The CIGAR string contained undefined CIGAR operations in addition to 'M', 'I' and 'D': $cigar_1\n";
9277 }
9278 }
9279
9280 # warn "Alignment score $number_of_mismatches_1\n";
9281 # print "Mismatches $number_of_mismatches_1\n\n";
9282 }
9283
9284 ### CIGAR 2
9285 if ($cigar_2 =~ /(D|I)/) {
9286 # warn "$cigar_2\n";
9287
9288 # parsing CIGAR string
9289 my @len = split (/\D+/,$cigar_2); # storing the length per operation
9290 my @ops = split (/\d+/,$cigar_2); # storing the operation
9291 shift @ops; # remove the empty first element
9292 die "CIGAR string '$cigar_2' contained a non-matching number of lengths and operations\n" unless (scalar @len == scalar @ops);
9293
9294 foreach (0..$#len) {
9295 if ($ops[$_] eq 'M') {
9296 # warn "skipping\n";
9297 next; #irrelevant
9298 }
9299 elsif ($ops[$_] eq 'I') { # insertion in the read sequence
9300 $number_of_mismatches_2 -= $insertion_open;
9301 $number_of_mismatches_2 -= $len[$_] * $insertion_extend;
9302 # warn "Insertion: Subtracting $ops[$_], length $len[$_], open: $insertion_open, extend: $insertion_extend\n";
9303 }
9304 elsif ($ops[$_] eq 'D') { # deletion in the read sequence
9305 $number_of_mismatches_2 -= $deletion_open;
9306 $number_of_mismatches_2 -= $len[$_] * $deletion_extend;
9307 # warn "Deletion: Subtracting $ops[$_], length $len[$_], open: $deletion_open, extend: $deletion_extend\n";
9308 }
9309 elsif ($cigar_2 =~ tr/[NSHPX=]//) { # if these (for standard mapping) illegal characters exist we die
9310 die "The CIGAR string contained illegal CIGAR operations in addition to 'M', 'I' and 'D': $cigar_2\n";
9311 }
9312 else {
9313 die "The CIGAR string contained undefined CIGAR operations in addition to 'M', 'I' and 'D': $cigar_2\n";
9314 }
9315 }
9316 }
9317
9318 ### Now we have InDel corrected Alignment scores
9319
9320 ### if the actual sequence contained Ns we need to adjust the number of mismatches. Ns receive a penalty of -1, but normal mismatches receive -6. This might still break if the
9321 ### sequence contained more than 5 Ns, but this should occur close to never
9322
9323 my $seq_1_N_count = $number_of_mismatches_1 % 6; # modulo 6 will return the integer rest after the division
9324 my $seq_2_N_count = $number_of_mismatches_2 % 6;
9325 # warn "N count 1: $seq_1_N_count\n";
9326 # warn "N count 2: $seq_2_N_count\n";
9327
9328 $number_of_mismatches_1 = int ($number_of_mismatches_1 / 6) + $seq_1_N_count;
9329 $number_of_mismatches_2 = int ($number_of_mismatches_2 / 6) + $seq_2_N_count;
9330
9331 # warn "MM1 $number_of_mismatches_1 \n";
9332 # warn "MM2 $number_of_mismatches_2 \n";
9333 }
9334 }
9335
9336 ####
9337
9338 my $XA_tag = "XA:Z:$number_of_mismatches_1";
9339 my $XB_tag = "XB:Z:$number_of_mismatches_2";
9340
9341 ####
9342
9343 my $read_group; # optional
9344 if ($rg_tag){
9345 $read_group = "RG:Z:$rg_id";
9346 }
9347
9348 ####
9349
9350 # SAM format: QNAME, FLAG, RNAME, 1-based POS, MAPQ, CIGAR, RNEXT, PNEXT, TLEN, SEQ, QUAL, optional fields
9351 ### optionally print number of non-bisulfite mismatches
9352 if ($non_bs_mm){
9353 if ($rg_tag){
9354 print OUT join("\t", ($id_1, $flag_1, $chr, $start_read_1, $mapq, $cigar_1, $rnext, $pnext_1, $tlen_1, $actual_seq_1, $qual_1, $NM_tag_1, $MD_tag_1, $XM_tag_1,$XR_tag_1,$XG_tag,$XA_tag,$read_group)), "\n";
9355 print OUT join("\t", ($id_2, $flag_2, $chr, $start_read_2, $mapq, $cigar_2, $rnext, $pnext_2, $tlen_2, $actual_seq_2, $qual_2, $NM_tag_2, $MD_tag_2, $XM_tag_2,$XR_tag_2,$XG_tag,$XB_tag,$read_group)), "\n";
9356 }
9357 else{
9358 print OUT join("\t", ($id_1, $flag_1, $chr, $start_read_1, $mapq, $cigar_1, $rnext, $pnext_1, $tlen_1, $actual_seq_1, $qual_1, $NM_tag_1, $MD_tag_1, $XM_tag_1,$XR_tag_1,$XG_tag,$XA_tag)), "\n";
9359 print OUT join("\t", ($id_2, $flag_2, $chr, $start_read_2, $mapq, $cigar_2, $rnext, $pnext_2, $tlen_2, $actual_seq_2, $qual_2, $NM_tag_2, $MD_tag_2, $XM_tag_2,$XR_tag_2,$XG_tag,$XB_tag)), "\n";
9360 }
9361 }
9362 else{ # default
9363 if ($rg_tag){
9364 print OUT join("\t", ($id_1, $flag_1, $chr, $start_read_1, $mapq, $cigar_1, $rnext, $pnext_1, $tlen_1, $actual_seq_1, $qual_1, $NM_tag_1, $MD_tag_1, $XM_tag_1,$XR_tag_1,$XG_tag,$read_group)), "\n";
9365 print OUT join("\t", ($id_2, $flag_2, $chr, $start_read_2, $mapq, $cigar_2, $rnext, $pnext_2, $tlen_2, $actual_seq_2, $qual_2, $NM_tag_2, $MD_tag_2, $XM_tag_2,$XR_tag_2,$XG_tag,$read_group)), "\n";
9366 }
9367 else{
9368 print OUT join("\t", ($id_1, $flag_1, $chr, $start_read_1, $mapq, $cigar_1, $rnext, $pnext_1, $tlen_1, $actual_seq_1, $qual_1, $NM_tag_1, $MD_tag_1, $XM_tag_1,$XR_tag_1,$XG_tag)), "\n";
