Mercurial > repos > bgruening > bismark
view bismark_methylation_extractor @ 5:b100248c35b8 draft
Uploaded
author | bgruening |
---|---|
date | Mon, 09 Feb 2015 18:27:40 -0500 |
parents | 91f07ff056ca |
children |
line wrap: on
line source
#!/usr/bin/perl use warnings; use strict; $|++; use Getopt::Long; use Cwd; use Carp; use FindBin qw($Bin); use lib "$Bin/../lib"; ## This program is Copyright (C) 2010-13, Felix Krueger (felix.krueger@babraham.ac.uk) ## This program is free software: you can redistribute it and/or modify ## it under the terms of the GNU General Public License as published by ## the Free Software Foundation, either version 3 of the License, or ## (at your option) any later version. ## This program is distributed in the hope that it will be useful, ## but WITHOUT ANY WARRANTY; without even the implied warranty of ## MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the ## GNU General Public License for more details. ## You should have received a copy of the GNU General Public License ## along with this program. If not, see <http://www.gnu.org/licenses/>. my @filenames; # input files my %counting; my $parent_dir = getcwd(); my %fhs; my $version = 'v0.10.1'; my ($ignore,$genomic_fasta,$single,$paired,$full,$report,$no_overlap,$merge_non_CpG,$vanilla,$output_dir,$no_header,$bedGraph,$remove,$coverage_threshold,$counts,$cytosine_report,$genome_folder,$zero,$CpG_only,$CX_context,$split_by_chromosome,$sort_size,$samtools_path,$gzip,$ignore_r2,$mbias_only,$gazillion,$ample_mem) = process_commandline(); ### only needed for bedGraph output my @sorting_files; # if files are to be written to bedGraph format, these are the methylation extractor output files my @methylcalls = qw (0 0 0); # [0] = methylated, [1] = unmethylated, [2] = total my @bedfiles; ### only needed for genome-wide cytosine methylation report my %chromosomes; my %mbias_1; my %mbias_2; ############################################################################################## ### Summarising Run Parameters ############################################################################################## ### METHYLATION EXTRACTOR warn "Summarising Bismark methylation extractor parameters:\n"; warn '='x63,"\n"; if ($single){ if ($vanilla){ warn "Bismark single-end vanilla format specified\n"; } else{ warn "Bismark single-end SAM format specified (default)\n"; # default } } elsif ($paired){ if ($vanilla){ warn "Bismark paired-end vanilla format specified\n"; } else{ warn "Bismark paired-end SAM format specified (default)\n"; # default } } if ($single){ if ($ignore){ warn "First $ignore bp will be disregarded when processing the methylation call string\n"; } } else{ ## paired-end if ($ignore){ warn "First $ignore bp will be disregarded when processing the methylation call string of Read 1\n"; } if ($ignore_r2){ warn "First $ignore_r2 bp will be disregarded when processing the methylation call string of Read 2\n"; } } if ($full){ warn "Strand-specific outputs will be skipped. Separate output files for cytosines in CpG, CHG and CHH context will be generated\n"; } if ($merge_non_CpG){ warn "Merge CHG and CHH context to non-CpG context specified\n"; } ### output directory if ($output_dir eq ''){ warn "Output will be written to the current directory ('$parent_dir')\n"; } else{ warn "Output path specified as: $output_dir\n"; } sleep (1); ### BEDGRAPH if ($bedGraph){ warn "\n\nSummarising bedGraph parameters:\n"; warn '='x63,"\n"; if ($counts){ warn "Generating additional output in bedGraph and coverage format\nbedGraph format:\t<Chromosome> <Start Position> <End Position> <Methylation Percentage>\ncoverage format:\t<Chromosome> <Start Position> <End Position> <Methylation Percentage> <count methylated> <count non-methylated>\n\n"; } else{ warn "Generating additional sorted output in bedGraph format (output format: <Chromosome> <Start Position> <End Position> <Methylation Percentage>)\n"; } warn "Using a cutoff of $coverage_threshold read(s) to report cytosine positions\n"; if ($CX_context){ warn "Reporting and sorting methylation information for all cytosine context (sorting may take a long time, you have been warned ...)\n"; } else{ # default $CpG_only = 1; warn "Reporting and sorting cytosine methylation information in CpG context only (default)\n"; } if ($remove){ warn "White spaces in read ID names will be removed prior to sorting\n"; } if ($ample_mem){ warn "Sorting chromosomal postions for the bedGraph step using arrays instead of using UNIX sort\n"; } elsif (defined $sort_size){ warn "The bedGraph UNIX sort command will use the following memory setting:\t'$sort_size'. Temporary directory used for sorting is the output directory\n"; } else{ warn "Setting a default memory usage for the bedGraph UNIX sort command to 2GB\n"; } sleep (1); if ($cytosine_report){ warn "\n\nSummarising genome-wide cytosine methylation report parameters:\n"; warn '='x63,"\n"; warn "Generating comprehensive genome-wide cytosine report\n(output format: <Chromosome> <Position> <Strand> <count methylated> <count non-methylated> <C-context> <trinucleotide context> )\n"; if ($CX_context){ warn "Reporting methylation for all cytosine contexts. Be aware that this will generate enormous files\n"; } else{ # default $CpG_only = 1; warn "Reporting cytosine methylation in CpG context only (default)\n"; } if ($split_by_chromosome){ warn "Splitting the cytosine report output up into individual files for each chromosome\n"; } ### Zero-based coordinates if ($zero){ warn "Using zero-based genomic coordinates (user-defined)\n"; } else{ # default, 1-based coords warn "Using 1-based genomic coordinates (default)\n"; } ### GENOME folder if ($genome_folder){ unless ($genome_folder =~/\/$/){ $genome_folder =~ s/$/\//; } warn "Genome folder was specified as $genome_folder\n"; } else{ $genome_folder = '/data/public/Genomes/Mouse/NCBIM37/'; warn "Using the default genome folder /data/public/Genomes/Mouse/NCBIM37/\n"; } sleep (1); } } warn "\n"; sleep (5); ###################################################### ### PROCESSING FILES ###################################################### foreach my $filename (@filenames){ # resetting counters and filehandles %fhs = (); %counting =( total_meCHG_count => 0, total_meCHH_count => 0, total_meCpG_count => 0, total_unmethylated_CHG_count => 0, total_unmethylated_CHH_count => 0, total_unmethylated_CpG_count => 0, sequences_count => 0, ); @sorting_files = (); @bedfiles = (); %mbias_1 = (); %mbias_2 = (); ### performing a quick check to see if a paired-end SAM file has been sorted by positions which does interfere with the logic used by the extractor unless ($vanilla){ if ($paired){ test_positional_sorting($filename); } } process_Bismark_results_file($filename); ### Closing all filehandles so that the Bismark methylation extractor output doesn't get truncated due to buffering issues foreach my $fh (keys %fhs) { if ($fh =~ /^[1230]$/) { foreach my $context (keys %{$fhs{$fh}}) { close $fhs{$fh}->{$context} or die $!; } } else{ close $fhs{$fh} or die $!; } } ### printing out all M-Bias data produce_mbias_plots ($filename); delete_unused_files(); if ($bedGraph){ my $out = (split (/\//,$filename))[-1]; # extracting the filename if a full path was specified $out =~ s/gz$//; $out =~ s/sam$//; $out =~ s/bam$//; $out =~ s/txt$//; $out =~ s/$/bedGraph/; my $bedGraph_output = $out; my @args; if ($remove){ push @args, '--remove'; } if ($CX_context){ push @args, '--CX_context'; } if ($no_header){ push @args, '--no_header'; } if ($gazillion){ push @args, '--gazillion'; } if ($ample_mem){ push @args, '--ample_memory'; } # if ($counts){ # push @args, "--counts"; # } push @args, "--buffer_size $sort_size"; push @args, "--cutoff $coverage_threshold"; push @args, "--output $bedGraph_output"; push @args, "--dir '$output_dir'"; ### adding all files to be sorted to @args foreach my $f (@sorting_files){ push @args, $f; } # print join "\t",@args,"\n"; system ("$Bin/bismark2bedGraph @args"); warn "Finished BedGraph conversion ...\n\n"; sleep(3); # open (OUT,'>',$output_dir.$bedGraph_output) or die "Problems with the bedGraph output filename detected: file path: '$output_dir'\tfile name: '$bedGraph_output' $!"; # warn "Writing bedGraph to file: $bedGraph_output\n"; # process_bedGraph_output(); # close OUT or die $!; ### genome-wide cytosine methylation report requires bedGraph processing anyway if ($cytosine_report){ @args = (); # resetting @args my $cytosine_out = $out; $cytosine_out =~ s/bedGraph$//; if ($CX_context){ $cytosine_out =~ s/$/CX_report.txt/; } else{ $cytosine_out =~ s/$/CpG_report.txt/; } push @args, "--output $cytosine_out"; push @args, "--dir '$output_dir'"; push @args, "--genome '$genome_folder'"; push @args, "--parent_dir '$parent_dir'"; if ($zero){ push @args, "--zero"; } if ($CX_context){ push @args, '--CX_context'; } if ($split_by_chromosome){ push @args, '--split_by_chromosome'; } my $coverage_output = $bedGraph_output; $coverage_output =~ s/bedGraph$/bismark.cov/; push @args, $output_dir . $coverage_output; # this will be the infile system ("$Bin/coverage2cytosine @args"); # generate_genome_wide_cytosine_report($bedGraph_output,$cytosine_out); warn "\n\nFinished generating genome-wide cytosine report\n\n"; } } } sub delete_unused_files{ warn "Deleting unused files ...\n\n"; sleep(1); my $index = 0; while ($index <= $#sorting_files){ if ($sorting_files[$index] =~ /gz$/){ open (USED,"zcat $sorting_files[$index] |") or die "Failed to read from methylation extractor output file $sorting_files[$index]: $!\n"; } else{ open (USED,$sorting_files[$index]) or die "Failed to read from methylation extractor output file $sorting_files[$index]: $!\n"; } my $used = 0; while (<USED>){ next if (/^Bismark/); if ($_){ $used = 1; last; } } if ($used){ warn "$sorting_files[$index] contains data ->\tkept\n"; ++$index; } else{ my $delete = unlink $sorting_files[$index]; if ($delete){ warn "$sorting_files[$index] was empty ->\tdeleted\n"; } else{ warn "$sorting_files[$index] was empty, however deletion was unsuccessful: $!\n" } ### we also need to remove the element from @sorting_files splice @sorting_files, $index, 1; } } warn "\n\n"; ## can't close the piped filehandles at this point because it will die (unfortunately) } sub produce_mbias_plots{ my $filename = shift; my $mbias = (split (/\//,$filename))[-1]; # extracting the filename if a full path was specified $mbias =~ s/gz$//; $mbias =~ s/sam$//; $mbias =~ s/bam$//; $mbias =~ s/txt$//; my $mbias_graph_1 = my $mbias_graph_2 = $mbias; $mbias_graph_1 = $output_dir . $mbias_graph_1 . 'M-bias_R1.png'; $mbias_graph_2 = $output_dir . $mbias_graph_2 . 'M-bias_R2.png'; $mbias =~ s/$/M-bias.txt/; open (MBIAS,'>',"$output_dir$mbias") or die "Failed to open file for the M-bias data\n\n"; # determining maximum read length my $max_length_1 = 0; my $max_length_2 = 0; foreach my $context (keys %mbias_1){ foreach my $pos (sort {$a<=>$b} keys %{$mbias_1{$context}}){ $max_length_1 = $pos unless ($max_length_1 >= $pos); } } if ($paired){ foreach my $context (keys %mbias_2){ foreach my $pos (sort {$a<=>$b} keys %{$mbias_2{$context}}){ $max_length_2 = $pos unless ($max_length_2 >= $pos); } } } if ($single){ warn "Determining maximum read length for M-Bias plot\n"; warn "Maximum read length of Read 1: $max_length_1\n\n"; } else{ warn "Determining maximum read lengths for M-Bias plots\n"; warn "Maximum read length of Read 1: $max_length_1\n"; warn "Maximum read length of Read 2: $max_length_2\n\n"; } # sleep(3); my @mbias_read1; my @mbias_read2; #Check whether the module GD::Graph:lines is installed my $gd_graph_installed = 0; eval{ require GD::Graph::lines; GD::Graph::lines->import(); }; unless($@) { # syntax or routine error variable, set if something goes wron in the last eval{ require ...} $gd_graph_installed = 1; #Check whether the module GD::Graph::colour is installed eval{ require GD::Graph::colour; GD::Graph::colour->import(qw(:colours :lists :files :convert)); }; if ($@) { warn "Perl module GD::Graph::colour not found, skipping drawing M-bias plots (only writing out M-bias plot table)\n"; sleep(2); $gd_graph_installed = 0; } } else{ warn "Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table)\n"; sleep(2); } my $graph_title; my $graph1; my $graph2; if ( $gd_graph_installed){ $graph1 = GD::Graph::lines->new(800,600); if ($paired){ $graph2 = GD::Graph::lines->new(800,600); } } foreach my $context (qw(CpG CHG CHH)){ @{$mbias_read1[0]} = (); if ($paired){ print MBIAS "$context context (R1)\n================\n"; $graph_title = 'M-bias (Read 1)'; } else{ print MBIAS "$context context\n===========\n"; $graph_title = 'M-bias'; } print MBIAS "position\tcount methylated\tcount unmethylated\t% methylation\tcoverage\n"; foreach my $pos (1..$max_length_1){ unless (defined $mbias_1{$context}->{$pos}->{meth}){ $mbias_1{$context}->{$pos}->{meth} = 0; } unless (defined $mbias_1{$context}->{$pos}->{un}){ $mbias_1{$context}->{$pos}->{un} = 0; } my $percent = ''; if (($mbias_1{$context}->{$pos}->{meth} + $mbias_1{$context}->{$pos}->{un}) > 0){ $percent = sprintf("%.2f",$mbias_1{$context}->{$pos}->{meth} * 100/ ( $mbias_1{$context}->{$pos}->{meth} + $mbias_1{$context}->{$pos}->{un}) ); } my $coverage = $mbias_1{$context}->{$pos}->{un} + $mbias_1{$context}->{$pos}->{meth}; print MBIAS "$pos\t$mbias_1{$context}->{$pos}->{meth}\t$mbias_1{$context}->{$pos}->{un}\t$percent\t$coverage\n"; push @{$mbias_read1[0]},$pos; if ($context eq 'CpG'){ push @{$mbias_read1[1]},$percent; push @{$mbias_read1[4]},$coverage; } elsif ($context eq 'CHG'){ push @{$mbias_read1[2]},$percent; push @{$mbias_read1[5]},$coverage; } elsif ($context eq 'CHH'){ push @{$mbias_read1[3]},$percent; push @{$mbias_read1[6]},$coverage; } } print MBIAS "\n"; } if ( $gd_graph_installed){ add_colour(nice_blue => [31,120,180]); add_colour(nice_orange => [255,127,0]); add_colour(nice_green => [51,160,44]); add_colour(pale_blue => [153,206,227]); add_colour(pale_orange => [253,204,138]); add_colour(pale_green => [191,230,207]); $graph1->set( x_label => 'position (bp)', y1_label => '% methylation', y2_label => '# methylation calls', title => $graph_title, line_width => 2, x_max_value => $max_length_1, x_min_value => 0, y_tick_number => 10, y_label_skip => 2, y1_max_value => 100, y1_min_value => 0, y_label_skip => 2, y2_min_value => 0, x_label_skip => 5, x_label_position => 0.5, x_tick_offset => -1, bgclr => 'white', transparent => 0, two_axes => 1, use_axis => [1,1,1,2,2,2], legend_placement => 'RC', legend_spacing => 6, legend_marker_width => 24, legend_marker_height => 18, dclrs => [ qw(nice_blue nice_orange nice_green pale_blue pale_orange pale_green)], ) or die $graph1->error; $graph1->set_legend('CpG methylation','CHG methylation','CHH methylation','CpG total calls','CHG total calls','CHH total calls'); my $gd1 = $graph1->plot(\@mbias_read1) or die $graph1->error; open (MBIAS_G1,'>',$mbias_graph_1) or die "Failed to write to file for M-bias plot 1: $!\n\n"; binmode MBIAS_G1; print MBIAS_G1 $gd1->png; } if ($paired){ foreach my $context (qw(CpG CHG CHH)){ @{$mbias_read2[0]} = (); print MBIAS "$context context (R2)\n================\n"; print MBIAS "position\tcount methylated\tcount unmethylated\t% methylation\tcoverage\n"; foreach my $pos (1..$max_length_2){ unless (defined $mbias_2{$context}->{$pos}->{meth}){ $mbias_2{$context}->{$pos}->{meth} = 0; } unless (defined $mbias_2{$context}->{$pos}->{un}){ $mbias_2{$context}->{$pos}->{un} = 0; } my $percent = ''; if (($mbias_2{$context}->{$pos}->{meth} + $mbias_2{$context}->{$pos}->{un}) > 0){ $percent = sprintf("%.2f",$mbias_2{$context}->{$pos}->{meth} * 100/ ($mbias_2{$context}->{$pos}->{meth} + $mbias_2{$context}->{$pos}->{un}) ); } my $coverage = $mbias_2{$context}->{$pos}->{un} + $mbias_2{$context}->{$pos}->{meth}; print MBIAS "$pos\t$mbias_2{$context}->{$pos}->{meth}\t$mbias_2{$context}->{$pos}->{un}\t$percent\t$coverage\n"; push @{$mbias_read2[0]},$pos; if ($context eq 'CpG'){ push @{$mbias_read2[1]},$percent; push @{$mbias_read2[4]},$coverage; } elsif ($context eq 'CHG'){ push @{$mbias_read2[2]},$percent; push @{$mbias_read2[5]},$coverage; } elsif ($context eq 'CHH'){ push @{$mbias_read2[3]},$percent; push @{$mbias_read2[6]},$coverage; } } print MBIAS "\n"; } if ( $gd_graph_installed){ add_colour(nice_blue => [31,120,180]); add_colour(nice_orange => [255,127,0]); add_colour(nice_green => [51,160,44]); add_colour(pale_blue => [153,206,227]); add_colour(pale_orange => [253,204,138]); add_colour(pale_green => [191,230,207]); $graph2->set( x_label => 'position (bp)', line_width => 2, x_max_value => $max_length_1, x_min_value => 0, y_tick_number => 10, y_label_skip => 2, y1_max_value => 100, y1_min_value => 0, y_label_skip => 2, y2_min_value => 0, x_label_skip => 5, x_label_position => 0.5, x_tick_offset => -1, bgclr => 'white', transparent => 0, two_axes => 1, use_axis => [1,1,1,2,2,2], legend_placement => 'RC', legend_spacing => 6, legend_marker_width => 24, legend_marker_height => 18, dclrs => [ qw(nice_blue nice_orange nice_green pale_blue pale_orange pale_green)], x_label => 'position (bp)', y1_label => '% methylation', y2_label => '# calls', title => 'M-bias (Read 2)', ) or die $graph2->error; $graph2->set_legend('CpG methylation','CHG methylation','CHH methylation','CpG total calls','CHG total calls','CHH total calls'); my $gd2 = $graph2->plot(\@mbias_read2) or die $graph2->error; open (MBIAS_G2,'>',$mbias_graph_2) or die "Failed to write to file for M-bias plot 2: $!