Mercurial > repos > bgruening > bismark
comparison bismark_methyl_extractor/bismark_methylation_extractor @ 7:fcadce4d9a06 draft
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit b'e6ee273f75fff61d1e419283fa8088528cf59470\n'
| author | bgruening |
|---|---|
| date | Sat, 06 May 2017 13:18:09 -0400 |
| parents | |
| children |
comparison
equal
deleted
inserted
replaced
| 6:0f8646f22b8d | 7:fcadce4d9a06 |
|---|---|
| 1 #!/usr/bin/env perl | |
| 2 use warnings; | |
| 3 use strict; | |
| 4 $|++; | |
| 5 use Getopt::Long; | |
| 6 use Cwd; | |
| 7 use Carp; | |
| 8 use FindBin qw($Bin); | |
| 9 use lib "$Bin/../lib"; | |
| 10 | |
| 11 ## This program is Copyright (C) 2010-16, Felix Krueger (felix.krueger@babraham.ac.uk) | |
| 12 | |
| 13 ## This program is free software: you can redistribute it and/or modify | |
| 14 ## it under the terms of the GNU General Public License as published by | |
| 15 ## the Free Software Foundation, either version 3 of the License, or | |
| 16 ## (at your option) any later version. | |
| 17 | |
| 18 ## This program is distributed in the hope that it will be useful, | |
| 19 ## but WITHOUT ANY WARRANTY; without even the implied warranty of | |
| 20 ## MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the | |
| 21 ## GNU General Public License for more details. | |
| 22 | |
| 23 ## You should have received a copy of the GNU General Public License | |
| 24 ## along with this program. If not, see <http://www.gnu.org/licenses/>. | |
| 25 | |
| 26 my @filenames; # input files | |
| 27 my %counting; | |
| 28 my $parent_dir = getcwd(); | |
| 29 | |
| 30 my %fhs; | |
| 31 | |
| 32 my $version = 'v0.16.3'; | |
| 33 my ($ignore,$genomic_fasta,$single,$paired,$full,$report,$no_overlap,$merge_non_CpG,$vanilla,$output_dir,$no_header,$bedGraph,$remove,$coverage_threshold,$counts,$cytosine_report,$genome_folder,$zero,$CpG_only,$CX_context,$split_by_chromosome,$sort_size,$samtools_path,$gzip,$ignore_r2,$mbias_off,$mbias_only,$gazillion,$ample_mem,$ignore_3prime,$ignore_3prime_r2,$multicore) = process_commandline(); | |
| 34 | |
| 35 | |
| 36 ### only needed for bedGraph output | |
| 37 my @sorting_files; # if files are to be written to bedGraph format, these are the methylation extractor output files | |
| 38 my @methylcalls = qw (0 0 0); # [0] = methylated, [1] = unmethylated, [2] = total | |
| 39 my @bedfiles; | |
| 40 | |
| 41 ### only needed for genome-wide cytosine methylation report | |
| 42 my %chromosomes; | |
| 43 | |
| 44 my %mbias_1; | |
| 45 my %mbias_2; | |
| 46 | |
| 47 | |
| 48 ############################################################################################## | |
| 49 ### Summarising Run Parameters | |
| 50 ############################################################################################## | |
| 51 | |
| 52 ### METHYLATION EXTRACTOR | |
| 53 | |
| 54 warn "Summarising Bismark methylation extractor parameters:\n"; | |
| 55 warn '='x63,"\n"; | |
| 56 | |
| 57 if ($single){ | |
| 58 if ($vanilla){ | |
| 59 warn "Bismark single-end vanilla format specified\n"; | |
| 60 } | |
| 61 else{ | |
| 62 warn "Bismark single-end SAM format specified (default)\n"; # default | |
| 63 } | |
| 64 } | |
| 65 elsif ($paired){ | |
| 66 if ($vanilla){ | |
| 67 warn "Bismark paired-end vanilla format specified\n"; | |
| 68 } | |
| 69 else{ | |
| 70 warn "Bismark paired-end SAM format specified (default)\n"; # default | |
| 71 } | |
| 72 } | |
| 73 | |
| 74 warn "Number of cores to be used: $multicore\n"; | |
| 75 | |
| 76 if ($single){ | |
| 77 if ($ignore){ | |
| 78 warn "First $ignore bp will be disregarded when processing the methylation call string\n"; | |
| 79 } | |
| 80 if ($ignore_3prime){ | |
| 81 warn "Last $ignore_3prime bp will be disregarded when processing the methylation call string\n"; | |
| 82 } | |
| 83 | |
| 84 } | |
| 85 else{ ## paired-end | |
| 86 if ($ignore){ | |
| 87 warn "First $ignore bp will be disregarded when processing the methylation call string of Read 1\n"; | |
| 88 } | |
| 89 if ($ignore_r2){ | |
| 90 warn "First $ignore_r2 bp will be disregarded when processing the methylation call string of Read 2\n"; | |
| 91 } | |
| 92 | |
| 93 if ($ignore_3prime){ | |
| 94 warn "Last $ignore_3prime bp will be disregarded when processing the methylation call string of Read 1\n"; | |
| 95 } | |
| 96 if ($ignore_3prime_r2){ | |
| 97 warn "Last $ignore_3prime_r2 bp will be disregarded when processing the methylation call string of Read 2\n"; | |
| 98 } | |
| 99 | |
| 100 | |
| 101 } | |
| 102 | |
| 103 | |
| 104 if ($full){ | |
| 105 warn "Strand-specific outputs will be skipped. Separate output files for cytosines in CpG, CHG and CHH context will be generated\n"; | |
| 106 } | |
| 107 if ($merge_non_CpG){ | |
| 108 warn "Merge CHG and CHH context to non-CpG context specified\n"; | |
| 109 } | |
| 110 ### output directory | |
| 111 if ($output_dir eq ''){ | |
| 112 warn "Output will be written to the current directory ('$parent_dir')\n"; | |
| 113 } | |
| 114 else{ | |
| 115 warn "Output path specified as: $output_dir\n"; | |
| 116 } | |
| 117 | |
| 118 | |
| 119 sleep (1); | |
| 120 | |
| 121 ### BEDGRAPH | |
| 122 | |
| 123 if ($bedGraph){ | |
| 124 warn "\n\nSummarising bedGraph parameters:\n"; | |
| 125 warn '='x63,"\n"; | |
| 126 | |
| 127 if ($counts){ | |
| 128 warn "Generating additional output in bedGraph and coverage format\nbedGraph format:\t<Chromosome> <Start Position> <End Position> <Methylation Percentage>\ncoverage format:\t<Chromosome> <Start Position> <End Position> <Methylation Percentage> <count methylated> <count non-methylated>\n\n"; | |
| 129 } | |
| 130 else{ | |
| 131 warn "Generating additional sorted output in bedGraph format (output format: <Chromosome> <Start Position> <End Position> <Methylation Percentage>)\n"; | |
| 132 } | |
| 133 | |
| 134 ### Zero-based coordinates | |
| 135 if ($zero){ | |
| 136 warn "Writing out an additional coverage file (ending in zero.cov) with 0-based start and 1-based end genomic coordinates (zero-based, half-open; user-defined)\n"; | |
| 137 } | |
| 138 | |
| 139 warn "Using a cutoff of $coverage_threshold read(s) to report cytosine positions\n"; | |
| 140 | |
| 141 if ($CX_context){ | |
| 142 warn "Reporting and sorting methylation information for all cytosine context (sorting may take a long time, you have been warned ...)\n"; | |
| 143 } | |
| 144 else{ # default | |
| 145 $CpG_only = 1; | |
| 146 warn "Reporting and sorting cytosine methylation information in CpG context only (default)\n"; | |
| 147 } | |
| 148 | |
| 149 if ($remove){ | |
| 150 warn "White spaces in read ID names will be removed prior to sorting\n"; | |
| 151 } | |
| 152 | |
| 153 if ($ample_mem){ | |
| 154 warn "Sorting chromosomal postions for the bedGraph step using arrays instead of using UNIX sort\n"; | |
| 155 } | |
| 156 elsif (defined $sort_size){ | |
| 157 warn "The bedGraph UNIX sort command will use the following memory setting:\t'$sort_size'. Temporary directory used for sorting is the output directory\n"; | |
| 158 } | |
| 159 else{ | |
| 160 warn "Setting a default memory usage for the bedGraph UNIX sort command to 2GB\n"; | |
| 161 } | |
| 162 | |
| 163 | |
| 164 | |
| 165 sleep (1); | |
| 166 | |
| 167 if ($cytosine_report){ | |
| 168 warn "\n\nSummarising genome-wide cytosine methylation report parameters:\n"; | |
| 169 warn '='x63,"\n"; | |
| 170 warn "Generating comprehensive genome-wide cytosine report\n(output format: <Chromosome> <Position> <Strand> <count methylated> <count non-methylated> <C-context> <trinucleotide context> )\n"; | |
| 171 | |
| 172 | |
| 173 if ($CX_context){ | |
| 174 warn "Reporting methylation for all cytosine contexts. Be aware that this will generate enormous files\n"; | |
| 175 } | |
| 176 else{ # default | |
| 177 $CpG_only = 1; | |
| 178 warn "Reporting cytosine methylation in CpG context only (default)\n"; | |
| 179 } | |
| 180 | |
| 181 if ($split_by_chromosome){ | |
| 182 warn "Splitting the cytosine report output up into individual files for each chromosome\n"; | |
| 183 } | |
| 184 | |
| 185 ### Zero-based coordinates | |
| 186 if ($zero){ | |
| 187 warn "Using zero-based start and 1-based end genomic coordinates (zero-based, half-open; user-defined)\n"; | |
| 188 } | |
| 189 else{ # default, 1-based coords | |
| 190 warn "Using 1-based genomic coordinates (default)\n"; | |
| 191 } | |
| 192 | |
| 193 ### GENOME folder | |
| 194 if ($genome_folder){ | |
| 195 unless ($genome_folder =~/\/$/){ | |
| 196 $genome_folder =~ s/$/\//; | |
| 197 } | |
| 198 warn "Genome folder was specified as $genome_folder\n"; | |
| 199 } | |
| 200 else{ | |
| 201 $genome_folder = '/data/public/Genomes/Mouse/NCBIM37/'; | |
| 202 warn "Using the default genome folder /data/public/Genomes/Mouse/NCBIM37/\n"; | |
| 203 } | |
| 204 sleep (1); | |
| 205 } | |
| 206 } | |
| 207 | |
| 208 warn "\n"; | |
| 209 sleep (1); | |
| 210 | |
| 211 ###################################################### | |
| 212 ### PROCESSING FILES | |
| 213 ###################################################### | |
| 214 | |
| 215 foreach my $filename (@filenames){ | |
| 216 # resetting counters and filehandles | |
| 217 %fhs = (); | |
| 218 %counting =( | |
| 219 total_meCHG_count => 0, | |
| 220 total_meCHH_count => 0, | |
| 221 total_meCpG_count => 0, | |
| 222 total_unmethylated_CHG_count => 0, | |
| 223 total_unmethylated_CHH_count => 0, | |
| 224 total_unmethylated_CpG_count => 0, | |
| 225 sequences_count => 0, | |
| 226 methylation_call_strings => 0, | |
| 227 ); | |
| 228 | |
| 229 @sorting_files = (); | |
| 230 @bedfiles = (); | |
| 231 | |
| 232 %mbias_1 = (); | |
| 233 %mbias_2 = (); | |
| 234 | |
| 235 | |
| 236 ### performing a quick check to see if a paired-end SAM file has been sorted by positions which does interfere with the logic used by the extractor | |
| 237 unless ($vanilla){ | |
| 238 if ($paired){ | |
| 239 test_positional_sorting($filename); | |
| 240 } | |
| 241 } | |
| 242 | |
| 243 my ($pid,$pids,$report_basename) = process_Bismark_results_file($filename); | |
| 244 | |
| 245 if ($pid == 0){ | |
| 246 warn "Finished processing child process. Exiting..\n"; | |
| 247 | |
| 248 # ### Closing all filehandles of the child process so that the Bismark methylation extractor output doesn't get truncated due to buffering issues | |
| 249 # foreach my $fh (keys %fhs) { | |
| 250 # if ($fh =~ /^[1230]$/) { | |
| 251 # foreach my $context (keys %{$fhs{$fh}}) { | |
| 252 # $fhs{$fh}->{$context}->flush; | |
| 253 # } | |
| 254 # } | |
| 255 # else{ | |
| 256 # $fhs{$fh}->flush; | |
| 257 # } | |
| 258 # } | |
| 259 exit 0; | |
| 260 } | |
| 261 | |
| 262 ### | |
| 263 if ($pid and $multicore > 1){ | |
| 264 warn "Now waiting for all child processes to complete\n"; | |
| 265 sleep(1); | |
| 266 | |
| 267 ### we need to ensure that we wait for all child processes to be finished before continuing | |
| 268 # warn "here are the child IDs: @$pids\n"; | |
| 269 # warn "Looping through the child process IDs:\n"; | |
| 270 | |
| 271 foreach my $id (@$pids){ | |
| 272 # print "$id\t"; | |
| 273 my $kid = waitpid ($id,0); | |
| 274 # print "Returned: $kid\nExit status: $?\n"; | |
| 275 unless ($? == 0){ | |
| 276 warn "\nChild process terminated with exit signal: '$?'\n\n"; | |
| 277 } | |
| 278 } | |
| 279 } | |
| 280 | |
| 281 ### Closing all filehandles so that the Bismark methylation extractor output doesn't get truncated due to buffering issues | |
| 282 foreach my $fh (keys %fhs) { | |
| 283 if ($fh =~ /^[1230]$/) { | |
| 284 foreach my $context (keys %{$fhs{$fh}}) { | |
| 285 close $fhs{$fh}->{$context} or die $!; | |
| 286 } | |
| 287 } | |
| 288 else{ | |
| 289 close $fhs{$fh} or die $!; | |
| 290 } | |
| 291 } | |
| 292 | |
| 293 ### We need to stitch together a main splitting report from all individual parent/child processes | |
| 294 if ($multicore > 1){ | |
| 295 merge_individual_splitting_reports($report_basename); | |
| 296 print_splitting_report(); | |
| 297 | |
| 298 merge_individual_mbias_reports($report_basename); # this updates the main %mbias_1 and %mbias_2 data structures so we can proceed normally | |
| 299 | |
| 300 } | |
| 301 | |
| 302 unless ($mbias_off){ | |
| 303 ### printing out all M-Bias data | |
| 304 produce_mbias_plots ($filename); produce_mbias_plots ($filename); | |
| 305 | |
| 306 } | |
| 307 | |
| 308 unless ($mbias_only){ | |
| 309 delete_unused_files(); | |
| 310 } | |
| 311 | |
| 312 if ($bedGraph){ | |
| 313 | |
| 314 my $out = (split (/\//,$filename))[-1]; # extracting the filename if a full path was specified | |
| 315 $out =~ s/gz$//; | |
| 316 $out =~ s/sam$//; | |
| 317 $out =~ s/bam$//; | |
| 318 $out =~ s/txt$//; | |
| 319 $out =~ s/$/bedGraph/; | |
| 320 | |
| 321 my $bedGraph_output = $out; | |
| 322 my @args; | |
| 323 | |
| 324 if ($remove){ | |
| 325 push @args, '--remove'; | |
| 326 } | |
| 327 if ($CX_context){ | |
| 328 push @args, '--CX_context'; | |
| 329 } | |
| 330 if ($no_header){ | |
| 331 push @args, '--no_header'; | |
| 332 } | |
| 333 if ($gazillion){ | |
| 334 push @args, '--gazillion'; | |
| 335 } | |
| 336 if ($ample_mem){ | |
| 337 push @args, '--ample_memory'; | |
| 338 } | |
| 339 if ($zero){ | |
| 340 push @args, "--zero"; | |
| 341 } | |
| 342 | |
| 343 # if ($counts){ | |
| 344 # push @args, "--counts"; | |
| 345 # } | |
| 346 | |
| 347 push @args, "--buffer_size $sort_size"; | |
| 348 push @args, "--cutoff $coverage_threshold"; | |
| 349 push @args, "--output $bedGraph_output"; | |
| 350 push @args, "--dir '$output_dir'"; | |
| 351 | |
| 352 ### adding all files to be sorted to @args | |
| 353 foreach my $f (@sorting_files){ | |
| 354 push @args, $f; | |
| 355 } | |
| 356 | |
| 357 # print join "\t",@args,"\n"; | |
| 358 | |
| 359 system ("$Bin/bismark2bedGraph @args"); | |
| 360 | |
| 361 warn "Finished BedGraph conversion ...\n\n"; | |
| 362 sleep(1); | |
| 363 | |
| 364 # open (OUT,'>',$output_dir.$bedGraph_output) or die "Problems with the bedGraph output filename detected: file path: '$output_dir'\tfile name: '$bedGraph_output' $!"; | |
| 365 # warn "Writing bedGraph to file: $bedGraph_output\n"; | |
| 366 # process_bedGraph_output(); | |
| 367 # close OUT or die $!; | |
| 368 | |
| 369 ### genome-wide cytosine methylation report requires bedGraph processing anyway | |
| 370 if ($cytosine_report){ | |
| 371 | |
| 372 @args = (); # resetting @args | |
| 373 my $cytosine_out = $out; | |
| 374 $cytosine_out =~ s/bedGraph$//; | |
| 375 | |
| 376 if ($CX_context){ | |
| 377 $cytosine_out =~ s/$/CX_report.txt/; | |
| 378 } | |
| 379 else{ | |
| 380 $cytosine_out =~ s/$/CpG_report.txt/; | |
| 381 } | |
| 382 | |
| 383 push @args, "--output $cytosine_out"; | |
| 384 push @args, "--dir '$output_dir'"; | |
| 385 push @args, "--genome '$genome_folder'"; | |
| 386 push @args, "--parent_dir '$parent_dir'"; | |
| 387 | |
| 388 if ($zero){ | |
| 389 push @args, "--zero"; | |
| 390 } | |
| 391 if ($CX_context){ | |
| 392 push @args, '--CX_context'; | |
| 393 } | |
| 394 if ($split_by_chromosome){ | |
| 395 push @args, '--split_by_chromosome'; | |
| 396 } | |
| 397 if ($gzip){ | |
| 398 push @args, '--gzip'; | |
| 399 } | |
| 400 | |
| 401 my $coverage_output = $bedGraph_output; | |
| 402 $coverage_output =~ s/bedGraph$/bismark.cov.gz/; | |
| 403 | |
| 404 push @args, $coverage_output; # this will be the infile | |
| 405 # warn "Handing over the following infile: $coverage_output\n"; sleep (5); | |
| 406 system ("$Bin/coverage2cytosine @args"); | |
| 407 | |
| 408 warn "\n\nFinished generating genome-wide cytosine report\n\n"; | |
| 409 } | |
| 410 } | |
| 411 } | |
| 412 | |
| 413 sub merge_individual_splitting_reports{ | |
| 414 | |
| 415 my $report_basename = shift; | |
| 416 | |
| 417 my @splitting_reports; # only needed in multi-core mode to generate an overall report | |
| 418 foreach my $ext (1..$multicore){ | |
| 419 push @splitting_reports, "$report_basename.$ext"; | |
| 420 } | |
| 421 warn "\nMerging individual splitting reports into overall report: '$report_basename'\n"; | |
| 422 warn "Merging from these individual files:\n"; | |
| 423 print join ("\n",@splitting_reports),"\n\n"; | |
| 424 sleep(1); | |
| 425 | |
| 426 ########## | |
| 427 # resetting the counter first | |
| 428 %counting =( | |
| 429 total_meCHG_count => 0, | |
| 430 total_meCHH_count => 0, | |
| 431 total_meCpG_count => 0, | |
| 432 total_unmethylated_CHG_count => 0, | |
| 433 total_unmethylated_CHH_count => 0, | |
| 434 total_unmethylated_CpG_count => 0, | |
| 435 sequences_count => 0, | |
| 436 methylation_call_strings => 0, | |
| 437 ); | |
| 438 | |
| 439 # repopulating the merged counter | |
| 440 foreach my $file (@splitting_reports){ | |
| 441 open (IR,$file) or die $!; | |
| 442 while (<IR>){ | |
| 443 chomp; | |
| 444 my ($context,$count) = (split /\t/); | |
| 445 if ($context){ | |
| 446 if ($context =~ /^Total C to T conversions in CpG context/){ | |
| 447 # warn "context: $context\ncount: $count\n"; | |
| 448 $counting{total_unmethylated_CpG_count} += $count; | |
| 449 } | |
| 450 elsif ($context =~ /^Total C to T conversions in CHG context/){ | |
| 451 # warn "context: $context\ncount: $count\n"; | |
| 452 $counting{total_unmethylated_CHG_count} += $count; | |
| 453 } | |
| 454 elsif ($context =~ /^Total C to T conversions in CHH context/){ | |
| 455 # warn "context: $context\ncount: $count\n"; | |
| 456 $counting{total_unmethylated_CHH_count} += $count; | |
| 457 } | |
| 458 elsif ($context =~ /^Total methylated C\'s in CpG context/){ | |
| 459 # warn "context: $context\ncount: $count\n"; | |
| 460 $counting{total_meCpG_count} += $count; | |
| 461 } | |
| 462 elsif ($context =~ /^Total methylated C\'s in CHG context/){ | |
| 463 # warn "context: $context\ncount: $count\n"; | |
| 464 $counting{total_meCHG_count} += $count; | |
| 465 } | |
| 466 elsif ($context =~ /^Total methylated C\'s in CHH context/){ | |
| 467 # warn "context: $context\ncount: $count\n"; | |
| 468 $counting{total_meCHH_count} += $count; | |
| 469 } | |
| 470 elsif ($context =~ /^line count/){ | |
| 471 # warn "Line count\ncount: $count\n"; | |
| 472 $counting{sequences_count} = $count; # always the same | |
| 473 } | |
| 474 elsif ($context =~ /^meth call strings/){ | |
| 475 # warn "Meth call strings\ncount: $count\n"; | |
| 476 $counting{methylation_call_strings} += $count; | |
| 477 } | |
| 478 } | |
| 479 } | |
| 480 } | |
| 481 | |
| 482 # deleting the individual reports afterwards | |
| 483 foreach my $file (@splitting_reports){ | |
| 484 unlink $file; | |
| 485 } | |
| 486 } | |
| 487 | |
| 488 | |
| 489 sub merge_individual_mbias_reports{ | |
| 490 | |
| 491 my $report_basename = shift; | |
| 492 | |
| 493 my @mbias_reports; # only needed in multi-core mode to generate an overall report | |
| 494 foreach my $ext (1..$multicore){ | |
| 495 push @mbias_reports, "$report_basename.${ext}.mbias"; | |
| 496 } | |
| 497 warn "\nMerging individual M-bias reports into overall M-bias statistics from these $multicore individual files:\n"; | |
| 498 print join ("\n",@mbias_reports),"\n\n"; | |
| 499 | |
| 500 | |
| 501 ########## | |
| 502 # resetting the counters first, then repopulating them | |
| 503 %mbias_1 = (); | |
| 504 %mbias_2 = (); | |
| 505 | |
| 506 # repopulating the merged counter | |
| 507 foreach my $file (@mbias_reports){ | |
| 508 open (IR,$file) or die $!; | |
| 509 | |
| 510 my $context; | |
| 511 my $read; | |
| 512 | |
| 513 while (<IR>){ | |
| 514 chomp; | |
| 515 # warn "$_\n"; sleep(1); | |
| 516 if ($_ =~ /context/){ | |
| 517 $context = $1 if ($_ =~ /(\D{3}) context/); | |
| 518 # warn "Context set as $context\n"; | |
| 519 | |
| 520 if ($_ =~ /R2/){ | |
| 521 $read = 'R2'; | |
| 522 } | |
| 523 else{ | |
| 524 $read = 'R1'; | |
| 525 } | |
| 526 # warn "Setting read identity to '$read'\n"; | |
| 527 | |
| 528 # reading in 2 additional lines (===========, and header line) | |
| 529 $_ = <IR>; | |
| 530 #warn "discarding line $_\n"; | |
| 531 $_ = <IR>; | |
| 532 #warn "discarding line $_\n"; | |
| 533 next; | |
| 534 } | |
| 535 else{ | |
| 536 | |
| 537 if ($_ eq ''){ | |
| 538 # empty line, only occurs after a context has finished and before a new context starts | |
| 539 next; | |
| 540 } | |
| 541 | |
| 542 my ($pos,$meth,$unmeth) = (split /\t/); | |
| 543 # warn "$pos\t$meth\t$unmeth\n"; sleep(1); | |
| 544 if ($read eq 'R1'){ | |
| 545 $mbias_1{$context}->{$pos}->{meth} += $meth; | |
| 546 $mbias_1{$context}->{$pos}->{un} += $unmeth; | |
| 547 } | |
| 548 elsif ($read eq 'R2'){ | |
| 549 $mbias_2{$context}->{$pos}->{meth} += $meth; | |
| 550 $mbias_2{$context}->{$pos}->{un} += $unmeth; | |
| 551 } | |
| 552 } | |
| 553 } | |
| 554 close IR or warn "Had trouble closing filehandle for $file: $!\n"; | |
| 555 } | |
| 556 | |
| 557 # deleting the individual reports afterwards | |
| 558 foreach my $file (@mbias_reports){ | |
| 559 unlink $file; | |
| 560 } | |
| 561 } | |
| 562 | |
| 563 | |
| 564 sub delete_unused_files{ | |
| 565 | |
| 566 warn "Deleting unused files ...\n\n"; sleep(1); | |
| 567 | |
| 568 my $index = 0; | |
| 569 | |
| 570 while ($index <= $#sorting_files){ | |
| 571 if ($sorting_files[$index] =~ /gz$/){ | |
| 572 open (USED,"gunzip -c $sorting_files[$index] |") or die "Failed to read from methylation extractor output file $sorting_files[$index]: $!\n"; | |
| 573 } | |
| 574 else{ | |
| 575 open (USED,$sorting_files[$index]) or die "Failed to read from methylation extractor output file $sorting_files[$index]: $!\n"; | |
| 576 } | |
| 577 | |
| 578 my $used = 0; | |
| 579 | |
| 580 while (<USED>){ | |
| 581 next if (/^Bismark/); | |
| 582 if ($_){ | |
| 583 $used = 1; | |
| 584 last; | |
| 585 } | |
| 586 } | |
| 587 | |
| 588 if ($used){ | |
| 589 warn "$sorting_files[$index] contains data ->\tkept\n"; | |
| 590 ++$index; | |
| 591 } | |
| 592 else{ | |
| 593 | |
| 594 my $delete = unlink $sorting_files[$index]; | |
| 595 | |
| 596 if ($delete){ | |
| 597 warn "$sorting_files[$index] was empty ->\tdeleted\n"; | |
| 598 } | |
| 599 else{ | |
| 600 warn "$sorting_files[$index] was empty, however deletion was unsuccessful: $!\n" | |
| 601 } | |
| 602 | |
| 603 ### we also need to remove the element from @sorting_files | |
| 604 splice @sorting_files, $index, 1; | |
| 605 } | |
| 606 } | |
| 607 warn "\n\n"; ## can't close the piped filehandles at this point because it will die (unfortunately) | |
| 608 } | |
| 609 | |
| 610 sub produce_mbias_plots{ | |
| 611 | |
| 612 my $filename = shift; | |
| 613 | |
| 614 my $mbias = (split (/\//,$filename))[-1]; # extracting the filename if a full path was specified | |
| 615 $mbias =~ s/gz$//; | |
| 616 $mbias =~ s/sam$//; | |
| 617 $mbias =~ s/bam$//; | |
| 618 $mbias =~ s/cram$//; | |
| 619 $mbias =~ s/txt$//; | |
| 620 my $mbias_graph_1 = my $mbias_graph_2 = $mbias; | |
| 621 $mbias_graph_1 = $output_dir . $mbias_graph_1 . 'M-bias_R1.png'; | |
| 622 $mbias_graph_2 = $output_dir . $mbias_graph_2 . 'M-bias_R2.png'; | |
| 623 | |
| 624 $mbias =~ s/$/M-bias.txt/; | |
| 625 | |
| 626 open (MBIAS,'>',"$output_dir$mbias") or die "Failed to open file for the M-bias data\n\n"; | |
| 627 | |
| 628 # determining maximum read length | |
| 629 my $max_length_1 = 0; | |
| 630 my $max_length_2 = 0; | |
| 631 | |
| 632 foreach my $context (keys %mbias_1){ | |
| 633 foreach my $pos (sort {$a<=>$b} keys %{$mbias_1{$context}}){ | |
| 634 $max_length_1 = $pos unless ($max_length_1 >= $pos); | |
| 635 } | |
| 636 } | |
| 637 if ($paired){ | |
| 638 foreach my $context (keys %mbias_2){ | |
| 639 foreach my $pos (sort {$a<=>$b} keys %{$mbias_2{$context}}){ | |
| 640 $max_length_2 = $pos unless ($max_length_2 >= $pos); | |
| 641 } | |
| 642 } | |
| 643 } | |
| 644 | |
| 645 if ($single){ | |
| 646 warn "Determining maximum read length for M-Bias plot\n"; | |
| 647 warn "Maximum read length of Read 1: $max_length_1\n\n"; | |
| 648 } | |
| 649 else{ | |
| 650 warn "Determining maximum read lengths for M-Bias plots\n"; | |
| 651 warn "Maximum read length of Read 1: $max_length_1\n"; | |
| 652 warn "Maximum read length of Read 2: $max_length_2\n\n"; | |
| 653 } | |
| 654 # sleep(3); | |
| 655 | |
| 656 my @mbias_read1; | |
| 657 my @mbias_read2; | |
| 658 | |
| 659 #Check whether the module GD::Graph:lines is installed | |
| 660 my $gd_graph_installed = 0; | |
| 661 eval{ | |
| 662 require GD::Graph::lines; | |
| 663 GD::Graph::lines->import(); | |
| 664 }; | |
| 665 | |
| 666 unless($@) { # syntax or routine error variable, set if something goes wrong in the last eval{ require ...} | |
| 667 $gd_graph_installed = 1; | |
| 668 | |
| 669 #Check whether the module GD::Graph::colour is installed | |
| 670 eval{ | |
| 671 require GD::Graph::colour; | |
| 672 GD::Graph::colour->import(qw(:colours :lists :files :convert)); | |
| 673 }; | |
| 674 | |
| 675 if ($@) { | |
| 676 warn "Perl module GD::Graph::colour not found, skipping drawing M-bias plots (only writing out M-bias plot table)\n"; | |
| 677 sleep(2); | |
| 678 $gd_graph_installed = 0; | |
| 679 } | |
| 680 | |
| 681 | |
| 682 } | |
| 683 else{ | |
| 684 warn "Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table)\n"; | |
| 685 sleep(2); | |
| 686 } | |
| 687 | |
| 688 | |
| 689 my $graph_title; | |
| 690 my $graph1; | |
| 691 my $graph2; | |
| 692 | |
| 693 if ( $gd_graph_installed){ | |
| 694 $graph1 = GD::Graph::lines->new(800,600); | |
| 695 if ($paired){ | |
| 696 $graph2 = GD::Graph::lines->new(800,600); | |
| 697 } | |
| 698 } | |
| 699 | |
| 700 foreach my $context (qw(CpG CHG CHH)){ | |
| 701 @{$mbias_read1[0]} = (); | |
| 702 | |
| 703 if ($paired){ | |
| 704 print MBIAS "$context context (R1)\n================\n"; | |
| 705 $graph_title = 'M-bias (Read 1)'; | |
| 706 } | |
| 707 else{ | |
| 708 print MBIAS "$context context\n===========\n"; | |
| 709 $graph_title = 'M-bias'; | |
| 710 } | |
| 711 print MBIAS "position\tcount methylated\tcount unmethylated\t% methylation\tcoverage\n"; | |
| 712 | |
| 713 foreach my $pos (1..$max_length_1){ | |
| 714 | |
| 715 unless (defined $mbias_1{$context}->{$pos}->{meth}){ | |
| 716 $mbias_1{$context}->{$pos}->{meth} = 0; | |
| 717 } | |
| 718 unless (defined $mbias_1{$context}->{$pos}->{un}){ | |
| 719 $mbias_1{$context}->{$pos}->{un} = 0; | |
| 720 } | |
| 721 | |
| 722 my $percent = ''; | |
| 723 if (($mbias_1{$context}->{$pos}->{meth} + $mbias_1{$context}->{$pos}->{un}) > 0){ | |
| 724 $percent = sprintf("%.2f",$mbias_1{$context}->{$pos}->{meth} * 100/ ( $mbias_1{$context}->{$pos}->{meth} + $mbias_1{$context}->{$pos}->{un}) ); | |
| 725 } | |
| 726 my $coverage = $mbias_1{$context}->{$pos}->{un} + $mbias_1{$context}->{$pos}->{meth}; | |
| 727 | |
| 728 print MBIAS "$pos\t$mbias_1{$context}->{$pos}->{meth}\t$mbias_1{$context}->{$pos}->{un}\t$percent\t$coverage\n"; | |
| 729 push @{$mbias_read1[0]},$pos; | |
| 730 | |
| 731 if ($context eq 'CpG'){ | |
| 732 push @{$mbias_read1[1]},$percent; | |
| 733 push @{$mbias_read1[4]},$coverage; | |
| 734 } | |
| 735 elsif ($context eq 'CHG'){ | |
| 736 push @{$mbias_read1[2]},$percent; | |
| 737 push @{$mbias_read1[5]},$coverage; | |
| 738 } | |
| 739 elsif ($context eq 'CHH'){ | |
| 740 push @{$mbias_read1[3]},$percent; | |
| 741 push @{$mbias_read1[6]},$coverage; | |
| 742 } | |
| 743 } | |
| 744 print MBIAS "\n"; | |
| 745 } | |
| 746 | |
| 747 if ( $gd_graph_installed){ | |
| 748 | |
| 749 add_colour(nice_blue => [31,120,180]); | |
| 750 add_colour(nice_orange => [255,127,0]); | |
| 751 add_colour(nice_green => [51,160,44]); | |
| 752 add_colour(pale_blue => [153,206,227]); | |
| 753 add_colour(pale_orange => [253,204,138]); | |
| 754 add_colour(pale_green => [191,230,207]); | |
| 755 | |
| 756 $graph1->set( | |
| 757 x_label => 'position (bp)', | |
| 758 y1_label => '% methylation', | |
| 759 y2_label => '# methylation calls', | |
| 760 title => $graph_title, | |
| 761 line_width => 2, | |
| 762 x_max_value => $max_length_1, | |
| 763 x_min_value => 0, | |
| 764 y_tick_number => 10, | |
| 765 y_label_skip => 2, | |
| 766 y1_max_value => 100, | |
| 767 y1_min_value => 0, | |
| 768 y_label_skip => 2, | |
| 769 y2_min_value => 0, | |
| 770 x_label_skip => 5, | |
| 771 x_label_position => 0.5, | |
| 772 x_tick_offset => -1, | |
| 773 bgclr => 'white', | |
| 774 transparent => 0, | |
| 775 two_axes => 1, | |
| 776 use_axis => [1,1,1,2,2,2], | |
| 777 legend_placement => 'RC', | |
| 778 legend_spacing => 6, | |
| 779 legend_marker_width => 24, | |
| 780 legend_marker_height => 18, | |
| 781 dclrs => [ qw(nice_blue nice_orange nice_green pale_blue pale_orange pale_green)], | |
| 782 ) or die $graph1->error; | |
| 783 | |
| 784 $graph1->set_legend('CpG methylation','CHG methylation','CHH methylation','CpG total calls','CHG total calls','CHH total calls'); | |
| 785 | |
| 786 ### Failure to plot the MBIAS graph will now generate a warning instead of dieing (previous version below. Suggested by Andrew DeiRossi, 05 June 2014) | |
| 787 if (my $gd1 = $graph1->plot(\@mbias_read1)) { | |
| 788 open (MBIAS_G1,'>',$mbias_graph_1) or die "Failed to write to file for M-bias plot 1: $!\n\n"; | |
| 789 binmode MBIAS_G1; | |
| 790 print MBIAS_G1 $gd1->png; | |
| 791 } | |
| 792 else { | |
| 793 warn "WARNING: Cannot generate read 1 M-bias plot: " , $graph1->error , "\n\n"; | |
| 794 } | |
| 795 | |
| 796 # my $gd1 = $graph1->plot(\@mbias_read1) or die $graph1->error; | |
| 797 # open (MBIAS_G1,'>',$mbias_graph_1) or die "Failed to write to file for M-bias plot 1: $!\n\n"; | |
| 798 # binmode MBIAS_G1; | |
| 799 # print MBIAS_G1 $gd1->png; | |
| 800 } | |
| 801 | |
| 802 if ($paired){ | |
| 803 | |
| 804 foreach my $context (qw(CpG CHG CHH)){ | |
| 805 @{$mbias_read2[0]} = (); | |
| 806 | |
| 807 print MBIAS "$context context (R2)\n================\n"; | |
| 808 print MBIAS "position\tcount methylated\tcount unmethylated\t% methylation\tcoverage\n"; | |
| 809 foreach my $pos (1..$max_length_2){ | |
| 810 | |
| 811 unless (defined $mbias_2{$context}->{$pos}->{meth}){ | |
| 812 $mbias_2{$context}->{$pos}->{meth} = 0; | |
| 813 } | |
| 814 unless (defined $mbias_2{$context}->{$pos}->{un}){ | |
| 815 $mbias_2{$context}->{$pos}->{un} = 0; | |
| 816 } | |
| 817 | |
| 818 my $percent = ''; | |
| 819 if (($mbias_2{$context}->{$pos}->{meth} + $mbias_2{$context}->{$pos}->{un}) > 0){ | |
| 820 $percent = sprintf("%.2f",$mbias_2{$context}->{$pos}->{meth} * 100/ ($mbias_2{$context}->{$pos}->{meth} + $mbias_2{$context}->{$pos}->{un}) ); | |
| 821 } | |
| 822 my $coverage = $mbias_2{$context}->{$pos}->{un} + $mbias_2{$context}->{$pos}->{meth}; | |
| 823 | |
| 824 print MBIAS "$pos\t$mbias_2{$context}->{$pos}->{meth}\t$mbias_2{$context}->{$pos}->{un}\t$percent\t$coverage\n"; | |
| 825 | |
| 826 push @{$mbias_read2[0]},$pos; | |
| 827 | |
| 828 if ($context eq 'CpG'){ | |
| 829 push @{$mbias_read2[1]},$percent; | |
| 830 push @{$mbias_read2[4]},$coverage; | |
| 831 } | |
| 832 elsif ($context eq 'CHG'){ | |
| 833 push @{$mbias_read2[2]},$percent; | |
| 834 push @{$mbias_read2[5]},$coverage; | |
| 835 } | |
| 836 elsif ($context eq 'CHH'){ | |
| 837 push @{$mbias_read2[3]},$percent; | |
| 838 push @{$mbias_read2[6]},$coverage; | |
| 839 } | |
| 840 } | |
| 841 print MBIAS "\n"; | |
| 842 } | |
| 843 | |
| 844 if ( $gd_graph_installed){ | |
| 845 | |
| 846 add_colour(nice_blue => [31,120,180]); | |
| 847 add_colour(nice_orange => [255,127,0]); | |
| 848 add_colour(nice_green => [51,160,44]); | |
| 849 add_colour(pale_blue => [153,206,227]); | |
| 850 add_colour(pale_orange => [253,204,138]); | |
| 851 add_colour(pale_green => [191,230,207]); | |
| 852 | |
| 853 $graph2->set( | |
| 854 x_label => 'position (bp)', | |
| 855 line_width => 2, | |
| 856 x_max_value => $max_length_1, | |
| 857 x_min_value => 0, | |
| 858 y_tick_number => 10, | |
| 859 y_label_skip => 2, | |
| 860 y1_max_value => 100, | |
| 861 y1_min_value => 0, | |
| 862 y_label_skip => 2, | |
| 863 y2_min_value => 0, | |