9369 print OUT join("\t", ($id_2, $flag_2, $chr, $start_read_2, $mapq, $cigar_2, $rnext, $pnext_2, $tlen_2, $actual_seq_2, $qual_2, $NM_tag_2, $MD_tag_2, $XM_tag_2,$XR_tag_2,$XG_tag)), "\n";
9370 }
9371 }
9372 }
9373
9374
9375 sub revcomp{
9376 my $seq = shift or die "Missing seq to reverse complement\n";
9377 $seq = reverse $seq;
9378 $seq =~ tr/ACTGactg/TGACTGAC/;
9379 return $seq;
9380 }
9381
9382 sub hemming_dist{
9383 my $matches = 0;
9384 my @actual_seq = split //,(shift @_);
9385 my @ref_seq = split //,(shift @_);
9386
9387 foreach (0..$#actual_seq){
9388 ++$matches if ($actual_seq[$_] eq $ref_seq[$_]);
9389 }
9390 return my $hd = scalar @actual_seq - $matches;
9391 }
9392
9393
9394 ### Getting rid of the bitwise comparison because even though the initial comparison is nice and quick, the regex loop looking for non-null bytes characters isn't. We might
9395 ### as well do a substring loop to start with, which enables us to generate proper MD:Z: flags that also take proper care of InDels
9396 ### 05 June 2014
9397
9398
9399 sub make_mismatch_string{
9400 my ($actual_seq,$ref_seq,$cigar,$md_sequence) = @_;
9401
9402 my $MD_tag = "MD:Z:";
9403 my $prev_matching = 0;
9404 my $last_char;
9405
9406 my $ref_base;
9407 my $actual_base;
9408
9409 foreach my $pos ( 0..(length$actual_seq) - 1 ){
9410
9411 $actual_base = substr($actual_seq,$pos,1);
9412 $ref_base = substr($ref_seq,$pos,1);
9413 # if ($verbose){ warn "reference: $ref_base\tseen base: $actual_base\n";}
9414
9415 if ( $actual_base eq $ref_base ){
9416 ++$prev_matching;
9417 }
9418 else{
9419 # If the mismatch is due to an insertion we simply move on, else we print the previously matching bases as well as the mismatching genomic base
9420 if ($ref_base eq 'X'){
9421 # if ($verbose){ warn "The genome base was an artificually padded '$ref_base' due to an insertion in the read at this position. Just ignoring it for the MD tag\n"; sleep(1);}
9422 }
9423 else{
9424 # if ($verbose){ warn "previous matching bases: $prev_matching\n";}
9425
9426 ### There is a mismatch between the sequence and the genome. First we need to write out how may bases matched until now
9427 if ($prev_matching == 0){
9428 # if ($verbose){ warn "Got a mismatch either at the very start or next to another mismatch. Need to add a padding 0 as well as the mismatch\n";}
9429 # if ($verbose){ warn "${prev_matching}$ref_base\n";}
9430 $MD_tag .= $prev_matching;
9431 $MD_tag .= $ref_base;
9432 }
9433 else{
9434 # if ($verbose){ warn "${prev_matching}$ref_base\n";}
9435 $MD_tag .= $prev_matching;
9436 $MD_tag .= $ref_base;
9437 }
9438
9439 $prev_matching = 0; # resetting $prev_matching
9440 }
9441
9442 }
9443
9444 }
9445 ### appending the number of matches one last time
9446 $MD_tag .= $prev_matching;
9447
9448
9449 ### If the read contains deletion(s) we need to take care of these in the MD-tag as well
9450 if ($cigar =~ /D/){
9451 my $deletions_total = 0;
9452 while ($cigar =~ /D/g){
9453 ++$deletions_total;
9454 }
9455 if ($verbose){ warn "Read contains $deletions_total deletions in total\n\n";}
9456
9457 if ($verbose){ warn "There was a deletion in the read!\n";}
9458 if ($verbose){ warn "actual:\t$actual_seq\nref:\t$ref_seq\nMD-seq:\t$md_sequence\nMD-tag: $MD_tag\n";}
9459
9460 # parsing CIGAR string
9461 my @len = split (/\D+/,$cigar); # storing the length per operation
9462 my @ops = split (/\d+/,$cigar); # storing the operation
9463 shift @ops; # remove the empty first element
9464 die "CIGAR string contained a non-matching number of lengths and operations\n" unless (scalar @len == scalar @ops);
9465
9466 my $MD_pos_so_far = 0;
9467 my $deletions_processed = 0;
9468 my $del_pos = 0;
9469 my $deleted_bases = '';
9470 my $new_MD = $1 if ($MD_tag =~ /MD:Z:(.*)/);
9471 my $md_index_already_processed;
9472
9473 my @md = split //,$new_MD;
9474
9475 if ($verbose){ warn "New MD-tag: $new_MD\n\n";}
9476 $MD_tag = "MD:Z:"; ### reconstituting a new MD-tag
9477 $new_MD = ''; # using this to build up a new string that will replace the old \@md
9478
9479 if ($verbose){ warn "CIGAR string; $cigar\n";}
9480 ### determining end position of a read
9481 foreach my $index(0..$#len){
9482
9483 if ($ops[$index] eq 'M'){ # matching bases
9484 $del_pos += $len[$index];
9485 if ($verbose){ warn "Operation is 'M', adding $len[$index] bp\n";}
9486 }
9487 elsif($ops[$index] eq 'I'){ # insertion
9488 $del_pos += $len[$index];
9489 ### need to add insertions in the read to MD pos so far!