\n\n"; binmode MBIAS_G2; print MBIAS_G2 $gd2->png; } } } sub process_commandline{ my $help; my $single_end; my $paired_end; my $ignore; my $ignore_r2; my $genomic_fasta; my $full; my $report; my $extractor_version; my $no_overlap; my $merge_non_CpG; my $vanilla; my $output_dir; my $no_header; my $bedGraph; my $coverage_threshold = 1; # Minimum number of reads covering before calling methylation status my $remove; my $counts; my $cytosine_report; my $genome_folder; my $zero; my $CpG_only; my $CX_context; my $split_by_chromosome; my $sort_size; my $samtools_path; my $gzip; my $mbias_only; my $gazillion; my $ample_mem; my $command_line = GetOptions ('help|man' => \$help, 'p|paired-end' => \$paired_end, 's|single-end' => \$single_end, 'fasta' => \$genomic_fasta, 'ignore=i' => \$ignore, 'ignore_r2=i' => \$ignore_r2, 'comprehensive' => \$full, 'report' => \$report, 'version' => \$extractor_version, 'no_overlap' => \$no_overlap, 'merge_non_CpG' => \$merge_non_CpG, 'vanilla' => \$vanilla, 'o|output=s' => \$output_dir, 'no_header' => \$no_header, 'bedGraph' => \$bedGraph, "cutoff=i" => \$coverage_threshold, "remove_spaces" => \$remove, "counts" => \$counts, "cytosine_report" => \$cytosine_report, 'g|genome_folder=s' => \$genome_folder, "zero_based" => \$zero, "CX|CX_context" => \$CX_context, "split_by_chromosome" => \$split_by_chromosome, "buffer_size=s" => \$sort_size, 'samtools_path=s' => \$samtools_path, "gzip" => \$gzip, "mbias_only" => \$mbias_only, "gazillion|scaffolds" => \$gazillion, "ample_memory" => \$ample_mem, ); ### EXIT ON ERROR if there were errors with any of the supplied options unless ($command_line){ die "Please respecify command line options\n"; } ### HELPFILE if ($help){ print_helpfile(); exit; } if ($extractor_version){ print << "VERSION"; Bismark Methylation Extractor Bismark Extractor Version: $version Copyright 2010-13 Felix Krueger, Babraham Bioinformatics www.bioinformatics.babraham.ac.uk/projects/bismark/ VERSION exit; } ### no files provided unless (@ARGV){ die "You need to provide one or more Bismark files to create an individual C methylation output. Please respecify!\n"; } @filenames = @ARGV; warn "\n *** Bismark methylation extractor version $version ***\n\n"; ### M-BIAS ONLY if ($mbias_only){ if ($bedGraph){ die "Option '--mbias_only' skips all sorts of methylation extraction, including the bedGraph generation. Please respecify!\n"; } if ($cytosine_report){ die "Option '--mbias_only' skips all sorts of methylation extraction, including the genome-wide cytosine methylation report generation. Please respecify!\n"; } if ($merge_non_CpG){ warn "Option '--mbias_only' skips all sorts of methylation extraction, thus '--merge' won't have any effect\n"; } if ($full){ warn "Option '--mbias_only' skips all sorts of methylation extraction, thus '--comprehensive' won't have any effect\n"; } sleep(3); } ### PRINT A REPORT unless ($report){ $report = 0; } ### OUTPUT DIR PATH if ($output_dir){ unless ($output_dir =~ /\/$/){ $output_dir =~ s/$/\//; } } else{ $output_dir = ''; } ### NO HEADER unless ($no_header){ $no_header = 0; } ### OLD (VANILLA) OUTPUT FORMAT unless ($vanilla){ $vanilla = 0; } if ($single_end){ $paired_end = 0; ### SINGLE END ALIGNMENTS } elsif ($paired_end){ $single_end = 0; ### PAIRED-END ALIGNMENTS } else{ ### we will try to determine whether the input file was a single-end or paired-end sequencing run from the SAM header if ($vanilla){ die "Please specify whether the supplied file(s) are in Bismark single-end or paired-end format with '-s' or '-p'\n\n"; } else{ # SAM/BAM format my $file = $filenames[0]; warn "Trying to determine the type of mapping from the SAM header line of file $file\n"; sleep(1); ### if the user did not specify whether the alignment file was single-end or paired-end we are trying to get this information from the @PG header line in the SAM/BAM file if ($file =~ /\.gz$/){ open (DETERMINE,"zcat $file |") or die "Unable to read from gzipped file $file: $!\n"; } elsif ($file =~ /\.bam$/ || `file -b $file` =~ /^gzip/){ open (DETERMINE,"samtools view -h $file |") or die "Unable to read from BAM file $file: $!\n"; } else{ open (DETERMINE,$file) or die "Unable to read from $file: $!\n"; } while (<DETERMINE>){ last unless (/^\@/); if ($_ =~ /^\@PG/){ # warn "found the \@PG line:\n"; # warn "$_"; if ($_ =~ /-1/ and $_ =~ /-2/){ warn "Treating file(s) as paired-end data (as extracted from \@PG line)\n\n"; sleep(1); $paired_end = 1; $single_end = 0; } else{ warn "Treating file(s) as single-end data (as extracted from \@PG line)\n\n"; sleep(1); $paired_end = 0; $single_end = 1; } } } close DETERMINE or warn $!; } } ### IGNORING <INT> bases at the start of the read when processing the methylation call string unless ($ignore){ $ignore = 0; } if (defined $ignore_r2){ die "You can only specify --ignore_r2 for paired-end result files\n" unless ($paired_end); } else{ $ignore_r2 = 0; } ### NO OVERLAP if ($no_overlap){ die "The option '--no_overlap' can only be specified for paired-end input!\n" unless ($paired_end); } else{ $no_overlap = 0; } ### COMPREHENSIVE OUTPUT unless ($full){ $full = 0; } ### MERGE NON-CpG context unless ($merge_non_CpG){ $merge_non_CpG = 0; } ### remove white spaces in read ID (needed for sorting using the sort command unless ($remove){ $remove = 0; } ### COVERAGE THRESHOLD FOR bedGraph OUTPUT if (defined $coverage_threshold){ unless ($coverage_threshold > 0){ die "Please select a coverage greater than 0 (positive integers only)\n"; } } else{ $coverage_threshold = 1; } ### SORT buffer size if (defined $sort_size){ unless ($sort_size =~ /^\d+\%$/ or $sort_size =~ /^\d+(K|M|G|T)$/){ die "Please select a buffer size as percentage (e.g. --buffer_size 20%) or a number to be multiplied with K, M, G, T etc. (e.g. --buffer_size 20G). For more information on sort type 'info sort' on a command line\n"; } } else{ $sort_size = '2G'; } if ($zero){ die "Option '--zero' is only available if '--cytosine_report' is specified as well. Please respecify\n" unless ($cytosine_report); } if ($CX_context){ die "Option '--CX_context' is only available if '--cytosine_report' or '--bedGraph' is specified as well. Please respecify\n" unless ($cytosine_report or $bedGraph); } else{ $CX_context = 0; } unless ($counts){ $counts = 1; # counts will always be set } if ($cytosine_report){ ### GENOME folder if ($genome_folder){ unless ($genome_folder =~/\/$/){ $genome_folder =~ s/$/\//; } } else{ die "Please specify a genome folder to proceed (full path only)\n"; } unless ($bedGraph){ warn "Setting the option '--bedGraph' since this is required for the genome-wide cytosine report\n"; $bedGraph = 1; } unless ($counts){ # warn "Setting the option '--counts' since this is required for the genome-wide cytosine report\n"; $counts = 1; } warn "\n"; } ### PATH TO SAMTOOLS if (defined $samtools_path){ # if Samtools was specified as full command if ($samtools_path =~ /samtools$/){ if (-e $samtools_path){ # Samtools executable found } else{ die "Could not find an installation of Samtools at the location $samtools_path. Please respecify\n"; } } else{ unless ($samtools_path =~ /\/$/){ $samtools_path =~ s/$/\//; } $samtools_path .= 'samtools'; if (-e $samtools_path){ # Samtools executable found } else{ die "Could not find an installation of Samtools at the location $samtools_path. Please respecify\n"; } } } # Check whether Samtools is in the PATH if no path was supplied by the user else{ if (!system "which samtools >/dev/null 2>&1"){ # STDOUT is binned, STDERR is redirected to STDOUT. Returns 0 if Samtools is in the PATH $samtools_path = `which samtools`; chomp $samtools_path; } } unless (defined $samtools_path){ $samtools_path = ''; } if ($gazillion){ if ($ample_mem){ die "You can't currently select '--ample_mem' together with '--gazillion'. Make your pick!\n\n"; } } return ($ignore,$genomic_fasta,$single_end,$paired_end,$full,$report,$no_overlap,$merge_non_CpG,$vanilla,$output_dir,$no_header,$bedGraph,$remove,$coverage_threshold,$counts,$cytosine_report,$genome_folder,$zero,$CpG_only,$CX_context,$split_by_chromosome,$sort_size,$samtools_path,$gzip,$ignore_r2,$mbias_only,$gazillion,$ample_mem); } sub test_positional_sorting{ my $filename = shift; print "\nNow testing Bismark result file $filename for positional sorting (which would be bad...)\t"; sleep(1); if ($filename =~ /\.gz$/) { open (TEST,"zcat $filename |") or die "Can't open gzipped file $filename: $!\n"; } elsif ($filename =~ /bam$/ || `file -b $filename` =~ /^gzip/) { if ($samtools_path){ open (TEST,"$samtools_path view -h $filename |") or die "Can't open BAM file $filename: $!\n"; } else{ die "Sorry couldn't find an installation of Samtools. Either specifiy an alternative path using the option '--samtools_path /your/path/', or use a SAM file instead\n\n"; } } else { open (TEST,$filename) or die "Can't open file $filename: $!\n"; } my $count = 0; while (<TEST>) { if (/^\@/) { # testing header lines if they contain the @SO flag (for being sorted) if (/^\@SO/) { die "SAM/BAM header line '$_' indicates that the Bismark aligment file has been sorted by chromosomal positions which is is incompatible with correct methylation extraction. Please use an unsorted file instead\n\n"; } next; } $count++; last if ($count > 100000); # else we test the first 100000 sequences if they start with the same read ID my ($id_1) = (split (/\t/)); ### reading the next line which should be read 2 $_ = <TEST>; my ($id_2) = (split (/\t/)); last unless ($id_2); ++$count; if ($id_1 eq $id_2){ ### ids are the same next; } else{ ### in previous versions of Bismark we appended /1 and /2 to the read IDs for easier eyeballing which read is which. These tags need to be removed first my $id_1_trunc = $id_1; $id_1_trunc =~ s/\/1$//; my $id_2_trunc = $id_2; $id_2_trunc =~ s/\/2$//; unless ($id_1_trunc eq $id_2_trunc){ die "The IDs of Read 1 ($id_1) and Read 2 ($id_2) are not the same. This might be a result of sorting the paired-end SAM/BAM files by chromosomal position which is not compatible with correct methylation extraction. Please use an unsorted file instead\n\n"; } } } # close TEST or die $!; somehow fails on our cluster... ### If it hasen't died so far then it seems the file is in the correct Bismark format (read 1 and read 2 of a pair directly following each other) warn "...passed!\n"; sleep(1); } sub process_Bismark_results_file{ my $filename = shift; warn "\nNow reading in Bismark result file $filename\n\n"; if ($filename =~ /\.gz$/) { open (IN,"zcat $filename |") or die "Can't open gzipped file $filename: $!\n"; } elsif ($filename =~ /bam$/ || `file -b $filename` =~ /^gzip/) { if ($samtools_path){ open (IN,"$samtools_path view -h $filename |") or die "Can't open BAM file $filename: $!\n"; } else{ die "Sorry couldn't find an installation of Samtools. Either specifiy an alternative path using the option '--samtools_path /your/path/', or use a SAM file instead\n\n"; } } else { open (IN,$filename) or die "Can't open file $filename: $!\n"; } ### Vanilla and SAM output need to read different numbers of header lines if ($vanilla) { my $bismark_version = <IN>; ## discarding the Bismark version info chomp $bismark_version; $bismark_version =~ s/\r//; # replaces \r line feed $bismark_version =~ s/Bismark version: //; if ($bismark_version =~ /^\@/) { warn "Detected \@ as the first character of the version information. Is it possible that the file is in SAM format?\n\n"; sleep (2); } unless ($version eq $bismark_version){ die "The methylation extractor and Bismark itself need to be of the same version!\n\nVersions used:\nmethylation extractor: '$version'\nBismark: '$bismark_version'\n"; } } else { # If the read is in SAM format (default) it can either start with @ header lines or start with alignments directly. # We are reading from it further down } my $output_filename = (split (/\//,$filename))[-1]; ### OPENING OUTPUT-FILEHANDLES if ($report) { my $report_filename = $output_filename; $report_filename =~ s/\.sam$//; $report_filename =~ s/\.txt$//; $report_filename =~ s/$/_splitting_report.txt/; $report_filename = $output_dir . $report_filename; open (REPORT,'>',$report_filename) or die "Failed to write to file $report_filename $!\n"; } if ($report) { print REPORT "$output_filename\n\n"; print REPORT "Parameters used to extract methylation information:\n"; if ($paired) { if ($vanilla) { print REPORT "Bismark result file: paired-end (vanilla Bismark format)\n"; } else { print REPORT "Bismark result file: paired-end (SAM format)\n"; # default } } if ($single) { if ($vanilla) { print REPORT "Bismark result file: single-end (vanilla Bismark format)\n"; } else { print REPORT "Bismark result file: single-end (SAM format)\n"; # default } } if ($single){ if ($ignore) { print REPORT "Ignoring first $ignore bp\n"; } } else{ # paired-end if ($ignore) { print REPORT "Ignoring first $ignore bp of Read 1\n"; } if ($ignore_r2){ print REPORT "Ignoring first $ignore_r2 bp of Read 2\n"; } } if ($full) { print REPORT "Output specified: comprehensive\n"; } else { print REPORT "Output specified: strand-specific (default)\n"; } if ($no_overlap) { print REPORT "No overlapping methylation calls specified\n"; } if ($genomic_fasta) { print REPORT "Genomic equivalent sequences will be printed out in FastA format\n"; } if ($merge_non_CpG) { print REPORT "Methylation in CHG and CHH context will be merged into \"non-CpG context\" output\n"; } print REPORT "\n"; } ##### open (OUT,"| gzip -c - > $output_dir$outfile") or die "Failed to write to $outfile: $!\n"; ### CpG-context and non-CpG context. THIS SECTION IS OPTIONAL ### if --comprehensive AND --merge_non_CpG was specified we are only writing out one CpG-context and one Any-Other-context result file if ($full and $merge_non_CpG) { my $cpg_output = my $other_c_output = $output_filename; ### C in CpG context $cpg_output =~ s/^/CpG_context_/; $cpg_output =~ s/sam$/txt/; $cpg_output =~ s/bam$/txt/; $cpg_output =~ s/$/.txt/ unless ($cpg_output =~ /\.txt$/); $cpg_output = $output_dir . $cpg_output; if ($gzip){ $cpg_output .= '.gz'; open ($fhs{CpG_context},"| gzip -c - > $cpg_output") or die "Failed to write to $cpg_output $! \n" unless($mbias_only); } else{ open ($fhs{CpG_context},'>',$cpg_output) or die "Failed to write to $cpg_output $! \n" unless($mbias_only); } warn "Writing result file containing methylation information for C in CpG context to $cpg_output\n" unless($mbias_only); push @sorting_files,$cpg_output; unless ($no_header) { print {$fhs{CpG_context}} "Bismark methylation extractor version $version\n" unless($mbias_only); } ### C in any other context than CpG $other_c_output =~ s/^/Non_CpG_context_/; $other_c_output =~ s/sam$/txt/; $other_c_output =~ s/bam$/txt/; $other_c_output =~ s/$/.txt/ unless ($other_c_output =~ /\.txt$/); $other_c_output = $output_dir . $other_c_output; if ($gzip){ $other_c_output .= '.gz'; open ($fhs{other_context},"| gzip -c - > $other_c_output") or die "Failed to write to $other_c_output $! \n" unless($mbias_only); } else{ open ($fhs{other_context},'>',$other_c_output) or die "Failed to write to $other_c_output $!\n" unless($mbias_only); } warn "Writing result file containing methylation information for C in any other context to $other_c_output\n" unless($mbias_only); push @sorting_files,$other_c_output; unless ($no_header) { print {$fhs{other_context}} "Bismark methylation extractor version $version\n" unless($mbias_only); } } ### if only --merge_non_CpG was specified we will write out 8 different output files, depending on where the (first) unique best alignment has been found elsif ($merge_non_CpG) { my $cpg_ot = my $cpg_ctot = my $cpg_ctob = my $cpg_ob = $output_filename; ### For cytosines in CpG context $cpg_ot =~ s/^/CpG_OT_/; $cpg_ot =~ s/sam$/txt/; $cpg_ot =~ s/bam$/txt/; $cpg_ot =~ s/$/.txt/ unless ($cpg_ot =~ /\.txt$/); $cpg_ot = $output_dir . $cpg_ot; if ($gzip){ $cpg_ot .= '.gz'; open ($fhs{0}->{CpG},"| gzip -c - > $cpg_ot") or die "Failed to write to $cpg_ot $!\n" unless($mbias_only); } else{ open ($fhs{0}->{CpG},'>',$cpg_ot) or die "Failed to write to $cpg_ot $!\n" unless($mbias_only); } warn "Writing result file containing methylation information for C in CpG context from the original top strand to $cpg_ot\n" unless($mbias_only); push @sorting_files,$cpg_ot; unless($no_header){ print {$fhs{0}->{CpG}} "Bismark methylation extractor version $version\n" unless($mbias_only); } $cpg_ctot =~ s/^/CpG_CTOT_/; $cpg_ctot =~ s/sam$/txt/; $cpg_ctot =~ s/bam$/txt/; $cpg_ctot =~ s/$/.txt/ unless ($cpg_ctot =~ /\.txt$/); $cpg_ctot = $output_dir . $cpg_ctot; if ($gzip){ $cpg_ctot .= '.gz'; open ($fhs{1}->{CpG},"| gzip -c - > $cpg_ctot") or die "Failed to write to $cpg_ctot $!\n" unless($mbias_only); } else{ open ($fhs{1}->{CpG},'>',$cpg_ctot) or die "Failed to write to $cpg_ctot $!\n" unless($mbias_only); } warn "Writing result file containing methylation information for C in CpG context from the complementary to original top strand to $cpg_ctot\n" unless($mbias_only); push @sorting_files,$cpg_ctot; unless($no_header){ print {$fhs{1}->{CpG}} "Bismark methylation extractor version $version\n" unless($mbias_only); } $cpg_ctob =~ s/^/CpG_CTOB_/; $cpg_ctob =~ s/sam$/txt/; $cpg_ctob =~ s/bam$/txt/; $cpg_ctob =~ s/$/.txt/ unless ($cpg_ctob =~ /\.txt$/); $cpg_ctob = $output_dir . $cpg_ctob; if ($gzip){ $cpg_ctob .= '.gz'; open ($fhs{2}->{CpG},"| gzip -c - > $cpg_ctob") or die "Failed to write to $cpg_ctob $!\n" unless($mbias_only); } else{ open ($fhs{2}->{CpG},'>',$cpg_ctob) or die "Failed to write to $cpg_ctob $!\n" unless($mbias_only); } warn "Writing result file containing methylation information for C in CpG context from the complementary to original bottom strand to $cpg_ctob\n" unless($mbias_only); push @sorting_files,$cpg_ctob; unless($no_header){ print {$fhs{2}->{CpG}} "Bismark methylation extractor version $version\n" unless($mbias_only); } $cpg_ob =~ s/^/CpG_OB_/; $cpg_ob =~ s/sam$/txt/; $cpg_ob =~ s/bam$/txt/; $cpg_ob =~ s/$/.txt/ unless ($cpg_ob =~ /\.txt$/); $cpg_ob = $output_dir . $cpg_ob; if ($gzip){ $cpg_ob .= '.gz'; open ($fhs{3}->{CpG},"| gzip -c - > $cpg_ob") or die "Failed to write to $cpg_ob $!\n" unless($mbias_only); } else{ open ($fhs{3}->{CpG},'>',$cpg_ob) or die "Failed to write to $cpg_ob $!\n" unless($mbias_only); } warn "Writing result file containing methylation information for C in CpG context from the original bottom strand to $cpg_ob\n\n" unless($mbias_only); push @sorting_files,$cpg_ob; unless($no_header){ print {$fhs{3}->{CpG}} "Bismark methylation extractor version $version\n" unless($mbias_only); } ### For cytosines in Non-CpG (CC, CT or CA) context my $other_c_ot = my $other_c_ctot = my $other_c_ctob = my $other_c_ob = $output_filename; $other_c_ot =~ s/^/Non_CpG_OT_/; $other_c_ot =~ s/sam$/txt/; $other_c_ot =~ s/bam$/txt/; $other_c_ot =~ s/$/.txt/ unless ($other_c_ot =~ /\.txt$/); $other_c_ot = $output_dir . $other_c_ot; if ($gzip){ $other_c_ot .= '.gz'; open ($fhs{0}->{other_c},"| gzip -c - > $other_c_ot") or die "Failed to write to $other_c_ot $!