annotate test-data/E.coli_PacBio_40x_first_1K_reads.fasta @ 0:d9f4c141d88a draft

planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
author bgruening
date Tue, 25 Sep 2018 05:24:27 -0400
parents
children
Ignore whitespace changes - Everywhere: Within whitespace: At end of lines:
rev   line source
0
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1 >m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/29/0_6709 RQ=0.843
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
2 aaacccacccaacccaagggaaaaaaaaggaaggggaagaaaagattttaaataaatggggggggtttgcccccggttgg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
3 aagcgggggacccccaaaccggggagtgggaaaataccgggtttttatttgcgaaaaagctttgggcgaggatctccttt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
4 tcatcggggccccggggttaaggtccaacttttccaccgcttcgctttccacgccggcccctgggccgcaaagttttctt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
5 gtggaatgtaaaaaacacaaaatactggcctggtttgtgttttttttccagtttttttcgatcccaagaataccttcgcg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
6 gttgattttcgctttaatggtttaccggtcagcgggagccaggaagacgccgcatgccgacccgggcaggatgccgccgt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
7 gaaaccgtggcagacgggattaaacgcgaatggtcgttgcgcgaagtatttcccggccaaaactgcgcgccaagaccgag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
8 tttctggccctcttccagcagttcctgttcccgctggaaacatcgcggaacgcctgaccatgttttcgttcccttccgtc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
9 ggcagttcaatcgtaatagtggagcgcttgctaacttgacggtttttcaggttggttttttccgccagacgtatccgccc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
10 aatcacaaacgcgatatgggtagcggccgggcaggctgcagtaccgagggtcgcattttttctcgccgaggagtttttca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
11 gtttggccggggaagtccagcagcggctttggtttcctggtagagatacgttttgttggcagagccggccgcttttcgca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
12 acggcaaggaattgtagctcatcgccatctaccgcgtacaaggtcgatttgcgcagggcaggttagtggccggtgtttga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
13 cctctttgtacatgtccagcgccgcattctgtgaatagcgcaggtttatctatcttcgatataggtgttatagaacgcct
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
14 ttcgacagcgtttctttgcttcatcaccttacccatccgctgcttggaatagtttcgaggccgccggtccacacgcgctg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
15 gcctttttaccgacgatgatcgcggtgcgggtatgctctggcaggtcggcagcacgccttttggcggcgatttcggagtt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
16 ttttaagattgcagcggccacgtacttgtcgtttgcttgggcttctggatcggtgaagggccgcaacctgttttctggtg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
17 tgccggccggaggcagtaaaagaagcgtcgtgacagggcttgctgcgcgccagcagggtcagggcttctggttccacgct
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
18 ttcagggatggtttcgccgtcgaagtcggcaacgctaacgtaatcggaagtgagtagatagttattgcggtaatttggtc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
19 tttccccatcgggaaaggttgcctggtagataaagggttttgttttgacatagcttccagcctgttacctaatatagata
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
20 tttgtgtttgtattcgaaaatggcgtgggccgcggtagtcacgggcgcacgcaaagtgcatttataagaacgcgtacatc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
21 gcggcgtaaagatccagcgaagacgcacgatacgctcacaccaatcaaaccccggcagaataaagctgtggttgatgacg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
22 agcctgactcggcatggggtggtggcccggaacggtcaaactgaatcgctgcgcagatcgctcgataagtccggcaggat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
23 gttaataatccgtagcaagccggtgctgacgccacgatggtatgccggactcaacgcgatcgccaagcggcgaaccggaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
24 caatcgccgccaggcgcggccgcaagcctgagagtttaacaacttgagaaaccagcagcagaaacaaagtggccatagcc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
25 cacggaatactctttcaccattttcacccagtacgccctgaattccagacattgcgcgacgaaacatggtttctaggcgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
26 caatccattcataccgtacaccgccacgatggcgatcataaccgggaacggaagacttcgtttttttgagatagacgcgg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
27 gattggttttggtcaggagataacttaatcagcgccccggtcagccagcataaacatcttgaactaactcagtaacatcc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
28 gacagcgttttggccgccggaagggatggacgcaggtcagaatcagcaccaggaagggcggactaacaggcggatttgcc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
29 ccgaggaaagggcccattgccagtccagttgcttttcggcagttttttatccagcataagcgtcgcggtatcaccgtaaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
30 catactcacggttgtcccgttttccggtacggagagttgaatttctgggaactcttcgtctttaaaatccagatcttgta
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
31 cgcgcggacgcagctgaacggataaccgatacggccaggataccggattaacgtcgatgggaatggtgatgtgccaagca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
32 gatcgaggaactcagatgggcgaccatcaaggtgacatttacccgccagcatcgcagccagagaacactgaccggcaacc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
33 cgacagcgcggatctggcgataatccgccgcatctgtgcaccgatagaacttgcgccagtcgacgttccggacggatgtt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
34 gttcttaatggcggacgtcgtagatgatcggcatgaatggttgtaaaccacatgacccgtaccacaaaagaatggtcagt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
35 gtaccaggtccacgaaaacggggcgcgacaatttgggaggaacatatttttcgtggttgcggcgcagcagccttcctcgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
36 aatttgcagatgacatccaagaccgccgcgaaagcttgcaaggtcgccgatgccgccaccagcggcaatgataaccaggc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
37 atgaccctcaactggtggtttctggctgaaggtggaagacgaagaccagaatgaccagaccgataaccgcctaataaacc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
38 cagcgcgataccaccttttctggcacccataaaacagacatatcagtattagaaataagttggatagtaaataacatgtg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
39 gtgaatcgctcgcgataatcctccgtttaaattttttgctgatagatcacagtcacgttctgttttgtatgacatgtttt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
40 tcagagcgctgactaaataatccgttttggtcgttacgcggggctttagcaaaattaatccctcacagtggaatattggc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
41 tgattaaagcagcggcaaatttaatgcactgtagataagcggcttttttcagagagaaagactctctggcgatgggttta
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
42 tagttttgtactgcgcagatgttaattggttttgtttggctggcttaatgttattgatatttatcggtctatattttttg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
43 ttctcacgggcagatgtcattaggttttatagattaatctgatctacccattttgtgggtaaaaaaattacacataatgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
44 ggtgtggacataatagttaattaactttttgttagcgtttttgaaatttaaaacaacgggttcacctgaagaagatatta
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
45 aatttttagcgctgatggagaggaaattatattggatctggacagagattttactgatgaaggatgtaacttgtgccagg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
46 ggtatttttgtcattacggtaataattatttactttacagctaacgcaagcgatccgttattggaatattgttttcagta
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
47 gtggaagtagtggttctgcctgaataacggtaacgtaaactgacgggcccgtgacgcctaaatggatagctggtggaaca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
48 cgaatgtggagtttgaccagccagatgaaggtatttaggcaggtaaacacggcgaatgttaaactcgttgggctgcttcg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
49 tcgggttgaaaatttcacatagtccctgatgcgcgtccaatccactggcacagtggtgcgtaacgttgcggcgttaaggc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
50 ctttttggcaagcgacgaggatcctggttcgttggagctgctgcgtggattagctgatcaaggctcggacctggtcataa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
51 tactgatgtttttccaggtcgcgcatttttctttttgccgccagcccgggtgagcgcccctggcttcagagcgggaagcc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
52 tggaaggggtttgatgcaggttattcacgaccaccgggtaaatgccagcgaatctttaattggttggccgcatcgggctg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
53 cggaggagatgacaatcacatcacttttgcaaacgcggtgttatgcaaggacaggcagtaatccgagccgcgttctcttt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
54 tgatatagatatgcgagcaaataattttcaggtcgataggcgtatccgctaattgaagataatctctttggctttcctcc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
55 agcgtcgagctgtttccacaggcattgggcaagcctgggatttgtggctagcgtatcggcgattcagctcgcgaccattg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
56 gtcgtcatcggataattaatacattgggatcatctggttcgacctctccccgtcccagggtaatctggacaaaaaattgt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
57 gtgaaaatcccgggtttcgcgattccaccggcggaatgctgcgccgaggattttctactgttgtttgacaagtgctaaac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
58 cgacgctcgctcgcttcttttggtcgagacaacgctttggtcaaaaaatgtatcgattttatcggggtgcgatccccggt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
59 ccatcatgcattaacttcaccgtggcagccagccgtgacgtagtgcaatgttacgctagtatttcgcctccgggttccgg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
60 ccctaattgcctccagccgcgttttcctatcagctttcccaacgtggtaatgcagcgtcgcgaccttggtcctactgccg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
61 ctgtctggcagcctggctttcactgtttaaaatcagcgtatggctaatcggtcgcgcgtttaatcttgctgattaaaaaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
62 cagccgataaccggagatttgatcttacccagcagaagagccaatctttcctgatagttattggctgttttgagaatgta
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
63 atctttccaactgccttataactcttcagatgcaataatccgagaatgcacatgcaattttattcataacttcgtggatg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
64 cgttcacgaagtgggcgttcaagcatagtttgcaccagacggcgagtcgctgcatcagtttacccgtacttcagtttgtc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
65 cctgaaggttgaacatggcagccgatgataacgccattactgcggcaccggacgggtgttgatcagtaatagccggtctt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
66 taatcgtaatcctccttcgtcggcgggcgcggggtaccggtcgcgtaacacttccgagacacatctaccacctgtgacat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
67 gagttggcttagcggtcgacagtttctcatcgtctgcgacttacgggtcattcagcaattcttgtgcggggcagtcgttg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
68 atcagcagtgacctcgccgcgggatcgtcccacggcaacggacgccttctttggatagactgcaaacatggccttggcgt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
69 tttgctcaaacagcgttggagattttcgtagggttccaggccgaaaggattttttcagtaccttaaccagaaatgcaggt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
70 gccaatcagtccgaccagcatgccaaataaatacgcgaccagataatgctccaacgcgacttgtcattgatctgttgggg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
71 tcacagcggcttaactcaaggccgattcgccacgcagggccaatttgttcttattgatttccctcgtagatggggtaaca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
72 tacgccgtaaagccttagagaccagaaaaccggcggattgataggcgacatttttctttccgcgcattcagcgctttaag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
73 gatgtctcaccctttaaatggctgacaagtacgctgggctttcaggatgcgatgtagcgaaggactttgcaatatcgtaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
74 cgacaataaacagcatagatgaacatcgttgcgtttttgcgtacggctttccgcgcatggcctggatgccactctcgctg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
75 cggtttttctggcaagccctgacgggatttccggcgagtcggcgaggggtacgcgccactgccagtgccttgttggctgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
76 catctcgcgtcaataatccactgaattctctcgcgcacgccagtaaatcagatgcaccacaatagcaaccgagaacagta
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
77 accgccctgaaccattaagatggcactgtggtactcatttctaaatgcggggaaacgtttggcgtaacatgccggtaggg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
78 caatgaatgtctcattcagacttccttgtgtgacaaatttcttaagacattaatctctgatgaggcggggtaatctcaca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
79 aggggagtaagaatgatgtggcttttataggggaagagactctggcacaacagaaactgccagtgcttgttaaatgagaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
80 gattccggggcttatgccttatagcgataatcatactgatgagagagggaaggtgtcatggatcaggcgctactgggacg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
81 ggggttatcggctgttataacggcgaaaagatcgatgtctatttcaacactgcgatatgtcaagcatatctggcaattgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
82 gtaacgtggcaacggcaagttatttaaatctcaaacgaaagcgcgtggaatcatgcaccggggaatgaagtcgacgtcgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
83 cactggtggttaaagtgattgatacgtgccccgagggcgcgggtcataaataagcgagggtaaaaatggaaatacgcgaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
84 ggccacaataaaatttgacattaatgaacagaagacaaggcaagcaaatcgctgaaattgtccttgtggccgaccgagag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
85 aatttagcgattatcgaacataccgatgtcgatgaatagcctgaaagggccaagggattgggtaaacag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
86 >m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/66/0_2820 RQ=0.800
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
87 aaaaaccaccaaaaagaaaaaaggaaaaggaaaaacaaaaaaaagaaaaaaaaaatttttttttgggaaaaaaaaacagg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
88 ggtttgggggaaaccccctgggaaaaaaaaaaaaaaaaaatgagaacgcagaggggttttgccggtaaagaaatgggttt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
89 ctgggttggaaaccgccgggggggtttaaaatatggtgccctgccttggcccattctttcgtttgaatgttggtttttta
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
90 aaggatggatgacggccttcccgttgggcggcaacggtccggggaaaaaatgatgcccggcagccctgggcgggaatacc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
91 ctgaatctggtcacacgggtcccctccggccctgggtggccccctgaacattgtggcaacagggaaaacccgccaaccag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
92 caatgaaagcggtcatacggaacaattaaacgacttcgcgcctcccggggctttggggcttggctgggctcacttgaaaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
93 ccggtccctgccttcagtatccaactggacaacgctgatgctggagccacaactgcagtataccccctgggcagggactt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
94 tccctggatgaccgggtaaggacaacgccgggttatgtgagttcgggcatggccagtgcagcacatgtgcgtgcgcggct
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
95 ttccgcgtctgggcaggcccacaacgaatcatgagcctttgcgaaggcacctcatcgccgtgccgcctgcgtgaacatgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
96 aaaacaacaggtgtgggagtgaattaccgggtgaactggtgggtacagccttctgttatccgcacgctttgcagctccgg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
97 ggaagatatgcgtgtggggaccttccactgctcaaaggcagcgggggatgacgttcctctgccatcacagatggcacatt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
98 cactcatggacgctgcaggccggactggaagccgccgtgtcgcgggaaaatatcccctgggcgttcaggccgttatgccc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
99 acagccgtcagcgggcagcagcggctgaaggggtataaacggtcaggccacactgaattgaccttctgacagaaaccatc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
100 gccctctctgttggtcccggtcaatcatgacgcgggagcgcgcggaaccggggcgcaacggatcttcaaacgccacattc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
101 gctggcaaatttaacaataacatggatattcatcacggagtggactatgtttaggacagattagtcggcgcgctgtgcct
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
102 gctgatcgcagattttgccattcttcgccttttgtttcagagcattaatcagcaaggccttctctgcgctggcagggctc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
103 atatttgctgtgtctgttcgggccacggccttactggctgggctatattcaccgaacgcataacccggttgtccatattc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
104 gcggctggcaggccgtatttccctgagcgcattgccggaatgaatcatcagcgttcatgtggggacttgaaatggtaacc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
105 atatcgcgcctggataggctcacgacctttttgaactctgtgaaatttttattctgaccacgcgctctcgccggtggtct
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
106 gctggctgtttcccccctgcagaatgcaaaaaacattcagcagacgggatcacatccaggaagatatgcagcaaggaaat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
107 taaccgggggtattaacttgctttttttataactgcctttttccttatggcgtgttctgcatgccgcaccattgagtcgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
108 gttacgtacgaatatttcaaccgtcactgatgtggtgggggcgggttgttgtagcctggctggctgcattagtgacgctg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
109 ctatggcggcgcagccagatcaggcgctggaaaaactgacctgtgcatgcagccagacactggaagaacaactataggtg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
110 ctcaacagtaaatccgtggctggaccaagtttcggcaaaacgattacagcttcctggactcactggacggaaagcgctaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
111 tctggctgacgctccatttttttttttttttccccttttccctcaccggaaattttcccggggaagagctgagggaattt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
112 gaaactgggggcaagacggaactgggttactgaactacaatgcctggtatgaagacacaatggcagggttttaaacgaac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
113 agtttgaaagagaagcctgtcattcacacctgatgaactaaacgcttcttccggaacctgcctgggaaattatcagccgg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
114 aagcggaatgacggattttctgtctccgatgcgttgcctggacggcggtgactggtatcccttttccaagcaaggtcggc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
115 cgtttgtaaatcatcccatcaacgtggaatgagacttgcgtatctgttgcctcctgcgggctgagccagaagtacaaatc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
116 aatgctccggaaatcaataagccggattaccggaatggtacttgctctccttcttttgtcgcgcaaacagaaacactcgt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
117 gtccaggaaattttatgaaacgccttacaacagctttatttccgtatgcaaacgggcgaatggtctgattcctccatgaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
118 acttgccggaacctggagtaccaagatgagaaaatgtttgcttccctggggagggcaggggacatggggtttgcccgctg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
119 aacgatgggaaacataattgcgacagagtccgtctgtgaaaaagacggccacggaattctcggtgataataatgccacga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
120 atggaggcagagaccagatactggtccagcggaagcagaaatcagacgaaatatttgttcaacttgcaagccgtacgtcg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
121 gtgcgcattcgacggacaaaacggacagtatccgttaacatgggaatatggcccgatgcaaactggaagtcccgtgaatc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
122 agtagccccggcgctgttga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
123 >m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/92/0_12187 RQ=0.859
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
124 gggaaaagagggagaaaatggccccagaaaaaaaaggaaaaaatcatggacctttttaatttgcccggtttccaatcttt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
125 cacggtgggtttttttttttccctgtgggtttttcccgttccagtctggtgcccttgtttaaaaactattattcgtcccc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
126 agcaccgctggggtaaccaattaattcacagcagcagctgatttaaccgtggtctggaaaaacgttggccttgcaaaaat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
127 agcgcgagaaagaaaaaatccctgattcggtgagtttttttccgcttaaaattaagggcggtcagttgaccgcctttttt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
128 cttttcgtagggcggataaagcaccggcatccgccacaaaagcaacaggaaaccatcatgaggcgataatgacctatcgt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
129 agccaagcaaggccacgcctcccgggaaacgttggcggcgttggcaatcctgcggcatctccggctcaaagcccgttgaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
130 gttttgccgaaaccgtgctggttcaactgcctaagccgcgcttccgccgattatcctttccgtttaagacccgacggcaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
131 gcgtgctcgattcagggggattgcgctaatggttcctggcccgaactcgttacgaaacggcgaagatgtgctggaaactg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
132 caaggtcatgggcggttcggtgatctcgacctgctgtcaaaacgcattctgacattccggcctgcggattgcttcgccct
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
133 ggtgagtttttccgaacgctggcgttttcttaacgataacttgactttaagcccaggcgaggcggattgccgattctatg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
134 acgccagttttcgggaacaggcggcccggttcggcacttaactcgctgcaaggcgcattctcgcacgggttaatcatggt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
135 agaaagccctcaacccacttgcgcatttttagtcgaagcgggcaattgattttccccgatgaagagatcgatttccttct
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
136 ccgacggaaacattgaagcccagctcaatgacgtttattgccgatcttgatgcacgtgcgtgcttgaacacgtcagggtt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
137 agtttggttgcgcgaagggtataaagtgttgattgccgacgtcctaagcgccggtaaaaatcgaggcctgtttaaacgcg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
138 ctggcggggcgtgaagcggcaatcgtaaccgatatcgcggaactagcgtgacgtgctgcgtgagcatatcaacattgagg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
139 aatgcgctgcatatcatcgatacgcgttgctacgtgaaagccagtgacgaagttagaagtattggtattcgagcgcgcgt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
140 gggcaggaattgacaggcgaccgcgtggctgtttatggtcgatggcaacctaaagacgccgtgatccggcagagatctgg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
141 cggaatttaattgcccgtctgcctagcgaaactgcgatcaccgtgggtgcgcaataaagcgatatccaccgcgaaacgct
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
142 tggaatgagtgaagtgaacggtcacgcgttttaattcgctctcggcaaggactgtgcaggcgtgacgtgctgcgtaacca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
143 ttcaaacagagcatgggctttgcaccaacatggaaggacggcttcctggcgcgtcggtcgccactacaggcgctggaaag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
144 gcagcggaacatctatcaacagggcaaagcgcaatgttggagccctggcaggtgaactggctggcggagaggttgcgtct
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
145 ggcacagcagaacttaaagcgaaatcatccggggatttacttcagacgacctgctgggcggattttctccagcttctgta
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
146 ttggtaagtaaccgcgcttacgaagcgcattctgactgtcagatgcggcttcgcttcattgtttaccatccgttattcct
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
147 caaccttttttttaaacattaattcttacgtaatttattaatcttttaaaaaatagcatttaatattgctcccgcgaacg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
148 attgtgatttcgattcacatttaaacaatttcagaatagacaaaactctgagtgtaataatggtagcctcgtgtcttgcg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
149 aaggattaagtgattatgaatatcttacatatatgtggtgactcaaaaatggttcaagtattgacaacaaaattgttcga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
150 gttcaccgcctatgattttgcccttctgtagcatcaccagagcaaaccgattagattcatgtgatctattttgtttgcta
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
151 tatcttaattttgctttttgcaaaggtcatctctccgtttatttacttgttttagtcaatgatggtgctttgcatatata
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
152 tctgggaattaatcgtatgcagattgtaatattcacagttgatactgtaattaaaataaatgaaggattatgtacatgga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
153 aacctttaaccatctccctgaaccgttccgcattcgtgttatttgaggcgctagttaaagacgtaccactgcgcttattt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
154 cgtgaagaggcaattattaaatcgtatgaacccgttctgctggataagcgaagatgttttttatcgatttactgaccgac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
155 agcgcaccgggggcggtgaccgcagagcatgcgcttgcgatgatgcgcggcgaacgaagcctacagcggcaagtcgtagt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
156 actatgcgtttagccgagttcagtgaaaaatattttggttatcaatacaccattccgataccaggcgccgtggcgcaggt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
157 caatttataattccggtactgattaaaaacgcgagcaggaaaaaggcctggaatcgccagaaaatggtggcgtttcataa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
158 ctatttcttttgataccagccgggccatagcgatcaaacggctgtacctgcgtaacgtctatatcaaagaagccttcgat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
159 tagggcgtgcgtttagactttaaaggcaactttgaccttgagggatgagaacggggtattgaagaagttggtcgaataac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