9490 $MD_pos_so_far += $len[$index];
9491 if ($verbose){ warn "Operation is 'I', adding $len[$index] bp\n";}
9492 }
9493 elsif($ops[$index] eq 'D'){ # deletion
9494 if ($verbose){ warn "Operation is 'D', extracting $len[$index] bp\n";}
9495 $deleted_bases = substr($md_sequence,$del_pos,$len[$index]);
9496 if ($verbose){ warn "Deleted bases: $deleted_bases\n\n";}
9497
9498 ### Now we need to process the MD-tag so far and write out everything up until this point, inlcuding the deletion
9499 if ($verbose){ warn "Now processing the MD-tag\n";}
9500 my $op;
9501
9502 my $this_deletion_processed;
9503 my $md_processed_so_far;
9504 my $current_md_index;
9505
9506 foreach my $el (@md){
9507
9508 unless (defined $current_md_index){
9509 $current_md_index = 0; # first element = index 0
9510 }
9511 else{
9512 ++$current_md_index;
9513 }
9514
9515 if ($md_index_already_processed and ($current_md_index <= $md_index_already_processed)){
9516 if ($verbose){ warn "This has to be another deletion within the same read. Currently processing index $current_md_index, but have already processed $md_index_already_processed indexes previously\n";}
9517 $new_MD .= $el;
9518 next;
9519 }
9520
9521 if ($verbose){ warn "Current element: $el\n";}
9522 unless (defined $op){ # initialize
9523 $op = $el;
9524 if ($verbose){ warn "Initializing \$op as $op\n";}
9525 next;
9526 }
9527
9528 if ($deletions_processed == $deletions_total){
9529 if ($verbose){ warn "Processed $deletions_processed in the read so far, out of $deletions_total total. Just appending elements until the end of the string: here $el\n";}
9530 $MD_tag .= $el;
9531 $new_MD .= $el;
9532 next;
9533 }
9534 # this only occurs when there are more deletions in the read but we want to regenerate a new MD tag
9535 if ($this_deletion_processed){
9536 $new_MD .= $el;
9537 next;
9538 }
9539
9540 if ($op =~ /^\d+$/){
9541 if ($verbose){ warn "Operation so far was a digit: $op\n";}
9542 if ($el =~ /\d/){
9543 $op .= $el;
9544 if ($verbose){ warn "Appending current operation $el. New operation is: $op\n";}
9545 next;
9546 }
9547 else{
9548 if ($verbose){ warn "current element is a word character: $el\n";}
9549
9550 ### Need to determine if the matching operation length includes the deletion position
9551 if ($verbose){ warn "Processing operation $op and adding it to MD pos which is so far: $MD_pos_so_far; deletion pos is $del_pos.\n";}
9552 $MD_pos_so_far += $op;
9553 if ($verbose){ warn "MD pos so far: $MD_pos_so_far\n";}
9554 if ($MD_pos_so_far < $del_pos){
9555 if ($verbose){ warn "Doesn't cover the deletion yet. Writing back out.\n";}
9556 $MD_tag .= $op;
9557 $new_MD .= $op;
9558 if ($verbose){ warn "Setting new operation to: $el\n";}
9559 $op = $el; # setting new $op
9560 }
9561 else{
9562 if ($verbose){ warn "Here we go, this operation covers the deletion position!!\n";}
9563 ### splitting up the number of matching bases in number before and after the deletion
9564
9565 my $pos_after_deletion = $MD_pos_so_far - $del_pos;
9566 my $pos_before_deletion = $op - $pos_after_deletion;
9567 if ($verbose){ warn "Splitting up previous operation '$op' into pos before deletion: ${pos_before_deletion} and pos_after_deletion: $pos_after_deletion\n";}
9568 $MD_tag .= "${pos_before_deletion}^${deleted_bases}";
9569 $new_MD .= "${pos_before_deletion}^${deleted_bases}${pos_after_deletion}";
9570 if ($verbose){ warn "\$newMD after adjusting for the current deletion: $new_MD\n";}
9571
9572 #adjusting the MD_position by the number of bases after the deletion
9573 $MD_pos_so_far -= $pos_after_deletion;
9574 if ($verbose){ warn "MD after adjusting for deletion: $MD_pos_so_far\n"; }
9575 ### also appending the current element because we are writing out the rest of the MD-string unchanged to $new_MD
9576 $new_MD .= $el;
9577
9578 $deletions_processed += 1;
9579 $this_deletion_processed = 1;
9580
9581 if ($deletions_processed == $deletions_total){ # this was the last deletion of the read
9582 if ($verbose){ warn "This was the last deletion in the read ($deletions_processed out of $deletions_total total). Continuing to append \$pos_after_deletion (${pos_after_deletion})..\n";}
9583 $MD_tag .= "${pos_after_deletion}";
9584
9585 ### also appending the current element because we are writing out the rest of the MD-string unchanged
9586 if ($verbose){ warn "also appending the current element $el\n";}
9587 $MD_tag .= $el;
9588 ### Finally also adding the length of the deletion to $del_pos
9589 $del_pos += $len[$index];
9590 if ($verbose){ warn "Adding length of the deletion itself (",$len[$index],") to \$del_pos: currently at $del_pos\n";}
9591 }
9592 else{
9593 if ($verbose){ warn "This wasn't the last deletion in the read. Substituting the last operation with the current deletion and reconstituting \@md\n";}
9594 if ($verbose){ warn "Adding length of deletion string '${pos_before_deletion}^${deleted_bases}' (",length("${pos_before_deletion}^${deleted_bases}")," - length of current operation (",length$op,") to current_md_index\n";}
9595
9596
9597 ### This migh need looking at!!
9598
9599 $current_md_index = $current_md_index + length("${pos_before_deletion}^${deleted_bases}") - length$op;
9600 if ($verbose){ warn "Current index = $current_md_index\n";}
9601
9602 if ($verbose){ warn "Setting \$md_index_already_processed to ",$current_md_index-1,"\n";}
9603 $md_index_already_processed = $current_md_index - 1;
9604
9605 if ($verbose){ warn "Exiting now and waiting for the next deletion\n";}
9606
9607 ### Finally also adding the length of the deletion to $del_pos
9608 $del_pos += $len[$index];
9609 $MD_pos_so_far += $len[$index];
9610 if ($verbose){ warn "Adding length of the deletion itself (",$len[$index],") to \$del_pos: currently at $del_pos\n";}
9611 if ($verbose){ warn "MD-tag so far: $MD_tag ~~\n";}
9612 #setting $op to en empty string so it is not being processed as the last element
9613 $op = '';
9614 # last; # exiting the loop and processing the CIGAR string further until we hit the next deletion
9615 }
9616 }
9617 }
9618 if ($verbose){ warn "MD-tag so far: $MD_tag ~~\n";}
9619 }
9620 else{
9621 if ($verbose){ warn "Operation so far was a word character: $op\n";}
9622 if ($el =~ /\d+/){
9623 # processing the previous mismatch position
9624 $MD_tag .= $op;
9625 $new_MD .= $op;
9626 $MD_pos_so_far += length($op);
9627 if ($verbose){ warn "Writing out mismatching base $op and adding length ",length($op),"\n";}
9628 }
9629 else{
9630 # this should never occur since mismatches are followed by a 0 or another digit
9631 die "current element is a another word character: $el. This should never happen!\n";
9632 }