| 864 x_label_skip => 5, | |
| 865 x_label_position => 0.5, | |
| 866 x_tick_offset => -1, | |
| 867 bgclr => 'white', | |
| 868 transparent => 0, | |
| 869 two_axes => 1, | |
| 870 use_axis => [1,1,1,2,2,2], | |
| 871 legend_placement => 'RC', | |
| 872 legend_spacing => 6, | |
| 873 legend_marker_width => 24, | |
| 874 legend_marker_height => 18, | |
| 875 dclrs => [ qw(nice_blue nice_orange nice_green pale_blue pale_orange pale_green)], | |
| 876 x_label => 'position (bp)', | |
| 877 y1_label => '% methylation', | |
| 878 y2_label => '# calls', | |
| 879 title => 'M-bias (Read 2)', | |
| 880 ) or die $graph2->error; | |
| 881 | |
| 882 $graph2->set_legend('CpG methylation','CHG methylation','CHH methylation','CpG total calls','CHG total calls','CHH total calls'); | |
| 883 | |
| 884 ### Failure to plot the MBIAS graph will now generate a warning instead of dieing (previous version below. Suggested by Andrew DeiRossi, 05 June 2014) | |
| 885 if (my $gd2 = $graph2->plot(\@mbias_read2)) { | |
| 886 open (MBIAS_G2,'>',$mbias_graph_2) or die "Failed to write to file for M-bias plot 2: $!\n\n"; | |
| 887 binmode MBIAS_G2; | |
| 888 print MBIAS_G2 $gd2->png; | |
| 889 } | |
| 890 else { | |
| 891 warn "WARNING: Cannot generate Read 2 M-bias plot: " , $graph2->error , "\n\n"; | |
| 892 } | |
| 893 | |
| 894 # my $gd2 = $graph2->plot(\@mbias_read2) or die $graph2->error; | |
| 895 # open (MBIAS_G2,'>',$mbias_graph_2) or die "Failed to write to file for M-bias plot 2: $!\n\n"; | |
| 896 # binmode MBIAS_G2; | |
| 897 # print MBIAS_G2 $gd2->png; | |
| 898 | |
| 899 } | |
| 900 } | |
| 901 } | |
| 902 | |
| 903 sub process_commandline{ | |
| 904 my $help; | |
| 905 my $single_end; | |
| 906 my $paired_end; | |
| 907 my $ignore; | |
| 908 my $ignore_r2; | |
| 909 my $genomic_fasta; | |
| 910 my $full; | |
| 911 my $report; | |
| 912 my $extractor_version; | |
| 913 my $no_overlap; | |
| 914 my $merge_non_CpG; | |
| 915 my $vanilla; | |
| 916 my $output_dir; | |
| 917 my $no_header; | |
| 918 my $bedGraph; | |
| 919 my $coverage_threshold = 1; # Minimum number of reads covering before calling methylation status | |
| 920 my $remove; | |
| 921 my $counts; | |
| 922 my $cytosine_report; | |
| 923 my $genome_folder; | |
| 924 my $zero; | |
| 925 my $CpG_only; | |
| 926 my $CX_context; | |
| 927 my $split_by_chromosome; | |
| 928 my $sort_size; | |
| 929 my $samtools_path; | |
| 930 my $gzip; | |
| 931 my $mbias_only; | |
| 932 my $mbias_off; | |
| 933 my $gazillion; | |
| 934 my $ample_mem; | |
| 935 my $include_overlap; | |
| 936 my $ignore_3prime; | |
| 937 my $ignore_3prime_r2; | |
| 938 my $multicore; | |
| 939 | |
| 940 my $command_line = GetOptions ('help|man' => \$help, | |
| 941 'p|paired-end' => \$paired_end, | |
| 942 's|single-end' => \$single_end, | |
| 943 'fasta' => \$genomic_fasta, | |
| 944 'ignore=i' => \$ignore, | |
| 945 'ignore_r2=i' => \$ignore_r2, | |
| 946 'comprehensive' => \$full, | |
| 947 'report' => \$report, | |
| 948 'version' => \$extractor_version, | |
| 949 'no_overlap' => \$no_overlap, | |
| 950 'merge_non_CpG' => \$merge_non_CpG, | |
| 951 'vanilla' => \$vanilla, | |
| 952 'o|output=s' => \$output_dir, | |
| 953 'no_header' => \$no_header, | |
| 954 'bedGraph' => \$bedGraph, | |
| 955 "cutoff=i" => \$coverage_threshold, | |
| 956 "remove_spaces" => \$remove, | |
| 957 "counts" => \$counts, | |
| 958 "cytosine_report" => \$cytosine_report, | |
| 959 'g|genome_folder=s' => \$genome_folder, | |
| 960 "zero_based" => \$zero, | |
| 961 "CX|CX_context" => \$CX_context, | |
| 962 "split_by_chromosome" => \$split_by_chromosome, | |
| 963 "buffer_size=s" => \$sort_size, | |
| 964 'samtools_path=s' => \$samtools_path, | |
| 965 'gzip' => \$gzip, | |
| 966 'mbias_only' => \$mbias_only, | |
| 967 'mbias_off' => \$mbias_off, | |
| 968 'gazillion|scaffolds' => \$gazillion, | |
| 969 'ample_memory' => \$ample_mem, | |
| 970 'include_overlap' => \$include_overlap, | |
| 971 'ignore_3prime=i' => \$ignore_3prime, | |
| 972 'ignore_3prime_r2=i' => \$ignore_3prime_r2, | |
| 973 'multicore=i' => \$multicore, | |
| 974 ); | |
| 975 | |
| 976 ### EXIT ON ERROR if there were errors with any of the supplied options | |
| 977 unless ($command_line){ | |
| 978 die "Please respecify command line options\n"; | |
| 979 } | |
| 980 | |
| 981 ### HELPFILE | |
| 982 if ($help){ | |
| 983 print_helpfile(); | |
| 984 exit; | |
| 985 } | |
| 986 | |
| 987 if ($extractor_version){ | |
| 988 print << "VERSION"; | |
| 989 | |
| 990 | |
| 991 Bismark Methylation Extractor | |
| 992 | |
| 993 Bismark Extractor Version: $version | |
| 994 Copyright 2010-15 Felix Krueger, Babraham Bioinformatics | |
| 995 www.bioinformatics.babraham.ac.uk/projects/bismark/ | |
| 996 | |
| 997 | |
| 998 VERSION | |
| 999 exit; | |
| 1000 } | |
| 1001 | |
| 1002 | |
| 1003 ### no files provided | |
| 1004 unless (@ARGV){ | |
| 1005 die "You need to provide one or more Bismark files to create an individual C methylation output. Please respecify!\n"; | |
| 1006 } | |
| 1007 @filenames = @ARGV; | |
| 1008 | |
| 1009 warn "\n *** Bismark methylation extractor version $version ***\n\n"; | |
| 1010 | |
| 1011 ### M-BIAS ONLY | |
| 1012 if ($mbias_only){ | |
| 1013 | |
| 1014 if ($mbias_off){ | |
| 1015 die "Options '--mbias_only' and '--mbias_off' are not compatible. Just pick one, mkay?\n"; | |
| 1016 } | |
| 1017 if ($bedGraph){ | |
| 1018 die "Option '--mbias_only' skips all sorts of methylation extraction, including the bedGraph generation. Please respecify!\n"; | |
| 1019 } | |
| 1020 if ($cytosine_report){ | |
| 1021 die "Option '--mbias_only' skips all sorts of methylation extraction, including the genome-wide cytosine methylation report generation. Please respecify!\n"; | |
| 1022 } | |
| 1023 if ($merge_non_CpG){ | |
| 1024 warn "Option '--mbias_only' skips all sorts of methylation extraction, thus '--merge' won't have any effect\n"; | |
| 1025 } | |
| 1026 if ($full){ | |
| 1027 warn "Option '--mbias_only' skips all sorts of methylation extraction, thus '--comprehensive' won't have any effect\n"; | |
| 1028 } | |
| 1029 sleep(3); | |
| 1030 } | |
| 1031 | |
| 1032 ### PRINT A REPORT | |
| 1033 unless ($report){ | |
| 1034 $report = 1; # making this the default | |
| 1035 } | |
| 1036 | |
| 1037 ### OUTPUT DIR PATH | |
| 1038 if ($output_dir){ | |
| 1039 unless ($output_dir =~ /\/$/){ | |
| 1040 $output_dir =~ s/$/\//; | |
| 1041 } | |
| 1042 } | |
| 1043 else{ | |
| 1044 $output_dir = ''; | |
| 1045 } | |
| 1046 | |
| 1047 ### NO HEADER | |
| 1048 unless ($no_header){ | |
| 1049 $no_header = 0; | |
| 1050 } | |
| 1051 | |
| 1052 ### OLD (VANILLA) OUTPUT FORMAT | |
| 1053 unless ($vanilla){ | |
| 1054 $vanilla = 0; | |
| 1055 } | |
| 1056 | |
| 1057 if ($single_end){ | |
| 1058 $paired_end = 0; ### SINGLE END ALIGNMENTS | |
| 1059 } | |
| 1060 elsif ($paired_end){ | |
| 1061 $single_end = 0; ### PAIRED-END ALIGNMENTS | |
| 1062 } | |
| 1063 else{ | |
| 1064 | |
| 1065 ### we will try to determine whether the input file was a single-end or paired-end sequencing run from the SAM header | |
| 1066 | |
| 1067 if ($vanilla){ | |
| 1068 die "Please specify whether the supplied file(s) are in Bismark single-end or paired-end format with '-s' or '-p'\n\n"; | |
| 1069 } | |
| 1070 else{ # SAM/BAM format | |
| 1071 | |
| 1072 my $file = $filenames[0]; | |
| 1073 warn "Trying to determine the type of mapping from the SAM header line of file $file\n"; sleep(1); | |
| 1074 | |
| 1075 ### if the user did not specify whether the alignment file was single-end or paired-end we are trying to get this information from the @PG header line in the SAM/BAM file | |
| 1076 if ($file =~ /\.gz$/){ | |
| 1077 open (DETERMINE,"gunzip -c $file |") or die "Unable to read from gzipped file $file: $!\n"; | |
| 1078 } | |
| 1079 elsif ($file =~ /\.cram$/ || $file =~ /\.bam$/ || isBam($file) ){ ### this would allow to read BAM files that do not end in *.bam | |
| 1080 open (DETERMINE,"samtools view -h $file |") or die "Unable to read from BAM/CRAM file $file: $!\n"; | |
| 1081 } | |
| 1082 else{ | |
| 1083 open (DETERMINE,$file) or die "Unable to read from $file: $!\n"; | |
| 1084 } | |
| 1085 | |
| 1086 while (<DETERMINE>){ | |
| 1087 last unless (/^\@/); | |
| 1088 if ($_ =~ /^\@PG/){ | |
| 1089 # warn "found the \@PG line:\n"; | |
| 1090 # warn "$_"; | |
| 1091 | |
| 1092 if ($_ =~ /\s+-1\s+/ and $_ =~ /\s+-2\s+/){ | |
| 1093 warn "Treating file(s) as paired-end data (as extracted from \@PG line)\n\n"; sleep(1); | |
| 1094 $paired_end = 1; | |
| 1095 $single_end = 0; | |
| 1096 } | |
| 1097 else{ | |
| 1098 warn "Treating file(s) as single-end data (as extracted from \@PG line)\n\n"; sleep(1); | |
| 1099 $paired_end = 0; | |
| 1100 $single_end = 1; | |
| 1101 } | |
| 1102 } | |
| 1103 } | |
| 1104 | |
| 1105 # close DETERMINE or warn $!; # this always throws an error anyway... | |
| 1106 | |
| 1107 } | |
| 1108 } | |
| 1109 | |
| 1110 ### IGNORING <INT> 5' END | |
| 1111 # bases at the start of the read when processing the methylation call string | |
| 1112 unless ($ignore){ | |
| 1113 $ignore = 0; | |
| 1114 } | |
| 1115 | |
| 1116 if (defined $ignore_r2){ | |
| 1117 die "You can only specify --ignore_r2 for paired-end result files\n" unless ($paired_end); | |
| 1118 } | |
| 1119 else{ | |
| 1120 $ignore_r2 = 0; | |
| 1121 } | |
| 1122 | |
| 1123 ### IGNORING <INT> 3' END | |
| 1124 # bases at the end of the read when processing the methylation call string | |
| 1125 unless ($ignore_3prime){ | |
| 1126 $ignore_3prime = 0; | |
| 1127 } | |
| 1128 | |
| 1129 if (defined $ignore_3prime_r2){ | |
| 1130 die "You can only specify --ignore_3prime_r2 for paired-end result files\n" unless ($paired_end); | |
| 1131 } | |
| 1132 else{ | |
| 1133 $ignore_3prime_r2 = 0; | |
| 1134 } | |
| 1135 | |
| 1136 | |
| 1137 ### NO OVERLAP | |
| 1138 ### --no_overlap is the default (as of version 0.12.6), unless someone explicitly asks to include overlaps | |
| 1139 if ($include_overlap){ | |
| 1140 die "The option '--include_overlap' can only be specified for paired-end input!\n" unless ($paired_end); | |
| 1141 warn "Setting option '--inlcude_overlap' for paired-end data (user-defined)\n\n"; | |
| 1142 $no_overlap = 0; | |
| 1143 } | |
| 1144 else{ # default | |
| 1145 if ($paired_end){ | |
| 1146 warn "Setting option '--no_overlap' since this is (normally) the right thing to do for paired-end data\n\n"; | |
| 1147 $no_overlap = 1; | |
| 1148 } | |
| 1149 } | |
| 1150 | |
| 1151 ### COMPREHENSIVE OUTPUT | |
| 1152 unless ($full){ | |
| 1153 $full = 0; | |
| 1154 } | |
| 1155 | |
| 1156 ### MERGE NON-CpG context | |
| 1157 unless ($merge_non_CpG){ | |
| 1158 $merge_non_CpG = 0; | |
| 1159 } | |
| 1160 | |
| 1161 ### remove white spaces in read ID (needed for sorting using the sort command | |
| 1162 unless ($remove){ | |
| 1163 $remove = 0; | |
| 1164 } | |
| 1165 | |
| 1166 ### COVERAGE THRESHOLD FOR bedGraph OUTPUT | |
| 1167 if (defined $coverage_threshold){ | |
| 1168 unless ($coverage_threshold > 0){ | |
| 1169 die "Please select a coverage greater than 0 (positive integers only)\n"; | |
| 1170 } | |
| 1171 } | |
| 1172 else{ | |
| 1173 $coverage_threshold = 1; | |
| 1174 } | |
| 1175 | |
| 1176 ### SORT buffer size | |
| 1177 if (defined $sort_size){ | |
| 1178 unless ($sort_size =~ /^\d+\%$/ or $sort_size =~ /^\d+(K|M|G|T)$/){ | |
| 1179 die "Please select a buffer size as percentage (e.g. --buffer_size 20%) or a number to be multiplied with K, M, G, T etc. (e.g. --buffer_size 20G). For more information on sort type 'info sort' on a command line\n"; | |
| 1180 } | |
| 1181 } | |
| 1182 else{ | |
| 1183 $sort_size = '2G'; | |
| 1184 } | |
| 1185 | |
| 1186 if ($zero){ | |
| 1187 die "Option '--zero' is only available if '--bedGraph' or '--cytosine_report' are specified as well. Please respecify\n" unless ($cytosine_report or $bedGraph); | |
| 1188 } | |
| 1189 | |
| 1190 if ($CX_context){ | |
| 1191 die "Option '--CX_context' is only available if '--bedGraph' or '--cytosine_report' are specified as well. Please respecify\n" unless ($cytosine_report or $bedGraph); | |
| 1192 } | |
| 1193 else{ | |
| 1194 $CX_context = 0; | |
| 1195 } | |
| 1196 | |
| 1197 unless ($counts){ | |
| 1198 $counts = 1; # counts will always be set | |
| 1199 } | |
| 1200 | |
| 1201 if ($cytosine_report){ | |
| 1202 | |
| 1203 ### GENOME folder | |
| 1204 if ($genome_folder){ | |
| 1205 unless ($genome_folder =~/\/$/){ | |
| 1206 $genome_folder =~ s/$/\//; | |
| 1207 } | |
| 1208 } | |
| 1209 else{ | |
| 1210 die "Please specify a genome folder to proceed (full path only)\n"; | |
| 1211 } | |
| 1212 | |
| 1213 unless ($bedGraph){ | |
| 1214 warn "Setting the option '--bedGraph' since this is required for the genome-wide cytosine report\n"; | |
| 1215 $bedGraph = 1; | |
| 1216 } | |
| 1217 unless ($counts){ | |
| 1218 # warn "Setting the option '--counts' since this is required for the genome-wide cytosine report\n"; | |
| 1219 $counts = 1; | |
| 1220 } | |
| 1221 warn "\n"; | |
| 1222 } | |
| 1223 | |
| 1224 ### PATH TO SAMTOOLS | |
| 1225 if (defined $samtools_path){ | |
| 1226 # if Samtools was specified as full command | |
| 1227 if ($samtools_path =~ /samtools$/){ | |
| 1228 if (-e $samtools_path){ | |
| 1229 # Samtools executable found | |
| 1230 } | |
| 1231 else{ | |
| 1232 die "Could not find an installation of Samtools at the location $samtools_path. Please respecify\n"; | |
| 1233 } | |
| 1234 } | |
| 1235 else{ | |
| 1236 unless ($samtools_path =~ /\/$/){ | |
| 1237 $samtools_path =~ s/$/\//; | |
| 1238 } | |
| 1239 $samtools_path .= 'samtools'; | |
| 1240 if (-e $samtools_path){ | |
| 1241 # Samtools executable found | |
| 1242 } | |
| 1243 else{ | |
| 1244 die "Could not find an installation of Samtools at the location $samtools_path. Please respecify\n"; | |
| 1245 } | |
| 1246 } | |
| 1247 } | |
| 1248 # Check whether Samtools is in the PATH if no path was supplied by the user | |
| 1249 else{ | |
| 1250 if (!system "which samtools >/dev/null 2>&1"){ # STDOUT is binned, STDERR is redirected to STDOUT. Returns 0 if Samtools is in the PATH | |
| 1251 $samtools_path = `which samtools`; | |
| 1252 chomp $samtools_path; | |
| 1253 } | |
| 1254 } | |
| 1255 | |
| 1256 unless (defined $samtools_path){ | |
| 1257 $samtools_path = ''; | |
| 1258 } | |
| 1259 | |
| 1260 | |
| 1261 if ($gazillion){ | |
| 1262 if ($ample_mem){ | |
| 1263 die "You can't currently select '--ample_mem' together with '--gazillion'. Make your pick!\n\n"; | |
| 1264 } | |
| 1265 } | |
| 1266 | |
| 1267 if (defined $multicore){ | |
| 1268 unless ($multicore > 0){ | |
| 1269 die "Core usage needs to be set to 1 or more (currently selected $multicore). Please respecify!\n"; | |
| 1270 } | |
| 1271 if ($multicore > 20){ | |
| 1272 warn "Core usage currently set to more than 20 threads. Let's see how this goes... (set value: $multicore)\n\n"; | |
| 1273 } | |
| 1274 } | |
| 1275 else{ | |
| 1276 $multicore = 1; # default. Single-thread mode | |
| 1277 warn "Setting core usage to single-threaded (default). Consider using --multicore <int> to speed up the extraction process.\n\n"; | |
| 1278 } | |
| 1279 | |
| 1280 return ($ignore,$genomic_fasta,$single_end,$paired_end,$full,$report,$no_overlap,$merge_non_CpG,$vanilla,$output_dir,$no_header,$bedGraph,$remove,$coverage_threshold,$counts,$cytosine_report,$genome_folder,$zero,$CpG_only,$CX_context,$split_by_chromosome,$sort_size,$samtools_path,$gzip,$ignore_r2,$mbias_off,$mbias_only,$gazillion,$ample_mem,$ignore_3prime,$ignore_3prime_r2,$multicore); | |
| 1281 } | |
| 1282 | |
| 1283 | |
| 1284 sub test_positional_sorting{ | |
| 1285 | |
| 1286 my $filename = shift; | |
| 1287 | |
| 1288 print "\nNow testing Bismark result file $filename for positional sorting (which would be bad...)\t"; | |
| 1289 sleep(1); | |
| 1290 | |
| 1291 if ($filename =~ /\.gz$/) { | |
| 1292 open (TEST,"gunzip -c $filename |") or die "Can't open gzipped file $filename: $!\n"; | |
| 1293 } | |
| 1294 elsif ($filename =~ /bam$/ || $filename =~ /cram$/ || isBam($filename) ){ ### this would allow to read BAM files that do not end in *.bam | |
| 1295 if ($samtools_path){ | |
| 1296 open (TEST,"$samtools_path view -h $filename |") or die "Can't open BAM/CRAM file $filename: $!\n"; | |
| 1297 } | |
| 1298 else{ | |
| 1299 die "Sorry couldn't find an installation of Samtools. Either specifiy an alternative path using the option '--samtools_path /your/path/', or use a SAM file instead\n\n"; | |
| 1300 } | |
| 1301 } | |
| 1302 else { | |
| 1303 open (TEST,$filename) or die "Can't open file $filename: $!\n"; | |
| 1304 } | |
| 1305 | |
| 1306 my $count = 0; | |
| 1307 | |
| 1308 while (<TEST>) { | |
| 1309 if (/^\@/) { # testing header lines if they contain the @SO flag (for being sorted) | |
| 1310 if (/^\@SO/) { | |
| 1311 die "SAM/BAM header line '$_' indicates that the Bismark aligment file has been sorted by chromosomal positions which is is incompatible with correct methylation extraction. Please use an unsorted file instead\n\n"; | |
| 1312 } | |
| 1313 next; | |
| 1314 } | |
| 1315 $count++; | |
| 1316 | |
| 1317 last if ($count > 100000); # else we test the first 100000 sequences if they start with the same read ID | |
| 1318 | |
| 1319 my ($id_1) = (split (/\t/)); | |
| 1320 | |
| 1321 ### reading the next line which should be read 2 | |
| 1322 $_ = <TEST>; | |
| 1323 my ($id_2) = (split (/\t/)); | |
| 1324 last unless ($id_2); | |
| 1325 ++$count; | |
| 1326 | |
| 1327 if ($id_1 eq $id_2){ | |
| 1328 ### ids are the same | |
| 1329 next; | |
| 1330 } | |
| 1331 else{ ### in previous versions of Bismark we appended /1 and /2 to the read IDs for easier eyeballing which read is which. These tags need to be removed first | |
| 1332 my $id_1_trunc = $id_1; | |
| 1333 $id_1_trunc =~ s/\/1$//; | |
| 1334 my $id_2_trunc = $id_2; | |
| 1335 $id_2_trunc =~ s/\/2$//; | |
| 1336 | |
| 1337 unless ($id_1_trunc eq $id_2_trunc){ | |
| 1338 die "The IDs of Read 1 ($id_1) and Read 2 ($id_2) are not the same. This might be a result of sorting the paired-end SAM/BAM files by chromosomal position which is not compatible with correct methylation extraction. Please use an unsorted file instead\n\n"; | |
| 1339 } | |
| 1340 } | |
| 1341 } | |
| 1342 # close TEST or die $!; somehow fails on our cluster... | |
| 1343 ### If it hasen't died so far then it seems the file is in the correct Bismark format (read 1 and read 2 of a pair directly following each other) | |
| 1344 warn "...passed!\n"; | |
| 1345 sleep(1); | |
| 1346 | |
| 1347 } | |
| 1348 | |
| 1349 sub process_Bismark_results_file{ | |
| 1350 | |
| 1351 my $filename = shift; | |
| 1352 my $report_filename = open_output_filehandles($filename); | |
| 1353 | |
| 1354 ### disabling buffering so we don't run into problems with half written out lines... | |
| 1355 foreach my $fh (keys %fhs){ | |
| 1356 if ($fh =~ /^[1230]$/) { | |
| 1357 foreach my $context (keys %{$fhs{$fh}}) { | |
| 1358 select($fhs{$fh}->{$context}); | |
| 1359 $|++; | |
| 1360 } | |
| 1361 } | |
| 1362 else{ | |
| 1363 select($fhs{$fh}); | |
| 1364 $|++; | |
| 1365 } | |
| 1366 } | |
| 1367 select(STDOUT); | |
| 1368 | |
| 1369 ################################################ | |
| 1370 ################################################ | |
| 1371 ### multi-process handling | |
| 1372 ### | |
| 1373 | |
| 1374 my $offset = 1; | |
| 1375 my $process_id; | |
| 1376 my @pids; | |
| 1377 if ($multicore > 1){ | |
| 1378 | |
| 1379 until ($offset == $multicore){ | |
| 1380 # warn "multicore: $multicore\noffset: $offset\n"; | |
| 1381 my $fork = fork; | |
| 1382 | |
| 1383 if (defined $fork){ | |
| 1384 if ($fork != 0){ | |
| 1385 $process_id = $fork; | |
| 1386 push @pids, $process_id; | |
| 1387 if ($offset < $multicore){ | |
| 1388 ++$offset; | |
| 1389 # warn "I am the parent process, child pid: $fork\nIncrementing offset counter to: $offset\n\n"; | |
| 1390 } | |
| 1391 else{ | |
| 1392 # warn "Reached the number of maximum multicores. Proceeeding to processing...\n"; | |
| 1393 } | |
| 1394 } | |
| 1395 elsif ($fork == 0){ | |
| 1396 # warn "I am a child process, pid: $fork\nOffset counter is: $offset\nProceeding to processing...\n"; | |
| 1397 $process_id = $fork; | |
| 1398 last; | |
| 1399 } | |
| 1400 } | |
| 1401 else{ | |
| 1402 die "Forking unsuccessful. Proceeding using a single thread only\n"; | |
| 1403 } | |
| 1404 } | |
| 1405 | |
| 1406 # warn "\nThe thread identity\n===================\n"; | |
| 1407 if ($process_id){ | |
| 1408 # print "I am the parent process. My children are called:\n"; | |
| 1409 # print join ("\t",@pids),"\n"; | |
| 1410 # print "I am going to process the following line count: $offset\n\n"; | |
| 1411 } | |
| 1412 elsif($process_id == 0){ | |
| 1413 # warn "I am a child process: Process ID: $process_id\n"; | |
| 1414 # warn "I am going to process the following line count: $offset\n\n"; | |
| 1415 } | |
| 1416 else{ | |
| 1417 die "Process ID was: $process_id\n"; | |
| 1418 } | |
| 1419 } | |
| 1420 else{ | |
| 1421 # warn "Single-core mode: setting pid to 1\n"; | |
| 1422 $process_id = 1; | |
| 1423 } | |
| 1424 | |
| 1425 ################################################ | |
| 1426 ################################################ | |
| 1427 if ($process_id){ | |
| 1428 warn "Now reading in Bismark result file $filename\n"; | |
| 1429 } | |
| 1430 else{ | |
| 1431 warn "\nNow reading in Bismark result file $filename\n\n"; | |
| 1432 } | |
| 1433 | |
| 1434 if ($filename =~ /\.gz$/) { | |
| 1435 open (IN,"gunzip -c $filename |") or die "Can't open gzipped file $filename: $!\n"; | |
| 1436 } | |
| 1437 elsif ($filename =~ /bam$/ || $filename =~ /cram$/ || isBam($filename) ){ ### this would allow to read BAM files that do not end in *.bam | |
| 1438 if ($samtools_path){ | |
| 1439 open (IN,"$samtools_path view -h $filename |") or die "Can't open BAM/CRAM file $filename: $!\n"; | |
| 1440 } | |
| 1441 else{ | |
| 1442 die "Sorry couldn't find an installation of Samtools. Either specifiy an alternative path using the option '--samtools_path /your/path/', or use a SAM file instead\n\n"; | |
| 1443 } | |
| 1444 } | |
| 1445 else { | |
| 1446 open (IN,$filename) or die "Can't open file $filename: $!\n"; | |
| 1447 } | |
| 1448 | |
| 1449 ### Vanilla and SAM output need to read different numbers of header lines | |
| 1450 if ($vanilla) { | |
| 1451 my $bismark_version = <IN>; ## discarding the Bismark version info | |
| 1452 chomp $bismark_version; | |
| 1453 $bismark_version =~ s/\r//; # replaces \r line feed | |
| 1454 $bismark_version =~ s/Bismark version: //; | |
| 1455 if ($bismark_version =~ /^\@/) { | |
| 1456 warn "Detected \@ as the first character of the version information. Is it possible that the file is in SAM format?\n\n"; | |
| 1457 sleep (1); | |
| 1458 } | |
| 1459 | |
| 1460 unless ($version eq $bismark_version){ | |
| 1461 die "The methylation extractor and Bismark itself need to be of the same version!\n\nVersions used:\nmethylation extractor: '$version'\nBismark: '$bismark_version'\n"; | |
| 1462 } | |
| 1463 } else { | |
| 1464 # If the read is in SAM format (default) it can either start with @ header lines or start with alignments directly. | |
| 1465 # We are reading from it further down | |
| 1466 } | |
| 1467 | |
| 1468 my $methylation_call_strings_processed = 0; | |
| 1469 my $line_count = 0; | |
| 1470 | |
| 1471 ### proceeding differently now for single-end or paired-end Bismark files | |
| 1472 | |
| 1473 ### PROCESSING SINGLE-END RESULT FILES | |
| 1474 if ($single) { | |
| 1475 | |
| 1476 ### also proceeding differently now for SAM format or vanilla Bismark format files | |
| 1477 if ($vanilla) { # old vanilla Bismark output format | |
| 1478 while (<IN>) { | |
| 1479 ++$line_count; | |
| 1480 warn "Processed lines: $line_count\n" if ($line_count%500000==0); | |
| 1481 | |
| 1482 if ( ($line_count - $offset)%$multicore == 0){ | |
| 1483 # warn "line count: $line_count\noffset: $offset\n"; | |
| 1484 # warn "Modulus: ",($line_count - $offset)%$multicore,"\n"; | |
| 1485 # warn "processing this line $line_count (processID: $process_id with \$offset $offset)\n"; | |
| 1486 } | |
| 1487 else{ | |
| 1488 # warn "skipping line $line_count for processID: $process_id with \$offset $offset)\n"; | |
| 1489 next; | |
| 1490 } | |
| 1491 | |
| 1492 ### $seq here is the chromosomal sequence (to use for the repeat analysis for example) | |
| 1493 my ($id,$strand,$chrom,$start,$seq,$meth_call,$read_conversion,$genome_conversion) = (split("\t"))[0,1,2,3,6,7,8,9]; | |
| 1494 | |
| 1495 ### we need to remove 2 bp of the genomic sequence as we were extracting read + 2bp long fragments to make a methylation call at the first or | |
| 1496 ### last position | |
| 1497 chomp $genome_conversion; | |
| 1498 | |
| 1499 my $index; | |
| 1500 if ($meth_call) { | |
| 1501 | |
| 1502 if ($read_conversion eq 'CT' and $genome_conversion eq 'CT') { ## original top strand | |
| 1503 $index = 0; | |
| 1504 } elsif ($read_conversion eq 'GA' and $genome_conversion eq 'CT') { ## complementary to original top strand | |
| 1505 $index = 1; | |
| 1506 } elsif ($read_conversion eq 'CT' and $genome_conversion eq 'GA') { ## original bottom strand | |
| 1507 $index = 3; | |
| 1508 } elsif ($read_conversion eq 'GA' and $genome_conversion eq 'GA') { ## complementary to original bottom strand | |
| 1509 $index = 2; | |
| 1510 } else { | |
| 1511 die "Unexpected combination of read and genome conversion: '$read_conversion' / '$genome_conversion'\n"; | |
| 1512 } | |
| 1513 | |
| 1514 ### Clipping off the first <int> number of bases from the methylation call string as specified with --ignore <int> | |
| 1515 if ($ignore) { | |
| 1516 $meth_call = substr($meth_call,$ignore,length($meth_call)-$ignore); | |
| 1517 | |
| 1518 ### If we are clipping off some bases at the start we need to adjust the start position of the alignments accordingly! | |
| 1519 if ($strand eq '+') { | |
| 1520 $start += $ignore; | |
| 1521 } | |
| 1522 elsif ($strand eq '-') { | |
| 1523 $start += length($meth_call)-1; ## $meth_call is already shortened! | |
| 1524 } | |
| 1525 else { | |
| 1526 die "Alignment did not have proper strand information: $strand\n"; | |
| 1527 } | |
| 1528 } | |
| 1529 | |
| 1530 ### Clipping off the last <int> number of bases from the methylation call string as specified with --ignore_3prime <int> | |
| 1531 if ($ignore_3prime) { | |
| 1532 | |
| 1533 $meth_call = substr($meth_call,0, (length($meth_call)) - $ignore_3prime); | |
| 1534 | |
| 1535 ### If we are clipping off some bases at the end we need to adjust the end position of the alignments accordingly | |
| 1536 if ($strand eq '+') { | |
| 1537 # clipping the 3' end does not affect the starting position # ignore 5' has already been taken care of, if relevant at all | |
| 1538 } | |
| 1539 elsif ($strand eq '-') { | |
| 1540 # here we need to discriminate if the start has been adjusted because of --ignore or not | |
| 1541 if ($ignore){ | |
| 1542 # position adjusted already, and because of this 3' trimming is irrelevant for the start position | |
| 1543 } | |
| 1544 else{ | |
| 1545 # Here we need to add the length ignore_3prime to the read starting position, adjustment of the start position will take place later in the methylation extraction step | |
| 1546 $start += $ignore_3prime; | |
| 1547 } | |
| 1548 } | |
| 1549 else { | |
| 1550 die "Alignment did not have proper strand information: $strand\n"; | |
| 1551 } | |
| 1552 } | |
| 1553 ### just as a comment, if --ignore has not been specified the starting position of reverse reads is adjusted later at the methylation extraction stage | |
| 1554 | |
| 1555 ### printing out the methylation state of every C in the read | |
| 1556 print_individual_C_methylation_states_single_end($meth_call,$chrom,$start,$id,$strand,$index); | |
| 1557 | |
| 1558 ++$methylation_call_strings_processed; # 1 per single-end result | |
| 1559 } | |
| 1560 } | |
| 1561 } else { # processing single-end SAM format (default) | |
| 1562 while (<IN>) { | |
| 1563 chomp; | |
| 1564 ### SAM format can either start with header lines (starting with @) or start with alignments directly | |
| 1565 if (/^\@/) { # skipping header lines (starting with @) | |
| 1566 warn "skipping SAM header line:\t$_\n" unless ($process_id == 0); | |
| 1567 next; | |
| 1568 } | |
| 1569 | |
| 1570 ++$line_count; | |
| 1571 # warn "$line_count\n"; | |
| 1572 warn "Processed lines: $line_count\n" if ($line_count%500000 == 0); | |
| 1573 | |
| 1574 if ( ($line_count - $offset)%$multicore == 0){ | |
| 1575 # warn "line count: $line_count\noffset: $offset\n"; | |
| 1576 # warn "Modulus: ",($line_count - $offset)%$multicore,"\n"; | |
| 1577 # warn "processing this line $line_count (processID: $process_id with \$offset $offset)\n"; | |
| 1578 } | |
| 1579 else{ | |
| 1580 # warn "skipping line $line_count for processID: $process_id with \$offset $offset)\n"; | |
| 1581 next; | |
| 1582 } | |
| 1583 | |
| 1584 # example read in SAM format | |
| 1585 # 1_R1/1 67 5 103172224 255 40M = 103172417 233 AATATTTTTTTTATTTTAAAATGTGTATTGATTTAAATTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:4 XX:Z:4T1T24TT7 XM:Z:....h.h........................hh....... XR:Z:CT XG:Z:CT | |
| 1586 ### | |
| 1587 | |
| 1588 # < 0.7.6 my ($id,$chrom,$start,$meth_call,$read_conversion,$genome_conversion) = (split("\t"))[0,2,3,13,14,15]; | |
| 1589 # < 0.7.6 $meth_call =~ s/^XM:Z://; | |
| 1590 # < 0.7.6 $read_conversion =~ s/^XR:Z://; | |
| 1591 # < 0.7.6 $genome_conversion =~ s/^XG:Z://; | |
| 1592 | |
| 1593 my ($id,$chrom,$start,$cigar) = (split("\t"))[0,2,3,5]; | |
| 1594 | |
| 1595 ### detecting the following SAM flags in case the SAM entry was shuffled by CRAM or Goby compression/decompression | |
| 1596 my $meth_call; ### Thanks to Zachary Zeno for this solution | |
| 1597 my $read_conversion; | |
| 1598 my $genome_conversion; | |
| 1599 | |
| 1600 while ( /(XM|XR|XG):Z:([^\t]+)/g ) { | |
| 1601 my $tag = $1; | |
| 1602 my $value = $2; | |
| 1603 | |
| 1604 if ($tag eq "XM") { | |
| 1605 $meth_call = $value; | |
| 1606 $meth_call =~ s/\r//; | |
| 1607 } elsif ($tag eq "XR") { | |
| 1608 $read_conversion = $value; | |
| 1609 $read_conversion =~ s/\r//; | |
| 1610 } elsif ($tag eq "XG") { | |
| 1611 $genome_conversion = $value; | |
| 1612 $genome_conversion =~ s/\r//; | |
| 1613 } | |
| 1614 } | |
| 1615 | |
| 1616 my $strand; | |
| 1617 # warn "$meth_call\n$read_conversion\n$genome_conversion\n"; | |
| 1618 | |
| 1619 my $index; | |
| 1620 if ($meth_call) { | |
| 1621 if ($read_conversion eq 'CT' and $genome_conversion eq 'CT') { ## original top strand | |
| 1622 $index = 0; | |
| 1623 $strand = '+'; | |
| 1624 } elsif ($read_conversion eq 'GA' and $genome_conversion eq 'CT') { ## complementary to original top strand | |
| 1625 $index = 1; | |
| 1626 $strand = '-'; | |
| 1627 } elsif ($read_conversion eq 'GA' and $genome_conversion eq 'GA') { ## complementary to original bottom strand | |
| 1628 $index = 2; | |
| 1629 $strand = '+'; | |
| 1630 } elsif ($read_conversion eq 'CT' and $genome_conversion eq 'GA') { ## original bottom strand | |
| 1631 $index = 3; | |
| 1632 $strand = '-'; | |
| 1633 } else { | |
| 1634 die "Unexpected combination of read and genome conversion: '$read_conversion' / '$genome_conversion'\n"; | |
| 1635 } | |
| 1636 | |
| 1637 ### If the read is in SAM format we need to reverse the methylation call if the read has been reverse-complemented for the output | |
| 1638 if ($strand eq '-') { | |
| 1639 $meth_call = reverse $meth_call; | |
| 1640 } | |
| 1641 # warn "\n$meth_call\n"; | |
| 1642 | |
| 1643 ### IGNORE 5 PRIME: Clipping off the first <int> number of bases from the methylation call string as specified with --ignore <int> | |
| 1644 if ($ignore) { | |
| 1645 # warn "\n\n$meth_call\n"; | |