160 gtgccgtatatcggtttgcaacatcacagtaactctgcaggtggtcagccggtttcactggcaaactttaaaagcgatgt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
161 aagcatcgcagaagaaataaccgatattccggtggtaatggactccgcgcgctttttgctgaaaacgcctatttcatcaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
162 gcgcgtgaagcagatacaaagactggacccatcgagcagatcaccgcgaaacctacaatatgccgaatgcttggcgatgt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
163 ccgccaagaaagatgcgatggtgccgatgggcggcccttgctgtgcatgaaagacgacagctttttgaatgtgtacaccg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
164 agtgcagaaccctttgcgtggtgcaaggaaggcttatcccgacatatggcggctggaaggcggcgcgattggagcgtctg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
165 gcggtaggttgtatgacggcatgaatctcgactggctggcttatcgtatcgcgcaggtacagtatctggttcgatggtct
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
166 ggaagagatttttggcgtttgttgcccgcaggcgggcgtcaacgcggcattcgttgatgccggtaaactgttgccgcata
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
167 ttgccggcagaccagttcccggacatggcgtctggcctgcgagctgtataaagttcgccggtatccggtgccggtaggag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
168 attggctctttctgttaggcgcgatccgaaaccggtaaaccacttgcatgcggctgaatcgctgcgtttaacgcatttcc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
169 gcgcgcaacatatactcaacacattatggactttccttatatgaagcctttaaacatgtgaaagagaacgcggcgaatat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
170 taaaggattaactttacgtacgaaccgaaaggtattgcgtcacttcaccgcaacttaaagatttaataatctacaggagt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
171 ggctatacaggaatgttagccatctctaccctacatcctcaataacaaaatagccttcctcttaaggtggcatcatcgaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
172 ctgatcaagctgaaaaaaagcactctgcatttttgggtgtttatggttatagcaggtacagtaattggttggaggtatgg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
173 ggttttttgcttttaactgttgacttgcggtgcctggtttttctggggtgcccttatccttatcaattgcctggtttttc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
174 aatgcttcattcgggttattgttattagaagcaaatttaaatttatcccgtcggctttccagtttttttaaccaccacac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
175 caaagattttaatcggtaacacctggaacattatcagcggtataccgttgcttcgttctctatatctcacttatgcctat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
176 atctctgctaatggtgcgattgcattagtgaaacgatatcaatgaattttggggtttattcacgctaatcacgtattgtc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
177 gggatctgcaacagccatttcgttgcagcgtattggtggctttaagttttcgttagccgccagtcgctattacctgcatt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
178 gttcctcgggctgaagattatctcctttgtgatcgtgttttggttcttttttcttccagtcgattacttcattctggcgg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
179 cgacgtcaccagctccactgcggaacgtttacttccgttatctttaatggcttttgcggtgtgtctggcgtcatttggtt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
180 ttccccggcaatatcccagcctgattatttgctactggaaaacgcaaaagataagttaatcaaaagcgtggtattttgtt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
181 tcgccttgctgcgcttggtgatttatctcttctgggctgctatttgcaaccatggggaatattcgcgagaaaagctttaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
182 ggccgaatttatctcctcaggcggcaacgttgatttcgctggtgaaatcgttcctcgcaaccaatacagcacggcattat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
183 cgagtttttgcctgctggtgttctctaacttagctggttgccagtttctttcttttgggtgtcacgctgggggtttgttt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
184 cgattatcggcggactgtttaagattgataactcccacggcgggcgtgtttcaaaaccgtgctgttaccttctgccacct
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
185 gcgttgttgtattctgaaaatcttccccgacggtcttttaattctaacggggatcgggcgttgcgggctgtgcgccacat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
186 cttgggcggtctttattcccgcagtggctgcaatcaaagctcgcaagaagtttcccatcagatgttcacggttgggcggc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
187 atctttattccggcgaattgtcaatctctttggtataaaagtgattttttgtgtgctggttcggcaacgtctttaacgtg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
188 ttcttaaattttggctaaattcttcaagaagccagccattcgttggcttcttgctctaggaattcacttatgtcagatgg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
189 caactcgcctgattcctccttcacacgtatgctttgcgtcacgcttactatcaggacgctttagccatgtccgctttttt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
190 tgatttgttagttttgcccttggttttactttatccgccggattgatatgtacctcgttggtttaccggcgcatttgccg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
191 ccgatctgcaatgccagcgaagcgcagttttgatattggcgttctcgcgtatatctggcggggctggcagctgcgatgtt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
192 tatttgccggtaaagtggccgatcgttcaggggaagccggtgcgccataccgcggggcggcgctatttattattgcctcg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
193 gtgttctgtttcacatggtgaaaccagcacgtttattcttgcaggccgattttctacagggggttgggcgcaggctgttg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
194 ttacgtatggcgttcgctattttgcgcgacacgctggatgatcgaacgtcgggctaaagtgctgtattactcaacggtat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
195 tactgcattcattcccggtgttagcgccagtgctcgacatctgattatggcttaaattccccgttggcagagtctgtttt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
196 tggcgatggcatgatgggcatcgcggtactgatgttgtcttttgtttattttaaaagaaaccgcagcggcccccgcagct
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
197 ttcggataaaccagagaaaaataggcgagtcgctgcttaaaccgtttttttccctcagcccgtgtttgttatcacaccag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
198 cacgctcagcgttttcggtgatcctcactttcgtcaacacgttcaccggtattgctcggatggaaatcatgggtttgagc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
199 gcggtgatacgcaccattatggcgtgaccctggcgtcagcattgacgttttccattctccacgccatttgcgctgggaaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
200 tttttaagccacgtacgttgatgaatcacatcgcaggtttgttatttcctggggcgggggatcaccttgccgttttcacc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
201 tcccatgcggttttctttctgtttggttttatcacgctgatttgcgccggttttctcggtaggtttttggtgtgggcgat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
202 gagtcaggcgttaggggccgtttttcattacgcgcgggccgctagccagctgacttaggtattgcgcagcgtttgcggtt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
203 cgtcctgtgggatttttggctgaagcggtggttgtatccgcggcatgaatacgctggaatcggattctgattgcctgtag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
204 catagtgagcgcctgttgctgattatgttttcgtcgcgcactggacgcccgcgttgccgcttcatgaagaaatccatcac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
205 cacgcttgatctcaatctgctgcttttgtctgcaactgctgatggccaggagcgcagcgtaacaaagcggcgaagcggat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
206 aaaagtgacacatttcggcggtgagtaagttcgctggcaaagttaaagagcgtggttttggacgacaccgctctttgtga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
207 actcaccggcttgggtctggtcgcccacaccgctgatggttcagcaatggagcaaaattctggcggtagtgggatgcaaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
208 tgacacctgctgctggaataaaccgcaccacagacaacgcgcggcctgcagttttatgagctggcggcggaattacgctt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
209 gatgaatgattcatgcttaagcgctgtcgaaacagattaccaacgttaaccgcaggcgacgcatcaattacggttactgg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
210 gattacgatttctttagattgcaatagctcgtggtgaagtgatatcggtttttcgcgggtcgcggaaagccatcctcgct
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
211 cgcgggagctgtaagctcgctatcgttagccttgattatgaagtggctgtttttagttgatgtgccctggtctggttagg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
212 caaagatcatccggcactgcatcaacgttggaatctggacaccttcttacggttatccgcatatcagcatttgctgggaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
213 cagagcgatacctggcgctggagcatgtggttacaggagctgggacggcgaacgcacgatttgctatgaggctgccgaat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
214 tcgagcagtcactgtttatggcagcgcaaccgcgacaatctgctactgcgacgcgccgcgctaactgtcagtactaacaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
215 tcaactccatcactgccgtggttgctcttcctctccgtttgacgaaagccagcaaaaaaaggcctgaaagttccttttac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
216 cccgctgctgtcggcataaacggcaagccataatccgaaatcgtctggttacggaaacgcaattaaaacctttacgcgtc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
217 gatggataacgaatcgtatgaacgcggacccaatttcacaataaaatgtaaaaaagtttgtaataagcttgttcttgaat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
218 caacttttagcgctttttagtctgttccatcattccacgtaatgaattactcttgttattcatactggaccattaagcat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
219 gggagcgaaacatggcggactcactttgcccgagattttaacggaaggtacatctgatttctgttcgtctccccttccag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
220 tggttcatcaagagcacgaaacattaacctctcatcgtcaaacgcgttttctggcgtccagaggtttactcgcagaactg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
221 atgttcatcgctgtaatggcattggcgaattgcgggaaatcgtcaccctgccgaaaaaaaaaagggggttaaaaaaaaac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
222 cccccggggtttttcagtgaataaacaatttgccttcggttttcccatttctatgcccgggaatatgtttggcgtggcgt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
223 taacaaccgaaggtgaattggttgggcctcatatggaactacagcgtgcgacgcggcgggttttcatagcccacacgcgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
224 cgataacacacttttccagcatgaatcgctatggatcagtaacaaaacgatcctaacgaagcggcgggcgcaggctcata
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
225 cgctgcgccgaagcgtgctaaaactaaccggtgatgttttgaattgacgatcctgcgcgatctgcagctgctgcccgcat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
226 tgccggacgcctgggaaatgtggctcatgtaaattcatgtagtaacgcgtttagcgacgccggaagccgttggatgggtg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
227 tggtcgtggcggtcacgccgcacgattgaaaagactcagtgtctggagttagaaatggccaacacggctggaaaaaagct
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
228 gccggatattcacagccgcgcaacaatccttaccaagccggatgaatgcgttttgcccactctctacagtgaaggctttt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
229 tggccaatattgatagacaaccacaagggagtcatcatgttctgaaaattggcaggtggttacgttaactggggagcctg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
230 ccgcaaaggctcatttaatggcatggtttgcacgtaaccccgtgcgaaaattgctcccggcgatgcatggaagtcaatgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
231 gttaccatccattgccgacattcccttgtatgacggctgacgtaacagccggaagaagtttccagcaacggttgaaggct
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
232 ctggcggaacaattcgtcaggctgacggtgtggtgatcgtcacgccggaatatcactactcgtaccgggtgggctgaaaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
233 tgccatcgactggctttcccgcactgcgatccacgctgggcaccggttaataccggtattgattcagacgcagcttcaat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
234 ggggcgtgattggcgggcgcggctgtcgtatcacctggcgccagatttcctggttttcctcgatgcaatggtgatgaaca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
235 aagccggaattttatgggcggcgtggattcagacaaagtttgaattgccgcaaaccggagaagttgattgatcagggtta
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
236 gcttggaccacctgaccgggatttgaccgggcattttggtgagttttattcagcgcagttaagatctaaataaaaaaacg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
237 ccgcacagcgaatcaatgcatggccgggtttttaacgcgctatcgattttagtgagcgtcggataaagaacaatcttcag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
238 gataacagcagcgcaacgattgattacgcacgggcttagattcacgcagcgtcgtcgtaacgggatttttcatcaacgca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
239 gtaggagataaagcccagcgcgataactttcggtaatcgagaaggctgaaacggcaatcacacggaggtactaaacgacg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
240 gaacagattcagtagatcctgcagcttcaagcgtgcccagactgggaaagtcatcagcacgccaacgtaaatcagcgggc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
241 accagctgcagcgtagcctggcacgcaatctccgccagcgggcgacagaaagataaccagcaggaacagcagaccaacaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
242 cactgccgtcagaccggtacgacgccaacggcgatacgccggaagaaggactcaatataagccgtacggaagaagtaccg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
243 ataacgaaccggtcacgagagatactggtcgcatacagcgcctgctttcatgcgcgggaattttcccgcttgcctcatcc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
244 gccagacctgcttttcggtcacgcaatccagcgtaccggaggagttcccaaacaagttgaccaacatgaagagaaaatta
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
245 ccctgcagccaccgaggttaaacgacccggctaaatctaacatgaccacaactgtcattaacgctcgcggcgcagaacga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
246 ttgcattgtagtgcacatcacccagcattccagcccaggcaggcgtcgtcaccacgatagaaaccagcaccgctgcgtga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
247 atgttggccgcgaggcccagaataggcaatgatgaagaagccgaggataccccaggaagtacgctttgtgagaagtccag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
248 attaccgatgctcacacaagcgttttccggggttagcgacaattcacactgcgtttttttgttcagcccattctgcaatt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
249 gaacagaccgattacgggcggtgaataccacacgcagactcaccggaatgttggctatatccagtaagcgaacgcggcaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
250 aatcgtcagtacagcgacctatcgcgccagaagatgcgccatcccgacctgccacgcaagcccacgctgtacaacgacaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
251 aagcgaagacgcattcaggcccatagcgggtgcaagtgcaactggcaggtttagcaaacagtcccatcactatactgcga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
252 atgcagcgatgcagacaggtagtgacgaagacggcgctggtaaatccatggccacagccaagaatttttgcgggttaaca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
253 aaaaacgatgtaccaatcgtcaggaagggtggtaaaacccggcgatcactttcgttcgtgcgggtcgttgcatgttcgcg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
254 cagttttaaacacgcgtttcagcaatcccttgaccagaattctgggtggtaatgttgatgactcatttaatctatttccc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
255 gacaaggagggaaaatcgcgtcggctatcgtatacaaaatgcgacaataggcgcgttttgtgagagactttttttattgg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
256 ttaacttatacggcaacggattgcgttgcggcaattcggctctaacgaaacgttaaactgatttaaaaaggaaggcatgt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
257 tccgcggatagaagcggttaattttttcgatctgcgacggtacgctggtcgacagtgaagtcatttgctctcgcgcatat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
258 gtaacgattgttttcaggaatttggtatttacgtcgatcctgaagaggtattcaaagtttcaaaggtgtaaaactgtacg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
259 aaaattatcgatatttttcccttgaacatggtgttacgttagcgaaagaagctgaaacacgttttacacgtgcagaagtc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
260 gctcggctggtttcgattcagaactggaagccatcgaaggggcttggagcgctccttgtcagcgatcagtgcgccaatgt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
261 gtgtggtaatcggcccaaataacaaatgcagcattctatgggcaagctgaaatatgttgcactacttccggataaactgt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
262 tcagcggtacgatattcgcgttggacgccagaccggcgttaatgttcgcatgtcgcaaaagcgagaatgtaaatgtagaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
263 aactgcatttctggtttgattgactgcaggtttgccggtgacaatctggtatcgacgcaggtatggcaagtgttctactt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
264 ctgcgccggccgcacaataagccgatcgttcacccgaaagtcacactttaccctctttcgcaggttacctgaactgtgga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
265 aagcgcgtgttggtattacggcatagttcttcacactcgcttcacttaccccgcttaaattggcgcttcaacaggtaagt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
266 aaagggagtttttgatatgtctgtttcacggtcgggtaatacatcacgggacttatttcttgcatttttaggaccgttta
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
267 attgggttggttctgttttctttgtctcttacatattaatcgcaaagaaccgctggttctttttgggtgataatacatcc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
268 aatttttctctatttgtgataactacggagctcattccctgcgttgttaacggtgtaatggttttgctgttctgcggaaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
269 agaatcgggtcacagaaacgtttatcgttgtctggctggtggcataggtggtcgctcgttatcaccggagaatctattgt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
270 ggcagtttattgtcatattaagggatggcttctcggagttgttttgaaaacattctttctggtgacagtcctcgttgtcc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
271 gcatcattcctgcccatttgctggcaggttgtggtgaatgagccagaatgcatttcccgtctaccggattttggatattt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
272 catgtcctgaaacagactctttaagttaagcagggatactttattctttggctactcaaaagcagacagggatgtttctt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
273 atgactcaaaattctaggccgttacccacattcaaatatcattcccagcaagccactggaaacagcccgtcatttgaaac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
274 caggataaataaccgtagagtgcgattggctgtgaacacaagacgttcagtttatcttacttcggtcctttttattgcgg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
275 tttgatgaagcttgaacatctctgtccgtggtgtaattgcgggacggttctgctgctggaaaagtttgcaggtaagtttt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
276 tcaggatgatgcagcatagaaggtgtt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
277 >m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/95/0_11468 RQ=0.866
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
278 agaccaccaggggagaaggaaaaaaaatggcttaaaaaaaatttataaataaccttcccgccccccattttttaaaggtt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
279 atattttttttttacaaccacttctctgaaaaaaccccactaaaaatctttttttttcccggttggggtcccaatactaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
280 tcccattcgtgtaaaatcacgagcggtttaatcgcaaatgccggtagcgggattcgcaagtttttagtcccatattaata
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
281 ttaacgtggttccccaatctgtggtgttaagtgctgcgttgaaagtctatttgcctgaaatgactaccgaagttttaaca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
282 actgccgcgttgctttagtaattggaggtacaagcttgcagcttcccagaggtccacctttaaacgtccaattgatactc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
283 tatcagcggcttgcgctgacctggctaaacaaggcacttcggcaatgcagtaattttacattgttttcatgttttgcctc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
284 caccaggacccgggtcagatttgccttaatatctgtcaatgtcgttagttccccttcatgccttaaaagctggaagccat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
285 tgtcagtgtgaggctaacgttttttaccgctatcaatttaccacttcttgaccattttgcataaacaccagccaattaat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
286 tgggggaagtactaaggaaggtgcgaacaatccctgatatgagatcatgtttttgtcatctggagccatagaaacagggt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
287 tcattcagtgaagtcatcaacttactttcgccgacagtggaattcagcagtaagcgccgtgcagacgccagaaaagagat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
288 ttttcttgtcccgcatggagcagatctgtccatggcaaaacatggtggacagtccatcggaggccgtttttaccccaagg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
289 ctggttatggccgcgaccttatccgctggaaaccatgctacggcatgtcactgcatgcagcattggtaaacctgagcgat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
290 ggcgcgatggaagatgctctgtaaacgaaatcggcttccctgcgtctgtttgcccgttatcctgatcagcgccttgcgcg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
291 accgcacaccatcatgaattttccgccacctgctggagcaagcaatcactggcgcgcccaattgttcagaccatcaatcg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
292 ctgctggccgaaggcaggcgtcatgatgagctcaggcaccttggtcgatgccaccatcattgaggcacccagctgcgaca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
293 agaacaaagagcagcaacggcgtatccggagatgccatcagaccaagaaaggccagtcagtggccactttggcatgaggc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
294 ccaattggtgtcgatgccaggagtgggcctgacccacagcctggtcaccaccgcggcaacgagcatcgactcaatcagct
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
295 gggtaatctgcttgcagtggagaggagcaatttgtctcagcgtatgccggctacgcaagggcgccacagcgcgaggagtg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
296 gcccgaggtggatgtggactggctgatcgttccgagcgccccggcaaggtaagaacccttggaaacagcatccacgcaag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
297 aaacaaaacggcatcaacatcggaatacatgaaagcagctccggggcccggtaagcacgccattttcgcatcatcaagcg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
298 acagttttcggctcgtgaaagccagatacaaggttgcttgaaaaacgataaccactggcgatgttattcacgctggccaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
299 cctggcttcgggcgggaacaaatgaatacgtcagttggagagatctcactaaaaactggggataacgccttaatggcgaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
300 gaacggtctaaaatagctgattcaaggcatgttaacgggagaaaaaatcggctcaaaatgagaaatgaaaatgactgagt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
301 caagtcgagaagaatttcccgctattcgcaccttcctaatttgatgctgtttctgtcggcccggattgtcatttttgcca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
302 ctggctaacgccaggtcgagattgttactacctgaaatgcatcgctggcgatcagattttaattgaaccatttcggccaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
303 atccaaattccgttgttggaaatcttagccggtattcactgaaaacaacgatatgaagcgtcctgatcgcattgctatta
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
304 ccagcgtgattgttcttgtctggtctaatgtgcttgttttaccccggtcaacttggcgcatgggcagcacttcgtttgcc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
305 atagtcgatattttggtatgctactggagataattacactctgctgagcggccatggcgaagttcgcagcaggcatcctg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
306 tattatccgtttcatttgcctctcctgttgatcgtctctagaacacaatcttttttggtgcatcttctgggaatgtaagg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
307 tgaatacggcaatgatttgctgctcatcttttatatctagcaccatgtccggtttgatgttattgagggaatacaacacc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
308 gtcatcactgatgttgtcagatattgccctttctatcttcaaatggcgcaacgcctctgggcagtttttttgccgtcgga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
309 aagtggtgatattgagtaatgcacggcgttggtgtttatcgcactgatccgactttcccctactgcaaaccacggccttg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
310 tttgaatcatttttgtgccgttacgatatcgaaccttttttgcaagctgcggtatcgaatgctcaactcctgatgttcgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
311 cacggctggattgatgaatgacggcattaacccgaaaatctgtccatactgggctgccttgagatgtaattccctgacac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
312 ctgcaatattggtttatccatttttggcgatggcgaaagtgtcattgatagtcacggtgaaaaggtcactccctgattca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
313 tgtaacggcaataccactcactgacatcgtaccgttgtaagtacggctatcactgccggcttgctctgcggcaaggctga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
314 cttggggtgtaaatggagattggaactgatactggcgttcaagctcgtttccacgttcgtccgtgatctcgtttccaggc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
315 atcacaatagtaggacatgctcatctgagacgactccatgaaccagtaccatagtgggttttttatgatcgtcatggcgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
316 cgtatacagtgtggcggtgtttgaatctgccaaatggaaatactgatggttgacgtagaacagatcaaccatcgtttcat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
317 tattttctggaagcactaagttgatgctgccagtttgacgaaacgtggcgtgtttgaacgctttgtttccagtaatatta
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
318 aggttgctttgaggtcattgtcaccgtcgtaactataatgtttatagccatgatgttgaaacgcaacccagaaaggagtt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
319 taggaccagttttaaaccaagcgcatagtgctttttagttcgactgcggtatagatcatcatcattcgcttcagacagtt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
320 cgcgataatgggcgatcaggatgcgagtggggctggttgttaagccgcaaagtgaaaatgggagattgtagttcgcgtca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