9633 if ($verbose){ warn "Setting new operation to: $el\n";}
9634 $op = $el; # setting new $op
9635 if ($verbose){ warn "MD-tag so far: $MD_tag ~~\n";}
9636 }
9637 }
9638
9639 ### need to consider last element if it was a digit or number and we are expecting the deletion in the last element of the MD-tag
9640 if ($op =~ /\d+/ and $deletions_processed < $deletions_total){
9641 if ($verbose){ warn "\n\nlast operation was $op\n";}
9642 if ($verbose){ warn "Processing operation $op; deletion pos is $del_pos. MD so far was: $MD_pos_so_far\n";}
9643
9644 $MD_pos_so_far += $op;
9645 if ($verbose){ warn "Adding $op to MD pos so far: $MD_pos_so_far\n";}
9646 if ($verbose){ warn "Deletions already processed: $deletions_processed, del total: $deletions_total\n\n";}
9647 if ($MD_pos_so_far >= $del_pos){
9648 if ($verbose){ warn "Here we go, this operation covers the deletion position!!\n";}
9649 ### splitting up the number of matching bases in number before and after the deletion
9650
9651 my $pos_after_deletion = $MD_pos_so_far - $del_pos;
9652 my $pos_before_deletion = $op - $pos_after_deletion;
9653 if ($verbose){ warn "Splitting up previous operation '$op' into pos before deletion: ${pos_before_deletion} and pos_after_deletion: $pos_after_deletion\n";}
9654
9655 $MD_tag .= "${pos_before_deletion}^${deleted_bases}";
9656 $new_MD .= "${pos_before_deletion}^${deleted_bases}${pos_after_deletion}";
9657
9658 #adjusting the MD_position by the number of bases after the deletion
9659 $MD_pos_so_far -= $pos_after_deletion;
9660 if ($verbose){ warn "MD after adjusting for deletion: $MD_pos_so_far\n"; }
9661
9662 $deletions_processed += 1;
9663 $this_deletion_processed = 1;
9664
9665 if ($deletions_processed == $deletions_total){ # this was the last deletion of the read
9666 if ($verbose){ warn "This was the last deletion in the read ($deletions_processed out of $deletions_total total). Continuing to append \$pos_after_deletion (${pos_after_deletion})..\n";}
9667 $MD_tag .= "${pos_after_deletion}";
9668
9669 }
9670 else{
9671 if ($verbose){ warn "This wasn't the last deletion in the read. Substituting the last operation with the current deletion and reconstituting \@md\n";}
9672 if ($verbose){ warn "Adding length of deletion string '${pos_before_deletion}^${deleted_bases}' (",length("${pos_before_deletion}^${deleted_bases}")," - length of current operation (",length$op,") to current_md_index\n";}
9673
9674 $current_md_index = $current_md_index + length("${pos_before_deletion}^${deleted_bases}") - length$op;
9675 if ($verbose){ warn "Current index = $current_md_index\n";}
9676
9677 if ($verbose){ warn "Setting \$md_index_already_processed to ",$current_md_index-1,"\n";}
9678 # since we are no longer in the loop we don't have to subtract 1 from $current_md_index (tit hasn't been incremented in the first place...)
9679 $md_index_already_processed = $current_md_index;
9680
9681 if ($verbose){ warn "Exiting now and waiting for the next deletion\n";}
9682
9683 $MD_pos_so_far += $len[$index];
9684 if ($verbose){ warn "MD-tag so far: $MD_tag ~~\n";}
9685 }
9686 ### Finally also adding the length of the deletion to $del_pos
9687 $del_pos += $len[$index];
9688 if ($verbose){ warn "Adding length of the deletion itself (",$len[$index],") to \$del_pos: currently at $del_pos\n";}
9689 }
9690 else{
9691 die "Something went wrong, we haven't seen a deletion so far even though we should have...\n\n";
9692 }
9693 }
9694
9695 # forming a new @md
9696 @md = split //,$new_MD;
9697 $new_MD = '';
9698 if ($verbose){ warn "New \@md array: @md\n\n";}
9699 if ($verbose){ warn "MD-tag so far: $MD_tag ~~\nnew_MD so far: $new_MD\n\n";}
9700
9701 }
9702 else{
9703 die "Found CIGAR operations other than M, I, D or N: '$ops[$index]'. Not allowed at the moment\n";
9704 }
9705 }
9706
9707 }
9708 if ($verbose){ warn "Returning MD-tag: $MD_tag\n";}
9709 return $MD_tag;
9710
9711 }
9712
9713 ### Getting rid of the bitwise comparison because even though the initial comparison is nice and quick, the regex loop looking for non-null bytes characters isn't. We might
9714 ### as well do a substring loop to start with, which enables us to generate proper MD:Z: flags that also take proper care of InDels
9715 # sub make_mismatch_string{
9716 # my $actual_seq = shift or die "Missing actual sequence\n";
9717 # my $ref_seq = shift or die "Missing reference sequence\n";
9718 # my $XX_tag = "XX:Z:";
9719
9720 # my $tmp = ($actual_seq ^ $ref_seq); # Bitwise comparison
9721
9722 # warn "'$tmp'\n"; sleep(1);
9723 # my $prev_mm_pos = 0;
9724
9725 # while($tmp =~ /[^\0]/g){ # Where bitwise comparison showed a difference
9726 # my $nuc_match = pos($tmp) - $prev_mm_pos - 1; # Generate number of nucleotide that matches since last mismatch
9727 # my $nuc_mm = substr($ref_seq, pos($tmp) - 1, 1) if pos($tmp) <= length($ref_seq); # Obtain reference nucleotide that was different from the actual read
9728 # $XX_tag .= "$nuc_match" if $nuc_match > 0; # Ignore if mismatches are adjacent to each other
9729 # $XX_tag .= "$nuc_mm" if defined $nuc_mm; # Ignore if there is no mismatch (prevents uninitialized string concatenation)
9730 # $prev_mm_pos = pos($tmp); # Position of last mismatch
9731 # }
9732 # my $end_matches = length($ref_seq) - $prev_mm_pos; # Provides number of matches from last mismatch till end of sequence
9733 # $XX_tag .= "$end_matches" if $end_matches > 0; # Ignore if mismatch is at the end of sequence
9734 # return $XX_tag;
9735 # }
9736
9737
9738
9739 sub print_helpfile{
9740 print << "HOW_TO";
9741
9742
9743 This program is free software: you can redistribute it and/or modify
9744 it under the terms of the GNU General Public License as published by
9745 the Free Software Foundation, either version 3 of the License, or
9746 (at your option) any later version.
9747
9748 This program is distributed in the hope that it will be useful,
9749 but WITHOUT ANY WARRANTY; without even the implied warranty of
9750 MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
9751 GNU General Public License for more details.
9752 You should have received a copy of the GNU General Public License
9753 along with this program. If not, see <http://www.gnu.org/licenses/>.
9754
9755
9756
9757 DESCRIPTION
9758
9759
9760 The following is a brief description of command line options and arguments to control the Bismark
9761 bisulfite mapper and methylation caller. Bismark takes in FastA or FastQ files and aligns the
9762 reads to a specified bisulfite genome. Sequence reads are transformed into a bisulfite converted forward strand
9763 version (C->T conversion) or into a bisulfite treated reverse strand (G->A conversion of the forward strand).