\n" unless($mbias_only); } else{ open ($fhs{0}->{other_c},'>',$other_c_ot) or die "Failed to write to $other_c_ot $!\n" unless($mbias_only); } warn "Writing result file containing methylation information for C in any other context from the original top strand to $other_c_ot\n" unless($mbias_only); push @sorting_files,$other_c_ot; unless($no_header){ print {$fhs{0}->{other_c}} "Bismark methylation extractor version $version\n" unless($mbias_only); } $other_c_ctot =~ s/^/Non_CpG_CTOT_/; $other_c_ctot =~ s/sam$/txt/; $other_c_ctot =~ s/bam$/txt/; $other_c_ctot =~ s/$/.txt/ unless ($other_c_ctot =~ /\.txt$/); $other_c_ctot = $output_dir . $other_c_ctot; if ($gzip){ $other_c_ctot .= '.gz'; open ($fhs{1}->{other_c},"| gzip -c - > $other_c_ctot") or die "Failed to write to $other_c_ctot $!\n" unless($mbias_only); } else{ open ($fhs{1}->{other_c},'>',$other_c_ctot) or die "Failed to write to $other_c_ctot $!\n" unless($mbias_only); } warn "Writing result file containing methylation information for C in any other context from the complementary to original top strand to $other_c_ctot\n" unless($mbias_only); push @sorting_files,$other_c_ctot; unless($no_header){ print {$fhs{1}->{other_c}} "Bismark methylation extractor version $version\n" unless($mbias_only); } $other_c_ctob =~ s/^/Non_CpG_CTOB_/; $other_c_ctob =~ s/sam$/txt/; $other_c_ctob =~ s/bam$/txt/; $other_c_ctob =~ s/$/.txt/ unless ($other_c_ctob =~ /\.txt$/); $other_c_ctob = $output_dir . $other_c_ctob; if ($gzip){ $other_c_ctob .= '.gz'; open ($fhs{2}->{other_c},"| gzip -c - > $other_c_ctob") or die "Failed to write to $other_c_ctob $!\n" unless($mbias_only); } else{ open ($fhs{2}->{other_c},'>',$other_c_ctob) or die "Failed to write to $other_c_ctob $!\n" unless($mbias_only); } warn "Writing result file containing methylation information for C in any other context from the complementary to original bottom strand to $other_c_ctob\n" unless($mbias_only); push @sorting_files,$other_c_ctob; unless($no_header){ print {$fhs{2}->{other_c}} "Bismark methylation extractor version $version\n" unless($mbias_only); } $other_c_ob =~ s/^/Non_CpG_OB_/; $other_c_ob =~ s/sam$/txt/; $other_c_ob =~ s/sam$/txt/; $other_c_ob =~ s/$/.txt/ unless ($other_c_ob =~ /\.txt$/); $other_c_ob = $output_dir . $other_c_ob; if ($gzip){ $other_c_ob .= '.gz'; open ($fhs{3}->{other_c},"| gzip -c - > $other_c_ob") or die "Failed to write to $other_c_ob $!\n" unless($mbias_only); } else{ open ($fhs{3}->{other_c},'>',$other_c_ob) or die "Failed to write to $other_c_ob $!\n" unless($mbias_only); } warn "Writing result file containing methylation information for C in any other context from the original bottom strand to $other_c_ob\n\n" unless($mbias_only); push @sorting_files,$other_c_ob; unless($no_header){ print {$fhs{3}->{other_c}} "Bismark methylation extractor version $version\n" unless($mbias_only); } } ### THIS SECTION IS THE DEFAULT (CpG, CHG and CHH context) ### if --comprehensive was specified we are only writing one file per context elsif ($full) { my $cpg_output = my $chg_output = my $chh_output = $output_filename; ### C in CpG context $cpg_output =~ s/^/CpG_context_/; $cpg_output =~ s/sam$/txt/; $cpg_output =~ s/bam$/txt/; $cpg_output =~ s/$/.txt/ unless ($cpg_output =~ /\.txt$/); $cpg_output = $output_dir . $cpg_output; if ($gzip){ $cpg_output .= '.gz'; open ($fhs{CpG_context},"| gzip -c - > $cpg_output") or die "Failed to write to $cpg_output $! \n" unless($mbias_only); } else{ open ($fhs{CpG_context},'>',$cpg_output) or die "Failed to write to $cpg_output $! \n" unless($mbias_only); } warn "Writing result file containing methylation information for C in CpG context to $cpg_output\n" unless($mbias_only); push @sorting_files,$cpg_output; unless($no_header){ print {$fhs{CpG_context}} "Bismark methylation extractor version $version\n" unless($mbias_only); } ### C in CHG context $chg_output =~ s/^/CHG_context_/; $chg_output =~ s/sam$/txt/; $chg_output =~ s/bam$/txt/; $chg_output =~ s/$/.txt/ unless ($chg_output =~ /\.txt$/); $chg_output = $output_dir . $chg_output; if ($gzip){ $chg_output .= '.gz'; open ($fhs{CHG_context},"| gzip -c - > $chg_output") or die "Failed to write to $chg_output $!\n" unless($mbias_only); } else{ open ($fhs{CHG_context},'>',$chg_output) or die "Failed to write to $chg_output $!\n" unless($mbias_only); } warn "Writing result file containing methylation information for C in CHG context to $chg_output\n" unless($mbias_only); push @sorting_files,$chg_output; unless($no_header){ print {$fhs{CHG_context}} "Bismark methylation extractor version $version\n" unless($mbias_only); } ### C in CHH context $chh_output =~ s/^/CHH_context_/; $chh_output =~ s/sam$/txt/; $chh_output =~ s/bam$/txt/; $chh_output =~ s/$/.txt/ unless ($chh_output =~ /\.txt$/); $chh_output = $output_dir . $chh_output; if ($gzip){ $chh_output .= '.gz'; open ($fhs{CHH_context},"| gzip -c - > $chh_output") or die "Failed to write to $chh_output $!\n" unless($mbias_only); } else{ open ($fhs{CHH_context},'>',$chh_output) or die "Failed to write to $chh_output $!\n" unless($mbias_only); } warn "Writing result file containing methylation information for C in CHH context to $chh_output\n" unless($mbias_only); push @sorting_files, $chh_output; unless($no_header){ print {$fhs{CHH_context}} "Bismark methylation extractor version $version\n" unless($mbias_only); } } ### else we will write out 12 different output files, depending on where the (first) unique best alignment was found else { my $cpg_ot = my $cpg_ctot = my $cpg_ctob = my $cpg_ob = $output_filename; ### For cytosines in CpG context $cpg_ot =~ s/^/CpG_OT_/; $cpg_ot =~ s/sam$/txt/; $cpg_ot =~ s/bam$/txt/; $cpg_ot =~ s/$/.txt/ unless ($cpg_ot =~ /\.txt$/); $cpg_ot = $output_dir . $cpg_ot; if ($gzip){ $cpg_ot .= '.gz'; open ($fhs{0}->{CpG},"| gzip -c - > $cpg_ot") or die "Failed to write to $cpg_ot $!\n" unless($mbias_only); } else{ open ($fhs{0}->{CpG},'>',$cpg_ot) or die "Failed to write to $cpg_ot $!\n" unless($mbias_only); } warn "Writing result file containing methylation information for C in CpG context from the original top strand to $cpg_ot\n" unless($mbias_only); push @sorting_files,$cpg_ot; unless($no_header){ print {$fhs{0}->{CpG}} "Bismark methylation extractor version $version\n" unless($mbias_only); } $cpg_ctot =~ s/^/CpG_CTOT_/; $cpg_ctot =~ s/sam$/txt/; $cpg_ctot =~ s/bam$/txt/; $cpg_ctot =~ s/$/.txt/ unless ($cpg_ctot =~ /\.txt$/); $cpg_ctot = $output_dir . $cpg_ctot; if ($gzip){ $cpg_ctot .= '.gz'; open ($fhs{1}->{CpG},"| gzip -c - > $cpg_ctot") or die "Failed to write to $cpg_ctot $!\n" unless($mbias_only); } else{ open ($fhs{1}->{CpG},'>',$cpg_ctot) or die "Failed to write to $cpg_ctot $!\n" unless($mbias_only); } warn "Writing result file containing methylation information for C in CpG context from the complementary to original top strand to $cpg_ctot\n" unless($mbias_only); push @sorting_files,$cpg_ctot; unless($no_header){ print {$fhs{1}->{CpG}} "Bismark methylation extractor version $version\n" unless($mbias_only); } $cpg_ctob =~ s/^/CpG_CTOB_/; $cpg_ctob =~ s/sam$/txt/; $cpg_ctob =~ s/bam$/txt/; $cpg_ctob =~ s/$/.txt/ unless ($cpg_ctob =~ /\.txt$/); $cpg_ctob = $output_dir . $cpg_ctob; if ($gzip){ $cpg_ctob .= '.gz'; open ($fhs{2}->{CpG},"| gzip -c - > $cpg_ctob") or die "Failed to write to $cpg_ctob $!\n" unless($mbias_only); } else{ open ($fhs{2}->{CpG},'>',$cpg_ctob) or die "Failed to write to $cpg_ctob $!\n" unless($mbias_only); } warn "Writing result file containing methylation information for C in CpG context from the complementary to original bottom strand to $cpg_ctob\n" unless($mbias_only); push @sorting_files,$cpg_ctob; unless($no_header){ print {$fhs{2}->{CpG}} "Bismark methylation extractor version $version\n" unless($mbias_only); } $cpg_ob =~ s/^/CpG_OB_/; $cpg_ob =~ s/sam$/txt/; $cpg_ob =~ s/bam$/txt/; $cpg_ob =~ s/$/.txt/ unless ($cpg_ob =~ /\.txt$/); $cpg_ob = $output_dir . $cpg_ob; if ($gzip){ $cpg_ob .= '.gz'; open ($fhs{3}->{CpG},"| gzip -c - > $cpg_ob") or die "Failed to write to $cpg_ob $!\n" unless($mbias_only); } else{ open ($fhs{3}->{CpG},'>',$cpg_ob) or die "Failed to write to $cpg_ob $!\n" unless($mbias_only); } warn "Writing result file containing methylation information for C in CpG context from the original bottom strand to $cpg_ob\n\n" unless($mbias_only); push @sorting_files,$cpg_ob; unless($no_header){ print {$fhs{3}->{CpG}} "Bismark methylation extractor version $version\n" unless($mbias_only); } ### For cytosines in CHG context my $chg_ot = my $chg_ctot = my $chg_ctob = my $chg_ob = $output_filename; $chg_ot =~ s/^/CHG_OT_/; $chg_ot =~ s/sam$/txt/; $chg_ot =~ s/bam$/txt/; $chg_ot =~ s/$/.txt/ unless ($chg_ot =~ /\.txt$/); $chg_ot = $output_dir . $chg_ot; if ($gzip){ $chg_ot .= '.gz'; open ($fhs{0}->{CHG},"| gzip -c - > $chg_ot") or die "Failed to write to $chg_ot $!\n" unless($mbias_only); } else{ open ($fhs{0}->{CHG},'>',$chg_ot) or die "Failed to write to $chg_ot $!\n" unless($mbias_only); } warn "Writing result file containing methylation information for C in CHG context from the original top strand to $chg_ot\n" unless($mbias_only); push @sorting_files,$chg_ot; unless($no_header){ print {$fhs{0}->{CHG}} "Bismark methylation extractor version $version\n" unless($mbias_only); } $chg_ctot =~ s/^/CHG_CTOT_/; $chg_ctot =~ s/sam$/txt/; $chg_ctot =~ s/bam$/txt/; $chg_ctot =~ s/$/.txt/ unless ($chg_ctot =~ /\.txt$/); $chg_ctot = $output_dir . $chg_ctot; if ($gzip){ $chg_ctot .= '.gz'; open ($fhs{1}->{CHG},"| gzip -c - > $chg_ctot") or die "Failed to write to $chg_ctot $!\n" unless($mbias_only); } else{ open ($fhs{1}->{CHG},'>',$chg_ctot) or die "Failed to write to $chg_ctot $!\n" unless($mbias_only); } warn "Writing result file containing methylation information for C in CHG context from the complementary to original top strand to $chg_ctot\n" unless($mbias_only); push @sorting_files,$chg_ctot; unless($no_header){ print {$fhs{1}->{CHG}} "Bismark methylation extractor version $version\n" unless($mbias_only); } $chg_ctob =~ s/^/CHG_CTOB_/; $chg_ctob =~ s/sam$/txt/; $chg_ctob =~ s/bam$/txt/; $chg_ctob =~ s/$/.txt/ unless ($chg_ctob =~ /\.txt$/); $chg_ctob = $output_dir . $chg_ctob; if ($gzip){ $chg_ctob .= '.gz'; open ($fhs{2}->{CHG},"| gzip -c - > $chg_ctob") or die "Failed to write to $chg_ctob $!\n" unless($mbias_only); } else{ open ($fhs{2}->{CHG},'>',$chg_ctob) or die "Failed to write to $chg_ctob $!\n" unless($mbias_only); } warn "Writing result file containing methylation information for C in CHG context from the complementary to original bottom strand to $chg_ctob\n" unless($mbias_only); push @sorting_files,$chg_ctob; unless($no_header){ print {$fhs{2}->{CHG}} "Bismark methylation extractor version $version\n" unless($mbias_only); } $chg_ob =~ s/^/CHG_OB_/; $chg_ob =~ s/sam$/txt/; $chg_ob =~ s/bam$/txt/; $chg_ob =~ s/$/.txt/ unless ($chg_ob =~ /\.txt$/); $chg_ob = $output_dir . $chg_ob; if ($gzip){ $chg_ob .= '.gz'; open ($fhs{3}->{CHG},"| gzip -c - > $chg_ob") or die "Failed to write to $chg_ob $!\n" unless($mbias_only); } else{ open ($fhs{3}->{CHG},'>',$chg_ob) or die "Failed to write to $chg_ob $!\n" unless($mbias_only); } warn "Writing result file containing methylation information for C in CHG context from the original bottom strand to $chg_ob\n\n" unless($mbias_only); push @sorting_files,$chg_ob; unless($no_header){ print {$fhs{3}->{CHG}} "Bismark methylation extractor version $version\n" unless($mbias_only); } ### For cytosines in CHH context my $chh_ot = my $chh_ctot = my $chh_ctob = my $chh_ob = $output_filename; $chh_ot =~ s/^/CHH_OT_/; $chh_ot =~ s/sam$/txt/; $chh_ot =~ s/bam$/txt/; $chh_ot =~ s/$/.txt/ unless ($chh_ot =~ /\.txt$/); $chh_ot = $output_dir . $chh_ot; if ($gzip){ $chh_ot .= '.gz'; open ($fhs{0}->{CHH},"| gzip -c - > $chh_ot") or die "Failed to write to $chh_ot $!\n" unless($mbias_only); } else{ open ($fhs{0}->{CHH},'>',$chh_ot) or die "Failed to write to $chh_ot $!\n" unless($mbias_only); } warn "Writing result file containing methylation information for C in CHH context from the original top strand to $chh_ot\n" unless($mbias_only); push @sorting_files,$chh_ot; unless($no_header){ print {$fhs{0}->{CHH}} "Bismark methylation extractor version $version\n" unless($mbias_only); } $chh_ctot =~ s/^/CHH_CTOT_/; $chh_ctot =~ s/sam$/txt/; $chh_ctot =~ s/bam$/txt/; $chh_ctot =~ s/$/.txt/ unless ($chh_ctot =~ /\.txt$/); $chh_ctot = $output_dir . $chh_ctot; if ($gzip){ $chh_ctot .= '.gz'; open ($fhs{1}->{CHH},"| gzip -c - > $chh_ctot") or die "Failed to write to $chh_ctot $!\n" unless($mbias_only); } else{ open ($fhs{1}->{CHH},'>',$chh_ctot) or die "Failed to write to $chh_ctot $!\n" unless($mbias_only); } warn "Writing result file containing methylation information for C in CHH context from the complementary to original top strand to $chh_ctot\n" unless($mbias_only); push @sorting_files,$chh_ctot; unless($no_header){ print {$fhs{1}->{CHH}} "Bismark methylation extractor version $version\n" unless($mbias_only); } $chh_ctob =~ s/^/CHH_CTOB_/; $chh_ctob =~ s/sam$/txt/; $chh_ctob =~ s/bam$/txt/; $chh_ctob =~ s/$/.txt/ unless ($chh_ctob =~ /\.txt$/); $chh_ctob = $output_dir . $chh_ctob; if ($gzip){ $chh_ctob .= '.gz'; open ($fhs{2}->{CHH},"| gzip -c - > $chh_ctob") or die "Failed to write to $chh_ctob $!\n" unless($mbias_only); } else{ open ($fhs{2}->{CHH},'>',$chh_ctob) or die "Failed to write to $chh_ctob $!\n" unless($mbias_only); } warn "Writing result file containing methylation information for C in CHH context from the complementary to original bottom strand to $chh_ctob\n" unless($mbias_only); push @sorting_files,$chh_ctob; unless($no_header){ print {$fhs{2}->{CHH}} "Bismark methylation extractor version $version\n" unless($mbias_only); } $chh_ob =~ s/^/CHH_OB_/; $chh_ob =~ s/sam$/txt/; $chh_ob =~ s/bam$/txt/; $chh_ob =~ s/$/.txt/ unless ($chh_ob =~ /\.txt$/); $chh_ob = $output_dir . $chh_ob; if ($gzip){ $chh_ob .= '.gz'; open ($fhs{3}->{CHH},"| gzip -c - > $chh_ob") or die "Failed to write to $chh_ob $!\n" unless($mbias_only); } else{ open ($fhs{3}->{CHH},'>',$chh_ob) or die "Failed to write to $chh_ob $!\n" unless($mbias_only); } warn "Writing result file containing methylation information for C in CHH context from the original bottom strand to $chh_ob\n\n" unless($mbias_only); push @sorting_files,$chh_ob; unless($no_header){ print {$fhs{3}->{CHH}} "Bismark methylation extractor version $version\n" unless($mbias_only); } } my $methylation_call_strings_processed = 0; my $line_count = 0; ### proceeding differently now for single-end or paired-end Bismark files ### PROCESSING SINGLE-END RESULT FILES if ($single) { ### also proceeding differently now for SAM format or vanilla Bismark format files if ($vanilla) { # old vanilla Bismark output format while (<IN>) { ++$line_count; warn "Processed lines: $line_count\n" if ($line_count%500000==0); ### $seq here is the chromosomal sequence (to use for the repeat analysis for example) my ($id,$strand,$chrom,$start,$seq,$meth_call,$read_conversion,$genome_conversion) = (split("\t"))[0,1,2,3,6,7,8,9]; ### we need to remove 2 bp of the genomic sequence as we were extracting read + 2bp long fragments to make a methylation call at the first or ### last position chomp $genome_conversion; my $index; if ($meth_call) { if ($read_conversion eq 'CT' and $genome_conversion eq 'CT') { ## original top strand $index = 0; } elsif ($read_conversion eq 'GA' and $genome_conversion eq 'CT') { ## complementary to original top strand $index = 1; } elsif ($read_conversion eq 'CT' and $genome_conversion eq 'GA') { ## original bottom strand $index = 3; } elsif ($read_conversion eq 'GA' and $genome_conversion eq 'GA') { ## complementary to original bottom strand $index = 2; } else { die "Unexpected combination of read and genome conversion: '$read_conversion' / '$genome_conversion'\n"; } ### Clipping off the first <int> number of bases from the methylation call string as specified with --ignore <int> if ($ignore) { $meth_call = substr($meth_call,$ignore,length($meth_call)-$ignore); ### If we are clipping off some bases at the start we need to adjust the start position of the alignments accordingly! if ($strand eq '+') { $start += $ignore; } elsif ($strand eq '-') { $start += length($meth_call)-1; ## $meth_call is already shortened! } else { die "Alignment did not have proper strand information: $strand\n"; } } ### printing out the methylation state of every C in the read print_individual_C_methylation_states_single_end($meth_call,$chrom,$start,$id,$strand,$index); ++$methylation_call_strings_processed; # 1 per single-end result } } } else { # processing single-end SAM format (default) while (<IN>) { ### SAM format can either start with header lines (starting with @) or start with alignments directly if (/^\@/) { # skipping header lines (starting with @) warn "skipping SAM header line:\t$_"; next; } ++$line_count; warn "Processed lines: $line_count\n" if ($line_count%500000==0); # example read in SAM format # 1_R1/1 67 5 103172224 255 40M = 103172417 233 AATATTTTTTTTATTTTAAAATGTGTATTGATTTAAATTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:4 XX:Z:4T1T24TT7 XM:Z:....h.h........................hh....... XR:Z:CT XG:Z:CT ### # < 0.7.6 my ($id,$chrom,$start,$meth_call,$read_conversion,$genome_conversion) = (split("\t"))[0,2,3,13,14,15]; # < 0.7.6 $meth_call =~ s/^XM:Z://; # < 0.7.6 $read_conversion =~ s/^XR:Z://; # < 0.7.6 $genome_conversion =~ s/^XG:Z://; my ($id,$chrom,$start,$cigar) = (split("\t"))[0,2,3,5]; ### detecting the following SAM flags in case the SAM entry was shuffled by CRAM or Goby compression/decompression my $meth_call; ### Thanks to Zachary Zeno for this solution my $read_conversion; my $genome_conversion; while ( /(XM|XR|XG):Z:([^\t]+)/g ) { my $tag = $1; my $value = $2; if ($tag eq "XM") { $meth_call = $value; $meth_call =~ s/\r//; } elsif ($tag eq "XR") { $read_conversion = $value; $read_conversion =~ s/\r//; } elsif ($tag eq "XG") { $genome_conversion = $value; $genome_conversion =~ s/\r//; } } my $strand; chomp $genome_conversion; # print "$meth_call\n$read_conversion\n$genome_conversion\n"; my $index; if ($meth_call) { if ($read_conversion eq 'CT' and $genome_conversion eq 'CT') { ## original top strand $index = 0; $strand = '+'; } elsif ($read_conversion eq 'GA' and $genome_conversion eq 'CT') { ## complementary to original top strand $index = 1; $strand = '-'; } elsif ($read_conversion eq 'GA' and $genome_conversion eq 'GA') { ## complementary to original bottom strand $index = 2; $strand = '+'; } elsif ($read_conversion eq 'CT' and $genome_conversion eq 'GA') { ## original bottom strand $index = 3; $strand = '-'; } else { die "Unexpected combination of read and genome conversion: '$read_conversion' / '$genome_conversion'\n"; } ### If the read is in SAM format we need to reverse the methylation call if the read has been reverse-complemented for the output if ($strand eq '-') { $meth_call = reverse $meth_call; } ### Clipping off the first <int> number of bases from the methylation call string as specified with --ignore <int> if ($ignore) { # print "\n\n$meth_call\n"; $meth_call = substr($meth_call,$ignore,length($meth_call)-$ignore); # print "$meth_call\n"; ### If we are ignoring a part of the sequence we also need to adjust the cigar string accordingly my @len = split (/\D+/,$cigar); # storing the length per operation my @ops = split (/\d+/,$cigar); # storing the operation shift @ops; # remove the empty first element die "CIGAR string contained a non-matching number of lengths and operations\n" unless (scalar @len == scalar @ops); my @comp_cigar; # building an array with all CIGAR operations foreach my $index (0..