# HG changeset patch
# User bgruening
# Date 1445366592 14400
# Node ID 5231f398d784023e0e8ff8727c193ed70b3b7820
# Parent  3a2aab18a217a98155aa6d24339993b7d23dc3d0
planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 3bc1d1c6f4e28ac7ff8df79fe4e3f00a195938e6-dirty

diff -r 3a2aab18a217 -r 5231f398d784 bamCompare.xml
--- a/bamCompare.xml	Tue Sep 16 13:46:05 2014 -0400
+++ b/bamCompare.xml	Tue Oct 20 14:43:12 2015 -0400
@@ -1,59 +1,59 @@
 <tool id="deeptools_bamCompare" name="bamCompare" version="@WRAPPER_VERSION@.0">
     <description>normalizes and compares two BAM files to obtain the ratio, log2ratio or difference. (bam2bigwig)</description>
-    <expand macro="requirements" />
-    <expand macro="stdio" />
     <macros>
         <token name="@BINARY@">bamCompare</token>
         <import>deepTools_macros.xml</import>
     </macros>
+    <expand macro="requirements" />
     <command>
+<![CDATA[
         bamCompare
 
         @THREADS@
 
-      --bamfile1 '$bamFile1'
-      -bai1 '${bamFile1.metadata.bam_index}'
-      --bamfile2 '$bamFile2'
-      -bai2 '${bamFile2.metadata.bam_index}'
+        --bamfile1 '$bamFile1'
+        -bai1 '${bamFile1.metadata.bam_index}'
+        --bamfile2 '$bamFile2'
+        -bai2 '${bamFile2.metadata.bam_index}'
 
-      --outFileName '$outFileName'
-      --outFileFormat '$outFileFormat'
+        --outFileName '$outFileName'
+        --outFileFormat '$outFileFormat'
 
-      --fragmentLength $fragmentLength
-      --binSize $binSize
+        --fragmentLength $fragmentLength
+        --binSize $binSize
 
-      #if $scaling.method == 'SES':
-        --scaleFactorsMethod SES
-        --sampleLength $scaling.sampleLength
-      #elif $scaling.method == 'readCount':
-        --scaleFactorsMethod readCount
-      #elif $scaling.method == 'own':
-        --scaleFactors '$scaling.scaleFactor1:$scaling.scaleFactor2'
-      #end if
+        #if $scaling.method == 'SES':
+            --scaleFactorsMethod SES
+            --sampleLength $scaling.sampleLength
+        #elif $scaling.method == 'readCount':
+            --scaleFactorsMethod readCount
+        #elif $scaling.method == 'own':
+            --scaleFactors '$scaling.scaleFactor1:$scaling.scaleFactor2'
+        #end if
 
-      --ratio $comparison.type
+        --ratio $comparison.type
 
-      #if $comparison.type=='subtract':
-          #if $comparison.normalization.type=='rpkm':
-            --normalizeUsingRPKM
-          #elif $comparison.normalization.type=='1x':
+        #if $comparison.type=='subtract':
+            #if $comparison.normalization.type=='rpkm':
+                --normalizeUsingRPKM
+            #elif $comparison.normalization.type=='1x':
 
-            #if $comparison.normalization.effectiveGenomeSize.effectiveGenomeSize_opt == "specific":
-                --normalizeTo1x $comparison.normalization.effectiveGenomeSize.effectiveGenomeSize
-            #else:
-                --normalizeTo1x $comparison.normalization.effectiveGenomeSize.effectiveGenomeSize_opt
-            #end if
+                #if $comparison.normalization.effectiveGenomeSize.effectiveGenomeSize_opt == "specific":
+                    --normalizeTo1x $comparison.normalization.effectiveGenomeSize.effectiveGenomeSize
+                #else:
+                    --normalizeTo1x $comparison.normalization.effectiveGenomeSize.effectiveGenomeSize_opt
+                #end if
 
-          #end if
-      #elif $comparison.type in ['ratio','log2']:
-          --pseudocount $comparison.pseudocount
-      #end if
+            #end if
+        #elif $comparison.type in ['ratio','log2']:
+            --pseudocount $comparison.pseudocount
+        #end if
 
-      #if str($region).strip() != '':
-          --region '$region'
-      #end if
+        #if str($region).strip() != '':
+            --region '$region'
+        #end if
 
-      #if $advancedOpt.showAdvancedOpt == "yes":
+        #if $advancedOpt.showAdvancedOpt == "yes":
             #if $advancedOpt.smoothLength:
             --smoothLength '$advancedOpt.smoothLength'
             #end if
@@ -68,27 +68,26 @@
             --missingDataAsZero $advancedOpt.missingDataAsZero
 
             #if str($advancedOpt.ignoreForNormalization).strip() != '':
-                --ignoreForNormalization $advancedOpt.ignoreForNormalization
+                --ignoreForNormalization '$advancedOpt.ignoreForNormalization'
             #end if
-
-      #end if
-
+            #if $samFlag:
+                --samFlag $samFlag
+            #end if
+        #end if
+]]>
     </command>
-
     <inputs>
         <param name="bamFile1" format="bam" type="data" label="First BAM file (e.g. treated sample)"
             help="The BAM file must be sorted."/>
-
         <param name="bamFile2" format="bam" type="data" label="Second BAM file (e.g. control sample)"
             help="The BAM file must be sorted."/>
-
-        <param name="fragmentLength" type="integer" value="300" min="1"
+        <param name="fragmentLength" type="integer" value="200" min="1"
             label="Length of the average fragment size"
-            help ="Reads will be extended to match this length unless they are paired-end, in which case they will be extended to match the fragment length. If this value is set to the read length or smaller, the read will not be extended. *Warning* the fragment length affects the normalization to 1x (see &quot;normalize coverage to 1x&quot;). The formula to normalize using the sequencing depth is genomeSize/(number of mapped reads * fragment length). *NOTE*: If the BAM files contain mated and unmated paired-end reads, unmated reads will be extended to match the fragment length."/>
+            help ="Reads will be extended to match this length unless they are paired-end, in which case they will be extended to match the fragment length. If this value is set to the read length or smaller, the read will not be extended. *Warning* the fragment length affects the normalization to 1x (see &quot;normalize coverage to 1x&quot;). The formula to normalize using the sequencing depth is genomeSize/(number of mapped reads * fragment length). *NOTE*: If the BAM files contain mated and unmated paired-end reads, unmated reads will be extended to match the fragment length. (--fragmentLength)"/>
 
         <param name="binSize" type="integer" value="50" min="1" 
             label="Bin size in bp"
-            help="The genome will be divided in bins (also called tiles) of the specified length. For each bin the overlaping number of fragments (or reads)  will be reported. If only half a fragment overlaps, this fraction will be reported. "/>
+            help="The genome will be divided in bins (also called tiles) of the specified length. For each bin the overlaping number of fragments (or reads)  will be reported. If only half a fragment overlaps, this fraction will be reported. (--binSize)"/>
 
         <conditional name="scaling">
             <param name="method" type="select" 
@@ -104,20 +103,21 @@
             </when>
             <when value="readCount" />
             <when value="own">
-                <param name="scaleFactor1" type="float" value="1"
-                    label="Scale factor for treatment"/>
-
-                <param name="scaleFactor2" type="float" value="1"
-                    label="Scale factor for input"/>
+                <expand macro="scaleFactor" />
             </when>
         </conditional>
 
         <conditional name="comparison">
             <param name="type" type="select" 
-                label="How to compare the two files">
-                <option value="log2" selected="true">compute log2 of the number of reads ratio</option>
-                <option value="ratio">compute the ratio of the number of reads</option>
-                <option value="subtract">compute difference (subtract input from treatment) of the number of reads</option>
+                label="How to compare the two files"
+                help="The default is to output the log2ratio between the two samples.
+                The reciprocal ratio returns the negative of the inverse of the ratio if
+                the ratio is less than 0. The resulting values are interpreted as negative fold changes.">
+                <option value="log2" selected="true">Compute log2 of the number of reads ratio</option>
+                <option value="ratio">Compute the ratio of the number of reads</option>
+                <option value="subtract">Compute difference (subtract input from treatment) of the number of reads</option>
+                <option value="add">Compute the sum of number of reads</option>
+                <option value="reciprocal_ratio">Computes the fold change. If the fold change is less than 1, the negative of the inverse is reported. E.g. A fold change of 10 to 5 would be reported not as 0.5 but as -2</option>
             </param>
             <when value="log2">
                 <expand macro="pseudocount" />
@@ -125,6 +125,10 @@
             <when value="ratio">
                 <expand macro="pseudocount" />
             </when>
+            <when value="add" />
+            <when value="reciprocal_ratio">
+                <expand macro="pseudocount" />
+            </when>
             <when value="subtract">
                 <conditional name="normalization">
                     <param name="type" type="select" label="Normalization method" >
@@ -145,9 +149,7 @@
             <option value="bigwig" selected="true">bigwig</option>
             <option value="bedgraph">bedgraph</option>
         </param>
-
         <expand macro="region_limit_operation" />
-
         <conditional name="advancedOpt">
             <param name="showAdvancedOpt" type="select" label="Show advanced options" >
                 <option value="no" selected="true">no</option>
@@ -155,32 +157,19 @@
             </param>
             <when value="no" />
             <when value="yes">
-
                 <param name="smoothLength" type="integer" value="1" optional="true" min="1"
                     label="Smooth values using the following length (in bp)"
-                    help ="The smooth length defines a window, larger than the bin size, to average the number of reads. For example, if the bin size is set to 20 bp and the smooth length is set to 60 bp, then, for each bin size the average of it and its left and right neighbors is considered. Any value smaller than the bin size will be ignored and no smoothing will be applied."/>
-
-                <param name="doNotExtendPairedEnds" type="boolean" truevalue="--doNotExtendPairedEnds" falsevalue=""
-                    label="Do not extend paired ends"
-                    help="If set, reads are not extended to match the fragment length reported in the BAM file, instead they will be extended to match the fragment length. Default is to extend the reads if paired end information is available."/>
-
-                <param name="ignoreDuplicates" type="boolean" truevalue="--ignoreDuplicates" falsevalue=""
-                    label="Ignore duplicates"
-                    help="If set, reads that have the same orientation and start position will be considered only once. If reads are paired, the mate position also has to coincide to ignore a read." /> 
-
-                <param name="minMappingQuality" type="integer" optional="true" value="1" min="1"
-                    label="Minimum mapping quality (e.g. BOWTIE2 measures)"
-                    help= "If set, only reads that have a mapping quality score higher than the given value are considered. *Note* Bowtie's Mapping quality is related to uniqueness: the higher the score, the more unique is a read. A mapping quality defined by Bowtie of 10 or less indicates that there is at least a 1 in 10 chance that the read truly originated elsewhere."/>
-
+                    help ="The smooth length defines a window, larger than the bin size, to average the number of reads. For example, if the bin size is set to 20 bp and the smooth length is set to 60 bp, then, for each bin size the average of it and its left and right neighbors is considered. Any value smaller than the bin size will be ignored and no smoothing will be applied. (--smoothLength)"/>
+                <expand macro="doNotExtendPairedEnds" />
+                <expand macro="ignoreDuplicates" />
+                <expand macro="minMappingQuality" />
                 <expand macro="missingDataAsZero" />
-
                 <param name="ignoreForNormalization" type="text" value="" size="50"
                     label="regions that should be excluded for calculating the scaling factor"
                     help="Sometimes it makes sense to exclude certain regions when calculating the scaling factor. For example, if you know some regions that you suspect to be present more often in your sample's genome than in the reference genome that will therefore accumulate reads (CNV). Another typical example is the single X chromosome in male samples that should be scaled separately from the diploid autosomes. For example chrX,chrY,chr3. or chr10:12220-128932" />
-
+                <expand macro="samFlag" />
             </when>
         </conditional>
-
     </inputs>
     <outputs>
         <data format="bigwig" name="outFileName">
@@ -190,8 +179,21 @@
         </change_format>
         </data>
     </outputs>
+    <tests>
+        <test>
+            <param name="bamFile1" value="bowtie2-test1.bam" ftype="bam" />
+            <param name="bamFile2" value="bowtie2-test1.bam" ftype="bam" />
+            <param name="showAdvancedOpt" value="no" />
+            <param name="outFileFormat" value="bigwig" />
+            <param name="fragmentLength" value="100" />
+            <param name="outFileFormat" value="bedgraph" />
+            <param name="binSize" value="5" />
+            <param name="type" value="ratio" />
+            <output name="outFileName" file="bamCompare_result1.bg" ftype="bedgraph" />
+        </test>
+    </tests>
     <help>
-
+<![CDATA[
 **What it does**
 
 This tool compares two BAM files based on the number of mapped reads. To
@@ -224,7 +226,7 @@
 -----
 
 @REFERENCES@
-
+]]>
     </help>
     <expand macro="citations" />
 </tool>
diff -r 3a2aab18a217 -r 5231f398d784 bamCorrelate.xml
--- a/bamCorrelate.xml	Tue Sep 16 13:46:05 2014 -0400
+++ b/bamCorrelate.xml	Tue Oct 20 14:43:12 2015 -0400
@@ -1,12 +1,12 @@
 <tool id="deeptools_bamCorrelate" name="bamCorrelate" version="@WRAPPER_VERSION@.0">
     <description>correlates pairs of BAM files</description>
-    <expand macro="requirements" />
-    <expand macro="stdio" />
     <macros>
         <token name="@BINARY@">bamCorrelate</token>
         <import>deepTools_macros.xml</import>
     </macros>
+    <expand macro="requirements" />
     <command>
+<![CDATA[
         #set files=[]
         #set labels=[]
 
@@ -18,8 +18,8 @@
 
         @THREADS@
 
-        --bamfiles #echo " ".join($files)
-        --labels #echo " ".join($labels)
+        --bamfiles '#echo "' '".join($files)#'
+        --labels '#echo "' '".join($labels)#'
         --fragmentLength $fragmentLength
         --corMethod $corMethod
 
@@ -28,7 +28,7 @@
         #if $output.showOutputSettings == "yes"
             --outRawCounts '$outFileRawCounts' 
             --outFileCorMatrix '$outFileCorMatrix'
-            --plotFileFormat $output.outFileFormat
+            --plotFileFormat '$output.outFileFormat'
         #else:
             --plotFileFormat 'png'
         #end if
@@ -37,7 +37,6 @@
             --binSize '$mode.binSize'
             --distanceBetweenBins '$mode.distanceBetweenBins'
             $mode.doNotRemoveOutliers
-
         #else:
             --BED $mode.region_file
         #end if
@@ -47,6 +46,10 @@
             --region '$mode.region'
         #end if
 
+        #if $plotTitle and str($plotTitle).strip() != "":
+            --plotTitle '$plotTitle'
+        #end if
+        $plotNumbers
         #if $mode.advancedOpt.showAdvancedOpt == "yes":
 
             $mode.advancedOpt.doNotExtendPairedEnds
@@ -66,14 +69,18 @@
             --colorMap '$mode.advancedOpt.colorMap'
 
         #end if
+]]>
     </command>
 
     <inputs>
         <expand macro="multiple_input_bams" />
 
-        <param name="fragmentLength" type="integer" value="300" min="1"
+        <param name="fragmentLength" type="integer" value="200" min="1"
             label="Length of the average fragment size"
-            help ="Reads will be extended to match this length unless they are paired-end, in which case they will be extended to match the fragment length. *NOTE*: If the BAM files contain mated and unmated paired-end reads, unmated reads will be extended to match the fragment length."/>
+            help ="Reads will be extended to match this length unless they are paired-end,
+            in which case they will be extended to match the fragment length.
+            *NOTE*: If the BAM files contain mated and unmated paired-end reads, unmated reads will
+            be extended to match the fragment length. (--fragmentLength)"/>
 
         <param name="corMethod" type="select" label="Correlation method">
             <option value="spearman" selected="True">Spearman</option>
@@ -82,14 +89,18 @@
 
         <conditional name="mode">
             <param name="modeOpt" type="select" label="Choose computation mode" 
-                help="In the bins mode, the correlation is computed based on equal length bins. In the BED file mode, as list of genomic regions in BED format has to be given. For each region in the BED file the number of overlapping reads is counted in each of the BAM files. Then the correlation is computed.">
+                help="In the bins mode, the correlation is computed based on equal
+                length bins. In the BED file mode, as list of genomic regions in BED
+                format has to be given. For each region in the BED file the number of
+                overlapping reads is counted in each of the BAM files.
+                Then the correlation is computed.">
                 <option value="bins" selected="true">Bins</option>
                 <option value="BED-file">Limit correlation to certain regions (BED file)</option>
             </param>
             <when value="bins">
                 <param name="binSize" type="integer" value="10000" min="1" 
                     label="Bin size in bp"
-                    help="Length in base pairs for a window used to sample the genome."/>
+                    help="Length in base pairs for a window used to sample the genome. (--binSize)"/>
 
                 <param name="distanceBetweenBins" type="integer" value="0" min="0"
                     label="Distance between bins"
@@ -97,7 +108,7 @@
                         the specified 'Bin size'. However, to reduce the
                         computation time, a larger distance between bins can
                         by given. Larger distances result in less bins being
-                        considered"/>
+                        considered. (--distanceBetweenBins)"/>
 
                 <param name="doNotRemoveOutliers" type="boolean"
                     truevalue="--doNotRemoveOutliers" falsevalue="" label="Do not filter outliers"
@@ -111,17 +122,19 @@
                         bamCorrelate tries to remove outliers using
                         the median absolute deviation (MAD) method applying a
                         threshold of 200 to only consider extremely large
-                        deviations from the median."/>
+                        deviations from the median. (--doNotRemoveOutliers)"/>
 
                 <expand macro="bamCorrelate_mode_actions" />
             </when>
             <when value="BED-file">
-                <param name="region_file" type="data" format="bed" label="Region file in BED format" help="Correlation is computed for the number of reads that overlap such regions."/>
+                <param name="region_file" type="data" format="bed"
+                    label="Region file in BED format"
+                    help="Correlation is computed for the number of reads that overlap such regions."/>
                 <expand macro="bamCorrelate_mode_actions" />
             </when>
-
         </conditional>
-
+        <expand macro="plotTitle" />
+        <expand macro="plotNumbers" />
         <conditional name="output">
             <param name="showOutputSettings" type="select" label="Show advanced output settings" >
                 <option value="no" selected="true">no</option>
@@ -155,8 +168,24 @@
             </filter>
         </data>
     </outputs>
+    <tests>
+        <test>
+            <repeat name="input_files">
+                <param name="bamfile" value="bowtie2-test1.bam" ftype="bam" />
+                <param name="label" value="first BAM file" />
+            </repeat>
+            <repeat name="input_files">
+                <param name="bamfile" value="bowtie2-test1.bam" ftype="bam" />
+                <param name="label" value="second BAM file" />
+            </repeat>
+            <param name="modeOpt" value="bins" />
+            <param name="binSize" value="10" />
+            <param name="showOutputSettings" value="no" />
+            <output name="outFileName" file="bamCorrelate_result1.png" ftype="png" compare="sim_size" />
+        </test>
+    </tests>
     <help>
-
+<![CDATA[
 **What it does**
 
 This tool is useful to assess the overall similarity of different BAM files. A typical application
@@ -183,7 +212,7 @@
 -----
 
 @REFERENCES@
-
+]]>
     </help>
     <expand macro="citations" />
 </tool>
diff -r 3a2aab18a217 -r 5231f398d784 bamCoverage.xml
--- a/bamCoverage.xml	Tue Sep 16 13:46:05 2014 -0400
+++ b/bamCoverage.xml	Tue Oct 20 14:43:12 2015 -0400
@@ -1,68 +1,71 @@
 <tool id="deeptools_bamCoverage" name="bamCoverage" version="@WRAPPER_VERSION@.0">
     <description> generates a coverage bigWig file from a given BAM file.  Multiple options are available to count reads and normalize coverage. (bam2bigwig)</description>
-    <expand macro="requirements" />
-    <expand macro="stdio" />
     <macros>
         <token name="@BINARY@">bamCoverage</token>
         <import>deepTools_macros.xml</import>
     </macros>
+    <expand macro="requirements" />
     <command>
+<![CDATA[
         bamCoverage
 
-        @THREADS@
+            @THREADS@
 
-        --bam '$bamInput'
-        --bamIndex ${bamInput.metadata.bam_index}
-        --outFileName '$outFileName'
-        --outFileFormat '$outFileFormat'
+            --bam '$bamInput'
+            --bamIndex ${bamInput.metadata.bam_index}
+            --outFileName '$outFileName'
+            --outFileFormat '$outFileFormat'
 
-        --fragmentLength $fragmentLength
-        --binSize $binSize
+            --fragmentLength $fragmentLength
+            --binSize $binSize
 
