view test-data/glimmer_wo_icm_trans-table-11_plasmid_genomic.fasta @ 1:b7b320f4c595 draft default tip

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit a4b0969b33a68a0ea9ba12291f6694aec24f13ed
author iuc
date Tue, 30 Oct 2018 18:51:01 -0400
parents a4136c1534be
children
line wrap: on
line source

>orf00001 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
TTGGCTCGTCTGCCTCGTGAGGAGATTCAAATGTCTGTTTCCCGGGTTCCGCTGCGGAAA
CATCAGGTAGAGCTTATGTCGGACCTCAGGAAATGGGTCCGGGTAGCCGCCCGGGAAAGC
GCCCGCACGGAGCGTGGGGCGCGGGCCACGGTGGTGTCCGCTACGGGTACGGGAAAGACG
ATCAGCGCGGCTGCTGCGGCGTTGGAGTTGTTCCCTTCGGGGCGGGTTCTCGTGATGGTG
CCGACGCTGGATCTGCTGGTGCAGACGGCGCAGTCGTGGCGGGCGGTGGGGCACACGGCG
CCGATGGTCGGGGTGTGCTCGCTGCCCAGGGATCTGCTCCTGGAGGAGCTGCGGGTGCGG
ACGACGACCCACCCGATCCGGCTCGCGCTTTGGGCCGGATCGGGGCCGGTGGTCGTGCTG
GCGACGTACTCCTCGCTCGTGGGCGAGGACGGGCAGGGCGGACCCTTGGAGGCCGCTCTC
GCCGGGGCTGGCTTGTACGGGCAGCGGATGGATGGCTTCGACCTTGCGGTCGTGGACGAG
GCGCACCGCACGGCGGGCAGCGCGGAGAAGGCGTGGGCGGCGATCCACGACAACGCCCGT
TTTCCGGCGGCGCACCGGCTGTACCTCACCGCGACCCCGCGCGTCCTGGCCCCGGCCCGT
CCCGCCAGGCACGAGGGCGAGGAGGGACGCGGGGAGGCGCCGGCACTCGTGACGATGGCG
AATGATCCGGCGGGCGAGTACGGGGCGTGGATTCACGAACTCGGTTTGTCCGAGGCAATC
GCGCGAAAAATCGTCGCGCCTTTTGAGATTGACGTTTTGGAGATTACTGATCCTGAGCCG
GAATTGATGGAGGGATTGGATCGGGAGGCGCGGCGTGGGCGGCGGCTTGCGTTGCTTCAG
ACCGGGCTTTTGGAGCACGCGGCCGAGCATAATATTTGCACCATGATGACGCTTCATCAG
CAGGTTGAGGAGGCGGCGGCTTTCGCGGAGAAAATGCCGGAGACGGCGGCGGAGCTTTAC
CGGAATGAGGTGTCGGCGGAGGATTTTGCCCTGGCCGAGGAGCTCCCGGCCTCCGAGGTG
GGTGGGGGGTTCTACGAGCTGGAGCCGGGGCGTCATGTGCCGCCGTCGCGGGTGTGGTCG
CGGTGGCTGTATGGGGAGCATCCTGTGGCCGAACGGCGTTCTGTGCTGCGGGAGTTCGCG
AACGGGATGGACGCGGAGGGGCGGCGGGTGCACCGGGCGTTCCTCGCTTCCGTACGGGTC
CTGGGTGAGGGCGTCGACATCGTCGGGGAGCGCGGGGTCGAGGCGATCTGCTTTGCCGAC
GCACGCGGGTCTCAGGTGGAGATCGTGCAGAACATCGGGCGCGCGTTGCGCCAGAACCCG
GATGGGCGGGCGAAGACGGCGCGGATCATCGTGCCGGTCTTCCTGCGGCCGGACGAGGAC
GGGGAGGGCATGGTGGCGTCGGAGGCGTACCGGCCGCTCGTCGCCGTACTCCAGGGCCTG
CGCTCGCACGACGAGCACCTGGTCGAGAAACTCATGCTGCGGGCGCGCGTACGGGCCGAG