$#len) { foreach (1..$len[$index]) { # print "$ops[$index]"; push @comp_cigar, $ops[$index]; } } # print "original CIGAR: $cigar\n"; # print "original CIGAR: @comp_cigar\n"; ### If we are clipping off some bases at the start we need to adjust the start position of the alignments accordingly! if ($strand eq '+') { my $D_count = 0; # counting all deletions that affect the ignored genomic position, i.e. Deletions and insertions my $I_count = 0; for (1..$ignore) { my $op = shift @comp_cigar; # adjusting composite CIGAR string by removing $ignore operations from the start # print "$_ deleted $op\n"; while ($op eq 'D') { # repeating this for deletions (D) $D_count++; $op = shift @comp_cigar; # print "$_ deleted $op\n"; } if ($op eq 'I') { # adjusting the genomic position for insertions (I) $I_count++; } } $start += $ignore + $D_count - $I_count; # print "start $start\t ignore: $ignore\t D count: $D_count I_count: $I_count\n"; } elsif ($strand eq '-') { for (1..$ignore) { my $op = pop @comp_cigar; # adjusting composite CIGAR string by removing $ignore operations, here the last value of the array while ($op eq 'D') { # repeating this for deletions (D) $op = pop @comp_cigar; } } ### For reverse strand alignments we need to determine the number of matching bases (M) or deletions (D) in the read from the CIGAR ### string to be able to work out the starting position of the read which is on the 3' end of the sequence my $MD_count = 0; # counting all operations that affect the genomic position, i.e. M and D. Insertions do not affect the start position foreach (@comp_cigar) { ++$MD_count if ($_ eq 'M' or $_ eq 'D'); } $start += $MD_count - 1; } ### reconstituting shortened CIGAR string my $new_cigar; my $count = 0; my $last_op; # print "ignore adjusted: @comp_cigar\n"; foreach my $op (@comp_cigar) { unless (defined $last_op){ $last_op = $op; ++$count; next; } if ($last_op eq $op) { ++$count; } else { $new_cigar .= "$count$last_op"; $last_op = $op; $count = 1; } } $new_cigar .= "$count$last_op"; # appending the last operation and count $cigar = $new_cigar; # print "ignore adjusted scalar: $cigar\n"; } } ### printing out the methylation state of every C in the read print_individual_C_methylation_states_single_end($meth_call,$chrom,$start,$id,$strand,$index,$cigar); ++$methylation_call_strings_processed; # 1 per single-end result } } } ### PROCESSING PAIRED-END RESULT FILES elsif ($paired) { ### proceeding differently now for SAM format or vanilla Bismark format files if ($vanilla) { # old vanilla Bismark paired-end output format while (<IN>) { ++$line_count; warn "processed line: $line_count\n" if ($line_count%500000==0); ### $seq here is the chromosomal sequence (to use for the repeat analysis for example) my ($id,$strand,$chrom,$start_read_1,$end_read_2,$seq_1,$meth_call_1,$seq_2,$meth_call_2,$first_read_conversion,$genome_conversion) = (split("\t"))[0,1,2,3,4,6,7,9,10,11,12,13]; my $index; chomp $genome_conversion; if ($first_read_conversion eq 'CT' and $genome_conversion eq 'CT') { $index = 0; ## this is OT } elsif ($first_read_conversion eq 'GA' and $genome_conversion eq 'GA') { $index = 2; ## this is CTOB!!! } elsif ($first_read_conversion eq 'GA' and $genome_conversion eq 'CT') { $index = 1; ## this is CTOT!!! } elsif ($first_read_conversion eq 'CT' and $genome_conversion eq 'GA') { $index = 3; ## this is OB } else { die "Unexpected combination of read and genome conversion: $first_read_conversion / $genome_conversion\n"; } if ($meth_call_1 and $meth_call_2) { ### Clipping off the first <int> number of bases from the methylation call strings as specified with '--ignore <int>' if ($ignore) { $meth_call_1 = substr($meth_call_1,$ignore,length($meth_call_1)-$ignore); ### we also need to adjust the start and end positions of the alignments accordingly if '--ignore' was specified $start_read_1 += $ignore; } if ($ignore_r2) { $meth_call_2 = substr($meth_call_2,$ignore_r2,length($meth_call_2)-$ignore_r2); ### we also need to adjust the start and end positions of the alignments accordingly if '--ignore_r2' was specified $end_read_2 -= $ignore_r2; } my $end_read_1; my $start_read_2; if ($strand eq '+') { $end_read_1 = $start_read_1+length($meth_call_1)-1; $start_read_2 = $end_read_2-length($meth_call_2)+1; ## we first pass the first read which is in + orientation on the forward strand print_individual_C_methylation_states_paired_end_files($meth_call_1,$chrom,$start_read_1,$id,'+',$index,0,0,undef,1); # the last two values are CIGAR string and read identity # we next pass the second read which is in - orientation on the reverse strand ### if --no_overlap was specified we also pass the end of read 1. If read 2 starts to overlap with read 1 we can stop extracting methylation calls from read 2 print_individual_C_methylation_states_paired_end_files($meth_call_2,$chrom,$end_read_2,$id,'-',$index,$no_overlap,$end_read_1,undef,2); } else { $end_read_1 = $start_read_1+length($meth_call_2)-1; # read 1 is the second reported read! $start_read_2 = $end_read_2-length($meth_call_1)+1; # read 2 is the first reported read! ## we first pass the first read which is in - orientation on the reverse strand print_individual_C_methylation_states_paired_end_files($meth_call_1,$chrom,$end_read_2,$id,'-',$index,0,0,undef,1); # we next pass the second read which is in + orientation on the forward strand ### if --no_overlap was specified we also pass the end of read 2. If read 2 starts to overlap with read 1 we will stop extracting methylation calls from read 2 print_individual_C_methylation_states_paired_end_files($meth_call_2,$chrom,$start_read_1,$id,'+',$index,$no_overlap,$start_read_2,undef,2); } $methylation_call_strings_processed += 2; # paired-end = 2 methylation calls } } } else { # Bismark paired-end SAM output format (default) while (<IN>) { ### SAM format can either start with header lines (starting with @) or start with alignments directly if (/^\@/) { # skipping header lines (starting with @) warn "skipping SAM header line:\t$_"; next; } ++$line_count; warn "Processed lines: $line_count\n" if ($line_count%500000==0); # example paired-end reads in SAM format (2 consecutive lines) # 1_R1/1 67 5 103172224 255 40M = 103172417 233 AATATTTTTTTTATTTTAAAATGTGTATTGATTTAAATTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:4 XX:Z:4T1T24TT7 XM:Z:....h.h........................hh....... XR:Z:CT XG:Z:CT # 1_R1/2 131 5 103172417 255 40M = 103172224 -233 TATTTTTTTTTAGAGTATTTTTTAATGGTTATTAGATTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:6 XX:Z:T5T1T9T9T7T3 XM:Z:h.....h.h.........h.........h.......h... XR:Z:GA XG:Z:CT # < version 0.7.6 my ($id_1,$chrom,$start_read_1,$meth_call_1,$first_read_conversion,$genome_conversion) = (split("\t"))[0,2,3,13,14,15]; my ($id_1,$chrom,$start_read_1,$cigar_1) = (split("\t"))[0,2,3,5]; ### detecting the following SAM flags in case the SAM entry was shuffled by CRAM or Goby compression/decompression my $meth_call_1; my $first_read_conversion; my $genome_conversion; while ( /(XM|XR|XG):Z:([^\t]+)/g ) { my $tag = $1; my $value = $2; if ($tag eq "XM") { $meth_call_1 = $value; $meth_call_1 =~ s/\r//; } elsif ($tag eq "XR") { $first_read_conversion = $value; $first_read_conversion =~ s/\r//; } elsif ($tag eq "XG") { $genome_conversion = $value; $genome_conversion =~ s/\r//; } } $_ = <IN>; # reading in the paired read # < version 0.7.6 my ($id_2,$start_read_2,$meth_call_2,$second_read_conversion) = (split("\t"))[0,3,13,14]; # < version 0.7.6 $meth_call_1 =~ s/^XM:Z://; # < version 0.7.6 $meth_call_2 =~ s/^XM:Z://; # < version 0.7.6 $first_read_conversion =~ s/^XR:Z://; # < version 0.7.6 $second_read_conversion =~ s/^XR:Z://; my ($id_2,$start_read_2,$cigar_2) = (split("\t"))[0,3,5]; ### detecting the following SAM flags in case the SAM entry was shuffled by CRAM or Goby compression/decompression my $meth_call_2; my $second_read_conversion; while ( /(XM|XR):Z:([^\t]+)/g ) { my $tag = $1; my $value = $2; if ($tag eq "XM") { $meth_call_2 = $value; $meth_call_2 =~ s/\r//; } elsif ($tag eq "XR") { $second_read_conversion = $value; $second_read_conversion = s/\r//; } } # < version 0.7.6 $genome_conversion =~ s/^XG:Z://; chomp $genome_conversion; # in case it captured a new line character # print join ("\t",$meth_call_1,$meth_call_2,$first_read_conversion,$second_read_conversion,$genome_conversion),"\n"; my $index; my $strand; if ($first_read_conversion eq 'CT' and $genome_conversion eq 'CT') { $index = 0; ## this is OT $strand = '+'; } elsif ($first_read_conversion eq 'GA' and $genome_conversion eq 'CT') { $index = 1; ## this is CTOT $strand = '-'; } elsif ($first_read_conversion eq 'GA' and $genome_conversion eq 'GA') { $index = 2; ## this is CTOB $strand = '+'; } elsif ($first_read_conversion eq 'CT' and $genome_conversion eq 'GA') { $index = 3; ## this is OB $strand = '-'; } else { die "Unexpected combination of read and genome conversion: $first_read_conversion / $genome_conversion\n"; } ### reversing the methylation call of the read that was reverse-complemented if ($strand eq '+') { $meth_call_2 = reverse $meth_call_2; } else { $meth_call_1 = reverse $meth_call_1; } if ($meth_call_1 and $meth_call_2) { my $end_read_1; ### READ 1 my @len_1 = split (/\D+/,$cigar_1); # storing the length per operation my @ops_1 = split (/\d+/,$cigar_1); # storing the operation shift @ops_1; # remove the empty first element die "CIGAR string contained a non-matching number of lengths and operations: $cigar_1\n".join(" ",@len_1)."\n".join(" ",@ops_1)."\n" unless (scalar @len_1 == scalar @ops_1); my @comp_cigar_1; # building an array with all CIGAR operations foreach my $index (0..$#len_1) { foreach (1..$len_1[$index]) { # print "$ops_1[$index]"; push @comp_cigar_1, $ops_1[$index]; } } # print "original CIGAR read 1: $cigar_1\n"; # print "original CIGAR read 1: @comp_cigar_1\n"; ### READ 2 my @len_2 = split (/\D+/,$cigar_2); # storing the length per operation my @ops_2 = split (/\d+/,$cigar_2); # storing the operation shift @ops_2; # remove the empty first element die "CIGAR string contained a non-matching number of lengths and operations\n" unless (scalar @len_2 == scalar @ops_2); my @comp_cigar_2; # building an array with all CIGAR operations for read 2 foreach my $index (0..$#len_2) { foreach (1..$len_2[$index]) { # print "$ops_2[$index]"; push @comp_cigar_2, $ops_2[$index]; } } # print "original CIGAR read 2: $cigar_2\n"; # print "original CIGAR read 2: @comp_cigar_2\n"; if ($ignore) { ### Clipping off the first <int> number of bases from the methylation call strings as specified with '--ignore <int>' for read 1 ### the methylation calls have already been reversed where necessary $meth_call_1 = substr($meth_call_1,$ignore,length($meth_call_1)-$ignore); if ($strand eq '+') { ### if the (read 1) strand information is '+', read 1 needs to be trimmed from the start my $D_count_1 = 0; # counting all deletions that affect the ignored genomic position for read 1, i.e. Deletions and insertions my $I_count_1 = 0; for (1..$ignore) { my $op = shift @comp_cigar_1; # adjusting composite CIGAR string of read 1 by removing $ignore operations from the start # print "$_ deleted $op\n"; while ($op eq 'D') { # repeating this for deletions (D) $D_count_1++; $op = shift @comp_cigar_1; # print "$_ deleted $op\n"; } if ($op eq 'I') { # adjusting the genomic position for insertions (I) $I_count_1++; } } $start_read_1 += $ignore + $D_count_1 - $I_count_1; # print "start read 1 $start_read_1\t ignore: $ignore\t D count 1: $D_count_1\tI_count 1: $I_count_1\n"; # the start position of reads mapping to the reverse strand is being adjusted further below } elsif ($strand eq '-') { ### if the (read 1) strand information is '-', read 1 needs to be trimmed from the back for (1..$ignore) { my $op = pop @comp_cigar_1; # adjusting composite CIGAR string by removing $ignore operations, here the last value of the array while ($op eq 'D') { # repeating this for deletions (D) $op = pop @comp_cigar_1; } } # the start position of reads mapping to the reverse strand is being adjusted further below } } if ($ignore_r2) { ### Clipping off the first <int> number of bases from the methylation call string as specified with '--ignore_r2 <int>' for read 2 ### the methylation calls have already been reversed where necessary $meth_call_2 = substr($meth_call_2,$ignore_r2,length($meth_call_2)-$ignore_r2); ### If we are ignoring a part of the sequence we also need to adjust the cigar string accordingly if ($strand eq '+') { ### if the (read 1) strand information is '+', read 2 needs to be trimmed from the back for (1..$ignore_r2) { my $op = pop @comp_cigar_2; # adjusting composite CIGAR string by removing $ignore operations, here the last value of the array while ($op eq 'D') { # repeating this for deletions (D) $op = pop @comp_cigar_2; } } # the start position of reads mapping to the reverse strand is being adjusted further below } elsif ($strand eq '-') { ### if the (read 1) strand information is '-', read 2 needs to be trimmed from the start my $D_count_2 = 0; # counting all deletions that affect the ignored genomic position for read 2, i.e. Deletions and insertions my $I_count_2 = 0; for (1..$ignore_r2) { my $op = shift @comp_cigar_2; # adjusting composite CIGAR string of read 2 by removing $ignore operations from the start # print "$_ deleted $op\n"; while ($op eq 'D') { # repeating this for deletions (D) $D_count_2++; $op = shift @comp_cigar_2; # print "$_ deleted $op\n"; } if ($op eq 'I') { # adjusting the genomic position for insertions (I) $I_count_2++; } } $start_read_2 += $ignore_r2 + $D_count_2 - $I_count_2; # print "start read 2 $start_read_2\t ignore R2: $ignore_r2\t D count 2: $D_count_2\tI_count 2: $I_count_2\n"; } } if ($ignore){ ### reconstituting shortened CIGAR string 1 my $new_cigar_1; my $count_1 = 0; my $last_op_1; # print "ignore adjusted CIGAR 1: @comp_cigar_1\n"; foreach my $op (@comp_cigar_1) { unless (defined $last_op_1){ $last_op_1 = $op; ++$count_1; next; } if ($last_op_1 eq $op) { ++$count_1; } else { $new_cigar_1 .= "$count_1$last_op_1"; $last_op_1 = $op; $count_1 = 1; } } $new_cigar_1 .= "$count_1$last_op_1"; # appending the last operation and count $cigar_1 = $new_cigar_1; # print "ignore adjusted CIGAR 1 scalar: $cigar_1\n"; } if ($ignore_r2){ ### reconstituting shortened CIGAR string 2 my $new_cigar_2; my $count_2 = 0; my $last_op_2; # print "ignore adjusted CIGAR 2: @comp_cigar_2\n"; foreach my $op (@comp_cigar_2) { unless (defined $last_op_2){ $last_op_2 = $op; ++$count_2; next; } if ($last_op_2 eq $op) { ++$count_2; } else { $new_cigar_2 .= "$count_2$last_op_2"; $last_op_2 = $op; $count_2 = 1; } } $new_cigar_2 .