-        #if $scaling.type=='rpkm':
-            --normalizeUsingRPKM
-        #elif $scaling.type=='1x':
-            #if $scaling.effectiveGenomeSize.effectiveGenomeSize_opt == "specific":
-                --normalizeTo1x $scaling.effectiveGenomeSize.effectiveGenomeSize
-            #else:
-                --normalizeTo1x $scaling.effectiveGenomeSize.effectiveGenomeSize_opt
-            #end if
-        #elif $scaling.type=='own':
-            --scaleFactor $scaling.scaleFactor
-        #end if
-
-        #if str($region).strip() != '':
-            --region '$region'
-        #end if
-
-        #if $advancedOpt.showAdvancedOpt == "yes":
-            #if $advancedOpt.smoothLength:
-                --smoothLength '$advancedOpt.smoothLength'
+            #if $scaling.type=='rpkm':
+                --normalizeUsingRPKM
+            #elif $scaling.type=='1x':
+                #if $scaling.effectiveGenomeSize.effectiveGenomeSize_opt == "specific":
+                    --normalizeTo1x $scaling.effectiveGenomeSize.effectiveGenomeSize
+                #else:
+                    --normalizeTo1x $scaling.effectiveGenomeSize.effectiveGenomeSize_opt
+                #end if
+            #elif $scaling.type=='own':
+                --scaleFactor $scaling.scaleFactor
             #end if
 
-            $advancedOpt.doNotExtendPairedEnds
-            $advancedOpt.ignoreDuplicates
-
-            #if $advancedOpt.minMappingQuality:
-                --minMappingQuality '$advancedOpt.minMappingQuality'
+            #if str($region).strip() != '':
+                --region '$region'
             #end if
 
-            --missingDataAsZero $advancedOpt.missingDataAsZero
+            #if $advancedOpt.showAdvancedOpt == "yes":
+                #if $advancedOpt.smoothLength:
+                    --smoothLength '$advancedOpt.smoothLength'
+                #end if
+
+                $advancedOpt.doNotExtendPairedEnds
+                $advancedOpt.ignoreDuplicates
 
-            ##if str($advancedOpt.ignoreForNormalization).strip() != '':
-            ##    --ignoreForNormalization $advancedOpt.ignoreForNormalization
-            ##end if
+                #if $advancedOpt.minMappingQuality:
+                    --minMappingQuality '$advancedOpt.minMappingQuality'
+                #end if
+
+                --missingDataAsZero $advancedOpt.missingDataAsZero
 
-        #end if
+                ##if str($advancedOpt.ignoreForNormalization).strip() != '':
+                ##    --ignoreForNormalization $advancedOpt.ignoreForNormalization
+                ##end if
+                #if $samFlag:
+                    --samFlag $samFlag
+                #end if
+            #end if
+]]>
     </command>
 
     <inputs>
         <param name="bamInput" format="bam" type="data" label="BAM file"
             help="The BAM file must be sorted."/>
 
-        <param name="fragmentLength" type="integer" value="300" min="1"
+        <param name="fragmentLength" type="integer" value="200" min="1"
             label="Length of the average fragment size"
-            help ="Reads will be extended to match this length unless they are paired-end, in which case they will be extended to match the fragment length. If this value is set to the read length or smaller, the read will not be extended. *Warning* the fragment length affects the normalization to 1x (see &quot;normalize coverage to 1x&quot;). Sequencing depth is defined as: (total number of mapped reads * fragment length) / effective genome size. *NOTE*: If the BAM files contain mated and unmated paired-end reads, unmated reads will be extended to match the fragment length."/>
+            help ="Reads will be extended to match this length unless they are paired-end, in which case they will be extended to match the fragment length. If this value is set to the read length or smaller, the read will not be extended. *Warning* the fragment length affects the normalization to 1x (see &quot;normalize coverage to 1x&quot;). Sequencing depth is defined as: (total number of mapped reads * fragment length) / effective genome size. *NOTE*: If the BAM files contain mated and unmated paired-end reads, unmated reads will be extended to match the fragment length. (--fragmentLength)"/>
 
         <param name="binSize" type="integer" value="50" min="1" 
             label="Bin size in bp"
@@ -102,22 +105,13 @@
             <when value="yes">
                 <param name="smoothLength" type="integer" value="1" optional="true" min="1"
                     label="Smooth values using the following length (in bp)"
-                    help ="The smooth length defines a window, larger than the bin size, to average the number of reads. For example, if the bin size is set to 20 bp and the smooth length is set to 60 bp, then, for each bin size the average of it and its left and right neighbors is considered. Any value smaller than the bin size will be ignored and no smoothing will be applied."/>
-
-                <param name="doNotExtendPairedEnds" type="boolean" truevalue="--doNotExtendPairedEnds" falsevalue=""
-                    label="Do not extend paired ends"
-                    help="If set, reads are not extended to match the fragment length reported in the BAM file, instead they will be extended to match the fragment length. Default is to extend the reads if paired end information is available."/>
+                    help ="The smooth length defines a window, larger than the bin size, to average the number of reads. For example, if the bin size is set to 20 bp and the smooth length is set to 60 bp, then, for each bin size the average of it and its left and right neighbors is considered. Any value smaller than the bin size will be ignored and no smoothing will be applied. (--smoothLength)"/>
 
-                <param name="ignoreDuplicates" type="boolean" truevalue="--ignoreDuplicates" falsevalue=""
-                    label="Ignore duplicates"
-                    help="If set, reads that have the same orientation and start position will be considered only once. If reads are paired, the mate position also has to coincide to ignore a read." /> 
-
-                <param name="minMappingQuality" type="integer" optional="true" value="1" min="1"
-                    label="Minimum mapping quality"
-                    help= "If set, only reads that have a mapping quality score higher than the given value are considered. *Note* Bowtie's Mapping quality is related to uniqueness: the higher the score, the more unique is a read. A mapping quality defined by Bowtie of 10 or less indicates that there is at least a 1 in 10 chance that the read truly originated elsewhere."/>
-
+                <expand macro="doNotExtendPairedEnds" />
+                <expand macro="ignoreDuplicates" />
+                <expand macro="minMappingQuality" />
                 <expand macro="missingDataAsZero" />
-
+                <expand macro="samFlag" />
              <!--   <param name="ignoreForNormalization" type="text" value="" size="50"
                     label="regions that should be excluded for calculating the scaling factor"
                     help="Sometimes it makes sense to exclude certain regions when calculating the scaling factor. For example, if you know some regions that you suspect to be present more often in your sample's genome than in the reference genome that will therefore accumulate reads (CNV). Another typical example is the single X chromosome in male samples that should be scaled separately from the diploid autosomes. For example chrX,chrY,chr3. or chr10:12220-128932" />
@@ -133,8 +127,46 @@
             </change_format>
         </data>
     </outputs>
+    <tests>
+        <test>
+            <param name="bamInput" value="bowtie2-test1.bam" ftype="bam" />
+            <param name="outFileFormat" value="bigwig" />
+            <param name="showAdvancedOpt" value="no" />
+            <param name="binSize" value="10" />
+            <param name="type" value="no" />
+            <output name="outFileName" file="bamCoverage_result1.bw" ftype="bigwig" />
+        </test>
+        <test>
+            <param name="bamInput" value="bowtie2-test1.bam" ftype="bam" />
+            <param name="outFileFormat" value="bigwig" />
+            <param name="showAdvancedOpt" value="no" />
+            <param name="binSize" value="10" />
+            <output name="outFileName" file="bamCoverage_result2.bw" ftype="bigwig" />
+        </test>
+        <test>
+            <param name="bamInput" value="bowtie2-test1.bam" ftype="bam" />
+            <param name="outFileFormat" value="bedgraph" />
+            <param name="showAdvancedOpt" value="no" />
+            <param name="binSize" value="10" />
+            <output name="outFileName" file="bamCoverage_result3.bg" ftype="bedgraph" />
+        </test>
+        <test>
+            <param name="bamInput" value="phiX.bam" ftype="bam" />
+            <param name="outFileFormat" value="bigwig" />
+            <param name="showAdvancedOpt" value="no" />
+            <param name="binSize" value="10" />
+            <output name="outFileName" file="bamCoverage_result4.bw" ftype="bigwig" />
+        </test>
+        <test>
+            <param name="bamInput" value="phiX.bam" ftype="bam" />
+            <param name="outFileFormat" value="bedgraph" />
+            <param name="showAdvancedOpt" value="no" />
+            <param name="binSize" value="10" />
+            <output name="outFileName" file="bamCoverage_result4.bg" ftype="bedgraph" />
+        </test>
+    </tests>
     <help>
-
+<![CDATA[
 **What it does**
 
 Given a BAM file, this tool generates a bigWig or bedGraph file of fragment or
@@ -160,7 +192,7 @@
 -----
 
 @REFERENCES@
-
+]]>
     </help>
     <expand macro="citations" />
 </tool>
diff -r 3a2aab18a217 -r 5231f398d784 bamFingerprint.xml
--- a/bamFingerprint.xml	Tue Sep 16 13:46:05 2014 -0400
+++ b/bamFingerprint.xml	Tue Oct 20 14:43:12 2015 -0400
@@ -1,62 +1,61 @@
 <tool id="deeptools_bamFingerprint" name="bamFingerprint" version="@WRAPPER_VERSION@.0">
     <description>plots profiles of BAM files; useful for assesing ChIP signal strength</description>
-    <expand macro="requirements" />
-    <expand macro="stdio" />
     <macros>
         <token name="@BINARY@">bamFingerprint</token>
         <import>deepTools_macros.xml</import>
     </macros>
+    <expand macro="requirements" />
     <command>
+<![CDATA[
         @multiple_input_bams@
 
-    bamFingerprint
+        bamFingerprint
+
+            @THREADS@
 
-        @THREADS@
+            --bamfiles #echo " ".join($files)
+            --labels #echo " ".join($labels)
+
+            --fragmentLength $fragmentLength
 
-      --bamfiles #echo " ".join($files)
-      --labels #echo " ".join($labels)
+            --plotFile $outFileName
 
-      --fragmentLength $fragmentLength
-
-      #set newoutFileName=str($outFileName)+".png"
-      --plotFile $newoutFileName
+            #if $output.showOutputSettings == "yes"
+                --plotFileFormat $output.outFileFormat
+                #if $output.saveRawCounts:
+                    --outRawCounts '$outFileRawCounts' 
+                #end if
+            #else
+                --plotFileFormat 'png'
+            #end if
 
-      #if $output.showOutputSettings == "yes"
-          --plotFileFormat $output.outFileFormat
-          #if $output.saveRawCounts:
-            --outRawCounts '$outFileRawCounts' 
-          #end if
-      #else
-        --plotFileFormat 'png'
-      #end if
+            #if str($region).strip() != '':
+                --region '$region'
+            #end if
 
-      #if str($region).strip() != '':
-          --region '$region'
-      #end if
+            #if $advancedOpt.showAdvancedOpt == "yes":
+                --binSize '$advancedOpt.binSize'
+                --numberOfSamples '$advancedOpt.numberOfSamples'
 
-      #if $advancedOpt.showAdvancedOpt == "yes":
-        --binSize '$advancedOpt.binSize'
-        --numberOfSamples '$advancedOpt.numberOfSamples'
+                $advancedOpt.doNotExtendPairedEnds
+                $advancedOpt.ignoreDuplicates
+                $advancedOpt.skipZeros
 
-        $advancedOpt.doNotExtendPairedEnds
-        $advancedOpt.ignoreDuplicates
-        $advancedOpt.skipZeros
+                #if $advancedOpt.minMappingQuality:
+                --minMappingQuality '$advancedOpt.minMappingQuality'
+                #end if
 
-        #if $advancedOpt.minMappingQuality:
-          --minMappingQuality '$advancedOpt.minMappingQuality'
-        #end if
-      #end if
-      ; mv $newoutFileName $outFileName
-      ; rm $temp_dir -rf
+                #if $advancedOpt.plotTitle and str($advancedOpt.plotTitle.value) != "":
+                    --plotTitle '$advancedOpt.plotTitle'
+                #end if
+
+            #end if
+]]>
     </command>
 
     <inputs>
         <expand macro="multiple_input_bams" />
-
-
-        <param name="fragmentLength" type="integer" value="200" min="1"
-           label="Length of the average fragment size"/>
-
+        <expand macro="fragmentLength" />
         <expand macro="region_limit_operation" />
 
         <conditional name="advancedOpt">
@@ -66,32 +65,19 @@
             </param>
             <when value="no" />
             <when value="yes">
-                <param name="binSize" type="integer" value="10000" min="1" 
+                <param name="binSize" type="integer" value="500" min="1" 
                    label="Bin size in bp"
                    help="Length in base pairs for a window used to sample the genome."/>
-                
                 <param name="numberOfSamples" type="integer" value="100000" min="1" 
                    label="Number of samples"
-                   help="Number of samples taken from the genome to compute the scaling factors"/>
-                
-                <param name="doNotExtendPairedEnds" type="boolean" truevalue="--doNotExtendPairedEnds" falsevalue=""
-                    label="Do not extend paired ends"
-                    help="If set, reads are not extended to match the fragment length reported in the BAM file, instead they will be extended to match the fragment length. Default is to extend the reads if paired end information is available."/>
-                  
-                <param name="ignoreDuplicates" type="boolean" truevalue="--ignoreDuplicates" falsevalue=""
-                    label="Ignore duplicates"
-                    help="If set, reads that have the same orientation and start position will be considered only once. If reads are paired, the mate position also has to coincide to ignore a read." /> 
-                  
-                <param name="minMappingQuality" type="integer" optional="true" value="1" min="1"
-                    label="Minimum mapping quality"
-                    help= "If set, only reads that have a mapping quality score higher than the given value are considered. *Note* Bowtie's Mapping quality is related to uniqueness: the higher the score, the more unique is a read. A mapping quality defined by Bowtie of 10 or less indicates that there is at least a 1 in 10 chance that the read truly originated elsewhere."/>
-                    
-                <param name="skipZeros" type="boolean" truevalue="--skipZeros" falsevalue=""
-                   label ="Include zeros"
-                   help  ="If set, then zero counts that happen for *all* BAM files given are ignored. This might have the effect that fewer regions are considered than indicated in the option where the number of samples is defined." />
+                   help="Number of samples taken from the genome to compute the scaling factors. (--numberOfSamples)"/>
+                <expand macro="doNotExtendPairedEnds" />
+                <expand macro="ignoreDuplicates" />
+                <expand macro="minMappingQuality" />
+                <expand macro="skipZeros" />
+                <expand macro="plotTitle" />
             </when>
         </conditional>
-
         <conditional name="output">
             <param name="showOutputSettings" type="select" label="Show advanced output settings">
                 <option value="no" selected="true">no</option>
@@ -100,10 +86,9 @@
             <when value="no" />
             <when value="yes">
                 <expand macro="input_image_file_format" />
-                <param name="saveRawCounts" type="boolean" label="Save the bin counts"/>
+                <param name="saveRawCounts" type="boolean" label="Save the bin counts" help="(--outRawCounts)"/>
             </when>
         </conditional>
-
     </inputs>
     <outputs>
         <expand macro="output_image_file_format" />
@@ -116,8 +101,22 @@
             </filter>
         </data>
     </outputs>
+    <tests>
+        <test>
+            <repeat name="input_files">
+                <param name="bamfile" value="bowtie2-test1.bam" ftype="bam" />
+            </repeat>
+            <repeat name="input_files">
+                <param name="bamfile" value="bowtie2-test1.bam" ftype="bam" />
+            </repeat>
+            <param name="fragmentLength" value="200" />
+            <param name="showAdvancedOpt" value="no" />
+            <param name="showOutputSettings" value="no" />
+            <output name="outFileName" file="bamFingerprint_result1.png" ftype="png" compare="sim_size" />
+        </test>
+    </tests>
     <help>
-
+<![CDATA[
 **What it does**
 
 This tool is useful to assess the strength of a ChIP (i.e. how clearly the enrichment signal can be separated from the background signal)
@@ -146,7 +145,7 @@
 -----
 
 @REFERENCES@
-
+]]>
     </help>
     <expand macro="citations" />
 </tool>
diff -r 3a2aab18a217 -r 5231f398d784 bamPEFragmentSize.xml
--- a/bamPEFragmentSize.xml	Tue Sep 16 13:46:05 2014 -0400
+++ b/bamPEFragmentSize.xml	Tue Oct 20 14:43:12 2015 -0400
@@ -1,27 +1,22 @@
 <tool id="deeptools_bamPEFragmentSize" name="bamPEFragmentSize" version="@WRAPPER_VERSION@.0">
-    <description>Given a BAM file it samples several regions to estimate the paird-end fragment length</description>
-    <expand macro="requirements" />
-    <expand macro="stdio" />
+    <description>Given a BAM file it samples several regions to estimate the paired-end fragment length</description>
     <macros>
         <token name="@BINARY@">bamPEFragmentSize</token>
         <import>deepTools_macros.xml</import>
     </macros>
+    <expand macro="requirements" />
     <command>
 <![CDATA[
         bamPEFragmentSize
-
-        @THREADS@
-
-        --bam '$bamInput'
-        --bamIndex ${bamInput.metadata.bam_index}
-        #if $histogram:
-            --histogram $histogram_outfile
-        #end if
-        > $outfile
-
+            @THREADS@
+            -bai ${bamInput.metadata.bam_index}
+            #if $histogram:
+                --histogram ./hist.png
+            #end if
+            '$bamInput'
+            > $outfile
 ]]>
     </command>
-
     <inputs>
         <param name="bamInput" format="bam" type="data" label="BAM file"
             help="The BAM file must be sorted."/>
@@ -30,13 +25,21 @@
             help="(--histogram)"/>
     </inputs>
     <outputs>
-        <data format="txt" name="outfile" label="${tool.name} on ${on_string}" />
-        <data name="histogram_outfile" format="tabular" from_work_dir="quant_bias_corrected.sf" label="${tool.name} on ${on_string} (Bias corrected Quantification)">
-            <filter>histogram == '--histogram'</filter>
+        <data name="outfile" format="txt"/>
+        <data name="histogram_outfile" from_work_dir="hist.png" format="png">
+            <filter>histogram is True</filter>
         </data>
     </outputs>
+    <tests>
+        <test>
+            <param name="bamInput" value="bowtie2-test1.bam" ftype="bam" />
+            <param name="histogram" value="True" />
+            <output name="outfile" file="bamPEFragmentSize_result1.txt" ftype="txt" />
+            <output name="histogram_outfile" file="bamPEFragmentSize_histogram_result1.png" ftype="png" compare="sim_size" />
+        </test>
+    </tests>
     <help>
-
+<![CDATA[
 **What it does**
 
 Given a BAM file it samples several regions to estimate the paird-end fragment length.
@@ -44,7 +47,7 @@
 -----
 
 @REFERENCES@
-
+]]>
     </help>
     <expand macro="citations" />
 </tool>
diff -r 3a2aab18a217 -r 5231f398d784 bigwigCompare.xml
--- a/bigwigCompare.xml	Tue Sep 16 13:46:05 2014 -0400
+++ b/bigwigCompare.xml	Tue Oct 20 14:43:12 2015 -0400
@@ -1,12 +1,12 @@
 <tool id="deeptools_bigwigCompare" name="bigwigCompare" version="@WRAPPER_VERSION@.0">
     <description>normalizes and compares two bigWig files to obtain the ratio, log2ratio or difference</description>
-    <expand macro="requirements"/>
-    <expand macro="stdio" />
     <macros>
         <token name="@BINARY@">bigwigCompare</token>
         <import>deepTools_macros.xml</import>
     </macros>
+    <expand macro="requirements"/>
     <command>
+<![CDATA[
         bigwigCompare
 
         @THREADS@
@@ -17,9 +17,9 @@
         --outFileName '$outFileName'
         --outFileFormat '$outFileFormat'
 
-        --ratio $comparison.type
+        --ratio $comparison.comparison_select
 
-        #if $comparison.type in ['ratio','log2']:
+        #if $comparison.comparison_select in ['ratio','log2']:
             --pseudocount $comparison.pseudocount
         #end if
 
@@ -33,21 +33,28 @@
           --scaleFactors '$advancedOpt.scaleFactor1:$advancedOpt.scaleFactor2'
           --binSize $advancedOpt.binSize
 
+            #if $advancedOpt.plotTitle and str($advancedOpt.plotTitle.value) != "":
+                --plotTitle '$advancedOpt.plotTitle'
+            #end if
+
         #end if
+]]>
     </command>
     <inputs>
         <param name="bigwigFile1" format="bigwig" type="data" label="Treatment bigwig file" />
         <param name="bigwigFile2" format="bigwig" type="data" label="bigWig file" />
 
-
         <conditional name="comparison">
-            <param name="type" type="select" 
-                label="How to compare the two files">
+            <param name="comparison_select" type="select" 
+                label="How to compare the two files"
+                help="The default is to output the log2ratio between the two samples.
+                The reciprocal ratio returns the negative of the inverse of the ratio if
+                the ratio is less than 0. The resulting values are interpreted as negative fold changes. (--ratio)">
                 <option value="log2" selected="true">compute log2 of the number of reads ratio</option>
                 <option value="ratio">compute the ratio of the number of reads</option>
                 <option value="subtract">compute difference (subtract input from treatment) of the number of reads</option>
                 <option value="add">compute the sum over all reads</option>
-                <option value="reciprocal_ratio">compute the reciprocal ratio of the number of reads</option>
+                <option value="reciprocal_ratio">Computes the fold change. If the fold change is less than 1, the negative of the inverse is reported. E.g. A fold change of 10 to 5 would be reported not as 0.5 but as -2</option>
             </param>
             <when value="log2">
                 <expand macro="pseudocount" />
@@ -57,7 +64,9 @@
             </when>
             <when value="subtract" />
             <when value="add" />
-            <when value="reciprocal_ratio" />
+            <when value="reciprocal_ratio">
+                <expand macro="pseudocount" />
+            </when>
         </conditional>
 