9764 Each of these reads are then aligned to bisulfite treated forward strand index of a reference genome
9765 (C->T converted) and a bisulfite treated reverse strand index of the genome (G->A conversion of the
9766 forward strand, by doing this alignments will produce the same positions). These 4 instances of Bowtie (1 or 2)
9767 are run in parallel. The sequence file(s) are then read in again sequence by sequence to pull out the original
9768 sequence from the genome and determine if there were any protected C's present or not.
9769
9770 As of version 0.7.0 Bismark will only run 2 alignment threads for OT and OB in parallel, the 4 strand mode can be
9771 re-enabled by using --non_directional.
9772
9773 The final output of Bismark is in SAM format by default. For Bowtie 1 one can alos choose to report the old
9774 'vanilla' output format, which is a single tab delimited file with all sequences that have a unique best
9775 alignment to any of the 4 possible strands of a bisulfite PCR product. Both formats are described in more detail below.
9776
9777
9778 USAGE: bismark [options] <genome_folder> {-1 <mates1> -2 <mates2> | <singles>}
9779
9780
9781 ARGUMENTS:
9782
9783 <genome_folder> The path to the folder containing the unmodified reference genome
9784 as well as the subfolders created by the Bismark_Genome_Preparation
9785 script (/Bisulfite_Genome/CT_conversion/ and /Bisulfite_Genome/GA_conversion/).
9786 Bismark expects one or more fastA files in this folder (file extension: .fa
9787 or .fasta). The path can be relative or absolute. The path may also be set as
9788 '--genome_folder /path/to/genome/folder/'.
9789
9790 -1 <mates1> Comma-separated list of files containing the #1 mates (filename usually includes
9791 "_1"), e.g. flyA_1.fq,flyB_1.fq). Sequences specified with this option must
9792 correspond file-for-file and read-for-read with those specified in <mates2>.
9793 Reads may be a mix of different lengths. Bismark will produce one mapping result
9794 and one report file per paired-end input file pair.
9795
9796 -2 <mates2> Comma-separated list of files containing the #2 mates (filename usually includes
9797 "_2"), e.g. flyA_1.fq,flyB_1.fq). Sequences specified with this option must
9798 correspond file-for-file and read-for-read with those specified in <mates1>.
9799 Reads may be a mix of different lengths.
9800
9801 <singles> A comma- or space-separated list of files containing the reads to be aligned (e.g.
9802 lane1.fq,lane2.fq lane3.fq). Reads may be a mix of different lengths. Bismark will
9803 produce one mapping result and one report file per input file.
9804
9805
9806 OPTIONS:
9807
9808
9809 Input:
9810
9811 --se/--single_end <list> Sets single-end mapping mode explicitly giving a list of file names as <list>.
9812 The filenames may be provided as a comma [,] or colon [:] separated list.
9813
9814 -q/--fastq The query input files (specified as <mate1>,<mate2> or <singles> are FASTQ
9815 files (usually having extension .fg or .fastq). This is the default. See also
9816 --solexa-quals.
9817
9818 -f/--fasta The query input files (specified as <mate1>,<mate2> or <singles> are FASTA
9819 files (usually having extensions .fa, .mfa, .fna or similar). All quality values
9820 are assumed to be 40 on the Phred scale. FASTA files are expected to contain both
9821 the read name and the sequence on a single line (and not spread over several lines).
9822
9823 -s/--skip <int> Skip (i.e. do not align) the first <int> reads or read pairs from the input.
9824
9825 -u/--upto <int> Only aligns the first <int> reads or read pairs from the input. Default: no limit.
9826
9827 --phred33-quals FASTQ qualities are ASCII chars equal to the Phred quality plus 33. Default: on.
9828
9829 --phred64-quals FASTQ qualities are ASCII chars equal to the Phred quality plus 64. Default: off.
9830
9831 --solexa-quals Convert FASTQ qualities from solexa-scaled (which can be negative) to phred-scaled
9832 (which can't). The formula for conversion is:
9833 phred-qual = 10 * log(1 + 10 ** (solexa-qual/10.0)) / log(10). Used with -q. This
9834 is usually the right option for use with (unconverted) reads emitted by the GA
9835 Pipeline versions prior to 1.3. Works only for Bowtie 1. Default: off.
9836
9837 --solexa1.3-quals Same as --phred64-quals. This is usually the right option for use with (unconverted)
9838 reads emitted by GA Pipeline version 1.3 or later. Default: off.
9839
9840 --path_to_bowtie The full path </../../> to the Bowtie (1 or 2) installation on your system. If not
9841 specified it is assumed that Bowtie (1 or 2) is in the PATH.
9842
9843
9844 Alignment:
9845
9846 -n/--seedmms <int> The maximum number of mismatches permitted in the "seed", i.e. the first L base pairs
9847 of the read (where L is set with -l/--seedlen). This may be 0, 1, 2 or 3 and the
9848 default is 1. This option is only available for Bowtie 1 (for Bowtie 2 see -N).
9849
9850 -l/--seedlen The "seed length"; i.e., the number of bases of the high quality end of the read to
9851 which the -n ceiling applies. The default is 28. Bowtie (and thus Bismark) is faster for
9852 larger values of -l. This option is only available for Bowtie 1 (for Bowtie 2 see -L).
9853
9854 -e/--maqerr <int> Maximum permitted total of quality values at all mismatched read positions throughout
9855 the entire alignment, not just in the "seed". The default is 70. Like Maq, bowtie rounds
9856 quality values to the nearest 10 and saturates at 30. This value is not relevant for
9857 Bowtie 2.
9858
9859 --chunkmbs <int> The number of megabytes of memory a given thread is given to store path descriptors in
9860 --best mode. Best-first search must keep track of many paths at once to ensure it is
9861 always extending the path with the lowest cumulative cost. Bowtie tries to minimize the
9862 memory impact of the descriptors, but they can still grow very large in some cases. If
9863 you receive an error message saying that chunk memory has been exhausted in --best mode,
9864 try adjusting this parameter up to dedicate more memory to the descriptors. This value
9865 is not relevant for Bowtie 2. Default: 512.
9866
9867 -I/--minins <int> The minimum insert size for valid paired-end alignments. E.g. if -I 60 is specified and
9868 a paired-end alignment consists of two 20-bp alignments in the appropriate orientation
9869 with a 20-bp gap between them, that alignment is considered valid (as long as -X is also
9870 satisfied). A 19-bp gap would not be valid in that case. Default: 0.