321 agacgatatttctgtctttgcagtgatctttcgtatccatgcgatgtactaatttggctgctcactgtttaaatgcgggc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
322 aggggaaccagactcgaaccggattgatgccgcctgataattttcttgctacgataactagcccgcgttcttgcactccc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
323 agcgtgtcagtattccctccgctcgatgcactattaccaaggtggattcgtcatagtcattcgtctacccgcctatcgcg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
324 agcggataaccctggaagctttcttacatgctgattaaacagggtggagggaacaaatatgttgtgcgaactaagccgtc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
325 tgtttcgacaacggtgacatttaagatcaacttattaccattgcggaacaggtacaatagggatatgtgaatgcgcccgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
326 aggaaacccagaatggaatgaattaaaactccttgttgacgaatctcgacacgagctgagaggtgtttggctataccagt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
327 aacttgcacaccactgcgcggttttgcaattgccgttgtccgtggcgatttcgatacgtaaatactggctccttccaaca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
328 cgctattattgagggttaacttcactgctcgcatgagtgttttaagatctgtaaaggtagttgaagtaatggttgacgag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
329 tttggttactgaatgtgccattttgttttgtgtaaaggaactgaggctgcgtaagcatccagtcattaatattaatccgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
330 ctcaaggtggcagcctgggagtagtccgaacttcccattagaaacttctgccacggctgctcatcaggagagtagtttag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
331 cagcgcaagcttgttcgcaccagtttgctgcgttttgtgagatccaacccttatgggacctgatcggcctgtggtggaaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
332 cgataatatcttagaagttcctggttaggtaatggtgtgattgtggtaccggggtaggacaatatatagtcgtaaacagc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
333 catttttttcttcagaaggcccatttttaaagacgcggctgttgcagaaatgccttgatcaagacaaattgtgccatttt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
334 tcatccaaagcgcgtagcaatgtttgccttttttttcgccattttctgatactatcagtgaattattcacctaggcaaaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
335 aaacgggctgaacgggaaaaataatgcgatatattaggatctacacctagtgatttttaatgttttcccgatcaaatcaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
336 cagcggcaattctctataccatctgcattgggctgggggagaaaaaggcaaaaccactggtgtaggccagtaacgttttt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
337 tttttaacatcttgtcgctcgcaggcaaagttatttagtagtgacatatttattaccggcgataactcatatcggctggc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
338 tgggtaaaaaactcgacttttgtatccgtagcgtttgttaatgcgtagttgttaactggtgtgttggtagaaaataggtc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
339 ttatttatagcccccgttttttctgagggagcgttttttaaatttgttaaggtcatacgaacgacataattactgggttg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
340 ctaatctcaattttttggtcggccattttttttacgccacttttccaggaattttccactccagtctctcgctctttccg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
341 gcaaagggaagccggtgggatcagtacaggtagaatctgaacgaattgttgaaacagtaactctgctttggtctggtcat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
342 ctttttggtggaatacctttcgaacgtttacgcgttttcagctcttctgatttgggcagaggaacagtcgccttgaagta
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
343 aaaatcgaacctgttgtaacttgaccggccctttcaacacgcccataacaggggctgagtcggaataaacgaattgattt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
344 ttatgtgcttttcaggcaaattcaacaatggtggtgtaaagcatgaaggatgatcatctgtatttctatattaatactag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
345 cttcaccacgctttttcatcaacggcagcaatactgaatgttttcaggaaccatcccctgtggtaaggtattcattgatg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
346 tttgtttataatatcagtgaatgtaatgtgtctgaagcatttaaattaaaactcctgtaataatgataataacgcagaaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
347 catattgttaattatgattatgcactgtttgcgatgagttgattaagacagaccatgtcatagggcaataatctgtccga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
348 gttatagctaactggttaatgcgtaaaaataaaaactgtattacaagtttctttataaatactgaagctgatagtgacgt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
349 tcccatccagtttgatcgtttcatcagaaacgcaagaatagttattgtcatttaccgcagccatcattcagtaacgggag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
350 gtgacccgctgtaatagccaaccggtgtcagttcccctgttttttgggcaacagaatagacgcgcgctcgattgctgagc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
351 aacttgtcagcgagcaagcattgcgccattaggatgaggccttccatgtgggggtcgctgctgaccagtggtctttggaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
352 tcaggtcgacagggaatttcacctgtatcgtccgcccgcgtgaatcccaccattagacctgtcaataacgcaatggtgca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
353 agcggccaatttttttggtccatttaggccgccagaccttaaacaaggcggtttttttcgttcccttctatcttacgaga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
354 gtatcataagcctttttcaatataggatgtgtgcgtttaaacgctacacatggttcgactggatcggttatccttggagg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
355 tttagcagcaattagcgttggtgctggttggcaggttatatttaatgtgctgtttttgcggccgcagttgaaccagttta
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
356 ttacttttaccgtgtcggatttcagcgcatggttatgatgtttcccatagtcaacatgccgggccgcccgtaacaactgg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
357 ggtacatgcaccagggggtatactcgcgcgatgatagtttaattctgtatcagttgaatctgtttcatggcactgaatgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
358 tgcaacagaagtgctgcacaatagcagctgttgtgaggttctttttgaaaacatatgaaacataatcctttaataacaaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
359 tttattttttttaaaataaaagggagctgaaagcaggttattatatctgtttgttgtttttgaatgtaaataaatacctc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
360 gttcagaataggccaacttcgcctgggatgtattttatttagatgaatttttatagttaccgatcatgtgaattaataag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
361 gtgctggtggaggtggtttgtgtgataattaatttcattactgaatgttttgcgctgaaaatagcaacatacttatagaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
362 attaaggatatatattggttttttatattcatcatttttgtattattcaatatcgagacaatttacatggaatgaaaaga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
363 ctgaatagcttgcagaatcggtattgtcagaggtgttaacaagttaattgggagacggtttgattgtaaaatgcaagaaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
364 ttgcttgatgtgcttcctcaatcagacttggtgaacaaagcacactttattgaaacttatcggcctattataggaaaggt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
365 caacgctcatggcagcatttgccccgaaaacaacgcgcacttcgtcagtaatttgattcgcccagctacagtctgggcga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
366 attcaattgttaacctcgcttaaacttccagcgccgtttcataataccgttgccgccttaacgacccttcggcaatagcg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
367 gtgcactcaccagatcggaaccacggacgatatcgccgccagcaaagattttcgggttggctggtcctggaaggcgttgt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
368 tcgctgcctgccggggcgactgatgcggcttgtgaattccagctcgacgctgtgtttttgccaggccattccatgttgtg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
369 gtggacggaaaccacaacgccatgatcaccgcattctgccgaacgattaatgttcggaacctgcaaaacgattcttccgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
370 gcggcgacgggccttttggcgtccgttcggcccatttccggtacgcaccatttttacggcgctgactttgcgttcccgtt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
371 caacttaatacccagcgcttgggaccgtttgaatttgaactctagcgccttcccttccgcgcgttttttcagcttcgcgg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
372 cggaccggcatgttctcttcaaatcacgacgataggcacaggtaacgtgcttcgctccctggcgcactggacgtacgcac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
373 gcaagtccatcgcagtgtcgcgccaccgcaaggaccgacccacgcgtttgccttccatgctgacgacggttcgtcgcggg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
374 ttttcacgcaaagcccattaactgttttggtgttggcgataggaacggcagcgctgccgtacacagccatcggcgtcttc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
375 ggttttccagccgcggccgcgcaattgactgataagtcgccgacgccaaggaacaacggcatcgtaatcactcagcagat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
376 cgtccaggcctgtacgtcgcggccccttcggtattgagtttgaaattcaatacccgatgccggtgaagatttcacggcga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
377 cgcgtcattacccttttttttccagcttgaagggccggaataccgaggtccaagcagcgcgccaattttcctagacgggt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
378 cgaagacatacggcttttacgcgttatcgcgtcgcaggacatccgcacacgccagactggccgggcctttgttttgtccg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
379 ataatcgccacttttttttaacgcgtcctgttttcacaccaacatatccggacgccagcccattcgaacgctttatcggt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
380 tgaataataggcgctcaaatgttgcccgatggtcaccgcgcaaactcatcgttcgagtgggcaggaaccttcgcacagac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
381 ggtcttgaggcagacttggtcgtccgcaaacttccggcaagggtgttggtctggtgcgacagttcgccgcttcaaaatac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
382 ggcccctcgttggcgagctcagccagttcgggatgtaggtttgtgtaaccgggcattttccactcgcagtatgggttgcc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
383 gcacgaacaggcagcggtcagcctgccgcttttgggcctggccttccgaaaacggctcgttaaattttccaacaaacatc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
384 tattttgccggatcttcagcggttttctttggcggatcaaccgcgctgcaggtccggataaaattgataaaattctgact
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
385 gcattgtttttgctactccttactggcgcctgcacacgcgcaactcagggctgcgaccctagactacggtgacctcgcag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
386 tgcttttacatgcactggacttcggtttaaccagcgcaaattttaggtggcgaaggttgactcagtttcgccagaaatct
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
387 cttcaccggcgcctgagagcggtatctgcacatcgctcgtgataagaccacgcagatgctctttcatggatatcgccaga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
388 gcgtcaacgcttaagactcggacagtccgggtttacgcgtttgcggaaatcgccgcttttcatcgagaacgtaagcgaaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
389 ccgcccggtcatgcccgcacgcgaagttacgccggttttttaccagaatgcagacgataccacccggtcatatattcaca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
390 accgtttgtcgccaatgccttctaccacggggtgatagaccgggagttacgcaccgcccgaacgttccagccgcgcgggc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
391 tgccgcatacaagacgacggcaccggtcgcggctacaggcaggtgttgccgataatgcttgcttatggcttgcgaaggcg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
392 gaaccaccgggaggacgaaatgggcgaatttaagccggccgccatgctttaccgacatagtcgttgcagtccaccgggtc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
393 aggttacagttccacgccgccgcgttcatcacgccgaagctcatggcctgcggtgccgttgaaaagtacgctttgtatta
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
394 ggatggctgcagcccctgaatcgccgtgcgttctgggcgatatagcctgaaaggcgacgcgccgacagaacggtcggtgt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
395 tgcgaaatatcgaaccagaaggttttgctctggcgcttcagcgacaaacggttttcgcctgttgcagtcaactggcgcgt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
396 tcacgcaggccgttatcaaacggtcgggtttgtttcggtgcagtagagtgccttacctggattgcgggttcggcagtccc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
397 tccccagcagcttcggacagcgccagcttctgctgttttggcggtgaaaccgtccagctctttcagcaggtcggtgcgac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
398 catcagtccaccagacgtggttacgccaacctgtgccatcagctcgcgggtttcaacgggcgataaacttcaaagtaatt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
399 cggtcaccttgatggcaggccgtgatagtggttcttacgcaagtttgtcaaccccccccccccccccccccccctcctga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
400 agttgctacaccccgtgtgcgcagttgtttcagatggctaaatacgtagatatttacagccgagcgccaccatcgggcca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
401 agtgccgaagccgaagcttctgcgccgagaatcgccgcctttgatgatatcgacaccgcgtttttcaggcgccatcggac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
402 tgcaaacggatcttgtgaacgcaagccgtttagcaccagcgcctgctgggtttcaacaagccccagctcccacggacagc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
403 ctgcgtatttaccgatgaaagggacttgcgccggtgccgccgtcatagcctgcgattggtgatcaagttccgcataagct
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
404 tttgccaacgccagtcgcgatggtgcctactcccggtttacggaaaccagcttcacggagatcatcgctttcgggtttaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
405 cctgcttggaaggtcgaaaatgagtgcgctaagtccctcgatagagtagatatttcgtgggtgcggcggcggggagctca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
406 gcgtcactccgggcacgaaatagcgcagtttggcgatgtaaggcctgactttatccaacccggccaacctgaccgccttc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
407 cgcctggcttcgcgccctgggcgactttaatctgaatgacgtcggcattgacagatacgccggagtaacccccaaagcga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
408 acgcggaagccacctgccttgatgcgcgacactttgttggtgccgtagcgcgccggggtcttcgccgccttcacggagtt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
409 cgaattaccgccgatgctgtttcatgcttccgccagcgccttcgtgggcttccgggctttcaacgcgccgatagacatcg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
410 cggcggtaatcaaagcgtttaaacattttgagtttcgctttgccgttcacaacaatagcaatgttggacgcgttttttca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
411 cgccggcgtaattgccaagcagatcgcgcagcgtggttgccggacgcttccattaacgcagctccgcgtattcctgatag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
412 tgctgtacttcgccgcgctttgtaacggcttgttgcagcgtgcgcaaccacgtccgggttgtaggcgtggtattcgccgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
413 cgtggaacgtatttcagcagaccgccctggctgatgggcttacgcgccagccaggcaacgttttcgacagattcagcaga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
414 tcctgctggaagtctttcaaagcttgcctccaccaatggcggcctgaccgcccctggaagcacaggccgccactaacata
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
415 tcgtgtaagagcgaccgcttcaaacagttttcgagcagcggtaagagggcgaatggtggagatgtcccattttggacatg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
416 attttgtacaagcttttgtttgacatgccgttacggtagttgagcatcacgggtacgaataattctttggccatcgcatg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
417 ggtgtcctacaggcggcccagcgtttcaataggcaaggtatggataaatagccgtcgcgccgaaggcccagcacacggcg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
418 aagtgttgcggatcgtcgggcgctggcggtttccggaagacgatgatgttggcatgcgcaacggcaggctttgatcgacc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
419 agacgtctggatcggcgccaaccgcgcatcgggctggaaccgtgcaaggcgatctttagcgatattccggtcggaagagc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
420 accagcagcaagacggttgccgctacgtaccaattttttccggctttgtcgcacagcttcttttgactgtcgcttcgagc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
421 gtggtttagtggacgtcaaaggtgatat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
422 >m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/95/11514_13534 RQ=0.866
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
423 atatcacctttgacttccagtcaaacctaacgctcgaagcggacagtccaaagagctgtgcgacaaaaagccgaaaaaaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
424 tggtacgttagcggcaccgttgctgctggtgctctcgcgaccccggaatattcgctaaagatcgcctgccgtttccagcc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
425 cgcgatggcgtttggcgcgatccaagaccgcgtctggtcgatcaaagcctgcgttgcgatgccaacattcaatcgtcgaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
426 accgcaagcgcccgcgatccgacacttcgccgtgttgctggggcttcggcgcgacggctattatccataccttgcctatg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
427 aaacgctggggccgcctggtagacacccatgcgatttgccaaagagttactcgtaccgtgatggctcaactaaccgttaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
428 cggcatcaacaaaggcttgtacaaaatcatatgtccaaaatgggcatctcaccatcgcgctgctttacggcgctgcctcg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
429 aaaactgtttttgaagcggtcgagtctacacgatgatgtttagtgggcccttgtgcttcagtggggcggttcagccgcca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
430 ttggtggagcaagctttgaagaactttccagcaggatctgctgaattgtcgaaacgtgctggctggcgtgtaaggcccat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
431 caagccagggcggtctgctgcaaatacgtccaacgcggcgaataccacgcctacaacccggacgtggtgcgcacgctgcg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
432 caacaagcggtacaaagcgcgagtacagcggactatcaggaataacgccgaagctgttaatgacgtccggcaaccacgct
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
433 gccgcgatctgctgctaattaccggggtgaaaacgcggtcaaccattgctgatgttggaactcggcataagcgactgttt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
434 taaacgccttttgataccgggccgcgatttgtctatcggcgcgtttaagcccggaagcccacgcggcggctgcggaagcg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
435 attgaacagcatcggcggtaattcggaactccggtaaggcggcgaagaccggccggcgctacgggcaccaacaaagtgtc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
436 gcgcatcaagcagtgctttcccggtagctttggggttctctcgcggcgtcttctggtcaatgcgcgccgtcattcagatt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
437 aaagtcgcccagggcgcgaagcccaggctgaaggcggtcaaagttttgccggtgataagtcacgccttacatgcgccaaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
438 ctgcgctattcggttggcccggagtgacgctgtattctccccgccgccgcaccagcgatattacttctatccgagggata
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
439 cttagcgcagctcaattttcgactcaagcaggtttaacccgaaaggcgatgatctcgtgagctggtttttccgaaccggg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
440 agtaggcaccaatcgcgaaatggcgtggcaaaagcttatgcgggactttgatcaccatcggcagctaatgaggcggcacc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
441 ggcgcaagttccgctttgtcattcggtgtaaatacgcaggctgtccgtgggagctgggctttgttgaaacccagcaggcg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
442 ctgggttgctaacgcttgccgtcacaagatccgttgcagggtccgatggcgctgaaaacgtgtcgatattatcaaggcgg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
443 cgattctcggcggtcgaagcttcgggcttcggcagctggccgcatggtgtggcgctcgcctgtaaatatctacgttattt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
444 tgcgcatcttttgaacaactggcgcacgggtgtagcaactcaggatgacaaactgcgtaagaaaccactatcacggctgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
445 cattcaaggtgacgaattactttttgagttttcgccctgaaagcgcgcgcgagctgatggcacagcttggcgtaacaacg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
446 ttctggtggattgattggtcgcaccgacctgctgcaagcagctggacggttttcaccggccaaacagcagaagctggcgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
447 tgttcgaagctgctggagaactggcgagcccgcattccaggtaaggcactctactgcagccgaaacaacccgccgtttga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
448 taacggcctgctgaacgcgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
449 >m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/113/0_11466 RQ=0.837
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
450 ggggggggggggggggggggggggggtggggggggggggggaaacacaattccccccgccccccgaaaaggcgggaaaga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
451 aatttaaaaaaaaaggcggcgggtttaaaaaaaaatccccgccgacaacctttgggggtccgtcaaagcatttacccttt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
452 ggaaagcgtttaccaataaggaaccaaagcggggcccaagccccgattatggtttttgctttggtggggttcccctggct
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
453 ggcgggggtgggctttcatttatggggtttttaatggcgggaacccctggtgcccgtgaagttcccaggttatctcaatg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
454 aagtcccgacttaatgacgcgcctccaagcctttacggtagcggcccccaaatggtccaccacaccgcgttggatgtgaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
455 aatcctcaaagatcttggatgaagaatatccgtgccaaggacccgtgcctggattgtttgaagatatcatcgaccccctc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
456 gggggaaatacacctgtccgaaagtgcgtgagaatcttaaaagccctgcgccggaaaccgaagtcccgctgggatttgta
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
457 acgcctgctggaaaataacccgttccccgtccgtgcagtgaacgtccccccgtaaaaagaatttatggttttctcgatcc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
458 cggaatgaagttttgttgggtggtttacggccattgatttacgcagcagcgttacccgtcaatcttgccggtataatcgg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
459 caaaaggtgattcctgccctggaccgagtaaagtgtgaagttgccggatggttttgcatccggcatggcaattttttatt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
460 tgtggttggggcgtgtttttcagcttggaaggttggaatcccgtgacggtaacgttgctcaagggttttcgcggtttggt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
461 ggtggcggtaacatgcccgaatacgcagcaaagccgtcgtgaatggcccgtatgcccagcgcgtgaatggtaacttctgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
462 ccgcgtttccacgctgattgcataatgggtgggagtggcccatgtttaatacacctgttccatgacgttcagtttcacac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
463 caagggtatcgcagacggaggcgctcttgcggcatttgtcgcccgagcaatgagcttatgtttggaacagatatcgcgga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
464 tatgcagcagctgcagtttgttttgataagccccagttccgggtttttcaatggcggcttgttacgccgccgccacgtag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
465 tggcacagaaataataatgtgttcaacttcgagtaaatcactgcatactgaaacacaggaaaggcagttgcaggttcatg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
466 tgtgaatgaccggttagcaaccattacgtgaacaaagagttcgcccggcctcagaccgggtttaaacgttctgcaggaac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
467 gcgactggtccggaacatccaattccatagaaacgcgcggtttttgcgcttggtgccaggttctcaaaaaaaccccggga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
468 tcctgtctccccagcatttttgactcatagtgcattgttgctgatgagtgttctatgtcctttcatcggaggttaacgac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
469 ctgtaaaacgcaaataattacgtttggctaatatagggcatacttctcggacgaatttaaacgcacagataaagtgtaag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
470 aacgtaagtaagtaaaattttatgaccattgcactggaataacttcaacagcttaaaaaaaacgctatccaggcgggcgt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
471 tcagggcgcttcggtgggatagatttttggcaggtccgaagcggtgattttttatgcgcttcatcgggcccgaacggggg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
472 cgggaaatcgaccactaatcggtattatcaagctctcttggtaaataaacctccgggcgggtcagcgtattggttacgat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
473 ctcgagataggtatgtccgtgaacgctaaacgtcagttgggactgggtgcccgcagtgaatttaactttcaactccgttt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
474 tgaaacgcggtgcagcacaattggtggtgaatcaggcatggaggggtactaccgggcgtggagcgcaaagaagcgtaaca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
475 ttccgcagcgaaaagtatcttaaccactcggatctatggggaaaacgcaaccgaacgtgcgccgtatcgttatctggcgg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
476 gaatgaaagcgcccgtttaaatggattggcccgtgcgtttaatggcatgaactaaatactgatgtctcgaccgaaatcga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
477 cgcaggcgtggatcattgaacttcgcgcggctcaatgtgggggctttttttgaagatttaaacgacaaagcaaccaccat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
478 cattctcaccacaccctacctggtaagacgcagaaatgctgtgcgagcaataatcgggcattattcaacacgggtgagct
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
479 gggtgaaaatacctcgatgaaggcgctgcctggcgaagcctggaaaaatccgggaaacgctttttattctgattctcgca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
480 accgaaaaggcccgttaccgaagcttcgattggctatcagtatcgacttgggtcgatacgcgacgctgggaagtgaagtg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
481 ctgcgtgagcaggggatcaacagcgtaaatttacggcagttttaatgagcaagggcattcaggtattaagttatgcgtaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