| 1646 $meth_call = substr($meth_call,$ignore,length($meth_call)-$ignore); | |
| 1647 # warn "$meth_call\n";sleep(1); | |
| 1648 | |
| 1649 ### If we are ignoring a part of the sequence we also need to adjust the cigar string accordingly | |
| 1650 | |
| 1651 my @len = split (/\D+/,$cigar); # storing the length per operation | |
| 1652 my @ops = split (/\d+/,$cigar); # storing the operation | |
| 1653 shift @ops; # remove the empty first element | |
| 1654 die "CIGAR string contained a non-matching number of lengths and operations\n" unless (scalar @len == scalar @ops); | |
| 1655 | |
| 1656 my @comp_cigar; # building an array with all CIGAR operations | |
| 1657 foreach my $index (0..$#len) { | |
| 1658 foreach (1..$len[$index]) { | |
| 1659 # print "$ops[$index]"; | |
| 1660 push @comp_cigar, $ops[$index]; | |
| 1661 } | |
| 1662 } | |
| 1663 # print "original CIGAR: $cigar\n"; | |
| 1664 # print "original CIGAR: @comp_cigar\n"; | |
| 1665 | |
| 1666 ### If we are clipping off some bases at the start we need to adjust the start position of the alignments accordingly! | |
| 1667 if ($strand eq '+') { | |
| 1668 | |
| 1669 my $D_count = 0; # counting all deletions that affect the ignored genomic position, i.e. Deletions and insertions | |
| 1670 my $I_count = 0; | |
| 1671 | |
| 1672 for (1..$ignore) { | |
| 1673 my $op = shift @comp_cigar; # adjusting composite CIGAR string by removing $ignore operations from the start | |
| 1674 # print "$_ deleted $op\n"; | |
| 1675 | |
| 1676 while ($op eq 'D') { # repeating this for deletions (D) | |
| 1677 $D_count++; | |
| 1678 $op = shift @comp_cigar; | |
| 1679 # print "$_ deleted $op\n"; | |
| 1680 } | |
| 1681 if ($op eq 'I') { # adjusting the genomic position for insertions (I) | |
| 1682 $I_count++; | |
| 1683 } | |
| 1684 } | |
| 1685 $start += $ignore + $D_count - $I_count; | |
| 1686 # print "start $start\t ignore: $ignore\t D count: $D_count I_count: $I_count\n"; | |
| 1687 } | |
| 1688 elsif ($strand eq '-') { | |
| 1689 | |
| 1690 for (1..$ignore) { | |
| 1691 my $op = pop @comp_cigar; # adjusting composite CIGAR string by removing $ignore operations, here the last value of the array | |
| 1692 while ($op eq 'D') { # repeating this for deletions (D) | |
| 1693 $op = pop @comp_cigar; | |
| 1694 } | |
| 1695 } | |
| 1696 | |
| 1697 ### For reverse strand alignments we need to determine the number of matching bases (M) or deletions (D) in the read from the CIGAR | |
| 1698 ### string to be able to work out the starting position of the read which is on the 3' end of the sequence | |
| 1699 my $MD_count = 0; # counting all operations that affect the genomic position, i.e. M and D. Insertions do not affect the start position | |
| 1700 foreach (@comp_cigar) { | |
| 1701 ++$MD_count if ($_ eq 'M' or $_ eq 'D'); | |
| 1702 } | |
| 1703 $start += $MD_count - 1; | |
| 1704 } | |
| 1705 | |
| 1706 ### reconstituting shortened CIGAR string | |
| 1707 my $new_cigar; | |
| 1708 my $count = 0; | |
| 1709 my $last_op; | |
| 1710 # print "ignore adjusted: @comp_cigar\n"; | |
| 1711 foreach my $op (@comp_cigar) { | |
| 1712 unless (defined $last_op){ | |
| 1713 $last_op = $op; | |
| 1714 ++$count; | |
| 1715 next; | |
| 1716 } | |
| 1717 if ($last_op eq $op) { | |
| 1718 ++$count; | |
| 1719 } else { | |
| 1720 $new_cigar .= "$count$last_op"; | |
| 1721 $last_op = $op; | |
| 1722 $count = 1; | |
| 1723 } | |
| 1724 } | |
| 1725 $new_cigar .= "$count$last_op"; # appending the last operation and count | |
| 1726 $cigar = $new_cigar; | |
| 1727 # print "ignore adjusted scalar: $cigar\n"; | |
| 1728 } | |
| 1729 | |
| 1730 ####################### | |
| 1731 ### INGORE 3' END ### | |
| 1732 ####################### | |
| 1733 | |
| 1734 # Clipping off the last <int> number of bases from the methylation call string as specified with --ignore_3prime <int> | |
| 1735 if ($ignore_3prime) { | |
| 1736 # warn "$meth_call\n"; | |
| 1737 $meth_call = substr($meth_call,0, (length($meth_call)) - $ignore_3prime); | |
| 1738 # warn "$meth_call\n";sleep(1); | |
| 1739 | |
| 1740 ### If we are ignoring a part of the sequence we also need to adjust the cigar string accordingly | |
| 1741 | |
| 1742 my @len = split (/\D+/,$cigar); # storing the length per operation | |
| 1743 my @ops = split (/\d+/,$cigar); # storing the operation | |
| 1744 shift @ops; # remove the empty first element | |
| 1745 die "CIGAR string contained a non-matching number of lengths and operations\n" unless (scalar @len == scalar @ops); | |
| 1746 | |
| 1747 my @comp_cigar; # building an array with all CIGAR operations | |
| 1748 foreach my $index (0..$#len) { | |
| 1749 foreach (1..$len[$index]) { | |
| 1750 # print "$ops[$index]"; | |
| 1751 push @comp_cigar, $ops[$index]; | |
| 1752 } | |
| 1753 } | |
| 1754 | |
| 1755 # print "original CIGAR: $cigar\n"; | |
| 1756 # print join ("",@comp_cigar),"\n"; | |
| 1757 | |
| 1758 ### If we are clipping off some bases at the end we might have to adjust the start position of the alignments accordingly | |
| 1759 if ($strand eq '+') { | |
| 1760 | |
| 1761 ### clipping the 3' end does not affect the starting position of forward strand alignments | |
| 1762 # ignore 5' has already been taken care of at this stage, if relevant at all | |
| 1763 | |
| 1764 for (1..$ignore_3prime) { | |
| 1765 my $op = pop @comp_cigar; # adjusting composite CIGAR string by removing $ignore_3prime operations from the end | |
| 1766 # print join ("",@comp_cigar),"\n"; | |
| 1767 # print "$_ deleted $op from 3' end\n"; | |
| 1768 while ($op eq 'D') { # repeating this for deletions (D) | |
| 1769 $op = pop @comp_cigar; | |
| 1770 # print join ("",@comp_cigar),"\n"; | |
| 1771 # print "$_ deleted $op from 3' end\n"; | |
| 1772 } | |
| 1773 } | |
| 1774 # print "Final truncated CIGAR string:\n"; | |
| 1775 # print join ("",@comp_cigar),"\n"; | |
| 1776 # $start += $ignore + $D_count - $I_count; | |
| 1777 # print "start $start\t ignore_3prime: $ignore_3prime\t D count: $D_count I_count: $I_count\n"; | |
| 1778 } | |
| 1779 elsif ($strand eq '-') { | |
| 1780 | |
| 1781 my $D_count = 0; # counting all deletions that affect the ignored genomic position, i.e. Deletions and insertions | |
| 1782 my $I_count = 0; | |
| 1783 | |
| 1784 for (1..$ignore_3prime) { | |
| 1785 my $op = shift @comp_cigar; # adjusting composite CIGAR string by removing $ignore_3prime operations, here the first value of the array | |
| 1786 while ($op eq 'D') { # repeating this for deletions (D) | |
| 1787 $D_count++; | |
| 1788 $op = shift @comp_cigar; | |
| 1789 } | |
| 1790 if ($op eq 'I') { # adjusting the genomic position for insertions (I) | |
| 1791 $I_count++; | |
| 1792 } | |
| 1793 | |
| 1794 } | |
| 1795 | |
| 1796 # here we need to discriminate if the start has been adjusted because of --ignore or not | |
| 1797 if ($ignore){ | |
| 1798 # the start position has already been modified for --ignore already, so we don't have to adjust the position again now | |
| 1799 } | |
| 1800 else{ | |
| 1801 # Here we need to add the length ignore_3prime to the read starting position | |
| 1802 # adjustment of the true starting position of this reverse read will take place later in the methylation extraction step | |
| 1803 $start += $ignore_3prime + $D_count - $I_count; | |
| 1804 } | |
| 1805 | |
| 1806 } | |
| 1807 | |
| 1808 ### reconstituting shortened CIGAR string | |
| 1809 my $new_cigar; | |
| 1810 my $count = 0; | |
| 1811 my $last_op; | |
| 1812 # print "ignore_3prime adjusted:\n"; print join ("",@comp_cigar),"\n"; | |
| 1813 foreach my $op (@comp_cigar) { | |
| 1814 unless (defined $last_op){ | |
| 1815 $last_op = $op; | |
| 1816 ++$count; | |
| 1817 next; | |
| 1818 } | |
| 1819 if ($last_op eq $op) { | |
| 1820 ++$count; | |
| 1821 } else { | |
| 1822 $new_cigar .= "$count$last_op"; | |
| 1823 $last_op = $op; | |
| 1824 $count = 1; | |
| 1825 } | |
| 1826 } | |
| 1827 $new_cigar .= "$count$last_op"; # appending the last operation and count | |
| 1828 $cigar = $new_cigar; | |
| 1829 # print "ignore_3prime adjusted scalar: $cigar\n"; | |
| 1830 } | |
| 1831 } | |
| 1832 ### printing out the methylation state of every C in the read | |
| 1833 print_individual_C_methylation_states_single_end($meth_call,$chrom,$start,$id,$strand,$index,$cigar); | |
| 1834 | |
| 1835 ++$methylation_call_strings_processed; # 1 per single-end result | |
| 1836 } | |
| 1837 } | |
| 1838 } | |
| 1839 | |
| 1840 ### PROCESSING PAIRED-END RESULT FILES | |
| 1841 elsif ($paired) { | |
| 1842 | |
| 1843 ### proceeding differently now for SAM format or vanilla Bismark format files | |
| 1844 if ($vanilla) { # old vanilla Bismark paired-end output format | |
| 1845 while (<IN>) { | |
| 1846 ++$line_count; | |
| 1847 warn "processed line: $line_count\n" if ($line_count%500000 == 0); | |
| 1848 | |
| 1849 if ( ($line_count - $offset)%$multicore == 0){ | |
| 1850 # warn "line count: $line_count\noffset: $offset\n"; | |
| 1851 # warn "Modulus: ",($line_count - $offset)%$multicore,"\n"; | |
| 1852 # warn "processing this line $line_count (processID: $process_id with \$offset $offset)\n"; | |
| 1853 } | |
| 1854 else{ | |
| 1855 # warn "skipping line $line_count for processID: $process_id with \$offset $offset)\n"; | |
| 1856 next; | |
| 1857 } | |
| 1858 | |
| 1859 ### $seq here is the chromosomal sequence (to use for the repeat analysis for example) | |
| 1860 my ($id,$strand,$chrom,$start_read_1,$end_read_2,$seq_1,$meth_call_1,$seq_2,$meth_call_2,$first_read_conversion,$genome_conversion) = (split("\t"))[0,1,2,3,4,6,7,9,10,11,12,13]; | |
| 1861 | |
| 1862 my $index; | |
| 1863 chomp $genome_conversion; | |
| 1864 | |
| 1865 if ($first_read_conversion eq 'CT' and $genome_conversion eq 'CT') { | |
| 1866 $index = 0; ## this is OT | |
| 1867 } elsif ($first_read_conversion eq 'GA' and $genome_conversion eq 'GA') { | |
| 1868 $index = 2; ## this is CTOB!!! | |
| 1869 } elsif ($first_read_conversion eq 'GA' and $genome_conversion eq 'CT') { | |
| 1870 $index = 1; ## this is CTOT!!! | |
| 1871 } elsif ($first_read_conversion eq 'CT' and $genome_conversion eq 'GA') { | |
| 1872 $index = 3; ## this is OB | |
| 1873 } else { | |
| 1874 die "Unexpected combination of read and genome conversion: $first_read_conversion / $genome_conversion\n"; | |
| 1875 } | |
| 1876 | |
| 1877 if ($meth_call_1 and $meth_call_2) { | |
| 1878 ### Clipping off the first <int> number of bases from the methylation call strings as specified with '--ignore <int>' | |
| 1879 | |
| 1880 ### IGNORE FROM 5' END | |
| 1881 if ($ignore) { | |
| 1882 $meth_call_1 = substr($meth_call_1,$ignore,length($meth_call_1)-$ignore); | |
| 1883 | |
| 1884 ### we also need to adjust the start and end positions of the alignments accordingly if '--ignore' was specified | |
| 1885 $start_read_1 += $ignore; | |
| 1886 } | |
| 1887 if ($ignore_r2) { | |
| 1888 $meth_call_2 = substr($meth_call_2,$ignore_r2,length($meth_call_2)-$ignore_r2); | |
| 1889 | |
| 1890 ### we also need to adjust the start and end positions of the alignments accordingly if '--ignore_r2' was specified | |
| 1891 $end_read_2 -= $ignore_r2; | |
| 1892 } | |
| 1893 | |
| 1894 ### IGNORE 3' END | |
| 1895 | |
| 1896 ### Clipping off the last <int> number of bases from the methylation call string of Read 1 as specified with --ignore_3prime <int> | |
| 1897 if ($ignore_3prime) { | |
| 1898 $meth_call_1 = substr($meth_call_1,0, length($meth_call_1) - $ignore_3prime); | |
| 1899 # we don't have to adjust the position now since the shortened methylation call will be fine, see below | |
| 1900 } | |
| 1901 ### Clipping off the last <int> number of bases from the methylation call string of Read 2 as specified with --ignore_3prime_r2 <int> | |
| 1902 if ($ignore_3prime_r2) { | |
| 1903 $meth_call_2 = substr($meth_call_2,0, length($meth_call_2) - $ignore_3prime_r2); | |
| 1904 # we don't have to adjust the position now since the shortened methylation call will be fine, see below | |
| 1905 } | |
| 1906 | |
| 1907 my $end_read_1; | |
| 1908 my $start_read_2; | |
| 1909 | |
| 1910 if ($strand eq '+') { | |
| 1911 | |
| 1912 $end_read_1 = $start_read_1 + length($meth_call_1) - 1; | |
| 1913 $start_read_2 = $end_read_2 - length($meth_call_2) + 1; | |
| 1914 | |
| 1915 ## we first pass the first read which is in + orientation on the forward strand | |
| 1916 print_individual_C_methylation_states_paired_end_files($meth_call_1,$chrom,$start_read_1,$id,'+',$index,0,0,undef,1); # the last two values are CIGAR string and read identity | |
| 1917 | |
| 1918 # we next pass the second read which is in - orientation on the reverse strand | |
| 1919 ### if --no_overlap was specified we also pass the end of read 1. If read 2 starts to overlap with read 1 we can stop extracting methylation calls from read 2 | |
| 1920 print_individual_C_methylation_states_paired_end_files($meth_call_2,$chrom,$end_read_2,$id,'-',$index,$no_overlap,$end_read_1,undef,2); | |
| 1921 } | |
| 1922 else { | |
| 1923 | |
| 1924 $end_read_1 = $start_read_1+length($meth_call_2)-1; # read 1 is the second reported read! | |
| 1925 $start_read_2 = $end_read_2-length($meth_call_1)+1; # read 2 is the first reported read! | |
| 1926 | |
| 1927 ## we first pass the first read which is in - orientation on the reverse strand | |
| 1928 print_individual_C_methylation_states_paired_end_files($meth_call_1,$chrom,$end_read_2,$id,'-',$index,0,0,undef,1); | |
| 1929 | |
| 1930 # we next pass the second read which is in + orientation on the forward strand | |
| 1931 ### if --no_overlap was specified we also pass the end of read 2. If read 2 starts to overlap with read 1 we will stop extracting methylation calls from read 2 | |
| 1932 print_individual_C_methylation_states_paired_end_files($meth_call_2,$chrom,$start_read_1,$id,'+',$index,$no_overlap,$start_read_2,undef,2); | |
| 1933 } | |
| 1934 | |
| 1935 $methylation_call_strings_processed += 2; # paired-end = 2 methylation calls | |
| 1936 } | |
| 1937 } | |
| 1938 } | |
| 1939 else { # Bismark paired-end BAM/SAM output format (default) | |
| 1940 while (<IN>) { | |
| 1941 chomp; | |
| 1942 ### SAM format can either start with header lines (starting with @) or start with alignments directly | |
| 1943 if (/^\@/) { # skipping header lines (starting with @) | |
| 1944 warn "skipping SAM header line:\t$_\n" unless ($process_id == 0); # no additional warnings for child procesess | |
| 1945 next; | |
| 1946 } | |
| 1947 | |
| 1948 ++$line_count; | |
| 1949 warn "Processed lines: $line_count\n" if ($line_count%500000==0); | |
| 1950 | |
| 1951 if ( ($line_count - $offset)%$multicore == 0){ | |
| 1952 # warn "line count: $line_count\noffset: $offset\n"; | |
| 1953 # warn "Modulus: ",($line_count - $offset)%$multicore,"\n"; | |
| 1954 # warn "processing this line $line_count (processID: $process_id with \$offset $offset)\n"; | |
| 1955 } | |
| 1956 else{ | |
| 1957 # warn "skipping line $line_count for processID: $process_id with \$offset $offset)\n"; | |
| 1958 $_ = <IN>; # reading and skipping another line since this is the paired-end read | |
| 1959 next; | |
| 1960 } | |
| 1961 | |
| 1962 # example paired-end reads in SAM format (2 consecutive lines) | |
| 1963 # 1_R1/1 67 5 103172224 255 40M = 103172417 233 AATATTTTTTTTATTTTAAAATGTGTATTGATTTAAATTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:4 XX:Z:4T1T24TT7 XM:Z:....h.h........................hh....... XR:Z:CT XG:Z:CT | |
| 1964 # 1_R1/2 131 5 103172417 255 40M = 103172224 -233 TATTTTTTTTTAGAGTATTTTTTAATGGTTATTAGATTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:6 XX:Z:T5T1T9T9T7T3 XM:Z:h.....h.h.........h.........h.......h... XR:Z:GA XG:Z:CT | |
| 1965 | |
| 1966 my ($id_1,$chrom,$start_read_1,$cigar_1) = (split("\t"))[0,2,3,5]; ### detecting the following SAM flags in case the SAM entry was shuffled by CRAM or Goby compression/decompression | |
| 1967 my $meth_call_1; | |
| 1968 my $first_read_conversion; | |
| 1969 my $genome_conversion; | |
| 1970 | |
| 1971 while ( /(XM|XR|XG):Z:([^\t]+)/g ) { | |
| 1972 my $tag = $1; | |
| 1973 my $value = $2; | |
| 1974 | |
| 1975 if ($tag eq "XM") { | |
| 1976 $meth_call_1 = $value; | |
| 1977 $meth_call_1 =~ s/\r//; | |
| 1978 } elsif ($tag eq "XR") { | |
| 1979 $first_read_conversion = $value; | |
| 1980 $first_read_conversion =~ s/\r//; | |
| 1981 } elsif ($tag eq "XG") { | |
| 1982 $genome_conversion = $value; | |
| 1983 $genome_conversion =~ s/\r//; | |
| 1984 } | |
| 1985 } | |
| 1986 | |
| 1987 $_ = <IN>; # reading in the paired read | |
| 1988 chomp; | |
| 1989 | |
| 1990 my ($id_2,$start_read_2,$cigar_2) = (split("\t"))[0,3,5]; ### detecting the following SAM flags in case the SAM entry was shuffled by CRAM or Goby compression/decompression | |
| 1991 | |
| 1992 my $meth_call_2; | |
| 1993 my $second_read_conversion; | |
| 1994 | |
| 1995 while ( /(XM|XR):Z:([^\t]+)/g ) { | |
| 1996 my $tag = $1; | |
| 1997 my $value = $2; | |
| 1998 | |
| 1999 if ($tag eq "XM") { | |
| 2000 $meth_call_2 = $value; | |
| 2001 $meth_call_2 =~ s/\r//; | |
| 2002 } elsif ($tag eq "XR") { | |
| 2003 $second_read_conversion = $value; | |
| 2004 $second_read_conversion = s/\r//; | |
| 2005 } | |
| 2006 } | |
| 2007 | |
| 2008 # < version 0.7.6 $genome_conversion =~ s/^XG:Z://; | |
| 2009 # chomp $genome_conversion; # in case it captured a new line character # already removed | |
| 2010 | |
| 2011 # print join ("\t",$meth_call_1,$meth_call_2,$first_read_conversion,$second_read_conversion,$genome_conversion),"\n"; | |
| 2012 | |
| 2013 my $index; | |
| 2014 my $strand; | |
| 2015 | |
| 2016 if ($first_read_conversion eq 'CT' and $genome_conversion eq 'CT') { | |
| 2017 $index = 0; ## this is OT | |
| 2018 $strand = '+'; | |
| 2019 } elsif ($first_read_conversion eq 'GA' and $genome_conversion eq 'CT') { | |
| 2020 $index = 1; ## this is CTOT | |
| 2021 $strand = '-'; | |
| 2022 } elsif ($first_read_conversion eq 'GA' and $genome_conversion eq 'GA') { | |
| 2023 $index = 2; ## this is CTOB | |
| 2024 $strand = '+'; | |
| 2025 } elsif ($first_read_conversion eq 'CT' and $genome_conversion eq 'GA') { | |
| 2026 $index = 3; ## this is OB | |
| 2027 $strand = '-'; | |
| 2028 } else { | |
| 2029 die "Unexpected combination of read and genome conversion: $first_read_conversion / $genome_conversion\n"; | |
| 2030 } | |
| 2031 | |
| 2032 ### reversing the methylation call of the read that was reverse-complemented | |
| 2033 if ($strand eq '+') { | |
| 2034 $meth_call_2 = reverse $meth_call_2; | |
| 2035 } else { | |
| 2036 $meth_call_1 = reverse $meth_call_1; | |
| 2037 } | |
| 2038 # warn "\n$meth_call_1\n$meth_call_2\n"; | |
| 2039 | |
| 2040 if ($meth_call_1 and $meth_call_2) { | |
| 2041 | |
| 2042 my $end_read_1; | |
| 2043 | |
| 2044 ### READ 1 | |
| 2045 my @len_1 = split (/\D+/,$cigar_1); # storing the length per operation | |
| 2046 my @ops_1 = split (/\d+/,$cigar_1); # storing the operation | |
| 2047 shift @ops_1; # remove the empty first element | |
| 2048 | |
| 2049 die "CIGAR string contained a non-matching number of lengths and operations: $cigar_1\n".join(" ",@len_1)."\n".join(" ",@ops_1)."\n" unless (scalar @len_1 == scalar @ops_1); | |
| 2050 | |
| 2051 my @comp_cigar_1; # building an array with all CIGAR operations | |
| 2052 foreach my $index (0..$#len_1) { | |
| 2053 foreach (1..$len_1[$index]) { | |
| 2054 # print "$ops_1[$index]"; | |
| 2055 push @comp_cigar_1, $ops_1[$index]; | |
| 2056 } | |
| 2057 } | |
| 2058 # print "original CIGAR read 1: $cigar_1\n"; | |
| 2059 # print "original CIGAR read 1: @comp_cigar_1\n"; | |
| 2060 | |
| 2061 ### READ 2 | |
| 2062 my @len_2 = split (/\D+/,$cigar_2); # storing the length per operation | |
| 2063 my @ops_2 = split (/\d+/,$cigar_2); # storing the operation | |
| 2064 shift @ops_2; # remove the empty first element | |
| 2065 die "CIGAR string contained a non-matching number of lengths and operations\n" unless (scalar @len_2 == scalar @ops_2); | |
| 2066 my @comp_cigar_2; # building an array with all CIGAR operations for read 2 | |
| 2067 foreach my $index (0..$#len_2) { | |
| 2068 foreach (1..$len_2[$index]) { | |
| 2069 # print "$ops_2[$index]"; | |
| 2070 push @comp_cigar_2, $ops_2[$index]; | |
| 2071 } | |
| 2072 } | |
| 2073 # print "original CIGAR read 2: $cigar_2\n"; | |
| 2074 # print "original CIGAR read 2: @comp_cigar_2\n"; | |
| 2075 | |
| 2076 ################################## | |
| 2077 ### IGNORE BASES FROM 5' END ### | |
| 2078 ################################## | |
| 2079 | |
| 2080 if ($ignore) { | |
| 2081 ### Clipping off the first <int> number of bases from the methylation call string as specified with '--ignore <int>' for read 1 | |
| 2082 ### the methylation calls have already been reversed where necessary | |
| 2083 | |
| 2084 if ( (length($meth_call_1) - $ignore) <= 0){ | |
| 2085 # next; # skipping this read entirely if the read is shorter than the portion to be ignored | |
| 2086 $meth_call_1 = undef; # will skip this read entirely since the read is shorter than the portion to be ignored | |
| 2087 } | |
| 2088 else { | |
| 2089 $meth_call_1 = substr($meth_call_1,$ignore,length($meth_call_1)-$ignore); | |
| 2090 | |
| 2091 if ($strand eq '+') { | |
| 2092 | |
| 2093 ### if the (read 1) strand information is '+', read 1 needs to be trimmed from the start | |
| 2094 my $D_count_1 = 0; # counting all deletions that affect the ignored genomic position for read 1, i.e. Deletions and insertions | |
| 2095 my $I_count_1 = 0; | |
| 2096 | |
| 2097 for (1..$ignore) { | |
| 2098 my $op = shift @comp_cigar_1; # adjusting composite CIGAR string of read 1 by removing $ignore operations from the start | |
| 2099 # print "$_ deleted $op\n"; | |
| 2100 | |
| 2101 while ($op eq 'D') { # repeating this for deletions (D) | |
| 2102 $D_count_1++; | |
| 2103 $op = shift @comp_cigar_1; | |
| 2104 # print "$_ deleted $op\n"; | |
| 2105 } | |
| 2106 if ($op eq 'I') { # adjusting the genomic position for insertions (I) | |
| 2107 $I_count_1++; | |
| 2108 } | |
| 2109 } | |
| 2110 | |
| 2111 $start_read_1 += $ignore + $D_count_1 - $I_count_1; | |
| 2112 # print "start read 1 $start_read_1\t ignore: $ignore\t D count 1: $D_count_1\tI_count 1: $I_count_1\n"; | |
| 2113 | |
| 2114 # the start position of reads mapping to the reverse strand is being adjusted further below | |
| 2115 } | |
| 2116 elsif ($strand eq '-') { | |
| 2117 | |
| 2118 ### if the (read 1) strand information is '-', read 1 needs to be trimmed from the back | |
| 2119 for (1..$ignore) { | |
| 2120 my $op = pop @comp_cigar_1; # adjusting composite CIGAR string by removing $ignore operations, here the last value of the array | |
| 2121 while ($op eq 'D') { # repeating this for deletions (D) | |
| 2122 $op = pop @comp_cigar_1; | |
| 2123 } | |
| 2124 } | |
| 2125 # the start position of reads mapping to the reverse strand is being adjusted further below | |
| 2126 | |
| 2127 } | |
| 2128 } | |
| 2129 } | |
| 2130 | |
| 2131 if ($ignore_r2) { | |
| 2132 ### Clipping off the first <int> number of bases from the methylation call string as specified with '--ignore_r2 <int>' for read 2 | |
| 2133 ### the methylation calls have already been reversed where necessary | |
| 2134 | |
| 2135 if ( (length($meth_call_2) - $ignore_r2) <= 0){ | |
| 2136 # next; # skipping this read entirely if the read is shorter than the portion to be ignored # this would skip the entire read pair! | |
| 2137 $meth_call_2 = undef; # will skip this read entirely since the read is shorter than the portion to be ignored | |
| 2138 } | |
| 2139 else { | |
| 2140 $meth_call_2 = substr($meth_call_2,$ignore_r2,length($meth_call_2)-$ignore_r2); | |
| 2141 | |
| 2142 ### If we are ignoring a part of the sequence we also need to adjust the cigar string accordingly | |
| 2143 | |
| 2144 if ($strand eq '+') { | |
| 2145 | |
| 2146 ### if the (read 1) strand information is '+', read 2 needs to be trimmed from the back | |
| 2147 | |
| 2148 for (1..$ignore_r2) { | |
| 2149 my $op = pop @comp_cigar_2; # adjusting composite CIGAR string by removing $ignore operations, here the last value of the array | |
| 2150 while ($op eq 'D') { # repeating this for deletions (D) | |
| 2151 $op = pop @comp_cigar_2; | |
| 2152 } | |
| 2153 } | |
| 2154 # the start position of reads mapping to the reverse strand is being adjusted further below | |
| 2155 } | |
| 2156 elsif ($strand eq '-') { | |
| 2157 | |
| 2158 ### if the (read 1) strand information is '-', read 2 needs to be trimmed from the start | |
| 2159 my $D_count_2 = 0; # counting all deletions that affect the ignored genomic position for read 2, i.e. Deletions and insertions | |
| 2160 my $I_count_2 = 0; | |
| 2161 | |
| 2162 for (1..$ignore_r2) { | |
| 2163 my $op = shift @comp_cigar_2; # adjusting composite CIGAR string of read 2 by removing $ignore operations from the start | |
| 2164 # print "$_ deleted $op\n"; | |
| 2165 | |
| 2166 while ($op eq 'D') { # repeating this for deletions (D) | |
| 2167 $D_count_2++; | |
| 2168 $op = shift @comp_cigar_2; | |
| 2169 # print "$_ deleted $op\n"; | |
| 2170 } | |
| 2171 if ($op eq 'I') { # adjusting the genomic position for insertions (I) | |
| 2172 $I_count_2++; | |
| 2173 } | |
| 2174 } | |
| 2175 | |
| 2176 $start_read_2 += $ignore_r2 + $D_count_2 - $I_count_2; | |
| 2177 # print "start read 2 $start_read_2\t ignore R2: $ignore_r2\t D count 2: $D_count_2\tI_count 2: $I_count_2\n"; | |
| 2178 } | |
| 2179 } | |
| 2180 } | |
| 2181 | |
| 2182 if ($ignore and $meth_call_1){ # if the methylation call string is undefined at this position we don't need any new CIGAR string | |
| 2183 | |
| 2184 ### reconstituting shortened CIGAR string 1 | |
| 2185 my $new_cigar_1; | |
| 2186 my $count_1 = 0; | |
| 2187 my $last_op_1; | |
| 2188 # print "ignore adjusted CIGAR 1: @comp_cigar_1\n"; | |
| 2189 foreach my $op (@comp_cigar_1) { | |
| 2190 unless (defined $last_op_1){ | |
| 2191 $last_op_1 = $op; | |
| 2192 ++$count_1; | |
| 2193 next; | |
| 2194 } | |
| 2195 if ($last_op_1 eq $op) { | |
| 2196 ++$count_1; | |
| 2197 } else { | |
| 2198 $new_cigar_1 .= "$count_1$last_op_1"; | |
| 2199 $last_op_1 = $op; | |
| 2200 $count_1 = 1; | |
| 2201 } | |
| 2202 } | |
| 2203 $new_cigar_1 .= "$count_1$last_op_1"; # appending the last operation and count | |
| 2204 $cigar_1 = $new_cigar_1; | |
| 2205 # print "ignore adjusted CIGAR 1 scalar: $cigar_1\n"; | |
| 2206 } | |
| 2207 | |
| 2208 if ($ignore_r2 and $meth_call_2){ # if the methylation call string is undefined at this point we don't need any new CIGAR string | |
| 2209 | |
| 2210 ### reconstituting shortened CIGAR string 2 | |
| 2211 my $new_cigar_2; | |
| 2212 my $count_2 = 0; | |
| 2213 my $last_op_2; | |
| 2214 # print "ignore adjusted CIGAR 2: @comp_cigar_2\n"; | |
| 2215 foreach my $op (@comp_cigar_2) { | |
| 2216 unless (defined $last_op_2){ | |
| 2217 $last_op_2 = $op; | |
| 2218 ++$count_2; | |
| 2219 next; | |
| 2220 } | |
| 2221 if ($last_op_2 eq $op) { | |
| 2222 ++$count_2; | |
| 2223 } | |
| 2224 else { | |
| 2225 $new_cigar_2 .= "$count_2$last_op_2"; | |
| 2226 $last_op_2 = $op; | |
| 2227 $count_2 = 1; | |
| 2228 } | |
| 2229 } | |
| 2230 $new_cigar_2 .= "$count_2$last_op_2"; # appending the last operation and count | |
| 2231 $cigar_2 = $new_cigar_2; | |
| 2232 # print "ignore_r2 adjusted CIGAR 2 scalar: $cigar_2\n"; | |
| 2233 } | |
| 2234 | |
| 2235 ########################### | |
| 2236 ### END IGNORE 5' END ### | |
| 2237 ########################### | |
| 2238 | |
| 2239 ################################## | |
| 2240 ### IGNORE BASES FROM 3' END ### | |
| 2241 ################################## | |
| 2242 | |
| 2243 # print "CIGAR string before truncating 3' end (Read 1)\n"; | |
| 2244 # print join ("",@comp_cigar_1),"\n"; | |
| 2245 | |
| 2246 if ($ignore_3prime and $meth_call_1) { # if the methylation call string is undefined at this point we don't need to process the read any further | |
| 2247 | |
| 2248 ### Clipping off the last <int> number of bases from the methylation call string as specified with '--ignore_3prime <int>' for read 1 | |
| 2249 ### the methylation calls have already been reversed where necessary | |
| 2250 | |
| 2251 if ( (length($meth_call_1) - $ignore_3prime) <= 0){ | |
| 2252 $meth_call_1 = undef; # will skip this read entirely since the read is shorter than the portion to be ignored | |
| 2253 } | |
| 2254 else { | |
| 2255 $meth_call_1 = substr($meth_call_1,0,length($meth_call_1) - $ignore_3prime); | |
| 2256 # warn "truncated meth_call 1:\n$meth_call_1\n"; | |
| 2257 | |
| 2258 if ($strand eq '+') { | |
| 2259 | |
| 2260 ### if the (read 1) strand information is '+', clipping the 3' end does not affect the starting position of forward strand alignments | |
| 2261 # ignore 5' has already been taken care of at this stage, if relevant at all | |
| 2262 | |
| 2263 for (1..$ignore_3prime) { | |
| 2264 my $op = pop @comp_cigar_1; # adjusting composite CIGAR string of read 1 by removing $ignore_3prime operations from the end | |
| 2265 # print "$_ deleted $op from 3' end\n"; | |
| 2266 # print join ("",@comp_cigar_1),"\n"; | |
| 2267 | |
| 2268 while ($op eq 'D') { # repeating this for deletions (D) | |
| 2269 $op = pop @comp_cigar_1; | |
| 2270 # print join ("",@comp_cigar_1),"\n"; | |
| 2271 # print "$_ deleted $op from 3' end\n"; | |
| 2272 } | |
| 2273 } | |
| 2274 | |
| 2275 # print "Final truncated CIGAR string (Read 1):\n"; | |
| 2276 # print join ("",@comp_cigar_1),"\n"; | |
| 2277 | |
| 2278 } | |
| 2279 elsif ($strand eq '-') { | |
| 2280 | |
| 2281 my $D_count_1 = 0; # counting all deletions that affect the ignored genomic position for read 1, i.e. Deletions and insertions | |
| 2282 my $I_count_1 = 0; | |
| 2283 | |
| 2284 ### if the (read 1) strand information is '-', the read 1 CIGAR string needs to be trimmed from the start | |
| 2285 for (1..$ignore_3prime) { | |
| 2286 my $op = shift @comp_cigar_1; # adjusting composite CIGAR string by removing $ignore_3prime operations, here the first value of the array | |
| 2287 # print join ("",@comp_cigar_1),"\n"; | |
| 2288 | |
| 2289 while ($op eq 'D') { # repeating this for deletions (D) | |
| 2290 $D_count_1++; | |
| 2291 $op = shift @comp_cigar_1; | |
| 2292 # print join ("",@comp_cigar_1),"\n"; | |
| 2293 } | |
| 2294 | |
| 2295 if ($op eq 'I') { # adjusting the genomic position for insertions (I) | |
| 2296 $I_count_1++; | |
| 2297 } | |
| 2298 } | |
| 2299 | |
| 2300 # print "Final truncated CIGAR string reverse_read:\n"; | |
| 2301 # print join ("",@comp_cigar_1),"\n"; | |
| 2302 | |
| 2303 # Here we need to add the length ignore_3prime to the read starting position | |
| 2304 # adjustment of the true start position of this reverse read will take place later in the methylation extraction step | |
| 2305 $start_read_1 += $ignore_3prime + $D_count_1 - $I_count_1; | |
| 2306 | |
| 2307 } | |
| 2308 } | |
| 2309 } | |
| 2310 | |
| 2311 if ($ignore_3prime_r2 and $meth_call_2) { # if the methylation call string is undefined at this point we don't need to process the read any further | |
| 2312 | |
| 2313 ### Clipping off the last <int> number of bases from the methylation call string as specified with '--ignore_3prime_r2 <int>' for read 2 | |
| 2314 ### the methylation calls have already been reversed where necessary | |
| 2315 | |
| 2316 if ( (length($meth_call_2) - $ignore_3prime_r2) <= 0){ | |
| 2317 $meth_call_2 = undef; # will skip this read entirely since the read is shorter than the portion to be ignored | |
| 2318 } | |
| 2319 else { | |
| 2320 $meth_call_2 = substr($meth_call_2,0,length($meth_call_2) - $ignore_3prime_r2); | |
| 2321 # warn "truncated meth_call 2:\n$meth_call_2\n"; | |
| 2322 | |
| 2323 ### If we are ignoring a part of the sequence we also need to adjust the cigar string and the positions accordingly | |
| 2324 | |
| 2325 if ($strand eq '+') { | |
| 2326 | |
