view glimmerHMM/glimmerhmm_predict.xml @ 0:c9699375fcf6 draft

planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/glimmer_hmm commit 0dc67759bcbdf5a8a285ded9ba751340d741fe63

<tool id="glimmerhmm_predict" name="GlimmerHMM" version="2.0">
    <description>Predict ORFs in eukaryotic genomes</description>
    <command detect_errors="exit_code"><![CDATA[
	    glimmerhmm
	    $input $trained_specie.fields.path
	    -o $output
	    -g
	    $svm_splice_prediction
	    $partial_gene
	    #if str($top_n_predictions) != "-1":
	        -n $top_n_predictions
        #end if
	]]></command>
    <inputs>
        <param name="input" type="data" format="fasta" label="Genome Sequence"/>
        <param name="trained_specie" type="select" label="Select a specie">
            <options from_data_table="glimmer_hmm_trained_dir">
                <filter type="sort_by" column="2"/>
                <validator type="no_options" message="No indexes are available"/>
            </options>
        </param>
        <param name="partial_gene" type="boolean" label="Don't make partial gene predictions" truevalue="-f" falsevalue="" checked="false" />
        <param name="svm_splice_prediction" type="boolean" label="Don't use svm splice site predictions" truevalue="-v" falsevalue="" checked="false" />
        <param name="top_n_predictions" type="integer" label="top n best predictions, -1 means infinite" value="-1"/>
    </inputs>
    <outputs>
        <data format="gff3" name="output" />
    </outputs>
    <help>

        **What it does**

        GlimmerHMM is a new gene finder based on a Generalized Hidden Markov Model (GHMM).
        Although the gene finder conforms to the overall mathematical framework of a GHMM,
        additionally it incorporates splice site models adapted from the GeneSplicer program and a
        decision tree adapted from GlimmerM. It also utilizes Interpolated Markov Models for the
        coding and noncoding models . Currently, GlimmerHMM's GHMM structure includes introns of each phase,
        intergenic regions, and four types of exons (initial, internal, final, and single).
        A basic user manual can be consulted here.

        -----

        **Example**

        Suppose you have the following DNA formatted sequences::

        >SQ   Sequence 8667507 BP; 1203558 A; 3121252 C; 3129638 G; 1213059 T; 0 other;
        cccgcggagcgggtaccacatcgctgcgcgatgtgcgagcgaacacccgggctgcgcccg
        ggtgttgcgctcccgctccgcgggagcgctggcgggacgctgcgcgtcccgctcaccaag
        cccgcttcgcgggcttggtgacgctccgtccgctgcgcttccggagttgcggggcttcgc
        cccgctaaccctgggcctcgcttcgctccgccttgggcctgcggcgggtccgctgcgctc
        ccccgcctcaagggcccttccggctgcgcctccaggacccaaccgcttgcgcgggcctgg

        Running this tool will produce this::

        ##gff-version 3
        ##sequence-region ConsensusfromCH236920mapping 1 4148552
        ConsensusfromCH236920mapping  GlimmerHMM  mRNA  1       122     .   +   .   ID=ConsensusfromCH236920mapping.path1.gene1;Name=ConsensusfromCH236920mapping.path1.gene1
        ConsensusfromCH236920mapping  GlimmerHMM  CDS   1       122     .   +   0   ID=ConsensusfromCH236920mapping.cds1.1;
        ConsensusfromCH236920mapping  GlimmerHMM  mRNA  14066   15205   .   -   .   ID=ConsensusfromCH236920mapping.path1.gene2;Name=ConsensusfromCH236920mapping.path1.gene2
        ConsensusfromCH236920mapping  GlimmerHMM  CDS   14066   15034   .   -   0   ID=ConsensusfromCH236920mapping.cds2.1;
        ConsensusfromCH236920mapping  GlimmerHMM  CDS   15137   15205   .   -   0   ID=ConsensusfromCH236920mapping.cds2.2;
        ConsensusfromCH236920mapping  GlimmerHMM  mRNA  19910   24210   .   -   .   ID=ConsensusfromCH236920mapping.path1.gene3;Name=ConsensusfromCH236920mapping.path1.gene3

    </help>
</tool>