9871
9872 -X/--maxins <int> The maximum insert size for valid paired-end alignments. E.g. if -X 100 is specified and
9873 a paired-end alignment consists of two 20-bp alignments in the proper orientation with a
9874 60-bp gap between them, that alignment is considered valid (as long as -I is also satisfied).
9875 A 61-bp gap would not be valid in that case. Default: 500.
9876
9877 --multicore <int> Sets the number of parallel instances of Bismark to be run concurrently. This forks the
9878 Bismark alignment step very early on so that each individual Spawn of Bismark processes
9879 only every n-th sequence (n being set by --multicore). Once all processes have completed,
9880 the individual BAM files, mapping reports, unmapped or ambiguous FastQ files are merged
9881 into single files in very much the same way as they would have been generated running Bismark
9882 conventionally with only a single instance.
9883
9884 If system resources are plentiful this is a viable option to speed up the alignment process
9885 (we observed a near linear speed increase for up to --multicore 8 tested). However, please note
9886 that a typical Bismark run will use several cores already (Bismark itself, 2 or 4 threads of
9887 Bowtie/Bowtie2, Samtools, gzip etc...) and ~10-16GB of memory depending on the choice of aligner
9888 and genome. WARNING: Bismark Parallel (BP?) is resource hungry! Each value of --multicore specified
9889 will effectively lead to a linear increase in compute and memory requirements, so --multicore 4 for
9890 e.g. the GRCm38 mouse genome will probably use ~20 cores and eat ~40GB or RAM, but at the same time
9891 reduce the alignment time to ~25-30%. You have been warned.
9892
9893
9894
9895 Bowtie 1 Reporting:
9896
9897 -k <2> Due to the way Bismark works Bowtie will report up to 2 valid alignments. This option
9898 will be used by default.
9899
9900 --best Make Bowtie guarantee that reported singleton alignments are "best" in terms of stratum
9901 (i.e. number of mismatches, or mismatches in the seed in the case if -n mode) and in
9902 terms of the quality; e.g. a 1-mismatch alignment where the mismatch position has Phred
9903 quality 40 is preferred over a 2-mismatch alignment where the mismatched positions both
9904 have Phred quality 10. When --best is not specified, Bowtie may report alignments that
9905 are sub-optimal in terms of stratum and/or quality (though an effort is made to report
9906 the best alignment). --best mode also removes all strand bias. Note that --best does not
9907 affect which alignments are considered "valid" by Bowtie, only which valid alignments
9908 are reported by Bowtie. Bowtie is about 1-2.5 times slower when --best is specified.
9909 Default: on.
9910
9911 --no_best Disables the --best option which is on by default. This can speed up the alignment process,
9912 e.g. for testing purposes, but for credible results it is not recommended to disable --best.
9913
9914
9915 Output:
9916
9917 --non_directional The sequencing library was constructed in a non strand-specific manner, alignments to all four
9918 bisulfite strands will be reported. Default: OFF.
9919
9920 (The current Illumina protocol for BS-Seq is directional, in which case the strands complementary
9921 to the original strands are merely theoretical and should not exist in reality. Specifying directional
9922 alignments (which is the default) will only run 2 alignment threads to the original top (OT)
9923 or bottom (OB) strands in parallel and report these alignments. This is the recommended option
9924 for sprand-specific libraries).
9925
9926 --pbat This options may be used for PBAT-Seq libraries (Post-Bisulfite Adapter Tagging; Kobayashi et al.,
9927 PLoS Genetics, 2012). This is essentially the exact opposite of alignments in 'directional' mode,
9928 as it will only launch two alignment threads to the CTOT and CTOB strands instead of the normal OT
9929 and OB ones. Use this option only if you are certain that your libraries were constructed following
9930 a PBAT protocol (if you don't know what PBAT-Seq is you should not specify this option). The option
9931 --pbat works only for FastQ files (in both Bowtie and Bowtie 2 mode) and using uncompressed
9932 temporary files only).
9933
9934 --sam-no-hd Suppress SAM header lines (starting with @). This might be useful when very large input files are
9935 split up into several smaller files to run concurrently and the output files are to be merged.
9936
9937 --rg_tag Write out a Read Group tag to the resulting SAM/BAM file. This will write the following line to the
9938 SAM header: \@RG PL: ILLUMINA ID:SAMPLE SM:SAMPLE ; to set ID and SM see --rg_id and --rg_sample.
9939 In addition each read receives an RG:Z:RG-ID tag. Default: OFF.
9940
9941 --rg_id <string> Sets the ID field in the \@RG header line. The default is 'SAMPLE'.
9942
9943 --rg_sample <string> Sets the SM field in the \@RG header line; can't be set without setting --rg_id as well. The default is
9944 'SAMPLE'.
9945
9946 --quiet Print nothing besides alignments.
9947
9948 --vanilla Performs bisulfite mapping with Bowtie 1 and prints the 'old' output (as in Bismark 0.5.X) instead
9949 of SAM format output.
9950
9951 -un/--unmapped Write all reads that could not be aligned to a file in the output directory. Written reads will
9952 appear as they did in the input, without any translation of quality values that may have
9953 taken place within Bowtie or Bismark. Paired-end reads will be written to two parallel files with _1
9954 and _2 inserted in their filenames, i.e. _unmapped_reads_1.txt and unmapped_reads_2.txt. Reads
9955 with more than one valid alignment with the same number of lowest mismatches (ambiguous mapping)
9956 are also written to _unmapped_reads.txt unless the option --ambiguous is specified as well.
9957
9958 --ambiguous Write all reads which produce more than one valid alignment with the same number of lowest
9959 mismatches or other reads that fail to align uniquely to a file in the output directory.
9960 Written reads will appear as. they did in the input, without any of the translation of quality
9961 values that may have taken place within Bowtie or Bismark. Paired-end reads will be written to two
9962 parallel files with _1 and _2 inserted in theit filenames, i.e. _ambiguous_reads_1.txt and
9963 _ambiguous_reads_2.txt. These reads are not written to the file specified with --un.
9964
9965 -o/--output_dir <dir> Write all output files into this directory. By default the output files will be written into
9966 the same folder as the input file(s). If the specified folder does not exist, Bismark will attempt
9967 to create it first. The path to the output folder can be either relative or absolute.
9968
9969 --temp_dir <dir> Write temporary files to this directory instead of into the same directory as the input files. If
9970 the specified folder does not exist, Bismark will attempt to create it first. The path to the
9971 temporary folder can be either relative or absolute.
9972
9973 --non_bs_mm Optionally outputs an extra column specifying the number of non-bisulfite mismatches a read during the
9974 alignment step. This option is only available for SAM format. In Bowtie 2 context, this value is
9975 just the number of actual non-bisulfite mismatches and ignores potential insertions or deletions.
