Mercurial > repos > bgruening > glimmer3
diff glimmer_w_icm.xml @ 0:841357e0acbf draft
Uploaded
| author | bgruening |
|---|---|
| date | Sat, 06 Jul 2013 10:09:30 -0400 |
| parents | |
| children |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/glimmer_w_icm.xml Sat Jul 06 10:09:30 2013 -0400 @@ -0,0 +1,224 @@ +<tool id="glimmer_knowlegde-based" name="Glimmer3" version="0.2"> + <description>Predict ORFs in prokaryotic genomes (knowlegde-based)</description> + <requirements> + <requirement type="package" version="3.02b">glimmer</requirement> + <requirement type="package" version="1.61">biopython</requirement> + <requirement type="set_environment">GLIMMER_SCRIPT_PATH</requirement> + </requirements> + <command> + #import tempfile, os + #set $temp = tempfile.NamedTemporaryFile( delete=False ) + #silent $temp.close() + #set $temp = $temp.name + + glimmer3 + --max_olap $max_olap + --gene_len $gene_len + --threshold $threshold + #if float( str($gc_percent) ) > 0.0: + --gc_percent $gc_percent + #end if + + #if $stop_codon_opts.stop_codon_opts_selector == "gb": + --trans_table "${stop_codon_opts.genbank_gencode}" + #else: + --stop_codons "${stop_codon_opts.stop_codons}" + #end if + + --start_codons $start_codons + + $linear + $no_indep + $extend + $seq_input + $icm_input + $temp 2>&1; + + ## convert prediction to FASTA sequences + \$GLIMMER_SCRIPT_PATH/glimmer2seq.py $temp".predict" $seq_input $genes_output; + + #if $report: + mv $temp".predict" $report_output; + #else: + rm $temp".predict"; + #end if + + #if $detailed_report: + mv $temp".detail" $detailed_output; + #else: + rm $temp".detail"; + #end if + + rm $temp + </command> + <inputs> + <param name="seq_input" type="data" format="fasta" label="Genome Sequence" /> + <param name="icm_input" type="data" format="data" label="Interpolated context model (ICM)" /> + + <param name="max_olap" type="integer" value="50" label="Set maximum overlap length" help="Overlaps this short or shorter are ignored." /> + <param name="gene_len" type="integer" value="90" label="Set the minimum gene length to n nucleotides" hrlp="This does not include the bases in the stop codon."/> + <param name="threshold" type="integer" value="30" label="Set threshold score for calling as gene" help="If the in-frame score >= N, then the region is given a number and considered a potential gene." /> + <param name="gc_percent" type="float" value="0.0" label="Set the GC percentage of the independent model, i.e., the model of intergenic sequence" help="If 0.0 specified, the GC percentage will be counted from the input file." /> + + <param name="linear" type="boolean" truevalue="--linear" falsevalue="" checked="true" label="Assume linear rather than circular genome, i.e., no wraparound" /> + <param name="no_indep" type="boolean" truevalue="--no_indep" falsevalue="" checked="false" label="Don’t use the independent probability score column at all" help="Using this option will produce more short gene predictions." /> + <param name="extend" type="boolean" truevalue="--extend" falsevalue="" checked="false" label="Also score orfs that extend off the end of the sequence(s)" /> + <param name="start_codons" type="text" value="atg,gtg,ttg" label="Specify start codons as a comma-separated