= "$count_2$last_op_2"; # appending the last operation and count $cigar_2 = $new_cigar_2; # print "ignore_r2 adjusted CIGAR 2 scalar: $cigar_2\n"; } ### Adjusting CIGAR string and starting position of reads in reverse orientation which we will pass to the extraction subroutine later on if ($strand eq '+') { ### adjusting the start position for all reads mapping to the reverse strand, in this case read 2 @comp_cigar_2 = reverse@comp_cigar_2; # the CIGAR string needs to be reversed for all reads aligning to the reverse strand, too # print "reverse: @comp_cigar_2\n"; my $MD_count_1 = 0; foreach (@comp_cigar_1) { ++$MD_count_1 if ($_ eq 'M' or $_ eq 'D'); # Matching bases or deletions affect the genomic position of the 3' ends of reads, insertions don't } my $MD_count_2 = 0; foreach (@comp_cigar_2) { ++$MD_count_2 if ($_ eq 'M' or $_ eq 'D'); # Matching bases or deletions affect the genomic position of the 3' ends of reads, insertions don't } $end_read_1 = $start_read_1 + $MD_count_1 - 1; $start_read_2 += $MD_count_2 - 1; ## Passing on the start position on the reverse strand } else { ### adjusting the start position for all reads mapping to the reverse strand, in this case read 1 @comp_cigar_1 = reverse@comp_cigar_1; # the CIGAR string needs to be reversed for all reads aligning to the reverse strand, too # print "reverse: @comp_cigar_1\n"; my $MD_count_1 = 0; foreach (@comp_cigar_1) { ++$MD_count_1 if ($_ eq 'M' or $_ eq 'D'); # Matching bases or deletions affect the genomic position of the 3' ends of reads, insertions don't } $end_read_1 = $start_read_1; $start_read_1 += $MD_count_1 - 1; ### Passing on the start position on the reverse strand } if ($strand eq '+') { ## we first pass the first read which is in + orientation on the forward strand; the last value is the read identity print_individual_C_methylation_states_paired_end_files($meth_call_1,$chrom,$start_read_1,$id_1,'+',$index,0,0,$cigar_1,1); # we next pass the second read which is in - orientation on the reverse strand ### if --no_overlap was specified we also pass the end of read 1. If read 2 starts to overlap with read 1 we can stop extracting methylation calls from read 2 print_individual_C_methylation_states_paired_end_files($meth_call_2,$chrom,$start_read_2,$id_2,'-',$index,$no_overlap,$end_read_1,$cigar_2,2); } else { ## we first pass the first read which is in - orientation on the reverse strand print_individual_C_methylation_states_paired_end_files($meth_call_1,$chrom,$start_read_1,$id_1,'-',$index,0,0,$cigar_1,1); # we next pass the second read which is in + orientation on the forward strand ### if --no_overlap was specified we also pass the end of read 1. If read 2 starts to overlap with read 1 we will stop extracting methylation calls from read 2 print_individual_C_methylation_states_paired_end_files($meth_call_2,$chrom,$start_read_2,$id_2,'+',$index,$no_overlap,$end_read_1,$cigar_2,2); } $methylation_call_strings_processed += 2; # paired-end = 2 methylation calls } } } } else { die "Single-end or paired-end reads not specified properly\n"; } warn "\n\nProcessed $line_count lines from $filename in total\n"; warn "Total number of methylation call strings processed: $methylation_call_strings_processed\n\n"; if ($report) { print REPORT "\n\nProcessed $line_count lines from $filename in total\n"; print REPORT "Total number of methylation call strings processed: $methylation_call_strings_processed\n\n"; } print_splitting_report (); } sub print_splitting_report{ ### Calculating methylation percentages if applicable my $percent_meCpG; if (($counting{total_meCpG_count}+$counting{total_unmethylated_CpG_count}) > 0){ $percent_meCpG = sprintf("%.1f",100*$counting{total_meCpG_count}/($counting{total_meCpG_count}+$counting{total_unmethylated_CpG_count})); } my $percent_meCHG; if (($counting{total_meCHG_count}+$counting{total_unmethylated_CHG_count}) > 0){ $percent_meCHG = sprintf("%.1f",100*$counting{total_meCHG_count}/($counting{total_meCHG_count}+$counting{total_unmethylated_CHG_count})); } my $percent_meCHH; if (($counting{total_meCHH_count}+$counting{total_unmethylated_CHH_count}) > 0){ $percent_meCHH = sprintf("%.1f",100*$counting{total_meCHH_count}/($counting{total_meCHH_count}+$counting{total_unmethylated_CHH_count})); } my $percent_non_CpG_methylation; if ($merge_non_CpG){ if ( ($counting{total_meCHH_count}+$counting{total_unmethylated_CHH_count}+$counting{total_meCHG_count}+$counting{total_unmethylated_CHG_count}) > 0){ $percent_non_CpG_methylation = sprintf("%.1f",100* ( $counting{total_meCHH_count}+$counting{total_meCHG_count} ) / ( $counting{total_meCHH_count}+$counting{total_unmethylated_CHH_count}+$counting{total_meCHG_count}+$counting{total_unmethylated_CHG_count} ) ); } } if ($report){ ### detailed information about Cs analysed print REPORT "Final Cytosine Methylation Report\n",'='x33,"\n"; my $total_number_of_C = $counting{total_meCHG_count}+$counting{total_meCHH_count}+$counting{total_meCpG_count}+$counting{total_unmethylated_CHG_count}+$counting{total_unmethylated_CHH_count}+$counting{total_unmethylated_CpG_count}; print REPORT "Total number of C's analysed:\t$total_number_of_C\n\n"; print REPORT "Total methylated C's in CpG context:\t$counting{total_meCpG_count}\n"; print REPORT "Total methylated C's in CHG context:\t$counting{total_meCHG_count}\n"; print REPORT "Total methylated C's in CHH context:\t$counting{total_meCHH_count}\n\n"; print REPORT "Total C to T conversions in CpG context:\t$counting{total_unmethylated_CpG_count}\n"; print REPORT "Total C to T conversions in CHG context:\t$counting{total_unmethylated_CHG_count}\n"; print REPORT "Total C to T conversions in CHH context:\t$counting{total_unmethylated_CHH_count}\n\n"; ### calculating methylated CpG percentage if applicable if ($percent_meCpG){ print REPORT "C methylated in CpG context:\t${percent_meCpG}%\n"; } else{ print REPORT "Can't determine percentage of methylated Cs in CpG context if value was 0\n"; } ### 2-Context Output if ($merge_non_CpG){ if ($percent_non_CpG_methylation){ print REPORT "C methylated in non-CpG context:\t${percent_non_CpG_methylation}%\n\n\n"; } else{ print REPORT "Can't determine percentage of methylated Cs in non-CpG context if value was 0\n\n\n"; } } ### 3 Context Output else{ ### calculating methylated CHG percentage if applicable if ($percent_meCHG){ print REPORT "C methylated in CHG context:\t${percent_meCHG}%\n"; } else{ print REPORT "Can't determine percentage of methylated Cs in CHG context if value was 0\n"; } ### calculating methylated CHH percentage if applicable if ($percent_meCHH){ print REPORT "C methylated in CHH context:\t${percent_meCHH}%\n\n\n"; } else{ print REPORT "Can't determine percentage of methylated Cs in CHH context if value was 0\n\n\n"; } } } ### detailed information about Cs analysed for on-screen report print "Final Cytosine Methylation Report\n",'='x33,"\n"; my $total_number_of_C = $counting{total_meCHG_count}+$counting{total_meCHH_count}+$counting{total_meCpG_count}+$counting{total_unmethylated_CHG_count}+$counting{total_unmethylated_CHH_count}+$counting{total_unmethylated_CpG_count}; print "Total number of C's analysed:\t$total_number_of_C\n\n"; print "Total methylated C's in CpG context:\t$counting{total_meCpG_count}\n"; print "Total methylated C's in CHG context:\t$counting{total_meCHG_count}\n"; print "Total methylated C's in CHH context:\t$counting{total_meCHH_count}\n\n"; print "Total C to T conversions in CpG context:\t$counting{total_unmethylated_CpG_count}\n"; print "Total C to T conversions in CHG context:\t$counting{total_unmethylated_CHG_count}\n"; print "Total C to T conversions in CHH context:\t$counting{total_unmethylated_CHH_count}\n\n"; ### printing methylated CpG percentage if applicable if ($percent_meCpG){ print "C methylated in CpG context:\t${percent_meCpG}%\n"; } else{ print "Can't determine percentage of methylated Cs in CpG context if value was 0\n"; } ### 2-Context Output if ($merge_non_CpG){ if ($percent_non_CpG_methylation){ print "C methylated in non-CpG context:\t${percent_non_CpG_methylation}%\n\n\n"; } else{ print "Can't determine percentage of methylated Cs in non-CpG context if value was 0\n\n\n"; } } ### 3-Context Output else{ ### printing methylated CHG percentage if applicable if ($percent_meCHG){ print "C methylated in CHG context:\t${percent_meCHG}%\n"; } else{ print "Can't determine percentage of methylated Cs in CHG context if value was 0\n"; } ### printing methylated CHH percentage if applicable if ($percent_meCHH){ print "C methylated in CHH context:\t${percent_meCHH}%\n\n\n"; } else{ print "Can't determine percentage of methylated Cs in CHH context if value was 0\n\n\n"; } } } sub print_individual_C_methylation_states_paired_end_files{ my ($meth_call,$chrom,$start,$id,$strand,$filehandle_index,$no_overlap,$end_read_1,$cigar,$read_identity) = @_; ### we will use the read identity for the M-bias plot to discriminate read 1 and read 2 die "Read identity was neither 1 nor 2: $read_identity\n\n" unless ($read_identity == 1 or $read_identity == 2); my @methylation_calls = split(//,$meth_call); ################################################################# ### . for bases not involving cytosines ### ### X for methylated C in CHG context (was protected) ### ### x for not methylated C in CHG context (was converted) ### ### H for methylated C in CHH context (was protected) ### ### h for not methylated C in CHH context (was converted) ### ### Z for methylated C in CpG context (was protected) ### ### z for not methylated C in CpG context (was converted) ### ### U for methylated C in Unknown context (was protected) ### ### u for not methylated C in Unknown context (was converted) ### ################################################################# my $methyl_CHG_count = 0; my $methyl_CHH_count = 0; my $methyl_CpG_count = 0; my $unmethylated_CHG_count = 0; my $unmethylated_CHH_count = 0; my $unmethylated_CpG_count = 0; my $pos_offset = 0; # this is only relevant for SAM reads with insertions or deletions my $cigar_offset = 0; # again, this is only relevant for SAM reads containing indels my @comp_cigar; ### Checking whether the CIGAR string is a linear genomic match or whether if requires indel processing if ($cigar =~ /^\d+M$/){ # this check speeds up the extraction process by up to 60%!!! } else{ # parsing CIGAR string my @len; my @ops; @len = split (/\D+/,$cigar); # storing the length per operation @ops = split (/\d+/,$cigar); # storing the operation shift @ops; # remove the empty first element die "CIGAR string contained a non-matching number of lengths and operations\n" unless (scalar @len == scalar @ops); foreach my $index (0..$#len){ foreach (1..$len[$index]){ # print "$ops[$index]"; push @comp_cigar, $ops[$index]; } } # warn "\nDetected CIGAR string: $cigar\n"; # warn "Length of methylation call: ",length $meth_call,"\n"; # warn "number of operations: ",scalar @ops,"\n"; # warn "number of length digits: ",scalar @len,"\n\n"; # print @comp_cigar,"\n"; # print "$meth_call\n\n"; # sleep (1); } if ($strand eq '-') { ### the CIGAR string needs to be reversed, the methylation call has already been reversed above if (@comp_cigar){ @comp_cigar = reverse@comp_cigar; # the CIGAR string needs to be reversed for all reads aligning to the reverse strand, too } # print "reverse CIGAR string: @comp_cigar\n"; ### the start position of paired-end files has already been corrected, see above } ### THIS IS AN OPTIONAL 2-CONTEXT (CpG and non-CpG) SECTION IF --merge_non_CpG was specified if ($merge_non_CpG) { if ($no_overlap) { # this has to be read 2... ### single-file CpG and non-CpG context output if ($full) { if ($strand eq '+') { for my $index (0..$#methylation_calls) { if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition+index: ",$start+$index,"\t"; $cigar_offset += $cigar_mod; $pos_offset += $pos_mod; } ### Returning as soon as the methylation calls start overlapping if ($start+$index+$pos_offset >= $end_read_1) { return; } if ($methylation_calls[$index] eq 'X') { $counting{total_meCHG_count}++; print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHG}->{$index+1}->{meth}++; } else{ $mbias_2{CHG}->{$index+1}->{meth}++; } } elsif ($methylation_calls[$index] eq 'x') { $counting{total_unmethylated_CHG_count}++; print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHG}->{$index+1}->{un}++; } else{ $mbias_2{CHG}->{$index+1}->{un}++; } } elsif ($methylation_calls[$index] eq 'Z') { $counting{total_meCpG_count}++; print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CpG}->{$index+1}->{meth}++; } else{ $mbias_2{CpG}->{$index+1}->{meth}++; } } elsif ($methylation_calls[$index] eq 'z') { $counting{total_unmethylated_CpG_count}++; print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CpG}->{$index+1}->{un}++; } else{ $mbias_2{CpG}->{$index+1}->{un}++; } } elsif ($methylation_calls[$index] eq 'H') { $counting{total_meCHH_count}++; print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHH}->{$index+1}->{meth}++; } else{ $mbias_2{CHH}->{$index+1}->{meth}++; } } elsif ($methylation_calls[$index] eq 'h') { $counting{total_unmethylated_CHH_count}++; print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHH}->{$index+1}->{un}++; } else{ $mbias_2{CHH}->{$index+1}->{un}++; } } elsif ($methylation_calls[$index] eq '.'){} elsif (lc$methylation_calls[$index] eq 'u'){} else{ die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n" unless($mbias_only); } } } elsif ($strand eq '-') { for my $index (0..$#methylation_calls) { if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition-index: ",$start-$index,"\t"; my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); $cigar_offset += $cigar_mod; $pos_offset += $pos_mod; } ### Returning as soon as the methylation calls start overlapping if ($start-$index+$pos_offset <= $end_read_1) { return; } if ($methylation_calls[$index] eq 'X') { $counting{total_meCHG_count}++; print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHG}->{$index+1}->{meth}++; } else{ $mbias_2{CHG}->{$index+1}->{meth}++; } } elsif ($methylation_calls[$index] eq 'x') { $counting{total_unmethylated_CHG_count}++; print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHG}->{$index+1}->{un}++; } else{ $mbias_2{CHG}->{$index+1}->{un}++; } } elsif ($methylation_calls[$index] eq 'Z') { $counting{total_meCpG_count}++; print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CpG}->{$index+1}->{meth}++; } else{ $mbias_2{CpG}->{$index+1}->{meth}++; } } elsif ($methylation_calls[$index] eq 'z') { $counting{total_unmethylated_CpG_count}++; print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CpG}->{$index+1}->{un}++; } else{ $mbias_2{CpG}->{$index+1}->{un}++; } } elsif ($methylation_calls[$index] eq 'H') { $counting{total_meCHH_count}++; print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHH}->{$index+1}->{meth}++; } else{ $mbias_2{CHH}->{$index+1}->{meth}++; } } elsif ($methylation_calls[$index] eq 'h') { $counting{total_unmethylated_CHH_count}++; print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHH}->{$index+1}->{un}++; } else{ $mbias_2{CHH}->{$index+1}->{un}++; } } elsif ($methylation_calls[$index] eq '.') {} elsif (lc$methylation_calls[$index] eq 'u'){} else{ die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n" unless($mbias_only); } } } else { die "The read orientation was neither + nor -: '$strand'\n"; } } ### strand-specific methylation output else { if ($strand eq '+') { for my $index (0..$#methylation_calls) { if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition+index: ",$start+$index,"\t"; $cigar_offset += $cigar_mod; $pos_offset += $pos_mod; } ### Returning as soon as the methylation calls start overlapping if ($start+$index+$pos_offset >= $end_read_1) { return; } if ($methylation_calls[$index] eq 'X') { $counting{total_meCHG_count}++; print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHG}->{$index+1}->{meth}++; } else{ $mbias_2{CHG}->{$index+1}->{meth}++; } } elsif ($methylation_calls[$index] eq 'x') { $counting{total_unmethylated_CHG_count}++; print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHG}->{$index+1}->{un}++; } else{ $mbias_2{CHG}->{$index+1}->{un}++; } } elsif ($methylation_calls[$index] eq 'Z') { $counting{total_meCpG_count}++; print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CpG}->{$index+1}->{meth}++; } else{ $mbias_2{CpG}->{$index+1}->{meth}++; } } elsif ($methylation_calls[$index] eq 'z') { $counting{total_unmethylated_CpG_count}++; print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CpG}->{$index+1}->{un}++; } else{ $mbias_2{CpG}->{$index+1}->{un}++; } } elsif ($methylation_calls[$index] eq 'H') { $counting{total_meCHH_count}++; print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHH}->{$index+1}->{meth}++; } else{ $mbias_2{CHH}->{$index+1}->{meth}++; } } elsif ($methylation_calls[$index] eq 'h') { $counting{total_unmethylated_CHH_count}++; print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHH}->{$index+1}->{un}++; } else{ $mbias_2{CHH}->{$index+1}->{un}++; } } elsif ($methylation_calls[$index] eq '.') {} elsif (lc$methylation_calls[$index] eq 'u'){} else{ die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; } } } elsif ($strand eq '-') { for my $index (0..$#methylation_calls) { if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition-index: ",$start-$index,"\t"; my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); $cigar_offset += $cigar_mod; $pos_offset += $pos_mod; } ### Returning as soon as the methylation calls start overlapping if ($start-$index+$pos_offset <= $end_read_1) { return; } if ($methylation_calls[$index] eq 'X') { $counting{total_meCHG_count}++; print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHG}->{$index+1}->{meth}++; } else{ $mbias_2{CHG}->{$index+1}->{meth}++; } } elsif ($methylation_calls[$index] eq 'x') { $counting{total_unmethylated_CHG_count}++; print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHG}->{$index+1}->{un}++; } else{ $mbias_2{CHG}->{$index+1}->{un}++; } } elsif ($methylation_calls[$index] eq 'Z') { $counting{total_meCpG_count}++; print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CpG}->{$index+1}->{meth}++; } else{ $mbias_2{CpG}->{$index+1}->{meth}++; } } elsif ($methylation_calls[$index] eq 'z') { $counting{total_unmethylated_CpG_count}++; print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CpG}->{$index+1}->{un}++; } else{ $mbias_2{CpG}->{$index+1}->{un}++; } } elsif ($methylation_calls[$index] eq 'H') { $counting{total_meCHH_count}++; print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHH}->{$index+1}->{meth}++; } else{ $mbias_2{CHH}->{$index+1}->{meth}++; } } elsif ($methylation_calls[$index] eq 'h') { $counting{total_unmethylated_CHH_count}++; print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHH}->{$index+1}->{un}++; } else{ $mbias_2{CHH}->{$index+1}->{un}++; } } elsif ($methylation_calls[$index] eq '.') {} elsif (lc$methylation_calls[$index] eq 'u'){} else{ die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; } } } else { die "The strand orientation was neither + nor -: '$strand'/n"; } } } ### this is the default paired-end procedure allowing overlaps and using every single C position ### Still within the 2-CONTEXT ONLY optional section else { ### single-file CpG and non-CpG context output if ($full) { if ($strand eq '+') { for my $index (0..$#methylation_calls) { if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition+index: ",$start+$index,"\t"; $cigar_offset += $cigar_mod; $pos_offset += $pos_mod; } if ($methylation_calls[$index] eq 'X') { $counting{total_meCHG_count}++; print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHG}->{$index+1}->{meth}++; } else{ $mbias_2{CHG}->{$index+1}->{meth}++; } } elsif ($methylation_calls[$index] eq 'x') { $counting{total_unmethylated_CHG_count}++; print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHG}->{$index+1}->{un}++; } else{ $mbias_2{CHG}->{$index+1}->{un}++; } } elsif ($methylation_calls[$index] eq 'Z') { $counting{total_meCpG_count}++; print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CpG}->{$index+1}->{meth}++; } else{ $mbias_2{CpG}->{$index+1}->{meth}++; } } elsif ($methylation_calls[$index] eq 'z') { $counting{total_unmethylated_CpG_count}++; print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CpG}->{$index+1}->{un}++; } else{ $mbias_2{CpG}->{$index+1}->{un}++; } } elsif ($methylation_calls[$index] eq 'H') { $counting{total_meCHH_count}++; print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHH}->{$index+1}->{meth}++; } else{ $mbias_2{CHH}->{$index+1}->{meth}++; } } elsif ($methylation_calls[$index] eq 'h') { $counting{total_unmethylated_CHH_count}++; print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHH}->{$index+1}->{un}++; } else{ $mbias_2{CHH}->{$index+1}->{un}++; } } elsif ($methylation_calls[$index] eq '.') {} elsif (lc$methylation_calls[$index] eq 'u'){} else{ die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n" unless($mbias_only); } } } elsif ($strand eq '-') { for my $index (0..