Mercurial > repos > bgruening > circexplorer

changeset 0:7488fa30b865 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/circexplorer commit a35817eb4119e6d674d01a5f7f91d4cddd0155d1-dirty
author bgruening
date Mon, 06 Jun 2016 18:12:32 -0400
parents
children c3b5869b95fd
files circexplorer.xml static/images/flow.jpg test-data/circ_Chimeric.out.junction test-data/circ_genome.fasta test-data/circ_output.txt test-data/circ_ref.txt test-data/circ_tophat.bam
diffstat 6 files changed, 110 insertions(+), 0 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/circexplorer.xml	Mon Jun 06 18:12:32 2016 -0400
@@ -0,0 +1,90 @@
+<tool id="circexplorer" name="CIRCexplorer" version="0.1.0">
+    <requirements>
+        <requirement type="package" version="0.1">circexplorer</requirement>
+    </requirements>
+    <command><![CDATA[
+        #if str($input_selection.input_type) == "star"
+            star_parse.py "$input_selection.junc" ./fusion_junctions.txt &&
+        #end if
+
+        CIRCexplorer.py
+
+        #if str($input_selection.input_type) == "tophat"
+            -f "$input_selection.fusion"
+        #elif str($input_selection.input_type) == "star"
+            -j ./fusion_junctions.txt
+        #end if
+
+        -g "$genome"
+        -r "$ref"
+        $no_fix
+]]>
+    </command>
+    <inputs>
+        <conditional name="input_selection">
+            <param name="input_type" type="select" label="Select input type" help="">
+                <option value="tophat">TopHat &amp; TopHat-Fusion</option>
+                <option value="star">STAR</option>
+            </param>
+            <when value="tophat">
+                <param argument="--fusion" type="data" format="bam" label="TopHat-Fusion fusion BAM file (used in TopHat-Fusion mapping)" />
+            </when>
+            <when value="star">
+                <param argument="--junc" type="data" format="bam" label="STAR Chimeric junction file (used in STAR mapping)" />
+            </when>
+        </conditional>
+
+        <param argument="--genome" type="data" format="fasta" label="Genome FASTA file" />
+
+        <param argument="--ref" type="data" format="txt" label="Gene annotation" />
+
+        <param name="no_fix" type="boolean" checked="false" truevalue="--no-fix" falsevalue=""
+               label="No-fix mode (useful for species with poor gene annotations)" help="(--no-fix)" />
+    </inputs>
+    <outputs>
+        <data name="output" format="txt"/>
+    </outputs>
+    <tests>
+        <test>
+            <param name="input_type" value="tophat" />
+            <param name="fusion" value="circ_tophat.bam" />
+            <param name="genome" value="circ_genome.fasta" />
+            <param name="ref" value="circ_ref.txt" />
+            <output name="output" file="circ_output.txt" ftype="txt"/>
+        </test>
+        <test>
+            <param name="input_type" value="star" />
+            <param name="junc" value="circ_Chimeric.out.junction" />
+            <param name="genome" value="circ_genome.fasta" />
+            <param name="ref" value="circ_ref.txt" />
+            <output name="output" file="circ_output.txt" ftype="txt"/>
+        </test>
+    </tests>
+    <help>
+**What it does**
+
+`CIRCexplorer`_ is a combined strategy to identify junction reads from back spliced exons and intron lariats.
+
+**A schematic flow shows the pipeline**
+
+.. image:: $PATH_TO_IMAGES/flow.jpg
+
+.. _CIRCexplorer: https://github.com/YangLab/CIRCexplorer
+
+**Notice**
+
+CIRCexplorer is now only a circular RNA annotating tool and it parses fusion junction information from mapping results of other aligners. The result of circular RNA annotating directly depends on the mapping strategy of aligners. Different aligners may have different circular RNA annotations. CIRCexplorer is now only in charge of giving fusion junctions a correct gene annotation. Other functions and supports for more aligners are under development.
+    </help>
+    <citations>
+        <citation type="bibtex">
+            @article{Cell,
+                author = {Zhang XO, Wang HB, Zhang Y, Lu X, Chen LL and Yang L},
+                year = {2014},
+                title = {Complementary Sequence-Mediated Exon Circularization},
+                publisher = {Cell},
+                journal = {Cell},
+                url = {http://www.cell.com/cell/abstract/S0092-8674(14)01111-8},
+            }
+        </citation>
+    </citations>
+</tool>
Binary file static/images/flow.jpg has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/circ_Chimeric.out.junction	Mon Jun 06 18:12:32 2016 -0400
@@ -0,0 +1,5 @@
+chr14	50329517	+	chr7	101273023	-	0	0	0	NB500961:75:HK5KFBGXX:1:11101:16270:1101	50320455	38M8935N89M24S	101273007	8S16M127S
+GL000255.1	2529926	+	chr15	43404287	+	0	0	0	NB500961:75:HK5KFBGXX:1:11101:12553:1148	2529791	135M16S	43404288	135S16M
+chrM	2627	-	chr7	101273023	-	0	0	0	NB500961:75:HK5KFBGXX:1:11101:23326:1154	2628	15S136M	101273008	15M136S
+chr15	40627489	+	chr15	40625526	+	0	0	0	NB500961:75:HK5KFBGXX:1:11101:24169:1220	40627445	44M107S	40625527	44S107M
+chr18	22007961	-	chr7	101273023	-	0	0	0	NB500961:75:HK5KFBGXX:1:11101:19668:1230	22007962	17S50M821N53M1400N31M	101273007	1S16M134S
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/circ_genome.fasta	Mon Jun 06 18:12:32 2016 -0400
@@ -0,0 +1,14 @@
+>test_chromosome
+AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+ACTACTATCTGACTAGACTGGAGGCGCTTGCGACTGAGCTAGGACGTGCC
+ACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGC
+AGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCT
+ACGTATTTGGCGCGCGGCGCTACGGCTGAGCGTCGAGCTTGCGATACGCC
+GTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG
+ACTATTACTTTATTATCTTACTCGGACGTAGACGGATCGGCAACGGGACT
+GTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG
+TTTTCTACTTGAGACTGGGATCGAGGCGGACTTTTTAGGACGGGACTTGC
+AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/circ_ref.txt	Mon Jun 06 18:12:32 2016 -0400
@@ -0,0 +1,1 @@
+SMARCA4	NM_003072	chr19	+	11071597	11172958	11094827	11172492	35	11071597,11094796,11095948,11096864,11097580,11098341,11099992,11101825,11105503,11106888,11107169,11113704,11114015,11118577,11121056,11123624,11129632,11130266,11132400,11134193,11135006,11136097,11136975,11138459,11141405,11143965,11144442,11144798,11145589,11151982,11168930,11169463,11170428,11170720,11172459,	11071850,11095049,11096081,11097269,11097679,11098600,11100119,11101999,11105677,11107056,11107220,11113835,11114073,11118699,11121207,11123788,11129699,11130377,11132643,11134307,11135114,11136184,11137022,11138626,11141569,11144193,11144541,11144876,11145808,11152236,11169039,11169565,11170561,11170863,11172958,
Binary file test-data/circ_tophat.bam has changed