482 acaatagcctaaccgtctggaagagctgtttgttttcactggttaattgaaaaacaaggagatcgcgcatgatgcatctt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
483 tactgggtggcgctaaaaagcatctgggcgaaaagagatccatcgctttttgcgtatcttgggtgcagaacgcttgggtg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
484 cccgcagtccatcaccctgaccctttactttatttcatctttcggtaaaactgaaattggttcgcgtattgggcgatatg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
485 ccatgggcttcagcctatatgcagtttcaatcgtaaaccggggctgactcatgatgtcggtgatcactcatgcctacgcc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
486 caaccgttgcgtcatcattttttggtgcccaagttttccagcgtactatgaagagtgctggtagctggccggttttccga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
487 ctcacgtccaattattgcggatatgtcggcggtggcgtgggcgcgtgtctgtttgttgggctattctggtgaacggcaaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
488 tttcattgtttttttgtgccatttccaggtgcaaattcgtgggtattccgttgcccttaacgcttggttgcttcacggcc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
489 gtgtttgttctcccttggccggttttgctgacggtgtgtttctgccaaaagttcgatgacatcagcctggtggcccaacc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
490 ctttgtgttcacgccactcacgtaaatttttgggcgggctccccttttactcactggactttggttgcgccgtttctggc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
491 aagggcctgtcgcacctgaaaaaacccaaatcgtttatatgaatcgtgtttccgctacggcttcctcggtatcatgattg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
492 tttccgctgggtcactaactttggcgtactgggtggtcctttatgtggcgttttatttgatctgtttggtcgcctgggat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
493 ccaacgtgggacgtgggtttgcgtagccttacaggctatttcctctcctctggattttggggggagaggagtttgaacgg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
494 cttatcaccctttaaatcaaccaatggtcaggtaagactgattttccgggcttaaggcaggaagggcgatgttaggtggg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
495 taattaacttgtcaacgatgaccgggcgcaaagagatactgatgcgctggagaaaaaaacatggggcacttctttcagtg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
496 ccgggccgtgaattctggcgcgggattaagctctgatatgcctcagccgcatgaaggggcatgaaagcggactctggtga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
497 gggtgtccatcttcttaaccgattatagccggagcgccacgtatcgcgtggcttcattattaaagccacaaacaactccc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
498 gttgcgaagttggatttctgcgttgtcacgttcacgttaatggaccagattgatcggcttgcgtgaaacccattggcacc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
499 agttttcagagtttttcgcagagcgtattggtcgaactgggttggccgcggaggtggacagtagtctttgcaaaccacca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
500 acaaaaaaatccgcctttcgtcctcaaacataatttgtatggagtattaacccgcgattctgatggcgactttttgctac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
501 aataaaagcgtgtttcaaccctcggttattttttcaatgtacaaacaagctgttatttcctctgctatgctgatgctggt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
502 tttaccgcaagtgggtcagtgccgcgttaactgcccgttatatgcaaaactcatcggaaaatgctgcgggtctgggcgca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
503 aaattggtgacaagatggtgaccgttggggaatcttccgggccgggacaaatgattgccgttgggagcccactgcccgcc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
504 aagttattacgcatttaatttttgtgctttggccaaaggttttatcgataaagttcatctcgagccggtcacagggggcg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
505 acaaaaagttgaaggacggttttggcacctcaaccaagccgctgagtaaaatcagtaaacttagttacctggaaagaata
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
506 gcgccggtctataacgcgccgagtgcgggagtgcgccatttggggtcaactgggccggacaattttgcgctaacccgatt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
507 tttgtcataaactgaaagacaggttcaaatcaaacctggtatcagagtccgttattgggccggatcgctgtgcctctatc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
508 agcggcactggatgccaacccgataatggccctgtcggtgcctaaacctatcaccatattcttgcgcgacgaaagaaaac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
509 acccgtttttcgccataactttcgacgacacatcggtacgcgctttccaataccagatggctaggcttgcgtgaacaggg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
510 ggatacgcgacactgagcatggttgcacgctggaaggctacgtgaagataagatcaatctccccttgcgccgagcggtgg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
511 tggaaattaactttgatggatggcctgcaagtcggtgagccgctatgcgtatcctgtgttgaacaatatggccaattgaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
512 aaggcgacggggcgtttaattgtttacctcacgcggtatgcaaacgttccaccgcagaaagtggaacgccaaaaaatcgg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
513 ctcgccaatttatgagcgtttttctggagctaacgcagaacattccgcgatgtatttgctttcagtcacctacccatttt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
514 gcatcggggtagaatggtttatgccgacgccccatattactgagagccgtagtgaggccacaataatttctggtttgatt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
515 ttgcaaccgttcacgccggcgctctggcgcaaatttaaatccgcatgtctggtcatctttccgtctccgtttggcggaat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
516 ttaaatgacagacgcgttgaaggcagcaacgatgccaggatttttcacctggcggtgacaacctatgaaaggccaagtaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
517 aaaccggggggtaatccgttgttttactaaaacgacttttaatatcttaagaacgggatttcgctgtgagacgaatggtt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
518 cgcggctttggtgagtaaccagccgaagggataacaatccagcaacctgtaccccgggaaaaacaaaatcgctttcgcgg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
519 tcaacgttttcatttcattgtcggccttcaaatagcggcgacgttgggttccgcccaaggtgcgagcttcttcatctggc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
520 atggtaacgaagcctggcgatgatgaaccaatatgcgccgacaactggcgcaagtgggccgccgcacggttacagaataa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
521 ttcctcgaccggcggttctggccgcgatggcaatacaggttgggagaaacgcttggcgcgttggtgacattccagatatc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
522 aaaatggctttcgttttcgagaatacccggctgcggtcaagataatcctggtccatgggcgcaagaacctttccaatagt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
523 gccaggtccgcatgagtcactttcacgcggtggagtttgcccctgagcatcgtgcgaatcactgaacttctttacctttc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
524 ttaaccctgtccgttaacgaagcaggcgatgccctgctttgcggaaattctcacccgcagtaattgccccagaatttttt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
525 gtttaggtgttactcatctgacggcatctttgcgtcagcagtttgcgttaccgcgccgaagcgtggcccatgtatcgcct
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
526 gtaaacgaattgatatttcttctggaacgctgctcggtaaacaataaagaggtggctgaacgatagcgcgcccgttgact
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
527 ggattactgccctcaacgcaaagccacacggaagtaccgggaagaatggatcgccatcgagtacccacaccgcatgacgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
528 gggtatttaaaacaaattttttaatggcatgcccggagacgggctcgcggactttctggagatcatttgccagtgggaca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
529 ttacgcgaacttttttgtgacctcacgcacgctttcattttaagagtcggggagttttcatgagagagcctgacaggaac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
530 acagcaagcggaccgtgctctattccgtgcaaaatgcagggccatcccgggttatctgcatgttgtgattgaacacaagc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
531 aaagcccggataagaaaatggcctttcgcctgattgcggttttattcctatatgccgccatgcaccggcaaatctggagg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
532 cttgggaccacgcatagctgccgcttggtggtgccgatactgttttaatgcagggcgaggccacaccttaatccgctatc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
533 aatgtgctggttttttgatatgttttacccttcgcctggagcttggcgcgacggcgtctataatacagtccctttcccgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
534 tgggtggatatcacccatcacaccggatggacgaaatcattgcaacatcggcggattgcgattcctcgaactactgcaaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
535 aacatatcgccagcgcgacttaatggttattgcttgaaagcaactgtcacgcgctgatcgacgaaagggtcactagcgga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
536 cgtcagtttcgtttgcatgcaaaactatattgctgcaacgcgtcatactgaacaagccggatttgtttttaggtgtgttg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
537 aagagacaggaaacgggaggggagtttccctatgatgaacgctggcgcagtggtttggaagagaaagggattgggagaag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
538 gggattcaagcaagggaagaagaagtaagtcaggaaattcgccccagcgtcttctgagtaaaggacatgtccgggaagaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
539 acgttgcagagatggcaaatttacctcttgctttgagattgaaataaggtaattaaccttattttaagttaacctggtgt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
540 ttaatgacaagatgacggtgggggtaattaataactgcgcatcagccgtagcgccagttaagtattacgcccgctcgaca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
541 ttttgttgtcgatcaggcgagccatcgcccagccaggcggctaccatgaattactgccgcgtttgctggttttcagtaaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
542 cttcccgcaatgtgtcggcacgggcgaatctgaatatcatcggcgcggaaagcctttttccattcagtttcttgcccgca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
543 atggtataatttcatcggagatcccgtttccccagcctgcaattttggtcagcaactccgaacttaaaaacttttgtaca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
544 cgactcaggcgcattttgcgttgtttttcgccgtcagaataaccgttacgggaacttagcgccagacccgtcttttggcg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
545 gcggcatattggcacaccccgacaattcaatatcgaagcccatatcgcccaccattttgcgcgatcagccggcccgttcg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
546 ctgaaaactcctttttcacgacagcaggcgattgtccggctggaccaggttgaaaacagcttttggctgacaatagtccg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
547 aaacgccgccgaaactcggtcccggacggctggcacctttcagcactggtcgaaaggccaggaacgtccaactggtaagt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
548 gtggggtttcaagtaaccgtttcgggtagacatctcttgttttaccgaaggggcgaaactaaatcactttacgtttgtct
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
549 cttaagcttccctcgcagtcctccctgcaagggtccgtggataacgagccagaatcttccgggccggtcgaactgcaaat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
550 cgggttaaacgaaaatatgaccgacgaccaacatcggcgcgggcttttttggcttcgtcgaccagctttcaatatggcca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
551 gatcgtcgcaggtttacccctggtaggtccccacccagcgccacgcgcatttgctctccatacgcaggccggcgaaattc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
552 tgctggacgcagcagcggcagggtttccggctaattaacacacacgctgactccttaatggaaatgtgtcttcgcccgga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
553 taaaccgccgggactccccacttcagcgcatcactcatgccgcacagcgcgcgcggatgtcgcccgtcttccgggcgagg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
554 gaactttttaagcgaatctttagaaatgtgacccgccggttaataccaaaggcgtcgtgcatccagaggatctgcccccc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
555 gtcagtgaccgttgcctggcggccaatgccataccgggaatcgcgccagtgctttccggctaatcacgtctttgccagtt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
556 caaccgcgcacgcaattccacgcaccagcagcttgtgcgcccagcagcttctaaggctcatggcaatccgctgagcagtt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
557 gatcgccccgcttcacatcggcccggcgcccctcgacactttcgtagccaccgaaaatattcactgactgtgggtgttta
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
558 acctaaagtgaccacatacaggaaacggcacgttcggtcagcatttgtaacggttttcctaccagccactcaccgcgcgt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
559 tcaattcttgaccattcgttttagcaccggcaacgcataaccgttgcgttagcgtttccgaaggcttgtttttccgggtg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
560 cgtggcatacgcccctaaacgcaggttcagccagcagcagaggcagttttggtgcgcccggcgaccgctaccggggcggc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
561 agtgtggtaaaggcgatatcggcaacggtaactgggcagggtggagtcgtgcctgaaccgttcatgccagcgaatcggcc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
562 caccagcatgacgttaagccctttcaatcagcacaaagagtttggcgacacagctatagtcatacgcggtggattgtcgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
563 gaaacgttttttttcctgttttgtacttcctgacagtaaaggagatgcgtggtcggttttttcatcaacgtatccctgat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
564 aaattgatgttgtgctggtctggcaattttattcagtcacattggttgggggcaatgatttatccgtagcagcactgcag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
565 aaggtgaacaggtgctgctacgttatcagggataggttacctggaaagtactggtgggctttttaaattccggccggttc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
566 gatagcaatattcccaggtccttgctttaatgttgccgtggaaatgaagagctgttgatgttgccgttaccttgaattca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
567 gggtaacccatcgggaggtgtcccatcttcggtttcaataatctctataacagaattcgtatcatttaggtttttaatgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
568 tcattagcgggatttttactggttgctaaacccttcaatgaaggtacgccagacgccttttggcggcagtgggcttcagt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
569 aagcgtattaaccagcagttgtgtggtttgaagtcctactttttcccagtgacgaagttttttgtttcaatattccacgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
570 acacgaaataccaaatttctgaagtgcgagatatcaaagggaacaggttgaagccgccattttttaattgtccagagcta
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
571 tattctttcccattctaaccgttgaatcctttgggactgatgggcccggtaagtatcggaggtaaaacatgcttggtaag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
572 gtttatttgtacattaattcagtgtgaaattggacataaatgttggttgctgtgatcttacaactctttgtaccagtgac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
573 cctgtaggccgcttaaacgaaataaacgtaaatttgatgactggcatacggactttgctgatttaagtgtatggatcgaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
574 cactctaagtatctgtataaaattcaacagttatgtttgtgtatataatccaccatccagcccaaaacttatcgtagtcg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
575 tctgcctttggttgcaaccctttaaagttgtagactcgctgtctgtgacgaaaaggaaaaattcttgagtttggaaggat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
576 ctcgatatcagaaccttcctgggcgtcattgaaatgtcagtctcctacttgtatcggtacaatgcagacggcagacggct
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
577 tgatattaacattggtgtacatacaggaccatggaaccgatgttctaaataagtttatgtccccgcccataaatctttac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
578 tgaaatcgaaccaatggcattttcaatagttattggaccaggattcgccttcttgccagatgctattgcagtagatccac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
579 caacacccgtaaaacctgtatccaggttatgaccacgtacattttttaccccagttcgggcgcgggcctgcgtgggtttt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
580 tataaaaaaccaagttgcttgctgttgaactgtgtaattaaaggtccatctgtgcggccagtggaggggcctcgatagtt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
581 atcaaactgcctgcattatttcccacataaaactttgttatatgcactggactgtattacaaaaagaatacagagtgcta
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
582 aaaaaagaatgtacctgaagatagtgcctttcatttttttaactccaattgtttctttaaattgatttactggttttggc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
583 gcctgtttttgtttttgttattcgtagtaatatcactaacacaatggctcataagtttggaccagatgtacacactcata
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
584 tgcaggatcgatttttgcatttcgggtgctacattttcaggatgaaccattcatgtcatccgcacattaactggatacag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
585 cggaacgagattcccgcctgaagcagtttaagaacattgaatgttattcccgccgaatcctgaaagtagaaaatatactt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
586 actcctacaattacttggctcctgacgaaaatttcccaaattttggcaaataaaaaaaaaaaaaaaaaaaaaatttaatt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
587 tgcctagagcccagcaagcgaatgacacgtaaggctctaaaatcaataaatatgtaactgattattagcacatgccagtt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
588 ttccctgtaatgcagcagtccggatacagtgcatagtgactcttttccacctggttgatcactttcaggagtaacattac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
589 gctgaaaaattatcccacccaagacgccaagatcaatattacctggttactgatttccgcttttgcaggtggctgttttt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
590 ttacattgggcaaacaaggtccaatatcccctgtccagcaatggctggaccagggggcgatgcaaaaaccgtaaatttgt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
591 aaacagaattattctcttttcattcagcttaacgtttgagtgggattgcattttatagttcctgaatctgttaagttctg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
592 gttagtttataggtttaactgtaaatgtggcttggtgcgaaaacttaccgcggcagtgacattgttttacggttttttat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
593 tttttctcacgaccaggcgtgggcac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
594 >m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/133/0_5390 RQ=0.875
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
595 gaggaaaaaaaaagggagggaaaaaaaaaaaatttttgccccccaaaaaaaaacccagatttaaaatccccaatatcgtt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
596 cccggcccaataaagggggttagagttttggcgcgccggaataccactgcatttgggggccaaagaatacagacctggtg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
597 ggggttttagaaccacagcggaggaacaacccgtagcaggatcacctgaagctgggtccaagattgcgcaacgaaatgcc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
598 gtcatcgttggcgagggtggtaatcaaatcgccgccaatgcgcgcatcatccttttattgaagattatttagggttaagg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
599 ccatgggtaggatgaggcaatttcggcgttggaatccagtttcatctcttttgttgtagggggcaacagcgcctgaacga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
600 tttcactggcaaaaggccttcaactttggcaagattgatggcgcgaatctccggcaacacgatgagtaagaagacagcgg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
601 gcggcagcagcctgttctggtgataaattggcgtcaatctgatccttcactgcccgtgcacggctttctcattttcgaca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
602 acggcagcgtgatgctgcgataggtgacgggaaattgtgacattactgcgtgtctaaatacgcgtccgcagtttattgcc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
603 gtaccatcagaaatcataaaaaacgtggcgatcaaacagcatttatccattttgttctttccgtggatgcagaataattc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
604 tatgaaagcataaattaaaaacgcacagaagcgtagaacgtttatgtctggttttataaaatgaaccttcaaattttatt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
605 ttttatgaaaacagcctttattttttatggttttcgttttataccgatggtttaatgtggaaatttgtcgaagagagcag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
606 atttgcgcaacttgggatcagtcttaaaaagttaaaaaaaatatattgcttgaacgatcaccgtttttttttccatgccg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
607 gttaaatatgcaaagtaaatggcagaaatgtgtttcctcaaacccgttcatttatgcacaaaaggaattgttcgatgtcc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
608 aaccaatggcttcggtcaccggctgtgctttggtatagaccaactcggcatgaatgatgtagacagggtttgggggcaaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
609 aatgcctcctgggtgaaattgaattactaatctttccggaatgggtgtttccgttccgggaatggtttccgccacaaccg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
610 ccgacgcgttttaaccagtttctggacccaagcggcgtaacccagcgcattttatgaagctgctgggataaaacggatta
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
611 ttgacgatgttactcagcttgcgaaagcggcgcgcaaatccgccagtggattatcgacatgcccttcccagcctgagctg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
612 gaaaaacgccatccgcgaagccttaatgcacagctttccgccgatgacgaaaagcctcttttgcgtgggcgctcctccgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
613 caccggcagaagcctatgccgggacgcttcttttgccggtcaggcaggaaccttcctcaacgttcagggttttgacgcgt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
614 tctcgtggcagtggaaacatgtatttgcttctctgtttaacgatcgcggccatctctatcgtgtgcacggcagggttgcg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
615 ataacgcgtggtgtggcgctctccgccggtgttcaacggatggtgcgctctgacctcgcatcaatctggcgtgatgttct
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
616 ccatctgataccgaatccggctctttgaccaggtggtgttatcaacttccgcacctggggcctttggggtgagatggtcg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
617 tgccagggtgcggtttaacccggatgagttttacgtgcataaacgcgacactggcggcgaatcgcccgctatgtgcgccg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
618 ccaccatggggtgcgaaaaacaatccgcatggttgtacgccgcccgacgccaggagcaccggcaagcaggttaaaatcga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
619 agacgtaccgcgcaggaacagcgtgacatcttctcgctgaccaacgaagaagtgcaaggaacctgcaaaaacaggccgta
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
620 caaattgagaaacactacggtcgccggcgatggatattagagtgggcgaaagatggccacacggtagaactgttcatagc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
621 tgtgcagcgcgtccggaaacgcgtgcgctcaccgcggtccaggtcatggagcgttatacgctgcaattcacagggtaacg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
622 ttatgcgccgacggcgcgtgctatcggtcatcgcatgcggtgcggtctgcgggtgacagtcatccatgacaataggcgaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
623 tgaaccggcatcgaacctggcgacgtgctggttactgacatgacgacccggactgggaaccgatcatgaagaaagccatt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
624 cgctgccaatcgttaccaccgtggcgggtcgtagcctgtcacgcggcgatcatcgctcgtgaactgggcattccgggccg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
625 gtagtggctgtggagatgccaacagaacggatgaaaagacgtgagcacgtcactgttttttggtgccgaaggtgataccg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
626 gttttagcgtctatgccggagttgctggaatttagcgtgtaaaagctctcagcgtagaaacgatgccggatctgccgttg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
627 aaagtgatgatgaacgtcgtaacccggaccgtgctttcgtacttgcctgcctaccccgaaaacgaacggcgtgggccctt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
628 gcgcgtctggaatttatcatcaaaaccgtatgattggcgtccccacccacgcggcaactgcttcgaagttttgaaacgat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
629 caggacaccgcgttgcaaaacgaaatcgcggcgagatgaaatggaaaggtttttgattctccgcgtgattttacgttggt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
630 cgtctgatgaagggaatgcgcgaacggcttggtgccgcgtttttatccgaaagcgcgtcattgtccgctctctgatattt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
631 ttttttttttttttttttttttttttttttttttaaaatcgaacgaaatatgccaacctggtcggtggtgaagcgttaac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
632 gaagccggcagatgaaagagaaccgaatgctcggcttccgtggcgcggcgctatgtttccgaagcgcttccgcgactgtt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
633 tgccgctggagtgtgacagcagtgaaaagtggcgcaagcgacatgggactgaccaagcgttgaaagatcatgaatcccgt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
634 tcgtgcgtaccgtagatcaggcgaaagcggtgttgaagaacttggcgcgtcaggggctgaaacgtggcgagaacgggctg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
635 aaaatcatcatgatgtggtgaaatcccgtcccaacgcctttttgctggccgagcagttctcgaatatttccgaccggctt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
636 ctcaattttggctcaaacgataatgacggcagctggcgctcagggtcctggaccgtgactccggcgtggtgtctgaattg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
637 ttcgatgagcgcaacgattgcggtgaaagcactgcctgtcgatggcttatccgttgccgcgaagaaacagggctccaata
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
638 tgtcggattgcggtccagggtccgtccgaccacggaagactttgccagcatggttgatggaaagaggggaatcgatagcc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
639 tgtctctgaacgtagggcggacaccgctggtgcaaacctggttaagcctggctgaaactgaagaatcaaaataaatcccg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
640 ggcggcgtttagggtccggccgggttatgctgatccctcgaagatgaaacttattcaatctcttcaacagacatcctgcg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
641 ttaaacgccgcataataatcttttctaaaaaacttttgtattttacctgaggtagtttcgcggtagttttttttcgcatt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
642 acaacgatatgttccaggataaatttaatattttgcgacccgtttacggctaaaaaagccactactcttccagcgataat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