9976 The format for single-end reads and read 1 of paired-end reads is 'XA:Z:number of mismatches'
9977 and 'XB:Z:number of mismatches' for read 2 of paired-end reads.
9978
9979 --gzip Temporary bisulfite conversion files will be written out in a GZIP compressed form to save disk
9980 space. This option is available for most alignment modes but is not available for paired-end FastA
9981 files. This option might be somewhat slower than writing out uncompressed files, but this awaits
9982 further testing.
9983
9984 --sam The output will be written out in SAM format instead of the default BAM format. Bismark will
9985 attempt to use the path to Samtools that was specified with '--samtools_path', or, if it hasn't
9986 been specified, attempt to find Samtools in the PATH. If no installation of Samtools can be found,
9987 the SAM output will be compressed with GZIP instead (yielding a .sam.gz output file).
9988
9989 --cram Writes the output to a CRAM file instead of BAM. This requires the use of Samtools 1.2 or higher.
9990
9991 --cram_ref <ref_file> CRAM output requires you to specify a reference genome as a single FastA file. If this single-FastA
9992 reference file is not supplied explicitly it will be regenerated from the genome .fa sequence(s)
9993 used for the Bismark run and written to a file called 'Bismark_genome_CRAM_reference.mfa' into the
9994 oputput directory.
9995
9996 --samtools_path The path to your Samtools installation, e.g. /home/user/samtools/. Does not need to be specified
9997 explicitly if Samtools is in the PATH already.
9998
9999 --prefix <prefix> Prefixes <prefix> to the output filenames. Trailing dots will be replaced by a single one. For
10000 example, '--prefix test' with 'file.fq' would result in the output file 'test.file.fq_bismark.sam' etc.
10001
10002 -B/--basename <basename> Write all output to files starting with this base file name. For example, '--basename foo'
10003 would result in the files 'foo.bam' and 'foo_SE_report.txt' (or its paired-end equivalent). Takes
10004 precedence over --prefix.
10005
10006 --old_flag Only in paired-end SAM mode, uses the FLAG values used by Bismark v0.8.2 and before. In addition,
10007 this options appends /1 and /2 to the read IDs for reads 1 and 2 relative to the input file. Since
10008 both the appended read IDs and custom FLAG values may cause problems with some downstream tools
10009 such as Picard, new defaults were implemented as of version 0.8.3.
10010
10011
10012 default old_flag
10013 =================== ===================
10014 Read 1 Read 2 Read 1 Read 2
10015
10016 OT: 99 147 67 131
10017
10018 OB: 83 163 115 179
10019
10020 CTOT: 147 99 67 131
10021
10022 CTOB: 163 83 115 179
10023
10024 --ambig_bam For reads that have multiple alignments a random alignment is written out to a special file ending in
10025 '.ambiguous.bam'. The alignments are in Bowtie2 format and do not any contain Bismark specific
10026 entries such as the methylation call etc. These ambiguous BAM files are intended to be used as
10027 coverage estimators for variant callers.
10028
10029 --nucleotide_coverage Calculates the mono- and di-nucleotide sequence composition of covered positions in the analysed BAM
10030 file and compares it to the genomic average composition once alignments are complete by calling 'bam2nuc'.
10031 Since this calculation may take a while, bam2nuc attempts to write the genomic sequence composition
10032 into a file called 'genomic_nucleotide_frequencies.txt' indside the reference genome folder so it can
10033 be re-used the next time round instead of calculating it once again. If a file 'nucleotide_stats.txt' is
10034 found with the Bismark reports it will be automatically detected and used for the Bismark HTML report.
10035 This option works only for BAM or CRAM files.
10036
10037
10038 Other:
10039
10040 -h/--help Displays this help file.
10041
10042 -v/--version Displays version information.
10043
10044
10045 BOWTIE 2 SPECIFIC OPTIONS
10046
10047 --bowtie1 Uses Bowtie 1 instead of Bowtie 2, which might be a good choice for faster and very short
10048 alignments. Bismark assumes that raw sequence data is adapter and/or quality trimmed where
10049 appropriate. Default: off.
10050
10051 --bowtie2 Default: ON. Uses Bowtie 2 instead of Bowtie 1. Bismark limits Bowtie 2 to only perform end-to-end
10052 alignments, i.e. searches for alignments involving all read characters (also called
10053 untrimmed or unclipped alignments). Bismark assumes that raw sequence data is adapter
10054 and/or quality trimmed where appropriate. Both small (.bt2) and large (.bt2l) Bowtie 2
10055 indexes are supported.
10056
10057 Bowtie 2 alignment options:
10058
10059 -N <int> Sets the number of mismatches to allowed in a seed alignment during multiseed alignment.
10060 Can be set to 0 or 1. Setting this higher makes alignment slower (often much slower)
10061 but increases sensitivity. Default: 0. This option is only available for Bowtie 2 (for
10062 Bowtie 1 see -n).
10063
10064 -L <int> Sets the length of the seed substrings to align during multiseed alignment. Smaller values
10065 make alignment slower but more senstive. Default: the --sensitive preset of Bowtie 2 is
10066 used by default, which sets -L to 20. This option is only available for Bowtie 2 (for
10067 Bowtie 1 see -l).
10068
10069 --ignore-quals When calculating a mismatch penalty, always consider the quality value at the mismatched
10070 position to be the highest possible, regardless of the actual value. I.e. input is treated
10071 as though all quality values are high. This is also the default behavior when the input
10072 doesn't specify quality values (e.g. in -f mode). This option is invariable and on by default.
10073
10074
10075 Bowtie 2 paired-end options:
10076
10077 --no-mixed This option disables Bowtie 2's behavior to try to find alignments for the individual mates if
10078 it cannot find a concordant or discordant alignment for a pair. This option is invariable and
10079 and on by default.
10080
10081 --no-discordant Normally, Bowtie 2 looks for discordant alignments if it cannot find any concordant alignments.
10082 A discordant alignment is an alignment where both mates align uniquely, but that does not
10083 satisfy the paired-end constraints (--fr/--rf/--ff, -I, -X). This option disables that behavior
10084 and it is on by default.
10085
10086 --dovetail It is possible, though unusual, for the mates to "dovetail", with the mates seemingly extending
10087 "past" each other as in this example:
10088
10089 Mate 1: GTCAGCTACGATATTGTTTGGGGTGACACATTACGC
10090 Mate 2: TATGAGTCAGCTACGATATTGTTTGGGGTGACACAT
10091 Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC
10092
10093 By default, dovetailing is considered inconsistent with concordant alignment, but setting --dovetail
10094 causes Bowtie 2 to consider dovetailing alignments as concordant. This becomes relevant whenever
10095 Reads are clipped from their 5' end prior to mapping, e.g. because of quality or bias issues.
10096 --dovetail is set automatically for PBAT libraries.