$#methylation_calls) { if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition-index: ",$start-$index,"\t"; my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); $cigar_offset += $cigar_mod; $pos_offset += $pos_mod; } if ($methylation_calls[$index] eq 'X') { $counting{total_meCHG_count}++; print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHG}->{$index+1}->{meth}++; } else{ $mbias_2{CHG}->{$index+1}->{meth}++; } } elsif ($methylation_calls[$index] eq 'x') { $counting{total_unmethylated_CHG_count}++; print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHG}->{$index+1}->{un}++; } else{ $mbias_2{CHG}->{$index+1}->{un}++; } } elsif ($methylation_calls[$index] eq 'Z') { $counting{total_meCpG_count}++; print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CpG}->{$index+1}->{meth}++; } else{ $mbias_2{CpG}->{$index+1}->{meth}++; } } elsif ($methylation_calls[$index] eq 'z') { $counting{total_unmethylated_CpG_count}++; print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CpG}->{$index+1}->{un}++; } else{ $mbias_2{CpG}->{$index+1}->{un}++; } } elsif ($methylation_calls[$index] eq 'H') { $counting{total_meCHH_count}++; print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHH}->{$index+1}->{meth}++; } else{ $mbias_2{CHH}->{$index+1}->{meth}++; } } elsif ($methylation_calls[$index] eq 'h') { $counting{total_unmethylated_CHH_count}++; print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHH}->{$index+1}->{un}++; } else{ $mbias_2{CHH}->{$index+1}->{un}++; } } elsif ($methylation_calls[$index] eq '.') {} elsif (lc$methylation_calls[$index] eq 'u'){} else{ die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n" unless($mbias_only); } } } else { die "The strand orientation as neither + nor -: '$strand'\n"; } } ### strand-specific methylation output ### still within the 2-CONTEXT optional section else { if ($strand eq '+') { for my $index (0..$#methylation_calls) { if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition+index: ",$start+$index,"\t"; $cigar_offset += $cigar_mod; $pos_offset += $pos_mod; } if ($methylation_calls[$index] eq 'X') { $counting{total_meCHG_count}++; print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHG}->{$index+1}->{meth}++; } else{ $mbias_2{CHG}->{$index+1}->{meth}++; } } elsif ($methylation_calls[$index] eq 'x') { $counting{total_unmethylated_CHG_count}++; print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHG}->{$index+1}->{un}++; } else{ $mbias_2{CHG}->{$index+1}->{un}++; } } elsif ($methylation_calls[$index] eq 'Z') { $counting{total_meCpG_count}++; print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CpG}->{$index+1}->{meth}++; } else{ $mbias_2{CpG}->{$index+1}->{meth}++; } } elsif ($methylation_calls[$index] eq 'z') { $counting{total_unmethylated_CpG_count}++; print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CpG}->{$index+1}->{un}++; } else{ $mbias_2{CpG}->{$index+1}->{un}++; } } elsif ($methylation_calls[$index] eq 'H') { $counting{total_meCHH_count}++; print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHH}->{$index+1}->{meth}++; } else{ $mbias_2{CHH}->{$index+1}->{meth}++; } } elsif ($methylation_calls[$index] eq 'h') { $counting{total_unmethylated_CHH_count}++; print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHH}->{$index+1}->{un}++; } else{ $mbias_2{CHH}->{$index+1}->{un}++; } } elsif ($methylation_calls[$index] eq '.') {} elsif (lc$methylation_calls[$index] eq 'u'){} else{ die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; } } } elsif ($strand eq '-') { for my $index (0..$#methylation_calls) { if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition-index: ",$start-$index,"\t"; my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); $cigar_offset += $cigar_mod; $pos_offset += $pos_mod; } if ($methylation_calls[$index] eq 'X') { $counting{total_meCHG_count}++; print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHG}->{$index+1}->{meth}++; } else{ $mbias_2{CHG}->{$index+1}->{meth}++; } } elsif ($methylation_calls[$index] eq 'x') { $counting{total_unmethylated_CHG_count}++; print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHG}->{$index+1}->{un}++; } else{ $mbias_2{CHG}->{$index+1}->{un}++; } } elsif ($methylation_calls[$index] eq 'Z') { $counting{total_meCpG_count}++; print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CpG}->{$index+1}->{meth}++; } else{ $mbias_2{CpG}->{$index+1}->{meth}++; } } elsif ($methylation_calls[$index] eq 'z') { $counting{total_unmethylated_CpG_count}++; print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CpG}->{$index+1}->{un}++; } else{ $mbias_2{CpG}->{$index+1}->{un}++; } } elsif ($methylation_calls[$index] eq 'H') { $counting{total_meCHH_count}++; print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHH}->{$index+1}->{meth}++; } else{ $mbias_2{CHH}->{$index+1}->{meth}++; } } elsif ($methylation_calls[$index] eq 'h') { $counting{total_unmethylated_CHH_count}++; print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHH}->{$index+1}->{un}++; } else{ $mbias_2{CHH}->{$index+1}->{un}++; } } elsif ($methylation_calls[$index] eq '.') {} elsif (lc$methylation_calls[$index] eq 'u'){} else{ die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; } } } else { die "The strand orientation as neither + nor -: '$strand'\n"; } } } } ############################################ ### THIS IS THE DEFAULT 3-CONTEXT OUTPUT ### ############################################ elsif ($no_overlap) { ### single-file CpG, CHG and CHH context output if ($full) { if ($strand eq '+') { for my $index (0..$#methylation_calls) { if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition+index: ",$start+$index,"\t"; $cigar_offset += $cigar_mod; $pos_offset += $pos_mod; } ### Returning as soon as the methylation calls start overlapping if ($start+$index+$pos_offset >= $end_read_1) { return; } if ($methylation_calls[$index] eq 'X') { $counting{total_meCHG_count}++; print {$fhs{CHG_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHG}->{$index+1}->{meth}++; } else{ $mbias_2{CHG}->{$index+1}->{meth}++; } } elsif ($methylation_calls[$index] eq 'x') { $counting{total_unmethylated_CHG_count}++; print {$fhs{CHG_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHG}->{$index+1}->{un}++; } else{ $mbias_2{CHG}->{$index+1}->{un}++; } } elsif ($methylation_calls[$index] eq 'Z') { $counting{total_meCpG_count}++; print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CpG}->{$index+1}->{meth}++; } else{ $mbias_2{CpG}->{$index+1}->{meth}++; } } elsif ($methylation_calls[$index] eq 'z') { $counting{total_unmethylated_CpG_count}++; print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CpG}->{$index+1}->{un}++; } else{ $mbias_2{CpG}->{$index+1}->{un}++; } } elsif ($methylation_calls[$index] eq 'H') { $counting{total_meCHH_count}++; print {$fhs{CHH_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHH}->{$index+1}->{meth}++; } else{ $mbias_2{CHH}->{$index+1}->{meth}++; } } elsif ($methylation_calls[$index] eq 'h') { $counting{total_unmethylated_CHH_count}++; print {$fhs{CHH_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHH}->{$index+1}->{un}++; } else{ $mbias_2{CHH}->{$index+1}->{un}++; } } elsif ($methylation_calls[$index] eq '.') {} elsif (lc$methylation_calls[$index] eq 'u'){} else{ die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; } } } elsif ($strand eq '-') { for my $index (0..$#methylation_calls) { if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition-index: ",$start-$index,"\t"; my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); $cigar_offset += $cigar_mod; $pos_offset += $pos_mod; } ### Returning as soon as the methylation calls start overlapping if ($start-$index+$pos_offset <= $end_read_1) { return; } if ($methylation_calls[$index] eq 'X') { $counting{total_meCHG_count}++; print {$fhs{CHG_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHG}->{$index+1}->{meth}++; } else{ $mbias_2{CHG}->{$index+1}->{meth}++; } } elsif ($methylation_calls[$index] eq 'x') { $counting{total_unmethylated_CHG_count}++; print {$fhs{CHG_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHG}->{$index+1}->{un}++; } else{ $mbias_2{CHG}->{$index+1}->{un}++; } } elsif ($methylation_calls[$index] eq 'Z') { $counting{total_meCpG_count}++; print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CpG}->{$index+1}->{meth}++; } else{ $mbias_2{CpG}->{$index+1}->{meth}++; } } elsif ($methylation_calls[$index] eq 'z') { $counting{total_unmethylated_CpG_count}++; print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CpG}->{$index+1}->{un}++; } else{ $mbias_2{CpG}->{$index+1}->{un}++; } } elsif ($methylation_calls[$index] eq 'H') { $counting{total_meCHH_count}++; print {$fhs{CHH_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHH}->{$index+1}->{meth}++; } else{ $mbias_2{CHH}->{$index+1}->{meth}++; } } elsif ($methylation_calls[$index] eq 'h') { $counting{total_unmethylated_CHH_count}++; print {$fhs{CHH_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHH}->{$index+1}->{un}++; } else{ $mbias_2{CHH}->{$index+1}->{un}++; } } elsif ($methylation_calls[$index] eq '.') {} elsif (lc$methylation_calls[$index] eq 'u'){} else{ die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; } } } else { die "The strand orientation as neither + nor -: '$strand'\n"; } } ### strand-specific methylation output else { if ($strand eq '+') { for my $index (0..$#methylation_calls) { if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition+index: ",$start+$index,"\t"; $cigar_offset += $cigar_mod; $pos_offset += $pos_mod; } ### Returning as soon as the methylation calls start overlapping if ($start+$index+$pos_offset >= $end_read_1) { return; } if ($methylation_calls[$index] eq 'X') { $counting{total_meCHG_count}++; print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHG}->{$index+1}->{meth}++; } else{ $mbias_2{CHG}->{$index+1}->{meth}++; } } elsif ($methylation_calls[$index] eq 'x') { $counting{total_unmethylated_CHG_count}++; print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHG}->{$index+1}->{un}++; } else{ $mbias_2{CHG}->{$index+1}->{un}++; } } elsif ($methylation_calls[$index] eq 'Z') { $counting{total_meCpG_count}++; print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CpG}->{$index+1}->{meth}++; } else{ $mbias_2{CpG}->{$index+1}->{meth}++; } } elsif ($methylation_calls[$index] eq 'z') { $counting{total_unmethylated_CpG_count}++; print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CpG}->{$index+1}->{un}++; } else{ $mbias_2{CpG}->{$index+1}->{un}++; } } elsif ($methylation_calls[$index] eq 'H') { $counting{total_meCHH_count}++; print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHH}->{$index+1}->{meth}++; } else{ $mbias_2{CHH}->{$index+1}->{meth}++; } } elsif ($methylation_calls[$index] eq 'h') { $counting{total_unmethylated_CHH_count}++; print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHH}->{$index+1}->{un}++; } else{ $mbias_2{CHH}->{$index+1}->{un}++; } } elsif ($methylation_calls[$index] eq '.') {} elsif (lc$methylation_calls[$index] eq 'u'){} else{ die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; } } } elsif ($strand eq '-') { for my $index (0..$#methylation_calls) { if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition-index: ",$start-$index,"\t"; my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); $cigar_offset += $cigar_mod; $pos_offset += $pos_mod; } ### Returning as soon as the methylation calls start overlapping if ($start-$index+$pos_offset <= $end_read_1) { return; } if ($methylation_calls[$index] eq 'X') { $counting{total_meCHG_count}++; print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHG}->{$index+1}->{meth}++; } else{ $mbias_2{CHG}->{$index+1}->{meth}++; } } elsif ($methylation_calls[$index] eq 'x') { $counting{total_unmethylated_CHG_count}++; print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHG}->{$index+1}->{un}++; } else{ $mbias_2{CHG}->{$index+1}->{un}++; } } elsif ($methylation_calls[$index] eq 'Z') { $counting{total_meCpG_count}++; print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CpG}->{$index+1}->{meth}++; } else{ $mbias_2{CpG}->{$index+1}->{meth}++; } } elsif ($methylation_calls[$index] eq 'z') { $counting{total_unmethylated_CpG_count}++; print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CpG}->{$index+1}->{un}++; } else{ $mbias_2{CpG}->{$index+1}->{un}++; } } elsif ($methylation_calls[$index] eq 'H') { $counting{total_meCHH_count}++; print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHH}->{$index+1}->{meth}++; } else{ $mbias_2{CHH}->{$index+1}->{meth}++; } } elsif ($methylation_calls[$index] eq 'h') { $counting{total_unmethylated_CHH_count}++; print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHH}->{$index+1}->{un}++; } else{ $mbias_2{CHH}->{$index+1}->{un}++; } } elsif ($methylation_calls[$index] eq '.') {} elsif (lc$methylation_calls[$index] eq 'u'){} else{ die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; } } } else { die "The strand orientation as neither + nor -: '$strand'\n"; } } } ### this is the default paired-end procedure allowing overlaps and using every single C position else { ### single-file CpG, CHG and CHH context output if ($full) { if ($strand eq '+') { for my $index (0..$#methylation_calls) { if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition+index: ",$start+$index,"\t"; $cigar_offset += $cigar_mod; $pos_offset += $pos_mod; } if ($methylation_calls[$index] eq 'X') { $counting{total_meCHG_count}++; print {$fhs{CHG_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHG}->{$index+1}->{meth}++; } else{ $mbias_2{CHG}->{$index+1}->{meth}++; } } elsif ($methylation_calls[$index] eq 'x') { $counting{total_unmethylated_CHG_count}++; print {$fhs{CHG_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHG}->{$index+1}->{un}++; } else{ $mbias_2{CHG}->{$index+1}->{un}++; } } elsif ($methylation_calls[$index] eq 'Z') { $counting{total_meCpG_count}++; print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CpG}->{$index+1}->{meth}++; } else{ $mbias_2{CpG}->{$index+1}->{meth}++; } } elsif ($methylation_calls[$index] eq 'z') { $counting{total_unmethylated_CpG_count}++; print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CpG}->{$index+1}->{un}++; } else{ $mbias_2{CpG}->{$index+1}->{un}++; } } elsif ($methylation_calls[$index] eq 'H') { $counting{total_meCHH_count}++; print {$fhs{CHH_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHH}->{$index+1}->{meth}++; } else{ $mbias_2{CHH}->{$index+1}->{meth}++; } } elsif ($methylation_calls[$index] eq 'h') { $counting{total_unmethylated_CHH_count}++; print {$fhs{CHH_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHH}->{$index+1}->{un}++; } else{ $mbias_2{CHH}->{$index+1}->{un}++; } } elsif ($methylation_calls[$index] eq '.') {} elsif (lc$methylation_calls[$index] eq 'u'){} else{ die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; } } } elsif ($strand eq '-') { for my $index (0..$#methylation_calls) { if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition-index: ",$start-$index,"\t"; my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); $cigar_offset += $cigar_mod; $pos_offset += $pos_mod; } if ($methylation_calls[$index] eq 'X') { $counting{total_meCHG_count}++; print {$fhs{CHG_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHG}->{$index+1}->{meth}++; } else{ $mbias_2{CHG}->{$index+1}->{meth}++; } } elsif ($methylation_calls[$index] eq 'x') { $counting{total_unmethylated_CHG_count}++; print {$fhs{CHG_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHG}->{$index+1}->{un}++; } else{ $mbias_2{CHG}->{$index+1}->{un}++; } } elsif ($methylation_calls[$index] eq 'Z') { $counting{total_meCpG_count}++; print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CpG}->{$index+1}->{meth}++; } else{ $mbias_2{CpG}->{$index+1}->{meth}++; } } elsif ($methylation_calls[$index] eq 'z') { $counting{total_unmethylated_CpG_count}++; print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CpG}->{$index+1}->{un}++; } else{ $mbias_2{CpG}->{$index+1}->{un}++; } } elsif ($methylation_calls[$index] eq 'H') { $counting{total_meCHH_count}++; print {$fhs{CHH_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHH}->{$index+1}->{meth}++; } else{ $mbias_2{CHH}->{$index+1}->{meth}++; } } elsif ($methylation_calls[$index] eq 'h') { $counting{total_unmethylated_CHH_count}++; print {$fhs{CHH_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHH}->{$index+1}->{un}++; } else{ $mbias_2{CHH}->{$index+1}->{un}++; } } elsif ($methylation_calls[$index] eq '.') {} elsif (lc$methylation_calls[$index] eq 'u'){} else{ die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; } } } else { die "The strand orientation as neither + nor -: '$strand'\n"; } } ### strand-specific methylation output else { if ($strand eq '+') { for my $index (0..$#methylation_calls) { if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition+index: ",$start+$index,"\t"; $cigar_offset += $cigar_mod; $pos_offset += $pos_mod; } if ($methylation_calls[$index] eq 'X') { $counting{total_meCHG_count}++; print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHG}->{$index+1}->{meth}++; } else{ $mbias_2{CHG}->{$index+1}->{meth}++; } } elsif ($methylation_calls[$index] eq 'x') { $counting{total_unmethylated_CHG_count}++; print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHG}->{$index+1}->{un}++; } else{ $mbias_2{CHG}->{$index+1}->{un}++; } } elsif ($methylation_calls[$index] eq 'Z') { $counting{total_meCpG_count}++; print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CpG}->{$index+1}->{meth}++; } else{ $mbias_2{CpG}->{$index+1}->{meth}++; } } elsif ($methylation_calls[$index] eq 'z') { $counting{total_unmethylated_CpG_count}++; print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CpG}->{$index+1}->{un}++; } else{ $mbias_2{CpG}->{$index+1}->{un}++; } } elsif ($methylation_calls[$index] eq 'H') { $counting{total_meCHH_count}++; print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHH}->{$index+1}->{meth}++; } else{ $mbias_2{CHH}->{$index+1}->{meth}++; } } elsif ($methylation_calls[$index] eq 'h') { $counting{total_unmethylated_CHH_count}++; print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHH}->{$index+1}->{un}++; } else{ $mbias_2{CHH}->{$index+1}->{un}++; } } elsif ($methylation_calls[$index] eq '.') {} elsif (lc$methylation_calls[$index] eq 'u'){} else{ die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; } } } elsif ($strand eq '-') { for my $index (0..