         <param name="outFileFormat" type="select" label="Coverage file format">
@@ -75,29 +84,54 @@
             <when value="no" />
             <when value="yes">
                 <param name="binSize" type="integer" value="50" min="1" 
-                    label="Bin size in bp"
-                    help="Size of the bins in bp for the output of the bigwig/bedgraph file "/>
-
+                    label="Length, in base pairs, of the non-overlapping bin for averaging the score over the regions length"
+                    help="Size of the bins in bp for the output of the bigwig/bedgraph file. (--binSize)"/>
                 <param name="missingDataAsZero" type="boolean" truevalue="yes" falsevalue="no" checked="True"
                     label ="Treat missing data as zero"
-                    help  ="This parameter determines if missing data should be replaced with a zero. If set to &quot;no&quot;, missing data will be ignored and will not be included in the output file at all. Missing data is defined as those regions for which no value exists in *any* of the bigwig files. The decision to include or exclude missing data depends on the interpretation of the data. Missing data in a bigwig file may mean that there is no information available for certain regions, for example a repetitive region that is not being considered. In the same file regions with low coverage may get zero read counts. If missing data is replaced by zero, this would convert the excluded repetitive regions into regions of low coverage." />
-
-                <param name="scaleFactor1" type="float" value="1" label="Scale factor for treatment"/>
-                <param name="scaleFactor2" type="float" value="1" label="Scale factor for input"/>
+                    help  ="This parameter determines if missing data should be replaced with a zero.
+                    If set to &quot;no&quot;, missing data will be ignored and will not be included in the
+                    output file at all. Missing data is defined as those regions for which no value exists in
+                    *any* of the bigwig files. The decision to include or exclude missing data depends on
+                    the interpretation of the data. Missing data in a bigwig file may mean that there is no
+                    information available for certain regions, for example a repetitive region that is not
+                    being considered. In the same file regions with low coverage may get zero read counts.
+                    If missing data is replaced by zero, this would convert the excluded repetitive regions
+                    into regions of low coverage. (--missingDataAsZero)" />
+                <expand macro="scaleFactor" />
+                <expand macro="plotTitle" />
             </when>
         </conditional>
     </inputs>
     <outputs>
         <data format="bigwig" name="outFileName">
-        <change_format>
-            <when input="outFileFormat" value="bigwig" format="bigwig" />
-            <when input="outFileFormat" value="bedgraph" format="bedgraph" />
-        </change_format>
+            <change_format>
+                <when input="outFileFormat" value="bigwig" format="bigwig" />
+                <when input="outFileFormat" value="bedgraph" format="bedgraph" />
+            </change_format>
         </data>
     </outputs>
-
-  <help>
-
+    <tests>
+        <test>
+            <param name="bigwigFile1" value="test.bw" ftype="bigwig" />
+            <param name="bigwigFile2" value="test.bw" ftype="bigwig" />
+            <param name="showAdvancedOpt" value="no" />
+            <param name="outFileFormat" value="bigwig" />
+            <param name="binSize" value="5" />
+            <param name="comparison_select" value="ratio" />
+            <output name="outFileName" file="bigwigCompare_result1.bw" ftype="bigwig" />
+        </test>
+        <test>
+            <param name="bigwigFile1" value="test.bw" ftype="bigwig" />
+            <param name="bigwigFile2" value="test.bw" ftype="bigwig" />
+            <param name="showAdvancedOpt" value="no" />
+            <param name="outFileFormat" value="bedgraph" />
+            <param name="binSize" value="10" />
+            <param name="comparison_select" value="ratio" />
+            <output name="outFileName" file="bigwigCompare_result2.bg" ftype="bedgraph" />
+        </test>
+    </tests>
+    <help>
+<![CDATA[
 **What it does**
 
 This tool compares two bigwig files based on the number of mapped reads. To
@@ -110,7 +144,7 @@
 -----
 
 @REFERENCES@
-
+]]>
     </help>
     <expand macro="citations" />
 </tool>
diff -r 3a2aab18a217 -r 5231f398d784 bigwigCorrelate.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/bigwigCorrelate.xml	Tue Oct 20 14:43:12 2015 -0400
@@ -0,0 +1,184 @@
+<tool id="deeptools_bigwigCorrelate" name="bigwigCorrelate" version="@WRAPPER_VERSION@.0">
+    <description>correlates pairs of BigWig files</description>
+    <macros>
+        <token name="@BINARY@">bigwigCorrelate</token>
+        <import>deepTools_macros.xml</import>
+    </macros> 
+   <expand macro="requirements" />
+    <command>
+<![CDATA[
+        #set files=[]
+        #set labels=[]
+
+        @multiple_input_bigwigs@
+
+        bigwigCorrelate
+
+        $mode.modeOpt
+
+        @THREADS@
+
+        --bwfiles '#echo "' '".join($files)#'
+        --labels '#echo "' '".join($labels)#'
+        #if $filterPercentile:
+            --filterPercentile $filterPercentile
+        #end if
+        --corMethod $corMethod
+
+        --plotFile $outFileName
+
+        #if $output.showOutputSettings == "yes"
+            --outRawCounts '$outFileRawCounts' 
+            --outFileCorMatrix '$outFileCorMatrix'
+            --plotFileFormat '$output.outFileFormat'
+        #else:
+            --plotFileFormat 'png'
+        #end if
+
+        #if $mode.modeOpt == "bins":
+            --binSize '$mode.binSize'
+        #else:
+            --BED $mode.region_file
+        #end if
+
+        #### options available in both modes
+        #if str($region.value) != '':
+            --region '$region'
+        #end if
+
+        #if $advancedOpt.showAdvancedOpt == "yes":
+
+            $advancedOpt.includeZeros
+
+            #if $advancedOpt.zMin:
+                --zMin $advancedOpt.zMin
+            #end if
+            #if $advancedOpt.zMax:
+                --zMax $advancedOpt.zMax
+            #end if
+            --colorMap '$advancedOpt.colorMap'
+
+            #if $plotTitle and str($plotTitle).strip() != "":
+                --plotTitle '$plotTitle'
+            #end if
+            $plotNumbers
+
+        #end if
+]]>
+    </command>
+
+    <inputs>
+        <expand macro="multiple_input_bigwigs" />
+
+        <param name="filterPercentile" type="float" optional="True" value="" min="0.0" max="100.0"
+            label="Percentile used to filter out extreme outliers"
+            help ="If not specified, it is automatically set to 99.9 in analyses
+                    using Pearson correlation! This means that values
+                    above that threshold, which consistently occur in all
+                    datasets, will not be taken into account for the
+                    correlation analysis. This behavior can be overridden
+                    by a user specified value from within the 0.0 to 100.0
+                    range. (--filterPercentile)"/>
+
+        <param name="corMethod" type="select" label="Correlation method" help="(--corMethod)">
+            <option value="spearman" selected="True">Spearman</option>
+            <option value="pearson">Pearson</option>
+        </param>
+
+        <conditional name="mode">
+            <param name="modeOpt" type="select" label="Choose computation mode" 
+                help="In the bins mode, the correlation is computed based on equal length bins.
+                In the BED file mode, as list of genomic regions in BED format has to be given.
+                For each region in the BED file the number of overlapping reads is counted in
+                each of the BAM files. Then the correlation is computed.">
+                <option value="bins" selected="true">Bins</option>
+                <option value="BED-file">Limit correlation to certain regions (BED file)</option>
+            </param>
+            <when value="bins">
+                <param name="binSize" type="integer" value="10000" min="1" 
+                    label="Bin size in bp"
+                    help="Length in base pairs for a window used to sample the genome. (--binSize)"/>
+            </when>
+            <when value="BED-file">
+                <param name="region_file" type="data" format="bed"
+                    label="Region file in BED format"
+                    help="Correlation is computed for the number of reads that overlap such regions."/>
+            </when>
+        </conditional>
+
+        <expand macro="bigwigCorrelate_mode_actions" />
+        <conditional name="output">
+            <param name="showOutputSettings" type="select" label="Show advanced output settings" >
+                <option value="no" selected="true">no</option>
+                <option value="yes">yes</option>
+            </param>
+            <when value="no" />
+            <when value="yes">
+                <expand macro="input_image_file_format"/>
+                <param name="saveRawCounts" type="boolean" label="Save the bin counts"/>
+                <param name="saveCorMatrix" type="boolean" label="Save the correlation matrix"/>
+            </when>
+        </conditional>
+
+    </inputs>
+    <outputs>
+        <expand macro="output_image_file_format" />
+        <data format="tabular" name="outFileRawCounts" label="${tool.name} on ${on_string}: bin counts">
+            <filter>
+            ((
+                output['showOutputSettings'] == 'yes' and 
+                output['saveRawCounts'] is True
+            ))
+            </filter>
+        </data>
+        <data format="tabular" name="outFileCorMatrix" label="${tool.name} on ${on_string}: correlation matrix">
+            <filter>
+            ((
+                output['showOutputSettings'] == 'yes' and 
+                output['saveCorMatrix'] is True
+            ))
+            </filter>
+        </data>
+    </outputs>
+    <tests>
+        <test>
+            <repeat name="input_files">
+                <param name="bigwigfile" value="test.bw" ftype="bigwig" />
+                <param name="label" value="first bigwig file" />
+            </repeat>
+            <repeat name="input_files">
+                <param name="bigwigfile" value="test.bw" ftype="bigwig" />
+                <param name="label" value="second bigwig file" />
+            </repeat>
+            <param name="modeOpt" value="bins" />
+            <param name="binSize" value="10" />
+            <param name="showOutputSettings" value="no" />
+            <param name="corMethod" value="spearman" />
+            <output name="outFileName" file="bigwigCorrelate_result1.png" ftype="png" compare="sim_size" />
+        </test>
+    </tests>
+    <help>
+<![CDATA[
+**What it does**
+
+bigwigCorrelate computes the overall similarity between two or more bigWig
+files based on coverage means of genomic regions. The correlation analysis
+is performed for the entire genome by running the program in 'bins' mode,
+or for certain regions only in 'BED-file' mode. Pearson or Spearman analyses
+are available to compute correlation coefficients. Results are saved to a
+heat map file. Further output files are optional.
+
+
+**Output files**:
+
+- **diagnostic plot**: clustered heatmap displaying the values for each pair-wise correlation
+- data matrix (optional): if you want to plot the correlation values using a different program, e.g. R, this matrix can be used
+
+
+-----
+
+@REFERENCES@
+]]>
+    </help>
+    <expand macro="citations" />
+</tool>
diff -r 3a2aab18a217 -r 5231f398d784 computeGCBias.xml
--- a/computeGCBias.xml	Tue Sep 16 13:46:05 2014 -0400
+++ b/computeGCBias.xml	Tue Oct 20 14:43:12 2015 -0400
@@ -1,12 +1,12 @@
 <tool id="deeptools_computeGCBias" name="computeGCBias" version="@WRAPPER_VERSION@.0">
     <description>to see whether your samples should be normalized for GC bias</description>
-    <expand macro="requirements" />
-    <expand macro="stdio" />
     <macros>
         <token name="@BINARY@">computeGCBias</token>
         <import>deepTools_macros.xml</import>
     </macros>
+    <expand macro="requirements" />
     <command>
+<![CDATA[
         ln -s $bamInput local_bamInput.bam;
         ln -s $bamInput.metadata.bam_index local_bamInput.bam.bai;
 
@@ -30,7 +30,6 @@
             #end if
 
             #if $advancedOpt.showAdvancedOpt == "yes":
-
                 --sampleSize '$advancedOpt.sampleSize'
                 --regionSize '$advancedOpt.regionSize'
 
@@ -47,6 +46,7 @@
                 --biasPlot $outImageName
                 --plotFileFormat $image_format
             #end if
+]]>
     </command>
     <inputs>
         <param name="bamInput" format="bam" type="data" label="BAM file"
@@ -54,11 +54,7 @@
 
         <expand macro="reference_genome_source" />
         <expand macro="effectiveGenomeSize" />
-
-        <param name="fragmentLength" type="integer" value="300" min="1"
-            label="Fragment length used for the sequencing"
-            help ="If paired-end reads are used, the fragment length is computed from the BAM file."/>
-
+        <expand macro="fragmentLength" />
         <expand macro="region_limit_operation" />
 
         <conditional name="advancedOpt">
@@ -69,21 +65,28 @@
             <when value="no" />
             <when value="yes">
                 <param name="sampleSize" type="integer" value="50000000" min="1"
-                    label="Number of sampling points to be considered" />
-
+                    label="Number of sampling points to be considered" help="(--sampleSize)" />
                 <param name="regionSize" type="integer" value="300" min="1"
                     label="Region size"
-                    help ="To plot the reads per GC over a region, the size of the region is required (see below for more details of the mthod). By default, the bin size is set to 300 bp, which is close to the standard fragment size many sequencing applications. However, if the depth of sequencing is low, a larger bin size will be required, otherwise many bins will not overlap with any read."/>
-
+                    help ="To plot the reads per GC over a region, the size of the region is
+                    required (see below for more details of the mthod). By default, the bin size
+                    is set to 300 bp, which is close to the standard fragment size many sequencing
+                    applications. However, if the depth of sequencing is low, a larger bin size will
+                    be required, otherwise many bins will not overlap with any read. (--regionSize)"/>
                 <param name="filterOut" type="data" format="bed" optional="true"
                     label="BED file containing genomic regions to be excluded from the estimation of the correction"
-                    help="Such regions  usually contain repetitive regions and peaks that if included will bias the correction. It is recommended to filter out known repetitive regions if multi-reads (reads that map to more than one genomic position) were excluded. In the case of ChIP-seq data, it is recommended to first use a peak caller to identify and filter out the identified peaks." />
+                    help="Such regions  usually contain repetitive regions and peaks that if included will
+                    bias the correction. It is recommended to filter out known repetitive regions if multi-reads
+                    (reads that map to more than one genomic position) were excluded. In the case of ChIP-seq data,
+                    it is recommended to first use a peak caller to identify and filter out the identified peaks. (--filterOut)" />
                 <param name="extraSampling" type="data" format="bed" optional="true"
                     label="BED file containing genomic regions for which extra sampling is required because they are underrepresented in the genome"
-                    help="" />
+                    help="(--extraSampling)" />
             </when>
         </conditional>
-        <param name="image_format" type="select" label="GC bias plot" help="If given, a diagnostic image summarizing the GC bias found on the sample will be created.">
+        <param name="image_format" type="select"
+            label="GC bias plot"
+            help="If given, a diagnostic image summarizing the GC bias found on the sample will be created. (--plotFileFormat)">
             <option value="none">No image</option>
             <option value="png" selected="true">Image in png format</option>
             <option value="pdf">Image in pdf format</option>
@@ -93,8 +96,8 @@
         </param>
     </inputs>
     <outputs>
-        <data format="tabular" name="outFileName" />
-        <data format="png" name="outImageName" label="${tool.name} GC-bias Plot">
+        <data name="outFileName" format="tabular" />
+        <data name="outImageName" format="png" label="${tool.name} GC-bias Plot">
             <filter>
             ((
                 image_format != 'none'
@@ -108,8 +111,25 @@
             </change_format>
         </data>
     </outputs>
+    <tests>
+        <test>
+            <param name="bamInput" value="paired_chr2L.bam" ftype="bam" />
+            <param name="image_format" value="png" />
+            <param name="showAdvancedOpt" value="yes" />
+            <param name="regionSize" value="1" />
+            <param name="fragmentLength" value="100" />
+            <param name="ref_source" value="history" />
+            <param name="input1" value="sequence.2bit" />
+            <param name="sampleSize" value="10" />
+            <param name="effectiveGenomeSize_opt" value="specific" />
+            <param name="effectiveGenomeSize" value="23011544" />
+            <param name="region" value="chr2L" />
+            <param name="image_format" value="none" />
+            <output name="outFileName" file="computeGCBias_result1.tabular" ftype="tabular" />
+        </test>
+    </tests>
     <help>
-
+<![CDATA[
 **What it does**
 
 This tool computes the GC bias using the method proposed by Benjamini and Speed (2012) Nucleic Acids Res. (see below for more explanations)
@@ -150,7 +170,7 @@
 -----
 
 @REFERENCES@
-
+]]>
     </help>
     <expand macro="citations" />
 </tool>
diff -r 3a2aab18a217 -r 5231f398d784 computeMatrix.xml
--- a/computeMatrix.xml	Tue Sep 16 13:46:05 2014 -0400
+++ b/computeMatrix.xml	Tue Oct 20 14:43:12 2015 -0400
@@ -1,197 +1,262 @@
 <tool id="deeptools_computeMatrix" name="computeMatrix" version="@WRAPPER_VERSION@.0">
-    <description>summarizes and prepares an intermediary file containing scores associated with genomic regions that can be used afterwards to plot a heatmap or a profile</description>
-    <expand macro="requirements" />
-    <expand macro="stdio" />
+    <description>preparation step to plot a heatmap or a profile</description>
     <macros>
         <token name="@BINARY@">computeMatrix</token>
         <import>deepTools_macros.xml</import>
     </macros>
+    <expand macro="requirements" />
     <command>
+<![CDATA[
         #import tempfile
 
-    #set $temp_input_handle = tempfile.NamedTemporaryFile()
-    #set $temp_input_path = $temp_input_handle.name
-    #silent $temp_input_handle.close()
+        #for $rf in $regionsFiles:
+            cat "$rf.regionsFile" >> ./temp_input_path;
+            #if str($rf.label.value).strip():
+                echo "\#$rf.label.value" >> ./temp_input_path;
+            #else:
+                echo "\#$rf.regionsFile.name" >> ./temp_input_path;
+            #end if
+        #end for
 
-    #for $rf in $regionsFiles:
-        cat "$rf.regionsFile" >> $temp_input_path;
-        #if str($rf.label.value).strip():
-            echo "\#$rf.label.value" >> $temp_input_path;
-        #else:
-            echo "\#$rf.regionsFile.name" >> $temp_input_path;
-        #end if
-    #end for
+        computeMatrix
 
+            $mode.mode_select
+            --regionsFileName ./temp_input_path
+            --scoreFileName '$scoreFile'
+            --outFileName '$outFileName'
 
-  computeMatrix
+            @THREADS@
 
-  $mode.mode_select
-  --regionsFileName '$temp_input_path'
-  --scoreFileName '$scoreFile'
-  --outFileName '$outFileName'
+            #if $output.showOutputSettings == "yes"
+                #if $output.saveData:
+                    --outFileNameData '$outFileNameData' 
+                #end if
+                #if $output.saveMatrix:
+                --outFileNameMatrix '$outFileNameMatrix'
+                #end if
 
-    @THREADS@
+                #if $output.saveSortedRegions:
+                    --outFileSortedRegions '$outFileSortedRegions'
+                #end if
+            #end if
 
-  #if $output.showOutputSettings == "yes"
-      #if $output.saveData:
-        --outFileNameData '$outFileNameData' 
-      #end if
-      #if $output.saveMatrix:
-      --outFileNameMatrix '$outFileNameMatrix'
-      #end if
-
-      #if $output.saveSortedRegions:
-        --outFileSortedRegions '$outFileSortedRegions'
-      #end if
-  #end if
+            #if $mode.mode_select == "reference-point":
+                --referencePoint $mode.referencePoint
+                $mode.nanAfterEnd
+                --beforeRegionStartLength $mode.beforeRegionStartLength
+                --afterRegionStartLength $mode.afterRegionStartLength
+            #else
+                --regionBodyLength $mode.regionBodyLength
+                --startLabel "$mode.startLabel"
+                --endLabel "$mode.endLabel"
+                #if $mode.regionStartLength.regionStartLength_select == "yes":
+                    --beforeRegionStartLength $mode.regionStartLength.beforeRegionStartLength
+                    --afterRegionStartLength $mode.regionStartLength.afterRegionStartLength
+                #end if
+            #end if
 
-  #if $mode.mode_select == "reference-point":
-    --referencePoint $mode.referencePoint
-    $mode.nanAfterEnd
-    --beforeRegionStartLength $mode.beforeRegionStartLength
-    --afterRegionStartLength $mode.afterRegionStartLength
-  #else
-    --regionBodyLength $mode.regionBodyLength
-    --startLabel "$mode.startLabel"
-    --endLabel "$mode.endLabel"
-    #if $mode.regionStartLength.regionStartLength_select == "yes":
-      --beforeRegionStartLength $mode.regionStartLength.beforeRegionStartLength
-      --afterRegionStartLength $mode.regionStartLength.afterRegionStartLength
-    #end if
-  #end if
+            #if $advancedOpt.showAdvancedOpt == "yes":
+                --sortRegions '$advancedOpt.sortRegions'
+                --sortUsing '$advancedOpt.sortUsing'
+                --averageTypeBins '$advancedOpt.averageTypeBins'
+                $advancedOpt.missingDataAsZero
+                $advancedOpt.skipZeros
+                --binSize $advancedOpt.binSize
 
