annotate test-data/phiX.fasta @ 27:4df95152a39e draft default tip

"planemo upload for repository https://github.com/deeptools/deepTools/tree/master/galaxy/wrapper/ commit 9308cb7fc910dba348d48fd0dce77a90264b7bdb"
author bgruening
date Fri, 11 Feb 2022 16:24:21 +0000
parents 19a6007845cc
children
Ignore whitespace changes - Everywhere: Within whitespace: At end of lines:
rev   line source
0
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
1 >phiX174
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
2 GAGTTTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGAGTCGAAAAATTATCTT
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
3 GATAAAGCAGGAATTACTACTGCTTGTTTACGAATTAAATCGAAGTGGACTGCTGGCGGAAAATGAGAAA
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
4 ATTCGACCTATCCTTGCGCAGCTCGAGAAGCTCTTACTTTGCGACCTTTCGCCATCAACTAACGATTCTG
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
5 TCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATATGCTTGGCACGTTCGTCAAGGACTGGTTTA
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
6 GATATGAGTCACATTTTGTTCATGGTAGAGATTCTCTTGTTGACATTTTAAAAGAGCGTGGATTACTATC
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
7 TGAGTCCGATGCTGTTCAACCACTAATAGGTAAGAAATCATGAGTCAAGTTACTGAACAATCCGTACGTT
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
8 TCCAGACCGCTTTGGCCTCTATTAAGCTCATTCAGGCTTCTGCCGTTTTGGATTTAACCGAAGATGATTT
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
9 CGATTTTCTGACGAGTAACAAAGTTTGGATTGCTACTGACCGCTCTCGTGCTCGTCGCTGCGTTGAGGCT
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
10 TGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCTTTCCTGCTCCTGTTGAGTTTATTGCTGCCG
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
11 TCATTGCTTATTATGTTCATCCCGTCAACATTCAAACGGCCTGTCTCATCATGGAAGGCGCTGAATTTAC
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
12 GGAAAACATTATTAATGGCGTCGAGCGTCCGGTTAAAGCCGCTGAATTGTTCGCGTTTACCTTGCGTGTA
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
13 CGCGCAGGAAACACTGACGTTCTTACTGACGCAGAAGAAAACGTGCGTCAAAAATTACGTGCAGAAGGAG
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
14 TGATGTAATGTCTAAAGGTAAAAAACGTTCTGGCGCTCGCCCTGGTCGTCCGCAGCCGTTGCGAGGTACT
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
15 AAAGGCAAGCGTAAAGGCGCTCGTCTTTGGTATGTAGGTGGTCAACAATTTTAATTGCAGGGGCTTCGGC
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
16 CCCTTACTTGAGGATAAATTATGTCTAATATTCAAACTGGCGCCGAGCGTATGCCGCATGACCTTTCCCA
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
17 TCTTGGCTTCCTTGCTGGTCAGATTGGTCGTCTTATTACCATTTCAACTACTCCGGTTATCGCTGGCGAC
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
18 TCCTTCGAGATGGACGCCGTTGGCGCTCTCCGTCTTTCTCCATTGCGTCGTGGCCTTGCTATTGACTCTA
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
19 CTGTAGACATTTTTACTTTTTATGTCCCTCATCGTCACGTTTATGGTGAACAGTGGATTAAGTTCATGAA
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
20 GGATGGTGTTAATGCCACTCCTCTCCCGACTGTTAACACTACTGGTTATATTGACCATGCCGCTTTTCTT
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
21 GGCACGATTAACCCTGATACCAATAAAATCCCTAAGCATTTGTTTCAGGGTTATTTGAATATCTATAACA
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
22 ACTATTTTAAAGCGCCGTGGATGCCTGACCGTACCGAGGCTAACCCTAATGAGCTTAATCAAGATGATGC
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
23 TCGTTATGGTTTCCGTTGCTGCCATCTCAAAAACATTTGGACTGCTCCGCTTCCTCCTGAGACTGAGCTT
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
24 TCTCGCCAAATGACGACTTCTACCACATCTATTGACATTATGGGTCTGCAAGCTGCTTATGCTAATTTGC
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