$#methylation_calls) { if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition-index: ",$start-$index,"\t"; my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); $cigar_offset += $cigar_mod; $pos_offset += $pos_mod; } if ($methylation_calls[$index] eq 'X') { $counting{total_meCHG_count}++; print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHG}->{$index+1}->{meth}++; } else{ $mbias_2{CHG}->{$index+1}->{meth}++; } } elsif ($methylation_calls[$index] eq 'x') { $counting{total_unmethylated_CHG_count}++; print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHG}->{$index+1}->{un}++; } else{ $mbias_2{CHG}->{$index+1}->{un}++; } } elsif ($methylation_calls[$index] eq 'Z') { $counting{total_meCpG_count}++; print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CpG}->{$index+1}->{meth}++; } else{ $mbias_2{CpG}->{$index+1}->{meth}++; } } elsif ($methylation_calls[$index] eq 'z') { $counting{total_unmethylated_CpG_count}++; print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CpG}->{$index+1}->{un}++; } else{ $mbias_2{CpG}->{$index+1}->{un}++; } } elsif ($methylation_calls[$index] eq 'H') { $counting{total_meCHH_count}++; print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHH}->{$index+1}->{meth}++; } else{ $mbias_2{CHH}->{$index+1}->{meth}++; } } elsif ($methylation_calls[$index] eq 'h') { $counting{total_unmethylated_CHH_count}++; print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); if ($read_identity == 1){ $mbias_1{CHH}->{$index+1}->{un}++; } else{ $mbias_2{CHH}->{$index+1}->{un}++; } } elsif ($methylation_calls[$index] eq '.') {} elsif (lc$methylation_calls[$index] eq 'u'){} else{ die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; } } } else { die "The strand orientation as neither + nor -: '$strand'\n"; } } } } sub check_cigar_string { my ($index,$cigar_offset,$pos_offset,$strand,$comp_cigar) = @_; # print "$index\t$cigar_offset\t$pos_offset\t$strand\t"; my ($new_cigar_offset,$new_pos_offset) = (0,0); if ($strand eq '+') { # print "### $strand strand @$comp_cigar[$index + $cigar_offset]\t"; if (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'M'){ # sequence position matches the genomic position # warn "position needs no adjustment\n"; } elsif (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'I'){ # insertion in the read sequence $new_pos_offset -= 1; # we need to subtract the length of inserted bases from the genomic position # warn "adjusted genomic position by -1 bp (insertion)\n"; } elsif (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'D'){ # deletion in the read sequence $new_cigar_offset += 1; # the composite cigar string does no longer match the methylation call index $new_pos_offset += 1; # we need to add the length of deleted bases to get the genomic position # warn "adjusted genomic position by +1 bp (deletion). Now looping through the CIGAR string until we hit another M or I\n"; while ( ($index + $cigar_offset + $new_cigar_offset) < (scalar @$comp_cigar) ){ if (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'M'){ # sequence position matches the genomic position # warn "position needs no adjustment\n"; last; } elsif (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'I'){ $new_pos_offset -= 1; # we need to subtract the length of inserted bases from the genomic position # warn "adjusted genomic position by another -1 bp (insertion)\n"; last; } elsif (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'D'){ # deletion in the read sequence $new_cigar_offset += 1; # the composite cigar string does no longer match the methylation call index $new_pos_offset += 1; # we need to add the length of deleted bases to get the genomic position # warn "adjusted genomic position by another +1 bp (deletion)\n"; } else{ die "The CIGAR string contained undefined operations in addition to 'M', 'I' and 'D': '@$comp_cigar[$index + $cigar_offset + $new_cigar_offset]'\n"; } } } else{ die "The CIGAR string contained undefined operations in addition to 'M', 'I' and 'D': '@$comp_cigar[$index + $cigar_offset + $new_cigar_offset]'\n"; } } elsif ($strand eq '-') { # print "### $strand strand @$comp_cigar[$index + $cigar_offset]\t"; if (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'M'){ # sequence position matches the genomic position # warn "position needs no adjustment\n"; } elsif (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'I'){ # insertion in the read sequence $new_pos_offset += 1; # we need to add the length of inserted bases to the genomic position # warn "adjusted genomic position by +1 bp (insertion)\n"; } elsif (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'D'){ # deletion in the read sequence $new_cigar_offset += 1; # the composite cigar string does no longer match the methylation call index $new_pos_offset -= 1; # we need to subtract the length of deleted bases to get the genomic position # warn "adjusted genomic position by -1 bp (deletion). Now looping through the CIGAR string until we hit another M or I\n"; while ( ($index + $cigar_offset + $new_cigar_offset) < (scalar @$comp_cigar) ){ if (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'M'){ # sequence position matches the genomic position # warn "Found new 'M' operation; position needs no adjustment\n"; last; } elsif (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'I'){ $new_pos_offset += 1; # we need to subtract the length of inserted bases from the genomic position # warn "Found new 'I' operation; adjusted genomic position by another +1 bp (insertion)\n"; last; } elsif (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'D'){ # deletion in the read sequence $new_cigar_offset += 1; # the composite cigar string does no longer match the methylation call index $new_pos_offset -= 1; # we need to subtract the length of deleted bases to get the genomic position # warn "adjusted genomic position by another -1 bp (deletion)\n"; } else{ die "The CIGAR string contained undefined operations in addition to 'M', 'I' and 'D': '@$comp_cigar[$index + $cigar_offset + $new_cigar_offset]'\n"; } } } else{ die "The CIGAR string contained undefined operations in addition to 'M', 'I' and 'D': '@$comp_cigar[$index + $cigar_offset + $new_cigar_offset]'\n"; } } # print "new cigar offset: $new_cigar_offset\tnew pos offset: $new_pos_offset\n"; return ($new_cigar_offset,$new_pos_offset); } sub print_individual_C_methylation_states_single_end{ my ($meth_call,$chrom,$start,$id,$strand,$filehandle_index,$cigar) = @_; my @methylation_calls = split(//,$meth_call); ################################################################# ### . for bases not involving cytosines ### ### X for methylated C in CHG context (was protected) ### ### x for not methylated C in CHG context (was converted) ### ### H for methylated C in CHH context (was protected) ### ### h for not methylated C in CHH context (was converted) ### ### Z for methylated C in CpG context (was protected) ### ### z for not methylated C in CpG context (was converted) ### ################################################################# my $methyl_CHG_count = 0; my $methyl_CHH_count = 0; my $methyl_CpG_count = 0; my $unmethylated_CHG_count = 0; my $unmethylated_CHH_count = 0; my $unmethylated_CpG_count = 0; my $pos_offset = 0; # this is only relevant for SAM reads with insertions or deletions my $cigar_offset = 0; # again, this is only relevant for SAM reads containing indels my @comp_cigar; if ($cigar){ # parsing CIGAR string ### Checking whether the CIGAR string is a linear genomic match or whether if requires indel processing if ($cigar =~ /^\d+M$/){ # warn "See!? I told you so! $cigar\n"; # sleep(1); } else{ my @len; my @ops; @len = split (/\D+/,$cigar); # storing the length per operation @ops = split (/\d+/,$cigar); # storing the operation shift @ops; # remove the empty first element # die "CIGAR string contained a non-matching number of lengths and operations: id: $id\nmeth call: $meth_call\nCIGAR: $cigar\n".join(" ",@len)."\n".join(" ",@ops)."\n" unless (scalar @len == scalar @ops); die "CIGAR string contained a non-matching number of lengths and operations\n" unless (scalar @len == scalar @ops); foreach my $index (0..$#len){ foreach (1..$len[$index]){ # print "$ops[$index]"; push @comp_cigar, $ops[$index]; } } } # warn "\nDetected CIGAR string: $cigar\n"; # warn "Length of methylation call: ",length $meth_call,"\n"; # warn "number of operations: ",scalar @ops,"\n"; # warn "number of length digits: ",scalar @len,"\n\n"; # print @comp_cigar,"\n"; # print "$meth_call\n\n"; # sleep (1); } ### adjusting the start position for all reads mapping to the reverse strand if ($strand eq '-') { if (@comp_cigar){ # only needed for SAM reads with InDels @comp_cigar = reverse@comp_cigar; # the CIGAR string needs to be reversed for all reads aligning to the reverse strand, too # print @comp_cigar,"\n"; } unless ($ignore){ ### if --ignore was specified the start position has already been corrected if ($cigar){ ### SAM format if ($cigar =~ /^(\d+)M$/){ # linear match $start += $1 - 1; } else{ # InDel read my $MD_count = 0; foreach (@comp_cigar){ ++$MD_count if ($_ eq 'M' or $_ eq 'D'); # Matching bases or deletions affect the genomic position of the 3' ends of reads, insertions don't } $start += $MD_count - 1; } } else{ ### vanilla format $start += length($meth_call)-1; } } } ### THIS IS THE CpG and Non-CpG SECTION (OPTIONAL) ### single-file CpG and other-context output if ($full and $merge_non_CpG) { if ($strand eq '+') { for my $index (0..$#methylation_calls) { if ($cigar and @comp_cigar){ # only needed for SAM alignments with InDels my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition+index: ",$start+$index,"\t"; $cigar_offset += $cigar_mod; $pos_offset += $pos_mod; } ### methylated Cs (any context) will receive a forward (+) orientation ### not methylated Cs (any context) will receive a reverse (-) orientation if ($methylation_calls[$index] eq 'X') { $counting{total_meCHG_count}++; print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); $mbias_1{CHG}->{$index+1}->{meth}++; } elsif ($methylation_calls[$index] eq 'x') { $counting{total_unmethylated_CHG_count}++; print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); $mbias_1{CHG}->{$index+1}->{un}++; } elsif ($methylation_calls[$index] eq 'Z') { $counting{total_meCpG_count}++; print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); $mbias_1{CpG}->{$index+1}->{meth}++; } elsif ($methylation_calls[$index] eq 'z') { $counting{total_unmethylated_CpG_count}++; print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); $mbias_1{CpG}->{$index+1}->{un}++; } elsif ($methylation_calls[$index] eq 'H') { $counting{total_meCHH_count}++; print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); $mbias_1{CHH}->{$index+1}->{meth}++; } elsif ($methylation_calls[$index] eq 'h') { $counting{total_unmethylated_CHH_count}++; print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); $mbias_1{CHH}->{$index+1}->{un}++; } elsif ($methylation_calls[$index] eq '.') {} elsif (lc$methylation_calls[$index] eq 'u'){} else{ die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; } } } elsif ($strand eq '-') { for my $index (0..$#methylation_calls) { ### methylated Cs (any context) will receive a forward (+) orientation ### not methylated Cs (any context) will receive a reverse (-) orientation if ($cigar and @comp_cigar){ # only needed for SAM entries with InDels # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition-index: ",$start-$index,"\t"; my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); $cigar_offset += $cigar_mod; $pos_offset += $pos_mod; } if ($methylation_calls[$index] eq 'X') { $counting{total_meCHG_count}++; print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); $mbias_1{CHG}->{$index+1}->{meth}++; } elsif ($methylation_calls[$index] eq 'x') { $counting{total_unmethylated_CHG_count}++; print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); $mbias_1{CHG}->{$index+1}->{un}++; } elsif ($methylation_calls[$index] eq 'Z') { $counting{total_meCpG_count}++; print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); $mbias_1{CpG}->{$index+1}->{meth}++; } elsif ($methylation_calls[$index] eq 'z') { $counting{total_unmethylated_CpG_count}++; print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); $mbias_1{CpG}->{$index+1}->{un}++; } elsif ($methylation_calls[$index] eq 'H') { $counting{total_meCHH_count}++; print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); $mbias_1{CHH}->{$index+1}->{meth}++; } elsif ($methylation_calls[$index] eq 'h') { $counting{total_unmethylated_CHH_count}++; print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); $mbias_1{CHH}->{$index+1}->{un}++; } elsif ($methylation_calls[$index] eq '.'){} elsif (lc$methylation_calls[$index] eq 'u'){} else{ die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; } } } else { die "The strand information was neither + nor -: $strand\n"; } } ### strand-specific methylation output elsif ($merge_non_CpG) { if ($strand eq '+') { for my $index (0..$#methylation_calls) { ### methylated Cs (any context) will receive a forward (+) orientation ### not methylated Cs (any context) will receive a reverse (-) orientation if ($cigar and @comp_cigar){ # only needed for SAM reads with Indels my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); $cigar_offset += $cigar_mod; $pos_offset += $pos_mod; } if ($methylation_calls[$index] eq 'X') { $counting{total_meCHG_count}++; print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); $mbias_1{CHG}->{$index+1}->{meth}++; } elsif ($methylation_calls[$index] eq 'x') { $counting{total_unmethylated_CHG_count}++; print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); $mbias_1{CHG}->{$index+1}->{un}++; } elsif ($methylation_calls[$index] eq 'Z') { $counting{total_meCpG_count}++; print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); $mbias_1{CpG}->{$index+1}->{meth}++; } elsif ($methylation_calls[$index] eq 'z') { $counting{total_unmethylated_CpG_count}++; print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); $mbias_1{CpG}->{$index+1}->{un}++; } elsif ($methylation_calls[$index] eq 'H') { $counting{total_meCHH_count}++; print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); $mbias_1{CHH}->{$index+1}->{meth}++; } elsif ($methylation_calls[$index] eq 'h') { $counting{total_unmethylated_CHH_count}++; print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); $mbias_1{CHH}->{$index+1}->{un}++; } elsif ($methylation_calls[$index] eq '.') {} elsif (lc$methylation_calls[$index] eq 'u'){} else{ die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; } } } elsif ($strand eq '-') { for my $index (0..$#methylation_calls) { ### methylated Cs (any context) will receive a forward (+) orientation ### not methylated Cs (any context) will receive a reverse (-) orientation if ($cigar and @comp_cigar){ # only needed for SAM reads with Indels my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); $cigar_offset += $cigar_mod; $pos_offset += $pos_mod; } if ($methylation_calls[$index] eq 'X') { $counting{total_meCHG_count}++; print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); $mbias_1{CHG}->{$index+1}->{meth}++; } elsif ($methylation_calls[$index] eq 'x') { $counting{total_unmethylated_CHG_count}++; print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); $mbias_1{CHG}->{$index+1}->{un}++; } elsif ($methylation_calls[$index] eq 'Z') { $counting{total_meCpG_count}++; print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); $mbias_1{CpG}->{$index+1}->{meth}++; } elsif ($methylation_calls[$index] eq 'z') { $counting{total_unmethylated_CpG_count}++; print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); $mbias_1{CpG}->{$index+1}->{un}++; } elsif ($methylation_calls[$index] eq 'H') { $counting{total_meCHH_count}++; print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); $mbias_1{CHH}->{$index+1}->{meth}++; } elsif ($methylation_calls[$index] eq 'h') { $counting{total_unmethylated_CHH_count}++; print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); $mbias_1{CHH}->{$index+1}->{un}++; } elsif ($methylation_calls[$index] eq '.') {} elsif (lc$methylation_calls[$index] eq 'u'){} else{ die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; } } } else { die "The strand information was neither + nor -: $strand\n"; } } ### THIS IS THE 3-CONTEXT (CpG, CHG and CHH) DEFAULT SECTION elsif ($full) { if ($strand eq '+') { for my $index (0..$#methylation_calls) { ### methylated Cs (any context) will receive a forward (+) orientation ### not methylated Cs (any context) will receive a reverse (-) orientation if ($cigar and @comp_cigar){ # only needed for SAM reads with Indels my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); $cigar_offset += $cigar_mod; $pos_offset += $pos_mod; } if ($methylation_calls[$index] eq 'X') { $counting{total_meCHG_count}++; print {$fhs{CHG_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); $mbias_1{CHG}->{$index+1}->{meth}++; } elsif ($methylation_calls[$index] eq 'x') { $counting{total_unmethylated_CHG_count}++; print {$fhs{CHG_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); $mbias_1{CHG}->{$index+1}->{un}++; } elsif ($methylation_calls[$index] eq 'Z') { $counting{total_meCpG_count}++; print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); $mbias_1{CpG}->{$index+1}->{meth}++; } elsif ($methylation_calls[$index] eq 'z') { $counting{total_unmethylated_CpG_count}++; print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); $mbias_1{CpG}->{$index+1}->{un}++; } elsif ($methylation_calls[$index] eq 'H') { $counting{total_meCHH_count}++; print {$fhs{CHH_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); $mbias_1{CHH}->{$index+1}->{meth}++; } elsif ($methylation_calls[$index] eq 'h') { $counting{total_unmethylated_CHH_count}++; print {$fhs{CHH_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); $mbias_1{CHH}->{$index+1}->{un}++; } elsif ($methylation_calls[$index] eq '.') {} elsif (lc$methylation_calls[$index] eq 'u'){} else{ die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n" unless($mbias_only); } } } elsif ($strand eq '-') { for my $index (0..