-  #if $advancedOpt.showAdvancedOpt == "yes":
-    --sortRegions '$advancedOpt.sortRegions'
-    --sortUsing '$advancedOpt.sortUsing'
-    --averageTypeBins '$advancedOpt.averageTypeBins'
-    $advancedOpt.missingDataAsZero
-    $advancedOpt.skipZeros
-    --binSize $advancedOpt.binSize
+                #if $advancedOpt.minThreshold is not None and str($advancedOpt.minThreshold) != '':
+                    --minThreshold $advancedOpt.minThreshold
+                #end if
+                #if $advancedOpt.maxThreshold is not None and str($advancedOpt.maxThreshold) != '':
+                    --maxThreshold $advancedOpt.maxThreshold
+                #end if
+                #if $advancedOpt.scale is not None and str($advancedOpt.scale) != '':
+                    --scale $advancedOpt.scale
+                #end if
+
+            #end if
+]]>
+    </command>
+    <inputs>
 
-    #if $advancedOpt.minThreshold:
-    --minThreshold $advancedOpt.minThreshold
-    #end if
-    #if $advancedOpt.maxThreshold:
-    --maxThreshold $advancedOpt.maxThreshold
-    #end if
-    #if $advancedOpt.scale:
-    --scale $advancedOpt.scale
-    #end if
+        <repeat name="regionsFiles" title="regions to plot" min="1">
+            <param name="regionsFile" format="bed" type="data" label="Regions to plot"
+                help="File, in BED format, containing the regions to plot."/>
+            <param name="label" type="text" size="30" optional="true" value="" label="Label"
+                help="Label to use in the output."/>
+        </repeat>
 
-  #end if
-  ; rm $temp_input_path
-
-  </command>
-  <inputs>
+        <param name="scoreFile" format="bigwig" type="data"
+            label="Score file"
+            help="Should be a bigWig file (containing a score, usually covering
+            the whole genome). You can generate a bigWig file either from a
+            bedGraph or WIG file using UCSC tools or from a BAM file using the
+            deepTool bamCoverage. (-scoreFile)"/>
 
-    <repeat name="regionsFiles" title="regions to plot" min="1">
-        <param name="regionsFile" format="bed" type="data" label="Regions to plot" help="File, in BED format, containing the regions to plot."/>
-        <param name="label" type="text" size="30" optional="true" value="" label="Label" help="Label to use in the output."/>
-    </repeat>
-
-    <param name="scoreFile" format="bigwig" type="data" label="Score file" help="Should be a bigWig file (containing a score, usually covering the whole genome). You can generate a bigWig file either from a bedGraph or WIG file using UCSC tools or from a BAM file using the deepTool bamCoverage."/>
+        <conditional name="mode" >
+            <param name="mode_select" type="select"
+                label="computeMatrix has two main output options"
+                help="In the scale-regions mode, all regions in the BED file are
+                stretched or shrunk to the same length (bp) that is indicated
+                by the user. Reference-point refers to a position within the BED
+                regions (e.g start of region). In the reference-point mode only
+                those genomic positions before (downstream) and/or after (upstream)
+                the reference point will be plotted.">
+                <option value="scale-regions" selected="true">scale-regions</option>
+                <option value="reference-point">reference-point</option>
+            </param>
 
-    <conditional name="mode" >
-      <param name="mode_select" type="select" label="computeMatrix has two main output options" help="In the scale-regions mode, all regions in the BED file are stretched or shrunk to the same length (bp) that is indicated by the user. Reference-point refers to a position within the BED regions (e.g start of region). In the reference-point mode only those genomic positions before (downstream) and/or after (upstream) the reference point will be plotted.">
-        <option value="scale-regions" selected="true">scale-regions</option>
-        <option value="reference-point">reference-point</option>
-      </param>
-
-      <when value="scale-regions" >
-        <param name="regionBodyLength" type="integer" value="500" label="Distance in bp to which all regions are going to be fitted"/>
-        <param name="startLabel" type="text" value="TSS" size="10" label="Label for the region start" help ="Label shown in the plot for the start of the region. Default is TSS (transcription start site), but could be changed to anything, e.g. &quot;peak start&quot;." />
-        <param name="endLabel" type="text" value="TES" size="10" label="Label for the region end" help="Label shown in the plot for the region end. Default is TES (transcription end site)."/>
-            <conditional name="regionStartLength">
-                <param name="regionStartLength_select" type="select" label="Set distance up- and downstream of the given regions">
-                    <option value="no" selected="true">no</option>
-                    <option value="yes">yes</option>
+            <when value="scale-regions" >
+                <param name="regionBodyLength" type="integer" value="500"
+                    label="Distance in bp to which all regions are going to be fitted" help="(--regionBodyLength)"/>
+                <param name="startLabel" type="text" value="TSS" size="10"
+                    label="Label for the region start"
+                    help ="Label shown in the plot for the start of the region.
+                    Default is TSS (transcription start site), but could be changed to anything,
+                    e.g. &quot;peak start&quot;. (--startLabel)" />
+                <param name="endLabel" type="text" value="TES" size="10"
+                    label="Label for the region end"
+                    help="Label shown in the plot for the region end. Default is TES (transcription end site). (--endLabel)"/>
+                <conditional name="regionStartLength">
+                    <param name="regionStartLength_select" type="select" label="Set distance up- and downstream of the given regions">
+                        <option value="no" selected="true">no</option>
+                        <option value="yes">yes</option>
+                    </param>
+                    <when value="no" />
+                    <when value="yes">
+                        <param name="beforeRegionStartLength" type="integer" value="1000" min="1"
+                            label="Distance upstream of the start site of the regions defined in the region file"
+                            help="If the regions are genes, this would be the
+                            distance upstream of the transcription start site. (--beforeRegionStartLength)"/>
+                        <param name="afterRegionStartLength" type="integer" value="1000" min="1"
+                            label="Distance downstream of the end site of the given regions"
+                            help="If the regions are genes, this would be the
+                            distance downstream of the transcription end site. (--afterRegionStartLength)"/>
+                    </when>
+                </conditional>
+            </when>
+            <when value="reference-point">
+                <param name="referencePoint" type="select" label="The reference point for the plotting">
+                    <option value="TSS" selected="true">beginning of region (e.g. TSS)</option>
+                    <option	 value="TES">end of region (e.g. TES)</option>
+                    <option value="center">center of region</option>
                 </param>
-                <when value="no" />
-                <when value="yes">
-                    <param name="beforeRegionStartLength" type="integer" value="1000" min="1" optional="true" label="Distance upstream of the start site of the regions defined in the region file" help="If the regions are genes, this would be the distance upstream of the transcription start site."/>
-                    <param name="afterRegionStartLength" type="integer" value="1000" min="1" optional="true" label="Distance downstream of the end site of the given regions" help="If the regions are genes, this would be the distance downstream of the transcription end site."/>
-                </when>
-            </conditional>
-      </when>
-      
-      <when value="reference-point">
-        <param name="referencePoint" type="select" label="The reference point for the plotting">
-            <option value="TSS" selected="true">beginning of region (e.g. TSS)</option>
-            <option	 value="TES">end of region (e.g. TES)</option>
-            <option value="center">center of region</option>
-        </param>
-        <param name="nanAfterEnd" type="boolean" truevalue="--nanAfterEnd" falsevalue="" label="Discard any values after the region end" help="This is useful to visualize the region end when not using the scale-regions mode and when the reference-point is set to the TSS."/>
-        <param name="beforeRegionStartLength" type="integer" value="1000" min="1" label="Distance upstream of the start site of the regions defined in the region file" help="If the regions are genes, this would be the distance upstream of the transcription start site."/>
-        <param name="afterRegionStartLength" type="integer" value="1000" min="1" label="Distance downstream of the end site of the given regions" help="If the regions are genes, this would be the distance downstream of the transcription end site."/>
-      </when>
-    </conditional>
+                <param name="nanAfterEnd" type="boolean" truevalue="--nanAfterEnd" falsevalue=""
+                    label="Discard any values after the region end"
+                    help="This is useful to visualize the region end when not using the
+                    scale-regions mode and when the reference-point is set to the TSS. (--nanAfterEnd)"/>
+                <param name="beforeRegionStartLength" type="integer" value="1000" min="1"
+                    label="Distance upstream of the start site of the regions defined in the region file"
+                    help="If the regions are genes, this would be the distance upstream of the transcription start site. (--beforeRegionStartLength)"/>
+                <param name="afterRegionStartLength" type="integer" value="1000" min="1"
+                    label="Distance downstream of the end site of the given regions"
+                    help="If the regions are genes, this would be the distance downstream of the transcription end site. (--afterRegionStartLength)"/>
+            </when>
+        </conditional>
 
-    <expand macro="input_graphic_output_settings">
-        <expand macro="input_save_matrix_values" />
-    </expand>
+        <expand macro="input_graphic_output_settings">
+            <expand macro="input_save_matrix_values" />
+        </expand>
 
-    <conditional name="advancedOpt" >
-      <param name="showAdvancedOpt" type="select" label="Show advanced options" >
-        <option value="no" selected="true">no</option>
-        <option value="yes">yes</option>
-      </param>
-      <when value="no" />
-      <when value="yes">
-        <param name="binSize" type="integer" value="100" min="1" optional="true" label="Length, in base pairs, of the non-overlapping bin for averaging the score over the regions length" />
-        <param name="sortRegions" type="select" label="Sort regions"
-           help="Whether the output file should present the regions sorted.">
-          <option value="no" selected="true">no ordering</option>
-          <option value="descend">descending order</option>
-          <option value="ascend">ascending order</option>
-        </param>
+        <conditional name="advancedOpt" >
+            <param name="showAdvancedOpt" type="select" label="Show advanced options" >
+                <option value="no" selected="true">no</option>
+                <option value="yes">yes</option>
+            </param>
+            <when value="no" />
+            <when value="yes">
+                <param name="binSize" type="integer" value="10" min="1"
+                    label="Length, in base pairs, of the non-overlapping bin for averaging the score over the regions length"
+                    help="(--binSize)"/>
+                <param name="sortRegions" type="select" label="Sort regions"
+                    help="Whether the output file should present the regions sorted.">
+                    <option value="no" selected="true">no ordering</option>
+                    <option value="descend">descending order</option>
+                    <option value="ascend">ascending order</option>
+                </param>
 
-        <param name="sortUsing" type="select" label="Method used for sorting." help="The value is computed for each row." >
-          <option value="mean" selected="true">mean</option>
-          <option value="median">median</option>
-          <option value="min">min</option>
-          <option value="max">max</option>
-          <option value="sum">sum</option>
-          <option value="region_length">region length</option>
-        </param>
+                <param name="sortUsing" type="select" label="Method used for sorting"
+                    help="The value is computed for each row. (--sortUsing)" >
+                    <option value="mean" selected="true">mean</option>
+                    <option value="median">median</option>
+                    <option value="min">min</option>
+                    <option value="max">max</option>
+                    <option value="sum">sum</option>
+                    <option value="region_length">region length</option>
+                </param>
 
-        <param name="averageTypeBins" type="select" label="Define the type of statistic that should be displayed." help="The value is computed for each bin.">
-          <option value="mean" selected="true">mean</option>
-          <option value="median">median</option>
-          <option value="min">min</option>
-          <option value="max">max</option>
-          <option value="sum">sum</option>
-          <option value="std">std</option>
-        </param>
+                <param name="averageTypeBins" type="select"
+                    label="Define the type of statistic that should be displayed."
+                    help="The value is computed for each bin. (--averageTypeBins)">
+                    <option value="mean" selected="true">mean</option>
+                    <option value="median">median</option>
+                    <option value="min">min</option>
+                    <option value="max">max</option>
+                    <option value="sum">sum</option>
+                    <option value="std">std</option>
+                </param>
 
-        <param name="missingDataAsZero" type="boolean" truevalue="--missingDataAsZero" falsevalue="" label="Indicate missing data as zero" help="Set to &quot;yes&quot;, if missing data should be indicated as zeros. Default is to ignore such cases which will be depicted as black areas in the heatmap. (see &quot;Missing data color&quot; options of the heatmapper for additional options)."/>
-        <param name="skipZeros" type="boolean" truevalue="--skipZeros" falsevalue="" label="Skip zeros" help="Whether regions with only scores of zero should be included or not. Default is to include them."/>
-        <param name="minThreshold" type="float" optional="true" label="Minimum threshold" help="Any region containing a value that is equal or less than this numeric value will be skipped. This is useful to skip, for example, genes where the read count is zero for any of the bins. This could be the result of unmappable areas and can bias the overall results."/>
-        <param name="maxThreshold" type="float" optional="true" label="Maximum threshold" help="Any region containing a value that is equal or higher that this numeric value will be skipped. The max threshold is useful to skip those few regions with very high read counts (e.g. major satellites) that may bias the average values."/>
-        <param name="scale" type="float" optional="true" label="Scale" help="If set, all values are multiplied by this number."/>
-      </when>
-    </conditional>
-    
+                <param name="missingDataAsZero" type="boolean" truevalue="--missingDataAsZero" falsevalue=""
+                    label="Indicate missing data as zero"
+                    help="Set to &quot;yes&quot;, if missing data should be indicated as zeros.
+                    Default is to ignore such cases which will be depicted as black areas in the
+                    heatmap. (see &quot;Missing data color&quot; options of the heatmapper for additional options).
+                    (--missingDataAsZero)"/>
+                <param name="skipZeros" type="boolean" truevalue="--skipZeros" falsevalue=""
+                    label="Skip zeros"
+                    help="Whether regions with only scores of zero should be included or not.
+                    Default is to include them. (--skipZeros)"/>
+                <param name="minThreshold" type="float" optional="True"
+                    label="Minimum threshold"
+                    help="Any region containing a value that is equal or less than this numeric
+                    value will be skipped. This is useful to skip, for example, genes where the
+                    read count is zero for any of the bins. This could be the result of
+                    unmappable areas and can bias the overall results. (--minThreshold)"/>
+                <param name="maxThreshold" type="float" optional="True"
+                    label="Maximum threshold"
+                    help="Any region containing a value that is equal or higher that this
+                    numeric value will be skipped. The max threshold is useful to skip those
+                    few regions with very high read counts (e.g. major satellites) that may
+                    bias the average values. (--maxThreshold)"/>
+                <param name="scale" type="float" optional="True" label="Scaling factor"
+                    help="If set, all values are multiplied by this number. (--scale)"/>
+            </when>
+        </conditional>
     </inputs>
-  <outputs>
-    <data format="bgzip" name="outFileName" label="${tool.name} on ${on_string}: Matrix" />
-    <expand macro="output_graphic_outputs" />
-    <expand macro="output_save_matrix_values" />
-  </outputs>
+    <outputs>
+        <data format="deeptools_compute_matrix_archive" name="outFileName" label="${tool.name} on ${on_string}: Matrix" />
+        <expand macro="output_graphic_outputs" />
+        <expand macro="output_save_matrix_values" />
+    </outputs>
     <!--
     computeMatrix -S test.bw -R test2.bed -a 100 -b 100 -bs 1 
     -->
     <tests>
         <test>
-            <param name="regionsFile" value="test2.bed" ftype="bed" />
-            <param name="scoreFile" value="test.bw" ftype="bigwig" />
-            <param name="advancedOpt.binSize" value="1" />
-            <param name="mode.beforeRegionStartLength" value="100" />
-            <param name="mode.afterRegionStartLength" value="100" />
-            <output name="outFileName" file="master.mat.gz" ftype="bgzip" compare="sim_size" delta="100" />
+            <param name="regionsFile" value="computeMatrix1.bed" ftype="bed" />
+            <param name="scoreFile" value="bamCoverage_result4.bw" ftype="bigwig" />
+            <param name="showAdvancedOpt" value="yes" />
+            <param name="mode_select" value="reference-point" />
+            <param name="binSize" value="10" />
+            <param name="sortUsing" value="sum" />
+            <param name="averageTypeBins" value="sum" />
+            <param name="missingDataAsZero" value="True" />
+            <param name="beforeRegionStartLength" value="10" />
+            <param name="afterRegionStartLength" value="10" />
+            <output name="outFileName" file="computeMatrix_result1.gz" ftype="deeptools_compute_matrix_archive" compare="sim_size" />
+        </test>
+        <test>
+            <param name="regionsFile" value="computeMatrix2.bed" ftype="bed" />
+            <param name="scoreFile" value="computeMatrix2.bw" ftype="bigwig" />
+            <param name="showAdvancedOpt" value="yes" />
+            <param name="mode_select" value="reference-point" />
+            <param name="binSize" value="10" />
+            <param name="beforeRegionStartLength" value="10" />
+            <param name="afterRegionStartLength" value="10" />
+            <output name="outFileName" file="computeMatrix_result2.gz" ftype="deeptools_compute_matrix_archive" compare="sim_size" />
         </test>
     </tests>
   <help>
-
+<![CDATA[
 **What it does**
 
 This tool prepares an intermediary file (a gzipped table of values)
@@ -217,7 +282,7 @@
 -----
 
 @REFERENCES@
-
+]]>
     </help>
     <expand macro="citations" />
 </tool>
diff -r 3a2aab18a217 -r 5231f398d784 correctGCBias.xml
--- a/correctGCBias.xml	Tue Sep 16 13:46:05 2014 -0400
+++ b/correctGCBias.xml	Tue Oct 20 14:43:12 2015 -0400
@@ -1,92 +1,60 @@
 <tool id="deeptools_correctGCBias" name="correctGCBias" version="@WRAPPER_VERSION@.0">
     <description>uses the output from computeGCBias to generate corrected BAM files</description>
-    <expand macro="requirements" />
-    <expand macro="stdio" />
     <macros>
         <token name="@BINARY@">correctGCBias</token>
         <import>deepTools_macros.xml</import>
     </macros>
+    <expand macro="requirements" />
     <command>
-        #import tempfile
-        #set $temp_dir = os.path.abspath(tempfile.mkdtemp())
-
-        #set $temp_bam_handle = tempfile.NamedTemporaryFile( dir=$temp_dir )
-        #set $temp_bam_path = $temp_bam_handle.name + '.bam'
-        #silent $temp_bam_handle.close()
-        #silent os.system("ln -s %s %s" % (str($bamInput), $temp_bam_path))
-        #silent os.system("ln -s %s %s.bai" % (str($bamInput.metadata.bam_index), $temp_bam_path))
-
+<![CDATA[
+        ln -s $bamInput local_bamInput.bam;
+        ln -s $bamInput.metadata.bam_index local_bamInput.bam.bai;
 
         correctGCBias
-
-        @THREADS@
-
-        --bamfile '$temp_bam_path'
-        --GCbiasFrequenciesFile $GCbiasFrequenciesFile
+            @THREADS@
+            --bamfile local_bamInput.bam
+            --GCbiasFrequenciesFile $GCbiasFrequenciesFile
 
-        @reference_genome_source@
-
-
-        #if $effectiveGenomeSize.effectiveGenomeSize_opt == "specific":
-            --effectiveGenomeSize $effectiveGenomeSize.effectiveGenomeSize
-        #else:
-            --effectiveGenomeSize $effectiveGenomeSize.effectiveGenomeSize_opt
-        #end if
+            @reference_genome_source@
 
-        #if str($region).strip() != '':
-            --region '$region'
-        #end if
+            #if $effectiveGenomeSize.effectiveGenomeSize_opt == "specific":
+                --effectiveGenomeSize $effectiveGenomeSize.effectiveGenomeSize
+            #else:
+                --effectiveGenomeSize $effectiveGenomeSize.effectiveGenomeSize_opt
+            #end if
 
-        #if $advancedOpt.showAdvancedOpt == "yes":
-            --binSize '$advancedOpt.binSize'  
-        #end if
+            #if str($region).strip() != '':
+                --region '$region'
+            #end if
+            --correctedFile corrected.bam;
 