| 2327 ### if the (read 1) strand information is '+', clipping the 3' end of read 2 does potentially affect the starting position of read 2 (reverse strand alignment) | |
| 2328 ### if the (read 1) strand information is '+', read 2 needs to be trimmed from the start | |
| 2329 | |
| 2330 my $D_count_2 = 0; # counting all deletions that affect the ignored genomic position for read 2, i.e. Deletions and insertions | |
| 2331 my $I_count_2 = 0; | |
| 2332 | |
| 2333 for (1..$ignore_3prime_r2) { | |
| 2334 my $op = shift @comp_cigar_2; # adjusting composite CIGAR string by removing $ignore operations, here the first value of the array | |
| 2335 # print "$_ deleted $op from 3' end\n"; | |
| 2336 # print join ("",@comp_cigar_2),"\n"; | |
| 2337 | |
| 2338 while ($op eq 'D') { # repeating this for deletions (D) | |
| 2339 $D_count_2++; | |
| 2340 $op = shift @comp_cigar_2; | |
| 2341 # print "$_ deleted $op from 3' end\n"; | |
| 2342 # print join ("",@comp_cigar_2),"\n"; | |
| 2343 } | |
| 2344 | |
| 2345 if ($op eq 'I') { # adjusting the genomic position for insertions (I) | |
| 2346 $I_count_2++; | |
| 2347 } | |
| 2348 } | |
| 2349 | |
| 2350 # print "Final truncated CIGAR string 2 (+ alignment):\n"; | |
| 2351 # print join ("",@comp_cigar_2),"\n"; | |
| 2352 | |
| 2353 # Here we need to add the length ignore_3prime_r2 to the read starting position | |
| 2354 # adjustment of the true start position of this reverse read will take place later in the methylation extraction step | |
| 2355 $start_read_2 += $ignore_3prime_r2 + $D_count_2 - $I_count_2; | |
| 2356 | |
| 2357 # print "start read 2 $start_read_2\t ignore R2: $ignore_r2\t D count 2: $D_count_2\tI_count 2: $I_count_2\n"; | |
| 2358 } | |
| 2359 elsif ($strand eq '-') { | |
| 2360 ### if the (read 1) strand information is '-', clipping the 3' end of read 2 does not affect its starting position (forward strand alignment) | |
| 2361 ### ignore_r2 5' has already been taken care of at this stage, if relevant at all | |
| 2362 | |
| 2363 ### if the (read 1) strand information is '-', read 2 needs to be trimmed from the end | |
| 2364 | |
| 2365 for (1..$ignore_3prime_r2) { | |
| 2366 my $op = pop @comp_cigar_2; # adjusting composite CIGAR string of read 2 by removing $ignore operations from the start | |
| 2367 # print "$_ deleted $op\n"; | |
| 2368 # print join ("",@comp_cigar_2),"\n"; | |
| 2369 | |
| 2370 while ($op eq 'D') { # repeating this for deletions (D) | |
| 2371 $op = pop @comp_cigar_2; | |
| 2372 # print "$_ deleted $op\n"; | |
| 2373 # print join ("",@comp_cigar_2),"\n"; | |
| 2374 } | |
| 2375 } | |
| 2376 | |
| 2377 # print "Final truncated CIGAR string 2 (- alignment):\n"; | |
| 2378 # print join ("",@comp_cigar_2),"\n"; | |
| 2379 | |
| 2380 } | |
| 2381 } | |
| 2382 } | |
| 2383 | |
| 2384 if ($ignore_3prime and $meth_call_1){ # if the methylation call string is undefined at this point we don't need any new CIGAR string | |
| 2385 | |
| 2386 ### reconstituting shortened CIGAR string 1 | |
| 2387 my $new_cigar_1; | |
| 2388 my $count_1 = 0; | |
| 2389 my $last_op_1; | |
| 2390 # print "ignore_3prime adjusted CIGAR 1: @comp_cigar_1\n"; | |
| 2391 foreach my $op (@comp_cigar_1) { | |
| 2392 unless (defined $last_op_1){ | |
| 2393 $last_op_1 = $op; | |
| 2394 ++$count_1; | |
| 2395 next; | |
| 2396 } | |
| 2397 if ($last_op_1 eq $op) { | |
| 2398 ++$count_1; | |
| 2399 } | |
| 2400 else { | |
| 2401 $new_cigar_1 .= "$count_1$last_op_1"; | |
| 2402 $last_op_1 = $op; | |
| 2403 $count_1 = 1; | |
| 2404 } | |
| 2405 } | |
| 2406 $new_cigar_1 .= "$count_1$last_op_1"; # appending the last operation and count | |
| 2407 $cigar_1 = $new_cigar_1; | |
| 2408 # warn "ignore_3prime adjusted CIGAR 1 scalar: $cigar_1\n"; | |
| 2409 } | |
| 2410 | |
| 2411 if ($ignore_3prime_r2 and $meth_call_2){ # if the methylation call string is undefined at this point we don't need any new CIGAR string | |
| 2412 | |
| 2413 ### reconstituting shortened CIGAR string 2 | |
| 2414 my $new_cigar_2; | |
| 2415 my $count_2 = 0; | |
| 2416 my $last_op_2; | |
| 2417 # print "ignore_3prime_r2 adjusted CIGAR 2: @comp_cigar_2\n"; | |
| 2418 foreach my $op (@comp_cigar_2) { | |
| 2419 unless (defined $last_op_2){ | |
| 2420 $last_op_2 = $op; | |
| 2421 ++$count_2; | |
| 2422 next; | |
| 2423 } | |
| 2424 if ($last_op_2 eq $op) { | |
| 2425 ++$count_2; | |
| 2426 } | |
| 2427 else { | |
| 2428 $new_cigar_2 .= "$count_2$last_op_2"; | |
| 2429 $last_op_2 = $op; | |
| 2430 $count_2 = 1; | |
| 2431 } | |
| 2432 } | |
| 2433 $new_cigar_2 .= "$count_2$last_op_2"; # appending the last operation and count | |
| 2434 $cigar_2 = $new_cigar_2; | |
| 2435 # warn "ignore_3prime_r2 adjusted CIGAR 2 scalar: $cigar_2\n"; | |
| 2436 } | |
| 2437 | |
| 2438 ########################### | |
| 2439 ### END IGNORE 3' END ### | |
| 2440 ########################### | |
| 2441 | |
| 2442 | |
| 2443 ### Adjusting CIGAR string and starting position of reads in reverse orientation which we will pass to the extraction subroutine later on | |
| 2444 | |
| 2445 if ($strand eq '+') { | |
| 2446 ### adjusting the start position for all reads mapping to the reverse strand, in this case read 2 | |
| 2447 @comp_cigar_2 = reverse@comp_cigar_2; # the CIGAR string needs to be reversed for all reads aligning to the reverse strand, too | |
| 2448 # print "reverse: @comp_cigar_2\n"; | |
| 2449 | |
| 2450 my $MD_count_1 = 0; | |
| 2451 foreach (@comp_cigar_1) { | |
| 2452 ++$MD_count_1 if ($_ eq 'M' or $_ eq 'D'); # Matching bases or deletions affect the genomic position of the 3' ends of reads, insertions don't | |
| 2453 } | |
| 2454 | |
| 2455 my $MD_count_2 = 0; | |
| 2456 foreach (@comp_cigar_2) { | |
| 2457 ++$MD_count_2 if ($_ eq 'M' or $_ eq 'D'); # Matching bases or deletions affect the genomic position of the 3' ends of reads, insertions don't | |
| 2458 } | |
| 2459 | |
| 2460 $end_read_1 = $start_read_1 + $MD_count_1 - 1; | |
| 2461 $start_read_2 += $MD_count_2 - 1; ## Passing on the start position on the reverse strand | |
| 2462 } | |
| 2463 else { | |
| 2464 ### adjusting the start position for all reads mapping to the reverse strand, in this case read 1 | |
| 2465 | |
| 2466 @comp_cigar_1 = reverse@comp_cigar_1; # the CIGAR string needs to be reversed for all reads aligning to the reverse strand, too | |
| 2467 # print "reverse: @comp_cigar_1\n"; | |
| 2468 | |
| 2469 my $MD_count_1 = 0; | |
| 2470 foreach (@comp_cigar_1) { | |
| 2471 ++$MD_count_1 if ($_ eq 'M' or $_ eq 'D'); # Matching bases or deletions affect the genomic position of the 3' ends of reads, insertions don't | |
| 2472 } | |
| 2473 | |
| 2474 $end_read_1 = $start_read_1; | |
| 2475 $start_read_1 += $MD_count_1 - 1; ### Passing on the start position on the reverse strand | |
| 2476 } | |
| 2477 | |
| 2478 if ($strand eq '+') { | |
| 2479 ## we first pass the first read which is in + orientation on the forward strand; the last value is the read identity | |
| 2480 print_individual_C_methylation_states_paired_end_files($meth_call_1,$chrom,$start_read_1,$id_1,'+',$index,0,0,$cigar_1,1); | |
| 2481 | |
| 2482 # we next pass the second read which is in - orientation on the reverse strand | |
| 2483 ### if --no_overlap was specified we also pass the end of read 1. If read 2 starts to overlap with read 1 we can stop extracting methylation calls from read 2 | |
| 2484 print_individual_C_methylation_states_paired_end_files($meth_call_2,$chrom,$start_read_2,$id_2,'-',$index,$no_overlap,$end_read_1,$cigar_2,2); | |
| 2485 } | |
| 2486 else { | |
| 2487 ## we first pass the first read which is in - orientation on the reverse strand | |
| 2488 print_individual_C_methylation_states_paired_end_files($meth_call_1,$chrom,$start_read_1,$id_1,'-',$index,0,0,$cigar_1,1); | |
| 2489 | |
| 2490 # we next pass the second read which is in + orientation on the forward strand | |
| 2491 ### if --no_overlap was specified we also pass the end of read 1. If read 2 starts to overlap with read 1 we will stop extracting methylation calls from read 2 | |
| 2492 print_individual_C_methylation_states_paired_end_files($meth_call_2,$chrom,$start_read_2,$id_2,'+',$index,$no_overlap,$end_read_1,$cigar_2,2); | |
| 2493 } | |
| 2494 | |
| 2495 $methylation_call_strings_processed += 2; # paired-end = 2 methylation call strings | |
| 2496 } | |
| 2497 } | |
| 2498 } | |
| 2499 } else { | |
| 2500 die "Single-end or paired-end reads not specified properly\n"; | |
| 2501 } | |
| 2502 | |
| 2503 $counting{sequences_count} = $line_count; | |
| 2504 $counting{methylation_call_strings} = $methylation_call_strings_processed; | |
| 2505 | |
| 2506 if ($multicore == 1){ | |
| 2507 print_splitting_report (); | |
| 2508 } | |
| 2509 elsif ($multicore > 1){ | |
| 2510 print_splitting_report_multicore($report_filename,$offset,$line_count,$methylation_call_strings_processed); | |
| 2511 print_mbias_report_multicore($report_filename,$offset,$line_count,$methylation_call_strings_processed); | |
| 2512 } | |
| 2513 | |
| 2514 return ($process_id,\@pids,$report_filename); | |
| 2515 | |
| 2516 } | |
| 2517 | |
| 2518 | |
| 2519 | |
| 2520 sub print_splitting_report{ | |
| 2521 | |
| 2522 ### Calculating methylation percentages if applicable | |
| 2523 warn "\nProcessed $counting{sequences_count} lines in total\n"; | |
| 2524 warn "Total number of methylation call strings processed: $counting{methylation_call_strings}\n\n"; | |
| 2525 if ($report) { | |
| 2526 print REPORT "\nProcessed $counting{sequences_count} lines in total\n"; | |
| 2527 print REPORT "Total number of methylation call strings processed: $counting{methylation_call_strings}\n\n"; | |
| 2528 } | |
| 2529 | |
| 2530 my $percent_meCpG; | |
| 2531 if (($counting{total_meCpG_count}+$counting{total_unmethylated_CpG_count}) > 0){ | |
| 2532 $percent_meCpG = sprintf("%.1f",100*$counting{total_meCpG_count}/($counting{total_meCpG_count}+$counting{total_unmethylated_CpG_count})); | |
| 2533 } | |
| 2534 | |
| 2535 my $percent_meCHG; | |
| 2536 if (($counting{total_meCHG_count}+$counting{total_unmethylated_CHG_count}) > 0){ | |
| 2537 $percent_meCHG = sprintf("%.1f",100*$counting{total_meCHG_count}/($counting{total_meCHG_count}+$counting{total_unmethylated_CHG_count})); | |
| 2538 } | |
| 2539 | |
| 2540 my $percent_meCHH; | |
| 2541 if (($counting{total_meCHH_count}+$counting{total_unmethylated_CHH_count}) > 0){ | |
| 2542 $percent_meCHH = sprintf("%.1f",100*$counting{total_meCHH_count}/($counting{total_meCHH_count}+$counting{total_unmethylated_CHH_count})); | |
| 2543 } | |
| 2544 | |
| 2545 my $percent_non_CpG_methylation; | |
| 2546 if ($merge_non_CpG){ | |
| 2547 if ( ($counting{total_meCHH_count}+$counting{total_unmethylated_CHH_count}+$counting{total_meCHG_count}+$counting{total_unmethylated_CHG_count}) > 0){ | |
| 2548 $percent_non_CpG_methylation = sprintf("%.1f",100* ( $counting{total_meCHH_count}+$counting{total_meCHG_count} ) / ( $counting{total_meCHH_count}+$counting{total_unmethylated_CHH_count}+$counting{total_meCHG_count}+$counting{total_unmethylated_CHG_count} ) ); | |
| 2549 } | |
| 2550 } | |
| 2551 | |
| 2552 if ($report){ | |
| 2553 ### detailed information about Cs analysed | |
| 2554 print REPORT "Final Cytosine Methylation Report\n",'='x33,"\n"; | |
| 2555 | |
| 2556 my $total_number_of_C = $counting{total_meCHG_count}+$counting{total_meCHH_count}+$counting{total_meCpG_count}+$counting{total_unmethylated_CHG_count}+$counting{total_unmethylated_CHH_count}+$counting{total_unmethylated_CpG_count}; | |
| 2557 print REPORT "Total number of C's analysed:\t$total_number_of_C\n\n"; | |
| 2558 | |
| 2559 print REPORT "Total methylated C's in CpG context:\t$counting{total_meCpG_count}\n"; | |
| 2560 print REPORT "Total methylated C's in CHG context:\t$counting{total_meCHG_count}\n"; | |
| 2561 print REPORT "Total methylated C's in CHH context:\t$counting{total_meCHH_count}\n\n"; | |
| 2562 | |
| 2563 print REPORT "Total C to T conversions in CpG context:\t$counting{total_unmethylated_CpG_count}\n"; | |
| 2564 print REPORT "Total C to T conversions in CHG context:\t$counting{total_unmethylated_CHG_count}\n"; | |
| 2565 print REPORT "Total C to T conversions in CHH context:\t$counting{total_unmethylated_CHH_count}\n\n"; | |
| 2566 | |
| 2567 ### calculating methylated CpG percentage if applicable | |
| 2568 if ($percent_meCpG){ | |
| 2569 print REPORT "C methylated in CpG context:\t${percent_meCpG}%\n"; | |
| 2570 } | |
| 2571 else{ | |
| 2572 print REPORT "Can't determine percentage of methylated Cs in CpG context if value was 0\n"; | |
| 2573 } | |
| 2574 | |
| 2575 ### 2-Context Output | |
| 2576 if ($merge_non_CpG){ | |
| 2577 if ($percent_non_CpG_methylation){ | |
| 2578 print REPORT "C methylated in non-CpG context:\t${percent_non_CpG_methylation}%\n\n\n"; | |
| 2579 } | |
| 2580 else{ | |
| 2581 print REPORT "Can't determine percentage of methylated Cs in non-CpG context if value was 0\n\n\n"; | |
| 2582 } | |
| 2583 } | |
| 2584 | |
| 2585 ### 3 Context Output | |
| 2586 else{ | |
| 2587 ### calculating methylated CHG percentage if applicable | |
| 2588 if ($percent_meCHG){ | |
| 2589 print REPORT "C methylated in CHG context:\t${percent_meCHG}%\n"; | |
| 2590 } | |
| 2591 else{ | |
| 2592 print REPORT "Can't determine percentage of methylated Cs in CHG context if value was 0\n"; | |
| 2593 } | |
| 2594 | |
| 2595 ### calculating methylated CHH percentage if applicable | |
| 2596 if ($percent_meCHH){ | |
| 2597 print REPORT "C methylated in CHH context:\t${percent_meCHH}%\n\n\n"; | |
| 2598 } | |
| 2599 else{ | |
| 2600 print REPORT "Can't determine percentage of methylated Cs in CHH context if value was 0\n\n\n"; | |
| 2601 } | |
| 2602 } | |
| 2603 } | |
| 2604 | |
| 2605 ### detailed information about Cs analysed for on-screen report | |
| 2606 warn "Final Cytosine Methylation Report\n",'='x33,"\n"; | |
| 2607 | |
| 2608 my $total_number_of_C = $counting{total_meCHG_count}+$counting{total_meCHH_count}+$counting{total_meCpG_count}+$counting{total_unmethylated_CHG_count}+$counting{total_unmethylated_CHH_count}+$counting{total_unmethylated_CpG_count}; | |
| 2609 warn "Total number of C's analysed:\t$total_number_of_C\n\n"; | |
| 2610 | |
| 2611 warn "Total methylated C's in CpG context:\t$counting{total_meCpG_count}\n"; | |
| 2612 warn "Total methylated C's in CHG context:\t$counting{total_meCHG_count}\n"; | |
| 2613 warn"Total methylated C's in CHH context:\t$counting{total_meCHH_count}\n\n"; | |
| 2614 | |
| 2615 warn "Total C to T conversions in CpG context:\t$counting{total_unmethylated_CpG_count}\n"; | |
| 2616 warn "Total C to T conversions in CHG context:\t$counting{total_unmethylated_CHG_count}\n"; | |
| 2617 warn"Total C to T conversions in CHH context:\t$counting{total_unmethylated_CHH_count}\n\n"; | |
| 2618 | |
| 2619 ### printing methylated CpG percentage if applicable | |
| 2620 if ($percent_meCpG){ | |
| 2621 warn "C methylated in CpG context:\t${percent_meCpG}%\n"; | |
| 2622 } | |
| 2623 else{ | |
| 2624 warn "Can't determine percentage of methylated Cs in CpG context if value was 0\n"; | |
| 2625 } | |
| 2626 | |
| 2627 ### 2-Context Output | |
| 2628 if ($merge_non_CpG){ | |
| 2629 if ($percent_non_CpG_methylation){ | |
| 2630 warn "C methylated in non-CpG context:\t${percent_non_CpG_methylation}%\n\n\n"; | |
| 2631 } | |
| 2632 else{ | |
| 2633 warn "Can't determine percentage of methylated Cs in non-CpG context if value was 0\n\n\n"; | |
| 2634 } | |
| 2635 } | |
| 2636 | |
| 2637 ### 3-Context Output | |
| 2638 else{ | |
| 2639 ### printing methylated CHG percentage if applicable | |
| 2640 if ($percent_meCHG){ | |
| 2641 warn "C methylated in CHG context:\t${percent_meCHG}%\n"; | |
| 2642 } | |
| 2643 else{ | |
| 2644 warn "Can't determine percentage of methylated Cs in CHG context if value was 0\n"; | |
| 2645 } | |
| 2646 | |
| 2647 ### printing methylated CHH percentage if applicable | |
| 2648 if ($percent_meCHH){ | |
| 2649 warn "C methylated in CHH context:\t${percent_meCHH}%\n\n\n"; | |
| 2650 } | |
| 2651 else{ | |
| 2652 warn "Can't determine percentage of methylated Cs in CHH context if value was 0\n\n\n"; | |
| 2653 } | |
| 2654 } | |
| 2655 } | |
| 2656 | |
| 2657 ### | |
| 2658 | |
| 2659 sub print_splitting_report_multicore{ | |
| 2660 | |
| 2661 my ($report_filename,$offset,$line_count,$meth_call_strings) = @_; | |
| 2662 | |
| 2663 # warn "\$report_filename is $report_filename\n"; | |
| 2664 my $special_report = $report_filename.".$offset"; | |
| 2665 | |
| 2666 open (SPECIAL_REPORT,'>',$special_report) or die $!; | |
| 2667 # warn "line count\t$line_count\n"; | |
| 2668 # warn "meth call strings\t$meth_call_strings\n"; | |
| 2669 | |
| 2670 print SPECIAL_REPORT "line count\t$line_count\n"; | |
| 2671 print SPECIAL_REPORT "meth call strings\t$meth_call_strings\n"; | |
| 2672 | |
| 2673 ### Calculating methylation percentages if applicable | |
| 2674 my $percent_meCpG; | |
| 2675 if (($counting{total_meCpG_count}+$counting{total_unmethylated_CpG_count}) > 0){ | |
| 2676 $percent_meCpG = sprintf("%.1f",100*$counting{total_meCpG_count}/($counting{total_meCpG_count}+$counting{total_unmethylated_CpG_count})); | |
| 2677 } | |
| 2678 | |
| 2679 my $percent_meCHG; | |
| 2680 if (($counting{total_meCHG_count}+$counting{total_unmethylated_CHG_count}) > 0){ | |
| 2681 $percent_meCHG = sprintf("%.1f",100*$counting{total_meCHG_count}/($counting{total_meCHG_count}+$counting{total_unmethylated_CHG_count})); | |
| 2682 } | |
| 2683 | |
| 2684 my $percent_meCHH; | |
| 2685 if (($counting{total_meCHH_count}+$counting{total_unmethylated_CHH_count}) > 0){ | |
| 2686 $percent_meCHH = sprintf("%.1f",100*$counting{total_meCHH_count}/($counting{total_meCHH_count}+$counting{total_unmethylated_CHH_count})); | |
| 2687 } | |
| 2688 | |
| 2689 my $percent_non_CpG_methylation; | |
| 2690 if ($merge_non_CpG){ | |
| 2691 if ( ($counting{total_meCHH_count}+$counting{total_unmethylated_CHH_count}+$counting{total_meCHG_count}+$counting{total_unmethylated_CHG_count}) > 0){ | |
| 2692 $percent_non_CpG_methylation = sprintf("%.1f",100* ( $counting{total_meCHH_count}+$counting{total_meCHG_count} ) / ( $counting{total_meCHH_count}+$counting{total_unmethylated_CHH_count}+$counting{total_meCHG_count}+$counting{total_unmethylated_CHG_count} ) ); | |
| 2693 } | |
| 2694 } | |
| 2695 | |
| 2696 if ($report){ | |
| 2697 | |
| 2698 ### detailed information about Cs analysed | |
| 2699 print SPECIAL_REPORT "Final Cytosine Methylation Report\n",'='x33,"\n"; | |
| 2700 | |
| 2701 my $total_number_of_C = $counting{total_meCHG_count}+$counting{total_meCHH_count}+$counting{total_meCpG_count}+$counting{total_unmethylated_CHG_count}+$counting{total_unmethylated_CHH_count}+$counting{total_unmethylated_CpG_count}; | |
| 2702 print SPECIAL_REPORT "Total number of C's analysed:\t$total_number_of_C\n\n"; | |
| 2703 | |
| 2704 print SPECIAL_REPORT "Total methylated C's in CpG context:\t$counting{total_meCpG_count}\n"; | |
| 2705 print SPECIAL_REPORT "Total methylated C's in CHG context:\t$counting{total_meCHG_count}\n"; | |
| 2706 print SPECIAL_REPORT "Total methylated C's in CHH context:\t$counting{total_meCHH_count}\n\n"; | |
| 2707 | |
| 2708 print SPECIAL_REPORT "Total C to T conversions in CpG context:\t$counting{total_unmethylated_CpG_count}\n"; | |
| 2709 print SPECIAL_REPORT "Total C to T conversions in CHG context:\t$counting{total_unmethylated_CHG_count}\n"; | |
| 2710 print SPECIAL_REPORT "Total C to T conversions in CHH context:\t$counting{total_unmethylated_CHH_count}\n\n"; | |
| 2711 | |
| 2712 ### calculating methylated CpG percentage if applicable | |
| 2713 if ($percent_meCpG){ | |
| 2714 print SPECIAL_REPORT "C methylated in CpG context:\t${percent_meCpG}%\n"; | |
| 2715 } | |
| 2716 else{ | |
| 2717 print SPECIAL_REPORT "Can't determine percentage of methylated Cs in CpG context if value was 0\n"; | |
| 2718 } | |
| 2719 | |
| 2720 ### 2-Context Output | |
| 2721 if ($merge_non_CpG){ | |
| 2722 if ($percent_non_CpG_methylation){ | |
| 2723 print SPECIAL_REPORT "C methylated in non-CpG context:\t${percent_non_CpG_methylation}%\n\n\n"; | |
| 2724 } | |
| 2725 else{ | |
| 2726 print SPECIAL_REPORT "Can't determine percentage of methylated Cs in non-CpG context if value was 0\n\n\n"; | |
| 2727 } | |
| 2728 } | |
| 2729 | |
| 2730 ### 3 Context Output | |
| 2731 else{ | |
| 2732 ### calculating methylated CHG percentage if applicable | |
| 2733 if ($percent_meCHG){ | |
| 2734 print SPECIAL_REPORT "C methylated in CHG context:\t${percent_meCHG}%\n"; | |
| 2735 } | |
| 2736 else{ | |
| 2737 print SPECIAL_REPORT "Can't determine percentage of methylated Cs in CHG context if value was 0\n"; | |
| 2738 } | |
| 2739 | |
| 2740 ### calculating methylated CHH percentage if applicable | |
| 2741 if ($percent_meCHH){ | |
| 2742 print SPECIAL_REPORT "C methylated in CHH context:\t${percent_meCHH}%\n\n\n"; | |
| 2743 } | |
| 2744 else{ | |
| 2745 print SPECIAL_REPORT "Can't determine percentage of methylated Cs in CHH context if value was 0\n\n\n"; | |
| 2746 } | |
| 2747 } | |
| 2748 } | |
| 2749 close SPECIAL_REPORT or warn "Failed to close filehandle for individual report $special_report\n"; | |
| 2750 } | |
| 2751 | |
| 2752 | |
| 2753 ### | |
| 2754 | |
| 2755 ### INDIVIDUAL M-BIAS REPORTS | |
| 2756 | |
| 2757 sub print_mbias_report_multicore{ | |
| 2758 | |
| 2759 my ($report_filename,$offset,$line_count,$meth_call_strings) = @_; | |
| 2760 | |
| 2761 # warn "\$report_filename is $report_filename\n"; | |
| 2762 my $special_mbias_report = $report_filename.".${offset}.mbias"; | |
| 2763 | |
| 2764 open (SPECIAL_MBIAS,'>',$special_mbias_report) or die $!; | |
| 2765 | |
| 2766 # determining maximum read length | |
| 2767 my $max_length_1 = 0; | |
| 2768 my $max_length_2 = 0; | |
| 2769 | |
| 2770 foreach my $context (keys %mbias_1){ | |
| 2771 foreach my $pos (sort {$a<=>$b} keys %{$mbias_1{$context}}){ | |
| 2772 $max_length_1 = $pos unless ($max_length_1 >= $pos); | |
| 2773 } | |
| 2774 } | |
| 2775 if ($paired){ | |
| 2776 foreach my $context (keys %mbias_2){ | |
| 2777 foreach my $pos (sort {$a<=>$b} keys %{$mbias_2{$context}}){ | |
| 2778 $max_length_2 = $pos unless ($max_length_2 >= $pos); | |
| 2779 } | |
| 2780 } | |
| 2781 } | |
| 2782 | |
| 2783 if ($single){ | |
| 2784 # warn "Determining maximum read length for M-Bias plot\n"; | |
| 2785 # warn "Maximum read length of Read 1: $max_length_1\n\n"; | |
| 2786 } | |
| 2787 else{ | |
| 2788 # warn "Determining maximum read lengths for M-Bias plots\n"; | |
| 2789 # warn "Maximum read length of Read 1: $max_length_1\n"; | |
| 2790 # warn "Maximum read length of Read 2: $max_length_2\n\n"; | |
| 2791 } | |
| 2792 | |
| 2793 foreach my $context (qw(CpG CHG CHH)){ | |
| 2794 | |
| 2795 if ($paired){ | |
| 2796 print SPECIAL_MBIAS "$context context (R1)\n================\n"; | |
| 2797 } | |
| 2798 else{ | |
| 2799 print SPECIAL_MBIAS "$context context\n===========\n"; | |
| 2800 } | |
| 2801 print SPECIAL_MBIAS "position\tcount methylated\tcount unmethylated\t% methylation\tcoverage\n"; | |
| 2802 | |
| 2803 foreach my $pos (1..$max_length_1){ | |
| 2804 | |
| 2805 unless (defined $mbias_1{$context}->{$pos}->{meth}){ | |
| 2806 $mbias_1{$context}->{$pos}->{meth} = 0; | |
| 2807 } | |
| 2808 unless (defined $mbias_1{$context}->{$pos}->{un}){ | |
| 2809 $mbias_1{$context}->{$pos}->{un} = 0; | |
| 2810 } | |
| 2811 | |
| 2812 my $percent = ''; | |
| 2813 if (($mbias_1{$context}->{$pos}->{meth} + $mbias_1{$context}->{$pos}->{un}) > 0){ | |
| 2814 $percent = sprintf("%.2f",$mbias_1{$context}->{$pos}->{meth} * 100/ ( $mbias_1{$context}->{$pos}->{meth} + $mbias_1{$context}->{$pos}->{un}) ); | |
| 2815 } | |
| 2816 my $coverage = $mbias_1{$context}->{$pos}->{un} + $mbias_1{$context}->{$pos}->{meth}; | |
| 2817 | |
| 2818 print SPECIAL_MBIAS "$pos\t$mbias_1{$context}->{$pos}->{meth}\t$mbias_1{$context}->{$pos}->{un}\t$percent\t$coverage\n"; | |
| 2819 } | |
| 2820 print SPECIAL_MBIAS "\n"; | |
| 2821 } | |
| 2822 | |
| 2823 if ($paired){ | |
| 2824 | |
| 2825 foreach my $context (qw(CpG CHG CHH)){ | |
| 2826 | |
| 2827 print SPECIAL_MBIAS "$context context (R2)\n================\n"; | |
| 2828 print SPECIAL_MBIAS "position\tcount methylated\tcount unmethylated\t% methylation\tcoverage\n"; | |
| 2829 | |
| 2830 foreach my $pos (1..$max_length_2){ | |
| 2831 | |
| 2832 unless (defined $mbias_2{$context}->{$pos}->{meth}){ | |
| 2833 $mbias_2{$context}->{$pos}->{meth} = 0; | |
| 2834 } | |
| 2835 unless (defined $mbias_2{$context}->{$pos}->{un}){ | |
| 2836 $mbias_2{$context}->{$pos}->{un} = 0; | |
| 2837 } | |
| 2838 | |
| 2839 my $percent = ''; | |
| 2840 if (($mbias_2{$context}->{$pos}->{meth} + $mbias_2{$context}->{$pos}->{un}) > 0){ | |
| 2841 $percent = sprintf("%.2f",$mbias_2{$context}->{$pos}->{meth} * 100/ ($mbias_2{$context}->{$pos}->{meth} + $mbias_2{$context}->{$pos}->{un}) ); | |
| 2842 } | |
| 2843 my $coverage = $mbias_2{$context}->{$pos}->{un} + $mbias_2{$context}->{$pos}->{meth}; | |
| 2844 | |
| 2845 print SPECIAL_MBIAS "$pos\t$mbias_2{$context}->{$pos}->{meth}\t$mbias_2{$context}->{$pos}->{un}\t$percent\t$coverage\n"; | |
| 2846 } | |
| 2847 } | |
| 2848 } | |
| 2849 | |
| 2850 close SPECIAL_MBIAS or warn "Failed to close filehandle for individual M-bias report $special_mbias_report\n"; | |
| 2851 } | |
| 2852 | |
| 2853 | |
| 2854 ### | |
| 2855 | |
| 2856 | |
| 2857 sub print_individual_C_methylation_states_paired_end_files{ | |
| 2858 | |
| 2859 my ($meth_call,$chrom,$start,$id,$strand,$filehandle_index,$no_overlap,$end_read_1,$cigar,$read_identity) = @_; | |
| 2860 | |
| 2861 unless (defined $meth_call) { | |
| 2862 return; # skip this read | |
| 2863 } | |
| 2864 | |
| 2865 ### we will use the read identity for the M-bias plot to discriminate read 1 and read 2 | |
| 2866 die "Read identity was neither 1 nor 2: $read_identity\n\n" unless ($read_identity == 1 or $read_identity == 2); | |
| 2867 | |
| 2868 my @methylation_calls = split(//,$meth_call); | |
| 2869 | |
| 2870 ################################################################# | |
| 2871 ### . for bases not involving cytosines ### | |
| 2872 ### X for methylated C in CHG context (was protected) ### | |
| 2873 ### x for not methylated C in CHG context (was converted) ### | |
| 2874 ### H for methylated C in CHH context (was protected) ### | |
| 2875 ### h for not methylated C in CHH context (was converted) ### | |
| 2876 ### Z for methylated C in CpG context (was protected) ### | |
| 2877 ### z for not methylated C in CpG context (was converted) ### | |
| 2878 ### U for methylated C in Unknown context (was protected) ### | |
| 2879 ### u for not methylated C in Unknown context (was converted) ### | |
| 2880 ################################################################# | |
| 2881 | |
| 2882 my $methyl_CHG_count = 0; | |
| 2883 my $methyl_CHH_count = 0; | |
| 2884 my $methyl_CpG_count = 0; | |
| 2885 my $unmethylated_CHG_count = 0; | |
| 2886 my $unmethylated_CHH_count = 0; | |
| 2887 my $unmethylated_CpG_count = 0; | |
| 2888 | |
| 2889 my $pos_offset = 0; # this is only relevant for SAM reads with insertions or deletions | |
| 2890 my $cigar_offset = 0; # again, this is only relevant for SAM reads containing indels | |
| 2891 my @comp_cigar; | |
| 2892 | |
| 2893 ### Checking whether the CIGAR string is a linear genomic match or whether if requires indel processing | |
| 2894 if ($cigar =~ /^\d+M$/){ | |
| 2895 # this check speeds up the extraction process by up to 60%!!! | |
| 2896 } | |
| 2897 else{ # parsing CIGAR string | |
| 2898 my @len; | |
| 2899 my @ops; | |
| 2900 @len = split (/\D+/,$cigar); # storing the length per operation | |
| 2901 @ops = split (/\d+/,$cigar); # storing the operation | |
| 2902 shift @ops; # remove the empty first element | |
| 2903 | |
| 2904 die "CIGAR string contained a non-matching number of lengths and operations\n" unless (scalar @len == scalar @ops); | |
| 2905 | |
| 2906 foreach my $index (0..$#len){ | |
| 2907 foreach (1..$len[$index]){ | |
| 2908 # print "$ops[$index]"; | |
| 2909 push @comp_cigar, $ops[$index]; | |
| 2910 } | |
| 2911 } | |
| 2912 # warn "\nDetected CIGAR string: $cigar\n"; | |
| 2913 # warn "Length of methylation call: ",length $meth_call,"\n"; | |
| 2914 # warn "number of operations: ",scalar @ops,"\n"; | |
| 2915 # warn "number of length digits: ",scalar @len,"\n\n"; | |
| 2916 # print @comp_cigar,"\n"; | |
| 2917 # print "$meth_call\n\n"; | |
| 2918 # sleep (1); | |
| 2919 } | |
| 2920 | |
| 2921 if ($strand eq '-') { | |
| 2922 | |
| 2923 ### the CIGAR string needs to be reversed, the methylation call has already been reversed above | |
| 2924 if (@comp_cigar){ | |
| 2925 @comp_cigar = reverse@comp_cigar; # the CIGAR string needs to be reversed for all reads aligning to the reverse strand, too | |
| 2926 } | |
| 2927 # print "reverse CIGAR string: @comp_cigar\n"; | |
| 2928 | |
| 2929 ### the start position of paired-end files has already been corrected, see above | |
| 2930 } | |
| 2931 | |
| 2932 ### THIS IS AN OPTIONAL 2-CONTEXT (CpG and non-CpG) SECTION IF --merge_non_CpG was specified | |
| 2933 | |
| 2934 if ($merge_non_CpG) { | |
| 2935 if ($no_overlap) { # this has to be read 2... | |
| 2936 | |
| 2937 ### single-file CpG and non-CpG context output | |
| 2938 if ($full) { | |
| 2939 if ($strand eq '+') { | |
| 2940 for my $index (0..$#methylation_calls) { | |
| 2941 | |
| 2942 if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels | |
| 2943 my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); | |
| 2944 # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition+index: ",$start+$index,"\t"; | |
| 2945 $cigar_offset += $cigar_mod; | |
| 2946 $pos_offset += $pos_mod; | |
| 2947 } | |
| 2948 | |
| 2949 ### Returning as soon as the methylation calls start overlapping | |
| 2950 if ($start+$index+$pos_offset >= $end_read_1) { | |
| 2951 return; | |
| 2952 } | |
| 2953 | |
| 2954 if ($methylation_calls[$index] eq 'X') { | |
| 2955 $counting{total_meCHG_count}++; | |
| 2956 print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 2957 if ($read_identity == 1){ | |
| 2958 $mbias_1{CHG}->{$index+1}->{meth}++; | |
| 2959 } | |
| 2960 else{ | |
| 2961 $mbias_2{CHG}->{$index+1}->{meth}++; | |
| 2962 } | |
| 2963 } | |
| 2964 elsif ($methylation_calls[$index] eq 'x') { | |
| 2965 $counting{total_unmethylated_CHG_count}++; | |
| 2966 print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 2967 if ($read_identity == 1){ | |
| 2968 $mbias_1{CHG}->{$index+1}->{un}++; | |
| 2969 } | |
| 2970 else{ | |
| 2971 $mbias_2{CHG}->{$index+1}->{un}++; | |
| 2972 } | |
| 2973 } | |
| 2974 elsif ($methylation_calls[$index] eq 'Z') { | |
| 2975 $counting{total_meCpG_count}++; | |
| 2976 print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 2977 if ($read_identity == 1){ | |
| 2978 $mbias_1{CpG}->{$index+1}->{meth}++; | |
| 2979 } | |
| 2980 else{ | |
| 2981 $mbias_2{CpG}->{$index+1}->{meth}++; | |
| 2982 } | |
| 2983 } | |
| 2984 elsif ($methylation_calls[$index] eq 'z') { | |
| 2985 $counting{total_unmethylated_CpG_count}++; | |
| 2986 print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 2987 if ($read_identity == 1){ | |
| 2988 $mbias_1{CpG}->{$index+1}->{un}++; | |
| 2989 } | |
| 2990 else{ | |
| 2991 $mbias_2{CpG}->{$index+1}->{un}++; | |
| 2992 } | |
| 2993 } | |
| 2994 elsif ($methylation_calls[$index] eq 'H') { | |
| 2995 $counting{total_meCHH_count}++; | |
| 2996 print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 2997 if ($read_identity == 1){ | |
| 2998 $mbias_1{CHH}->{$index+1}->{meth}++; | |
| 2999 } | |
| 3000 else{ | |
| 3001 $mbias_2{CHH}->{$index+1}->{meth}++; | |
| 3002 } | |
| 3003 } | |
| 3004 elsif ($methylation_calls[$index] eq 'h') { | |
| 3005 $counting{total_unmethylated_CHH_count}++; | |
| 3006 print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3007 if ($read_identity == 1){ | |
| 3008 $mbias_1{CHH}->{$index+1}->{un}++; | |