$#methylation_calls) { ### methylated Cs (any context) will receive a forward (+) orientation ### not methylated Cs (any context) will receive a reverse (-) orientation if ($cigar and @comp_cigar){ # only needed for SAM reads with Indels my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); $cigar_offset += $cigar_mod; $pos_offset += $pos_mod; } if ($methylation_calls[$index] eq 'X') { $counting{total_meCHG_count}++; print {$fhs{CHG_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); $mbias_1{CHG}->{$index+1}->{meth}++; } elsif ($methylation_calls[$index] eq 'x') { $counting{total_unmethylated_CHG_count}++; print {$fhs{CHG_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); $mbias_1{CHG}->{$index+1}->{un}++; } elsif ($methylation_calls[$index] eq 'Z') { $counting{total_meCpG_count}++; print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); $mbias_1{CpG}->{$index+1}->{meth}++; } elsif ($methylation_calls[$index] eq 'z') { $counting{total_unmethylated_CpG_count}++; print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); $mbias_1{CpG}->{$index+1}->{un}++; } elsif ($methylation_calls[$index] eq 'H') { $counting{total_meCHH_count}++; print {$fhs{CHH_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); $mbias_1{CHH}->{$index+1}->{meth}++; } elsif ($methylation_calls[$index] eq 'h') { $counting{total_unmethylated_CHH_count}++; print {$fhs{CHH_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); $mbias_1{CHH}->{$index+1}->{un}++; } elsif ($methylation_calls[$index] eq '.') {} elsif (lc$methylation_calls[$index] eq 'u'){} else{ die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; } } } else { die "The read had a strand orientation which was neither + nor -: $strand\n"; } } ### strand-specific methylation output else { if ($strand eq '+') { for my $index (0..$#methylation_calls) { ### methylated Cs (any context) will receive a forward (+) orientation ### not methylated Cs (any context) will receive a reverse (-) orientation if ($cigar and @comp_cigar){ # only needed for SAM reads with Indels my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); $cigar_offset += $cigar_mod; $pos_offset += $pos_mod; } if ($methylation_calls[$index] eq 'X') { $counting{total_meCHG_count}++; print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); $mbias_1{CHG}->{$index+1}->{meth}++; } elsif ($methylation_calls[$index] eq 'x') { $counting{total_unmethylated_CHG_count}++; print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); $mbias_1{CHG}->{$index+1}->{un}++; } elsif ($methylation_calls[$index] eq 'Z') { $counting{total_meCpG_count}++; print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); $mbias_1{CpG}->{$index+1}->{meth}++; } elsif ($methylation_calls[$index] eq 'z') { $counting{total_unmethylated_CpG_count}++; print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); $mbias_1{CpG}->{$index+1}->{un}++; } elsif ($methylation_calls[$index] eq 'H') { $counting{total_meCHH_count}++; print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); $mbias_1{CHH}->{$index+1}->{meth}++; } elsif ($methylation_calls[$index] eq 'h') { $counting{total_unmethylated_CHH_count}++; print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); $mbias_1{CHH}->{$index+1}->{un}++; } elsif ($methylation_calls[$index] eq '.') {} elsif (lc$methylation_calls[$index] eq 'u'){} else{ die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; } } } elsif ($strand eq '-') { for my $index (0..$#methylation_calls) { ### methylated Cs (any context) will receive a forward (+) orientation ### not methylated Cs (any context) will receive a reverse (-) orientation if ($cigar and @comp_cigar){ # only needed for SAM reads with Indels my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); $cigar_offset += $cigar_mod; $pos_offset += $pos_mod; } if ($methylation_calls[$index] eq 'X') { $counting{total_meCHG_count}++; print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); $mbias_1{CHG}->{$index+1}->{meth}++; } elsif ($methylation_calls[$index] eq 'x') { $counting{total_unmethylated_CHG_count}++; print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); $mbias_1{CHG}->{$index+1}->{un}++; } elsif ($methylation_calls[$index] eq 'Z') { $counting{total_meCpG_count}++; print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); $mbias_1{CpG}->{$index+1}->{meth}++; } elsif ($methylation_calls[$index] eq 'z') { $counting{total_unmethylated_CpG_count}++; print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); $mbias_1{CpG}->{$index+1}->{un}++; } elsif ($methylation_calls[$index] eq 'H') { $counting{total_meCHH_count}++; print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); $mbias_1{CHH}->{$index+1}->{meth}++; } elsif ($methylation_calls[$index] eq 'h') { $counting{total_unmethylated_CHH_count}++; print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n" unless($mbias_only); $mbias_1{CHH}->{$index+1}->{un}++; } elsif ($methylation_calls[$index] eq '.') {} elsif (lc$methylation_calls[$index] eq 'u'){} else{ die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; } } } else { die "The strand information was neither + nor -: $strand\n"; } } } sub print_helpfile{ print << 'HOW_TO'; DESCRIPTION The following is a brief description of all options to control the Bismark methylation extractor. The script reads in a bisulfite read alignment results file produced by the Bismark bisulfite mapper and extracts the methylation information for individual cytosines. This information is found in the methylation call field which can contain the following characters: ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ~~~ X for methylated C in CHG context ~~~ ~~~ x for not methylated C CHG ~~~ ~~~ H for methylated C in CHH context ~~~ ~~~ h for not methylated C in CHH context ~~~ ~~~ Z for methylated C in CpG context ~~~ ~~~ z for not methylated C in CpG context ~~~ ~~~ U for methylated C in Unknown context (CN or CHN ~~~ ~~~ u for not methylated C in Unknown context (CN or CHN) ~~~ ~~~ . for any bases not involving cytosines ~~~ ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ The methylation extractor outputs result files for cytosines in CpG, CHG and CHH context (this distinction is actually already made in Bismark itself). As the methylation information for every C analysed can produce files which easily have tens or even hundreds of millions of lines, file sizes can become very large and more difficult to handle. The C methylation info additionally splits cytosine methylation calls up into one of the four possible strands a given bisulfite read aligned against: OT original top strand CTOT complementary to original top strand OB original bottom strand CTOB complementary to original bottom strand Thus, by default twelve individual output files are being generated per input file (unless --comprehensive is specified, see below). The output files can be imported into a genome viewer, such as SeqMonk, and re-combined into a single data group if desired (in fact unless the bisulfite reads were generated preserving directionality it doesn't make any sense to look at the data in a strand-specific manner). Strand-specific output files can optionally be skipped, in which case only three output files for CpG, CHG or CHH context will be generated. For both the strand-specific and comprehensive outputs there is also the option to merge both non-CpG contexts (CHG and CHH) into one single non-CpG context. The output files are in the following format (tab delimited): <sequence_id> <strand> <chromosome> <position> <methylation call> USAGE: methylation_extractor [options] <filenames> ARGUMENTS: ========== <filenames> A space-separated list of Bismark result files in SAM format from which methylation information is extracted for every cytosine in the reads. For alignment files in the older custom Bismark output see option '--vanilla'. OPTIONS: -s/--single-end Input file(s) are Bismark result file(s) generated from single-end read data. Specifying either --single-end or --paired-end is mandatory. -p/--paired-end Input file(s) are Bismark result file(s) generated from paired-end read data. Specifying either --paired-end or --single-end is mandatory. --vanilla The Bismark result input file(s) are in the old custom Bismark format (up to version 0.5.x) and not in SAM format which is the default as of Bismark version 0.6.x or higher. Default: OFF. --no_overlap For paired-end reads it is theoretically possible that read_1 and read_2 overlap. This option avoids scoring overlapping methylation calls twice (only methylation calls of read 1 are used for in the process since read 1 has historically higher quality basecalls than read 2). Whilst this option removes a bias towards more methylation calls in the center of sequenced fragments it may de facto remove a sizable proportion of the data. This option is highly recommended for paired-end data. --ignore <int> Ignore the first <int> bp from the 5' end of Read 1 when processing the methylation call string. This can remove e.g. a restriction enzyme site at the start of each read or any other source of bias (e.g. PBAT-Seq data). --ignore_r2 <int> Ignore the first <int> bp from the 5' end of Read 2 of paired-end sequencing results only. Since the first couple of bases in Read 2 of BS-Seq experiments show a severe bias towards non-methylation as a result of end-repairing sonicated fragments with unmethylated cytosines (see M-bias plot), it is recommended that the first couple of bp of Read 2 are removed before starting downstream analysis. Please see the section on M-bias plots in the Bismark User Guide for more details. --comprehensive Specifying this option will merge all four possible strand-specific methylation info into context-dependent output files. The default contexts are: - CpG context - CHG context - CHH context --merge_non_CpG This will produce two output files (in --comprehensive mode) or eight strand-specific output files (default) for Cs in - CpG context - non-CpG context --report Prints out a short methylation summary as well as the paramaters used to run this script. --no_header Suppresses the Bismark version header line in all output files for more convenient batch processing. -o/--output DIR Allows specification of a different output directory (absolute or relative path). If not specified explicitely, the output will be written to the current directory. --samtools_path The path to your Samtools installation, e.g. /home/user/samtools/. Does not need to be specified explicitly if Samtools is in the PATH already. --gzip The methylation extractor files (CpG_OT_..., CpG_OB_... etc) will be written out in a GZIP compressed form to save disk space. This option does not work on bedGraph and genome-wide cytosine reports as they are 'tiny' anyway. --version Displays version information. -h/--help Displays this help file and exits. --mbias_only The methylation extractor will read the entire file but only output the M-bias table and plots as well as a report (optional) and then quit. Default: OFF. bedGraph specific options: ========================== --bedGraph After finishing the methylation extraction, the methylation output is written into a sorted bedGraph file that reports the position of a given cytosine and its methylation state (in %, see details below). The methylation extractor output is temporarily split up into temporary files, one per chromosome (written into the current directory or folder specified with -o/--output); these temp files are then used for sorting and deleted afterwards. By default, only cytosines in CpG context will be sorted. The option '--CX_context' may be used to report all cytosines irrespective of sequence context (this will take MUCH longer!). The default folder for temporary files during the sorting process is the output directory. The bedGraph conversion step is performed by the external module 'bismark2bedGraph'; this script needs to reside in the same folder as the bismark_methylation_extractor itself. --cutoff [threshold] The minimum number of times a methylation state has to be seen for that nucleotide before its methylation percentage is reported. Default: 1. --remove_spaces Replaces whitespaces in the sequence ID field with underscores to allow sorting. --CX/--CX_context The sorted bedGraph output file contains information on every single cytosine that was covered in the experiment irrespective of its sequence context. This applies to both forward and reverse strands. Please be aware that this option may generate large temporary and output files and may take a long time to sort (up to many hours). Default: OFF. (i.e. Default = CpG context only). --buffer_size <string> This allows you to specify the main memory sort buffer when sorting the methylation information. Either specify a percentage of physical memory by appending % (e.g. --buffer_size 50%) or a multiple of 1024 bytes, e.g. 'K' multiplies by 1024, 'M' by 1048576 and so on for 'T' etc. (e.g. --buffer_size 20G). For more information on sort type 'info sort' on a command line. Defaults to 2G. --scaffolds/--gazillion Users working with unfinished genomes sporting tens or even hundreds of thousands of scaffolds/contigs/chromosomes frequently encountered errors with pre-sorting reads to individual chromosome files. These errors were caused by the operating system's limit of the number of filehandle that can be written to at any one time (typically 1024; to find out this limit on Linux, type: ulimit -a). To bypass the limitation of open filehandles, the option --scaffolds does not pre-sort methylation calls into individual chromosome files. Instead, all input files are temporarily merged into a single file (unless there is only a single file), and this file will then be sorted by both chromosome AND position using the Unix sort command. Please be aware that this option might take a looooong time to complete, depending on the size of the input files, and the memory you allocate to this process (see --buffer_size). Nevertheless, it seems to be working. --ample_memory Using this option will not sort chromosomal positions using the UNIX 'sort' command, but will instead use two arrays to sort methylated and unmethylated calls. This may result in a faster sorting process of very large files, but this comes at the cost of a larger memory footprint (two arrays of the length of the largest human chromosome 1 (~250M bp) consume around 16GB of RAM). Due to overheads in creating and looping through these arrays it seems that it will actually be *slower* for small files (few million alignments), and we are currently testing at which point it is advisable to use this option. Note that --ample_memory is not compatible with options '--scaffolds/--gazillion' (as it requires pre-sorted files to begin with). Genome-wide cytosine methylation report specific options: ========================================================= --cytosine_report After the conversion to bedGraph has completed, the option '--cytosine_report' produces a genome-wide methylation report for all cytosines in the genome. By default, the output uses 1-based chromosome coordinates (zero-based cords are optional) and reports CpG context only (all cytosine context is optional). The output considers all Cs on both forward and reverse strands and reports their position, strand, trinucleotide content and methylation state (counts are 0 if not covered). The cytsoine report conversion step is performed by the external module 'bedGraph2cytosine'; this script needs to reside in the same folder as the bismark_methylation_extractor itself. --CX/--CX_context The output file contains information on every single cytosine in the genome irrespective of its context. This applies to both forward and reverse strands. Please be aware that this will generate output files with > 1.1 billion lines for a mammalian genome such as human or mouse. Default: OFF (i.e. Default = CpG context only). --zero_based Uses zero-based coordinates like used in e.g. bed files instead of 1-based coordinates. Default: OFF. --genome_folder <path> Enter the genome folder you wish to use to extract sequences from (full path only). Accepted formats are FastA files ending with '.fa' or '.fasta'. Specifying a genome folder path is mandatory. --split_by_chromosome Writes the output into individual files for each chromosome instead of a single output file. Files will be named to include the input filename and the chromosome number. OUTPUT: The bismark_methylation_extractor output is in the form: ======================================================== <seq-ID> <methylation state*> <chromosome> <start position (= end position)> <methylation call> * Methylated cytosines receive a '+' orientation, * Unmethylated cytosines receive a '-' orientation. The bedGraph output (optional) looks like this (tab-delimited; 0-based start coords, 1-based end coords): ========================================================================================================= track type=bedGraph (header line) <chromosome> <start position> <end position> <methylation percentage> The coverage output looks like this (tab-delimited, 1-based genomic coords): ============================================================================ <chromosome> <start position> <end position> <methylation percentage> <count methylated> <count non-methylated> The genome-wide cytosine methylation output file is tab-delimited in the following format: ========================================================================================== <chromosome> <position> <strand> <count methylated> <count non-methylated> <C-context> <trinucleotide context> This script was last modified on 25 November 2013. HOW_TO }