-        ###set newoutFileName="corrected."+str($outFileFormat)
-        ##--correctedFile $newoutFileName;
-        --correctedFile "corrected.bam";
-
-        ##mv $newoutFileName $outFileName
-        mv "corrected.bam" $outFileName
+        mv corrected.bam $outFileName;
+]]>
     </command>
     <inputs>
         <param name="GCbiasFrequenciesFile" type="data" format="tabular" label="Output of computeGCBias" />
-        <param name="bamInput" format="bam" type="data" label="BAM file" help="This should be same file that was used for computeGCbias. The BAM file must be sorted."/>
+        <param name="bamInput" format="bam" type="data"
+            label="BAM file" help="This should be same file that was used for computeGCbias. The BAM file must be sorted. (--bamfile)" />
         <expand macro="reference_genome_source" />
         <expand macro="effectiveGenomeSize" />
-
-        <!--
-        <param name="outFileFormat" type="select" label="File format of the output">
-            <option value="bam">bam</option>
-            <option value="bw">bigwig</option>
-            <option value="bg">bedgraph</option>
-        </param>
-        -->
         <expand macro="region_limit_operation" />
-
-        <conditional name="advancedOpt">
-            <param name="showAdvancedOpt" type="select" label="Show advanced options" >
-                <option value="no" selected="true">no</option>
-                <option value="yes">yes</option>
-            </param>
-            <when value="no" />
-            <when value="yes">
-                <param name="binSize" type="integer" value="50" min="1" 
-                    label="Bin size in bp"
-                    help="Size of the bins in bp for the output of the bigwig/bedgraph file."/>
-            </when>
-        </conditional>
     </inputs>
     <outputs>
-        <data format="bam" name="outFileName">
-            <!--<change_format>
-                <when input="outFileFormat" value="bw" format="bigwig" />
-                <when input="outFileFormat" value="bam" format="bam" />
-                <when input="outFileFormat" value="bg" format="bedgraph" />
-            </change_format>-->
-        </data>
+        <data format="bam" name="outFileName" />
     </outputs>
+    <tests>
+        <test>
+            <param name="GCbiasFrequenciesFile" value="computeGCBias_result1.tabular" ftype="tabular" />
+            <param name="bamInput" value="paired_chr2L.bam" ftype="bam" />
+            <param name="ref_source" value="history" />
+            <param name="input1" value="sequence.2bit" />
+            <param name="effectiveGenomeSize_opt" value="specific" />
+            <param name="effectiveGenomeSize" value="23011544" />
+            <output name="outFileName" file="correctGCBias_result1.bam" ftype="bam" />
+        </test>
+    </tests>
     <help>
-
+<![CDATA[
 **What it does**
 
 This tool requires the output from computeGCBias to correct a given BAM file according to the method proposed by
@@ -103,7 +71,7 @@
 -----
 
 @REFERENCES@
-
+]]>
     </help>
     <expand macro="citations" />
 </tool>
diff -r 3a2aab18a217 -r 5231f398d784 datatypes_conf.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/datatypes_conf.xml	Tue Oct 20 14:43:12 2015 -0400
@@ -0,0 +1,6 @@
+<?xml version="1.0"?>
+<datatypes>
+    <registration>
+        <datatype extension="deeptools_compute_matrix_archive" type="galaxy.datatypes.binary:CompressedArchive" subclass="True" display_in_upload="True"/>
+    </registration>
+</datatypes>
diff -r 3a2aab18a217 -r 5231f398d784 deepTools_macros.xml
--- a/deepTools_macros.xml	Tue Sep 16 13:46:05 2014 -0400
+++ b/deepTools_macros.xml	Tue Oct 20 14:43:12 2015 -0400
@@ -10,57 +10,67 @@
             </param>
             <when value="no" />
             <when value="yes">
-                <param name="doNotExtendPairedEnds" type="boolean" truevalue="--doNotExtendPairedEnds" falsevalue=""
-                    label="Do not extend paired ends"
-                    help="If set, reads are not extended to match the fragment length reported in the BAM file, instead they will be extended to match the fragment length. Default is to extend the reads if paired end information is available."/>
-
-                <param name="ignoreDuplicates" type="boolean" truevalue="--ignoreDuplicates" falsevalue=""
-                    label="Ignore duplicates"
-                    help="If set, reads that have the same orientation and start position will be considered only once. If reads are paired, the mate position also has to coincide to ignore a read." /> 
-
-                <param name="minMappingQuality" type="integer" optional="true" value="1" min="1"
-                    label="Minimum mapping quality"
-                    help= "If set, only reads that have a mapping quality score higher than the given value are considered. *Note* Bowtie's Mapping quality is related to uniqueness: the higher the score, the more unique is a read. A mapping quality defined by Bowtie of 10 or less indicates that there is at least a 1 in 10 chance that the read truly originated elsewhere."/>
-
-                <param name="includeZeros" type="boolean" truevalue="--includeZeros" falsevalue=""
-                    label ="Include zeros"
-                    help  ="If set, then regions with zero counts for *all* BAM files given are included. The default behavior is to ignore those cases." />
-
-                <param name="zMin" type="integer" value="" optional="true" label="Minimum value for the heatmap intensities"
-                    help="If not specified the value is set automatically."/>
-
-                <param name="zMax" type="integer" value="" optional="true" label="Maximum value for the heatmap intensities"
-                    help="If not specified the value is set automatically."/>
-
+                <expand macro="doNotExtendPairedEnds" />
+                <expand macro="ignoreDuplicates" />
+                <expand macro="minMappingQuality" />
+                <expand macro="includeZeros" />
+                <expand macro="zMin_zMax" />
                 <expand macro="colormap" />
             </when>
         </conditional>
     </xml>
 
+
+    <xml name="bigwigCorrelate_mode_actions">
+
+        <expand macro="region_limit_operation" />
+
+        <conditional name="advancedOpt">
+            <param name="showAdvancedOpt" type="select" label="Show advanced options" >
+                <option value="no" selected="true">no</option>
+                <option value="yes">yes</option>
+            </param>
+            <when value="no" />
+            <when value="yes">
+                <expand macro="includeZeros" />
+                <expand macro="zMin_zMax" />
+                <expand macro="colormap" />
+                <expand macro="plotTitle" />
+                <expand macro="plotNumbers" />
+            </when>
+        </conditional>
+    </xml>
+
+
+    <xml name="includeZeros">
+        <param name="includeZeros" type="boolean" truevalue="--includeZeros" falsevalue=""
+            label="Include zeros"
+            help="If set, then regions with zero counts for *all* BAM files given are included. The default behavior is to ignore those cases. (--includeZeros)" />
+    </xml>
+    <xml name="zMin_zMax">
+        <param name="zMin" type="integer" value="" optional="true" label="Minimum value for the heatmap intensities"
+            help="If not specified the value is set automatically. (--zMin)"/>
+        <param name="zMax" type="integer" value="" optional="true" label="Maximum value for the heatmap intensities"
+            help="If not specified the value is set automatically. (--zMax)"/>
+    </xml>
+
     <xml name="region_limit_operation">
         <param name="region" type="text" value=""
             label="Region of the genome to limit the operation to"
-            help="This is useful when testing parameters to reduce the computing time. The format is chr:start:end, for example &quot;chr10&quot; or &quot;chr10:456700:891000&quot;" />
+            help="This is useful when testing parameters to reduce the computing time. The format is chr:start:end, for example &quot;chr10&quot; or &quot;chr10:456700:891000&quot;. (--region)" />
     </xml>
-    
+
     <token name="@THREADS@">--numberOfProcessors "\${GALAXY_SLOTS:-4}"</token>
-    <token name="@WRAPPER_VERSION@">1.5.9.1</token>
+    <token name="@WRAPPER_VERSION@">1.5.11</token>
     <xml name="requirements">
         <requirements>
+            <requirement type="package" version="2.7">python</requirement>
             <requirement type="binary">@BINARY@</requirement>
-            <requirement type="package" >samtools</requirement>
             <requirement type="package" >deepTools</requirement>
-            <requirement type="package" >ucsc_tools</requirement>
-            <requirement type="package" version="1.5.9.1">deepTools</requirement>
-            <requirement type="package" version="0.1">ucsc_tools</requirement>
-            <requirement type="package" version="1.7.1">numpy</requirement>
-            <requirement type="package" version="0.7.7">pysam</requirement>
-            <requirement type="package" version="0.12.0">scipy</requirement>
-            <requirement type="package" version="1.2.1">matplotlib</requirement>
-            <requirement type="package" version="0.1.19">samtools</requirement>
-            <requirement type="package" version="12-2013">bx-python</requirement>
+            <requirement type="package" version="1.5.11">deepTools</requirement>
             <yield />
         </requirements>
+        <expand macro="stdio" />
         <version_command>@BINARY@ --version</version_command>
     </xml>
 
@@ -70,7 +80,7 @@
                 label="Did you compute the matrix with more than one groups of regions?"
                 help="Would you like to cluster the regions according to the similarity of the signal distribution? This is only possible if you used computeMatrix on only one group of regions.">
                 <option value="yes">Yes, I used multiple groups of regions</option>
-                <option value="no">No, I used only one region.</option>
+                <option value="no">No, I used only one group</option>
             </param>
             <when value="no">
                 <conditional name="clustering">
@@ -87,9 +97,9 @@
             </when>
             <when value="yes" />
         </conditional>
+    </xml>
 
-    </xml>
-    <token name="@kmeans_clusterin@">
+    <token name="@KMEANS_CLUSTERING@">
         #if $advancedOpt.used_multiple_regions.used_multiple_regions_options == 'no':
             #if $advancedOpt.used_multiple_regions.clustering.clustering_options == 'kmeans':
                 #if int($advancedOpt.used_multiple_regions.clustering.k_kmeans) > 0:
@@ -99,6 +109,51 @@
         #end if
     </token>
 
+    <xml name="samFlag">
+        <param name="samFlag" type="integer" optional="true" value=""
+            label="Filter reads based on the SAM flag"
+            help= "For example to get only reads that are the first mate use a flag of 64. This is useful to count properly paired reads only once, otherwise the second mate will be also considered for the coverage. (--samFlag)"/>
+    </xml>
+    <xml name="plotNumbers">
+        <param name="plotNumbers" type="boolean" truevalue="--plotNumbers" falsevalue="" 
+            label="Plot the correlation value" 
+            help="If set, then the correlation number is plotted on top of the heatmap. (--plotNumbers)"/>
+    </xml>
+    <xml name="doNotExtendPairedEnds">
+        <param name="doNotExtendPairedEnds" type="boolean" truevalue="--doNotExtendPairedEnds" falsevalue=""
+            label="Do not extend paired ends"
+            help="If set, reads are not extended to match the fragment length reported in the BAM file, instead they will be extended to match the fragment length. Default is to extend the reads if paired end information is available. (--doNotExtendPairedEnds)"/>
+    </xml>
+
+    <xml name="ignoreDuplicates">
+        <param name="ignoreDuplicates" type="boolean" truevalue="--ignoreDuplicates" falsevalue=""
+            label="Ignore duplicates"
+            help="If set, reads that have the same orientation and start position will be considered only once. If reads are paired, the mate position also has to coincide to ignore a read. (--ignoreDuplicates)" />
+    </xml>
+
+    <xml name="minMappingQuality">
+        <param name="minMappingQuality" type="integer" optional="true" value="1" min="1"
+            label="Minimum mapping quality"
+            help= "If set, only reads that have a mapping quality score higher than the given value are considered. *Note* Bowtie's Mapping quality is related to uniqueness: the higher the score, the more unique is a read. A mapping quality defined by Bowtie of 10 or less indicates that there is at least a 1 in 10 chance that the read truly originated elsewhere. (--minMappingQuality)"/>
+    </xml>
+
+    <xml name="skipZeros">
+        <param name="skipZeros" type="boolean" truevalue="--skipZeros" falsevalue=""
+            label ="Skip zeros"
+            help  ="If set, then zero counts that happen for *all* BAM files given are ignored. This might have the effect that fewer regions are considered than indicated in the option where the number of samples is defined. (--skipZeros)" />
+    </xml>
+
+    <xml name="fragmentLength">
+        <param name="fragmentLength" type="integer" value="300" min="1"
+            label="Fragment length used for the sequencing"
+            help ="If paired-end reads are used, the fragment length is computed from the BAM file. (--fragmentLength)"/>
+    </xml>
+
+    <xml name="scaleFactor">
+        <param name="scaleFactor1" type="float" value="1" label="Scale factor for treatment" help="(--scaleFactors)"/>
+        <param name="scaleFactor2" type="float" value="1" label="Scale factor for input" help="(--scaleFactors)"/>
+    </xml>
+
     <xml name="stdio">
         <stdio>
             <exit_code range="1:" />
@@ -109,9 +164,11 @@
             <regex match="Traceback" />
         </stdio>
     </xml>
+
     <xml name="pseudocount">
         <param name="pseudocount" type="float" value="1" label="Pseudocount" help="Small number to avoid dividing by zero."/>
     </xml>
+
     <token name="@REFERENCES@">
 
 .. class:: infomark
@@ -126,11 +183,6 @@
 .. _Max Planck Institute for Immunobiology and Epigenetics: http://www3.ie-freiburg.mpg.de
 .. _help site: https://github.com/fidelram/deepTools/wiki/
 
-**References**
-
-If you use this Galaxy tool in work leading to a scientific publication please
-cite the following paper:
-
     </token>
     <xml name="citations">
         <citations>
@@ -140,36 +192,46 @@
     </xml>
 
     <xml name="multiple_input_bams">
-        <repeat name="input_files" title="BAM files" min="2">
-            <param name="bamfile" type="data" format="bam" 
-                label="Bam file" 
-                help="The BAM file must be sorted."/>
-            <param name="label" type="text" size="30" optional="true" value=""
-                label="Label"
-                help="Label to use in the output. If not given the dataset name will be used instead."/>
-          </repeat>
+        <param name="bamfiles" type="data" format="bam"
+            label="Bam file" multiple="true"
+            help="The BAM file must be sorted."/>
+    </xml>
+
+    <xml name="multiple_input_bigwigs">
+        <param name="bigwigfiles" type="data" format="bigwig" multiple="True"
+            label="Bigwig file" 
+            help="The Bigwig file must be sorted."/>
+    </xml>
+
+    <xml name="plotTitle">
+        <param name="plotTitle" type="text" value="" size="30" optional="True"
+            label="Title of the plot"
+            help="Title of the plot, to be printed on top of the generated image. (--plotTitle)" />
     </xml>
 
     <token name="@multiple_input_bams@">
-        #import tempfile
-        #set $temp_dir = os.path.abspath(tempfile.mkdtemp())
+<![CDATA[
         #set files=[]
         #set labels=[]
-        #for $i in $input_files:
-            #set $temp_input_handle = tempfile.NamedTemporaryFile( dir=$temp_dir )
-            #set $temp_input_path = $temp_input_handle.name
-            #silent $temp_input_handle.close()
-            #silent os.system("ln -s %s %s.bam" % (str($i.bamfile), $temp_input_path))
-            #silent os.system("ln -s %s %s.bam.bai" % (str($i.bamfile.metadata.bam_index), $temp_input_path))
-            #silent $files.append('%s.bam' % $temp_input_path)
+        #for $counter, $bamfile in enumerate($bamfiles):
+            ln -s "${bamfile}" "./${counter}.bam" &&
+            ln -s "${bamfile.metadata.bam_index}" "./${counter}.bam.bai" &&
+            #silent $files.append('%s.bam' % $counter)
+            #silent $labels.append("'%s'" % ($bamfile.display_name))
+        #end for
+]]>
+    </token>
 
-            ##set $files += [str($i.bamfile)]
-            #if str($i.label.value) != "":
-                #set $labels += ["\"%s\"" % ($i.label.value)]
-            #else
-                #set $labels += ["\"%s\"" % ($i.bamfile.name)]
-            #end if
+    <token name="@multiple_input_bigwigs@">
+<![CDATA[
+        #set files=[]
+        #set labels=[]
+        #for $counter, $bigwig in enumerate($bigwigfiles):
+            ln -s "${bigwig}" "${counter}.bw" &&
+            #silent $files.append('%s.bw' % $counter)
+            #silent $labels.append("'%s'" % ($bigwig.display_name))
         #end for
+]]>
     </token>
 
     <xml name="reference_genome_source">
@@ -180,7 +242,7 @@
             </param>
             <when value="cached">
                 <param name="input1_2bit" type="select" label="Using reference genome" help="If your genome of interest is not listed, contact the Galaxy team">
-                    <options from_data_table="deepTools_seqs">
+                    <options from_data_table="lastz_seqs">
                         <filter type="sort_by" column="1" />
                         <validator type="no_options" message="No indexes are available." />
                     </options>
diff -r 3a2aab18a217 -r 5231f398d784 heatmapper.xml
--- a/heatmapper.xml	Tue Sep 16 13:46:05 2014 -0400
+++ b/heatmapper.xml	Tue Oct 20 14:43:12 2015 -0400
@@ -1,12 +1,12 @@
 <tool id="deeptools_heatmapper" name="heatmapper" version="@WRAPPER_VERSION@.0">
     <description>creates a heatmap for a score associated to genomic regions</description>
-    <expand macro="requirements"/>
-    <expand macro="stdio" />
     <macros>
         <token name="@BINARY@">heatmapper</token>
         <import>deepTools_macros.xml</import>
     </macros>
+    <expand macro="requirements"/>
     <command>
+<![CDATA[
         heatmapper
 
         --matrixFile $matrixFile
@@ -75,18 +75,19 @@
             --refPointLabel '$advancedOpt.referencePointLabel'
             --regionsLabel '$advancedOpt.regionsLabel'
 
-            #if str($advancedOpt.plotTitle.value) != "None":
+            #if $advancedOpt.plotTitle and str($advancedOpt.plotTitle.value) != "":
                 --plotTitle '$advancedOpt.plotTitle'
             #end if
 
             $advancedOpt.onePlotPerGroup
 
-            @kmeans_clusterin@
+            @KMEANS_CLUSTERING@
 
         #end if
+]]>
     </command>
     <inputs>
-        <param name="matrixFile" format="bgzip" type="data" label="Matrix file from the computeMatrix tool"/>
+        <param name="matrixFile" format="deeptools_compute_matrix_archive" type="data" label="Matrix file from the computeMatrix tool"/>
 
         <expand macro="input_graphic_output_settings">
             <expand macro="input_image_file_format" />
@@ -101,13 +102,14 @@
             <when value="no" />
             <when value="yes">
                 <param name="sortRegions" type="select" label="Sort regions"
-                    help="Whether the heatmap should present the regions sorted. The default is to sort in descending order based on the mean value per region.">
+                    help="Whether the heatmap should present the regions sorted. The default is to sort in descending order based on the mean value per region. (--sortRegions)">
                     <option value="no">no ordering</option>
                     <option value="descend" selected="true">descending order</option>
                     <option value="ascend">ascending order</option>
                 </param>
 
-                <param name="sortUsing" type="select" label="Method used for sorting" help="For each row the method is computed." >
+                <param name="sortUsing" type="select" label="Method used for sorting"
+                    help="For each row the method is computed. (--sortUsing)">
                     <option value="mean" selected="true">mean</option>
                     <option value="median">median</option>
                     <option value="min">min</option>
@@ -116,7 +118,9 @@
                     <option value="region_length">region length</option>
                 </param>
 
-                <param name="averageTypeSummaryPlot" type="select" label="Type of statistic that should be plotted in the summary image above the heatmap">
+                <param name="averageTypeSummaryPlot" type="select"
+                    label="Type of statistic that should be plotted in the summary image above the heatmap"
+                    help="(--averageTypeSummaryPlot)">
                     <option value="mean" selected="true">mean</option>
                     <option value="median">median</option>
                     <option value="min">min</option>
@@ -125,22 +129,34 @@
                     <option value="std">std</option>
                 </param>
 
-                <param name="missingDataColor" type="text" label="Missing data color" value="black" optional="true" help="If 'Represent missing data as zero' is not set, such cases will be colored in black by default. By using this parameter a different color can be set. A value between 0 and 1 will be used for a gray scale (black is 0). Also color names can be used, see a list here: http://packages.python.org/ete2/reference/reference_svgcolors.html. Alternatively colors can be specified using the #rrggbb notation." />
+                <param name="missingDataColor" type="text" value="black" optional="true" label="Missing data color" 
+                    help="If 'Represent missing data as zero' is not set, such cases will be colored in black by default.
+                    By using this parameter a different color can be set. A value between 0 and 1 will be used for a gray scale (black is 0).
+                    Also color names can be used, see a list here: http://packages.python.org/ete2/reference/reference_svgcolors.html.
+                    Alternatively colors can be specified using the #rrggbb notation. (--missingDataColor)" />
 
                 <expand macro="colormap" />
 
-                <param name="zMin" type="float" value="" size="3" label="Minimum value for the heatmap intensities. Leave empty for automatic values" optional="true"/>
-                <param name="zMax" type="float" value="" size="3" label="Maximum value for the heatmap intensities. Leave empty for automatic values" optional="true"/>
-                <param name="yMin" type="float" value="" size="3" label="Minimum value for the Y-axis of the summary plot. Leave empty for automatic values" optional="true"/>
-                <param name="yMax" type="float" value="" size="3" label="Maximum value for Y-axis of the summary plot. Leave empty for automatic values" optional="true"/>
+                <param name="zMin" type="float" value="" size="3"
+                    label="Minimum value for the heatmap intensities. Leave empty for automatic values" help="(--zMin)"/>
+                <param name="zMax" type="float" value="" size="3"
+                    label="Maximum value for the heatmap intensities. Leave empty for automatic values" help="(--zMax)"/>
+                <param name="yMin" type="float" value="" size="3"
+                    label="Minimum value for the Y-axis of the summary plot. Leave empty for automatic values" help="(--yMin)"/>
+                <param name="yMax" type="float" value="" size="3"
+                    label="Maximum value for Y-axis of the summary plot. Leave empty for automatic values" help="(--yMax)"/>
+                <param name="xAxisLabel" type="text" value="distance from TSS (bp)" size="200"
+                    label="Description for the x-axis label" help="(--xAxisLabel)"/>
+                <param name="yAxisLabel" type="text" value="genes" size="30"
+                    label="Description for the y-axis label for the top panel" help="(--yAxisLabel)"/>
 
