Mercurial > repos > bgruening > dotknot

diff test-data/HCoV229E_short_KISSINGHAIRPINS.fasta @ 0:42d20ff5da1b draft default tip

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna/dotknot commit 1973f3035c10db80883d80847ea254289f5cce2a-dirty
author bgruening
date Thu, 17 Sep 2015 17:10:07 -0400
parents
children
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/HCoV229E_short_KISSINGHAIRPINS.fasta	Thu Sep 17 17:10:07 2015 -0400
@@ -0,0 +1,2 @@
+> PKB171 human coronavirus 229E, coronavirus; ribosomal frameshifting; polymerase
+CGGGGCUCUAGUGCCGCUCGACUAGAGCCCUGUAUGGACCACGAGCAGUCCAUG
\ No newline at end of file