25 ATACTGACCAAGAACGTGATTACTTCATGCAGCGTTACCGTGATGTTATTTCTTCATTTGGAGGTAAAAC
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
26 CTCTTATGACGCTGACAACCGTCCTTTACTTGTCATGCGCTCTAATCTCTGGGCATCTGGCTATGATGTT
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
27 GATGGAACTGACCAAACGTCGTTAGGCCAGTTTTCTGGTCGTGTTCAACAGACCTATAAACATTCTGTGC
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
28 CGCGTTTCTTTGTTCCTGAGCATGGCACTATGTTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGAC
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
29 TAAAGAGATTCAGTACCTTAACGCTAAAGGTGCTTTGACTTATACCGATATTGCTGGCGACCCTGTTTTG
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
30 TATGGCAACTTGCCGCCGCGTGAAATTTCTATGAAGGATGTTTTCCGTTCTGGTGATTCGTCTAAGAAGT
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
31 TTAAGATTGCTGAGGGTCAGTGGTATCGTTATGCGCCTTCGTATGTTTCTCCTGCTTATCACCTTCTTGA
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
32 AGGCTTCCCATTCATTCAGGAACCGCCTTCTGGTGATTTGCAAGAACGCGTACTTATTCGCCACCATGAT
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
33 TATGACCAGTGTTTCCAGTCCGTTCAGTTGTTGCAGTGGAATAGTCAGGTTAAATTTAATGTGACCGTTT
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
34 ATCGCAATCTGCCGACCACTCGCGATTCAATCATGACTTCGTGATAAAAGATTGAGTGTGAGGTTATAAC
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
35 GCCGAAGCGGTAAAAATTTTAATTTTTGCCGCTGAGGGGTTGACCAAGCGAAGCGCGGTAGGTTTTCTGC
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
36 TTAGGAGTTTAATCATGTTTCAGACTTTTATTTCTCGCCATAATTCAAACTTTTTTTCTGATAAGCTGGT
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
37 TCTCACTTCTGTTACTCCAGCTTCTTCGGCACCTGTTTTACAGACACCTAAAGCTACATCGTCAACGTTA
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
38 TATTTTGATAGTTTGACGGTTAATGCTGGTAATGGTGGTTTTCTTCATTGCATTCAGATGGATACATCTG
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
39 TCAACGCCGCTAATCAGGTTGTTTCTGTTGGTGCTGATATTGCTTTTGATGCCGACCCTAAATTTTTTGC
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
40 CTGTTTGGTTCGCTTTGAGTCTTCTTCGGTTCCGACTACCCTCCCGACTGCCTATGATGTTTATCCTTTG
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
41 AATGGTCGCCATGATGGTGGTTATTATACCGTCAAGGACTGTGTGACTATTGACGTCCTTCCCCGTACGC
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
42 CGGGCAATAATGTTTATGTTGGTTTCATGGTTTGGTCTAACTTTACCGCTACTAAATGCCGCGGATTGGT
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
43 TTCGCTGAATCAGGTTATTAAAGAGATTATTTGTCTCCAGCCACTTAAGTGAGGTGATTTATGTTTGGTG
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
44 CTATTGCTGGCGGTATTGCTTCTGCTCTTGCTGGTGGCGCCATGTCTAAATTGTTTGGAGGCGGTCAAAA
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
45 AGCCGCCTCCGGTGGCATTCAAGGTGATGTGCTTGCTACCGATAACAATACTGTAGGCATGGGTGATGCT
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
46 GGTATTAAATCTGCCATTCAAGGCTCTAATGTTCCTAACCCTGATGAGGCCGCCCCTAGTTTTGTTTCTG
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
47 GTGCTATGGCTAAAGCTGGTAAAGGACTTCTTGAAGGTACGTTGCAGGCTGGCACTTCTGCCGTTTCTGA
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
48 TAAGTTGCTTGATTTGGTTGGACTTGGTGGCAAGTCTGCCGCTGATAAAGGAAAGGATACTCGTGATTAT
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
49 CTTGCTGCTGCATTTCCTGAGCTTAATGCTTGGGAGCGTGCTGGTGCTGATGCTTCCTCTGCTGGTATGG
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
50 TTGACGCCGGATTTGAGAATCAAAAAGAGCTTACTAAAATGCAACTGGACAATCAGAAAGAGATTGCCGA
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
51 GATGCAAAATGAGACTCAAAAAGAGATTGCTGGCATTCAGTCGGCGACTTCACGCCAGAATACGAAAGAC
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
52 CAGGTATATGCACAAAATGAGATGCTTGCTTATCAACAGAAGGAGTCTACTGCTCGCGTTGCGTCTATTA