643 gaaatgatgcggcgctttcagcacgacataagcgcaatgatcgttcacgctaaacgttcatacgagcatgtgcaaacgca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
644 cacaggcatcgtgaatttttagattgcattgcaataaaatatctttccacttcaacggcttgctaatattttgccgccgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
645 ggaaataatatctttttgcgtccggtaaaatttttattatagcccagcctgcatccatacggcagagatcggccgctgta
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
646 aagtaccagcctctatccagggcacgggcggtttaattcaggttcatcaaatacccataaacacatttggggccacgcga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
647 ggcttcttcaccttgcaacctggcgcggtaaggtcttgcgtgcggtcatcgacgcactttaatcctctgacacctgcggc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
648 aggccgtaacatcggtgtgcataaagcgcgacaaaggaatgcatgagattcaccacccgcatgcggcgaactttctgtgg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
649 aaccataaacacttaatcaatcttaatttgcgcggctgctggcattcacagagcgcgccactttttttggggattgtgtt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
650 cgccgcaaagaaaggaaacgcagcgtgaaggtccgcggtttgtttctctagtacattcaaaagatcatagacaaacggcg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
651 ttgcgccgagcatacaggtggcaacggccttgctgctcaagccagcgcgagacacgcatcagggagtgaaaatatttcta
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
652 acaacacgctgcgagcgcaatttaagaatggtgccgttacggcatgagaaagcccgttggcgtgaccataggtggcggca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
653 ggcatcataaacgacatctgccaggtcagattcagtcgcgcgcaataagcccgctgcactggcgagaatattgtttatgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
654 gttagcatcaacgccctttggcagagcgcgctcggtccggaggtaacagcacgcaagctaatcgatcgccgtgggtgcgt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
655 tatcgccgtggtcccagtgaggtattgtcggcgtatatctgacttaatgagagggaagaggtggcgggaaggcgcagttt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
656 tgttcacgccgacaatttgtttgtagttgtgaagctgaattttgcagcgggcaggattaaatctaccgtgacgcgtttgt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
657 tttaaacaacgttcggtggcaaagaacatttttgcctgaacttattgaggcacccagcaccagttctgttcccgccagga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
658 aggcaacagcgcacggaaacttgcaccgaattttcagggcaggcaagatagattaacggtaaattcacacgcagccaggc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
659 agttggaacctgcgatgcgaatcgcctgattcatatacctcgctaacatccagtttgccagacaagctcgcggcgtgatc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
660 gagcgcgtatacgtgtaagatgcaccatggattatcgacaggcaattttgtctggcaatcgcacgagcggtctgctgcag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
661 taatccggccagccgaagcatcgccccataaccttgcctgacgatacgcacgcacgcgcgttgttgttaaacgtgttatg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
662 tcactttcatgttggagctctcgaaacaga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
663 >m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/161/0_1549 RQ=0.800
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
664 aataccacacgaccccaccgtccaaaggggaaagggggaaaagaggaaaaaatttggaaaaaggttttgtttttaagccc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
665 gcaggcccgaattttttttttccttgggaagattgggataaaggggttggggggggaccgccaacagaatgctttttcct
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
666 ctggtttagatagaggctcagccgcggcggtttggttttccccttttgaagaaggcggcacgatttaactgaggcgttga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
667 tgtaatttccgtctgcacagaacttgccctttgtcggcaaggtaaactcgctgagcgggtgaaccaagttagtttttggt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
668 tcgctacgggtgtggaaaaaatggtttttcaaggaggagtcgacaagatcccttcaccttgttcagaatcggatttgatt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
669 tttgaataggtttaagtcgatgtgcacggcatacgggcagaagatgaacgttcgcattagcgcggtcgtattcaatcggt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
670 tcgcctgcacatgtccggaacaggcagggccaccagcgtgggcaatgaacggccgaagggtcgttcttttttacagcggg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
671 cctagaagggacataacacagcgtgaaatcggggtaattcacgggtattgacggagattagcgtaaggcgaagacagggg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
672 tttcgattacaaccgaaggaatttttacagccctggctctggccactaatggcatgcctgatgccttgggagggtggcgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
673 agtggcagttctggtgattacgaacgaccgggcttccagcacgcgcgcttaggtttacgttttgcgggctgaagtagcgt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
674 ggggttagggcggacaaccagcttcaacgatttcaagaaaagcagtttcgtattaagccggtcatcattttttcaggatc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
675 tgacatcgacgcatgcgtaatcggtatttcccgtttttaaacctgcaaatcatagggtttactcattggtcgcaacttgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
676 aaggttcgtctctttttgtttgctgatgaaactgactataaccgaaggtaatatctccagtgccgccagtaggtagatgg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
677 cacaaacctgacgatcattattaagactttctttagatgaaggaaccgtacggcagtgttgatgggcgtcaagaactctg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
678 actgatgcgttaaaaaattgtttcgccgtgggtaaggtaagtttgctttccctgacgaacacggctcaaaaagcgagcgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
679 cagtcagctgctcagttcattcaatgtcttagagagcggcaggttgactcaaattaaaggtttcaggccggcgcgcccca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
680 aggttcttgttgtgcgacagctacgaatgtatgaaggtggcgcaaacggtgcgtgcgtaaacgactatttttttccataa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
681 gcgatgttctttaaaaacgaagcggtgtctggctgacaagttgaagttgttttgattatgataattgattgcaaaatatg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
682 tttgattaacaattaagcaatttatgttaagcaaatggataatattgatgttttcgcggcgagatcacgtttgtaaattc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
683 ttccgcggagccggtggaatgcggttata
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
684 >m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/183/2813_4499 RQ=0.884
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
685 cagggctgtaacccttcgaacccttgttcaaggtgaatgtgtgcgtcgcaagttttaaggctttctcggacggaccgagc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
686 atgccacgcaaccgcggagcgcgcacattcttgtgtatgaaatatgcggctcagggactggcccgcttgcgaaatctcag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
687 agaaattgttgtcttcacggtttactctaccacagtaaaccgaaaagttgtcatttcaaagttttgggttagttttttcg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
688 ggtgagcgacgcgtgttcaagtaacgcttgtttctactggtcctgctttgcatgcatcgcgaatacgctgtttcgcatac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
689 cttgccgcgtagttcacgatctttgctttttcttgcgctaactcatagctgatattccaatgcggcaatgaagaccaact
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
690 gttcagtatttgtgactctagtggcgttctttcagaatcttgcaaccgttggttcagatcggtccgctgggccttgattc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
691 aaacgcaatccgctttggtcaggcgggcagttcaacgcaagctgaacggccaaaaatttgggatatggacgggttgtgca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
692 gacattgcgcaccttcctgcctgattgactgcgctgcttcgtctttaagacccatggtctgcgaaggggcgacactatag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
693 ctacccctgatgagaagagacaagcccttttcctggtccaccagggccaaagttggtagcatatcatgaatattcctcct
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
694 ttgacgacgaatgctttatgttctatacagaacgaaaatgctgttacaacgaaatgaaccagtaatctgaacgcaacagg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
695 gacgggtctgacccagctgagatgcatggtttaatcagcgggatgatatgtggcggtaacacgatgacagctcatggcta
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
696 ccggctacttcacgaccctgacggaaacgaaggcatgggctttcggtcatgagctggcacaggcactgcgttaaaatgca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
697 ctggctgccaccagcgagccctgcaggaatggaacggccttcctttttcagctttatcctgcctgatggcggattgatgt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
698 cagcgttttcgatcggctgaatgcaattggcaggtggtcaatcacttcctgcttggtctttggcgtttacgcaaccggaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
699 gctggaaataaagtgacggcgaaccggtgaagctaatgcgacgatgctgcgtaaacatttgcgcaactggttacgaacga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
700 agccgaagatcaggaagagcttttgaaatgtcgcttgaagagatcatcgaatagttcgtgttgccgtcgctgttatgcca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
701 cgacacctttaactcatccgcaaccgacggcgcgccagaagtacaaaaaaccgactctaactaaaaaaaaaaaacgtaag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
702 gagagtgttatgagtgagattaatgccggcaagagtttcatcgtcgccgtcaggcgcctggtggagcaaaatgcaaaccc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
703 ggcagcgccgcgctgaattttttgctgcaccagaagtaacagcgtagcgccgacgcgaatacccctatctgtcgaacagt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
704 gacttctggtacttcaaccgctttacgaaccggaagcggtgctggtgctgattaacaagcgatgacactaataaccacag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
705 cgttctgttttaacgcggttccgcgaccctgacgggcggagattctggttggccgtcgcttaggcgcaggatgccggcgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
706 cagaga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
707 >m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/272/5687_16279 RQ=0.849
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
708 tagcgtgatatcggtaagcgcctgcctgcgcacatacctgggcctgcagattatcgacttgagcgccattcagggatgaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
709 gtcgattcctggttgccgcctgacctgacgccgcctgtccgaaaccgcacaggctgaacctgaagaaggtgctgggttcc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
710 agtcccgacgtgcgggtggccgtactcgtcccaactctatcaatggcggcgtttctccgtggaactacctgctaatcgtg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
711 ggtacgcggtagcgtcacctctcaggtgaaaaatgacgactatctgattctggaatgccgtaaaataatccaggtttacg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
712 tcaatccgaacaacgaagtttattgcatcaaacatgcgcgcttgttcaggagcaagtggctttctgaaaaagcagagctt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
713 gctaaacctgaagatctgccagcttattacgctggacggtcaccaggtagaaagttatcgcgctaacattgcgtagcggt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
714 tttcgtgacgttgaaggtgcagagcgtgaaacggcgctgaaggcgttggtctgtaacgatcgtactgagttcctgtttca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
715 tggacgccgacgcactgcccactgagagaagcagtttttgctgcttacaaagcagtggctgaagcgctggtggctcgcac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
716 gcgtttatcgtttcgtacatggagcatcggcggcggacaaagacgctgccatactgaacttcccgaaagagagaacccgt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
717 ttcctcggctggcgcgctatccgtatgcgatggatcgtcagagagatccctgcgcgatcagctccgcgctagatccgctg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
718 cgtgcctcggcttttcggtaattggcggcattatgtttcccgatggagtcatatctggtttgaagaaagtggcggtgcac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
719 tgcgcaagagatcgaatctacaaacaggaactgcgcgacgaaaggtaaaggcgtttgaaccgagtcattgaaaatcgcgt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
720 aaatgggttggagaacacgcgcggctgccgcaacaattgcacaacgtcattgtagcacaagaagttttgatttcttttag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
721 tatcaggcaccaaatgatttaacgggcagtgacacctctcggcagtttttgacccgtggtaattgaattatgatttcaca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
722 ccttacccagccaaatgtcacgggtccgtgctgaacttgatccagcaagtttttattggatgcttcttcatgctgaaagg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
723 caaatggaactggcatgtgtggtgacttgctgcgcgatgaaacgtgctaccttctgttgcctggggatgggtgctggacg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
724 aattctctatgagcgccatgttctacttcccgcgcattaaggaagattatcccgtaacacgaacttcgaagaatgcgaag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
725 gtgttagcagagcaggcctcttgctccaaaccgacaacggcacgagttttaatgacgctggttaacaaggttcattgaag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
726 aaaaagaacaatctgctatcccacgcaaatgccggcccaaatttactgcttaggagaacgactcatctggtttgttccgg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
727 ataaactggaaatgctctggttttccggacggaacaagaaggataccggaactatctgagatcattgctcgcgctctttc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
728 tggcgagatttaggtcaatatcgaagacgtgccggatgtcgtttttagcggaaaaaaatcgttggttgatggtattgcta
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
729 tgcaacgcaacggtaacaaatggtcgcgccagtagaccggcaccattggtaaaatctttgaaacgctcaccacgcatctc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
730 tctactcgatctggatagcggccgttggaactgtttcgtcacttcggtatcgaacccggttgaactgaaggcgaaggctt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
731 caagcgtattgctgcaagaaggtcagcgcgtgacaagttggcgatactgtcattggggaatttgatctgcgctgctggaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
732 gagagaaacgcaagtctccctgactaggttgttaatctccaacatggacgaaaatcaaagtaatgaacctcaaactgtcc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
733 ggtagcggtaaccgtggggtgaaaccccggttatccgcatcaagaagtaaattcttgccggcagtgaaaataatggccgg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
734 cccatcgggcgccattttttttatgcttgccgccagcgcgggcaaaaatcaattcatcgcctcctcatgctgctgggtgt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
735 agcgcatcatttccagtaacgcgcaacgcccgctcggtggcaactggcagtcgtgttaacgccgcttcccttcagcaggc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
736 cactgatgagctgaggcacaaacaggtgcgcccagtgcctttcaggtcggtttttttagcccgtgaatgggaaagtgaca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
737 gttcaccgcttgtcggcagtgaccaccgacaacctgcattctgattttcttcattaccggaggcgctggtaaccacgcac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
738 ccatcttaaatgtgtcgacaaagcagaacttttgcggcagcaattggcaactgtcgagctcggcgggcaatttttaccgg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
739 tccggattttccaactccaaagatttataggggggtaattcctgcgccaggcggcagttaaatattgtggatacgcttcg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
740 ggggaagggtcaggtttgacatagagaattgccggactatcgaattatcgccaatccaccggatccgacgcatgagtcgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
741 aataggtcaggatgtgtctttgcgtagcgcagtcaggccactcgccaggattttttgatttgcgatgcggttcccatata
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
742 gcccgttggttacagcacgaagttggcgcagcgcatgcacgctcgctgaaggcgcacgcaaataggcgcgctaaactcat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
743 tctgtccggatcggcaccaccggtagaaagtgtcataatgccggcggtattgctcacaatacgtcggcaacggcaaaggg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
744 acatttcagggcgtttctgttgatagcaggcacggcaatgctgttgcccacgctggccgtaaaccacctggactggggca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
745 cggcgacgatatccgcctggcagtgcctactcttatcgttaaacaacccacaactgactcatttaattttttttctcctt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
746 gcgatgatcctcatcgtaatcctaaccgaaactttaccctgattctggcaagtcaatttcggctatcacaaaacaaggat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
747 aaggtaattcaatgaagaaaatcatttgtctggtccattacactactaatgacactccccgttacggcgagtaactggtc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
748 ccatggaagaagcgcgcatcaacgcccatgctggagggattagcacagaaaaaggattagatatttgtgcgcacggcgtg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
749 ctgaacatactgctatgaagcggtttctcatctgcgtctgaagctcgcataccgtgaaaccggcattggcacagctgggg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
750 gcgagcaagtttattgataaggttgcttcgtcgtcatcgaattactggaagccgtatattgtggaagatccccggtaaga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
751 gcgatgagaacgcacagcttttttacatgcgttaaattgcgcagacggataaaacggtgcctgtcgggaaggaaattaat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
752 agcgccgcttgtgggaaggcaatttttacaggaggtaacatgaaaaaacgctttatttatcacgatgaaaaaatcgaata
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
753 aattttttggtggatagattacgaagcggggatagtttttaggctgtcaactatggaaggaataaaggtagtattggtag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
754 attccagacaaagcagttcgggataattgaagaaactacgtggttggaaaggaagcgcaggtaatttgggattgcccgca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
755 aaaatgaagaaagggctatcaagaaagatccaaagtttaactcattggaatcggctactattttgatgatgacagaaatt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
756 tggagccttcatgttaaaacgtcaacacaacttccagtgccatttttactgactccactttatatgtgttgctgggatga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
757 agaatctccttttttgggcaagcgattgaagggtggctgatgctcgtagaacgttcttgagaataagcctcgtaagagcg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
758 gatctggactgttgctgattttccctcaaaatgttaattgaaactatgtgggtatgaatacatcgctctgggacagtatt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
759 cttggaagaggatgttcgttgcgcaattactagtgcgatgaaatgagggcatatctcgcagagcaatatgattaccttac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
760 gcaactgccattcgtccagattaaagtcatgggtaaaatctccgcataaacttaaaaagtatgggactcaatcctagcgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
761 gtccatcagcttacgcaaaaatttcaatggggtgacggttcaggaactgcaccatacttcaaaaaaattgattgatgacc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
762 ttaacgggcgtttccggtcacgaaaattaaatactgcattctgtcgcagccaacaactgttaaaaaagtgcgcctttgtt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
763 ttatgccggatgcggcgttaaacgcctgtatccgggccctacaaaatcgtggctaaattcaatttattattggcagaacc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
764 ttgtaggcctgataagcgtagcgcatcaggcagtttgcgtttttggtcattagcaagtctcgcgaatgctattaatctta
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
765 atccccggcccctggctaaaatggctcttccgcaaacacacccggtaatagaaaggttgcgatcgccgagcgagtcgcag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
766 aatgatcgccaccaccaccgcgtcaggcgttagctttttgccaacccgcaggtgggctcggcggcaacgcgcgccgcgga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
767 gctgacgccacagtaatattcttccgcacgccgccagtttcgcgcatggtgttttcgcatgcgcgctggatgaataatcc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
768 agcacctcatcacatagagaagcgttgaaaatccccggcaggcatattccgtaggcctagcggccgaaatgccgggcatg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
769 ctgctgggccctcttcgcggttgcaaggccggacacatggcacgcggtttgaattttgtttcgcgggcattaaagcgtga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
770 gacgccggtgataggtgccggtcgtcccatgctggagcaaaatgagtgatgggcccgccggtttgctggccagatttccg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
771 gcagttggttggtgtaatgcgcataagggttatagggattattgaactggatcgaggcagctttccgctttcggccacga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
772 ttccgccatcttccagcggccagatcggcgcgcccttcatgccctggctcttttggtgacaagaatcagtttccggcacc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
773 ataagccacgcatcgccgacggcgttttcgctggctcatgtttgtcgggcatcagcaattatttcatgcgataccgcctt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
774 tcagcgcgtgcaatcaaattgccagccgcaatgccgggtgtggaccactgtgggcttccgattaagaccatcaccccggt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
775 tttatatttccccccgcgcttttccgcctcgacgatcatcgaaatggccggcacgatctttcaccgaacctggcgggtta
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
776 attgccttccgtttttaacgcacacttcacttgcggttatccggccagcccattcgctgcaacttccatcgcagaggcgg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
777 tattggcctattggtttgttctaatgtactcacgatctctatccatacgtttggtgttgcctgatggcgaacgcttgcgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
778 gttcttacaggttttacaggttacaaaccgcttgcattaaaaaagcccgggatcgcgggaagcgcctctgggcgttttaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
779 cattcacgtcaactatcaggcgcttgtggcgagagggcaagttcctcatgcgcgggtttcgattacgctcgtccggccga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
780 gtgtttataaccagccggcgctatgttgcagacccaaacgacataaagctcgccacgctgcggggcatcgtcgccatgcg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
781 ggtcacgaccgtcacggattcgtttttaaccacacagcggctgacgcacttaattgggtgtcagtggacctttcgggctg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
782 gcttcgcagttaccctgtaccgggcaagcggcgggatatggagggctgggtacggcggctgagatattcactttccaagg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
783 ggcgcaggaagagatccccgcgccctgatacgcaggtgtgtacggcccagcgcgccgagcgatgcgcgccaacatggaga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
784 cgctgtcccgagcgaatggttccctgcaggcgttcactttcgcccaataaattcgagggcacaaaacgggtcggccggtt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
785 cgcgccatactgattcggcggcggcgtcagcctgtttcaatattgccctgggctcatcaaactaaacacgatccgtctac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
786 ttcaggggtcgcttctttcctgagtccgtgggtcacaaaaacgctgggtgaattttagtttcttcatggagttagcagcc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
787 agcgacgcagctgctctttttagcgcacctgcgattccagcgcgccaaacggttcatgcaagcagcagcatttgcggttt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
788 ccacagccagcgcgcgcgccagcgccacgcgctgtttctggccgccggtaaagctgcgcggataacgatccccagatggg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
789 caaggctgaacgcattttccagcaattttgtcactttcgctttttgatggctgcggcattcgggcgctcggccgacgcgg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
790 cagcaccgtcaggccaaaagcggatattgtcgaacaccgtcaataatggcggaacagcggcgtaaatgctggaacacgaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
791 agccaactttaaacgagatcactgtgcgtgcggcgctcacgctggtgccgtggaagcgaataaggccgcgctggttgatg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
792 gctccagccctcggcgataatgcgcaggcagcgtggttttccccggggaaccggggaccggccgccagcaacgctgacca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
793 tctgactgaaggcaatatgctcagtgagatagtcgttcaagcacctggggtggcgaacaaacgattcttatattgggcaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
794 tcctcacttgctcatcgatgttcctcctgctgtgcgcggtttttgcctgattctcaggcgccactggcaacatacttttt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
795 aaaaaacagggtgataatcgcatcagcgttacagcgcgcggcaggcggtaaaggcgccggacggtgttgtagtcgctggc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
796 tcgcgcagtcaatttcaatctgtaacggcagcgacaggtttttcgccgcgaatcgaccggaaccagacaccggcgccaaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
797 ctgcggccaattgcgcggctgttgtcaacaccacgccataagcagccgcccagcggtatgttcggtaaattgtgacgggg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
798 cgacggaacatctggccagccggacgcccgccaagcaaatcgccgcttcgtcttccctggctgcccctggcttaaacatc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
799 accgcaaccgttcgcgcaccagcaaatcggacacgtcacgaagatggtgaccagcaccatttcccccggccaggagaaca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
800 taattttgcaggttatgctgtcgagccaaccgcggagcgggccgttagagcgtaggaacagcatacaccagacggccaac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
801 cactggcggatacgggcaaacggaatgttcagtagcgtagcagtaactggcgtccagggaagttaaagcgcgttcaccag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
802 cgcaggcagcagaatgccgaaacacacaggtttacgggtacggcaatcagcgcgagtcatcaccgtcagccagatggcgt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
803 gcaggcatgtccggatcggccagattctgtaagaatccggcatgcagccgccttgctgaatgcctgccgaagatgtaaat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
804 cgattcggcgcacgcgccggatgaacgccgaaaccagcatcccgctggccaatcagaaaccatttgccccagttaatcgg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
