diff glimmerHMM/glimmerhmm_predict.xml @ 0:c9699375fcf6 draft

planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/glimmer_hmm commit 0dc67759bcbdf5a8a285ded9ba751340d741fe63

--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/glimmerHMM/glimmerhmm_predict.xml	Wed Jul 13 10:55:48 2016 -0400
@@ -0,0 +1,66 @@
+<tool id="glimmerhmm_predict" name="GlimmerHMM" version="2.0">
+    <description>Predict ORFs in eukaryotic genomes</description>
+    <command detect_errors="exit_code"><![CDATA[
+	    glimmerhmm
+	    $input $trained_specie.fields.path
+	    -o $output
+	    -g
+	    $svm_splice_prediction
+	    $partial_gene
+	    #if str($top_n_predictions) != "-1":
+	        -n $top_n_predictions
+        #end if
+	]]></command>
+    <inputs>
+        <param name="input" type="data" format="fasta" label="Genome Sequence"/>
+        <param name="trained_specie" type="select" label="Select a specie">
+            <options from_data_table="glimmer_hmm_trained_dir">
+                <filter type="sort_by" column="2"/>
+                <validator type="no_options" message="No indexes are available"/>
+            </options>
+        </param>
+        <param name="partial_gene" type="boolean" label="Don't make partial gene predictions" truevalue="-f" falsevalue="" checked="false" />
+        <param name="svm_splice_prediction" type="boolean" label="Don't use svm splice site predictions" truevalue="-v" falsevalue="" checked="false" />
+        <param name="top_n_predictions" type="integer" label="top n best predictions, -1 means infinite" value="-1"/>
+    </inputs>
+    <outputs>
+        <data format="gff3" name="output" />
+    </outputs>
+    <help>
+
+        **What it does**
+
+        GlimmerHMM is a new gene finder based on a Generalized Hidden Markov Model (GHMM).
+        Although the gene finder conforms to the overall mathematical framework of a GHMM,
+        additionally it incorporates splice site models adapted from the GeneSplicer program and a
+        decision tree adapted from GlimmerM. It also utilizes Interpolated Markov Models for the
+        coding and noncoding models . Currently, GlimmerHMM's GHMM structure includes introns of each phase,
+        intergenic regions, and four types of exons (initial, internal, final, and single).
+        A basic user manual can be consulted here.
+
+        -----
+
+        **Example**
+
+        Suppose you have the following DNA formatted sequences::
+
+        >SQ   Sequence 8667507 BP; 1203558 A; 3121252 C; 3129638 G; 1213059 T; 0 other;
+        cccgcggagcgggtaccacatcgctgcgcgatgtgcgagcgaacacccgggctgcgcccg
+        ggtgttgcgctcccgctccgcgggagcgctggcgggacgctgcgcgtcccgctcaccaag
+        cccgcttcgcgggcttggtgacgctccgtccgctgcgcttccggagttgcggggcttcgc
+        cccgctaaccctgggcctcgcttcgctccgccttgggcctgcggcgggtccgctgcgctc
+        ccccgcctcaagggcccttccggctgcgcctccaggacccaaccgcttgcgcgggcctgg
+
+        Running this tool will produce this::
+
+        ##gff-version 3
+        ##sequence-region ConsensusfromCH236920mapping 1 4148552
+        ConsensusfromCH236920mapping  GlimmerHMM  mRNA  1       122     .   +   .   ID=ConsensusfromCH236920mapping.path1.gene1;Name=ConsensusfromCH236920mapping.path1.gene1
+        ConsensusfromCH236920mapping  GlimmerHMM  CDS   1       122     .   +   0   ID=ConsensusfromCH236920mapping.cds1.1;
+        ConsensusfromCH236920mapping  GlimmerHMM  mRNA  14066   15205   .   -   .   ID=ConsensusfromCH236920mapping.path1.gene2;Name=ConsensusfromCH236920mapping.path1.gene2
+        ConsensusfromCH236920mapping  GlimmerHMM  CDS   14066   15034   .   -   0   ID=ConsensusfromCH236920mapping.cds2.1;
+        ConsensusfromCH236920mapping  GlimmerHMM  CDS   15137   15205   .   -   0   ID=ConsensusfromCH236920mapping.cds2.2;
+        ConsensusfromCH236920mapping  GlimmerHMM  mRNA  19910   24210   .   -   .   ID=ConsensusfromCH236920mapping.path1.gene3;Name=ConsensusfromCH236920mapping.path1.gene3
+
+    </help>
+</tool>