| 3009 } | |
| 3010 else{ | |
| 3011 $mbias_2{CHH}->{$index+1}->{un}++; | |
| 3012 } | |
| 3013 } | |
| 3014 elsif ($methylation_calls[$index] eq '.'){} | |
| 3015 elsif (lc$methylation_calls[$index] eq 'u'){} | |
| 3016 else{ | |
| 3017 die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n" unless($mbias_only); | |
| 3018 } | |
| 3019 } | |
| 3020 } | |
| 3021 elsif ($strand eq '-') { | |
| 3022 for my $index (0..$#methylation_calls) { | |
| 3023 | |
| 3024 if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels | |
| 3025 # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition-index: ",$start-$index,"\t"; | |
| 3026 my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); | |
| 3027 $cigar_offset += $cigar_mod; | |
| 3028 $pos_offset += $pos_mod; | |
| 3029 } | |
| 3030 | |
| 3031 ### Returning as soon as the methylation calls start overlapping | |
| 3032 if ($start-$index+$pos_offset <= $end_read_1) { | |
| 3033 return; | |
| 3034 } | |
| 3035 | |
| 3036 if ($methylation_calls[$index] eq 'X') { | |
| 3037 $counting{total_meCHG_count}++; | |
| 3038 print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3039 if ($read_identity == 1){ | |
| 3040 $mbias_1{CHG}->{$index+1}->{meth}++; | |
| 3041 } | |
| 3042 else{ | |
| 3043 $mbias_2{CHG}->{$index+1}->{meth}++; | |
| 3044 } | |
| 3045 } | |
| 3046 elsif ($methylation_calls[$index] eq 'x') { | |
| 3047 $counting{total_unmethylated_CHG_count}++; | |
| 3048 print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3049 if ($read_identity == 1){ | |
| 3050 $mbias_1{CHG}->{$index+1}->{un}++; | |
| 3051 } | |
| 3052 else{ | |
| 3053 $mbias_2{CHG}->{$index+1}->{un}++; | |
| 3054 } | |
| 3055 } | |
| 3056 elsif ($methylation_calls[$index] eq 'Z') { | |
| 3057 $counting{total_meCpG_count}++; | |
| 3058 print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3059 if ($read_identity == 1){ | |
| 3060 $mbias_1{CpG}->{$index+1}->{meth}++; | |
| 3061 } | |
| 3062 else{ | |
| 3063 $mbias_2{CpG}->{$index+1}->{meth}++; | |
| 3064 } | |
| 3065 } | |
| 3066 elsif ($methylation_calls[$index] eq 'z') { | |
| 3067 $counting{total_unmethylated_CpG_count}++; | |
| 3068 print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3069 if ($read_identity == 1){ | |
| 3070 $mbias_1{CpG}->{$index+1}->{un}++; | |
| 3071 } | |
| 3072 else{ | |
| 3073 $mbias_2{CpG}->{$index+1}->{un}++; | |
| 3074 } | |
| 3075 } | |
| 3076 elsif ($methylation_calls[$index] eq 'H') { | |
| 3077 $counting{total_meCHH_count}++; | |
| 3078 print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3079 if ($read_identity == 1){ | |
| 3080 $mbias_1{CHH}->{$index+1}->{meth}++; | |
| 3081 } | |
| 3082 else{ | |
| 3083 $mbias_2{CHH}->{$index+1}->{meth}++; | |
| 3084 } | |
| 3085 } | |
| 3086 elsif ($methylation_calls[$index] eq 'h') { | |
| 3087 $counting{total_unmethylated_CHH_count}++; | |
| 3088 print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3089 if ($read_identity == 1){ | |
| 3090 $mbias_1{CHH}->{$index+1}->{un}++; | |
| 3091 } | |
| 3092 else{ | |
| 3093 $mbias_2{CHH}->{$index+1}->{un}++; | |
| 3094 } | |
| 3095 } | |
| 3096 elsif ($methylation_calls[$index] eq '.') {} | |
| 3097 elsif (lc$methylation_calls[$index] eq 'u'){} | |
| 3098 else{ | |
| 3099 die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n" unless($mbias_only); | |
| 3100 } | |
| 3101 } | |
| 3102 } else { | |
| 3103 die "The read orientation was neither + nor -: '$strand'\n"; | |
| 3104 } | |
| 3105 } | |
| 3106 | |
| 3107 ### strand-specific methylation output | |
| 3108 else { | |
| 3109 if ($strand eq '+') { | |
| 3110 for my $index (0..$#methylation_calls) { | |
| 3111 | |
| 3112 if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels | |
| 3113 my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); | |
| 3114 # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition+index: ",$start+$index,"\t"; | |
| 3115 $cigar_offset += $cigar_mod; | |
| 3116 $pos_offset += $pos_mod; | |
| 3117 } | |
| 3118 | |
| 3119 ### Returning as soon as the methylation calls start overlapping | |
| 3120 if ($start+$index+$pos_offset >= $end_read_1) { | |
| 3121 return; | |
| 3122 } | |
| 3123 | |
| 3124 if ($methylation_calls[$index] eq 'X') { | |
| 3125 $counting{total_meCHG_count}++; | |
| 3126 print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3127 if ($read_identity == 1){ | |
| 3128 $mbias_1{CHG}->{$index+1}->{meth}++; | |
| 3129 } | |
| 3130 else{ | |
| 3131 $mbias_2{CHG}->{$index+1}->{meth}++; | |
| 3132 } | |
| 3133 } | |
| 3134 elsif ($methylation_calls[$index] eq 'x') { | |
| 3135 $counting{total_unmethylated_CHG_count}++; | |
| 3136 print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3137 if ($read_identity == 1){ | |
| 3138 $mbias_1{CHG}->{$index+1}->{un}++; | |
| 3139 } | |
| 3140 else{ | |
| 3141 $mbias_2{CHG}->{$index+1}->{un}++; | |
| 3142 } | |
| 3143 } | |
| 3144 elsif ($methylation_calls[$index] eq 'Z') { | |
| 3145 $counting{total_meCpG_count}++; | |
| 3146 print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3147 if ($read_identity == 1){ | |
| 3148 $mbias_1{CpG}->{$index+1}->{meth}++; | |
| 3149 } | |
| 3150 else{ | |
| 3151 $mbias_2{CpG}->{$index+1}->{meth}++; | |
| 3152 } | |
| 3153 } | |
| 3154 elsif ($methylation_calls[$index] eq 'z') { | |
| 3155 $counting{total_unmethylated_CpG_count}++; | |
| 3156 print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3157 if ($read_identity == 1){ | |
| 3158 $mbias_1{CpG}->{$index+1}->{un}++; | |
| 3159 } | |
| 3160 else{ | |
| 3161 $mbias_2{CpG}->{$index+1}->{un}++; | |
| 3162 } | |
| 3163 } | |
| 3164 elsif ($methylation_calls[$index] eq 'H') { | |
| 3165 $counting{total_meCHH_count}++; | |
| 3166 print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3167 if ($read_identity == 1){ | |
| 3168 $mbias_1{CHH}->{$index+1}->{meth}++; | |
| 3169 } | |
| 3170 else{ | |
| 3171 $mbias_2{CHH}->{$index+1}->{meth}++; | |
| 3172 } | |
| 3173 } | |
| 3174 elsif ($methylation_calls[$index] eq 'h') { | |
| 3175 $counting{total_unmethylated_CHH_count}++; | |
| 3176 print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3177 if ($read_identity == 1){ | |
| 3178 $mbias_1{CHH}->{$index+1}->{un}++; | |
| 3179 } | |
| 3180 else{ | |
| 3181 $mbias_2{CHH}->{$index+1}->{un}++; | |
| 3182 } | |
| 3183 } | |
| 3184 elsif ($methylation_calls[$index] eq '.') {} | |
| 3185 elsif (lc$methylation_calls[$index] eq 'u'){} | |
| 3186 else{ | |
| 3187 die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; | |
| 3188 } | |
| 3189 } | |
| 3190 } elsif ($strand eq '-') { | |
| 3191 for my $index (0..$#methylation_calls) { | |
| 3192 | |
| 3193 if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels | |
| 3194 # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition-index: ",$start-$index,"\t"; | |
| 3195 my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); | |
| 3196 $cigar_offset += $cigar_mod; | |
| 3197 $pos_offset += $pos_mod; | |
| 3198 } | |
| 3199 | |
| 3200 ### Returning as soon as the methylation calls start overlapping | |
| 3201 if ($start-$index+$pos_offset <= $end_read_1) { | |
| 3202 return; | |
| 3203 } | |
| 3204 | |
| 3205 if ($methylation_calls[$index] eq 'X') { | |
| 3206 $counting{total_meCHG_count}++; | |
| 3207 print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3208 if ($read_identity == 1){ | |
| 3209 $mbias_1{CHG}->{$index+1}->{meth}++; | |
| 3210 } | |
| 3211 else{ | |
| 3212 $mbias_2{CHG}->{$index+1}->{meth}++; | |
| 3213 } | |
| 3214 } | |
| 3215 elsif ($methylation_calls[$index] eq 'x') { | |
| 3216 $counting{total_unmethylated_CHG_count}++; | |
| 3217 print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3218 if ($read_identity == 1){ | |
| 3219 $mbias_1{CHG}->{$index+1}->{un}++; | |
| 3220 } | |
| 3221 else{ | |
| 3222 $mbias_2{CHG}->{$index+1}->{un}++; | |
| 3223 } | |
| 3224 } | |
| 3225 elsif ($methylation_calls[$index] eq 'Z') { | |
| 3226 $counting{total_meCpG_count}++; | |
| 3227 print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3228 if ($read_identity == 1){ | |
| 3229 $mbias_1{CpG}->{$index+1}->{meth}++; | |
| 3230 } | |
| 3231 else{ | |
| 3232 $mbias_2{CpG}->{$index+1}->{meth}++; | |
| 3233 } | |
| 3234 } | |
| 3235 elsif ($methylation_calls[$index] eq 'z') { | |
| 3236 $counting{total_unmethylated_CpG_count}++; | |
| 3237 print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3238 if ($read_identity == 1){ | |
| 3239 $mbias_1{CpG}->{$index+1}->{un}++; | |
| 3240 } | |
| 3241 else{ | |
| 3242 $mbias_2{CpG}->{$index+1}->{un}++; | |
| 3243 } | |
| 3244 } | |
| 3245 elsif ($methylation_calls[$index] eq 'H') { | |
| 3246 $counting{total_meCHH_count}++; | |
| 3247 print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3248 if ($read_identity == 1){ | |
| 3249 $mbias_1{CHH}->{$index+1}->{meth}++; | |
| 3250 } | |
| 3251 else{ | |
| 3252 $mbias_2{CHH}->{$index+1}->{meth}++; | |
| 3253 } | |
| 3254 } | |
| 3255 elsif ($methylation_calls[$index] eq 'h') { | |
| 3256 $counting{total_unmethylated_CHH_count}++; | |
| 3257 print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3258 if ($read_identity == 1){ | |
| 3259 $mbias_1{CHH}->{$index+1}->{un}++; | |
| 3260 } | |
| 3261 else{ | |
| 3262 $mbias_2{CHH}->{$index+1}->{un}++; | |
| 3263 } | |
| 3264 } | |
| 3265 elsif ($methylation_calls[$index] eq '.') {} | |
| 3266 elsif (lc$methylation_calls[$index] eq 'u'){} | |
| 3267 else{ | |
| 3268 die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; | |
| 3269 } | |
| 3270 } | |
| 3271 } else { | |
| 3272 die "The strand orientation was neither + nor -: '$strand'/n"; | |
| 3273 } | |
| 3274 } | |
| 3275 } | |
| 3276 | |
| 3277 ### this is the default paired-end procedure allowing overlaps and using every single C position | |
| 3278 ### Still within the 2-CONTEXT ONLY optional section | |
| 3279 else { | |
| 3280 ### single-file CpG and non-CpG context output | |
| 3281 if ($full) { | |
| 3282 if ($strand eq '+') { | |
| 3283 for my $index (0..$#methylation_calls) { | |
| 3284 | |
| 3285 if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels | |
| 3286 my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); | |
| 3287 # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition+index: ",$start+$index,"\t"; | |
| 3288 $cigar_offset += $cigar_mod; | |
| 3289 $pos_offset += $pos_mod; | |
| 3290 } | |
| 3291 | |
| 3292 if ($methylation_calls[$index] eq 'X') { | |
| 3293 $counting{total_meCHG_count}++; | |
| 3294 print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3295 if ($read_identity == 1){ | |
| 3296 $mbias_1{CHG}->{$index+1}->{meth}++; | |
| 3297 } | |
| 3298 else{ | |
| 3299 $mbias_2{CHG}->{$index+1}->{meth}++; | |
| 3300 } | |
| 3301 } | |
| 3302 elsif ($methylation_calls[$index] eq 'x') { | |
| 3303 $counting{total_unmethylated_CHG_count}++; | |
| 3304 print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3305 if ($read_identity == 1){ | |
| 3306 $mbias_1{CHG}->{$index+1}->{un}++; | |
| 3307 } | |
| 3308 else{ | |
| 3309 $mbias_2{CHG}->{$index+1}->{un}++; | |
| 3310 } | |
| 3311 } | |
| 3312 elsif ($methylation_calls[$index] eq 'Z') { | |
| 3313 $counting{total_meCpG_count}++; | |
| 3314 print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3315 if ($read_identity == 1){ | |
| 3316 $mbias_1{CpG}->{$index+1}->{meth}++; | |
| 3317 } | |
| 3318 else{ | |
| 3319 $mbias_2{CpG}->{$index+1}->{meth}++; | |
| 3320 } | |
| 3321 } | |
| 3322 elsif ($methylation_calls[$index] eq 'z') { | |
| 3323 $counting{total_unmethylated_CpG_count}++; | |
| 3324 print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3325 if ($read_identity == 1){ | |
| 3326 $mbias_1{CpG}->{$index+1}->{un}++; | |
| 3327 } | |
| 3328 else{ | |
| 3329 $mbias_2{CpG}->{$index+1}->{un}++; | |
| 3330 } | |
| 3331 } | |
| 3332 elsif ($methylation_calls[$index] eq 'H') { | |
| 3333 $counting{total_meCHH_count}++; | |
| 3334 print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3335 if ($read_identity == 1){ | |
| 3336 $mbias_1{CHH}->{$index+1}->{meth}++; | |
| 3337 } | |
| 3338 else{ | |
| 3339 $mbias_2{CHH}->{$index+1}->{meth}++; | |
| 3340 } | |
| 3341 } | |
| 3342 elsif ($methylation_calls[$index] eq 'h') { | |
| 3343 $counting{total_unmethylated_CHH_count}++; | |
| 3344 print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3345 if ($read_identity == 1){ | |
| 3346 $mbias_1{CHH}->{$index+1}->{un}++; | |
| 3347 } | |
| 3348 else{ | |
| 3349 $mbias_2{CHH}->{$index+1}->{un}++; | |
| 3350 } | |
| 3351 } | |
| 3352 elsif ($methylation_calls[$index] eq '.') {} | |
| 3353 elsif (lc$methylation_calls[$index] eq 'u'){} | |
| 3354 else{ | |
| 3355 die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n" unless($mbias_only); | |
| 3356 } | |
| 3357 } | |
| 3358 } elsif ($strand eq '-') { | |
| 3359 for my $index (0..$#methylation_calls) { | |
| 3360 | |
| 3361 if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels | |
| 3362 # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition-index: ",$start-$index,"\t"; | |
| 3363 my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); | |
| 3364 $cigar_offset += $cigar_mod; | |
| 3365 $pos_offset += $pos_mod; | |
| 3366 } | |
| 3367 | |
| 3368 if ($methylation_calls[$index] eq 'X') { | |
| 3369 $counting{total_meCHG_count}++; | |
| 3370 print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3371 if ($read_identity == 1){ | |
| 3372 $mbias_1{CHG}->{$index+1}->{meth}++; | |
| 3373 } | |
| 3374 else{ | |
| 3375 $mbias_2{CHG}->{$index+1}->{meth}++; | |
| 3376 } | |
| 3377 } | |
| 3378 elsif ($methylation_calls[$index] eq 'x') { | |
| 3379 $counting{total_unmethylated_CHG_count}++; | |
| 3380 print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3381 if ($read_identity == 1){ | |
| 3382 $mbias_1{CHG}->{$index+1}->{un}++; | |
| 3383 } | |
| 3384 else{ | |
| 3385 $mbias_2{CHG}->{$index+1}->{un}++; | |
| 3386 } | |
| 3387 } | |
| 3388 elsif ($methylation_calls[$index] eq 'Z') { | |
| 3389 $counting{total_meCpG_count}++; | |
| 3390 print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3391 if ($read_identity == 1){ | |
| 3392 $mbias_1{CpG}->{$index+1}->{meth}++; | |
| 3393 } | |
| 3394 else{ | |
| 3395 $mbias_2{CpG}->{$index+1}->{meth}++; | |
| 3396 } | |
| 3397 } | |
| 3398 elsif ($methylation_calls[$index] eq 'z') { | |
| 3399 $counting{total_unmethylated_CpG_count}++; | |
| 3400 print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3401 if ($read_identity == 1){ | |
| 3402 $mbias_1{CpG}->{$index+1}->{un}++; | |
| 3403 } | |
| 3404 else{ | |
| 3405 $mbias_2{CpG}->{$index+1}->{un}++; | |
| 3406 } | |
| 3407 } | |
| 3408 elsif ($methylation_calls[$index] eq 'H') { | |
| 3409 $counting{total_meCHH_count}++; | |
| 3410 print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3411 if ($read_identity == 1){ | |
| 3412 $mbias_1{CHH}->{$index+1}->{meth}++; | |
| 3413 } | |
| 3414 else{ | |
| 3415 $mbias_2{CHH}->{$index+1}->{meth}++; | |
| 3416 } | |
| 3417 } | |
| 3418 elsif ($methylation_calls[$index] eq 'h') { | |
| 3419 $counting{total_unmethylated_CHH_count}++; | |
| 3420 print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3421 if ($read_identity == 1){ | |
| 3422 $mbias_1{CHH}->{$index+1}->{un}++; | |
| 3423 } | |
| 3424 else{ | |
| 3425 $mbias_2{CHH}->{$index+1}->{un}++; | |
| 3426 } | |
| 3427 } | |
| 3428 elsif ($methylation_calls[$index] eq '.') {} | |
| 3429 elsif (lc$methylation_calls[$index] eq 'u'){} | |
| 3430 else{ | |
| 3431 die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n" unless($mbias_only); | |
| 3432 } | |
| 3433 } | |
| 3434 } else { | |
| 3435 die "The strand orientation as neither + nor -: '$strand'\n"; | |
| 3436 } | |
| 3437 } | |
| 3438 | |
| 3439 ### strand-specific methylation output | |
| 3440 ### still within the 2-CONTEXT optional section | |
| 3441 else { | |
| 3442 if ($strand eq '+') { | |
| 3443 for my $index (0..$#methylation_calls) { | |
| 3444 | |
| 3445 if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels | |
| 3446 my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); | |
| 3447 # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition+index: ",$start+$index,"\t"; | |
| 3448 $cigar_offset += $cigar_mod; | |
| 3449 $pos_offset += $pos_mod; | |
| 3450 } | |
| 3451 | |
| 3452 if ($methylation_calls[$index] eq 'X') { | |
| 3453 $counting{total_meCHG_count}++; | |
| 3454 print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3455 if ($read_identity == 1){ | |
| 3456 $mbias_1{CHG}->{$index+1}->{meth}++; | |
| 3457 } | |
| 3458 else{ | |
| 3459 $mbias_2{CHG}->{$index+1}->{meth}++; | |
| 3460 } | |
| 3461 } | |
| 3462 elsif ($methylation_calls[$index] eq 'x') { | |
| 3463 $counting{total_unmethylated_CHG_count}++; | |
| 3464 print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3465 if ($read_identity == 1){ | |
| 3466 $mbias_1{CHG}->{$index+1}->{un}++; | |
| 3467 } | |
| 3468 else{ | |
| 3469 $mbias_2{CHG}->{$index+1}->{un}++; | |
| 3470 } | |
| 3471 } | |
| 3472 elsif ($methylation_calls[$index] eq 'Z') { | |
| 3473 $counting{total_meCpG_count}++; | |
| 3474 print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3475 if ($read_identity == 1){ | |
| 3476 $mbias_1{CpG}->{$index+1}->{meth}++; | |
| 3477 } | |
| 3478 else{ | |
| 3479 $mbias_2{CpG}->{$index+1}->{meth}++; | |
| 3480 } | |
| 3481 } | |
| 3482 elsif ($methylation_calls[$index] eq 'z') { | |
| 3483 $counting{total_unmethylated_CpG_count}++; | |
| 3484 print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3485 if ($read_identity == 1){ | |
| 3486 $mbias_1{CpG}->{$index+1}->{un}++; | |
| 3487 } | |
| 3488 else{ | |
| 3489 $mbias_2{CpG}->{$index+1}->{un}++; | |
| 3490 } | |
| 3491 } | |
| 3492 elsif ($methylation_calls[$index] eq 'H') { | |
| 3493 $counting{total_meCHH_count}++; | |
| 3494 print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3495 if ($read_identity == 1){ | |
| 3496 $mbias_1{CHH}->{$index+1}->{meth}++; | |
| 3497 } | |
| 3498 else{ | |
| 3499 $mbias_2{CHH}->{$index+1}->{meth}++; | |
| 3500 } | |
| 3501 } | |
| 3502 elsif ($methylation_calls[$index] eq 'h') { | |
| 3503 $counting{total_unmethylated_CHH_count}++; | |
| 3504 print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3505 if ($read_identity == 1){ | |
| 3506 $mbias_1{CHH}->{$index+1}->{un}++; | |
| 3507 } | |
| 3508 else{ | |
| 3509 $mbias_2{CHH}->{$index+1}->{un}++; | |
| 3510 } | |
| 3511 } | |
| 3512 elsif ($methylation_calls[$index] eq '.') {} | |
| 3513 elsif (lc$methylation_calls[$index] eq 'u'){} | |
| 3514 else{ | |
| 3515 die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; | |
| 3516 } | |
| 3517 } | |
| 3518 } elsif ($strand eq '-') { | |
| 3519 for my $index (0..$#methylation_calls) { | |
| 3520 | |
| 3521 if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels | |
| 3522 # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition-index: ",$start-$index,"\t"; | |
| 3523 my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); | |
| 3524 $cigar_offset += $cigar_mod; | |
| 3525 $pos_offset += $pos_mod; | |
| 3526 } | |
| 3527 | |
| 3528 if ($methylation_calls[$index] eq 'X') { | |
| 3529 $counting{total_meCHG_count}++; | |
| 3530 print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3531 if ($read_identity == 1){ | |
| 3532 $mbias_1{CHG}->{$index+1}->{meth}++; | |
| 3533 } | |
| 3534 else{ | |
| 3535 $mbias_2{CHG}->{$index+1}->{meth}++; | |
| 3536 } | |
| 3537 } | |
| 3538 elsif ($methylation_calls[$index] eq 'x') { | |
| 3539 $counting{total_unmethylated_CHG_count}++; | |
| 3540 print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3541 if ($read_identity == 1){ | |
| 3542 $mbias_1{CHG}->{$index+1}->{un}++; | |
| 3543 } | |
| 3544 else{ | |
| 3545 $mbias_2{CHG}->{$index+1}->{un}++; | |
| 3546 } | |
| 3547 } | |
| 3548 elsif ($methylation_calls[$index] eq 'Z') { | |
| 3549 $counting{total_meCpG_count}++; | |
| 3550 print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3551 if ($read_identity == 1){ | |
| 3552 $mbias_1{CpG}->{$index+1}->{meth}++; | |
| 3553 } | |
| 3554 else{ | |
| 3555 $mbias_2{CpG}->{$index+1}->{meth}++; | |
| 3556 } | |
| 3557 } | |
| 3558 elsif ($methylation_calls[$index] eq 'z') { | |
| 3559 $counting{total_unmethylated_CpG_count}++; | |
| 3560 print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3561 if ($read_identity == 1){ | |
| 3562 $mbias_1{CpG}->{$index+1}->{un}++; | |
| 3563 } | |
| 3564 else{ | |
| 3565 $mbias_2{CpG}->{$index+1}->{un}++; | |
| 3566 } | |
| 3567 } | |
| 3568 elsif ($methylation_calls[$index] eq 'H') { | |
| 3569 $counting{total_meCHH_count}++; | |
| 3570 print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3571 if ($read_identity == 1){ | |
| 3572 $mbias_1{CHH}->{$index+1}->{meth}++; | |
| 3573 } | |
| 3574 else{ | |
| 3575 $mbias_2{CHH}->{$index+1}->{meth}++; | |
| 3576 } | |
| 3577 } | |
| 3578 elsif ($methylation_calls[$index] eq 'h') { | |
| 3579 $counting{total_unmethylated_CHH_count}++; | |
| 3580 print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3581 if ($read_identity == 1){ | |
| 3582 $mbias_1{CHH}->{$index+1}->{un}++; | |
| 3583 } | |
| 3584 else{ | |
| 3585 $mbias_2{CHH}->{$index+1}->{un}++; | |
| 3586 } | |
| 3587 } | |
| 3588 elsif ($methylation_calls[$index] eq '.') {} | |
| 3589 elsif (lc$methylation_calls[$index] eq 'u'){} | |
| 3590 else{ | |
| 3591 die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; | |
| 3592 } | |
| 3593 } | |
| 3594 } else { | |
| 3595 die "The strand orientation as neither + nor -: '$strand'\n"; | |
| 3596 } | |
| 3597 } | |
| 3598 } | |
| 3599 } | |
| 3600 | |
| 3601 ############################################ | |
| 3602 ### THIS IS THE DEFAULT 3-CONTEXT OUTPUT ### | |
| 3603 ############################################ | |
| 3604 | |
| 3605 elsif ($no_overlap) { | |
| 3606 ### single-file CpG, CHG and CHH context output | |
| 3607 if ($full) { | |
| 3608 if ($strand eq '+') { | |
| 3609 for my $index (0..$#methylation_calls) { | |
| 3610 | |
| 3611 if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels | |
| 3612 my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); | |
| 3613 # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition+index: ",$start+$index,"\t"; | |
| 3614 $cigar_offset += $cigar_mod; | |
| 3615 $pos_offset += $pos_mod; | |
| 3616 } | |
| 3617 | |
| 3618 ### Returning as soon as the methylation calls start overlapping | |
| 3619 if ($start+$index+$pos_offset >= $end_read_1) { | |
| 3620 return; | |
| 3621 } | |
| 3622 | |
| 3623 if ($methylation_calls[$index] eq 'X') { | |
| 3624 $counting{total_meCHG_count}++; | |
| 3625 print {$fhs{CHG_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3626 if ($read_identity == 1){ | |
| 3627 $mbias_1{CHG}->{$index+1}->{meth}++; | |
| 3628 } | |
| 3629 else{ | |
| 3630 $mbias_2{CHG}->{$index+1}->{meth}++; | |
| 3631 } | |
| 3632 } | |
| 3633 elsif ($methylation_calls[$index] eq 'x') { | |
| 3634 $counting{total_unmethylated_CHG_count}++; | |
| 3635 print {$fhs{CHG_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3636 if ($read_identity == 1){ | |
| 3637 $mbias_1{CHG}->{$index+1}->{un}++; | |
| 3638 } | |
| 3639 else{ | |
| 3640 $mbias_2{CHG}->{$index+1}->{un}++; | |
| 3641 } | |
| 3642 } | |
| 3643 elsif ($methylation_calls[$index] eq 'Z') { | |
| 3644 $counting{total_meCpG_count}++; | |
| 3645 print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3646 if ($read_identity == 1){ | |
| 3647 $mbias_1{CpG}->{$index+1}->{meth}++; | |
| 3648 } | |
| 3649 else{ | |
| 3650 $mbias_2{CpG}->{$index+1}->{meth}++; | |
| 3651 } | |
| 3652 } | |
| 3653 elsif ($methylation_calls[$index] eq 'z') { | |
| 3654 $counting{total_unmethylated_CpG_count}++; | |
| 3655 print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3656 if ($read_identity == 1){ | |
| 3657 $mbias_1{CpG}->{$index+1}->{un}++; | |
| 3658 } | |
| 3659 else{ | |
| 3660 $mbias_2{CpG}->{$index+1}->{un}++; | |
| 3661 } | |
| 3662 } | |
| 3663 elsif ($methylation_calls[$index] eq 'H') { | |
| 3664 $counting{total_meCHH_count}++; | |
| 3665 print {$fhs{CHH_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3666 if ($read_identity == 1){ | |
| 3667 $mbias_1{CHH}->{$index+1}->{meth}++; | |
| 3668 } | |
| 3669 else{ | |
| 3670 $mbias_2{CHH}->{$index+1}->{meth}++; | |
| 3671 } | |
| 3672 } | |
| 3673 elsif ($methylation_calls[$index] eq 'h') { | |
| 3674 $counting{total_unmethylated_CHH_count}++; | |
| 3675 print {$fhs{CHH_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3676 if ($read_identity == 1){ | |
| 3677 $mbias_1{CHH}->{$index+1}->{un}++; | |
| 3678 } | |
| 3679 else{ | |
| 3680 $mbias_2{CHH}->{$index+1}->{un}++; | |
| 3681 } | |
| 3682 } | |
| 3683 elsif ($methylation_calls[$index] eq '.') {} | |
| 3684 elsif (lc$methylation_calls[$index] eq 'u'){} | |
| 3685 else{ | |
| 3686 die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; | |
| 3687 } | |
| 3688 } | |
| 3689 } elsif ($strand eq '-') { | |
| 3690 for my $index (0..$#methylation_calls) { | |
| 3691 | |
| 3692 if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels | |
| 3693 # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition-index: ",$start-$index,"\t"; | |
| 3694 my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); | |
| 3695 $cigar_offset += $cigar_mod; | |
| 3696 $pos_offset += $pos_mod; | |
| 3697 } | |
| 3698 | |
| 3699 ### Returning as soon as the methylation calls start overlapping | |
| 3700 if ($start-$index+$pos_offset <= $end_read_1) { | |
| 3701 return; | |
| 3702 } | |
| 3703 | |
| 3704 if ($methylation_calls[$index] eq 'X') { | |
| 3705 $counting{total_meCHG_count}++; | |
| 3706 print {$fhs{CHG_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3707 if ($read_identity == 1){ | |
| 3708 $mbias_1{CHG}->{$index+1}->{meth}++; | |
| 3709 } | |
| 3710 else{ | |
| 3711 $mbias_2{CHG}->{$index+1}->{meth}++; | |
| 3712 } | |
| 3713 } | |
| 3714 elsif ($methylation_calls[$index] eq 'x') { | |
| 3715 $counting{total_unmethylated_CHG_count}++; | |
| 3716 print {$fhs{CHG_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3717 if ($read_identity == 1){ | |
| 3718 $mbias_1{CHG}->{$index+1}->{un}++; | |
| 3719 } | |
| 3720 else{ | |
| 3721 $mbias_2{CHG}->{$index+1}->{un}++; | |
| 3722 } | |
| 3723 } | |
| 3724 elsif ($methylation_calls[$index] eq 'Z') { | |
| 3725 $counting{total_meCpG_count}++; | |
| 3726 print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3727 if ($read_identity == 1){ | |
| 3728 $mbias_1{CpG}->{$index+1}->{meth}++; | |
| 3729 } | |
| 3730 else{ | |
| 3731 $mbias_2{CpG}->{$index+1}->{meth}++; | |
| 3732 } | |
| 3733 } | |
| 3734 elsif ($methylation_calls[$index] eq 'z') { | |
| 3735 $counting{total_unmethylated_CpG_count}++; | |
| 3736 print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3737 if ($read_identity == 1){ | |
| 3738 $mbias_1{CpG}->{$index+1}->{un}++; | |
| 3739 } | |
| 3740 else{ | |
| 3741 $mbias_2{CpG}->{$index+1}->{un}++; | |
| 3742 } | |
| 3743 } | |
| 3744 elsif ($methylation_calls[$index] eq 'H') { | |
| 3745 $counting{total_meCHH_count}++; | |
| 3746 print {$fhs{CHH_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3747 if ($read_identity == 1){ | |
| 3748 $mbias_1{CHH}->{$index+1}->{meth}++; | |
| 3749 } | |
| 3750 else{ | |
| 3751 $mbias_2{CHH}->{$index+1}->{meth}++; | |
| 3752 } | |
| 3753 } | |
| 3754 elsif ($methylation_calls[$index] eq 'h') { | |
| 3755 $counting{total_unmethylated_CHH_count}++; | |
| 3756 print {$fhs{CHH_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3757 if ($read_identity == 1){ | |
| 3758 $mbias_1{CHH}->{$index+1}->{un}++; | |
| 3759 } | |
| 3760 else{ | |
| 3761 $mbias_2{CHH}->{$index+1}->{un}++; | |
| 3762 } | |
| 3763 } | |
| 3764 elsif ($methylation_calls[$index] eq '.') {} | |
| 3765 elsif (lc$methylation_calls[$index] eq 'u'){} | |
| 3766 else{ | |
| 3767 die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; | |
| 3768 } | |
| 3769 } | |
| 3770 } else { | |
| 3771 die "The strand orientation as neither + nor -: '$strand'\n"; | |
| 3772 } | |
| 3773 } | |
| 3774 | |
| 3775 ### strand-specific methylation output | |
| 3776 else { | |
| 3777 if ($strand eq '+') { | |
| 3778 for my $index (0..$#methylation_calls) { | |
| 3779 | |
| 3780 if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels | |
| 3781 my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); | |
| 3782 # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition+index: ",$start+$index,"\t"; | |
| 3783 $cigar_offset += $cigar_mod; | |
| 3784 $pos_offset += $pos_mod; | |
| 3785 } | |
| 3786 | |
| 3787 ### Returning as soon as the methylation calls start overlapping | |
| 3788 if ($start+$index+$pos_offset >= $end_read_1) { | |
| 3789 return; | |
| 3790 } | |
| 3791 | |
| 3792 if ($methylation_calls[$index] eq 'X') { | |
| 3793 $counting{total_meCHG_count}++; | |
| 3794 print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3795 if ($read_identity == 1){ | |
| 3796 $mbias_1{CHG}->{$index+1}->{meth}++; | |
| 3797 } | |
| 3798 else{ | |
| 3799 $mbias_2{CHG}->{$index+1}->{meth}++; | |
| 3800 } | |
| 3801 } | |
| 3802 elsif ($methylation_calls[$index] eq 'x') { | |
| 3803 $counting{total_unmethylated_CHG_count}++; | |
| 3804 print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3805 if ($read_identity == 1){ | |
| 3806 $mbias_1{CHG}->{$index+1}->{un}++; | |
| 3807 } | |
| 3808 else{ | |
| 3809 $mbias_2{CHG}->{$index+1}->{un}++; | |
| 3810 } | |
| 3811 } | |
| 3812 elsif ($methylation_calls[$index] eq 'Z') { | |
| 3813 $counting{total_meCpG_count}++; | |
| 3814 print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3815 if ($read_identity == 1){ | |
| 3816 $mbias_1{CpG}->{$index+1}->{meth}++; | |
| 3817 } | |
| 3818 else{ | |
| 3819 $mbias_2{CpG}->{$index+1}->{meth}++; | |
| 3820 } | |
| 3821 } | |
| 3822 elsif ($methylation_calls[$index] eq 'z') { | |
| 3823 $counting{total_unmethylated_CpG_count}++; | |
| 3824 print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3825 if ($read_identity == 1){ | |
| 3826 $mbias_1{CpG}->{$index+1}->{un}++; | |
| 3827 } | |
| 3828 else{ | |
| 3829 $mbias_2{CpG}->{$index+1}->{un}++; | |
| 3830 } | |
| 3831 } | |
| 3832 elsif ($methylation_calls[$index] eq 'H') { | |
| 3833 $counting{total_meCHH_count}++; | |
| 3834 print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3835 if ($read_identity == 1){ | |
| 3836 $mbias_1{CHH}->{$index+1}->{meth}++; | |
| 3837 } | |
| 3838 else{ | |
| 3839 $mbias_2{CHH}->{$index+1}->{meth}++; | |
| 3840 } | |
| 3841 } | |
| 3842 elsif ($methylation_calls[$index] eq 'h') { | |
| 3843 $counting{total_unmethylated_CHH_count}++; | |
| 3844 print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3845 if ($read_identity == 1){ | |
| 3846 $mbias_1{CHH}->{$index+1}->{un}++; | |
| 3847 } | |
| 3848 else{ | |
| 3849 $mbias_2{CHH}->{$index+1}->{un}++; | |
| 3850 } | |
| 3851 } | |
| 3852 elsif ($methylation_calls[$index] eq '.') {} | |
| 3853 elsif (lc$methylation_calls[$index] eq 'u'){} | |
| 3854 else{ | |
| 3855 die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; | |
| 3856 } | |
| 3857 } | |
| 3858 } elsif ($strand eq '-') { | |
| 3859 for my $index (0..$#methylation_calls) { | |
| 3860 | |
| 3861 if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels | |
| 3862 # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition-index: ",$start-$index,"\t"; | |
| 3863 my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); | |
| 3864 $cigar_offset += $cigar_mod; | |
| 3865 $pos_offset += $pos_mod; | |
| 3866 } | |
| 3867 | |
| 3868 ### Returning as soon as the methylation calls start overlapping | |
| 3869 if ($start-$index+$pos_offset <= $end_read_1) { | |
| 3870 return; | |
| 3871 } | |
| 3872 | |
| 3873 if ($methylation_calls[$index] eq 'X') { | |
| 3874 $counting{total_meCHG_count}++; | |
| 3875 print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3876 if ($read_identity == 1){ | |
| 3877 $mbias_1{CHG}->{$index+1}->{meth}++; | |
| 3878 } | |
| 3879 else{ | |
| 3880 $mbias_2{CHG}->{$index+1}->{meth}++; | |
| 3881 } | |