-                <param name="xAxisLabel" type="text" value="distance from TSS (bp)" size="200" label="Description for the x-axis label" />
-                <param name="yAxisLabel" type="text" value="genes" size="30" label="Description for the y-axis label for the top panel" />
+                <param name="heatmapWidth" type="float" value="7.5" min="1" max="100"
+                    label="Heatmap width in cm" help="The minimum value is 1 and the maximum is 100."/>
+                <param name="heatmapHeight" type="float" value="25" min="3" max="100"
+                    label="Heatmap height in cm" help="The minimum value is 3 and the maximum is 100."/>
 
-                <param name="heatmapWidth" type="float" value="7.5" min="1" max="100" label="Heatmap width in cm" help="The minimum value is 1 and the maximum is 100."/>
-                <param name="heatmapHeight" type="float" value="25" min="3" max="100" label="Heatmap height in cm" help="The minimum value is 3 and the maximum is 100."/>
-
-                <param name="whatToShow" type="select" label="What to show" help ="The default is to include a summary or profile plot on top of the heatmap and a heatmap colorbar.">
+                <param name="whatToShow" type="select" label="What to show"
+                    help ="The default is to include a summary or profile plot on top of the heatmap and a heatmap colorbar. (--whatToShow)">
                     <option value="plot, heatmap and colorbar" selected="true">summary plot, heatmap and colorbar</option>
                     <option value="plot and heatmap">summary plot and heatmap (no colorbar)</option>
                     <option value="heatmap only">heatmap only</option>
@@ -148,25 +164,31 @@
                     <option value="colorbar only">colorbar only</option>
                 </param>
 
-                <param name="startLabel" type="text" value="TSS" size="10" label="Label for the region start" help ="[only for scale-regions mode] Label shown in the plot for the start of the region. Default is TSS (transcription start site), but could be changed to anything, e.g. &quot;peak start&quot;." />
-                <param name="endLabel" type="text" value="TES" size="10" label="Label for the region end" help="[only for scale-regions mode] Label shown in the plot for the region end. Default is TES (transcription end site)."/>
+                <param name="startLabel" type="text" value="TSS" size="10"
+                    label="Label for the region start"
+                    help ="Only for scale-regions mode. Label shown in the plot for the start of the region. Default is TSS (transcription start site), but could be changed to anything, e.g. &quot;peak start&quot;. (--startLabel)" />
+                <param name="endLabel" type="text" value="TES" size="10"
+                    label="Label for the region end"
+                    help="Only for scale-regions mode. Label shown in the plot for the region end. Default is TES (transcription end site). (--endLabel)"/>
 
-                <param name="referencePointLabel" type="text" value="TSS" size="10" label="Reference point label" help ="[only for scale-regions mode] Label shown in the plot for the reference-point. Default is the same as the reference point selected (e.g. TSS), but could be anything, e.g. &quot;peak start&quot; etc." />
+                <param name="referencePointLabel" type="text" value="TSS" size="10"
+                    label="Reference point label"
+                    help ="Label shown in the plot for the reference-point. Default is the same as the reference point selected (e.g. TSS), but could be anything, e.g. &quot;peak start&quot; etc. (--referencePointLabel)" />
                 <param name="regionsLabel" type="text" value="genes" size="30" 
                     label="Labels for the regions plotted in the heatmap" 
-                    help="If more than one region is being plotted a list of labels separated by comma and limited by quotes, is required. For example, label1, label2.">
+                    help="If more than one region is being plotted a list of labels separated by comma and limited by quotes, is required. For example, label1, label2. (--regionsLabel)">
                     <sanitizer>
                         <valid initial="string.printable">
                         </valid>
                     </sanitizer>
                 </param>
-                <param name="plotTitle" type="text" value="" size="30" label="Title of the plot" help="Title of the plot, to be printed on top of the generated image. Leave blank for no title." />
+                <expand macro="plotTitle" />
                 <param name="onePlotPerGroup" type="boolean" truevalue="--onePlotPerGroup" falsevalue="" 
                     label="Do one plot per group" 
-                    help="When computeMatrix was used on more than one group of genes, the average plots for all the groups will be drawn in one panel by default. If this option is set, each group will get its own plot, stacked on top of each other."/>
+                    help="When computeMatrix was used on more than one group of genes, the average plots for all the groups will be drawn in one panel by default.
+                        If this option is set, each group will get its own plot, stacked on top of each other. (--onePlotPerGroup)"/>
 
                 <expand macro="kmeans_clustering" />
-
             </when>
         </conditional>
     </inputs>
@@ -177,12 +199,12 @@
     </outputs>
     <tests>
         <test>
-            <param name="matrixFile" value="master.mat.gz" ftype="bgzip" />
-            <output name="outFileName" file="master.png" ftype="png" compare="sim_size" delta="100" />
+            <param name="matrixFile" value="computeMatrix_result1.gz" ftype="deeptools_compute_matrix_archive" />
+            <output name="outFileName" file="heatmapper_result1.png" ftype="png" compare="sim_size" delta="100" />
         </test>
     </tests>
     <help>
-
+<![CDATA[
 **What it does**
 
 The heatmapper visualizes scores associated with genomic regions, for example ChIP enrichment values around the TSS of genes.
@@ -205,7 +227,7 @@
 -----
 
 @REFERENCES@
-
+]]>
     </help>
     <expand macro="citations" />
 </tool>
diff -r 3a2aab18a217 -r 5231f398d784 profiler.xml
--- a/profiler.xml	Tue Sep 16 13:46:05 2014 -0400
+++ b/profiler.xml	Tue Oct 20 14:43:12 2015 -0400
@@ -2,13 +2,13 @@
     <description>
         creates a profile plot for a score associated to genomic regions
     </description>
-    <expand macro="requirements" />
-    <expand macro="stdio" />
     <macros>
         <token name="@BINARY@">profiler</token>
         <import>deepTools_macros.xml</import>
     </macros>
+    <expand macro="requirements" />
     <command>
+<![CDATA[
         profiler
 
         --matrixFile $matrixFile
@@ -29,8 +29,8 @@
         #end if
 
         #if $scaleRegions.showScaleRegionsOpt == "yes":
-            --startLabel $scaleRegions.startLabel
-            --endLabel $scaleRegions.endLabel
+            --startLabel '$scaleRegions.startLabel'
+            --endLabel '$scaleRegions.endLabel'
         #end if
 
         #if $advancedOpt.showAdvancedOpt == "yes":
@@ -43,7 +43,7 @@
 
             --regionsLabel '$advancedOpt.regionsLabel'
 
-            #if str($advancedOpt.plotTitle).strip() != "":
+            #if $advancedOpt.plotTitle and str($advancedOpt.plotTitle).strip() != "":
                 --plotTitle '$advancedOpt.plotTitle'
             #end if
 
@@ -65,12 +65,13 @@
                 --yAxisLabel '$advancedOpt.yAxisLabel'
             #end if
 
-            @kmeans_clusterin@
+            @KMEANS_CLUSTERING@
 
         #end if
+]]>
     </command>
     <inputs>
-        <param name="matrixFile" format="bgzip" type="data" label="Matrix file from the computeMatrix tool"/>
+        <param name="matrixFile" format="deeptools_compute_matrix_archive" type="data" label="Matrix file from the computeMatrix tool"/>
         <conditional name="scaleRegions">
             <param name="showScaleRegionsOpt" type="select" label="The input matrix was computed in scale-regions mode">
                 <option value="no" selected="true">no</option>
@@ -78,8 +79,14 @@
             </param>
             <when value="no" />
             <when value="yes">
-                <param name="startLabel" type="text" value="TSS" size="10" label="Label for the region start" help ="[only for scale-regions mode] Label shown in the plot for the start of the region. Default is TSS (transcription start site), but could be changed to anything, e.g. &quot;peak start&quot;." />
-                <param name="endLabel" type="text" value="TES" size="10" label="Label for the region end" help="[only for scale-regions mode] Label shown in the plot for the region end. Default is TES (transcription end site)."/>
+                <param name="startLabel" type="text" value="TSS" size="10"
+                    label="Label for the region start"
+                    help ="[only for scale-regions mode] Label shown in the plot
+                    for the start of the region. Default is TSS (transcription start site),
+                    but could be changed to anything, e.g. &quot;peak start&quot;." />
+                <param name="endLabel" type="text" value="TES" size="10"
+                    label="Label for the region end"
+                    help="[only for scale-regions mode] Label shown in the plot for the region end. Default is TES (transcription end site)."/>
             </when>
         </conditional>
 
@@ -109,23 +116,46 @@
                     label="Plot width" 
                     help="Width in cm. The default value is 8 centimeters. The minimum value is 1 cm." />
                 <param name="plotType" type="select" label="Plot type"
-                    help="For the summary plot (profile) only. The &quot;lines&quot; option will plot the profile line based on the average type selected. The &quot;fill&quot; option fills the region between zero and the profile curve. The fill in color is semi transparent to distinguish different profiles. The &quot;add standard error&quot; option colors the region between the profile and the standard error of the data. As in the case of fill, a semi-transparent color is used. The option &quot;overlapped_lines&quot; plots each region values, one on top of the other; this option only works if &quot;one plot per proup&quot; is set.">
+                    help="For the summary plot (profile) only. The &quot;lines&quot; option will
+                    plot the profile line based on the average type selected. The &quot;fill&quot;
+                    option fills the region between zero and the profile curve. The fill in color is
+                    semi transparent to distinguish different profiles. The &quot;add standard error&quot;
+                    option colors the region between the profile and the standard error of the data.
+                    As in the case of fill, a semi-transparent color is used.
+                    The option &quot;overlapped_lines&quot; plots each region values, one on top of
+                    the other; this option only works if &quot;one plot per proup&quot; is set.">
                     <option value="lines" selected="true">lines</option>
                     <option value="fill">fill</option>
                     <option value="se">add standard error</option>
                     <option value="overlapped_lines">overlapped lines</option>
                 </param>
-                <param name="regionsLabel" type="text" value="genes" size="30" label="Labels for the regions plotted in the heatmap" help="If more than one region is being plotted a list of labels separated by comma and limited by quotes, is required. For example, &quot;label1, label2&quot;."/>
-                <param name="plotTitle" type="text" value="" size="30" label="Title of the plot" help="Title of the plot, to be printed on top of the generated image. Leave blank for no title." />
-                <param name="colors" type="text" value="" size="40" label="List of colors to use for the plotted lines" help="Color names and html hex strings (e.g. #eeff22) are accepted. The color names should be given separated by spaces. (--colors red blue green)">
-                    <validator type="expression" message="Only numbers, digits, '#' and spaces are allowed.">all(c in ' #abcdefghijklmnopqrstuvwxyz0123456789' for c in value)</validator>
+                <param name="regionsLabel" type="text" value="genes" size="30"
+                    label="Labels for the regions plotted in the heatmap"
+                    help="If more than one region is being plotted a list of labels separated
+                    by comma and limited by quotes, is required. For example, &quot;label1, label2&quot;."/>
+
+                <expand macro="plotTitle" />
+                <param name="colors" type="text" value="" size="40"
+                    label="List of colors to use for the plotted lines"
+                    help="Color names and html hex strings (e.g. #eeff22) are accepted.
+                    The color names should be given separated by spaces. (--colors red blue green)">
+                    <validator type="expression"
+                        message="Only numbers, digits, '#' and spaces are allowed.">all(c in ' #abcdefghijklmnopqrstuvwxyz0123456789' for c in value)</validator>
                 </param>
 
-                <param name="onePlotPerGroup" type="boolean" truevalue="--onePlotPerGroup" falsevalue="" label="Do one plot per group" help="When the region file contains groups separated by &quot;#&quot;, the default is to plot the averages for the distinct plots in one plot. If this option is set, each group will get its own plot, stacked on top of each other."/>
-                <param name="yMin" type="float" value="" size="3" label="Minimum value for the Y-axis of the summary plot. Leave empty for automatic values" optional="true"/>
-                <param name="yMax" type="float" value="" size="3" label="Maximum value for Y-axis of the summary plot. Leave empty for automatic values" optional="true"/>
-                <param name="xAxisLabel" type="text" value="gene distance (bp)" size="50" label="Description for the x-axis label" />
-                <param name="yAxisLabel" type="text" value="" size="50" label="Description for the y-axis label for the top panel" />
+                <param name="onePlotPerGroup" type="boolean" truevalue="--onePlotPerGroup" falsevalue=""
+                    label="Do one plot per group"
+                    help="When the region file contains groups separated by &quot;#&quot;, the default is
+                    to plot the averages for the distinct plots in one plot. If this option is set, each group
+                    will get its own plot, stacked on top of each other."/>
+                <param name="yMin" type="float" value="" size="3" optional="true"
+                    label="Minimum value for the Y-axis of the summary plot. Leave empty for automatic values"/>
+                <param name="yMax" type="float" value="" size="3" optional="true"
+                    label="Maximum value for Y-axis of the summary plot. Leave empty for automatic values" />
+                <param name="xAxisLabel" type="text" value="gene distance (bp)" size="50"
+                    label="Description for the x-axis label" />
+                <param name="yAxisLabel" type="text" value="" size="50"
+                    label="Description for the y-axis label for the top panel" />
 
                 <expand macro="kmeans_clustering" />
 
@@ -136,7 +166,14 @@
         <expand macro="output_image_file_format" />
         <expand macro="output_graphic_outputs" />
     </outputs>
+    <tests>
+        <test>
+            <param name="matrixFile" value="computeMatrix_result1.gz" ftype="deeptools_compute_matrix_archive" />
+            <output name="outFileName" file="profiler_result1.png" ftype="png" compare="sim_size" delta="100" />
+        </test>
+    </tests>
     <help>
+<![CDATA[
 