list" /> + + <conditional name="stop_codon_opts"> + <param name="stop_codon_opts_selector" type="select" label="Specify start codons as"> + <option value="gb" selected="True">Genbank translation table entry</option> + <option value="free_form">Comma-separated list</option> + </param> + <when value="gb"> + <param name="genbank_gencode" type="select" label="Use Genbank translation table to specify stop codons"> + <option value="1" select="True">1. Standard</option> + <option value="2">2. Vertebrate Mitochondrial</option> + <option value="3">3. Yeast Mitochondrial</option> + <option value="4">4. Mold, Protozoan, and Coelenterate Mitochondrial Code and the Mycoplasma/Spiroplasma Code</option> + <option value="5">5. Invertebrate Mitochondrial</option> + <option value="6">6. Ciliate, Dasycladacean and Hexamita Nuclear Code</option> + <option value="9">9. Echinoderm Mitochondrial</option> + <option value="10">10. Euplotid Nuclear</option> + <option value="11">11. Bacteria and Archaea</option> + <option value="12">12. Alternative Yeast Nuclear</option> + <option value="13">13. Ascidian Mitochondrial</option> + <option value="14">14. Flatworm Mitochondrial</option> + <option value="15">15. Blepharisma Macronuclear</option> + <option value="16">16. Chlorophycean Mitochondrial</option> + <option value="21">21. Trematode Mitochondrial</option> + <option value="22">22. Scenedesmus obliquus mitochondrial</option> + <option value="23">23. Thraustochytrium Mitochondrial</option> + <option value="24">24. Pterobranchia mitochondrial</option> + </param> + </when> + <when value="free_form"> + <param name="stop_codons" type="text" value="tag,tga,taa" label="Specify stop codons as a comma-separated list" /> + </when> + </conditional> + + <param name="report" type="boolean" truevalue="" falsevalue="" checked="false" label="Report the classic glimmer table output"/> + <param name="detailed_report" type="boolean" truevalue="" falsevalue="" checked="false" label="Output a detailed gene prediction report as separate file"/> + </inputs> + <outputs> + <data name="genes_output" format="fasta" label="Glimmer3 on ${on_string} (Gene Prediction FASTA)" /> + <data name="report_output" format="txt" label="Glimmer3 on ${on_string} (Gene Prediction table)"> + <filter>report == True</filter> + </data> + <data name="detailed_output" format="txt" label="Glimmer3 on ${on_string} (detailed report)"> + <filter>detailed_report == True</filter> + </data> + </outputs> + <tests> + <test> + <param name="seq_input" value='streptomyces_Tu6071_genomic.fasta' /> + <param name="icm_input" value='streptomyces_Tu6071_plasmid_genes.icm' /> + <param name="max_olap" value="50" /> + <param name="gene_len" value="90" /> + <param name="threshold" value="30" /> + <param name="gc_percent" value="0.0" /> + <param name="linear" value="--linear" /> + <param name="no_indep" value="" /> + <param name="extend" value="" /> + <param name="start_codons" value="atg,gtg,ttg" /> + <param name="genbank_gencode" value="11" /> + <param name="detailed_report" value="" /> + <param name="report" value="" /> + <output name="genes_output" file='glimmer_w_icm_trans-table-11_genomic.fasta' ftype="fasta" /> + </test> + </tests> + <help> + + +**What it does** + +This is the main