| 3882 } | |
| 3883 elsif ($methylation_calls[$index] eq 'x') { | |
| 3884 $counting{total_unmethylated_CHG_count}++; | |
| 3885 print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3886 if ($read_identity == 1){ | |
| 3887 $mbias_1{CHG}->{$index+1}->{un}++; | |
| 3888 } | |
| 3889 else{ | |
| 3890 $mbias_2{CHG}->{$index+1}->{un}++; | |
| 3891 } | |
| 3892 } | |
| 3893 elsif ($methylation_calls[$index] eq 'Z') { | |
| 3894 $counting{total_meCpG_count}++; | |
| 3895 print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3896 if ($read_identity == 1){ | |
| 3897 $mbias_1{CpG}->{$index+1}->{meth}++; | |
| 3898 } | |
| 3899 else{ | |
| 3900 $mbias_2{CpG}->{$index+1}->{meth}++; | |
| 3901 } | |
| 3902 } | |
| 3903 elsif ($methylation_calls[$index] eq 'z') { | |
| 3904 $counting{total_unmethylated_CpG_count}++; | |
| 3905 print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3906 if ($read_identity == 1){ | |
| 3907 $mbias_1{CpG}->{$index+1}->{un}++; | |
| 3908 } | |
| 3909 else{ | |
| 3910 $mbias_2{CpG}->{$index+1}->{un}++; | |
| 3911 } | |
| 3912 } | |
| 3913 elsif ($methylation_calls[$index] eq 'H') { | |
| 3914 $counting{total_meCHH_count}++; | |
| 3915 print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3916 if ($read_identity == 1){ | |
| 3917 $mbias_1{CHH}->{$index+1}->{meth}++; | |
| 3918 } | |
| 3919 else{ | |
| 3920 $mbias_2{CHH}->{$index+1}->{meth}++; | |
| 3921 } | |
| 3922 } | |
| 3923 elsif ($methylation_calls[$index] eq 'h') { | |
| 3924 $counting{total_unmethylated_CHH_count}++; | |
| 3925 print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3926 if ($read_identity == 1){ | |
| 3927 $mbias_1{CHH}->{$index+1}->{un}++; | |
| 3928 } | |
| 3929 else{ | |
| 3930 $mbias_2{CHH}->{$index+1}->{un}++; | |
| 3931 } | |
| 3932 } | |
| 3933 elsif ($methylation_calls[$index] eq '.') {} | |
| 3934 elsif (lc$methylation_calls[$index] eq 'u'){} | |
| 3935 else{ | |
| 3936 die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; | |
| 3937 } | |
| 3938 } | |
| 3939 } else { | |
| 3940 die "The strand orientation as neither + nor -: '$strand'\n"; | |
| 3941 } | |
| 3942 } | |
| 3943 } | |
| 3944 | |
| 3945 ### this is the paired-end procedure allowing overlaps and using every single C position | |
| 3946 else { | |
| 3947 ### single-file CpG, CHG and CHH context output | |
| 3948 if ($full) { | |
| 3949 if ($strand eq '+') { | |
| 3950 for my $index (0..$#methylation_calls) { | |
| 3951 | |
| 3952 if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels | |
| 3953 my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); | |
| 3954 # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition+index: ",$start+$index,"\t"; | |
| 3955 $cigar_offset += $cigar_mod; | |
| 3956 $pos_offset += $pos_mod; | |
| 3957 } | |
| 3958 | |
| 3959 if ($methylation_calls[$index] eq 'X') { | |
| 3960 $counting{total_meCHG_count}++; | |
| 3961 print {$fhs{CHG_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3962 if ($read_identity == 1){ | |
| 3963 $mbias_1{CHG}->{$index+1}->{meth}++; | |
| 3964 } | |
| 3965 else{ | |
| 3966 $mbias_2{CHG}->{$index+1}->{meth}++; | |
| 3967 } | |
| 3968 } | |
| 3969 elsif ($methylation_calls[$index] eq 'x') { | |
| 3970 $counting{total_unmethylated_CHG_count}++; | |
| 3971 print {$fhs{CHG_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3972 if ($read_identity == 1){ | |
| 3973 $mbias_1{CHG}->{$index+1}->{un}++; | |
| 3974 } | |
| 3975 else{ | |
| 3976 $mbias_2{CHG}->{$index+1}->{un}++; | |
| 3977 } | |
| 3978 } | |
| 3979 elsif ($methylation_calls[$index] eq 'Z') { | |
| 3980 $counting{total_meCpG_count}++; | |
| 3981 print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3982 if ($read_identity == 1){ | |
| 3983 $mbias_1{CpG}->{$index+1}->{meth}++; | |
| 3984 } | |
| 3985 else{ | |
| 3986 $mbias_2{CpG}->{$index+1}->{meth}++; | |
| 3987 } | |
| 3988 } | |
| 3989 elsif ($methylation_calls[$index] eq 'z') { | |
| 3990 $counting{total_unmethylated_CpG_count}++; | |
| 3991 print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3992 if ($read_identity == 1){ | |
| 3993 $mbias_1{CpG}->{$index+1}->{un}++; | |
| 3994 } | |
| 3995 else{ | |
| 3996 $mbias_2{CpG}->{$index+1}->{un}++; | |
| 3997 } | |
| 3998 } | |
| 3999 elsif ($methylation_calls[$index] eq 'H') { | |
| 4000 $counting{total_meCHH_count}++; | |
| 4001 print {$fhs{CHH_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4002 if ($read_identity == 1){ | |
| 4003 $mbias_1{CHH}->{$index+1}->{meth}++; | |
| 4004 } | |
| 4005 else{ | |
| 4006 $mbias_2{CHH}->{$index+1}->{meth}++; | |
| 4007 } | |
| 4008 } | |
| 4009 elsif ($methylation_calls[$index] eq 'h') { | |
| 4010 $counting{total_unmethylated_CHH_count}++; | |
| 4011 print {$fhs{CHH_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4012 if ($read_identity == 1){ | |
| 4013 $mbias_1{CHH}->{$index+1}->{un}++; | |
| 4014 } | |
| 4015 else{ | |
| 4016 $mbias_2{CHH}->{$index+1}->{un}++; | |
| 4017 } | |
| 4018 } | |
| 4019 elsif ($methylation_calls[$index] eq '.') {} | |
| 4020 elsif (lc$methylation_calls[$index] eq 'u'){} | |
| 4021 else{ | |
| 4022 die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; | |
| 4023 } | |
| 4024 } | |
| 4025 } elsif ($strand eq '-') { | |
| 4026 for my $index (0..$#methylation_calls) { | |
| 4027 | |
| 4028 if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels | |
| 4029 # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition-index: ",$start-$index,"\t"; | |
| 4030 my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); | |
| 4031 $cigar_offset += $cigar_mod; | |
| 4032 $pos_offset += $pos_mod; | |
| 4033 } | |
| 4034 | |
| 4035 if ($methylation_calls[$index] eq 'X') { | |
| 4036 $counting{total_meCHG_count}++; | |
| 4037 print {$fhs{CHG_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4038 if ($read_identity == 1){ | |
| 4039 $mbias_1{CHG}->{$index+1}->{meth}++; | |
| 4040 } | |
| 4041 else{ | |
| 4042 $mbias_2{CHG}->{$index+1}->{meth}++; | |
| 4043 } | |
| 4044 } | |
| 4045 elsif ($methylation_calls[$index] eq 'x') { | |
| 4046 $counting{total_unmethylated_CHG_count}++; | |
| 4047 print {$fhs{CHG_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4048 if ($read_identity == 1){ | |
| 4049 $mbias_1{CHG}->{$index+1}->{un}++; | |
| 4050 } | |
| 4051 else{ | |
| 4052 $mbias_2{CHG}->{$index+1}->{un}++; | |
| 4053 } | |
| 4054 } | |
| 4055 elsif ($methylation_calls[$index] eq 'Z') { | |
| 4056 $counting{total_meCpG_count}++; | |
| 4057 print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4058 if ($read_identity == 1){ | |
| 4059 $mbias_1{CpG}->{$index+1}->{meth}++; | |
| 4060 } | |
| 4061 else{ | |
| 4062 $mbias_2{CpG}->{$index+1}->{meth}++; | |
| 4063 } | |
| 4064 } | |
| 4065 elsif ($methylation_calls[$index] eq 'z') { | |
| 4066 $counting{total_unmethylated_CpG_count}++; | |
| 4067 print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4068 if ($read_identity == 1){ | |
| 4069 $mbias_1{CpG}->{$index+1}->{un}++; | |
| 4070 } | |
| 4071 else{ | |
| 4072 $mbias_2{CpG}->{$index+1}->{un}++; | |
| 4073 } | |
| 4074 } | |
| 4075 elsif ($methylation_calls[$index] eq 'H') { | |
| 4076 $counting{total_meCHH_count}++; | |
| 4077 print {$fhs{CHH_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4078 if ($read_identity == 1){ | |
| 4079 $mbias_1{CHH}->{$index+1}->{meth}++; | |
| 4080 } | |
| 4081 else{ | |
| 4082 $mbias_2{CHH}->{$index+1}->{meth}++; | |
| 4083 } | |
| 4084 } | |
| 4085 elsif ($methylation_calls[$index] eq 'h') { | |
| 4086 $counting{total_unmethylated_CHH_count}++; | |
| 4087 print {$fhs{CHH_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4088 if ($read_identity == 1){ | |
| 4089 $mbias_1{CHH}->{$index+1}->{un}++; | |
| 4090 } | |
| 4091 else{ | |
| 4092 $mbias_2{CHH}->{$index+1}->{un}++; | |
| 4093 } | |
| 4094 } | |
| 4095 elsif ($methylation_calls[$index] eq '.') {} | |
| 4096 elsif (lc$methylation_calls[$index] eq 'u'){} | |
| 4097 else{ | |
| 4098 die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; | |
| 4099 } | |
| 4100 } | |
| 4101 } else { | |
| 4102 die "The strand orientation as neither + nor -: '$strand'\n"; | |
| 4103 } | |
| 4104 } | |
| 4105 | |
| 4106 ### strand-specific methylation output | |
| 4107 else { | |
| 4108 if ($strand eq '+') { | |
| 4109 for my $index (0..$#methylation_calls) { | |
| 4110 | |
| 4111 if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels | |
| 4112 my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); | |
| 4113 # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition+index: ",$start+$index,"\t"; | |
| 4114 $cigar_offset += $cigar_mod; | |
| 4115 $pos_offset += $pos_mod; | |
| 4116 } | |
| 4117 | |
| 4118 if ($methylation_calls[$index] eq 'X') { | |
| 4119 $counting{total_meCHG_count}++; | |
| 4120 print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4121 if ($read_identity == 1){ | |
| 4122 $mbias_1{CHG}->{$index+1}->{meth}++; | |
| 4123 } | |
| 4124 else{ | |
| 4125 $mbias_2{CHG}->{$index+1}->{meth}++; | |
| 4126 } | |
| 4127 } | |
| 4128 elsif ($methylation_calls[$index] eq 'x') { | |
| 4129 $counting{total_unmethylated_CHG_count}++; | |
| 4130 print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4131 if ($read_identity == 1){ | |
| 4132 $mbias_1{CHG}->{$index+1}->{un}++; | |
| 4133 } | |
| 4134 else{ | |
| 4135 $mbias_2{CHG}->{$index+1}->{un}++; | |
| 4136 } | |
| 4137 } | |
| 4138 elsif ($methylation_calls[$index] eq 'Z') { | |
| 4139 $counting{total_meCpG_count}++; | |
| 4140 print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4141 if ($read_identity == 1){ | |
| 4142 $mbias_1{CpG}->{$index+1}->{meth}++; | |
| 4143 } | |
| 4144 else{ | |
| 4145 $mbias_2{CpG}->{$index+1}->{meth}++; | |
| 4146 } | |
| 4147 } | |
| 4148 elsif ($methylation_calls[$index] eq 'z') { | |
| 4149 $counting{total_unmethylated_CpG_count}++; | |
| 4150 print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4151 if ($read_identity == 1){ | |
| 4152 $mbias_1{CpG}->{$index+1}->{un}++; | |
| 4153 } | |
| 4154 else{ | |
| 4155 $mbias_2{CpG}->{$index+1}->{un}++; | |
| 4156 } | |
| 4157 } | |
| 4158 elsif ($methylation_calls[$index] eq 'H') { | |
| 4159 $counting{total_meCHH_count}++; | |
| 4160 print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4161 if ($read_identity == 1){ | |
| 4162 $mbias_1{CHH}->{$index+1}->{meth}++; | |
| 4163 } | |
| 4164 else{ | |
| 4165 $mbias_2{CHH}->{$index+1}->{meth}++; | |
| 4166 } | |
| 4167 } | |
| 4168 elsif ($methylation_calls[$index] eq 'h') { | |
| 4169 $counting{total_unmethylated_CHH_count}++; | |
| 4170 print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4171 if ($read_identity == 1){ | |
| 4172 $mbias_1{CHH}->{$index+1}->{un}++; | |
| 4173 } | |
| 4174 else{ | |
| 4175 $mbias_2{CHH}->{$index+1}->{un}++; | |
| 4176 } | |
| 4177 } | |
| 4178 elsif ($methylation_calls[$index] eq '.') {} | |
| 4179 elsif (lc$methylation_calls[$index] eq 'u'){} | |
| 4180 else{ | |
| 4181 die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; | |
| 4182 } | |
| 4183 } | |
| 4184 } elsif ($strand eq '-') { | |
| 4185 for my $index (0..$#methylation_calls) { | |
| 4186 | |
| 4187 if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels | |
| 4188 # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition-index: ",$start-$index,"\t"; | |
| 4189 my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); | |
| 4190 $cigar_offset += $cigar_mod; | |
| 4191 $pos_offset += $pos_mod; | |
| 4192 } | |
| 4193 | |
| 4194 if ($methylation_calls[$index] eq 'X') { | |
| 4195 $counting{total_meCHG_count}++; | |
| 4196 print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4197 if ($read_identity == 1){ | |
| 4198 $mbias_1{CHG}->{$index+1}->{meth}++; | |
| 4199 } | |
| 4200 else{ | |
| 4201 $mbias_2{CHG}->{$index+1}->{meth}++; | |
| 4202 } | |
| 4203 } | |
| 4204 elsif ($methylation_calls[$index] eq 'x') { | |
| 4205 $counting{total_unmethylated_CHG_count}++; | |
| 4206 print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4207 if ($read_identity == 1){ | |
| 4208 $mbias_1{CHG}->{$index+1}->{un}++; | |
| 4209 } | |
| 4210 else{ | |
| 4211 $mbias_2{CHG}->{$index+1}->{un}++; | |
| 4212 } | |
| 4213 } | |
| 4214 elsif ($methylation_calls[$index] eq 'Z') { | |
| 4215 $counting{total_meCpG_count}++; | |
| 4216 print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4217 if ($read_identity == 1){ | |
| 4218 $mbias_1{CpG}->{$index+1}->{meth}++; | |
| 4219 } | |
| 4220 else{ | |
| 4221 $mbias_2{CpG}->{$index+1}->{meth}++; | |
| 4222 } | |
| 4223 } | |
| 4224 elsif ($methylation_calls[$index] eq 'z') { | |
| 4225 $counting{total_unmethylated_CpG_count}++; | |
| 4226 print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4227 if ($read_identity == 1){ | |
| 4228 $mbias_1{CpG}->{$index+1}->{un}++; | |
| 4229 } | |
| 4230 else{ | |
| 4231 $mbias_2{CpG}->{$index+1}->{un}++; | |
| 4232 } | |
| 4233 } | |
| 4234 elsif ($methylation_calls[$index] eq 'H') { | |
| 4235 $counting{total_meCHH_count}++; | |
| 4236 print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4237 if ($read_identity == 1){ | |
| 4238 $mbias_1{CHH}->{$index+1}->{meth}++; | |
| 4239 } | |
| 4240 else{ | |
| 4241 $mbias_2{CHH}->{$index+1}->{meth}++; | |
| 4242 } | |
| 4243 } | |
| 4244 elsif ($methylation_calls[$index] eq 'h') { | |
| 4245 $counting{total_unmethylated_CHH_count}++; | |
| 4246 print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4247 if ($read_identity == 1){ | |
| 4248 $mbias_1{CHH}->{$index+1}->{un}++; | |
| 4249 } | |
| 4250 else{ | |
| 4251 $mbias_2{CHH}->{$index+1}->{un}++; | |
| 4252 } | |
| 4253 } | |
| 4254 elsif ($methylation_calls[$index] eq '.') {} | |
| 4255 elsif (lc$methylation_calls[$index] eq 'u'){} | |
| 4256 else{ | |
| 4257 die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; | |
| 4258 } | |
| 4259 } | |
| 4260 } else { | |
| 4261 die "The strand orientation as neither + nor -: '$strand'\n"; | |
| 4262 } | |
| 4263 } | |
| 4264 } | |
| 4265 } | |
| 4266 | |
| 4267 sub check_cigar_string { | |
| 4268 my ($index,$cigar_offset,$pos_offset,$strand,$comp_cigar) = @_; | |
| 4269 # print "$index\t$cigar_offset\t$pos_offset\t$strand\t"; | |
| 4270 my ($new_cigar_offset,$new_pos_offset) = (0,0); | |
| 4271 | |
| 4272 if ($strand eq '+') { | |
| 4273 # print "### $strand strand @$comp_cigar[$index + $cigar_offset]\t"; | |
| 4274 | |
| 4275 if (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'M'){ # sequence position matches the genomic position | |
| 4276 # warn "position needs no adjustment\n"; | |
| 4277 } | |
| 4278 | |
| 4279 elsif (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'I'){ # insertion in the read sequence | |
| 4280 $new_pos_offset -= 1; # we need to subtract the length of inserted bases from the genomic position | |
| 4281 # warn "adjusted genomic position by -1 bp (insertion)\n"; | |
| 4282 } | |
| 4283 | |
| 4284 elsif (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'D'){ # deletion in the read sequence | |
| 4285 $new_cigar_offset += 1; # the composite cigar string does no longer match the methylation call index | |
| 4286 $new_pos_offset += 1; # we need to add the length of deleted bases to get the genomic position | |
| 4287 # warn "adjusted genomic position by +1 bp (deletion). Now looping through the CIGAR string until we hit another M or I\n"; | |
| 4288 | |
| 4289 while ( ($index + $cigar_offset + $new_cigar_offset) < (scalar @$comp_cigar) ){ | |
| 4290 if (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'M'){ # sequence position matches the genomic position | |
| 4291 # warn "position needs no adjustment\n"; | |
| 4292 last; | |
| 4293 } | |
| 4294 elsif (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'I'){ | |
| 4295 $new_pos_offset -= 1; # we need to subtract the length of inserted bases from the genomic position | |
| 4296 # warn "adjusted genomic position by another -1 bp (insertion)\n"; | |
| 4297 last; | |
| 4298 } | |
| 4299 elsif (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'D'){ # deletion in the read sequence | |
| 4300 $new_cigar_offset += 1; # the composite cigar string does no longer match the methylation call index | |
| 4301 $new_pos_offset += 1; # we need to add the length of deleted bases to get the genomic position | |
| 4302 # warn "adjusted genomic position by another +1 bp (deletion)\n"; | |
| 4303 } | |
| 4304 else{ | |
| 4305 die "The CIGAR string contained undefined operations in addition to 'M', 'I' and 'D': '@$comp_cigar[$index + $cigar_offset + $new_cigar_offset]'\n"; | |
| 4306 } | |
| 4307 } | |
| 4308 } | |
| 4309 else{ | |
| 4310 die "The CIGAR string contained undefined operations in addition to 'M', 'I' and 'D': '@$comp_cigar[$index + $cigar_offset + $new_cigar_offset]'\n"; | |
| 4311 } | |
| 4312 } | |
| 4313 | |
| 4314 elsif ($strand eq '-') { | |
| 4315 # print "### $strand strand @$comp_cigar[$index + $cigar_offset]\t"; | |
| 4316 | |
| 4317 if (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'M'){ # sequence position matches the genomic position | |
| 4318 # warn "position needs no adjustment\n"; | |
| 4319 } | |
| 4320 | |
| 4321 elsif (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'I'){ # insertion in the read sequence | |
| 4322 $new_pos_offset += 1; # we need to add the length of inserted bases to the genomic position | |
| 4323 # warn "adjusted genomic position by +1 bp (insertion)\n"; | |
| 4324 } | |
| 4325 | |
| 4326 elsif (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'D'){ # deletion in the read sequence | |
| 4327 $new_cigar_offset += 1; # the composite cigar string does no longer match the methylation call index | |
| 4328 $new_pos_offset -= 1; # we need to subtract the length of deleted bases to get the genomic position | |
| 4329 # warn "adjusted genomic position by -1 bp (deletion). Now looping through the CIGAR string until we hit another M or I\n"; | |
| 4330 | |
| 4331 while ( ($index + $cigar_offset + $new_cigar_offset) < (scalar @$comp_cigar) ){ | |
| 4332 if (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'M'){ # sequence position matches the genomic position | |
| 4333 # warn "Found new 'M' operation; position needs no adjustment\n"; | |
| 4334 last; | |
| 4335 } | |
| 4336 elsif (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'I'){ | |
| 4337 $new_pos_offset += 1; # we need to subtract the length of inserted bases from the genomic position | |
| 4338 # warn "Found new 'I' operation; adjusted genomic position by another +1 bp (insertion)\n"; | |
| 4339 last; | |
| 4340 } | |
| 4341 elsif (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'D'){ # deletion in the read sequence | |
| 4342 $new_cigar_offset += 1; # the composite cigar string does no longer match the methylation call index | |
| 4343 $new_pos_offset -= 1; # we need to subtract the length of deleted bases to get the genomic position | |
| 4344 # warn "adjusted genomic position by another -1 bp (deletion)\n"; | |
| 4345 } | |
| 4346 else{ | |
| 4347 die "The CIGAR string contained undefined operations in addition to 'M', 'I' and 'D': '@$comp_cigar[$index + $cigar_offset + $new_cigar_offset]'\n"; | |
| 4348 } | |
| 4349 } | |
| 4350 } | |
| 4351 else{ | |
| 4352 die "The CIGAR string contained undefined operations in addition to 'M', 'I' and 'D': '@$comp_cigar[$index + $cigar_offset + $new_cigar_offset]'\n"; | |
| 4353 } | |
| 4354 } | |
| 4355 # print "new cigar offset: $new_cigar_offset\tnew pos offset: $new_pos_offset\n"; | |
| 4356 return ($new_cigar_offset,$new_pos_offset); | |
| 4357 } | |
| 4358 | |
| 4359 sub print_individual_C_methylation_states_single_end{ | |
| 4360 | |
| 4361 my ($meth_call,$chrom,$start,$id,$strand,$filehandle_index,$cigar) = @_; | |
| 4362 my @methylation_calls = split(//,$meth_call); | |
| 4363 | |
| 4364 ################################################################# | |
| 4365 ### . for bases not involving cytosines ### | |
| 4366 ### X for methylated C in CHG context (was protected) ### | |
| 4367 ### x for not methylated C in CHG context (was converted) ### | |
| 4368 ### H for methylated C in CHH context (was protected) ### | |
| 4369 ### h for not methylated C in CHH context (was converted) ### | |
| 4370 ### Z for methylated C in CpG context (was protected) ### | |
| 4371 ### z for not methylated C in CpG context (was converted) ### | |
| 4372 ################################################################# | |
| 4373 | |
| 4374 my $methyl_CHG_count = 0; | |
| 4375 my $methyl_CHH_count = 0; | |
| 4376 my $methyl_CpG_count = 0; | |
| 4377 my $unmethylated_CHG_count = 0; | |
| 4378 my $unmethylated_CHH_count = 0; | |
| 4379 my $unmethylated_CpG_count = 0; | |
| 4380 | |
| 4381 my $pos_offset = 0; # this is only relevant for SAM reads with insertions or deletions | |
| 4382 my $cigar_offset = 0; # again, this is only relevant for SAM reads containing indels | |
| 4383 | |
| 4384 my @comp_cigar; | |
| 4385 | |
| 4386 if ($cigar){ # parsing CIGAR string | |
| 4387 | |
| 4388 ### Checking whether the CIGAR string is a linear genomic match or whether it requires indel processing | |
| 4389 if ($cigar =~ /^\d+M$/){ | |
| 4390 # warn "See!? I told you so! $cigar\n"; | |
| 4391 # sleep(1); | |
| 4392 } | |
| 4393 else{ | |
| 4394 | |
| 4395 my @len; | |
| 4396 my @ops; | |
| 4397 | |
| 4398 @len = split (/\D+/,$cigar); # storing the length per operation | |
| 4399 @ops = split (/\d+/,$cigar); # storing the operation | |
| 4400 shift @ops; # remove the empty first element | |
| 4401 # die "CIGAR string contained a non-matching number of lengths and operations: id: $id\nmeth call: $meth_call\nCIGAR: $cigar\n".join(" ",@len)."\n".join(" ",@ops)."\n" unless (scalar @len == scalar @ops); | |
| 4402 die "CIGAR string contained a non-matching number of lengths and operations\n" unless (scalar @len == scalar @ops); | |
| 4403 | |
| 4404 foreach my $index (0..$#len){ | |
| 4405 foreach (1..$len[$index]){ | |
| 4406 # print "$ops[$index]"; | |
| 4407 push @comp_cigar, $ops[$index]; | |
| 4408 } | |
| 4409 } | |
| 4410 } | |
| 4411 # warn "\nDetected CIGAR string: $cigar\n"; | |
| 4412 # warn "Length of methylation call: ",length $meth_call,"\n"; | |
| 4413 # warn "number of operations: ",scalar @ops,"\n"; | |
| 4414 # warn "number of length digits: ",scalar @len,"\n\n"; | |
| 4415 # print @comp_cigar,"\n"; | |
| 4416 # print "$meth_call\n\n"; | |
| 4417 # sleep (1); | |
| 4418 } | |
| 4419 | |
| 4420 ### adjusting the start position for all reads mapping to the reverse strand | |
| 4421 if ($strand eq '-') { | |
| 4422 | |
| 4423 if (@comp_cigar){ # only needed for SAM reads with InDels | |
| 4424 @comp_cigar = reverse@comp_cigar; # the CIGAR string needs to be reversed for all reads aligning to the reverse strand, too | |
| 4425 # print @comp_cigar,"\n"; | |
| 4426 } | |
| 4427 | |
| 4428 unless ($ignore){ ### if --ignore was specified the start position has already been corrected | |
| 4429 | |
| 4430 if ($cigar){ ### SAM format | |
| 4431 if ($cigar =~ /^(\d+)M$/){ # linear match | |
| 4432 $start += $1 - 1; | |
| 4433 } | |
| 4434 else{ # InDel read | |
| 4435 my $MD_count = 0; | |
| 4436 foreach (@comp_cigar){ | |
| 4437 ++$MD_count if ($_ eq 'M' or $_ eq 'D'); # Matching bases or deletions affect the genomic position of the 3' ends of reads, insertions don't | |
| 4438 } | |
| 4439 $start += $MD_count - 1; | |
| 4440 } | |
| 4441 } | |
| 4442 else{ ### vanilla format | |
| 4443 $start += length($meth_call)-1; | |
| 4444 } | |
| 4445 } | |
| 4446 } | |
| 4447 | |
| 4448 ### THIS IS THE CpG and Non-CpG SECTION (OPTIONAL) | |
| 4449 | |
| 4450 ### single-file CpG and other-context output | |
| 4451 if ($full and $merge_non_CpG) { | |
| 4452 if ($strand eq '+') { | |
| 4453 for my $index (0..$#methylation_calls) { | |
| 4454 | |
| 4455 if ($cigar and @comp_cigar){ # only needed for SAM alignments with InDels | |
| 4456 my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); | |
| 4457 # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition+index: ",$start+$index,"\t"; | |
| 4458 $cigar_offset += $cigar_mod; | |
| 4459 $pos_offset += $pos_mod; | |
| 4460 } | |
| 4461 | |
| 4462 ### methylated Cs (any context) will receive a forward (+) orientation | |
| 4463 ### not methylated Cs (any context) will receive a reverse (-) orientation | |
| 4464 if ($methylation_calls[$index] eq 'X') { | |
| 4465 $counting{total_meCHG_count}++; | |
| 4466 my $line = join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n"; | |
| 4467 print {$fhs{other_context}} $line unless($mbias_only); | |
| 4468 # print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4469 $mbias_1{CHG}->{$index+1}->{meth}++; | |
| 4470 } | |
| 4471 elsif ($methylation_calls[$index] eq 'x') { | |
| 4472 $counting{total_unmethylated_CHG_count}++; | |
| 4473 my $line = join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n"; | |
| 4474 print {$fhs{other_context}} $line unless($mbias_only); | |
| 4475 # print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4476 $mbias_1{CHG}->{$index+1}->{un}++; | |
| 4477 } | |
| 4478 elsif ($methylation_calls[$index] eq 'Z') { | |
| 4479 $counting{total_meCpG_count}++; | |
| 4480 my $line = join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n"; | |
| 4481 print {$fhs{CpG_context}} $line unless($mbias_only); | |
| 4482 # print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4483 $mbias_1{CpG}->{$index+1}->{meth}++; | |
| 4484 } | |
| 4485 elsif ($methylation_calls[$index] eq 'z') { | |
| 4486 $counting{total_unmethylated_CpG_count}++; | |
| 4487 my $line = join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n"; | |
| 4488 print {$fhs{CpG_context}} $line unless($mbias_only); | |
| 4489 # print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4490 $mbias_1{CpG}->{$index+1}->{un}++; | |
| 4491 } | |
| 4492 elsif ($methylation_calls[$index] eq 'H') { | |
| 4493 $counting{total_meCHH_count}++; | |
| 4494 my $line = join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n"; | |
| 4495 print {$fhs{other_context}} $line unless($mbias_only); | |
| 4496 # print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4497 $mbias_1{CHH}->{$index+1}->{meth}++; | |
| 4498 } | |
| 4499 elsif ($methylation_calls[$index] eq 'h') { | |
| 4500 $counting{total_unmethylated_CHH_count}++; | |
| 4501 my $line = join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n"; | |
| 4502 print {$fhs{other_context}} $line unless($mbias_only); | |
| 4503 # print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4504 $mbias_1{CHH}->{$index+1}->{un}++; | |
| 4505 } | |
| 4506 elsif ($methylation_calls[$index] eq '.') {} | |
| 4507 elsif (lc$methylation_calls[$index] eq 'u'){} | |
| 4508 else{ | |
| 4509 die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; | |
| 4510 } | |
| 4511 } | |
| 4512 } | |
| 4513 elsif ($strand eq '-') { | |
| 4514 | |
| 4515 for my $index (0..$#methylation_calls) { | |
| 4516 ### methylated Cs (any context) will receive a forward (+) orientation | |
| 4517 ### not methylated Cs (any context) will receive a reverse (-) orientation | |
| 4518 | |
| 4519 if ($cigar and @comp_cigar){ # only needed for SAM entries with InDels | |
| 4520 # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition-index: ",$start-$index,"\t"; | |
| 4521 my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); | |
| 4522 $cigar_offset += $cigar_mod; | |
| 4523 $pos_offset += $pos_mod; | |
| 4524 } | |
| 4525 | |
| 4526 if ($methylation_calls[$index] eq 'X') { | |
| 4527 $counting{total_meCHG_count}++; | |
| 4528 my $line = join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n"; | |
| 4529 print {$fhs{other_context}} $line unless($mbias_only); | |
| 4530 #print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4531 $mbias_1{CHG}->{$index+1}->{meth}++; | |
| 4532 } | |
| 4533 elsif ($methylation_calls[$index] eq 'x') { | |
| 4534 $counting{total_unmethylated_CHG_count}++; | |
| 4535 my $line = join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n"; | |
| 4536 print {$fhs{other_context}} $line unless($mbias_only); | |
| 4537 #print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4538 $mbias_1{CHG}->{$index+1}->{un}++; | |
| 4539 } | |
| 4540 elsif ($methylation_calls[$index] eq 'Z') { | |
| 4541 $counting{total_meCpG_count}++; | |
| 4542 my $line = join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n"; | |
| 4543 print {$fhs{CpG_context}} $line unless($mbias_only); | |
| 4544 #print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4545 $mbias_1{CpG}->{$index+1}->{meth}++; | |
| 4546 } | |
| 4547 elsif ($methylation_calls[$index] eq 'z') { | |
| 4548 $counting{total_unmethylated_CpG_count}++; | |
| 4549 my $line = join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n"; | |
| 4550 print {$fhs{CpG_context}} $line unless($mbias_only); | |
| 4551 #print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4552 $mbias_1{CpG}->{$index+1}->{un}++; | |
| 4553 } | |
| 4554 elsif ($methylation_calls[$index] eq 'H') { | |
| 4555 $counting{total_meCHH_count}++; | |
| 4556 my $line = join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n"; | |
| 4557 print {$fhs{other_context}} $line unless($mbias_only); | |
| 4558 #print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4559 $mbias_1{CHH}->{$index+1}->{meth}++; | |
| 4560 } | |
| 4561 elsif ($methylation_calls[$index] eq 'h') { | |
| 4562 $counting{total_unmethylated_CHH_count}++; | |
| 4563 my $line = join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n"; | |
| 4564 print {$fhs{other_context}} $line unless($mbias_only); | |
| 4565 #print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4566 $mbias_1{CHH}->{$index+1}->{un}++; | |
| 4567 } | |
| 4568 elsif ($methylation_calls[$index] eq '.'){} | |
| 4569 elsif (lc$methylation_calls[$index] eq 'u'){} | |
| 4570 else{ | |
| 4571 die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; | |
| 4572 } | |
| 4573 } | |
| 4574 } | |
| 4575 else { | |
| 4576 die "The strand information was neither + nor -: $strand\n"; | |
| 4577 } | |
| 4578 } | |
| 4579 | |
| 4580 ### strand-specific methylation output | |
| 4581 elsif ($merge_non_CpG) { | |
| 4582 if ($strand eq '+') { | |
| 4583 for my $index (0..$#methylation_calls) { | |
| 4584 ### methylated Cs (any context) will receive a forward (+) orientation | |
| 4585 ### not methylated Cs (any context) will receive a reverse (-) orientation | |
| 4586 | |
| 4587 if ($cigar and @comp_cigar){ # only needed for SAM reads with Indels | |
| 4588 my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); | |
| 4589 $cigar_offset += $cigar_mod; | |
| 4590 $pos_offset += $pos_mod; | |
| 4591 } | |
| 4592 | |
| 4593 if ($methylation_calls[$index] eq 'X') { | |
| 4594 $counting{total_meCHG_count}++; | |
| 4595 print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4596 $mbias_1{CHG}->{$index+1}->{meth}++; | |
| 4597 } | |
| 4598 elsif ($methylation_calls[$index] eq 'x') { | |
| 4599 $counting{total_unmethylated_CHG_count}++; | |
| 4600 print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4601 $mbias_1{CHG}->{$index+1}->{un}++; | |
| 4602 } | |
| 4603 elsif ($methylation_calls[$index] eq 'Z') { | |
| 4604 $counting{total_meCpG_count}++; | |
| 4605 print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4606 $mbias_1{CpG}->{$index+1}->{meth}++; | |
| 4607 } | |
| 4608 elsif ($methylation_calls[$index] eq 'z') { | |
| 4609 $counting{total_unmethylated_CpG_count}++; | |
| 4610 print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4611 $mbias_1{CpG}->{$index+1}->{un}++; | |
| 4612 } | |
| 4613 elsif ($methylation_calls[$index] eq 'H') { | |
| 4614 $counting{total_meCHH_count}++; | |
| 4615 print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4616 $mbias_1{CHH}->{$index+1}->{meth}++; | |
| 4617 } | |
| 4618 elsif ($methylation_calls[$index] eq 'h') { | |
| 4619 $counting{total_unmethylated_CHH_count}++; | |
| 4620 print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4621 $mbias_1{CHH}->{$index+1}->{un}++; | |