 **What it does**
 
@@ -158,7 +195,7 @@
 -----
 
 @REFERENCES@
-
+]]>
     </help>
     <expand macro="citations" />
 </tool>
diff -r 3a2aab18a217 -r 5231f398d784 repository_dependencies.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/repository_dependencies.xml	Tue Oct 20 14:43:12 2015 -0400
@@ -0,0 +1,4 @@
+<?xml version="1.0"?>
+<repositories>
+    <repository changeset_revision="74b09c8e5f6e" name="data_manager_twobit_builder" owner="devteam" toolshed="https://toolshed.g2.bx.psu.edu" />
+</repositories>
diff -r 3a2aab18a217 -r 5231f398d784 test-data/bamCompare_result1.bg
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bamCompare_result1.bg	Tue Oct 20 14:43:12 2015 -0400
@@ -0,0 +1,1 @@
+chrM	0	16569	1.0
diff -r 3a2aab18a217 -r 5231f398d784 test-data/bamCorrelate_result1.png
Binary file test-data/bamCorrelate_result1.png has changed
diff -r 3a2aab18a217 -r 5231f398d784 test-data/bamCoverage_result1.bw
Binary file test-data/bamCoverage_result1.bw has changed
diff -r 3a2aab18a217 -r 5231f398d784 test-data/bamCoverage_result2.bw
Binary file test-data/bamCoverage_result2.bw has changed
diff -r 3a2aab18a217 -r 5231f398d784 test-data/bamCoverage_result3.bg
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bamCoverage_result3.bg	Tue Oct 20 14:43:12 2015 -0400
@@ -0,0 +1,11 @@
+chrM	0	210	12259800.00
+chrM	210	220	11998953.19
+chrM	220	230	10694719.15
+chrM	230	240	8347097.87
+chrM	240	250	6260323.40
+chrM	250	260	3391008.51
+chrM	260	16310	2608468.09
+chrM	16310	16320	2347621.28
+chrM	16320	16330	1304234.04
+chrM	16330	16340	1043387.23
+chrM	16340	16350	521693.62
diff -r 3a2aab18a217 -r 5231f398d784 test-data/bamCoverage_result4.bg
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bamCoverage_result4.bg	Tue Oct 20 14:43:12 2015 -0400
@@ -0,0 +1,460 @@
+phiX174	0	10	5613.46
+phiX174	10	20	16840.38
+phiX174	20	70	50521.15
+phiX174	70	90	67361.54
+phiX174	90	100	84201.92
+phiX174	100	120	89815.38
+phiX174	120	140	101042.31
+phiX174	140	160	112269.23
+phiX174	160	170	123496.15
+phiX174	170	180	145950.00
+phiX174	180	200	162790.38
+phiX174	200	210	168403.85
+phiX174	210	240	179630.77
+phiX174	240	250	190857.69
+phiX174	250	260	202084.62
+phiX174	260	270	235765.38
+phiX174	270	280	263832.69
+phiX174	280	290	286286.54
+phiX174	290	300	314353.85
+phiX174	300	310	297513.46
+phiX174	310	320	303126.92
+phiX174	320	330	342421.15
+phiX174	330	340	359261.54
+phiX174	340	360	387328.85
+phiX174	360	370	404169.23
+phiX174	370	390	421009.62
+phiX174	390	400	415396.15
+phiX174	400	410	426623.08
+phiX174	410	420	432236.54
+phiX174	420	460	449076.92
+phiX174	460	470	465917.31
+phiX174	470	480	443463.46
+phiX174	480	490	449076.92
+phiX174	490	500	471530.77
+phiX174	500	510	454690.38
+phiX174	510	520	465917.31
+phiX174	520	530	471530.77
+phiX174	530	540	449076.92
+phiX174	540	560	482757.69
+phiX174	560	570	499598.08
+phiX174	570	580	505211.54
+phiX174	580	590	499598.08
+phiX174	590	600	488371.15
+phiX174	600	610	471530.77
+phiX174	610	620	533278.85
+phiX174	620	630	572573.08
+phiX174	630	640	566959.62
+phiX174	640	660	544505.77
+phiX174	660	670	538892.31
+phiX174	670	680	499598.08
+phiX174	680	690	527665.38
+phiX174	690	700	533278.85
+phiX174	700	720	499598.08
+phiX174	720	730	510825.00
+phiX174	730	740	516438.46
+phiX174	740	750	505211.54
+phiX174	750	760	477144.23
+phiX174	760	770	471530.77
+phiX174	770	780	488371.15
+phiX174	780	800	533278.85
+phiX174	800	820	522051.92
+phiX174	820	830	499598.08
+phiX174	830	850	460303.85
+phiX174	850	860	454690.38
+phiX174	860	870	443463.46
+phiX174	870	880	471530.77
+phiX174	880	890	499598.08
+phiX174	890	900	505211.54
+phiX174	900	920	527665.38
+phiX174	920	930	544505.77
+phiX174	930	940	538892.31
+phiX174	940	960	527665.38
+phiX174	960	970	510825.00
+phiX174	970	980	488371.15
+phiX174	980	990	482757.69
+phiX174	990	1000	460303.85
+phiX174	1000	1010	454690.38
+phiX174	1010	1020	493984.62
+phiX174	1020	1030	471530.77
+phiX174	1030	1040	527665.38
+phiX174	1040	1060	538892.31
+phiX174	1060	1080	555732.69
+phiX174	1080	1090	578186.54
+phiX174	1090	1100	583800.00
+phiX174	1100	1110	572573.08
+phiX174	1110	1130	561346.15
+phiX174	1130	1140	527665.38
+phiX174	1140	1150	555732.69
+phiX174	1150	1160	544505.77
+phiX174	1160	1170	566959.62
+phiX174	1170	1180	606253.85
+phiX174	1180	1190	617480.77
+phiX174	1190	1200	583800.00
+phiX174	1200	1210	555732.69
+phiX174	1210	1220	583800.00
+phiX174	1220	1230	538892.31
+phiX174	1230	1240	527665.38
+phiX174	1240	1250	465917.31
+phiX174	1250	1260	471530.77
+phiX174	1260	1270	482757.69
+phiX174	1270	1280	460303.85
+phiX174	1280	1290	471530.77
+phiX174	1290	1320	437850.00
+phiX174	1320	1330	421009.62
+phiX174	1330	1340	454690.38
+phiX174	1340	1350	465917.31
+phiX174	1350	1360	460303.85
+phiX174	1360	1370	477144.23
+phiX174	1370	1380	505211.54
+phiX174	1380	1390	488371.15
+phiX174	1390	1400	522051.92
+phiX174	1400	1420	550119.23
+phiX174	1420	1430	522051.92
+phiX174	1430	1440	544505.77
+phiX174	1440	1450	561346.15
+phiX174	1450	1460	595026.92
+phiX174	1460	1470	589413.46
+phiX174	1470	1490	578186.54
+phiX174	1490	1500	566959.62
+phiX174	1500	1520	544505.77
+phiX174	1520	1530	516438.46
+phiX174	1530	1540	538892.31
+phiX174	1540	1550	527665.38
+phiX174	1550	1560	550119.23
+phiX174	1560	1570	544505.77
+phiX174	1570	1580	555732.69
+phiX174	1580	1590	488371.15
+phiX174	1590	1600	477144.23
+phiX174	1600	1610	460303.85
+phiX174	1610	1620	454690.38
+phiX174	1620	1630	443463.46
+phiX174	1630	1640	477144.23
+phiX174	1640	1650	482757.69
+phiX174	1650	1670	488371.15
+phiX174	1670	1680	482757.69
+phiX174	1680	1690	465917.31
+phiX174	1690	1700	477144.23
+phiX174	1700	1710	493984.62
+phiX174	1710	1730	505211.54
+phiX174	1730	1740	516438.46
+phiX174	1740	1750	493984.62
+phiX174	1750	1760	449076.92
+phiX174	1760	1780	415396.15
+phiX174	1780	1790	409782.69
+phiX174	1790	1800	415396.15
+phiX174	1800	1810	443463.46
+phiX174	1810	1820	421009.62
+phiX174	1820	1830	449076.92
+phiX174	1830	1840	544505.77
+phiX174	1840	1860	555732.69
+phiX174	1860	1870	595026.92
+phiX174	1870	1890	583800.00
+phiX174	1890	1900	589413.46
+phiX174	1900	1910	583800.00
+phiX174	1910	1920	578186.54
+phiX174	1920	1930	600640.38
+phiX174	1930	1940	623094.23
+phiX174	1940	1950	606253.85
+phiX174	1950	1960	628707.69
+phiX174	1960	1970	639934.62
+phiX174	1970	1990	662388.46
+phiX174	1990	2000	668001.92
+phiX174	2000	2010	690455.77
+phiX174	2010	2020	656775.00
+phiX174	2020	2030	662388.46
+phiX174	2030	2040	611867.31
+phiX174	2040	2050	555732.69
+phiX174	2050	2060	516438.46
+phiX174	2060	2070	522051.92
+phiX174	2070	2080	493984.62
+phiX174	2080	2100	538892.31
+phiX174	2100	2110	527665.38
+phiX174	2110	2120	499598.08
+phiX174	2120	2130	538892.31
+phiX174	2130	2140	505211.54
+phiX174	2140	2150	488371.15
+phiX174	2150	2160	499598.08
+phiX174	2160	2170	488371.15
+phiX174	2170	2180	505211.54
+phiX174	2180	2190	488371.15
+phiX174	2190	2200	505211.54
+phiX174	2200	2220	516438.46
+phiX174	2220	2230	527665.38
+phiX174	2230	2240	561346.15
+phiX174	2240	2250	555732.69
+phiX174	2250	2260	538892.31
+phiX174	2260	2270	499598.08
+phiX174	2270	2280	482757.69
+phiX174	2280	2290	493984.62
+phiX174	2290	2300	477144.23
+phiX174	2300	2310	566959.62
+phiX174	2310	2320	600640.38
+phiX174	2320	2330	611867.31
+phiX174	2330	2340	606253.85
+phiX174	2340	2350	617480.77
+phiX174	2350	2360	606253.85
+phiX174	2360	2370	623094.23
+phiX174	2370	2380	617480.77
+phiX174	2380	2390	606253.85
+phiX174	2390	2400	617480.77
+phiX174	2400	2410	578186.54
+phiX174	2410	2420	583800.00
+phiX174	2420	2430	555732.69
+phiX174	2430	2440	538892.31
+phiX174	2440	2450	522051.92
+phiX174	2450	2460	572573.08
+phiX174	2460	2470	606253.85
+phiX174	2470	2480	668001.92
+phiX174	2480	2490	639934.62
+phiX174	2490	2500	668001.92
+phiX174	2500	2510	645548.08
+phiX174	2510	2540	578186.54
+phiX174	2540	2550	544505.77
+phiX174	2550	2560	572573.08
+phiX174	2560	2570	589413.46
+phiX174	2570	2580	606253.85
+phiX174	2580	2590	611867.31
+phiX174	2590	2600	595026.92
+phiX174	2600	2610	561346.15
+phiX174	2610	2620	595026.92
+phiX174	2620	2630	606253.85
+phiX174	2630	2650	673615.38
+phiX174	2650	2660	668001.92
+phiX174	2660	2670	606253.85
+phiX174	2670	2680	617480.77
+phiX174	2680	2690	600640.38
+phiX174	2690	2700	589413.46
+phiX174	2700	2710	583800.00
+phiX174	2710	2720	595026.92
+phiX174	2720	2730	639934.62
+phiX174	2730	2740	662388.46
+phiX174	2740	2750	701682.69
+phiX174	2750	2760	696069.23
+phiX174	2760	2780	679228.85
+phiX174	2780	2790	673615.38
+phiX174	2790	2800	662388.46
+phiX174	2800	2810	690455.77
+phiX174	2810	2820	668001.92
+phiX174	2820	2830	645548.08
+phiX174	2830	2840	673615.38
+phiX174	2840	2850	617480.77
+phiX174	2850	2860	589413.46
+phiX174	2860	2870	600640.38
+phiX174	2870	2880	606253.85
+phiX174	2880	2890	595026.92
+phiX174	2890	2910	566959.62
+phiX174	2910	2920	572573.08
+phiX174	2920	2930	522051.92
+phiX174	2930	2940	488371.15
+phiX174	2940	2950	527665.38
+phiX174	2950	2960	505211.54
+phiX174	2960	2970	493984.62
+phiX174	2970	2980	510825.00
+phiX174	2980	2990	477144.23
+phiX174	2990	3000	482757.69
+phiX174	3000	3010	527665.38
+phiX174	3010	3020	510825.00
+phiX174	3020	3030	533278.85
+phiX174	3030	3040	550119.23
+phiX174	3040	3050	522051.92
+phiX174	3050	3060	566959.62
+phiX174	3060	3070	578186.54
+phiX174	3070	3080	572573.08
+phiX174	3080	3090	578186.54
+phiX174	3090	3100	555732.69
+phiX174	3100	3110	611867.31
+phiX174	3110	3120	606253.85
+phiX174	3120	3130	578186.54
+phiX174	3130	3140	583800.00
+phiX174	3140	3150	589413.46
+phiX174	3150	3160	561346.15
+phiX174	3160	3170	566959.62
+phiX174	3170	3180	561346.15
+phiX174	3180	3190	606253.85
+phiX174	3190	3200	600640.38
+phiX174	3200	3210	606253.85
+phiX174	3210	3230	583800.00
+phiX174	3230	3240	611867.31
+phiX174	3240	3250	595026.92
+phiX174	3250	3260	561346.15
+phiX174	3260	3270	572573.08
+phiX174	3270	3280	589413.46
+phiX174	3280	3290	572573.08
+phiX174	3290	3300	566959.62
+phiX174	3300	3310	589413.46
+phiX174	3310	3320	550119.23
+phiX174	3320	3330	589413.46
+phiX174	3330	3340	611867.31
+phiX174	3340	3350	628707.69
+phiX174	3350	3370	634321.15
+phiX174	3370	3380	628707.69
+phiX174	3380	3390	634321.15
+phiX174	3390	3400	572573.08
+phiX174	3400	3430	595026.92
+phiX174	3430	3440	611867.31
+phiX174	3440	3450	623094.23
+phiX174	3450	3460	600640.38
+phiX174	3460	3470	623094.23
+phiX174	3470	3480	578186.54
+phiX174	3480	3490	583800.00
+phiX174	3490	3500	634321.15
+phiX174	3500	3510	628707.69
+phiX174	3510	3520	639934.62
+phiX174	3520	3530	645548.08
+phiX174	3530	3540	578186.54
+phiX174	3540	3550	589413.46
+phiX174	3550	3560	572573.08
+phiX174	3560	3580	550119.23
+phiX174	3580	3590	522051.92
+phiX174	3590	3600	589413.46
+phiX174	3600	3620	617480.77
+phiX174	3620	3630	611867.31
+phiX174	3630	3640	589413.46
+phiX174	3640	3650	583800.00
+phiX174	3650	3670	572573.08
+phiX174	3670	3680	578186.54
+phiX174	3680	3690	589413.46
+phiX174	3690	3700	561346.15
+phiX174	3700	3710	544505.77
+phiX174	3710	3720	550119.23
+phiX174	3720	3730	572573.08
+phiX174	3730	3750	555732.69
+phiX174	3750	3760	533278.85
+phiX174	3760	3770	516438.46
+phiX174	3770	3790	522051.92
+phiX174	3790	3800	465917.31
+phiX174	3800	3820	432236.54
+phiX174	3820	3830	404169.23
+phiX174	3830	3840	443463.46
+phiX174	3840	3850	477144.23
+phiX174	3850	3860	493984.62
+phiX174	3860	3870	499598.08
+phiX174	3870	3880	488371.15
+phiX174	3880	3900	477144.23
+phiX174	3900	3910	454690.38
+phiX174	3910	3920	443463.46
+phiX174	3920	3930	415396.15
+phiX174	3930	3940	409782.69
+phiX174	3940	3960	421009.62
+phiX174	3960	3970	460303.85
+phiX174	3970	3980	471530.77
+phiX174	3980	3990	460303.85
+phiX174	3990	4000	471530.77
+phiX174	4000	4010	482757.69
+phiX174	4010	4020	460303.85
+phiX174	4020	4030	477144.23
+phiX174	4030	4040	482757.69
+phiX174	4040	4050	437850.00
+phiX174	4050	4060	404169.23
+phiX174	4060	4070	381715.38
+phiX174	4070	4080	353648.08
+phiX174	4080	4090	376101.92
+phiX174	4090	4100	381715.38
+phiX174	4100	4110	364875.00
+phiX174	4110	4130	359261.54
+phiX174	4130	4140	387328.85
+phiX174	4140	4150	409782.69
+phiX174	4150	4160	398555.77
+phiX174	4160	4170	437850.00
+phiX174	4170	4180	409782.69
+phiX174	4180	4190	437850.00
+phiX174	4190	4200	443463.46
+phiX174	4200	4210	454690.38
+phiX174	4210	4220	465917.31
+phiX174	4220	4230	454690.38
+phiX174	4230	4240	449076.92
+phiX174	4240	4250	471530.77
+phiX174	4250	4260	465917.31
+phiX174	4260	4290	510825.00
+phiX174	4290	4300	522051.92
+phiX174	4300	4310	533278.85
+phiX174	4310	4320	555732.69
+phiX174	4320	4330	561346.15
+phiX174	4330	4340	505211.54
+phiX174	4340	4350	477144.23
+phiX174	4350	4370	493984.62
+phiX174	4370	4380	505211.54
+phiX174	4380	4390	493984.62
+phiX174	4390	4400	477144.23
+phiX174	4400	4410	499598.08
+phiX174	4410	4420	510825.00
+phiX174	4420	4430	522051.92
+phiX174	4430	4440	533278.85
+phiX174	4440	4450	544505.77
+phiX174	4450	4460	533278.85
+phiX174	4460	4480	527665.38
+phiX174	4480	4490	538892.31
+phiX174	4490	4500	550119.23
+phiX174	4500	4510	527665.38
+phiX174	4510	4530	505211.54
+phiX174	4530	4540	516438.46
+phiX174	4540	4550	550119.23
+phiX174	4550	4560	555732.69
+phiX174	4560	4570	533278.85
+phiX174	4570	4580	522051.92
+phiX174	4580	4600	493984.62
+phiX174	4600	4610	505211.54
+phiX174	4610	4620	449076.92
+phiX174	4620	4630	482757.69
+phiX174	4630	4640	471530.77
+phiX174	4640	4650	488371.15
+phiX174	4650	4660	454690.38
+phiX174	4660	4670	465917.31
+phiX174	4670	4690	460303.85
+phiX174	4690	4700	488371.15
+phiX174	4700	4710	482757.69
+phiX174	4710	4720	471530.77
+phiX174	4720	4730	482757.69
+phiX174	4730	4740	510825.00
+phiX174	4740	4750	527665.38
+phiX174	4750	4760	538892.31
+phiX174	4760	4770	561346.15
+phiX174	4770	4790	611867.31
+phiX174	4790	4810	623094.23
+phiX174	4810	4830	606253.85
+phiX174	4830	4840	561346.15
+phiX174	4840	4850	617480.77
+phiX174	4850	4860	595026.92
+phiX174	4860	4870	606253.85
+phiX174	4870	4880	600640.38
+phiX174	4880	4900	589413.46
+phiX174	4900	4910	538892.31
+phiX174	4910	4920	533278.85
+phiX174	4920	4930	544505.77
+phiX174	4930	4940	516438.46
+phiX174	4940	4950	482757.69
+phiX174	4950	4960	454690.38
+phiX174	4960	4970	409782.69
+phiX174	4970	4980	381715.38
+phiX174	4980	4990	336807.69
+phiX174	4990	5000	359261.54
+phiX174	5000	5010	392942.31
+phiX174	5010	5020	415396.15
+phiX174	5020	5030	409782.69
+phiX174	5030	5040	415396.15
+phiX174	5040	5050	437850.00
+phiX174	5050	5060	381715.38
+phiX174	5060	5070	364875.00
+phiX174	5070	5080	359261.54
+phiX174	5080	5090	364875.00
+phiX174	5090	5100	370488.46
+phiX174	5100	5120	376101.92
+phiX174	5120	5140	364875.00
+phiX174	5140	5150	370488.46
+phiX174	5150	5160	359261.54
+phiX174	5160	5180	319967.31
+phiX174	5180	5190	325580.77
+phiX174	5190	5200	314353.85
+phiX174	5200	5210	269446.15
+phiX174	5210	5220	235765.38
+phiX174	5220	5230	202084.62
+phiX174	5230	5240	190857.69
+phiX174	5240	5250	162790.38
+phiX174	5250	5280	129109.62
+phiX174	5280	5290	106655.77
+phiX174	5290	5300	78588.46
+phiX174	5300	5310	61748.08
+phiX174	5310	5340	33680.77
+phiX174	5340	5350	22453.85
+phiX174	5350	5386	11226.9
diff -r 3a2aab18a217 -r 5231f398d784 test-data/bamCoverage_result4.bw
Binary file test-data/bamCoverage_result4.bw has changed
diff -r 3a2aab18a217 -r 5231f398d784 test-data/bamFingerprint_result1.png
Binary file test-data/bamFingerprint_result1.png has changed
diff -r 3a2aab18a217 -r 5231f398d784 test-data/bamPEFragmentSize_histogram_result1.png
Binary file test-data/bamPEFragmentSize_histogram_result1.png has changed
diff -r 3a2aab18a217 -r 5231f398d784 test-data/bamPEFragmentSize_result1.txt
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bamPEFragmentSize_result1.txt	Tue Oct 20 14:43:12 2015 -0400
@@ -0,0 +1,9 @@
+Sample size: 3
+
+Min.: 241.0
+1st Qu.: 241.5
+Mean: 244.666666667
+Median: 242.0
+3rd Qu.: 246.5
+Max.: 251.0
+Std: 4.49691252108
diff -r 3a2aab18a217 -r 5231f398d784 test-data/bigwigCompare_result1.bw
Binary file test-data/bigwigCompare_result1.bw has changed
diff -r 3a2aab18a217 -r 5231f398d784 test-data/bigwigCompare_result2.bg
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bigwigCompare_result2.bg	Tue Oct 20 14:43:12 2015 -0400
@@ -0,0 +1,3 @@
+ch1	0	400	1.0
+ch2	0	400	1.0
+ch3	0	400	1.0
diff -r 3a2aab18a217 -r 5231f398d784 test-data/bigwigCorrelate_result1.png
Binary file test-data/bigwigCorrelate_result1.png has changed
diff -r 3a2aab18a217 -r 5231f398d784 test-data/bowtie2-test1.bam
Binary file test-data/bowtie2-test1.bam has changed
diff -r 3a2aab18a217 -r 5231f398d784 test-data/computeGCBias_result1.tabular
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/computeGCBias_result1.tabular	Tue Oct 20 14:43:12 2015 -0400
@@ -0,0 +1,101 @@
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 2.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 2.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
diff -r 3a2aab18a217 -r 5231f398d784 test-data/computeMatrix1.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/computeMatrix1.bed	Tue Oct 20 14:43:12 2015 -0400
@@ -0,0 +1,8 @@
+phiX174	1000	1500	CG11023	0	+
+phiX174	150	1750	cda5	0	-
+phiX174	150	177	cda8	0	-
+phiX174	75	1500	cda9	0	+
+phiX174	101	175	C11023	0	+
+phiX174	125	150	ca5	0	-
+phiX174	450	1750	ca8	0	+
+phiX174	80	1500	cda9	0	+
diff -r 3a2aab18a217 -r 5231f398d784 test-data/computeMatrix2.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/computeMatrix2.bed	Tue Oct 20 14:43:12 2015 -0400
@@ -0,0 +1,6 @@
+ch1	100	150	CG11023	0	+
+ch2	150	175	cda5	0	-
+ch3	100	125	cda8	0	+
+ch1	75	125	C11023	0	+
+ch2	125	150	ca5	0	-
+ch3	75	100	ca8	0	+
diff -r 3a2aab18a217 -r 5231f398d784 test-data/computeMatrix2.bw
Binary file test-data/computeMatrix2.bw has changed
diff -r 3a2aab18a217 -r 5231f398d784 test-data/computeMatrix_result1.gz
Binary file test-data/computeMatrix_result1.gz has changed
diff -r 3a2aab18a217 -r 5231f398d784 test-data/computeMatrix_result2.gz
Binary file test-data/computeMatrix_result2.gz has changed
diff -r 3a2aab18a217 -r 5231f398d784 test-data/correctGCBias_result1.bam
Binary file test-data/correctGCBias_result1.bam has changed
diff -r 3a2aab18a217 -r 5231f398d784 test-data/heatmapper_result1.png
Binary file test-data/heatmapper_result1.png has changed
diff -r 3a2aab18a217 -r 5231f398d784 test-data/master.mat.gz
Binary file test-data/master.mat.gz has changed
diff -r 3a2aab18a217 -r 5231f398d784 test-data/master.png
Binary file test-data/master.png has changed
diff -r 3a2aab18a217 -r 5231f398d784 test-data/paired_chr2L.bam
Binary file test-data/paired_chr2L.bam has changed
diff -r 3a2aab18a217 -r 5231f398d784 test-data/phiX.2bit
Binary file test-data/phiX.2bit has changed