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
53 TGGAAAACACCAATCTTTCCAAGCAACAGCAGGTTTCCGAGATTATGCGCCAAATGCTTACTCAAGCTCA
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
54 AACGGCTGGTCAGTATTTTACCAATGACCAAATCAAAGAAATGACTCGCAAGGTTAGTGCTGAGGTTGAC
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
55 TTAGTTCATCAGCAAACGCAGAATCAGCGGTATGGCTCTTCTCATATTGGCGCTACTGCAAAGGATATTT
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
56 CTAATGTCGTCACTGATGCTGCTTCTGGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGA
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
57 TACTTGGAACAATTTCTGGAAAGACGGTAAAGCTGATGGTATTGGCTCTAATTTGTCTAGGAAATAACCG
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
58 TCAGGATTGACACCCTCCCAATTGTATGTTTTCATGCCTCCAAATCTTGGAGGCTTTTTTATGGTTCGTT
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
59 CTTATTACCCTTCTGAATGTCACGCTGATTATTTTGACTTTGAGCGTATCGAGGCTCTTAAACCTGCTAT
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
60 TGAGGCTTGTGGCATTTCTACTCTTTCTCAATCCCCAATGCTTGGCTTCCATAAGCAGATGGATAACCGC
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
61 ATCAAGCTCTTGGAAGAGATTCTGTCTTTTCGTATGCAGGGCGTTGAGTTCGATAATGGTGATATGTATG
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
62 TTGACGGCCATAAGGCTGCTTCTGACGTTCGTGATGAGTTTGTATCTGTTACTGAGAAGTTAATGGATGA
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
63 ATTGGCACAATGCTACAATGTGCTCCCCCAACTTGATATTAATAACACTATAGACCACCGCCCCGAAGGG
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
64 GACGAAAAATGGTTTTTAGAGAACGAGAAGACGGTTACGCAGTTTTGCCGCAAGCTGGCTGCTGAACGCC
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
65 CTCTTAAGGATATTCGCGATGAGTATAATTACCCCAAAAAGAAAGGTATTAAGGATGAGTGTTCAAGATT
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
66 GCTGGAGGCCTCCACTATGAAATCGCGTAGAGGCTTTACTATTCAGCGTTTGATGAATGCAATGCGACAG
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
67 GCTCATGCTGATGGTTGGTTTATCGTTTTTGACACTCTCACGTTGGCTGACGACCGATTAGAGGCGTTTT
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
68 ATGATAATCCCAATGCTTTGCGTGACTATTTTCGTGATATTGGTCGTATGGTTCTTGCTGCCGAGGGTCG
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
69 CAAGGCTAATGATTCACACGCCGACTGCTATCAGTATTTTTGTGTGCCTGAGTATGGTACAGCTAATGGC
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
70 CGTCTTCATTTCCATGCGGTGCATTTTATGCGGACACTTCCTACAGGTAGCGTTGACCCTAATTTTGGTC
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
71 GTCGGGTACGCAATCGCCGCCAGTTAAATAGCTTGCAAAATACGTGGCCTTATGGTTACAGTATGCCCAT
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
72 CGCAGTTCGCTACACGCAGGACGCTTTTTCACGTTCTGGTTGGTTGTGGCCTGTTGATGCTAAAGGTGAG
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
73 CCGCTTAAAGCTACCAGTTATATGGCTGTTGGTTTCTATGTGGCTAAATACGTTAACAAAAAGTCAGATA
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
74 TGGACCTTGCTGCTAAAGGTCTAGGAGCTAAAGAATGGAACAACTCACTAAAAACCAAGCTGTCGCTACT
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
75 TCCCAAGAAGCTGTTCAGAATCAGAATGAGCCGCAACTTCGGGATGAAAATGCTCACAATGACAAATCTG
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
76 TCCACGGAGTGCTTAATCCAACTTACCAAGCTGGGTTACGACGCGACGCCGTTCAACCAGATATTGAAGC
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
77 AGAACGCAAAAAGAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCCGACGTTTTGGCGGCGCAACC
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
78 TGTGACGACAAATCTGCTCAAATTTATGCGCGCTTCGATAAAAATGATTGGCGTATCCAACCTGCA
19a6007845cc planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0a9265a12a303b54cdaa974e82e87c2ac60962ee-dirty
bgruening
parents:
diff changeset
79