| 4622 } | |
| 4623 elsif ($methylation_calls[$index] eq '.') {} | |
| 4624 elsif (lc$methylation_calls[$index] eq 'u'){} | |
| 4625 else{ | |
| 4626 die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; | |
| 4627 } | |
| 4628 } | |
| 4629 } | |
| 4630 elsif ($strand eq '-') { | |
| 4631 | |
| 4632 for my $index (0..$#methylation_calls) { | |
| 4633 ### methylated Cs (any context) will receive a forward (+) orientation | |
| 4634 ### not methylated Cs (any context) will receive a reverse (-) orientation | |
| 4635 | |
| 4636 if ($cigar and @comp_cigar){ # only needed for SAM reads with Indels | |
| 4637 my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); | |
| 4638 $cigar_offset += $cigar_mod; | |
| 4639 $pos_offset += $pos_mod; | |
| 4640 } | |
| 4641 | |
| 4642 if ($methylation_calls[$index] eq 'X') { | |
| 4643 $counting{total_meCHG_count}++; | |
| 4644 print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4645 $mbias_1{CHG}->{$index+1}->{meth}++; | |
| 4646 } | |
| 4647 elsif ($methylation_calls[$index] eq 'x') { | |
| 4648 $counting{total_unmethylated_CHG_count}++; | |
| 4649 print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4650 $mbias_1{CHG}->{$index+1}->{un}++; | |
| 4651 } | |
| 4652 elsif ($methylation_calls[$index] eq 'Z') { | |
| 4653 $counting{total_meCpG_count}++; | |
| 4654 print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4655 $mbias_1{CpG}->{$index+1}->{meth}++; | |
| 4656 } | |
| 4657 elsif ($methylation_calls[$index] eq 'z') { | |
| 4658 $counting{total_unmethylated_CpG_count}++; | |
| 4659 print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4660 $mbias_1{CpG}->{$index+1}->{un}++; | |
| 4661 } | |
| 4662 elsif ($methylation_calls[$index] eq 'H') { | |
| 4663 $counting{total_meCHH_count}++; | |
| 4664 print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4665 $mbias_1{CHH}->{$index+1}->{meth}++; | |
| 4666 } | |
| 4667 elsif ($methylation_calls[$index] eq 'h') { | |
| 4668 $counting{total_unmethylated_CHH_count}++; | |
| 4669 print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4670 $mbias_1{CHH}->{$index+1}->{un}++; | |
| 4671 } | |
| 4672 elsif ($methylation_calls[$index] eq '.') {} | |
| 4673 elsif (lc$methylation_calls[$index] eq 'u'){} | |
| 4674 else{ | |
| 4675 die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; | |
| 4676 } | |
| 4677 } | |
| 4678 } | |
| 4679 else { | |
| 4680 die "The strand information was neither + nor -: $strand\n"; | |
| 4681 } | |
| 4682 } | |
| 4683 | |
| 4684 ### THIS IS THE 3-CONTEXT (CpG, CHG and CHH) DEFAULT SECTION | |
| 4685 | |
| 4686 elsif ($full) { | |
| 4687 if ($strand eq '+') { | |
| 4688 for my $index (0..$#methylation_calls) { | |
| 4689 ### methylated Cs (any context) will receive a forward (+) orientation | |
| 4690 ### not methylated Cs (any context) will receive a reverse (-) orientation | |
| 4691 | |
| 4692 if ($cigar and @comp_cigar){ # only needed for SAM reads with Indels | |
| 4693 my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); | |
| 4694 $cigar_offset += $cigar_mod; | |
| 4695 $pos_offset += $pos_mod; | |
| 4696 } | |
| 4697 | |
| 4698 if ($methylation_calls[$index] eq 'X') { | |
| 4699 $counting{total_meCHG_count}++; | |
| 4700 print {$fhs{CHG_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4701 $mbias_1{CHG}->{$index+1}->{meth}++; | |
| 4702 } | |
| 4703 elsif ($methylation_calls[$index] eq 'x') { | |
| 4704 $counting{total_unmethylated_CHG_count}++; | |
| 4705 print {$fhs{CHG_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4706 $mbias_1{CHG}->{$index+1}->{un}++; | |
| 4707 } | |
| 4708 elsif ($methylation_calls[$index] eq 'Z') { | |
| 4709 $counting{total_meCpG_count}++; | |
| 4710 print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4711 $mbias_1{CpG}->{$index+1}->{meth}++; | |
| 4712 } | |
| 4713 elsif ($methylation_calls[$index] eq 'z') { | |
| 4714 $counting{total_unmethylated_CpG_count}++; | |
| 4715 print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4716 $mbias_1{CpG}->{$index+1}->{un}++; | |
| 4717 } | |
| 4718 elsif ($methylation_calls[$index] eq 'H') { | |
| 4719 $counting{total_meCHH_count}++; | |
| 4720 print {$fhs{CHH_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4721 $mbias_1{CHH}->{$index+1}->{meth}++; | |
| 4722 } | |
| 4723 elsif ($methylation_calls[$index] eq 'h') { | |
| 4724 $counting{total_unmethylated_CHH_count}++; | |
| 4725 print {$fhs{CHH_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4726 $mbias_1{CHH}->{$index+1}->{un}++; | |
| 4727 } | |
| 4728 elsif ($methylation_calls[$index] eq '.') {} | |
| 4729 elsif (lc$methylation_calls[$index] eq 'u'){} | |
| 4730 else{ | |
| 4731 die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n" unless($mbias_only); | |
| 4732 } | |
| 4733 } | |
| 4734 } | |
| 4735 elsif ($strand eq '-') { | |
| 4736 | |
| 4737 for my $index (0..$#methylation_calls) { | |
| 4738 ### methylated Cs (any context) will receive a forward (+) orientation | |
| 4739 ### not methylated Cs (any context) will receive a reverse (-) orientation | |
| 4740 | |
| 4741 if ($cigar and @comp_cigar){ # only needed for SAM reads with Indels | |
| 4742 my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); | |
| 4743 $cigar_offset += $cigar_mod; | |
| 4744 $pos_offset += $pos_mod; | |
| 4745 } | |
| 4746 | |
| 4747 if ($methylation_calls[$index] eq 'X') { | |
| 4748 $counting{total_meCHG_count}++; | |
| 4749 print {$fhs{CHG_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4750 $mbias_1{CHG}->{$index+1}->{meth}++; | |
| 4751 } | |
| 4752 elsif ($methylation_calls[$index] eq 'x') { | |
| 4753 $counting{total_unmethylated_CHG_count}++; | |
| 4754 print {$fhs{CHG_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4755 $mbias_1{CHG}->{$index+1}->{un}++; | |
| 4756 } | |
| 4757 elsif ($methylation_calls[$index] eq 'Z') { | |
| 4758 $counting{total_meCpG_count}++; | |
| 4759 print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4760 $mbias_1{CpG}->{$index+1}->{meth}++; | |
| 4761 } | |
| 4762 elsif ($methylation_calls[$index] eq 'z') { | |
| 4763 $counting{total_unmethylated_CpG_count}++; | |
| 4764 print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4765 $mbias_1{CpG}->{$index+1}->{un}++; | |
| 4766 } | |
| 4767 elsif ($methylation_calls[$index] eq 'H') { | |
| 4768 $counting{total_meCHH_count}++; | |
| 4769 print {$fhs{CHH_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4770 $mbias_1{CHH}->{$index+1}->{meth}++; | |
| 4771 } | |
| 4772 elsif ($methylation_calls[$index] eq 'h') { | |
| 4773 $counting{total_unmethylated_CHH_count}++; | |
| 4774 print {$fhs{CHH_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4775 $mbias_1{CHH}->{$index+1}->{un}++; | |
| 4776 } | |
| 4777 elsif ($methylation_calls[$index] eq '.') {} | |
| 4778 elsif (lc$methylation_calls[$index] eq 'u'){} | |
| 4779 else{ | |
| 4780 die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; | |
| 4781 } | |
| 4782 } | |
| 4783 } | |
| 4784 else { | |
| 4785 die "The read had a strand orientation which was neither + nor -: $strand\n"; | |
| 4786 } | |
| 4787 } | |
| 4788 | |
| 4789 ### strand-specific methylation output | |
| 4790 else { | |
| 4791 if ($strand eq '+') { | |
| 4792 for my $index (0..$#methylation_calls) { | |
| 4793 ### methylated Cs (any context) will receive a forward (+) orientation | |
| 4794 ### not methylated Cs (any context) will receive a reverse (-) orientation | |
| 4795 | |
| 4796 if ($cigar and @comp_cigar){ # only needed for SAM reads with Indels | |
| 4797 my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); | |
| 4798 $cigar_offset += $cigar_mod; | |
| 4799 $pos_offset += $pos_mod; | |
| 4800 } | |
| 4801 | |
| 4802 if ($methylation_calls[$index] eq 'X') { | |
| 4803 $counting{total_meCHG_count}++; | |
| 4804 print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4805 $mbias_1{CHG}->{$index+1}->{meth}++; | |
| 4806 } | |
| 4807 elsif ($methylation_calls[$index] eq 'x') { | |
| 4808 $counting{total_unmethylated_CHG_count}++; | |
| 4809 print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4810 $mbias_1{CHG}->{$index+1}->{un}++; | |
| 4811 } | |
| 4812 elsif ($methylation_calls[$index] eq 'Z') { | |
| 4813 $counting{total_meCpG_count}++; | |
| 4814 print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4815 $mbias_1{CpG}->{$index+1}->{meth}++; | |
| 4816 } | |
| 4817 elsif ($methylation_calls[$index] eq 'z') { | |
| 4818 $counting{total_unmethylated_CpG_count}++; | |
| 4819 print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4820 $mbias_1{CpG}->{$index+1}->{un}++; | |
| 4821 } | |
| 4822 elsif ($methylation_calls[$index] eq 'H') { | |
| 4823 $counting{total_meCHH_count}++; | |
| 4824 print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4825 $mbias_1{CHH}->{$index+1}->{meth}++; | |
| 4826 } | |
| 4827 elsif ($methylation_calls[$index] eq 'h') { | |
| 4828 $counting{total_unmethylated_CHH_count}++; | |
| 4829 print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4830 $mbias_1{CHH}->{$index+1}->{un}++; | |
| 4831 } | |
| 4832 elsif ($methylation_calls[$index] eq '.') {} | |
| 4833 elsif (lc$methylation_calls[$index] eq 'u'){} | |
| 4834 else{ | |
| 4835 die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; | |
| 4836 } | |
| 4837 } | |
| 4838 } | |
| 4839 elsif ($strand eq '-') { | |
| 4840 | |
| 4841 for my $index (0..$#methylation_calls) { | |
| 4842 ### methylated Cs (any context) will receive a forward (+) orientation | |
| 4843 ### not methylated Cs (any context) will receive a reverse (-) orientation | |
| 4844 | |
| 4845 if ($cigar and @comp_cigar){ # only needed for SAM reads with Indels | |
| 4846 my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); | |
| 4847 $cigar_offset += $cigar_mod; | |
| 4848 $pos_offset += $pos_mod; | |
| 4849 } | |
| 4850 | |
| 4851 if ($methylation_calls[$index] eq 'X') { | |
| 4852 $counting{total_meCHG_count}++; | |
| 4853 print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4854 $mbias_1{CHG}->{$index+1}->{meth}++; | |
| 4855 } | |
| 4856 elsif ($methylation_calls[$index] eq 'x') { | |
| 4857 $counting{total_unmethylated_CHG_count}++; | |
| 4858 print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4859 $mbias_1{CHG}->{$index+1}->{un}++; | |
| 4860 } | |
| 4861 elsif ($methylation_calls[$index] eq 'Z') { | |
| 4862 $counting{total_meCpG_count}++; | |
| 4863 print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4864 $mbias_1{CpG}->{$index+1}->{meth}++; | |
| 4865 } | |
| 4866 elsif ($methylation_calls[$index] eq 'z') { | |
| 4867 $counting{total_unmethylated_CpG_count}++; | |
| 4868 print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4869 $mbias_1{CpG}->{$index+1}->{un}++; | |
| 4870 } | |
| 4871 elsif ($methylation_calls[$index] eq 'H') { | |
| 4872 $counting{total_meCHH_count}++; | |
| 4873 print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4874 $mbias_1{CHH}->{$index+1}->{meth}++; | |
| 4875 } | |
| 4876 elsif ($methylation_calls[$index] eq 'h') { | |
| 4877 $counting{total_unmethylated_CHH_count}++; | |
| 4878 print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4879 $mbias_1{CHH}->{$index+1}->{un}++; | |
| 4880 } | |
| 4881 elsif ($methylation_calls[$index] eq '.') {} | |
| 4882 elsif (lc$methylation_calls[$index] eq 'u'){} | |
| 4883 else{ | |
| 4884 die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; | |
| 4885 } | |
| 4886 } | |
| 4887 } | |
| 4888 else { | |
| 4889 die "The strand information was neither + nor -: $strand\n"; | |
| 4890 } | |
| 4891 } | |
| 4892 } | |
| 4893 | |
| 4894 sub open_output_filehandles{ | |
| 4895 | |
| 4896 my $filename = shift; | |
| 4897 | |
| 4898 my $output_filename = (split (/\//,$filename))[-1]; | |
| 4899 my $report_filename = $output_filename; | |
| 4900 | |
| 4901 ### OPENING OUTPUT-FILEHANDLES | |
| 4902 if ($report) { | |
| 4903 $report_filename =~ s/\.sam$//; | |
| 4904 $report_filename =~ s/\.bam$//; | |
| 4905 $report_filename =~ s/\.cram$//; | |
| 4906 $report_filename =~ s/\.txt$//; | |
| 4907 $report_filename =~ s/$/_splitting_report.txt/; | |
| 4908 $report_filename = $output_dir . $report_filename; | |
| 4909 open (REPORT,'>',$report_filename) or die "Failed to write to file $report_filename $!\n"; | |
| 4910 } | |
| 4911 | |
| 4912 if ($report) { | |
| 4913 | |
| 4914 print REPORT "$output_filename\n\n"; | |
| 4915 print REPORT "Parameters used to extract methylation information:\n"; | |
| 4916 print REPORT "Bismark Extractor Version: $version\n"; | |
| 4917 | |
| 4918 if ($paired) { | |
| 4919 if ($vanilla) { | |
| 4920 print REPORT "Bismark result file: paired-end (vanilla Bismark format)\n"; | |
| 4921 } else { | |
| 4922 print REPORT "Bismark result file: paired-end (SAM format)\n"; # default | |
| 4923 } | |
| 4924 } | |
| 4925 | |
| 4926 if ($single) { | |
| 4927 if ($vanilla) { | |
| 4928 print REPORT "Bismark result file: single-end (vanilla Bismark format)\n"; | |
| 4929 } else { | |
| 4930 print REPORT "Bismark result file: single-end (SAM format)\n"; # default | |
| 4931 } | |
| 4932 } | |
| 4933 if ($single){ | |
| 4934 if ($ignore) { | |
| 4935 print REPORT "Ignoring first $ignore bp\n"; | |
| 4936 } | |
| 4937 if ($ignore_3prime) { | |
| 4938 print REPORT "Ignoring last $ignore_3prime bp\n"; | |
| 4939 } | |
| 4940 } | |
| 4941 else{ # paired-end | |
| 4942 if ($ignore) { | |
| 4943 print REPORT "Ignoring first $ignore bp of Read 1\n"; | |
| 4944 } | |
| 4945 if ($ignore_r2){ | |
| 4946 print REPORT "Ignoring first $ignore_r2 bp of Read 2\n"; | |
| 4947 } | |
| 4948 | |
| 4949 if ($ignore_3prime) { | |
| 4950 print REPORT "Ignoring last $ignore_3prime bp of Read 1\n"; | |
| 4951 } | |
| 4952 if ($ignore_3prime_r2){ | |
| 4953 print REPORT "Ignoring last $ignore_3prime_r2 bp of Read 2\n"; | |
| 4954 } | |
| 4955 | |
| 4956 } | |
| 4957 | |
| 4958 if ($full) { | |
| 4959 print REPORT "Output specified: comprehensive\n"; | |
| 4960 } else { | |
| 4961 print REPORT "Output specified: strand-specific (default)\n"; | |
| 4962 } | |
| 4963 | |
| 4964 if ($no_overlap) { | |
| 4965 print REPORT "No overlapping methylation calls specified\n"; | |
| 4966 } | |
| 4967 if ($genomic_fasta) { | |
| 4968 print REPORT "Genomic equivalent sequences will be printed out in FastA format\n"; | |
| 4969 } | |
| 4970 if ($merge_non_CpG) { | |
| 4971 print REPORT "Methylation in CHG and CHH context will be merged into \"non-CpG context\" output\n"; | |
| 4972 } | |
| 4973 | |
| 4974 print REPORT "\n"; | |
| 4975 } | |
| 4976 | |
| 4977 ##### open (OUT,"| gzip -c - > $output_dir$outfile") or die "Failed to write to $outfile: $!\n"; | |
| 4978 | |
| 4979 ### CpG-context and non-CpG context. THIS SECTION IS OPTIONAL | |
| 4980 ### if --comprehensive AND --merge_non_CpG was specified we are only writing out one CpG-context and one Any-Other-context result file | |
| 4981 if ($full and $merge_non_CpG) { | |
| 4982 my $cpg_output = my $other_c_output = $output_filename; | |
| 4983 ### C in CpG context | |
| 4984 $cpg_output =~ s/^/CpG_context_/; | |
| 4985 $cpg_output =~ s/sam$/txt/; | |
| 4986 $cpg_output =~ s/bam$/txt/; | |
| 4987 $cpg_output =~ s/cram$/txt/; | |
| 4988 $cpg_output =~ s/$/.txt/ unless ($cpg_output =~ /\.txt$/); | |
| 4989 $cpg_output = $output_dir . $cpg_output; | |
| 4990 | |
| 4991 if ($gzip){ | |
| 4992 $cpg_output .= '.gz'; | |
| 4993 open ($fhs{CpG_context},"| gzip -c - > $cpg_output") or die "Failed to write to $cpg_output $! \n" unless($mbias_only); | |
| 4994 } | |
| 4995 else{ ### disclaimer: I am aware of "The Useless Use of Cat Awards", but I saw no other option... | |
| 4996 open ($fhs{CpG_context},"| cat > $cpg_output") or die "Failed to write to $cpg_output $! \n" unless($mbias_only); | |
| 4997 # open ($fhs{CpG_context},'>',$cpg_output) or die "Failed to write to $cpg_output $! \n" unless($mbias_only); | |
| 4998 } | |
| 4999 | |
| 5000 warn "Writing result file containing methylation information for C in CpG context to $cpg_output\n" unless($mbias_only); | |
| 5001 push @sorting_files,$cpg_output; | |
| 5002 | |
| 5003 unless ($no_header) { | |
| 5004 print {$fhs{CpG_context}} "Bismark methylation extractor version $version\n" unless($mbias_only); | |
| 5005 } | |
| 5006 | |
| 5007 ### C in any other context than CpG | |
| 5008 $other_c_output =~ s/^/Non_CpG_context_/; | |
| 5009 $other_c_output =~ s/sam$/txt/; | |
| 5010 $other_c_output =~ s/bam$/txt/; | |
| 5011 $other_c_output =~ s/cram$/txt/; | |
| 5012 $other_c_output =~ s/$/.txt/ unless ($other_c_output =~ /\.txt$/); | |
| 5013 $other_c_output = $output_dir . $other_c_output; | |
| 5014 | |
| 5015 if ($gzip){ | |
| 5016 $other_c_output .= '.gz'; | |
| 5017 open ($fhs{other_context},"| gzip -c - > $other_c_output") or die "Failed to write to $other_c_output $! \n" unless($mbias_only); | |
| 5018 } | |
| 5019 else{ | |
| 5020 open ($fhs{other_context},"| cat > $other_c_output") or die "Failed to write to $other_c_output $!\n" unless($mbias_only); | |
| 5021 # open ($fhs{other_context},'>',$other_c_output) or die "Failed to write to $other_c_output $!\n" unless($mbias_only); | |
| 5022 } | |
| 5023 | |
| 5024 warn "Writing result file containing methylation information for C in any other context to $other_c_output\n" unless($mbias_only); | |
| 5025 push @sorting_files,$other_c_output; | |
| 5026 | |
| 5027 | |
| 5028 unless ($no_header) { | |
| 5029 print {$fhs{other_context}} "Bismark methylation extractor version $version\n" unless($mbias_only); | |
| 5030 } | |
| 5031 } | |
| 5032 | |
| 5033 ### if only --merge_non_CpG was specified we will write out 8 different output files, depending on where the (first) unique best alignment has been found | |
| 5034 elsif ($merge_non_CpG) { | |
| 5035 | |
| 5036 my $cpg_ot = my $cpg_ctot = my $cpg_ctob = my $cpg_ob = $output_filename; | |
| 5037 | |
| 5038 ### For cytosines in CpG context | |
| 5039 $cpg_ot =~ s/^/CpG_OT_/; | |
| 5040 $cpg_ot =~ s/sam$/txt/; | |
| 5041 $cpg_ot =~ s/bam$/txt/; | |
| 5042 $cpg_ot =~ s/cram$/txt/; | |
| 5043 $cpg_ot =~ s/$/.txt/ unless ($cpg_ot =~ /\.txt$/); | |
| 5044 $cpg_ot = $output_dir . $cpg_ot; | |
| 5045 | |
| 5046 if ($gzip){ | |
| 5047 $cpg_ot .= '.gz'; | |
| 5048 open ($fhs{0}->{CpG},"| gzip -c - > $cpg_ot") or die "Failed to write to $cpg_ot $!\n" unless($mbias_only); | |
| 5049 } | |
| 5050 else{ | |
| 5051 open ($fhs{0}->{CpG},"| cat > $cpg_ot") or die "Failed to write to $cpg_ot $!\n" unless($mbias_only); | |
| 5052 # open ($fhs{0}->{CpG},'>',$cpg_ot) or die "Failed to write to $cpg_ot $!\n" unless($mbias_only); | |
| 5053 } | |
| 5054 | |
| 5055 warn "Writing result file containing methylation information for C in CpG context from the original top strand to $cpg_ot\n" unless($mbias_only); | |
| 5056 push @sorting_files,$cpg_ot; | |
| 5057 | |
| 5058 unless($no_header){ | |
| 5059 print {$fhs{0}->{CpG}} "Bismark methylation extractor version $version\n" unless($mbias_only); | |
| 5060 } | |
| 5061 | |
| 5062 $cpg_ctot =~ s/^/CpG_CTOT_/; | |
| 5063 $cpg_ctot =~ s/sam$/txt/; | |
| 5064 $cpg_ctot =~ s/bam$/txt/; | |
| 5065 $cpg_ctot =~ s/cram$/txt/; | |
| 5066 $cpg_ctot =~ s/$/.txt/ unless ($cpg_ctot =~ /\.txt$/); | |
| 5067 $cpg_ctot = $output_dir . $cpg_ctot; | |
| 5068 | |
| 5069 if ($gzip){ | |
| 5070 $cpg_ctot .= '.gz'; | |
| 5071 open ($fhs{1}->{CpG},"| gzip -c - > $cpg_ctot") or die "Failed to write to $cpg_ctot $!\n" unless($mbias_only); | |
| 5072 } | |
| 5073 else{ | |
| 5074 open ($fhs{1}->{CpG},"| cat > $cpg_ctot") or die "Failed to write to $cpg_ctot $!\n" unless($mbias_only); | |
| 5075 # open ($fhs{1}->{CpG},'>',$cpg_ctot) or die "Failed to write to $cpg_ctot $!\n" unless($mbias_only); | |
| 5076 } | |
| 5077 | |
| 5078 warn "Writing result file containing methylation information for C in CpG context from the complementary to original top strand to $cpg_ctot\n" unless($mbias_only); | |
| 5079 push @sorting_files,$cpg_ctot; | |
| 5080 | |
| 5081 unless($no_header){ | |
| 5082 print {$fhs{1}->{CpG}} "Bismark methylation extractor version $version\n" unless($mbias_only); | |
| 5083 } | |
| 5084 | |
| 5085 $cpg_ctob =~ s/^/CpG_CTOB_/; | |
| 5086 $cpg_ctob =~ s/sam$/txt/; | |
| 5087 $cpg_ctob =~ s/bam$/txt/; | |
| 5088 $cpg_ctob =~ s/cram$/txt/; | |
| 5089 $cpg_ctob =~ s/$/.txt/ unless ($cpg_ctob =~ /\.txt$/); | |
| 5090 $cpg_ctob = $output_dir . $cpg_ctob; | |
| 5091 | |
| 5092 if ($gzip){ | |
| 5093 $cpg_ctob .= '.gz'; | |
| 5094 open ($fhs{2}->{CpG},"| gzip -c - > $cpg_ctob") or die "Failed to write to $cpg_ctob $!\n" unless($mbias_only); | |
| 5095 } | |
| 5096 else{ | |
| 5097 open ($fhs{2}->{CpG},"| cat > $cpg_ctob") or die "Failed to write to $cpg_ctob $!\n" unless($mbias_only); | |
| 5098 # open ($fhs{2}->{CpG},'>',$cpg_ctob) or die "Failed to write to $cpg_ctob $!\n" unless($mbias_only); | |
| 5099 } | |
| 5100 | |
| 5101 warn "Writing result file containing methylation information for C in CpG context from the complementary to original bottom strand to $cpg_ctob\n" unless($mbias_only); | |
| 5102 push @sorting_files,$cpg_ctob; | |
| 5103 | |
| 5104 unless($no_header){ | |
| 5105 print {$fhs{2}->{CpG}} "Bismark methylation extractor version $version\n" unless($mbias_only); | |
| 5106 } | |
| 5107 | |
| 5108 $cpg_ob =~ s/^/CpG_OB_/; | |
| 5109 $cpg_ob =~ s/sam$/txt/; | |
| 5110 $cpg_ob =~ s/bam$/txt/; | |
| 5111 $cpg_ob =~ s/cram$/txt/; | |
| 5112 $cpg_ob =~ s/$/.txt/ unless ($cpg_ob =~ /\.txt$/); | |
| 5113 $cpg_ob = $output_dir . $cpg_ob; | |
| 5114 | |
| 5115 if ($gzip){ | |
| 5116 $cpg_ob .= '.gz'; | |
| 5117 open ($fhs{3}->{CpG},"| gzip -c - > $cpg_ob") or die "Failed to write to $cpg_ob $!\n" unless($mbias_only); | |
| 5118 } | |
| 5119 else{ | |
| 5120 open ($fhs{3}->{CpG},"| cat > $cpg_ob") or die "Failed to write to $cpg_ob $!\n" unless($mbias_only); | |
| 5121 # open ($fhs{3}->{CpG},'>',$cpg_ob) or die "Failed to write to $cpg_ob $!\n" unless($mbias_only); | |
| 5122 } | |
| 5123 | |
| 5124 warn "Writing result file containing methylation information for C in CpG context from the original bottom strand to $cpg_ob\n\n" unless($mbias_only); | |
| 5125 push @sorting_files,$cpg_ob; | |
| 5126 | |
| 5127 unless($no_header){ | |
| 5128 print {$fhs{3}->{CpG}} "Bismark methylation extractor version $version\n" unless($mbias_only); | |
| 5129 } | |
| 5130 | |
| 5131 ### For cytosines in Non-CpG (CC, CT or CA) context | |
| 5132 my $other_c_ot = my $other_c_ctot = my $other_c_ctob = my $other_c_ob = $output_filename; | |
| 5133 | |
| 5134 $other_c_ot =~ s/^/Non_CpG_OT_/; | |
| 5135 $other_c_ot =~ s/sam$/txt/; | |
| 5136 $other_c_ot =~ s/bam$/txt/; | |
| 5137 $other_c_ot =~ s/cram$/txt/; | |
| 5138 $other_c_ot =~ s/$/.txt/ unless ($other_c_ot =~ /\.txt$/); | |
| 5139 $other_c_ot = $output_dir . $other_c_ot; | |
| 5140 | |
| 5141 if ($gzip){ | |
| 5142 $other_c_ot .= '.gz'; | |
| 5143 open ($fhs{0}->{other_c},"| gzip -c - > $other_c_ot") or die "Failed to write to $other_c_ot $!\n" unless($mbias_only); | |
| 5144 } | |
| 5145 else{ | |
| 5146 open ($fhs{0}->{other_c},"| cat > $other_c_ot") or die "Failed to write to $other_c_ot $!\n" unless($mbias_only); | |
| 5147 # open ($fhs{0}->{other_c},'>',$other_c_ot) or die "Failed to write to $other_c_ot $!\n" unless($mbias_only); | |
| 5148 } | |
| 5149 | |
| 5150 warn "Writing result file containing methylation information for C in any other context from the original top strand to $other_c_ot\n" unless($mbias_only); | |
| 5151 push @sorting_files,$other_c_ot; | |
| 5152 | |
| 5153 unless($no_header){ | |
| 5154 print {$fhs{0}->{other_c}} "Bismark methylation extractor version $version\n" unless($mbias_only); | |
| 5155 } | |
| 5156 | |
| 5157 $other_c_ctot =~ s/^/Non_CpG_CTOT_/; | |
| 5158 $other_c_ctot =~ s/sam$/txt/; | |
| 5159 $other_c_ctot =~ s/bam$/txt/; | |
| 5160 $other_c_ctot =~ s/cram$/txt/; | |
| 5161 $other_c_ctot =~ s/$/.txt/ unless ($other_c_ctot =~ /\.txt$/); | |
| 5162 $other_c_ctot = $output_dir . $other_c_ctot; | |
| 5163 | |
| 5164 if ($gzip){ | |
| 5165 $other_c_ctot .= '.gz'; | |
| 5166 open ($fhs{1}->{other_c},"| gzip -c - > $other_c_ctot") or die "Failed to write to $other_c_ctot $!\n" unless($mbias_only); | |
| 5167 } | |
| 5168 else{ | |
| 5169 open ($fhs{1}->{other_c},"| cat > $other_c_ctot") or die "Failed to write to $other_c_ctot $!\n" unless($mbias_only); | |
| 5170 # open ($fhs{1}->{other_c},'>',$other_c_ctot) or die "Failed to write to $other_c_ctot $!\n" unless($mbias_only); | |
| 5171 } | |
| 5172 | |
| 5173 warn "Writing result file containing methylation information for C in any other context from the complementary to original top strand to $other_c_ctot\n" unless($mbias_only); | |
| 5174 push @sorting_files,$other_c_ctot; | |
| 5175 | |
| 5176 unless($no_header){ | |
| 5177 print {$fhs{1}->{other_c}} "Bismark methylation extractor version $version\n" unless($mbias_only); | |
| 5178 } | |
| 5179 | |
| 5180 $other_c_ctob =~ s/^/Non_CpG_CTOB_/; | |
| 5181 $other_c_ctob =~ s/sam$/txt/; | |
| 5182 $other_c_ctob =~ s/bam$/txt/; | |
| 5183 $other_c_ctob =~ s/cram$/txt/; | |
| 5184 $other_c_ctob =~ s/$/.txt/ unless ($other_c_ctob =~ /\.txt$/); | |
| 5185 $other_c_ctob = $output_dir . $other_c_ctob; | |
| 5186 | |
| 5187 if ($gzip){ | |
| 5188 $other_c_ctob .= '.gz'; | |
| 5189 open ($fhs{2}->{other_c},"| gzip -c - > $other_c_ctob") or die "Failed to write to $other_c_ctob $!\n" unless($mbias_only); | |
| 5190 } | |
| 5191 else{ | |
| 5192 open ($fhs{2}->{other_c},"| cat > $other_c_ctob") or die "Failed to write to $other_c_ctob $!\n" unless($mbias_only); | |
| 5193 # open ($fhs{2}->{other_c},'>',$other_c_ctob) or die "Failed to write to $other_c_ctob $!\n" unless($mbias_only); | |
| 5194 } | |
| 5195 | |
| 5196 warn "Writing result file containing methylation information for C in any other context from the complementary to original bottom strand to $other_c_ctob\n" unless($mbias_only); | |
| 5197 push @sorting_files,$other_c_ctob; | |
| 5198 | |
| 5199 unless($no_header){ | |
| 5200 print {$fhs{2}->{other_c}} "Bismark methylation extractor version $version\n" unless($mbias_only); | |
| 5201 } | |
| 5202 | |
| 5203 $other_c_ob =~ s/^/Non_CpG_OB_/; | |
| 5204 $other_c_ob =~ s/sam$/txt/; | |
| 5205 $other_c_ob =~ s/sam$/txt/; | |
| 5206 $other_c_ob =~ s/cram$/txt/; | |
| 5207 $other_c_ob =~ s/$/.txt/ unless ($other_c_ob =~ /\.txt$/); | |
| 5208 $other_c_ob = $output_dir . $other_c_ob; | |
| 5209 | |
| 5210 if ($gzip){ | |
| 5211 $other_c_ob .= '.gz'; | |
| 5212 open ($fhs{3}->{other_c},"| gzip -c - > $other_c_ob") or die "Failed to write to $other_c_ob $!\n" unless($mbias_only); | |
| 5213 } | |
| 5214 else{ | |
| 5215 open ($fhs{3}->{other_c},"| cat > $other_c_ob") or die "Failed to write to $other_c_ob $!\n" unless($mbias_only); | |
| 5216 # open ($fhs{3}->{other_c},'>',$other_c_ob) or die "Failed to write to $other_c_ob $!\n" unless($mbias_only); | |
| 5217 } | |
| 5218 | |
| 5219 warn "Writing result file containing methylation information for C in any other context from the original bottom strand to $other_c_ob\n\n" unless($mbias_only); | |
| 5220 push @sorting_files,$other_c_ob; | |
| 5221 | |
| 5222 unless($no_header){ | |
| 5223 print {$fhs{3}->{other_c}} "Bismark methylation extractor version $version\n" unless($mbias_only); | |
| 5224 } | |
| 5225 } | |
| 5226 | |
| 5227 ### THIS SECTION IS THE DEFAULT (CpG, CHG and CHH context) | |
| 5228 | |
| 5229 ### if --comprehensive was specified we are only writing one file per context | |
| 5230 elsif ($full) { | |
| 5231 my $cpg_output = my $chg_output = my $chh_output = $output_filename; | |
| 5232 ### C in CpG context | |
| 5233 $cpg_output =~ s/^/CpG_context_/; | |
| 5234 $cpg_output =~ s/sam$/txt/; | |
| 5235 $cpg_output =~ s/bam$/txt/; | |
| 5236 $cpg_output =~ s/cram$/txt/; | |
| 5237 $cpg_output =~ s/$/.txt/ unless ($cpg_output =~ /\.txt$/); | |
| 5238 $cpg_output = $output_dir . $cpg_output; | |
| 5239 | |
| 5240 if ($gzip){ | |
| 5241 $cpg_output .= '.gz'; | |
| 5242 open ($fhs{CpG_context},"| gzip -c - > $cpg_output") or die "Failed to write to $cpg_output $! \n" unless($mbias_only); | |
| 5243 } | |
| 5244 else{ | |
| 5245 open ($fhs{CpG_context},"| cat > $cpg_output") or die "Failed to write to $cpg_output $! \n" unless($mbias_only); | |
| 5246 # open ($fhs{CpG_context},'>',$cpg_output) or die "Failed to write to $cpg_output $! \n" unless($mbias_only); | |
| 5247 } | |
| 5248 | |
| 5249 warn "Writing result file containing methylation information for C in CpG context to $cpg_output\n" unless($mbias_only); | |
| 5250 push @sorting_files,$cpg_output; | |
| 5251 | |
| 5252 unless($no_header){ | |
| 5253 print {$fhs{CpG_context}} "Bismark methylation extractor version $version\n" unless($mbias_only); | |
| 5254 } | |
| 5255 | |
| 5256 ### C in CHG context | |
| 5257 $chg_output =~ s/^/CHG_context_/; | |
| 5258 $chg_output =~ s/sam$/txt/; | |
| 5259 $chg_output =~ s/bam$/txt/; | |
| 5260 $chg_output =~ s/cram$/txt/; | |
| 5261 $chg_output =~ s/$/.txt/ unless ($chg_output =~ /\.txt$/); | |
| 5262 $chg_output = $output_dir . $chg_output; | |
| 5263 | |
| 5264 if ($gzip){ | |
| 5265 $chg_output .= '.gz'; | |
| 5266 open ($fhs{CHG_context},"| gzip -c - > $chg_output") or die "Failed to write to $chg_output $!\n" unless($mbias_only); | |
| 5267 } | |
| 5268 else{ | |
| 5269 open ($fhs{CHG_context},"| cat > $chg_output") or die "Failed to write to $chg_output $!\n" unless($mbias_only); | |
| 5270 # open ($fhs{CHG_context},'>',$chg_output) or die "Failed to write to $chg_output $!\n" unless($mbias_only); | |
| 5271 } | |
| 5272 | |
| 5273 warn "Writing result file containing methylation information for C in CHG context to $chg_output\n" unless($mbias_only); | |
| 5274 push @sorting_files,$chg_output; | |
| 5275 | |
| 5276 unless($no_header){ | |
| 5277 print {$fhs{CHG_context}} "Bismark methylation extractor version $version\n" unless($mbias_only); | |
| 5278 } | |
| 5279 | |
| 5280 ### C in CHH context | |
| 5281 $chh_output =~ s/^/CHH_context_/; | |
| 5282 $chh_output =~ s/sam$/txt/; | |
| 5283 $chh_output =~ s/bam$/txt/; | |
| 5284 $chh_output =~ s/cram$/txt/; | |
| 5285 $chh_output =~ s/$/.txt/ unless ($chh_output =~ /\.txt$/); | |
| 5286 $chh_output = $output_dir . $chh_output; | |
| 5287 | |
| 5288 if ($gzip){ | |
| 5289 $chh_output .= '.gz'; | |
| 5290 open ($fhs{CHH_context},"| gzip -c - > $chh_output") or die "Failed to write to $chh_output $!\n" unless($mbias_only); | |
| 5291 } | |
| 5292 else{ | |
| 5293 open ($fhs{CHH_context},"| cat > $chh_output") or die "Failed to write to $chh_output $!\n" unless($mbias_only); | |
| 5294 # open ($fhs{CHH_context},'>',$chh_output) or die "Failed to write to $chh_output $!\n" unless($mbias_only); | |
| 5295 } | |
| 5296 | |
| 5297 warn "Writing result file containing methylation information for C in CHH context to $chh_output\n" unless($mbias_only); | |
| 5298 push @sorting_files, $chh_output; | |
| 5299 | |
| 5300 unless($no_header){ | |
| 5301 print {$fhs{CHH_context}} "Bismark methylation extractor version $version\n" unless($mbias_only); | |
| 5302 } | |
| 5303 } | |
| 5304 ### else we will write out 12 different output files, depending on where the (first) unique best alignment was found | |
| 5305 else { | |
| 5306 my $cpg_ot = my $cpg_ctot = my $cpg_ctob = my $cpg_ob = $output_filename; | |
| 5307 | |
| 5308 ### For cytosines in CpG context | |
| 5309 $cpg_ot =~ s/^/CpG_OT_/; | |
| 5310 $cpg_ot =~ s/sam$/txt/; | |
| 5311 $cpg_ot =~ s/bam$/txt/; | |
| 5312 $cpg_ot =~ s/cram$/txt/; | |
| 5313 $cpg_ot =~ s/$/.txt/ unless ($cpg_ot =~ /\.txt$/); | |
| 5314 $cpg_ot = $output_dir . $cpg_ot; | |
| 5315 | |
| 5316 if ($gzip){ | |
| 5317 $cpg_ot .= '.gz'; | |
| 5318 open ($fhs{0}->{CpG},"| gzip -c - > $cpg_ot") or die "Failed to write to $cpg_ot $!\n" unless($mbias_only); | |
| 5319 } | |
| 5320 else{ | |
| 5321 open ($fhs{0}->{CpG},"| cat > $cpg_ot") or die "Failed to write to $cpg_ot $!\n" unless($mbias_only); | |