diff -r 3a2aab18a217 -r 5231f398d784 test-data/phiX.bam
Binary file test-data/phiX.bam has changed
diff -r 3a2aab18a217 -r 5231f398d784 test-data/phiX.bam.bai
Binary file test-data/phiX.bam.bai has changed
diff -r 3a2aab18a217 -r 5231f398d784 test-data/phiX.fasta
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/phiX.fasta	Tue Oct 20 14:43:12 2015 -0400
@@ -0,0 +1,79 @@
+>phiX174
+GAGTTTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGAGTCGAAAAATTATCTT
+GATAAAGCAGGAATTACTACTGCTTGTTTACGAATTAAATCGAAGTGGACTGCTGGCGGAAAATGAGAAA
+ATTCGACCTATCCTTGCGCAGCTCGAGAAGCTCTTACTTTGCGACCTTTCGCCATCAACTAACGATTCTG
+TCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATATGCTTGGCACGTTCGTCAAGGACTGGTTTA
+GATATGAGTCACATTTTGTTCATGGTAGAGATTCTCTTGTTGACATTTTAAAAGAGCGTGGATTACTATC
+TGAGTCCGATGCTGTTCAACCACTAATAGGTAAGAAATCATGAGTCAAGTTACTGAACAATCCGTACGTT
+TCCAGACCGCTTTGGCCTCTATTAAGCTCATTCAGGCTTCTGCCGTTTTGGATTTAACCGAAGATGATTT
+CGATTTTCTGACGAGTAACAAAGTTTGGATTGCTACTGACCGCTCTCGTGCTCGTCGCTGCGTTGAGGCT
+TGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCTTTCCTGCTCCTGTTGAGTTTATTGCTGCCG
+TCATTGCTTATTATGTTCATCCCGTCAACATTCAAACGGCCTGTCTCATCATGGAAGGCGCTGAATTTAC
+GGAAAACATTATTAATGGCGTCGAGCGTCCGGTTAAAGCCGCTGAATTGTTCGCGTTTACCTTGCGTGTA
+CGCGCAGGAAACACTGACGTTCTTACTGACGCAGAAGAAAACGTGCGTCAAAAATTACGTGCAGAAGGAG
+TGATGTAATGTCTAAAGGTAAAAAACGTTCTGGCGCTCGCCCTGGTCGTCCGCAGCCGTTGCGAGGTACT
+AAAGGCAAGCGTAAAGGCGCTCGTCTTTGGTATGTAGGTGGTCAACAATTTTAATTGCAGGGGCTTCGGC
+CCCTTACTTGAGGATAAATTATGTCTAATATTCAAACTGGCGCCGAGCGTATGCCGCATGACCTTTCCCA
+TCTTGGCTTCCTTGCTGGTCAGATTGGTCGTCTTATTACCATTTCAACTACTCCGGTTATCGCTGGCGAC
+TCCTTCGAGATGGACGCCGTTGGCGCTCTCCGTCTTTCTCCATTGCGTCGTGGCCTTGCTATTGACTCTA
+CTGTAGACATTTTTACTTTTTATGTCCCTCATCGTCACGTTTATGGTGAACAGTGGATTAAGTTCATGAA
+GGATGGTGTTAATGCCACTCCTCTCCCGACTGTTAACACTACTGGTTATATTGACCATGCCGCTTTTCTT
+GGCACGATTAACCCTGATACCAATAAAATCCCTAAGCATTTGTTTCAGGGTTATTTGAATATCTATAACA
+ACTATTTTAAAGCGCCGTGGATGCCTGACCGTACCGAGGCTAACCCTAATGAGCTTAATCAAGATGATGC
+TCGTTATGGTTTCCGTTGCTGCCATCTCAAAAACATTTGGACTGCTCCGCTTCCTCCTGAGACTGAGCTT
+TCTCGCCAAATGACGACTTCTACCACATCTATTGACATTATGGGTCTGCAAGCTGCTTATGCTAATTTGC
+ATACTGACCAAGAACGTGATTACTTCATGCAGCGTTACCGTGATGTTATTTCTTCATTTGGAGGTAAAAC
+CTCTTATGACGCTGACAACCGTCCTTTACTTGTCATGCGCTCTAATCTCTGGGCATCTGGCTATGATGTT
+GATGGAACTGACCAAACGTCGTTAGGCCAGTTTTCTGGTCGTGTTCAACAGACCTATAAACATTCTGTGC
+CGCGTTTCTTTGTTCCTGAGCATGGCACTATGTTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGAC
+TAAAGAGATTCAGTACCTTAACGCTAAAGGTGCTTTGACTTATACCGATATTGCTGGCGACCCTGTTTTG
+TATGGCAACTTGCCGCCGCGTGAAATTTCTATGAAGGATGTTTTCCGTTCTGGTGATTCGTCTAAGAAGT
+TTAAGATTGCTGAGGGTCAGTGGTATCGTTATGCGCCTTCGTATGTTTCTCCTGCTTATCACCTTCTTGA
+AGGCTTCCCATTCATTCAGGAACCGCCTTCTGGTGATTTGCAAGAACGCGTACTTATTCGCCACCATGAT
+TATGACCAGTGTTTCCAGTCCGTTCAGTTGTTGCAGTGGAATAGTCAGGTTAAATTTAATGTGACCGTTT
+ATCGCAATCTGCCGACCACTCGCGATTCAATCATGACTTCGTGATAAAAGATTGAGTGTGAGGTTATAAC
+GCCGAAGCGGTAAAAATTTTAATTTTTGCCGCTGAGGGGTTGACCAAGCGAAGCGCGGTAGGTTTTCTGC
+TTAGGAGTTTAATCATGTTTCAGACTTTTATTTCTCGCCATAATTCAAACTTTTTTTCTGATAAGCTGGT
+TCTCACTTCTGTTACTCCAGCTTCTTCGGCACCTGTTTTACAGACACCTAAAGCTACATCGTCAACGTTA
+TATTTTGATAGTTTGACGGTTAATGCTGGTAATGGTGGTTTTCTTCATTGCATTCAGATGGATACATCTG
+TCAACGCCGCTAATCAGGTTGTTTCTGTTGGTGCTGATATTGCTTTTGATGCCGACCCTAAATTTTTTGC
+CTGTTTGGTTCGCTTTGAGTCTTCTTCGGTTCCGACTACCCTCCCGACTGCCTATGATGTTTATCCTTTG
+AATGGTCGCCATGATGGTGGTTATTATACCGTCAAGGACTGTGTGACTATTGACGTCCTTCCCCGTACGC
+CGGGCAATAATGTTTATGTTGGTTTCATGGTTTGGTCTAACTTTACCGCTACTAAATGCCGCGGATTGGT
+TTCGCTGAATCAGGTTATTAAAGAGATTATTTGTCTCCAGCCACTTAAGTGAGGTGATTTATGTTTGGTG
+CTATTGCTGGCGGTATTGCTTCTGCTCTTGCTGGTGGCGCCATGTCTAAATTGTTTGGAGGCGGTCAAAA
+AGCCGCCTCCGGTGGCATTCAAGGTGATGTGCTTGCTACCGATAACAATACTGTAGGCATGGGTGATGCT
+GGTATTAAATCTGCCATTCAAGGCTCTAATGTTCCTAACCCTGATGAGGCCGCCCCTAGTTTTGTTTCTG
+GTGCTATGGCTAAAGCTGGTAAAGGACTTCTTGAAGGTACGTTGCAGGCTGGCACTTCTGCCGTTTCTGA
+TAAGTTGCTTGATTTGGTTGGACTTGGTGGCAAGTCTGCCGCTGATAAAGGAAAGGATACTCGTGATTAT
+CTTGCTGCTGCATTTCCTGAGCTTAATGCTTGGGAGCGTGCTGGTGCTGATGCTTCCTCTGCTGGTATGG
+TTGACGCCGGATTTGAGAATCAAAAAGAGCTTACTAAAATGCAACTGGACAATCAGAAAGAGATTGCCGA
+GATGCAAAATGAGACTCAAAAAGAGATTGCTGGCATTCAGTCGGCGACTTCACGCCAGAATACGAAAGAC
+CAGGTATATGCACAAAATGAGATGCTTGCTTATCAACAGAAGGAGTCTACTGCTCGCGTTGCGTCTATTA
+TGGAAAACACCAATCTTTCCAAGCAACAGCAGGTTTCCGAGATTATGCGCCAAATGCTTACTCAAGCTCA
+AACGGCTGGTCAGTATTTTACCAATGACCAAATCAAAGAAATGACTCGCAAGGTTAGTGCTGAGGTTGAC
+TTAGTTCATCAGCAAACGCAGAATCAGCGGTATGGCTCTTCTCATATTGGCGCTACTGCAAAGGATATTT
+CTAATGTCGTCACTGATGCTGCTTCTGGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGA
+TACTTGGAACAATTTCTGGAAAGACGGTAAAGCTGATGGTATTGGCTCTAATTTGTCTAGGAAATAACCG
+TCAGGATTGACACCCTCCCAATTGTATGTTTTCATGCCTCCAAATCTTGGAGGCTTTTTTATGGTTCGTT
+CTTATTACCCTTCTGAATGTCACGCTGATTATTTTGACTTTGAGCGTATCGAGGCTCTTAAACCTGCTAT
+TGAGGCTTGTGGCATTTCTACTCTTTCTCAATCCCCAATGCTTGGCTTCCATAAGCAGATGGATAACCGC
+ATCAAGCTCTTGGAAGAGATTCTGTCTTTTCGTATGCAGGGCGTTGAGTTCGATAATGGTGATATGTATG
+TTGACGGCCATAAGGCTGCTTCTGACGTTCGTGATGAGTTTGTATCTGTTACTGAGAAGTTAATGGATGA
+ATTGGCACAATGCTACAATGTGCTCCCCCAACTTGATATTAATAACACTATAGACCACCGCCCCGAAGGG
+GACGAAAAATGGTTTTTAGAGAACGAGAAGACGGTTACGCAGTTTTGCCGCAAGCTGGCTGCTGAACGCC
+CTCTTAAGGATATTCGCGATGAGTATAATTACCCCAAAAAGAAAGGTATTAAGGATGAGTGTTCAAGATT
+GCTGGAGGCCTCCACTATGAAATCGCGTAGAGGCTTTACTATTCAGCGTTTGATGAATGCAATGCGACAG
+GCTCATGCTGATGGTTGGTTTATCGTTTTTGACACTCTCACGTTGGCTGACGACCGATTAGAGGCGTTTT
+ATGATAATCCCAATGCTTTGCGTGACTATTTTCGTGATATTGGTCGTATGGTTCTTGCTGCCGAGGGTCG
+CAAGGCTAATGATTCACACGCCGACTGCTATCAGTATTTTTGTGTGCCTGAGTATGGTACAGCTAATGGC
+CGTCTTCATTTCCATGCGGTGCATTTTATGCGGACACTTCCTACAGGTAGCGTTGACCCTAATTTTGGTC
+GTCGGGTACGCAATCGCCGCCAGTTAAATAGCTTGCAAAATACGTGGCCTTATGGTTACAGTATGCCCAT
+CGCAGTTCGCTACACGCAGGACGCTTTTTCACGTTCTGGTTGGTTGTGGCCTGTTGATGCTAAAGGTGAG
+CCGCTTAAAGCTACCAGTTATATGGCTGTTGGTTTCTATGTGGCTAAATACGTTAACAAAAAGTCAGATA
+TGGACCTTGCTGCTAAAGGTCTAGGAGCTAAAGAATGGAACAACTCACTAAAAACCAAGCTGTCGCTACT
+TCCCAAGAAGCTGTTCAGAATCAGAATGAGCCGCAACTTCGGGATGAAAATGCTCACAATGACAAATCTG
+TCCACGGAGTGCTTAATCCAACTTACCAAGCTGGGTTACGACGCGACGCCGTTCAACCAGATATTGAAGC
+AGAACGCAAAAAGAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCCGACGTTTTGGCGGCGCAACC
+TGTGACGACAAATCTGCTCAAATTTATGCGCGCTTCGATAAAAATGATTGGCGTATCCAACCTGCA
+
diff -r 3a2aab18a217 -r 5231f398d784 test-data/profiler_result1.png
Binary file test-data/profiler_result1.png has changed
diff -r 3a2aab18a217 -r 5231f398d784 test-data/sequence.2bit
Binary file test-data/sequence.2bit has changed
diff -r 3a2aab18a217 -r 5231f398d784 test-data/test2.bed
--- a/test-data/test2.bed	Tue Sep 16 13:46:05 2014 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,8 +0,0 @@
-ch1	100	150	CG11023	0	+
-ch2	150	175	cda5	0	-
-ch3	100	125	cda8	0	+
-#Group 1
-ch1	75	125	C11023	0	+
-ch2	125	150	ca5	0	-
-ch3	75	100	ca8	0	+
-#Group 2
diff -r 3a2aab18a217 -r 5231f398d784 tool-data/deepTools_seqs.loc.sample
--- a/tool-data/deepTools_seqs.loc.sample	Tue Sep 16 13:46:05 2014 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,27 +0,0 @@
-#This is a sample file distributed with Galaxy that enables tools
-#to use a directory of 2bit genome files for use with deepTools. You will
-#need to supply these files and then create a deepTools_seqs.loc file
-#similar to this one (store it in this directory) that points to
-#the directories in which those files are stored. The deepTools_seqs.loc
-#file has this format:
-#
-#<unique_build_id>	<display_name>	<file_path>
-#
-#So, for example, if your deepTools_seqs.loc began like this:
-#
-#hg18	Human (Homo sapiens): hg18	/depot/data2/galaxy/twobit/hg18.2bit
-#hg19	Human (Homo sapiens): hg19	/depot/data2/galaxy/twobit/hg19.2bit
-#mm9	Mouse (Mus musculus): mm9	/depot/data2/galaxy/twobit/mm9.2bit
-#
-#then your /depot/data2/galaxy/twobit/ directory
-#would need to contain the following 2bit files:
-#
-#-rw-r--r--  1 james    universe 830134 2005-09-13 10:12 hg18.2bit
-#-rw-r--r--  1 james    universe 527388 2005-09-13 10:12 hg19.2bit
-#-rw-r--r--  1 james    universe 269808 2005-09-13 10:12 mm9.2bit
-#
-#Your deepTools_seqs.loc file should include an entry per line for 
-#each file you have stored that you want to be available. Note that 
-#your files should all have the extension '2bit'.
-#
-#Please note that the <unique_build_id> is also used as "Species name abbreviation".
diff -r 3a2aab18a217 -r 5231f398d784 tool-data/lastz_seqs.loc.sample
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool-data/lastz_seqs.loc.sample	Tue Oct 20 14:43:12 2015 -0400
@@ -0,0 +1,29 @@
+#This is a sample file distributed with Galaxy that enables tools
+#to use a directory of 2bit genome files for use with deepTools. 
+#This file is named lastz_seqs.loc file to make use of an already existing loc
+#file from the lastz tool that is created by the twobit data-manager.
+#You will need to supply these files and then create a lastz_seqs.loc file
+#similar to this one (store it in this directory) that points to
+#the directories in which those files are stored. The lastz_seqs.loc
+#file has this format:
+#
+#<unique_build_id>	<display_name>	<file_path>
+#
+#So, for example, if your lastz_seqs.loc began like this:
+#
+#hg18	Human (Homo sapiens): hg18	/depot/data2/galaxy/twobit/hg18.2bit
+#hg19	Human (Homo sapiens): hg19	/depot/data2/galaxy/twobit/hg19.2bit
+#mm9	Mouse (Mus musculus): mm9	/depot/data2/galaxy/twobit/mm9.2bit
+#
+#then your /depot/data2/galaxy/twobit/ directory
+#would need to contain the following 2bit files:
+#
+#-rw-r--r--  1 james    universe 830134 2005-09-13 10:12 hg18.2bit
+#-rw-r--r--  1 james    universe 527388 2005-09-13 10:12 hg19.2bit
+#-rw-r--r--  1 james    universe 269808 2005-09-13 10:12 mm9.2bit
+#
+#Your lastz_seqs.loc file should include an entry per line for 
+#each file you have stored that you want to be available. Note that 
+#your files should all have the extension '2bit'.
+#
+#Please note that the <unique_build_id> is also used as "Species name abbreviation".
diff -r 3a2aab18a217 -r 5231f398d784 tool_data_table_conf.xml.sample
--- a/tool_data_table_conf.xml.sample	Tue Sep 16 13:46:05 2014 -0400
+++ b/tool_data_table_conf.xml.sample	Tue Oct 20 14:43:12 2015 -0400
@@ -1,7 +1,8 @@
+<!-- Use the file tool_data_table_conf.xml.oldlocstyle if you don't want to update your loc files as changed in revision 4550:535d276c92bc-->
 <tables>
-    <!-- Locations of 2bit sequence files for use in deepTools -->
-    <table name="deepTools_seqs" comment_char="#">
+    <!-- Locations of 2bit sequence files for use in Lastz -->
+    <table name="lastz_seqs" comment_char="#">
         <columns>value, name, path</columns>
-        <file path="tool-data/deepTools_seqs.loc" />
+        <file path="tool-data/lastz_seqs.loc" />
     </table>
 </tables>
diff -r 3a2aab18a217 -r 5231f398d784 tool_dependencies.xml
--- a/tool_dependencies.xml	Tue Sep 16 13:46:05 2014 -0400
+++ b/tool_dependencies.xml	Tue Oct 20 14:43:12 2015 -0400
@@ -1,101 +1,9 @@
 <?xml version="1.0"?>
 <tool_dependency>
-    <package name="samtools" version="0.1.19">
-        <repository changeset_revision="923adc89c666" name="package_samtools_0_1_19" owner="iuc" prior_installation_required="True" toolshed="https://toolshed.g2.bx.psu.edu" />
-    </package>
-    <package name="numpy" version="1.7.1">
-        <repository changeset_revision="ef12a3a11d5b" name="package_numpy_1_7" owner="iuc" prior_installation_required="True" toolshed="https://toolshed.g2.bx.psu.edu" />
-    </package>
-    <package name="matplotlib" version="1.2.1">
-        <repository changeset_revision="fe60617380df" name="package_matplotlib_1_2" owner="iuc" prior_installation_required="True" toolshed="https://toolshed.g2.bx.psu.edu" />
-    </package>
-    <package name="scipy" version="0.12.0">
-        <repository changeset_revision="984d208b0808" name="package_scipy_0_12" owner="iuc" prior_installation_required="True" toolshed="https://toolshed.g2.bx.psu.edu" />
-    </package>
-    <package name="pysam" version="0.7.7">
-        <repository changeset_revision="b62538c8c664" name="package_pysam_0_7_7" owner="iuc" prior_installation_required="True" toolshed="https://toolshed.g2.bx.psu.edu" />
-    </package>
-    <package name="bx-python" version="12-2013">
-        <repository changeset_revision="55bd96a1c3b3" name="package_bx_python_12_2013" owner="iuc" prior_installation_required="True" toolshed="https://toolshed.g2.bx.psu.edu" />
+    <package name="python" version="2.7">
+        <repository changeset_revision="eb37ce21eef1" name="package_python_2_7" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu" />
     </package>
-
-    <package name="ucsc_tools" version="0.1">
-        <install version="1.0">
-            <actions>
-                <action type="download_binary">
-                    <url_template architecture="x86_64" os="linux">http://hgdownload.cse.ucsc.edu/admin/exe/linux.x86_64/bedGraphToBigWig</url_template>
-                    <url_template architecture="i686" os="darwin">http://hgdownload.cse.ucsc.edu/admin/exe/macOSX.i386/bedGraphToBigWig</url_template>
-                    <url_template architecture="i386" os="darwin">http://hgdownload.cse.ucsc.edu/admin/exe/macOSX.i386/bedGraphToBigWig</url_template>
-                    <url_template architecture="x86_64" os="darwin">http://hgdownload.cse.ucsc.edu/admin/exe/macOSX.x86_64/bedGraphToBigWig</url_template>
-                </action>
-                <action type="chmod">
-                    <file mode="755">$INSTALL_DIR/bedGraphToBigWig</file>
-                </action>
-                <action type="download_binary">
-                    <url_template architecture="x86_64" os="linux">http://hgdownload.cse.ucsc.edu/admin/exe/linux.x86_64/bigWigInfo</url_template>
-                    <url_template architecture="i686" os="darwin">http://hgdownload.cse.ucsc.edu/admin/exe/macOSX.i386/bigWigInfo</url_template>
-                    <url_template architecture="i386" os="darwin">http://hgdownload.cse.ucsc.edu/admin/exe/macOSX.i386/bigWigInfo</url_template>
-                    <url_template architecture="x86_64" os="darwin">http://hgdownload.cse.ucsc.edu/admin/exe/macOSX.x86_64/bigWigInfo</url_template>
-                </action>
-                <action type="chmod">
-                    <file mode="755">$INSTALL_DIR/bigWigInfo</file>
-                </action>
-                <action type="download_binary">
-                    <url_template architecture="x86_64" os="linux">http://hgdownload.cse.ucsc.edu/admin/exe/linux.x86_64/bigWigToBedGraph</url_template>
-                    <url_template architecture="i686" os="darwin">http://hgdownload.cse.ucsc.edu/admin/exe/macOSX.i386/bigWigToBedGraph</url_template>
-                    <url_template architecture="i386" os="darwin">http://hgdownload.cse.ucsc.edu/admin/exe/macOSX.i386/bigWigToBedGraph</url_template>
-                    <url_template architecture="x86_64" os="darwin">http://hgdownload.cse.ucsc.edu/admin/exe/macOSX.x86_64/bigWigToBedGraph</url_template>
-                </action>
-                <action type="chmod">
-                    <file mode="755">$INSTALL_DIR/bigWigToBedGraph</file>
-                </action>
-                <action type="set_environment">
-                    <environment_variable action="prepend_to" name="PATH">$INSTALL_DIR</environment_variable>
-                </action>
-             </actions>
-         </install>
-         <readme>The tools downloaded by this dependency definition are free for academic use. TODO: UCSC tools are only available with their latest version. That is not good for reproducibility.</readme>
-     </package>
-
-    <package name="deepTools" version="1.5.9.1">
-        <install version="1.0">
-            <actions>
-                <action type="shell_command">git clone --recursive https://github.com/fidelram/deepTools.git</action>
-                <!-- populate the environment variables from the dependend repos -->
-                <action type="set_environment_for_install">
-                    <repository changeset_revision="b62538c8c664" name="package_pysam_0_7_7" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu">
-                        <package name="pysam" version="0.7.7" />
-                    </repository>
-                    <repository changeset_revision="55bd96a1c3b3" name="package_bx_python_12_2013" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu">
-                        <package name="bx-python" version="12-2013" />
-                    </repository>
-                    <repository changeset_revision="ef12a3a11d5b" name="package_numpy_1_7" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu">
-                        <package name="numpy" version="1.7.1" />
-                    </repository>
-                    <repository changeset_revision="fe60617380df" name="package_matplotlib_1_2" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu">
-                        <package name="matplotlib" version="1.2.1" />
-                    </repository>
-                    <repository changeset_revision="984d208b0808" name="package_scipy_0_12" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu">
-                        <package name="scipy" version="0.12.0" />
-                    </repository>
-                </action>
-                <action type="shell_command">git reset --hard 351890e3db9a443484c5c349791b7247163cc94f</action>
-                <action type="make_directory">$INSTALL_DIR/lib/python</action>
-                <action type="shell_command">
-                    export PYTHONPATH=$PYTHONPATH:$INSTALL_DIR/lib/python &amp;&amp; 
-                    python setup.py install --install-lib $INSTALL_DIR/lib/python --install-scripts $INSTALL_DIR/bin
-                </action>
-                <action type="set_environment">
-                    <environment_variable action="prepend_to" name="PATH">$INSTALL_DIR/bin</environment_variable>
-                    <environment_variable action="prepend_to" name="PYTHONPATH">$INSTALL_DIR/lib/python</environment_variable>
-                    <!-- disable the config file of deepTools -->
-                    <environment_variable action="set_to" name="DEEP_TOOLS_NO_CONFIG">TRUE</environment_variable>
-                </action>
-             </actions>
-         </install>
-         <readme>
-            Installation of deepTools from Fidel Ramirez.
-            https://github.com/fidelram/deepTools
-         </readme>
-     </package>
+    <package name="deepTools" version="1.5.11">
+        <repository changeset_revision="01eb49da8dcf" name="package_python_2_7_deeptools_1_5_11" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu" />
+    </package>
 </tool_dependency>