10097
10098
10099 Bowtie 2 effort options:
10100
10101 -D <int> Up to <int> consecutive seed extension attempts can "fail" before Bowtie 2 moves on, using
10102 the alignments found so far. A seed extension "fails" if it does not yield a new best or a
10103 new second-best alignment. Default: 15.
10104
10105 -R <int> <int> is the maximum number of times Bowtie 2 will "re-seed" reads with repetitive seeds.
10106 When "re-seeding," Bowtie 2 simply chooses a new set of reads (same length, same number of
10107 mismatches allowed) at different offsets and searches for more alignments. A read is considered
10108 to have repetitive seeds if the total number of seed hits divided by the number of seeds
10109 that aligned at least once is greater than 300. Default: 2.
10110
10111 Bowtie 2 parallelization options:
10112
10113
10114 -p NTHREADS Launch NTHREADS parallel search threads (default: 1). Threads will run on separate processors/cores
10115 and synchronize when parsing reads and outputting alignments. Searching for alignments is highly
10116 parallel, and speedup is close to linear. Increasing -p increases Bowtie 2's memory footprint.
10117 E.g. when aligning to a human genome index, increasing -p from 1 to 8 increases the memory footprint
10118 by a few hundred megabytes. This option is only available if bowtie is linked with the pthreads
10119 library (i.e. if BOWTIE_PTHREADS=0 is not specified at build time). In addition, this option will
10120 automatically use the option '--reorder', which guarantees that output SAM records are printed in
10121 an order corresponding to the order of the reads in the original input file, even when -p is set
10122 greater than 1 (Bismark requires the Bowtie 2 output to be this way). Specifying --reorder and
10123 setting -p greater than 1 causes Bowtie 2 to run somewhat slower and use somewhat more memory then
10124 if --reorder were not specified. Has no effect if -p is set to 1, since output order will naturally
10125 correspond to input order in that case.
10126
10127 Bowtie 2 Scoring options:
10128
10129 --score_min <func> Sets a function governing the minimum alignment score needed for an alignment to be considered
10130 "valid" (i.e. good enough to report). This is a function of read length. For instance, specifying
10131 L,0,-0.2 sets the minimum-score function f to f(x) = 0 + -0.2 * x, where x is the read length.
10132 See also: setting function options at http://bowtie-bio.sourceforge.net/bowtie2. The default is
10133 L,0,-0.2.
10134
10135 --rdg <int1>,<int2> Sets the read gap open (<int1>) and extend (<int2>) penalties. A read gap of length N gets a penalty
10136 of <int1> + N * <int2>. Default: 5, 3.
10137
10138 --rfg <int1>,<int2> Sets the reference gap open (<int1>) and extend (<int2>) penalties. A reference gap of length N gets
10139 a penalty of <int1> + N * <int2>. Default: 5, 3.
10140
10141
10142 Bowtie 2 Reporting options:
10143
10144 -most_valid_alignments <int> This used to be the Bowtie 2 parameter -M. As of Bowtie 2 version 2.0.0 beta7 the option -M is
10145 deprecated. It will be removed in subsequent versions. What used to be called -M mode is still the
10146 default mode, but adjusting the -M setting is deprecated. Use the -D and -R options to adjust the
10147 effort expended to find valid alignments.
10148
10149 For reference, this used to be the old (now deprecated) description of -M:
10150 Bowtie 2 searches for at most <int>+1 distinct, valid alignments for each read. The search terminates when it
10151 can't find more distinct valid alignments, or when it finds <int>+1 distinct alignments, whichever
10152 happens first. Only the best alignment is reported. Information from the other alignments is used to
10153 estimate mapping quality and to set SAM optional fields, such as AS:i and XS:i. Increasing -M makes
10154 Bowtie 2 slower, but increases the likelihood that it will pick the correct alignment for a read that
10155 aligns many places. For reads that have more than <int>+1 distinct, valid alignments, Bowtie 2 does not
10156 guarantee that the alignment reported is the best possible in terms of alignment score. -M is
10157 always used and its default value is set to 10.
10158
10159
10160 'VANILLA' Bismark OUTPUT:
10161
10162 Single-end output format (tab-separated):
10163
10164 (1) <seq-ID>
10165 (2) <read alignment strand>
10166 (3) <chromosome>
10167 (4) <start position>
10168 (5) <end position>
10169 (6) <observed bisulfite sequence>
10170 (7) <equivalent genomic sequence>
10171 (8) <methylation call>
10172 (9) <read conversion
10173 (10) <genome conversion>
10174 (11) <read quality score (Phred33)>
10175
10176
10177 Paired-end output format (tab-separated):
10178 (1) <seq-ID>
10179 (2) <read 1 alignment strand>
10180 (3) <chromosome>
10181 (4) <start position>
10182 (5) <end position>
10183 (6) <observed bisulfite sequence 1>
10184 (7) <equivalent genomic sequence 1>
10185 (8) <methylation call 1>
10186 (9) <observed bisulfite sequence 2>
10187 (10) <equivalent genomic sequence 2>
10188 (11) <methylation call 2>
10189 (12) <read 1 conversion
10190 (13) <genome conversion>
10191 (14) <read 1 quality score (Phred33)>
10192 (15) <read 2 quality score (Phred33)>
10193
10194
10195 Bismark SAM OUTPUT (default):
10196
10197 (1) QNAME (seq-ID)
10198 (2) FLAG (this flag tries to take the strand a bisulfite read originated from into account (this is different from ordinary DNA alignment flags!))
10199 (3) RNAME (chromosome)
10200 (4) POS (start position)
10201 (5) MAPQ (always 255 for use with Bowtie)
10202 (6) CIGAR
10203 (7) RNEXT
10204 (8) PNEXT
10205 (9) TLEN
10206 (10) SEQ
10207 (11) QUAL (Phred33 scale)
10208 (12) NM-tag (edit distance to the reference)
10209 (13) MD-tag (base-by-base mismatches to the reference (handles indels)
10210 (14) XM-tag (methylation call string)
10211 (15) XR-tag (read conversion state for the alignment)
10212 (16) XG-tag (genome conversion state for the alignment)
10213 (17) XA/XB-tag (non-bisulfite mismatches) (optional!)
10214
10215 Each read of paired-end alignments is written out in a separate line in the above format.
10216
10217
10218 Last edited on 25 July 2016
10219 HOW_TO
10220 }