805 gcgcgcgtcataacgctttcaatttgggtaaacttcactgccagattaactgacctaagtcgcacacgcgaccaaagagg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
806 cgactgttgcatagtgttattgagaacgagcagcagcagagatgccgcgaggatcaccgaagcacatggggcgctcgctg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
807 ccggtaagtcaaatcctgttaaaggccgcacaaaaatcatcagcgaccgtcacttccgtcttccgacgcgatctttcccg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
808 gcggataaaaatcacccgcgccaaattcacgcaagactacgggtaaacgaaaggcgccacgtcccgccacctaggcgccg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
809 gagaaagctccggcgagcaccacttttgggggcagaaactcgctggcccagcgcgttgcaccaagcgtttcgccgctttc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
810 ttccatatttccgggcctaacctcttcaggcaccggctgcacggtacgcaccacaaacggaatgctggtaaagccctaag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
811 ccacgcaaatccccagccattgtataggtgactttgatatcaaccttcgccagccccatgtcaccgtaaaaaaccgttta
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
812 cgggaaaaagggagcgagccagcggttaaaccggcgacagccgggttggcagcgataagggtaatatcatcagcgcatca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
813 aagcagcgtcgcggcctgggaagcgataggcgggttagggagtcccaccgcccatcagcagacccgaaaaggattgtcgt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
814 gtaaaaatcgatgccacaaacggccgacaggcagcgttactttgtaggccgcgacaacctgcgggttgtgatcaccgtcc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
815 cagtactgcgccacccactcatctggcaagttgcatccacagcgcgagagcgcgcagcagcaaaatcaggcaccccaaca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
816 gcagaactggtggccggacggcttaagggtaaagcccggcagcacgcgtctgggaggagaaaagcaaacatcgttaccgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
817 cccgccgctaacaggcttgtctaactcgccgccgtggtgaagtggggtttttccatcactttcccggccaggagccaaag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
818 ttgtgtcttccacggatgcggaacagcttcgggtctgcgggaattgtctttcagtttgtcatcacgctccgggttattca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
819 tcgcggtagttatagtcgggtgatggatggtttgcgcctgggggctatagagcatagttcaagataggcttttggggcgg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
820 cttttttcgttaccgtttggcctgcacagttttttatcaaccctacgccaccgggaattccgccagaatgttgttgttcg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
821 gaatcacgcacttcataaagccctgcgctttcatatctgtttacggctgttggttcacttcgattcgaaggctaatcagc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
822 aacaatgcccagccgcgctcggcaaaagtggtgtccgcgccacgacctggccagtatgcgaacactttcaacgttttcag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
823 ggaactgggtcaggtaactttgttcggttttggcctttgtcaccaccgtcagtttattccgctgcggcacccatgccggc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
824 cgagataggttataacgggcgtttaagccgttcgacgtttcgggttcgggaaaagatcagcttacgtcggagcgcaccag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
825 gtcgttcgccaatcgtggatttctttcggggttactccttttacgcaccaggaagcccatgggggtgggagtagaacggc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
826 gagctacttattcggcaaggcgcgactggcagtcggccgggatcagcttgccttatcgtggcaaggatttgtacgtcggt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
827 tcaacctggttataagtgagcatacggtcggcttttaaagccctgtaaaatcgccagcgctgggttttgattgtaccgcg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
828 gcctgagattgttttttatgcgtcagtttgtcgcccgccgttatcttttgcccattgttttggctccaaacgcggcggat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
829 tcagggcgggaagcagcttcggcgggagcgtcataagaacttgtttcaggtgtgcagttgttccgtttgcctgtactggg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
830 ccgccagcaaggcagagataggcgacgagcgcgagtgagtgtcttttttcagaagttaacggggccattgcgcaccctta
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
831 aaaatttaatgactttctacatagccatcgatattttctaacggacgtggaaaggagtaacggttttttaatataccgtt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
832 tggtgatttggaagttgaaaagggatataagaacttggttcatgcaggcgtaattggggttggcagtcagttttggaccg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
833 gggagggaggtctatggcgcggagaaacgcggggagcggttacacattagtacgtgaggattttcgagcactggccgggg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
834 ccaaaatgacaaataaaataggcctggtgaacttagttcaagagacgaaatcctccccacaaatgccagggcaggaaaca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
835 gaggtgaaatcagctacgcgacgctataccgtctccggcagttgttgctgccgcatcaaatacattctgtggctacggtt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
836 aaatcgctggattcatccgatgcgaggaaaggccgcagagtttcgcgacttccagcggacgttcggcgaggcgacgcatg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
837 gattgcttttcggccatttcagtcaggcacgactctggagtcttgtccgggttcgaacactgggggtgcaatgctttcgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
838 gccattggtgtgcgcacgtatccgggcagacatgggcgttaacgcgaataccagactgcgcgtacttccttagcggccag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
839 cgattttggtcaaggcgccaacatcgcggctttcgttaaggcgttacgccgtttcgccagggatcgccaccattatcacc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
840 agtgatctgaagacatgcatcagcaatgcgac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
841 >m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/285/0_21870 RQ=0.859
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
842 gttgggaggaccgaagaaaatttttggggggccccccaaatttctgttttttttccccttgtttttcccttttgcctggc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
843 ccccttgctgcactcgtgaactgctttttcggatgtggcgccatccacagctcggcccaattcggctgggtggacggttt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
844 ttcatacaataaagtttaaagtcaacgcgtttttgctgcgcccaggcatagttttgcactgagtttaatgagtttttttt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
845 tgcatgaaaatcaatccctgtttttaattgtggaaattaatccactattaaagcaagaatctacggtttaagtaactgga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
846 ggcaaaagtcgttactagtcctcagtttttttttgttaaaaagtgtgtaggattatattgttactattgttatcgctttt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
847 tttaacagggcaacggaacaccgcgcagagcaataacccaaacaggcagttaagtggagagaacaaatgtcaaacaaacc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
848 ctttcattatcaggctcttttccatcaaaaaagatgactactgagtattacctgcttaaccagcgccacgttagagtatc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
849 tgaaatttgaaggcaggagatttttgaaagtcgcacccgaagcgttaactctgtgggcccaggcgtttcatgatgcgtcg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
850 ttcatgcttgcgtccggcgcaccaacaacaggtgggccgaattctgcgtgacccgggaggccagcgaaaatgataaatat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
851 gtggcggctgcattctgcgtaactccgacatcgcgggaaaggcgtttctgcacctgtcaggatacgcaccgcgattattg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
852 tttggtaaaaagggcataagcgtgtatggacacggtggtggttgatgaagcggcgctggcgcggggtgtctataaacact
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
853 tatatcgaagataattgcgctactcgcaaaaacgcgccgctggatatgtataaagaagtgaataccggcaccaatctgca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
854 ggcagatcgatctttatgccgttgatgggaacgaatacaaattcctcgtaatcgccaaagtggtggttcggcaaacaagc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
855 gttctctatcaggaaaccaaagcgttactgacgccggggaaactgcaaaattactggttgagaagatgctgcacctgggt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
856 acggcggctgtctccgtatcatattgcgttcgttatttgtggaacttctgcagaaacgacttaaaaacggtgaactgggc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
857 ttcccgcgaaatatactatgatgaactgcaccacggaagggaatgagcacggtcagcgttcgcggatgtggaagctgtga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
858 aaaagaattgctctgatcggagcgcaatcttggtctgggtgcgcagtttggtggtaaatacttcgctcactgacatccgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
859 gtgattcgcctgccaacgtcacgggcatctgcggtcggtatgggcggtttcctgctctgctgaccggtaaatatcaagcg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
860 aagatcaactcgtcaggggattggatcgaaaactggaacataatccagggcaaatatatcccggaagagctgcgcaagcg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
861 ggagaaggcgaagcggtggccgcgttgacattaaccgtccgatgaaagagtcctcgcacaggtttgtcgagtaatcccgt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
862 tttctacacgcttatcgctaaaacggcacgattatcggcggtcgtgatattgtcacccaaactgaaaagagcggatggat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
863 aagggtgaagggctgcgcagtagatcaagatcatccggatttactacgcgggtccggcctaaacgccgggaaggttatgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
864 ctccggttctcttggccaatgggggaagggaggggggggggaggagaaagggggcgaaccgccggacggaatggtatttt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
865 aatgtcgatcaactgcaagcgcagggcggaagtatgatcatgctggcgaaaggcaaccgcagccagccaggtgacggatg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
866 cctgtaaaaaacacggcggcttctacatttggagtatgcggtggtccggcccgctgtattggcgcagggcagtattaaga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
867 gcctggaaaatgtggttggaatatcggaactgggaatggaagccatctggaaaattgaaagtggaagatttccggcgttt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
868 atccttgtggatgataaaggaaaatgacttcttcaaagcagatacaactcacacaatgcacccgctgtgtgaaataaaca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
869 gagcgccttgcgggcggttttttacatggcacgaaagaacaacattttgttatcaaatggtaccataataagtgagctaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
870 aagttgcttaacgaaagcaacagaaaagaaaaaatttaatcaggtgaggagcaggtcatgaatccgtacgcagcgaaaaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
871 gattcgatgggggcgatttgatgtccggcagataagctgtggggcgcacaaatcaacgctgcgcatggagcatttccgca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
872 tttcgacggagaaaatgccacctcactgatttcatgccgttggcgctaaccacagcgttgcagcggcaaaagttaatgaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
873 gaattttaggctttgttgtctgaagagaaagcgagcgccattcgtccaggcggcggatgaagtactggcagacagcaatg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
874 agacgaacttcccgtggctatctggcagaaccggctccggcccgcaaagtaaatgaacatgaacgaagtgctggctaacg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
875 ggccagtgaattactcggcggtgttgcgcgggatggaacgtaagttcacctaaacgacgacgtgaaaaaagcaaagttca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
876 acgatgttttcgacggcgatgcacgttgcggcgctgcctggcgctgccaagcaaactcattcctcagcttaaacctgaca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
877 cagaagcactgaatgagaaatccgtgcttttttgcccgatatcggtcaaattggtcgtactctactttgcagatgccacg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
878 ccgttaaacgctgggggcagcgatttccggctgggtagcgatgctcggcataatctcaaacatatcgaatacagcctgct
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
879 cacgtaggaactggctctttggcggtacagcggtgggtactggactataataccgcattccggagtatgcgcgtcgcgta
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
880 gcaaagatgactggcagtattacctgtgcaaccgtttgttaccggcgccgaacaaatttgaagcgctggcgacctgtgat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
881 gcctggttaggcgcacggcgcgttgacagggtttgctgcgtcactgatgaaaattcgccaattgatgtcgctgctggctc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
882 tgccgcgctggcggaattggtgaaatctcaatccgcggaaaatgagccgggagctcaaatcatgccggggaaagtgaacc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
883 aaacagtgtgaggcattaacatgctctgctgtcaggtgatggggaacgacgtgggcgatcaacatggggggcgcttccgg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
884 taatttgaactgaaacgtttccgtcaatggtgatcacaaatttcctgcaatcggtgcgcttgctggcagatggcatggaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
885 agtttttaacaaacactgcgcagtgggtattgaaccgaatcgtgagcgaatcaatcaaattaactcaatgaatcgcttga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
886 tgctggtgactggcttaacacccaattggttatgacaagcgcgccgagatcgccaaaaaagcgcataaagagggctgact
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
887 taaagctgcgggccttgcgctggggtatttagcgaagcgagtttgacagctgggtacgtgccagaacagatggtcggccg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
888 ttaatgaaagccgggcgttatgctgcaccatcaggtgcagcgtggaatgactcaacgaaggcggctgcgcctgaaggttt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
889 aataacggtgcttgcaattgcggcatcgtaatttaaacactcaccaacgtccggcacgaacgccgcgccattatcccgat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
890 taacagtgcaatcagtggtgtagggcaggcgtgttggacttgtttttgaatctctttgtaccaagagcgcgggaatcgct
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
891 gggcaatccttcaccggacgtttttgatttttaacttcgcgttttgtgggcagggcagcgatatcctatagctctgctcc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
892 agtttttctttgccagctcctcgcgcgtccacggttgcgacactggtggtgatttcaggcttttttcatgctgtgccagg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
893 acttcatcacgatgtaaattcttaatgatattttattagcccaaccaaagcgtaaagtggcggggtcgtgcagaacggtg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
894 gacgtgcggtaagcattaaggtgatcagcccgggcaaatgagatgcaccattcaaacgtgccgcggtggggagttctgat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
895 tcaaccgtgaagatatgctcgaacgtggtcttgagtttattgattgtgctgaatatgactgaccacgctgcttgcgaggt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
896 tatcgacctggtacacaacacgccaggcagacggacagcggccttgctgctgcgattttcgtgactgtttttgaaataaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
897 taaaatggccggaaaaatgacgaagcgcagcgactgcgcgtcgttgccgagatgttgttttactcaatacgattaagcgg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
898 atttgctatctctttttttttacctccggcaaagagaacacgcgggcaacaatagcttgtgttgctcagatgagcggcaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
899 atatagccagcctttttgtttccatctggcgaaaggtagtgttgagtcgtctagagactgtaacgcgcataaatattaac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
900 cctttagttacaacatttattttatagcacgtcggggttgacttgaccattcggtgcgcgtagtgtcaggcagaggtaaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
901 ttgggcggatgtttatgccataacggcagctcaacgagaagcgggcaccaccagtttagctggtgtcacaattacgcgta
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
902 cgaccattgccagtgctatagagtggacaattgcagcccagcccgcagcccgccggttgagacgatccggctggatcgag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
903 ggaacaaaaggtttcaaagatatggttcgcgtttctggggcaatcctgggcatcatcctcaaaattaatgtcgctctatt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
904 ctccacagtagcaggctggtttttcgaacgcgttgaatggcagtacgcagggtcgttattgagcaaattatcagcacgcg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
905 ctccattaagcgcaatattcctaacggccgcataatgcctttgcacgagcgtttttattccgtacgtttttatcggcgtt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
906 actgctgaatatctgccagatgcgttgacatgcacaaggcaggtctgtgttcgctaagatgttgaagctcgttttggtgg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
907 gcgagatcgcgtcgggcataagtcagcagtcttcaattaaagcttcaagttacttgatatcacgaattcaacgcctggat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
908 tcggcggcgctcaggttatcgctcatctccagtcgataacgcaggcgcactaacggtgttcgcagttcgtgagcgatacg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
909 tcaatcgagctgttttttgctggcaattaaggcgttgctatttgtcgccatctggttaaatgcgacgccaagtcgttcaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
910 agtcgaccctcatccaaagtggatacgttcattgagatgcccatcgccaaatcgttgcgggccgctgcttccagttttaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
911 ctatctgccagtggagcggagcatccagataaacaccggaaaggcgagggaaatagcaataaaagcgatcagggcgatat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
912 ccagcaatccgcatctgattggagataataaagggataaggaacaggccaactgccacacgtagtggctgcgcgggatta
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
913 cgctgcaaaaacgtgtactgatcgttccggcgacaatttcgcgccacgcagtcggtgcatggaaatatcaatcaagatgg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
914 tatttactcaagttggcttcgaacacgctagatcgaacgagagatttaaatttcatctctttcagagttttaccccagtc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
915 gtgtgcgggatctcacgggaattcgctgcgcattcagattacagcgaatgttttatcaaaatcatccagcgactgtttgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
916 ccgcgcgttcgcgtaaatttgttacaccaagacaacagcatgagacattcacaaggaagcagacaaacaataacaggtaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
917 aaactggataacagtttttttattctttcgctttattccatgcatgaggccaaaaagatagctcttttgtacgcacagtt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
918 ttttaatgcgaattaaaaggttctgcgggcgtttattcgaggcaagtttttttttttcttaccgcgaaattagccacgtc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
919 acgctacgatcagtccgtcataactgcgccgatcgtaaattttttcagcaatgcatcgcgtccatgattttgcccggcaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
920 tggtagactttaattccacaataattcgaaatcagctttgtctttagagcgagatttcagtgttagacagggtgactacg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
921 cggtattaaaaaaatgatgggatcgaatgtcaacgtgccgaaaatggcgggcttttggtagggagtcagagacgtttccc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
922 ttgaaagacttttggtcagtgtgggcttgctcattcttgacgcaaatgcaacgtaaacgcgctagcaaaacagcaggggg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
923 cgtcgttttttgggagaaatctagtcgcaggcacccatttttccgtgcaggatgtgttcatatcgctaatcgagagaggt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
924 ttagaagaacaatcgtccagacactttgcgctaaatcacggacaaatggtcatgccgtcctttgcctggtagcatgatgt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
925 cgagtaacaccaaaatccggattttctcgcaaatggttcttcggcctggtcgcgcgcgttctctacggtaacctgcattc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
926 atgtttgccagtacgtcggaaatcagtggaaccgacttcgcatcatcttcacaaaacgatagtgttcataacattcacgg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
927 tagatataaaaaacgtcaaatacacgcgctgtttttacttactataatcgtttctaacaagtttttcatcagggtattct
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
928 actggatgacttgttatgggaagtgttaaggtaaaagatggggcctggtaatcaagcgcgctcggcgctggtagtgcgtg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
929 ttgattggttgtttagcaaaaacgaaaaattattatatcgccgggctgatttccacttttcgccgcccctttgcgcttta
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
930 tcgcgcattatattggttggccagcgacgcgcatgaagccttacgcgcaaaaccatcatttttagtatgactggtcgatt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
931 attccctttttgtttacgctggtgtcgctgttggtatttcaccggaatgatgcgcttgcccgccgcttttgttgggttct
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
932 gttgcgtgtttgggggataagcgcatgggtgttgattatattgctggataaagctgcattacgcagatgaacgaaccgcc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
933 atcaaagtgggggaaactgcgtcggtgacaaagcaactggtagtaagtaatcgacaggtcgatcacttctttctcgccag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
934 ggcggttttcatcagtgatttatttcagcgcctgtttgtcgatattcgcatcatatagtcaattaaacaggatagcgatg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
935 gcgcaatagaattcactttcacttccggttgccagcttgtcggcaaacgagcgggtcatattattcgcagtggccgcttt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
936 gcttgccgcactacgcatatgttttgtcgctaccgcgctcacaccacataaatcggtaaagtgaaatgatatcgctggcg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
937 gcgtgtcgtgcccacgcagtaatctttccagcgcattggttgagcaggtatggggtattaacgtggaatgctgcatcatg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
938 caagagtacgtcggcagtgggcaccggtttttccgccatccacgcactggcgttatgcaacattagcacgcagacatggg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
939 tgcttttttagttacttgtcaatcggcaaacgccatcacaacctcgttggtcgaaaaaatcagcctgaatacactgcagc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
940 acctgccattaacagtcataatgtgctgatagtgtgtccgatagctgacaattcaaaccggttgccttttgattaatgaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
941 aattgccatgcgagggcgaggccgatgcgacgacctccgccagtaatataatattggcaagggcctgggttttacccatc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
942 gttatctctttgcttatccaacgatgggattgacgttatccacagcatgccaggtcgccggaactgaaggcaatattaac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
943 aggcatgccaatcagcaccattttcctgacggttcagtacaattatcatggtatgtgcgcgcgtaaggaaaacctagtta
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
944 acagcccggtgcctacagaacaacggataacagcagtgcatttgacagaggcgtacactaaccataagcccataaatggc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
945 aggcacggacacgtaccgctttatgcagtggacggtttgcgatttttcagcaacgaacgcgccgacaggaatagggcacc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
946 agaatcatttctgaggcgatggtcagcaaccgtgcttgttatgaaccggtcagccagatgagtacagacaaatttgcacg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
947 cagatgtttggtcaaccacagtgaggcggatggcgcaagcttgtggcttttctggcgcgcaaaaaaaatgcgcggaatgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
948 tttatgagtggccggcaggaacgtacttctgctgccatgatggtctattgcttaagtagcggcgccgcaaacgacaacga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
949 tcaaaccggcaagcgtgatgattcgccccatggtcccatcatttctcaccatcagacggcattgaaacggttcacgaatt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
950 cagcagttttcaggacgtgccaacaaccatgcgaaagcagcgttactagcaagtaaacgcccagagcggagagaacggcc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
951 agcagtggtgctttgccatacatcacgttttattccgcgcacgcgcagaaacaaccagtgggcacctttccacacaatga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
952 aaaccacagggtgatcagcatggtgttttttccctgttcccaaacgggtccgcaagtgcaagtccggtgaagtcgagctt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
953 gaaggtatccagtttgaacatcatcatcgccagcacacaaaatcagacccagcggcaacaattttgcgcagtgtcgccac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
954 caggttaatgctggcaggcggtttggcacaccgcgaggatcaaaaagtgaacaatccacataaagccgatgcacgactat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
955 cattgccaggtattacatatcgccaaacaggcgcaattccggcggtgtccgtaaaaaaagctaaggcggaaaaaacgatc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
956 accagaaaggagaacgttggcgatgactgcgcacagccagttcccatgcggaaaaaagccgattacgtcgccaaaccttg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
957 cgcggaaataggtaaagataccgcgttcacgttcgggacgaatgcgcgtgaggatcagcctggcaaaggccagcaataaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
958 atgccagcgccagtatcccgcgatgagcagtgctgcgggctggcaatgccgccatattttgcgggcagactgaaaacagc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
959 ccgcgccagcattgagctttaataccagcgcggtgagtggctcagtccagttttctttttccaatcgattatccagtgat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
960 taaaaagtgataacgaagaataaatatctagggcaaaacgctaaaaatggagtttgcatgaagccgctgggattttaacg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
961 aagagattgtgtctgcatgcaatggtcgcggggaaattttgtgactaaaaattgcgaagggcatagccgccttatatgag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
962 taactgaaatagtttatttatacagatctgcgctgacggtcaggttattaccacgttcctgccatgcgggtgatgtgtaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
963 tactttagcacctttcttcgcggcacggtttcgcacctgataggagactttcggtcatgttgcgtagttgccagagaatt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
964 tgaatgctgtcgaacgggaccatatcgctgcggtcgctttttgttcagttcttcgactttagtgcatccgggagcgtgac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
965 gggtggtaacgcgccttttgatgactggggtttcaagaagcgaccgacttcagaatttggtgatgcgccgtagtcgaaca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