| 5322 # open ($fhs{0}->{CpG},'>',$cpg_ot) or die "Failed to write to $cpg_ot $!\n" unless($mbias_only); | |
| 5323 } | |
| 5324 | |
| 5325 warn "Writing result file containing methylation information for C in CpG context from the original top strand to $cpg_ot\n" unless($mbias_only); | |
| 5326 push @sorting_files,$cpg_ot; | |
| 5327 | |
| 5328 unless($no_header){ | |
| 5329 print {$fhs{0}->{CpG}} "Bismark methylation extractor version $version\n" unless($mbias_only); | |
| 5330 } | |
| 5331 | |
| 5332 $cpg_ctot =~ s/^/CpG_CTOT_/; | |
| 5333 $cpg_ctot =~ s/sam$/txt/; | |
| 5334 $cpg_ctot =~ s/bam$/txt/; | |
| 5335 $cpg_ctot =~ s/cram$/txt/; | |
| 5336 $cpg_ctot =~ s/$/.txt/ unless ($cpg_ctot =~ /\.txt$/); | |
| 5337 $cpg_ctot = $output_dir . $cpg_ctot; | |
| 5338 | |
| 5339 if ($gzip){ | |
| 5340 $cpg_ctot .= '.gz'; | |
| 5341 open ($fhs{1}->{CpG},"| gzip -c - > $cpg_ctot") or die "Failed to write to $cpg_ctot $!\n" unless($mbias_only); | |
| 5342 } | |
| 5343 else{ | |
| 5344 open ($fhs{1}->{CpG},"| cat > $cpg_ctot") or die "Failed to write to $cpg_ctot $!\n" unless($mbias_only); | |
| 5345 # open ($fhs{1}->{CpG},'>',$cpg_ctot) or die "Failed to write to $cpg_ctot $!\n" unless($mbias_only); | |
| 5346 } | |
| 5347 | |
| 5348 warn "Writing result file containing methylation information for C in CpG context from the complementary to original top strand to $cpg_ctot\n" unless($mbias_only); | |
| 5349 push @sorting_files,$cpg_ctot; | |
| 5350 | |
| 5351 unless($no_header){ | |
| 5352 print {$fhs{1}->{CpG}} "Bismark methylation extractor version $version\n" unless($mbias_only); | |
| 5353 } | |
| 5354 | |
| 5355 $cpg_ctob =~ s/^/CpG_CTOB_/; | |
| 5356 $cpg_ctob =~ s/sam$/txt/; | |
| 5357 $cpg_ctob =~ s/bam$/txt/; | |
| 5358 $cpg_ctob =~ s/cram$/txt/; | |
| 5359 $cpg_ctob =~ s/$/.txt/ unless ($cpg_ctob =~ /\.txt$/); | |
| 5360 $cpg_ctob = $output_dir . $cpg_ctob; | |
| 5361 | |
| 5362 if ($gzip){ | |
| 5363 $cpg_ctob .= '.gz'; | |
| 5364 open ($fhs{2}->{CpG},"| gzip -c - > $cpg_ctob") or die "Failed to write to $cpg_ctob $!\n" unless($mbias_only); | |
| 5365 } | |
| 5366 else{ | |
| 5367 open ($fhs{2}->{CpG},"| cat > $cpg_ctob") or die "Failed to write to $cpg_ctob $!\n" unless($mbias_only); | |
| 5368 # open ($fhs{2}->{CpG},'>',$cpg_ctob) or die "Failed to write to $cpg_ctob $!\n" unless($mbias_only); | |
| 5369 } | |
| 5370 | |
| 5371 warn "Writing result file containing methylation information for C in CpG context from the complementary to original bottom strand to $cpg_ctob\n" unless($mbias_only); | |
| 5372 push @sorting_files,$cpg_ctob; | |
| 5373 | |
| 5374 unless($no_header){ | |
| 5375 print {$fhs{2}->{CpG}} "Bismark methylation extractor version $version\n" unless($mbias_only); | |
| 5376 } | |
| 5377 | |
| 5378 $cpg_ob =~ s/^/CpG_OB_/; | |
| 5379 $cpg_ob =~ s/sam$/txt/; | |
| 5380 $cpg_ob =~ s/bam$/txt/; | |
| 5381 $cpg_ob =~ s/cram$/txt/; | |
| 5382 $cpg_ob =~ s/$/.txt/ unless ($cpg_ob =~ /\.txt$/); | |
| 5383 $cpg_ob = $output_dir . $cpg_ob; | |
| 5384 | |
| 5385 if ($gzip){ | |
| 5386 $cpg_ob .= '.gz'; | |
| 5387 open ($fhs{3}->{CpG},"| gzip -c - > $cpg_ob") or die "Failed to write to $cpg_ob $!\n" unless($mbias_only); | |
| 5388 } | |
| 5389 else{ | |
| 5390 open ($fhs{3}->{CpG},"| cat > $cpg_ob") or die "Failed to write to $cpg_ob $!\n" unless($mbias_only); | |
| 5391 # open ($fhs{3}->{CpG},'>',$cpg_ob) or die "Failed to write to $cpg_ob $!\n" unless($mbias_only); | |
| 5392 } | |
| 5393 | |
| 5394 warn "Writing result file containing methylation information for C in CpG context from the original bottom strand to $cpg_ob\n\n" unless($mbias_only); | |
| 5395 push @sorting_files,$cpg_ob; | |
| 5396 | |
| 5397 unless($no_header){ | |
| 5398 print {$fhs{3}->{CpG}} "Bismark methylation extractor version $version\n" unless($mbias_only); | |
| 5399 } | |
| 5400 | |
| 5401 ### For cytosines in CHG context | |
| 5402 my $chg_ot = my $chg_ctot = my $chg_ctob = my $chg_ob = $output_filename; | |
| 5403 | |
| 5404 $chg_ot =~ s/^/CHG_OT_/; | |
| 5405 $chg_ot =~ s/sam$/txt/; | |
| 5406 $chg_ot =~ s/bam$/txt/; | |
| 5407 $chg_ot =~ s/cram$/txt/; | |
| 5408 $chg_ot =~ s/$/.txt/ unless ($chg_ot =~ /\.txt$/); | |
| 5409 $chg_ot = $output_dir . $chg_ot; | |
| 5410 | |
| 5411 if ($gzip){ | |
| 5412 $chg_ot .= '.gz'; | |
| 5413 open ($fhs{0}->{CHG},"| gzip -c - > $chg_ot") or die "Failed to write to $chg_ot $!\n" unless($mbias_only); | |
| 5414 } | |
| 5415 else{ | |
| 5416 open ($fhs{0}->{CHG},"| cat > $chg_ot") or die "Failed to write to $chg_ot $!\n" unless($mbias_only); | |
| 5417 # open ($fhs{0}->{CHG},'>',$chg_ot) or die "Failed to write to $chg_ot $!\n" unless($mbias_only); | |
| 5418 } | |
| 5419 | |
| 5420 warn "Writing result file containing methylation information for C in CHG context from the original top strand to $chg_ot\n" unless($mbias_only); | |
| 5421 push @sorting_files,$chg_ot; | |
| 5422 | |
| 5423 unless($no_header){ | |
| 5424 print {$fhs{0}->{CHG}} "Bismark methylation extractor version $version\n" unless($mbias_only); | |
| 5425 } | |
| 5426 | |
| 5427 $chg_ctot =~ s/^/CHG_CTOT_/; | |
| 5428 $chg_ctot =~ s/sam$/txt/; | |
| 5429 $chg_ctot =~ s/bam$/txt/; | |
| 5430 $chg_ctot =~ s/cram$/txt/; | |
| 5431 $chg_ctot =~ s/$/.txt/ unless ($chg_ctot =~ /\.txt$/); | |
| 5432 $chg_ctot = $output_dir . $chg_ctot; | |
| 5433 | |
| 5434 if ($gzip){ | |
| 5435 $chg_ctot .= '.gz'; | |
| 5436 open ($fhs{1}->{CHG},"| gzip -c - > $chg_ctot") or die "Failed to write to $chg_ctot $!\n" unless($mbias_only); | |
| 5437 } | |
| 5438 else{ | |
| 5439 open ($fhs{1}->{CHG},"| cat > $chg_ctot") or die "Failed to write to $chg_ctot $!\n" unless($mbias_only); | |
| 5440 # open ($fhs{1}->{CHG},'>',$chg_ctot) or die "Failed to write to $chg_ctot $!\n" unless($mbias_only); | |
| 5441 } | |
| 5442 | |
| 5443 warn "Writing result file containing methylation information for C in CHG context from the complementary to original top strand to $chg_ctot\n" unless($mbias_only); | |
| 5444 push @sorting_files,$chg_ctot; | |
| 5445 | |
| 5446 unless($no_header){ | |
| 5447 print {$fhs{1}->{CHG}} "Bismark methylation extractor version $version\n" unless($mbias_only); | |
| 5448 } | |
| 5449 | |
| 5450 $chg_ctob =~ s/^/CHG_CTOB_/; | |
| 5451 $chg_ctob =~ s/sam$/txt/; | |
| 5452 $chg_ctob =~ s/bam$/txt/; | |
| 5453 $chg_ctob =~ s/cram$/txt/; | |
| 5454 $chg_ctob =~ s/$/.txt/ unless ($chg_ctob =~ /\.txt$/); | |
| 5455 $chg_ctob = $output_dir . $chg_ctob; | |
| 5456 | |
| 5457 if ($gzip){ | |
| 5458 $chg_ctob .= '.gz'; | |
| 5459 open ($fhs{2}->{CHG},"| gzip -c - > $chg_ctob") or die "Failed to write to $chg_ctob $!\n" unless($mbias_only); | |
| 5460 } | |
| 5461 else{ | |
| 5462 open ($fhs{2}->{CHG},"| cat > $chg_ctob") or die "Failed to write to $chg_ctob $!\n" unless($mbias_only); | |
| 5463 # open ($fhs{2}->{CHG},'>',$chg_ctob) or die "Failed to write to $chg_ctob $!\n" unless($mbias_only); | |
| 5464 } | |
| 5465 | |
| 5466 warn "Writing result file containing methylation information for C in CHG context from the complementary to original bottom strand to $chg_ctob\n" unless($mbias_only); | |
| 5467 push @sorting_files,$chg_ctob; | |
| 5468 | |
| 5469 unless($no_header){ | |
| 5470 print {$fhs{2}->{CHG}} "Bismark methylation extractor version $version\n" unless($mbias_only); | |
| 5471 } | |
| 5472 | |
| 5473 $chg_ob =~ s/^/CHG_OB_/; | |
| 5474 $chg_ob =~ s/sam$/txt/; | |
| 5475 $chg_ob =~ s/bam$/txt/; | |
| 5476 $chg_ob =~ s/cram$/txt/; | |
| 5477 $chg_ob =~ s/$/.txt/ unless ($chg_ob =~ /\.txt$/); | |
| 5478 $chg_ob = $output_dir . $chg_ob; | |
| 5479 | |
| 5480 if ($gzip){ | |
| 5481 $chg_ob .= '.gz'; | |
| 5482 open ($fhs{3}->{CHG},"| gzip -c - > $chg_ob") or die "Failed to write to $chg_ob $!\n" unless($mbias_only); | |
| 5483 } | |
| 5484 else{ | |
| 5485 open ($fhs{3}->{CHG},"| cat > $chg_ob") or die "Failed to write to $chg_ob $!\n" unless($mbias_only); | |
| 5486 # open ($fhs{3}->{CHG},'>',$chg_ob) or die "Failed to write to $chg_ob $!\n" unless($mbias_only); | |
| 5487 } | |
| 5488 | |
| 5489 warn "Writing result file containing methylation information for C in CHG context from the original bottom strand to $chg_ob\n\n" unless($mbias_only); | |
| 5490 push @sorting_files,$chg_ob; | |
| 5491 | |
| 5492 unless($no_header){ | |
| 5493 print {$fhs{3}->{CHG}} "Bismark methylation extractor version $version\n" unless($mbias_only); | |
| 5494 } | |
| 5495 | |
| 5496 ### For cytosines in CHH context | |
| 5497 my $chh_ot = my $chh_ctot = my $chh_ctob = my $chh_ob = $output_filename; | |
| 5498 | |
| 5499 $chh_ot =~ s/^/CHH_OT_/; | |
| 5500 $chh_ot =~ s/sam$/txt/; | |
| 5501 $chh_ot =~ s/bam$/txt/; | |
| 5502 $chh_ot =~ s/cram$/txt/; | |
| 5503 $chh_ot =~ s/$/.txt/ unless ($chh_ot =~ /\.txt$/); | |
| 5504 $chh_ot = $output_dir . $chh_ot; | |
| 5505 | |
| 5506 if ($gzip){ | |
| 5507 $chh_ot .= '.gz'; | |
| 5508 open ($fhs{0}->{CHH},"| gzip -c - > $chh_ot") or die "Failed to write to $chh_ot $!\n" unless($mbias_only); | |
| 5509 } | |
| 5510 else{ | |
| 5511 open ($fhs{0}->{CHH},"| cat > $chh_ot") or die "Failed to write to $chh_ot $!\n" unless($mbias_only); | |
| 5512 # open ($fhs{0}->{CHH},'>',$chh_ot) or die "Failed to write to $chh_ot $!\n" unless($mbias_only); | |
| 5513 } | |
| 5514 | |
| 5515 warn "Writing result file containing methylation information for C in CHH context from the original top strand to $chh_ot\n" unless($mbias_only); | |
| 5516 push @sorting_files,$chh_ot; | |
| 5517 | |
| 5518 unless($no_header){ | |
| 5519 print {$fhs{0}->{CHH}} "Bismark methylation extractor version $version\n" unless($mbias_only); | |
| 5520 } | |
| 5521 | |
| 5522 $chh_ctot =~ s/^/CHH_CTOT_/; | |
| 5523 $chh_ctot =~ s/sam$/txt/; | |
| 5524 $chh_ctot =~ s/bam$/txt/; | |
| 5525 $chh_ctot =~ s/cram$/txt/; | |
| 5526 $chh_ctot =~ s/$/.txt/ unless ($chh_ctot =~ /\.txt$/); | |
| 5527 $chh_ctot = $output_dir . $chh_ctot; | |
| 5528 | |
| 5529 if ($gzip){ | |
| 5530 $chh_ctot .= '.gz'; | |
| 5531 open ($fhs{1}->{CHH},"| gzip -c - > $chh_ctot") or die "Failed to write to $chh_ctot $!\n" unless($mbias_only); | |
| 5532 } | |
| 5533 else{ | |
| 5534 open ($fhs{1}->{CHH},"| cat > $chh_ctot") or die "Failed to write to $chh_ctot $!\n" unless($mbias_only); | |
| 5535 # open ($fhs{1}->{CHH},'>',$chh_ctot) or die "Failed to write to $chh_ctot $!\n" unless($mbias_only); | |
| 5536 } | |
| 5537 | |
| 5538 warn "Writing result file containing methylation information for C in CHH context from the complementary to original top strand to $chh_ctot\n" unless($mbias_only); | |
| 5539 push @sorting_files,$chh_ctot; | |
| 5540 | |
| 5541 unless($no_header){ | |
| 5542 print {$fhs{1}->{CHH}} "Bismark methylation extractor version $version\n" unless($mbias_only); | |
| 5543 } | |
| 5544 | |
| 5545 $chh_ctob =~ s/^/CHH_CTOB_/; | |
| 5546 $chh_ctob =~ s/sam$/txt/; | |
| 5547 $chh_ctob =~ s/bam$/txt/; | |
| 5548 $chh_ctob =~ s/cram$/txt/; | |
| 5549 $chh_ctob =~ s/$/.txt/ unless ($chh_ctob =~ /\.txt$/); | |
| 5550 $chh_ctob = $output_dir . $chh_ctob; | |
| 5551 | |
| 5552 if ($gzip){ | |
| 5553 $chh_ctob .= '.gz'; | |
| 5554 open ($fhs{2}->{CHH},"| gzip -c - > $chh_ctob") or die "Failed to write to $chh_ctob $!\n" unless($mbias_only); | |
| 5555 } | |
| 5556 else{ | |
| 5557 open ($fhs{2}->{CHH},"| cat > $chh_ctob") or die "Failed to write to $chh_ctob $!\n" unless($mbias_only); | |
| 5558 # open ($fhs{2}->{CHH},'>',$chh_ctob) or die "Failed to write to $chh_ctob $!\n" unless($mbias_only); | |
| 5559 } | |
| 5560 | |
| 5561 warn "Writing result file containing methylation information for C in CHH context from the complementary to original bottom strand to $chh_ctob\n" unless($mbias_only); | |
| 5562 push @sorting_files,$chh_ctob; | |
| 5563 | |
| 5564 unless($no_header){ | |
| 5565 print {$fhs{2}->{CHH}} "Bismark methylation extractor version $version\n" unless($mbias_only); | |
| 5566 } | |
| 5567 | |
| 5568 $chh_ob =~ s/^/CHH_OB_/; | |
| 5569 $chh_ob =~ s/sam$/txt/; | |
| 5570 $chh_ob =~ s/bam$/txt/; | |
| 5571 $chh_ob =~ s/cram$/txt/; | |
| 5572 $chh_ob =~ s/$/.txt/ unless ($chh_ob =~ /\.txt$/); | |
| 5573 $chh_ob = $output_dir . $chh_ob; | |
| 5574 | |
| 5575 if ($gzip){ | |
| 5576 $chh_ob .= '.gz'; | |
| 5577 open ($fhs{3}->{CHH},"| gzip -c - > $chh_ob") or die "Failed to write to $chh_ob $!\n" unless($mbias_only); | |
| 5578 } | |
| 5579 else{ | |
| 5580 open ($fhs{3}->{CHH},"| cat > $chh_ob") or die "Failed to write to $chh_ob $!\n" unless($mbias_only); | |
| 5581 # open ($fhs{3}->{CHH},'>',$chh_ob) or die "Failed to write to $chh_ob $!\n" unless($mbias_only); | |
| 5582 } | |
| 5583 | |
| 5584 warn "Writing result file containing methylation information for C in CHH context from the original bottom strand to $chh_ob\n\n" unless($mbias_only); | |
| 5585 push @sorting_files,$chh_ob; | |
| 5586 | |
| 5587 unless($no_header){ | |
| 5588 print {$fhs{3}->{CHH}} "Bismark methylation extractor version $version\n" unless($mbias_only); | |
| 5589 } | |
| 5590 } | |
| 5591 return $report_filename; | |
| 5592 } | |
| 5593 | |
| 5594 sub isBam{ | |
| 5595 | |
| 5596 my $filename = shift; | |
| 5597 | |
| 5598 # reading the first line of the input file to see if it is a BAM file in disguise (i.e. a BAM file that does not end in *.bam which may be produced by Galaxy) | |
| 5599 open (DISGUISE,"gunzip -c $filename |") or die "Failed to open filehandle DISGUISE for $filename\n\n"; | |
| 5600 | |
| 5601 ### when BAM files read through a gunzip -c stream they start with BAM... | |
| 5602 my $bam_in_disguise = <DISGUISE>; | |
| 5603 # warn "BAM in disguise: $bam_in_disguise\n\n"; | |
| 5604 | |
| 5605 if ($bam_in_disguise){ | |
| 5606 if ($bam_in_disguise =~ /^BAM/){ | |
| 5607 close (DISGUISE) or warn "Had trouble closing filehandle BAM in disguise: $!\n"; | |
| 5608 return 1; | |
| 5609 } | |
| 5610 else{ | |
| 5611 close (DISGUISE) or warn "Had trouble closing filehandle BAM in disguise: $!\n"; | |
| 5612 return 0; | |
| 5613 } | |
| 5614 } | |
| 5615 else{ | |
| 5616 close (DISGUISE) or warn "Had trouble closing filehandle BAM in disguise: $!\n"; | |
| 5617 return 0; | |
| 5618 } | |
| 5619 } | |
| 5620 | |
| 5621 | |
| 5622 sub print_helpfile{ | |
| 5623 | |
| 5624 print << 'HOW_TO'; | |
| 5625 | |
| 5626 | |
| 5627 DESCRIPTION | |
| 5628 | |
| 5629 The following is a brief description of all options to control the Bismark | |
| 5630 methylation extractor. The script reads in a bisulfite read alignment results file | |
| 5631 produced by the Bismark bisulfite mapper (in BAM/CRAM/SAM format) and extracts the | |
| 5632 methylation information for individual cytosines. This information is found in the | |
| 5633 methylation call field which can contain the following characters: | |
| 5634 | |
| 5635 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ | |
| 5636 ~~~ X for methylated C in CHG context ~~~ | |
| 5637 ~~~ x for not methylated C CHG ~~~ | |
| 5638 ~~~ H for methylated C in CHH context ~~~ | |
| 5639 ~~~ h for not methylated C in CHH context ~~~ | |
| 5640 ~~~ Z for methylated C in CpG context ~~~ | |
| 5641 ~~~ z for not methylated C in CpG context ~~~ | |
| 5642 ~~~ U for methylated C in Unknown context (CN or CHN ~~~ | |
| 5643 ~~~ u for not methylated C in Unknown context (CN or CHN) ~~~ | |
| 5644 ~~~ . for any bases not involving cytosines ~~~ | |
| 5645 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ | |
| 5646 | |
| 5647 The methylation extractor outputs result files for cytosines in CpG, CHG and CHH | |
| 5648 context (this distinction is actually already made in Bismark itself). As the methylation | |
| 5649 information for every C analysed can produce files which easily have tens or even hundreds of | |
| 5650 millions of lines, file sizes can become very large and more difficult to handle. The C | |
| 5651 methylation info additionally splits cytosine methylation calls up into one of the four possible | |
| 5652 strands a given bisulfite read aligned against: | |
| 5653 | |
| 5654 OT original top strand | |
| 5655 CTOT complementary to original top strand | |
| 5656 | |
| 5657 OB original bottom strand | |
| 5658 CTOB complementary to original bottom strand | |
| 5659 | |
| 5660 Thus, by default twelve individual output files are being generated per input file (unless | |
| 5661 --comprehensive is specified, see below). The output files can be imported into a genome | |
| 5662 viewer, such as SeqMonk, and re-combined into a single data group if desired (in fact | |
| 5663 unless the bisulfite reads were generated preserving directionality it doesn't make any | |
| 5664 sense to look at the data in a strand-specific manner). Strand-specific output files can | |
| 5665 optionally be skipped, in which case only three output files for CpG, CHG or CHH context | |
| 5666 will be generated. For both the strand-specific and comprehensive outputs there is also | |
| 5667 the option to merge both non-CpG contexts (CHG and CHH) into one single non-CpG context. | |
| 5668 | |
| 5669 | |
| 5670 The output files are in the following format (tab delimited): | |
| 5671 | |
| 5672 <sequence_id> <strand> <chromosome> <position> <methylation call> | |
| 5673 | |
| 5674 | |
| 5675 USAGE: bismark_methylation_extractor [options] <filenames> | |
| 5676 | |
| 5677 | |
| 5678 ARGUMENTS: | |
| 5679 ========== | |
| 5680 | |
| 5681 <filenames> A space-separated list of Bismark result files in SAM format from | |
| 5682 which methylation information is extracted for every cytosine in | |
| 5683 the reads. For alignment files in the older custom Bismark output | |
| 5684 see option '--vanilla'. | |
| 5685 | |
| 5686 OPTIONS: | |
| 5687 | |
| 5688 -s/--single-end Input file(s) are Bismark result file(s) generated from single-end | |
| 5689 read data. If neither -s nor -p is set the type of experiment will | |
| 5690 be determined automatically. | |
| 5691 | |
| 5692 -p/--paired-end Input file(s) are Bismark result file(s) generated from paired-end | |
| 5693 read data. If neither -s nor -p is set the type of experiment will | |
| 5694 be determined automatically. | |
| 5695 | |
| 5696 --vanilla The Bismark result input file(s) are in the old custom Bismark format | |
| 5697 (up to version 0.5.x) and not in SAM format which is the default as | |
| 5698 of Bismark version 0.6.x or higher. Default: OFF. | |
| 5699 | |
| 5700 --no_overlap For paired-end reads it is theoretically possible that read_1 and | |
| 5701 read_2 overlap. This option avoids scoring overlapping methylation | |
| 5702 calls twice (only methylation calls of read 1 are used for in the process | |
| 5703 since read 1 has historically higher quality basecalls than read 2). | |
| 5704 Whilst this option removes a bias towards more methylation calls | |
| 5705 in the center of sequenced fragments it may de facto remove a sizable | |
| 5706 proportion of the data. This option is on by default for paired-end data | |
| 5707 but can be disabled using --include_overlap. Default: ON. | |
| 5708 | |
| 5709 --include_overlap For paired-end data all methylation calls will be extracted irrespective of | |
| 5710 of whether they overlap or not. Default: OFF. | |
| 5711 | |
| 5712 --ignore <int> Ignore the first <int> bp from the 5' end of Read 1 (or single-end alignment | |
| 5713 files) when processing the methylation call string. This can remove e.g. a | |
| 5714 restriction enzyme site at the start of each read or any other source of | |
| 5715 bias (such as PBAT-Seq data). | |
| 5716 | |
| 5717 --ignore_r2 <int> Ignore the first <int> bp from the 5' end of Read 2 of paired-end sequencing | |
| 5718 results only. Since the first couple of bases in Read 2 of BS-Seq experiments | |
| 5719 show a severe bias towards non-methylation as a result of end-repairing | |
| 5720 sonicated fragments with unmethylated cytosines (see M-bias plot), it is | |
| 5721 recommended that the first couple of bp of Read 2 are removed before | |
| 5722 starting downstream analysis. Please see the section on M-bias plots in the | |
| 5723 Bismark User Guide for more details. | |
| 5724 | |
| 5725 --ignore_3prime <int> Ignore the last <int> bp from the 3' end of Read 1 (or single-end alignment | |
| 5726 files) when processing the methylation call string. This can remove unwanted | |
| 5727 biases from the end of reads. | |
| 5728 | |
| 5729 --ignore_3prime_r2 <int> Ignore the last <int> bp from the 3' end of Read 2 of paired-end sequencing | |
| 5730 results only. This can remove unwanted biases from the end of reads. | |
| 5731 | |
| 5732 --comprehensive Specifying this option will merge all four possible strand-specific | |
| 5733 methylation info into context-dependent output files. The default | |
| 5734 | |
| 5735 contexts are: | |
| 5736 - CpG context | |
| 5737 - CHG context | |
| 5738 - CHH context | |
| 5739 | |
| 5740 --merge_non_CpG This will produce two output files (in --comprehensive mode) or eight | |
| 5741 strand-specific output files (default) for Cs in | |
| 5742 - CpG context | |
| 5743 - non-CpG context | |
| 5744 | |
| 5745 --report Prints out a short methylation summary as well as the paramaters used to run | |
| 5746 this script. Default: ON. | |
| 5747 | |
| 5748 --no_header Suppresses the Bismark version header line in all output files for more convenient | |
| 5749 batch processing. | |
| 5750 | |
| 5751 -o/--output DIR Allows specification of a different output directory (absolute or relative | |
| 5752 path). If not specified explicitly, the output will be written to the current directory. | |
| 5753 | |
| 5754 --samtools_path The path to your Samtools installation, e.g. /home/user/samtools/. Does not need to be specified | |
| 5755 explicitly if Samtools is in the PATH already. | |
| 5756 | |
| 5757 --gzip The methylation extractor files (CpG_OT_..., CpG_OB_... etc) will be written out in | |
| 5758 a GZIP compressed form to save disk space. This option is also passed on to the genome-wide | |
| 5759 cytosine report. BedGraph and coverage files will be written out as .gz by default. | |
| 5760 | |
| 5761 --version Displays version information. | |
| 5762 | |
| 5763 -h/--help Displays this help file and exits. | |
| 5764 | |
| 5765 --mbias_only The methylation extractor will read the entire file but only output the M-bias table and plots as | |
| 5766 well as a report (optional) and then quit. Default: OFF. | |
| 5767 | |
| 5768 --mbias_off The methylation extractor will process the entire file as usual but doesn't write out any M-bias report. | |
| 5769 Only recommended for users who deliberately want to keep an earlier version of the M-bias report. | |
| 5770 Default: OFF. | |
| 5771 | |
| 5772 --multicore <int> Sets the number of cores to be used for the methylation extraction process. If system resources | |
| 5773 are plentiful this is a viable option to speed up the extraction process (we observed a near linear | |
| 5774 speed increase for up to 10 cores used). Please note that a typical process of extracting a BAM file | |
| 5775 and writing out '.gz' output streams will in fact use ~3 cores per value of --multicore <int> | |
| 5776 specified (1 for the methylation extractor itself, 1 for a Samtools stream, 1 for GZIP stream), so | |
| 5777 --multicore 10 is likely to use around 30 cores of system resources. This option has no bearing | |
| 5778 on the bismark2bedGraph or genome-wide cytosine report processes. | |
| 5779 | |
| 5780 | |
| 5781 | |
| 5782 | |
| 5783 bedGraph specific options: | |
| 5784 ========================== | |
| 5785 | |
| 5786 --bedGraph After finishing the methylation extraction, the methylation output is written into a | |
| 5787 sorted bedGraph file that reports the position of a given cytosine and its methylation | |
| 5788 state (in %, see details below). The methylation extractor output is temporarily split up into | |
| 5789 temporary files, one per chromosome (written into the current directory or folder | |
| 5790 specified with -o/--output); these temp files are then used for sorting and deleted | |
| 5791 afterwards. By default, only cytosines in CpG context will be sorted. The option | |
| 5792 '--CX_context' may be used to report all cytosines irrespective of sequence context | |
| 5793 (this will take MUCH longer!). The default folder for temporary files during the sorting | |
| 5794 process is the output directory. The bedGraph conversion step is performed by the external | |
| 5795 module 'bismark2bedGraph'; this script needs to reside in the same folder as the | |
| 5796 bismark_methylation_extractor itself. | |
| 5797 | |
| 5798 --zero_based Write out an additional coverage file (ending in .zero.cov) that uses 0-based genomic start | |
| 5799 and 1-based genomic end coordinates (zero-based, half-open), like used in the bedGraph file, | |
| 5800 instead of using 1-based coordinates throughout. Default: OFF. | |
| 5801 | |
| 5802 | |
| 5803 --cutoff [threshold] The minimum number of times any methylation state (methylated or unmethylated) has to be seen | |
| 5804 for a nucleotide before its methylation percentage is reported. Default: 1. | |
| 5805 | |
| 5806 --remove_spaces Replaces whitespaces in the sequence ID field with underscores to allow sorting. | |
| 5807 | |
| 5808 --CX/--CX_context The sorted bedGraph output file contains information on every single cytosine that was covered | |
| 5809 in the experiment irrespective of its sequence context. This applies to both forward and | |
| 5810 reverse strands. Please be aware that this option may generate large temporary and output files | |
| 5811 and may take a long time to sort (up to many hours). Default: OFF. | |
| 5812 (i.e. Default = CpG context only). | |
| 5813 | |
| 5814 --buffer_size <string> This allows you to specify the main memory sort buffer when sorting the methylation information. | |
| 5815 Either specify a percentage of physical memory by appending % (e.g. --buffer_size 50%) or | |
| 5816 a multiple of 1024 bytes, e.g. 'K' multiplies by 1024, 'M' by 1048576 and so on for 'T' etc. | |
| 5817 (e.g. --buffer_size 20G). For more information on sort type 'info sort' on a command line. | |
| 5818 Defaults to 2G. | |
| 5819 | |
| 5820 --scaffolds/--gazillion Users working with unfinished genomes sporting tens or even hundreds of thousands of | |
| 5821 scaffolds/contigs/chromosomes frequently encountered errors with pre-sorting reads to | |
| 5822 individual chromosome files. These errors were caused by the operating system's limit | |
| 5823 of the number of filehandle that can be written to at any one time (typically 1024; to | |
| 5824 find out this limit on Linux, type: ulimit -a). | |
| 5825 To bypass the limitation of open filehandles, the option --scaffolds does not pre-sort | |
| 5826 methylation calls into individual chromosome files. Instead, all input files are | |
| 5827 temporarily merged into a single file (unless there is only a single file), and this | |
| 5828 file will then be sorted by both chromosome AND position using the Unix sort command. | |
| 5829 Please be aware that this option might take a looooong time to complete, depending on | |
| 5830 the size of the input files, and the memory you allocate to this process (see --buffer_size). | |
| 5831 Nevertheless, it seems to be working. | |
| 5832 | |
| 5833 --ample_memory Using this option will not sort chromosomal positions using the UNIX 'sort' command, but will | |
| 5834 instead use two arrays to sort methylated and unmethylated calls. This may result in a faster | |
| 5835 sorting process of very large files, but this comes at the cost of a larger memory footprint | |
| 5836 (two arrays of the length of the largest human chromosome 1 (~250M bp) consume around 16GB | |
| 5837 of RAM). Due to overheads in creating and looping through these arrays it seems that it will | |
| 5838 actually be *slower* for small files (few million alignments), and we are currently testing at | |
| 5839 which point it is advisable to use this option. Note that --ample_memory is not compatible | |
| 5840 with options '--scaffolds/--gazillion' (as it requires pre-sorted files to begin with). | |
| 5841 | |
| 5842 | |
| 5843 | |
| 5844 Genome-wide cytosine methylation report specific options: | |
| 5845 ========================================================= | |
| 5846 | |
| 5847 --cytosine_report After the conversion to bedGraph has completed, the option '--cytosine_report' produces a | |
| 5848 genome-wide methylation report for all cytosines in the genome. By default, the output uses 1-based | |
| 5849 chromosome coordinates (zero-based start coords are optional) and reports CpG context only (all | |
| 5850 cytosine context is optional). The output considers all Cs on both forward and reverse strands and | |
| 5851 reports their position, strand, trinucleotide content and methylation state (counts are 0 if not | |
| 5852 covered). The cytosine report conversion step is performed by the external module | |
| 5853 'coverage2cytosine'; this script needs to reside in the same folder as the bismark_methylation_extractor | |
| 5854 itself. | |
| 5855 | |
| 5856 --CX/--CX_context The output file contains information on every single cytosine in the genome irrespective of | |
| 5857 its context. This applies to both forward and reverse strands. Please be aware that this will | |
| 5858 generate output files with > 1.1 billion lines for a mammalian genome such as human or mouse. | |
| 5859 Default: OFF (i.e. Default = CpG context only). | |
| 5860 | |
| 5861 --zero_based Uses 0-based genomic coordinates instead of 1-based coordinates. Default: OFF. | |
| 5862 | |
| 5863 --genome_folder <path> Enter the genome folder you wish to use to extract sequences from (full path only). Accepted | |
| 5864 formats are FastA files ending with '.fa' or '.fasta'. Specifying a genome folder path is mandatory. | |
| 5865 | |
| 5866 --split_by_chromosome Writes the output into individual files for each chromosome instead of a single output file. Files | |
| 5867 will be named to include the input filename and the chromosome number. | |
| 5868 | |
| 5869 | |
| 5870 | |
| 5871 OUTPUT: | |
| 5872 | |
| 5873 The bismark_methylation_extractor output is in the form: | |
| 5874 ======================================================== | |
| 5875 <seq-ID> <methylation state*> <chromosome> <start position (= end position)> <methylation call> | |
| 5876 | |
| 5877 * Methylated cytosines receive a '+' orientation, | |
| 5878 * Unmethylated cytosines receive a '-' orientation. | |
| 5879 | |
| 5880 | |
| 5881 | |
| 5882 The bedGraph output (optional) looks like this (tab-delimited; 0-based start coords, 1-based end coords): | |
| 5883 ========================================================================================================= | |
| 5884 | |
| 5885 track type=bedGraph (header line) | |
| 5886 | |
| 5887 <chromosome> <start position> <end position> <methylation percentage> | |
| 5888 | |
| 5889 | |
| 5890 | |
| 5891 The coverage output looks like this (tab-delimited, 1-based genomic coords; zero-based half-open coordinates available with '--zero_based'): | |
| 5892 ============================================================================================================================================ | |
| 5893 | |
| 5894 <chromosome> <start position> <end position> <methylation percentage> <count methylated> <count non-methylated> | |
| 5895 | |
| 5896 | |
| 5897 | |
| 5898 The genome-wide cytosine methylation output file is tab-delimited in the following format: | |
| 5899 ========================================================================================== | |
| 5900 <chromosome> <position> <strand> <count methylated> <count non-methylated> <C-context> <trinucleotide context> | |
| 5901 | |
| 5902 | |
| 5903 | |
| 5904 This script was last modified on 25 February 2016. | |
| 5905 | |
| 5906 HOW_TO | |
| 5907 } |