program that makes gene preditions based on an interpolated context model (ICM). + +The ICM can be generated with extracted CDS from related organisms (ICM builder). If you can't generate an ICM model you can use the non knowlegde-based Glimmer with a de novo prediction. + +----- + +**Example** + +*Input*:: + + - interpolated context model (ICM): Use the 'Glimmer ICM builder' tool to create one + - Genome Sequence in FASTA format + + >CELF22B7 C.aenorhabditis elegans (Bristol N2) cosmid F22B7 + GATCCTTGTAGATTTTGAATTTGAAGTTTTTTCTCATTCCAAAACTCTGT + GATCTGAAATAAAATGTCTCAAAAAAATAGAAGAAAACATTGCTTTATAT + TTATCAGTTATGGTTTTCAAAATTTTCTGACATACCGTTTTGCTTCTTTT + TTTCTCATCTTCTTCAAATATCAATTGTGATAATCTGACTCCTAACAATC + GAATTTCTTTTCCTTTTTCTTTTTCCAACAACTCCAGTGAGAACTTTTGA + ATATCTTCAAGTGACTTCACCACATCAGAAGGTGTCAACGATCTTGTGAG + AACATCGAATGAAGATAATTTTAATTTTAGAGTTACAGTTTTTCCTCCGA + CAATTCCTGATTTACGAACATCTTCTTCAAGCATTCTACAGATTTCTTGA + TGCTCTTCTAGGAGGATGTTGAAATCCGAAGTTGGAGAAAAAGTTCTCTC + AACTGAAATGCTTTTTCTTCGTGGATCCGATTCAGATGGACGACCTGGCA + GTCCGAGAGCCGTTCGAAGGAAAGATTCTTGTGAGAGAGGCGTGAAACAC + AAAGGGTATAGGTTCTTCTTCAGATTCATATCACCAACAGTTTGAATATC + CATTGCTTTCAGTTGAGCTTCGCATACACGACCAATTCCTCCAACCTAAA + AAATTATCTAGGTAAAACTAGAAGGTTATGCTTTAATAGTCTCACCTTAC + GAATCGGTAAATCCTTCAAAAACTCCATAATCGCGTTTTTATCATTTTCT + ..... + +*Output*:: + + - FASTA file with predicted proteins + - Glimmer prediction file (optional) + + >CELF22B7 C.aenorhabditis elegans (Bristol N2) cosmid F22B7. + orf00001 40137 52 +2 8.68 + orf00004 603 34 -1 2.91 + orf00006 1289 1095 -3 3.16 + orf00007 1555 1391 -2 2.33 + orf00008 1809 1576 -1 1.02 + orf00010 1953 2066 +3 3.09 + orf00011 2182 2304 +1 0.89 + orf00013 2390 2521 +2 0.60 + orf00018 2570 3073 +2 2.54 + orf00020 3196 3747 +1 2.91 + orf00022 3758 4000 +2 0.83 + orf00023 4399 4157 -2 1.31 + orf00025 4463 4759 +2 2.92 + orf00026 4878 5111 +3 0.78 + orf00027 5468 5166 -3 1.64 + orf00029 5590 5832 +1 0.29 + orf00032 6023 6226 +2 6.02 + orf00033 6217 6336 +1 3.09 + ........ + + - Glimmer detailed report (optional) + + >CELF22B7 C.aenorhabditis elegans (Bristol N2) cosmid F22B7. + Sequence length = 40222 + + ----- Start ----- --- Length ---- ------------- Scores ------------- + ID Frame of Orf of Gene Stop of Orf of Gene Raw InFrm F1 F2 F3 R1 R2 R3 NC + 0001 +2 40137 40137 52 135 135 9.26 96 - 96 - - 3 - 0 + 0002 +1 58 64 180 120 114 5.01 69 69 - - 30 - - 0 + +3 300 309 422 120 111 -0.68 20 - - 20 38 - - 41 + +3 423 432 545 120 111 1.29 21 - 51 21 13 - 8 5 + 0003 +2 401 416 595 192 177 2.51 93 - 93 - 5 - - 1 + 0004 -1 645 552 34 609 516 2.33 99 - - - 99 - - 0 + +1 562 592 762 198 168 -2.54 1 1 - - - - - 98 + +1 763 772 915 150 141 -1.34 1 1 - - - - 86 11 + +3 837 846 1007 168 159 1.35 28 - 50 28 - - 17 3 + 0005 -3 1073 977 654 417 321 0.52 84 - - - - - 84 15 + 0006 -3 1373 1319 1095 276 222 3.80 99 - - - - - 99 0 + 0007 -2 1585 1555 1391 192 162 2.70 98 - - - - 98 - 1 + 0008 -1 1812 1809 1576 234 231 1.26 94 - - - 94 - - 5 + 0009 +2 1721 1730 1945 222 213 0.68 80 - 80 - - - - 19 + ..... + +------- + +**References** + +A.L. Delcher, K.A. Bratke, E.C. Powers, and S.L. Salzberg. Identifying bacterial genes and endosymbiont DNA with Glimmer. Bioinformatics (Advance online version) (2007). + + + </help> + +</tool>