966 cccgggatctcaactttcttcgccggcttcgccccggcagccattttagctggcacgtcctgcttggaatctgcggatca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
967 agctccgggctctggagatcgtttcttagcatctttttttatagatgaatgcagtaatacgctggttgccgcctggttgg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
968 catcgattttgacgacgtatgtagaaagagtaggcactttcgcttttgcgcttttggtgatggcatattgattctggctg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
969 gctacggaatagaagcctggacggtgaccgggtgtctaaacggttcaatcagaacagctgtctttcggcgttcgacaaca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
970 ccgttaattacgcgatttattgctttcttctgcttttttcagcatgcgctttatagaggtcagcgaccacacgccagtta
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
971 ccgctgttacaaaaatcagaagtgctcgacaacataaaaagggcggcaccttctttattggcgacgaatgaaacggcttt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
972 caccgctatcgcatagcattaaaacgacggtaaccatacacggtcacaaggttttaacgctgcgctttgctccggtgtca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
973 gttctgtttgctggcgttttaacggagaatgccatagcagaaaagcagtgcggacggccaggcgggtgttctttaagctt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
974 tcataaaaattatccttcgcctttgcgcaaccaggtactggtattgttattaacggagaaacgtggctgattttgcattt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
975 taaaacggtgtaactggttgcgtcattttttcatatcacattcttaagccaattttatctgctctaaattgacgcgtcta
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
976 tgcttaaaaaacagcgtatcagacttcattactactgaagcaactgaattgtataagttaatttaatgttaagttagtga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
977 ttcgtgccggggccgatgtctcgttttaacccgaccgtcgaagacaattatcagtctttaatccggcgttctaaggtgtt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
978 tataccactatcacggctgaatcgttaatatctttgcgagttcacgcgaaatactgatttttggcgctaagaaatcacag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
979 ggcataatttttcaagtacgttataggggcgttttgttttttatactaatttattttaacggagtaacattagctcgtac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
980 atgagcagcttgtgtggctcctgacacaggcaaaccatcatcaataaaccgatggaagaatatcatgcgaattgggcata
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
981 caagagaagggttcaccaatgaaacccgtgttgcaggcaacgccaaaaacagtgggaacagctgctgaaactggggtttt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
982 ttaaccgttcgcggttagagagcggcgcgggtcaaactggcaagttttgacgataaagcgtttgtgcagcgggcgtgaaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
983 ttgtagagggaatagcgtctggcagtcagagatcattctgaagtcaatgcgcgttttagaatgatgaaattgcgttaact
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
984 gcatcctgggacaaacgctggtgagtttttctatctggctgcgagaatccggattaattgcaaaacttgcggaagcgtta
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
985 acgtgacgtgatggcgatgggactctgtgcgcgtatcttcacgcgccacaatcgctggacgcactaagctcgatggcgac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
986 catcgccggttatgcgccattgttgagcggcacatgaatttgggcgcttctttttaccgggcaaattactgggccgggaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
987 agtgccacagcaaaagtgatggtgattggtcgcgggtgttgcaggtctggcgcctattggccgagcaaacatctcggcgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
988 gattgtggcgtgcattcgacacccgcccggcagtgaaagaacagtatttcaaagtatgggcgggattcctcgagcttgga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
989 tttttaaagaggaaaagctggcaagcggcgatggctatgccaaagtggatgtcgacgcgttcatcaaagcggaaatggta
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
990 actctttgccgcccaggcaaatagaggtcgatatattgtcacacgcgcttattcgcaggcaaacagcgccgaagctaatt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
991 acccgtgaaatggttgactccatgaaggcgggcagtgtgattgtccgacctggcagcccaaaacggcggcaaacttgtga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
992 atacacgtgccgggtgaaatcttcactacggcaattgtgtcaaagtgattggttatacgctcttccgggcgtctgccgaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
993 cgcaatcctcagctttacgggcaaaactcggttaatctgctgaaactgtttgtgcaagagaaaagacgagcaatatactg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
994 ttgattttgatgatgtggtgattcgcggcgtgaccggtgatccgtgcgggcgaaatttacctggcccggcacgcgattcg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
995 gtatagctcagccgcaggcggcacaaagcggcaccggaaaagtgaaaactgaggaaaaatgtacctgctcacgtggcgta
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
996 aatacgcttgatgggctggcattcattcttttggctggatggcaagcgttgcgccgaagaattcttggcaacttaccgtt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
997 ttcgcgctggcatgcgttgtcggttattacgtggtgtggatgtaatcgcacgcgctgcatacaccgttgatgtcggtcac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
998 caacgcgatttaggcggattattgttgttcggaggcatgttgcagatttggccaggggcggtggttagcttcttagtttt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
999 tttatcgggtgctttatagccagcattaatatttcggtggcttcacgtggatcagcgcatgctgaaatgttcgcacaaat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1000 taaggggtaacatatgtctggaggattagtttacgctgcataaatttgttgcgcgatcctgttttatcttcagtcctggc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1001 ggtctttcgaaaacattgaaaacgtctcgccagggtaaaattcggttatcgcggatggcgattgcgttaatgcaaccatt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1002 tttggacggatacgggtaatgttggctggtcttgctaggcgatggtcattggtggggcaatctgggtatccgttcggcga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1003 agaaagttgaaatgaccgaaaaaaaaaatgggggcagaactggtggcgaatccgcaatagctttcgtgggtctggcggca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1004 gtgctggttggctttaacagctatctgcaatcatgaggcgggaatggcaccgattctggtcaatattcacctgacgcgaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1005 gtggttcctcgtatcattcatccggggcggtaacgtttcacgggttcggtggtggcgtttcggcaaacgtgtggcaagat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1006 ttttcgtctaaagcattggatgctgcaaaccgtacaaaatgaactggcgtctgggtcgttttcttcctgctgctgattgg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1007 tatttgttcgcaacggacagcgtcgctgcaagtgctgggcatttgctgataatgacgcaattgcgctggtttcgctggca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1008 tttagatcgcctcatcggtggtgcagatatgcgcagtgtggtgtcgtatgctgaactcgtactccggcttggcggctgcg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1009 gctgcgggctttatgctcagccaacgacctgctgattgtgacccgttgcgctggtgttcttcggggctatccttttcctt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1010 acattatgtgtaaggcgatgcacgttcctttatcagcgttattgcgggtggtttcggcagccgacggcttctttctactg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1011 gcgatgatcggaagtggggtgaagcactgcgaatcacgcagaagagacagcggaactgctgaataaactcccttcagtga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1012 tcattattcggtacggcatggcagtcgcgcaggcgcaatatcctgtcgctgaattactgagaaattgcgcgcgtcgtgta
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1013 ttaatgtgcgtttcggtatccaaccggtcgcggggcgtttgcctggccatatgaacgtattgctggcttgaagcaaaagt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1014 acgtatggacatcgtgctggaaatggacgagatcaatgatactttttgctgatacgatacgtactggtgattggtgctaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1015 cgattacggttaaccggcggcgcaggatgatccgaagagtcgattgctgggtttatgctgtgctgaagtgtggaaagcgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1016 agaaacgtgattgtttttaaacgttcgattgaacactggctatgctggttgtgcaaaacccgctttcttcatggaaaaca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1017 cccatgctgtttggtgagccaagccgcgtggatgcatcctgaaagctctgtaaccctgacggcctgctgaggcgttccac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1018 ttttattgagattcgttaacagaacggcggatgctttgactcgcgctgtttgttcaagcgcaaattttgacataattgtc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1019 aacggcaacggaaaagcagcataccaccggtttctaacaacatccccaaaaaatcaacgacaaaataccaccaatgtgga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1020 aagccccagcccagcccatgatacgcggctccagattattgcccgaaagcagattaatcgcagatatccgccagcaccag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1021 caacgcttcgtacgaagccattaaaacccagtacctgaagcgatagggggaattgccgcgaggactgaacaataattcgg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1022 gatgtaattaagcgcaaaggacagcaatcccagacaaaagcgaagcgaacattcgagtgcggcgagcatcgccaggcgac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1023 caggccggtgatgaatgctgatggctgttttcagcaccagataatgaaaacactgtcatcgacgtttgaattcgccgcca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1024 tcccttcaaccggacgcgccatcattttgctgaaatttttccggcaattgtggcacttcgagcagcataaacagccaccg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1025 tcagcgcaataaaaatattgatgacatggcattagataacttgcgtcaataagttgtgaggcaacgtatcgccgcgttgg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1026 atcatataatgcgccagctggtcactgagacggtgaatccctacgcgttgcaacaacggttcaaggcgcttttttgcacg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1027 gcgtcataaagagttgcataattgcggtctacgtcgcgtcaactcgttgagcgcggaacccagataagctaatagcaaca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1028 ccatcgcatgcacgaatgatggtcaatcaaaatcgaacacgcagtacacgcggcaacgcagcggccatgtgttggcacca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1029 gcaggttaagaataaagcaataaataatgcgagaataaacggcacgatgatctcaggcgcaaacggataccgagagaata
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1030 ctgaaccagcaattcccaacataatgagatttttaggccattgagcgtgatgatcggctttgccatgcttgttcacgttt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1031 tttcttctttgcttataataatgtctttttcgctccgtcacctaacgaatcaaagccgctcaggtcaagaagtgaaatat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1032 tttgagttaattttttaagcttatgatacaaatcaggcgtgtttcaactacgaggacaattatcatccgcgatgacgaga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1033 agcaacactgcggataatttgtaatattatgggaaaattttgtttcaggacgttattttctacatttaccatcatttttt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1034 ttttttttttttcgtacctcatccacttatcttgctcgtaatggtggcagcactggcgcaaacgcgctttagtctttctt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1035 tctgcaaagcttgcgctatgcgcggggcttgacactttactttggtttcgctgaattagcagaaaattaaaataattcct
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1036 ctgcagaaaaggagcaatgtatatttattggtttttattaggtctggctattgctacagaaattaccggtacgctgtcac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1037 tgaaagatgggcgagcgtcagtgagggaaatgggcggctttattttaatgctggtgatgatttctctgtcgtatatattt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1038 ctctctttcgccgttataaaaaatcgccttaggctagcttatgcgctgtggggaaggtatcggtattttatttattaccc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1039 ttgttttagcgttttggtattcgagcgaagttttatcgctgatgaaaattccgggtttaaccaccctggtcgccgggatt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1040 gtggttttgataaaatcaggtaccgtaagcgcgtaacctgaactggaggtgaaccatggccagtttgaatgggttcacgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1041 cgcctggtggcatggcaatgtgctggaaatttgcgttgctaacgtctttttgaaattttctgacggtttcgtcgcaaaat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1042 atttggcttgctccctggcgggggtgctggctgctttagtgcgctttcttcaagcgggtttaaaggggatcgacttgttg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1043 tgcttatgcattgtggggcgggtttggtattgccagccacgttagccgcaggttgaaattttgttttggtcaacggttaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1044 attcggtaaaaggcttggattggcctgtcttgctgtttggctggaatgctgcatggtggaaaacttgcctgatgaagacg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1045 ctgcccgcgctgtcggcagcgtttgaacattatttttgcgacagtctgatccagcttgtacgcgaaaaccggtacagaaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1046 tggccggtttatcgggcgcgccagcgatcttcgcgggcaggagccgaacttttgcaccaattaattgccagccgtcatcg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1047 tatgcaacatcagagggcgaaccgctgtgaccggcggtatcgcactggatgtgacataccgacgtttgcgcccagccagt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1048 caacttacagttttttgatgactgtacaacgtatgagatgatcttcagggtagcctgcctgagtcacttttagactgcgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1049 ttttaatgcggcgtaaggcggcttttatctccctcaaataaggcaaggcgtaatgcagaagggggttacgtagcaacaat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1050 caatccgaagtccacggcgcggctgcgggaggtacaatccaaccatcccatctgctttttaaacggctttcccagtgtcc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1051 gtgataaacggcggcttctatgtcccgtgtgatctcatagcggccaaagacctttatttgaagcacaaacgcaggctgca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1052 gctgctttatcggcttttaacctttggaggtgtaataaaccagtgtcctgccggttaatgccagattgggtgcaatcagc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1053 gtccgcgtatcataattgcgctggccgtttccagttgcccaccgcacccaacggtgattgggtcgtttgtcattcacttg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1054 gcaacgattatcatgaaccaaaaaacagggtgctgacctgcatcgtttgccgatctggcaacgtctggtttaatctgcaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1055 aacacagcagacgtcaaactaattgacccacatacagcaatgttgtagcatatcacactctggtgggtaatttatgattt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1056 attaaaagcaaagcctcataaatataatagacgggacgggctgaaagtgggagtaaaatcagataactacaatcaggaaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1057 gattaaaaacgggcggtaaatcagtgcgcataaaataaggatgatcagaatgaactcaaagcgataacggcccaccatac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1058 taccctccgctaaaggcggtgctaaacgttacctcgcttaggcacgtattttcaggcgcgagggggcgcgccagcaatta
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1059 ctgttgaaaacttacgctgcgggttggtgcagcaggttttgccggttgctggatggctgtgtttctttggcgtgttcttc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1060 gctgcctgcgctttttgtttcagggcttttactgttgcagctttcgttatttttatgatgctttttaagccgcctgcgtt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1061 ttctgggcaggtgctgctttaatgctgttcttttagatgtgtagttttcgccggcgcttgctttggtggtcgtcgcagtc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1062 ggagcggtgtggtcgtagtctcttgcagcaaaaaggccggaaagacagacccatagcagcggcaacaaccagagctaata
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1063 cttttttttcattgtcattacccctcaatttgttttttcattaacccactgcggggccgttgaaataactaatatttccc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1064 tgggaatggcagacttccgtgagtggttggttttcagcgtgtacgatattgtaaataacgctgaataaattacagcgttg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1065 ataataacgtaattgtgacttaagggaaaaaatttagcttacgcataatagtagtctttgatcgggtaactatttttact
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1066 tataatttaaaagcagtagaataaactgcgatacataataaatgacacacagcaaaatgaatccgtttatttgggtactt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1067 ataatccgatgacgctagacggctgcggggaaattgggcctggcgctttcgtctattttaggattgggcctattacgttg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1068 gtttgagctggcataagtccggacgggtatttacgcagtccggaactttatttttcaaggcgtgcagagacgatgccaaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1069 cgcgtcccgacagcagagcaaatgaccaggcatcagagcaataaatgcgggccgacgccgttcagccatagttatgccag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1070 aaaacaccaccgcgttcccggcaatactgcgatccagatagtactgaagcagatacaggaggacgggcctggctttagcg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1071 cgttttgcgcgggggcggatccagctgctgtactgagtgggctgcgaagaatctgctagaagagtaaattccggcaaaga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1072 tcagccacaagcgagctgaataaggtcatcaggtaaaccaaaacattcataaacccgtgaaaacaacatcactggacacc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1073 gcccatagcgggtggtcatggttgggctttgggtggctccaatgtccgggtcaaataagccaagcgataataagccaaca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1074 cgggggcctgactgacatgcaggtgggagagcatcaacgatagccgatgtaattaacagcgtgacgaacggaccccatcc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1075 gcaaaaagccttctgcagacaataacggtaatctccggtcccgctagtgcagacgaaagttgagtaaacaacgtcttagg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1076 gcgcagcgaagtcgggcgaacatggcgtgattttcagggaggattttccaagaacgatcaacgccgaggccagcggcgaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1077 acaaccgattgccgccagatgcaattcgccagttgaaaaaagtccgtgaagacaccgctaattaaggtcgctcatgccgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1078 caatttgagttgccgcttgatatacaaccccattgaaaaggccacggcaaactggatggatttcctcgctaagaataagt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1079 catgccaacagctgcacgcgcacttaaacgaaagcaatcaaggcgcgcataatcaaaatgccgtgccagctggttcgatc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1080 attgtcgaaagtaaacggtacaaaatggaggcaacagtaggcgcacgtgacgcatcactgtttgcgaccaatggcaatcg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1081 gatagccgggcagtaaacagcaaaccaatagccaacatcgcgtggaaatggaagtgaaattactactgttcgcgggggtt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1082 taagcaaactcctgcgaagcacaggaagcgatagcctgcacacaatagagaagtgcaaatgtttgccagtccggcagaga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1083 acagcgccaggggtgagcgcataaattgcggcgtacgcgttaataatatttgattttggctgagaaatgcttttggcttg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1084 ttcagtgtcgcttgcgcggagcgcatcaacagttgtatacggctacgttgaaatcttgctaatatgcctgtagagtcagg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1085 ctttattacatagggtaggaaaatcgcattgttcctgttctatatattaataatctcaataagaatgttttaaatatgaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1086 tatttgaacttcgtcatctgcgttacttttgttgctgttgcggaagagctgcaatttcggggcgccgctgcccgcttgaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1087 tatttcgcaacgcgctaagtcagcagaattaggccgctggagcaacaaattggtgccggcgactgctgggcacgaaacaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1088 tcgcagtgtattgctgacggcagcatggaaaacagtttcttgcagattagtcgaaatctgttctatgtggtgagctgctg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1089 cggcgttcgagctgaaggctgcatcaagggtgaagcgggggagttgcgcttggttttacttcggtcggtcctttttattc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1090 gggcggttgtccgatacgttatcgctgtttcgccgtgatttatcctgatgtccatttacaaaccgcgaaaatgaacactc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1091 gcgagcaaatcgctcgcttcattgaaggaacgcttggaatatggattgctgcgtgaacaacagcgttacgcggagttccg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1092 gcttgaacacgcagtcatcgtcatgaaaccgcttatggcgatgatctctccgacgatcatcccctggcaaataacccgaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1093 tgtaacgctggctgaactggcgaaagaacctgttgttctttttttgatccgcaaacgttcgggagcagggctgtatgacg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1094 atattctcgggcctgaactgcgacgtttaccatttgacgcccgtcatcaactcaggaggtgggcgaggcaatgaccaatc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1095 atgcggtctgggttttccgccggtctgggtgtttcatttattttgcctgcgtcatttaaagtgttcaggctcaccagaaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1096 tgcgctggctgccgattgctgacgaggatgcggtttctgccaaatggtggttggtctggccgaaacatcatgacaaagtc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1097 cggctgcgcgttaactttcgttattcatctgctgaatgctctcagttgagggacatttcaggaaaaagcccgaaaaatgt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1098 gctgttaatcacatgctaaggtaaaattttgacgacacgtattgaagtgcttcacattagccttcagattatttcggagc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1099 gcgagaatatagggagtatgggtgttgctgaaaacagcagcctgggccattgatcaattagcagaccaacgcgggcgcgg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1100 tttatcgctgattgatcaggttggttccagtctccgcgtatcggatctttccgtctggcgcactggctctgcgcagtaat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1101 cactaaaattgtccgtgagatgctcgaagcacactggtcgcaagagctggaatcaaagaagcggggaactgtggcgtccg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1102 gcggtgggggctggtggttgaaatgaagcctggcactatctttctctgcgccttagtcgcgggagatttttccttgctct
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1103 gcgcgatctgagcgcaaactggtgtggaagagttcgcacggaactggcgttaaaagatgacttgccacttgctggatcgt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1104 attttatttccccatatcgatcagtttttttattccgccaccccgaaaaaacttgagcgtctaacttcgattgcataacc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1105 ttgccgggaattattgatacggaaaatggtattgtaacatcgcaatgcgttctaacgaggatgtaaagagatgccgctcg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1106 ggcgcaggcgtctggaggcagcataccggcgttccggtttctattcagcatgatatcagcgcaatggaacgatggcagag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1107 gccttgtttggtgcctagcgggggcgcggatgtgatttcaggtggttatcgatctcacatacgtgggggcgggcggtcat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1108 tccgatggtcatctgtaacacgaggcaggcagtagtctcgtgggaaatagggcacacaacaaggtcgacccgtatgggaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1109 acgctgtttattgcgggaaatcactgggctgcctcgaacctcgcagcggtggacagtatttcttgaggctggcacagctg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1110 cgtcttaatcaatccatgagcctcgatgttacatggacaaccgttaaccgtggactcatttgtggtcaggcggcattgcg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1111 cggcgctctactcggcaaaagaccatcattacggggtgggcgcgcatgtcgggcgcattcttgccatcatggtggaattt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1112 atttaacccacaaaaaatactggattggcttccaccgtttagtaagcggcagatatcctcttcccgtcatctagacagat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1113 cgtcagcaggcccttcctggcgtatagtcagcacatcagcgttgagagtactcagtttttctaaccaggcaacgatggca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1114 ggcgctgcactggtaaaagacgcgatgtataacggttctttgtttgattcgtctgttgcagggtttaacaattttttaac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1115 tgttcttacaaaatttgcgctatctcaatt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1116 >m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/285/21916_24474 RQ=0.859
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1117 attgagatagcgcaaattttggtagaaacagttaaaaaatgttaacctgcaaaagacgcataacaaagaaaccgttatac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1118 atcgcggtctttttaccagttgcaggcctgccatcggtggcctggttagaaaaactagtacttctcacgctgatgtggct
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1119 gactatacgcaggaagggctgctgacggatgctgtctgagatgaccgggaagaggatatctgccgctttccttaacggtg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1120 agccaatcagtattttttttgtgggttaaataaattcacatgattggcaagaatgcgcgcgacatgcgcgcccacccggt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1121 atgatgttcttttgccagtagatcgccgcgcaatgcgtcctgacacaatgaggtccacggttaacggttgtccatgtaac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1122 atcgagctcatggttggtattaagagcagtgtgcagctcaagaataactgtccgcacgctggcgatggtttcggaggcag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1123 ccgtgcattcgcaataatcagcgttttccataccgggtcgacctgtgtgtggctatttccgacgagactactgctgctgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1124 gtgttaggcagatgaccatcggtaatgacgcccgcccccacgtttgttgatcgataaccccccctgaatcacatcgcgcg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1125 cccgcgtgaggcaaccaaacaaggctctgccctcgtccatgcggctgatatcatgctggaattataaaccggaacgccgt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1126 tatgctgctccagccgcctcgccgagcggctatctcttttacctcctcgtagaacggctctgcgattgtccaatacattt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1127 tccgtatcaataattcccggcaaggttatggccaatcgaagttagacgctcaagttttttctggtggcggataaaaaact
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1128 gatcgactatgggaaataatacgatccagcaatgcaagttcatctttttaacgccagttcctgcgaactcttcacaccag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1129 tttgctgggctcagatcgcgcagaggcaaggaaaatctgccccgcgactatgcgcagagaaagatagtgccatggggggg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1130 gggggcttcagtttcacacacctatcgccccgccgacggccacggttcccgttctttgatttccagctcttgcaccaggt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1131 gtgcttcgagcatctcacggaacatttttagtgtactgggcagggaagccagttggccagacgggaaaagatcgatagcg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1132 agactggacccaagcttgctcaataggcgataaaccgcgcgcctcatggcgttggtctgctttttttgactcatgtgcca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1133 ggctggttttcagcaacacgcgcatactccctatattttcggcgctccgaaattaatcttgtaggctatggtgaagcctt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1134 aatacgtgtcgtcactttttacttaggcatgtgaatttaaagcacattttcgggcttttcgctgaaatttgcctctacct
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1135 gagagcattcagccagatgaatacgacagttacgcgcagcggactttgttctgatgtttcgagccaggaccaaccacatt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1136 tcagaaaccgatcctcttcaggaatcggcacgcagcgcattttcgttgagctgaacagtttaaatgacgcaggcaaaatt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1137 gaacaccagaccggcggaaaccagaccgatgattggtcattgcctcgcccacctcctgagtgatgacgggcgtcaaatgg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1138 taagtcgcactcagcccgagaatatcgtcatacagcctgtcccgacgtggcggtcaaaaaagacaaaggttcttttcgca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1139 gttcagccagcgttccattcggttatttgccaggggtatgatcgtgcgggaatcatcgggccataagcggtttcatggac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1140 gatgatgcgtgttcaagcgactccggtaacgctgtgttagcgccggcaatcccatatcgcaggttgccttcaatgagcgg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1141 agccgatttgctcggcgagtgttcctttcgcggggtttgtaaatgggatcatcaggataatcacggcgaaacagcgataa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1142 cgtatcggacaccgcccgataaaagggagtcgtgttacgaagtaaaacaaatgcgaactcccccgcttcaccctgatgca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1143 gctttcagcggagcggcagcgtcatcaccatagacaggattttggccgactatctgcaagaaactgttttttcctgctgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1144 gtagcaatacactgcgattggttcgtgccagccagtcggcaccaatttgtttgctccagcgctgaatctgctgacttagc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1145 ggcgggttgccgaactttcagtgcgggcagcgggcgcgccgaatgcagcctcttccgcacagcacaaagtaacgcagatg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1146 aacgaaagttcaatattcatatttaacaacatttatttgagaattattatatattagacagaacaattcgattttttcct
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1147 accctatgtaataagcctgatctacaggcatatttagcaaggatttcaagtgaggcgtaactacaactgttgatggcgct
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1148 cgcaagcgacactgacaagcaaagcaatttctcagccaaatgcaaatttaattaaccgcggtatcgccgcaatttatg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1149 >m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/324/388_18213 RQ=0.872
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1150 cgcgcggcagaatatttgcggtactttcaacagaaaaactcacgcagcataccgcgtcaacaggccctgacgcagaccat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1151 taacatggggtaccgccctgcatccggttgggattaaggttgacgtagctttccgtcagcagttcaccgccgttccggca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1152 ggccacagtagcgccagtcgacagcagcttcagtatcaccagccgaaattagctcggataaacggttttttttcggcagc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1153 gtcggcagacattttactgcttccttcaggtaagatgacaatttcaaggaacgtcccgtcgatgaccagcgtatgttttc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1154 ggtatgtgttgaatcttcatctttaaaagtgatctcaacgcaagggcacaataccgctttggtttcagcacatgagtcag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1155 gcgtgaaacaggaaaatcgcgggctgtcaaagaaggtttcatcccgcagaagtgcacactggtacagtaattcggcccgt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1156 ttttttaccgcaagtggcgacaacctgttaaaatcctgccttttcgccattttcaaaggcgatgttataaagaactggac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1157 catcgcggcgcacgttaacttctcacgcggcttgtcgacagggcgttttaacacatcgcgaaatcccccgccatgcaggc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1158 cgccagagaatggtaatttttgttagagcctttaccgctgcattgcagacgggcaaagagaatcagttcaaacgccgtac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1159 accctcttcccgggtgaatatccaccggcatccgcgccacatcgtcataattctaacgaatggtcaggcatgtaaatgaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1160 cgtcacgcgttttgcgtgaccgcgcagtgcttcagtccacactgttatctaatgaccttctttgccccaaatggttaggg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1161 cgagtggtatcggtatacatcccggacggcggcgaaccggctcaagcccggtgagtaccttcaatggcatccagcgtata
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1162 agtttgcgtcatggttttcagttagtaattcgagtttgaatcgtcagcgataggttcaggaccaagaaaatgagatcggt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1163 tagaaataatcttcgaagccgtgaatgcgtggttgccgggcctctatgacagtctggcggcaggaagcgtagtaaaacgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1164 caccgcctggggtaaatcagcactcatctccgtctgtttgcagcagccagaagtcaaatccgcgcgcttccagcgggtca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1165 atctgcaatgacttaagatcgtaaatatggctgtgactctagcacatattgctgcccgtgtaggggttctcgttctgacg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1166 cgagattagtcgtcagcagttcaaacgggcgccaccgcggtttaccaccatggggcagcataaaacatgtggacaaccag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1167 gtggcgtaagatatccccctatgacgaacgcgcaatacccagcgaatgcacacagccatgttccaggacaatggattcca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1168 gcagctctgccgcgtcggaaaggcttacggcggcaaactgcggaatgatcatgtcaacgttcagggtgatgttccgcagc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1169 cagtttttgtaacaagctcgcttttggcagagcgccggcgagagctgcttgaaaccgtgtaaataaagaagcgtagcatc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1170 agtacaagctctctgacgcggtatcagtggaacgtgtggtccgcgcaggcgatgcagcctcggtggtcaggtcggtgcca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1171 tcagaaatgtactcgagagtacgtgccagccgggcgcggatggtatcgcacgcgtaaagttggaacaggtgcggcttaaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1172 acttgcacacaagggtcgacggtgccagcaggcggccgaccattccagtcgatgatcctagctctgatgaatatgaacgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1173 aacagcaagttttgaagtgcggaaactttcgcacatgcacggtatccagttcgctcgtccccgcccggggtttacgcaga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1174 cgtgttgtatcggcaacctacaacccgcgagggtagcggatgatgatggcatgagcagcaacggtaatggcgttcctttg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1175 gcgcatacggccagtttacgttttccagccactcaagctgaaactcgctagctcaccgtgcggcagcttccaaaacacct
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1176 gggctattccaggcaacaggattggcattgctcacccaataaacccggcggcttacgcaccggggagatacccgcatcct
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1177 ggtaaaacgcgctgtacatcgcgggcatggaaatcgtggttgcccggcagccagtacgcagggcgcacgaaacttgcgat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1178 tggcttcagcgacatgctgataggcgcagaggattgatcctgcgactaaatcacctgtcgcgacaatcaggttcgaattg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1179 tgctggttgtggccggaatcgcctccacaccgcctggtaactctcaggtgtttaccgccacacagggcttcgtgcttttt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1180 gtgcaaacaggtgagtgtcggtaatttgtaaaatctgatctggctcacagccagaggaaggttaacaggctttccaatgg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1181 tgtcttaggtttccgacgctaataaaccggaatcgccatcgctgccatgtgcttaaaacagtatcgaaccagtccgcgct
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1182 aaaaactgattaatttgaaatgcttttcgtgcgcgttgaatgcaacttttttattaggataatcataccgcgctttgaag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1183 cgaaaaattctgcttggcttgaacacacttcagccaccatcgcgtcatgatagcagacgcaccgtcattgacggaaggct
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1184 ccagtaactgatgcgcgggcgcagtgctgttctattgtcacagggtagtgtttcgggtcgattccaccaatcgtcagccg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1185 atattgttggcgtttgccaaccatgatagctttacagtttcgccgggtgcggtcattgccgcggtaacaaacggcgcaaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1186 ttgtgaaagttcattctcgcaacgagcgcgcaaatcatttcaggaatcaggtggtggtaccgcttcaatttatgcccact
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1187 cattttgttaagcttgatgatgcgcttgcaagcagattgcaagcgatgaccgacgctgcgttgtcgattttccctcttac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1188 tacccactggtatgcctgttcggctttacacatgaagccgaatatcttcgttttccatcacagaccgtgaataccggctt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1189 gcggtgcgtgggcgtccacttcgccaccataatttgacgaacgctcactggtgcccccggctttgccaggaaacttaaca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1190 ccgttttggtcacgttttgactatcagtcccgctcttccatcgcttcgcgacgggcaacatcttccacatttcaacctct
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1191 tcatcaatgaccggccaaccatctcgccagtagccaagggggtttcgctggttgtcgttacgcggcaatccgaatctgct
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1192 caatcagcacatacttcatcacgccactgggtcaaagggtagcaagactgcggcgtgaccgcgctcaaaaatttcccgcc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1193 gcagctcatgactttcctttgccccgttgatagacgattgacgacaatctagtaaagaatctaatgaaaaaaagccgcga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1194 taaagttgttttcgtgcaataatttctacaatcgtttttggcaaatgtaacgggcaggttgtctggcttaagcattgtta
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1195 actggtctggcactaatagtgaaattaaattgtgaaatttcagcgacgtttgactgccggtttgcggccatgtctcagtg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1196 gtttaattgaggcacattaacgccctatggacgtaacggccaacccccccttttgcggtagggctttctgctagaaatcc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1197 gcataattttacagttttgatcgcgctaaaatactgcttcaccccaaggaatgcaaatggaagaatttgggctccccttc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1198 ttatcggcctgagcctttctgggttcagtttcgttgagccaggccgatgaacactgatgcaagtttatcagcaagcacgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1199 ttagtaacccggacttgcgtaagtctggcggcgccgattcgtgatgctcgcctttgaaaaaattaatgaagcgcgcagtc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1200 cattactggccaccagctaggtttaaggttgcagattacacctatagcaacggctacctgcgacgcgaacggcatcaact
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1201 taaccgcgacagtgcgctccttgcagttaacctcaatccattttttgatattcgaaattggccgtgcgttacgctgcaag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1202 tgaaaaagcagagggattacaggaacgtcacgttaatcaggacgcgatcagaagaaaccttgatgctcaacaccgcgagg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1203 gcttatttcaacgtgtgaatgctattgacgtttttcctatacacaggcaacaaaagaagcgatctaccgtcaattagact
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1204 caaaccacccctccacgttttaaccgtgggctggtagcgatcaaaccgacgtgggcagaactgcccgcgcatatcgtaga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1205 tacgtgctggcgaaatcgaagtggcgcgcacgaagtataacacatctgataacgcggtagagcagctgcgccagatcaca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1206 cggtaaactactatcgcggaaactggctgcgctgaattcgtaacaactgttaaaaccgacaaaccacagccggttaacgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1207 gctgctgaaagaagctcggaaaacgcaacctgctcagatgctgatgtactgcaggcacgcttgaggccaggactggcgcg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1208 cgagcaattcgccaggcgcaggatggtattaccgactctggattttaaacggcttctaccggggatttctgaacctctta
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1209 tagcggttcgaaacccgtggtgccgctggtaaccagtatgacgaatagcaatagtgggccagaacaaagttggcctgagc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1210 ttctcgctgccgatttatcagggcggaaatggttaactcgcaggtgaaacaggcaccgtaaaactttgtcggtgccagac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1211 gagcaactggaaagtgcctatcgtagcgtcgtgctaagaccgtgcgttcactcttcaacaacattaatgcatctatcagt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1212 agcattaacgcctacaaactaagccgtagtttttccgctcaagctcaattagacgcgatggaaagcgggctactcgagtc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1213 ggtacggtaccatttgtttgatgtgttggatggcgaccaccaaagttgtagcaacgccaagcaagagctggccgaatgcg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1214 cgttataagctaccgtgattaattcagctgaatattaagtccgctctgggtaacgttgaacaaggcagatcttgctggac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1215 tgaacaatgcgcgctggcgcaaagccggtttcactaatccggaaaaacgttgcacgcaaacgccgaaccagaaatgctaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1216 ttgctgatggttatgcgcctgattagccgcggcacagcgtttcagcaaacatccgcacgcactaccaccagtaacgtcat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1217 aacgctttcgtaactgatgacgacgaacggggcttgcggccaccgtctgaacgtcaggcaacgtaaagatacggttaatc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1218 tgcgcattcttccccttctcggttcaatttccgacgcgcatccctctcattcttgatgggtatttccgcccactggtccc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1219 gggaagacaaaaatgaaacgcggacaaaatccatacgccacgattttgttcccgcaaaaagcgtggatgcgcacgccaat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1220 ctgacacccatcgctttctcggcggttgcactgtttttatgctggctggctggtgaaaatagagtgatgaaacagtggtg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1221 ctctctatcagatgctgacgatctgttcagactgcaaacccaggcaaaaagcgccgaatgtgaccaccggcgtacacaat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1222 gcgctgaaagaagcgaacgtactgcgccgaatacgccacgtgagactgtgtttgcttgaaatttggtgaaggtcaagtgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1223 cagcaggcaagccagctggatggcacatagaaaaccaggcgcaggcccagcaatccagcgggagtttctgggatgcgctg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1224 atggccgcggttacatgatggcgtctgatggggcggctggcggcggggatttgcaacagcagccgctgttctctgcctcg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1225 aaaaacgcagccagtccggcttacggtaaaatatacgacgcgacgggtaaaactatggcggcagccccagccaggcccgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1226 aaccaatgaccgttacgcgaagaacgcaatggcaccaaaaccgcgacaccactaccgttaccgtggcggttttggtgaat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1227 ctgttgccgaaacacaagctatgcagcgtagtgcacggtaccattcttctgcgttgaatggtggcctgataaaccgatgg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1228 aaaagagtcagtaattaccggcgccctgcctggcgtgagaaagcccacgaatcggttttcaattttcacaccatgtacgg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1229 cgagccgtactggtgtgaagatgcttactaaagttgaccctcgcccaggttggaaaagctggaaagaagtcaccgccgaa
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1230 ctgcacaatgtgcctgaaagtggtggaaaaagtgatcgccagcgatgagctgatgaccaaattccggcattccaaaacac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1231 acctggaagttttgtgtcgcagtcatggctgaacgcaatcagccatcgctttattcgcgtcttgattctgggcgtgggat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1232 ggcactgggtgaacctaaacttcttcggaaaataacgccgatacgccaacgtccactataagcgaggcggcgttctttgc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1233 agtggaatctggactggaagatcagctttaaacgccggtaacttgcggagggcagcggacgcagtttaacagtctgcaag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1234 aaaaactgatcgatcgctttcgttgagctgcgtgaactagtatggcttccagttgctgcatctcacctcttgtcgcgaca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1235 accggtggaagactgggaaccattcaggtatttgcaggactgcgcaacggaagctgagattgctactgagttcctctaca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1236 tcgatgatatcgggttaggtgaaaaggtcagtcacgaatttacagatcaggtaatttccaaagctgttcaaaccttgggg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1237 gggggtaatccgtgggaattttatgttggcgtgagatgttctcaaccaagctggaggatgcaggctacctggcttggaac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1238 cggcgtggaagaaggcattatctccaacggcacttctaaaccgctaactggtgggagatgttccgaaatcaccccgaacc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1239 ttgctgcccgcttattttgcggaagatgaaatcatccgcaatggaaaactatgttggtttaaaaccgatcttctcccgtg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1240 aaggcgcaaacagtgtcgatcattgagtaacggctaaaaaaccttgaatgcacggaaaggtccgtatgttgcgaagaagg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1241 ggaatgattgttcagcaattccaccgttaatacggcgtagataattcggcgacaatgcatgatgctgattgggtaagctg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1242 gctggtgaacgatcaacctgcggaattggcattgccggtgagagacggtgcaatgatgatcacgctcggatatagttcgg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1243 tttttatccacgatatttttggtttgaaataagacgataccggatggcactcgtcgatgcgcggttaattgttagcctat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1244 ctgcaccgacgaatactcaaggctgccatttctataccctcacgaatatggtaagttggctctcgccgcatcccacggca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1245 actaaacatacagtatagatacaggcaaattagggatgcctcgtggcgttttggggttttcgataacgtgccacgttcat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1246 ggtcgaaggtaattcaaccagaggatgttgttttgctggcccttgccacggtcagaattcgcttttttcacatagctctt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1247 aaacgacgtcggcccacgagatcacgggttgaactatcacgtgcactttcactgtgcgcaggttatgcaccacgttagct
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1248 ggcgacgcaacattattccttcatctcggcaagcgctgccaagttgttgcgccaatttcgaaatggccaggcgcaggttt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1249 tgctactcgtccagatactacaacctgcaccatcgggatatcagcgtcaggatacatcttatatcagcacgccccacgag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1250 gccgtggtcaaagcccagcttctttatccagcgtcaccgggatcggcgctaaacagctcaaaaccagacgctgtgccagc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1251 cgccaggcgaaccggaggcaggataatgcgtatcgacagcgcctgcgggaagcaccaaagtccataaatccgtgggccgg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1252 cgactccatcgggttcaatcctgttttccacgggtaaaggccagtgagccgaaaccacacaatcgcttgcgggcgtggca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1253 atgtcatccccacttctgccagctgcgggtataggtacaaattatcttccagccgttcatgcggacaccgtgctaaaaac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1254 aatgctggcgataggtgttgaagactgatgatctccttaacaaagcgtgtccattttgattatcctcacaataggcttgt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1255 ttcggcggagtaagaccccggataacaatgatgatgatcatcattattttgaaacgatctgcctgaagtgaaggatttat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1256 aaggagttgtcgatgtcaagtacctctcattctgaccagtactggcgggggaagcgctacgatggtggtattggctgggt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1257 tttctcgcgtttctcggggacaaaatacctcgaaccgcttagcttagcgtttttcgactagggttttagcacggcgcggg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1258 ggatcttgtttggagctcagatgctcattaatggaaatgcttccttgccgctagcagctgaaggaaatgtcgcctgtgtt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1259 gggttatcggaatgttttattcttcggtctgcttggctattttggcctggacgcgcatgttgctactattgctcatcgca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1260 ggatttaaatgcaaaaactcggtgcagccgttgcaaaatcgatcaagcgcacagcccatttctgctcactgctcggcaat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1261 ccaggttctgtcataacttccccggaagtggattggccactttgtcacggcgagcagcaacctggagctgggattggcat
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1262 cggcactgccgtcgcgttgcagcaaatatcctgaggtccctggcagtggcagggacgccggttatatgtcgggccagtag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1263 ggggtcctaaacgtaccgagtcgattctgtgggcggggatttctggacttagcgagaaattcttggtgggtggtgctggc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1264 gtggttaatcctcggttagcaatgatttcccggtggtttcatgggggcaatcatggcggggcggttgcaggaattatggt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1265 ggcgtctctcggttgaatgattaatgcgctcgccaaagaattgacctaataataaccccagctatggcgtacttagtgtg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1266 aagatgtcagtgatgggattcagtttttagtcgctgtacaacggcgggaatgattggtttaaacaactcagaagttgtcc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1267 agcgcatggacaactttctgccagctttcccgaaagccttattctaccttttttcgggctgtctctttcactcgtactgt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1268 ttaagtatttgttccgcgctttcaagcagtgcgtcctctgtcctggcgaaaacgcccgacaataagtttcaaatgcagga
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1269 ataacccaccacaaccagagcaatcatacaatccagtacccaggcgataaacatccttttacttaatatttaacaatact
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1270 aaacatttagcgtataaatttcacatatcctttttcggatctagtgtcatatggtgcaataataacgaacaattataatg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1271 attttttgatcataatgaaaagatagctgatattaatgaaatttttctcaaatagaaagagaagcggaattaagcatcgt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1272 tgcatagcaggaaaataaaaacgaagcctgctacacacttcgggtttcttgattgaaggcagtaattaaggcagcggttt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1273 tcagctgggctttacgctcatgtgcctgatcgtaatgccagggtcttcaatagtcgagcgccatattgtgttttatttgg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1274 caaacgtcaataccctctggtgcacgcgccatcgtgccatcgtcattagtcagctcacaacagtacacagccgtttaaag
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1275 cctgcagcgtctcagaatcaaatagttgcttttcagtatgaaccgccacgcgtcagtacaccacctgcctgagcgcgagt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1276 ggaaaacgtggccaggacgattcagatgctgacggttttgcgcatcggcaatcgctgcgcgaacggtcgtaatacggtca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1277 gcgcagaaacaccggttagtcacaccttccgctgctcaatggtcacggtaaaacggttgcataggcgctggtgttatttt
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1278 ctacatcattggcagatcgagttgtttacggcgatttcagtatgcacaggcaaacaatatcgctaccgtggcgaatggtc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1279 agcgccatctgccccctccttttttcaaaaaccagttcatgggggttttttctgcccgggaaaaaaaaaaggaaaaatca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1280 tatcaacttcgttttcacggcttccatcatcagcacattacaccagcgtccttcacgcagcgcagcgtgctttttcacac
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1281 gttcgaaaggcgtacaaaaggaggaaagtagcgtctgattcatggtaaaaaaaaacctcactaaaaatttatggttacca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1282 aatcaggggcagtcttaggagtggcggcaaaatagtagccaaatacgatgaggggtccatgaccgacagaatcgttactc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1283 tctccatcggactctaccgtcgccggaattacccggagtctgctgtctttgaagttgcacgccaaagcgctcgcggcttc
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1284 aactgagttgatttacgccggtgggaatttcgccccgcccctgagaataagcggattcactataacgctaatgattagcg
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1285 cagcaacggcaatagcttcacataattctggtttatgccttaccttatcgcactagcaatggcaactcaagcacctatca
d9f4c141d88a planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 2f6d48e1d2161d03411d9fbb4fc3d16f0fa3d2e1
bgruening
parents:
diff changeset
1286 gtacgggaaagctaaatgattgaccgaaaaaaattggcaacatcgctcgcaggttcacga