AGCGCGAGCGCGCGCAGCGCGGAGGAGGGCGGTGCGGGGCCCTCGCGGCTCCTGTCGGAC
TCCGGGACGGCGGCTGCGGCCTCCGAGGGCGTCGAGGGCCAGGAGCAGGGCGAGGACGGC
GCCGAGGCGGAGTCGGTGCTGCTGCGGTTCTCCTCGCCGCGCGCGGCGTCGACGGTCGCG
GCGTTCCTGCGGACGCGGGTGTACCAGCCCGAGTCGCTGGTGTGGCTGGAGGGGTACGAG
GCCCTGCGCGCCTGGCGGGCCGAGCAAGGGGTGAGCGGGGTGTGCGCGGTCCCGTACGAC
GCCGAGGTCGCCGCGGGGGCCTCGCGGCGGTACCCGGTCGGGCGGTGGACCGCCGCGCAA
CGCCGCGCCCGCCGCGAGGGCACCCTCAGCGCACACCGCGTCGAGCTCCTCGACGCGGAG
GGCATGGTGTGGGAGCCGCGCGAGGAGGAATGGGAGCGCACGCTCGCGGGGCTTCGCTCC
TACCGGACGGCGTACGGGCACCTCGCCCCCCACAGGCGCGAAACCTGGGGCGAAGACGAG
GGTGAGGACGTCGTACGCGTCGGGGACCTGATGGCGAACCTCCGCCGCAAGGACGGACTC
GGGAAGGACGCGAAGCGGGCCGCCGCGCGCGCCGCGCAGCTGAGGGCCGTCGATGCGGAC
TGGGACTGCCCGTGGCCGCTGGACTGGCAGCGCTGCTGCCGGAAACTCGTGCTCCTGGCC
GCGGACGAGCCCGGCGGGCGCCTGCCGGAGATCGCGCCCGGGGTCTGCCTGGACGGGGAT
GACCTCGGGGTGTGGGTCGCGCGGCAGCAGGAGCCGCGGGTGTGGGCGCGGCTCAGCACC
GAGCAGCGGGCGCGGCTCGAAGCGCTCGGGCTGCGGCCCACCGAAGCGGCCCCGGGGCGG
GGTGTGGAGGGCACGGGGGCGGCGGGGAGCATGAAGCGGACGGCGACGGCGCGAACGGCT
TTTCAGCGGGGTGTGGCGGCGCTCGCGCAGTGGGTCGAGCGGGAAGGCGCGGGGAAACCC
GTACCCCGCAAACACGTCGAGACCGTCAGCGTCGACGGCGAGGACGTCGACGTACGCCTC
GGCGTATGGATCTCGAACACCAAGAGCCGGTACGACGGGCTGAGCGAGGACGAACGCGCG
CAGCTCACCGCACTCGGAATGCCCTGGGCAGGATGA
>orf00005 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGCTCGCCGCCGTACGGGACACGATCGCCGAGACCGGCCAGGGACCGTCCGTACGGCAG
ATCCAGCGCGTCACCGGGCTCGCGCTCGGCACCATCGCCCACCACCTGAAGGCGCTGGAG
GAGAGCGGCCCCCTCGTCCGTACGGGCCTGCACTGGCGCACCTGCCGCCTGGGCTGA
>orf00006 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGACCGATGAACTGCTCCGCCTCGCCCAGGAGAGGCGTGCGACCTACCGCGACCTCACC
CTCGGCGGCCCCGCCCGCCCCCCGACACCTCTGCGCCGGGCACTGATCCGGCAGTCCGCC
CGCCTGCTCGACGGCCCGCCCACCACGGCCCGCCGGGCTCTGCTGTGCCGCCCGCCCACG
CCCGCGTCCCCGCCCTCGCGGGGGACCAGGTGA
>orf00007 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGACCGATTTCCCCGACGATCTCCTCGCGGCTCAGCGCGACCTCACCGCCGTACGCGCC
ACCCTTTCCGCCCGCCTCGCGGCGCTGCCGCCCTCGGCCGAGCCGATGCCCGCGTGGGAG
CGGCCCGACGGCTACTGGGCGGGCGCCCGTACGCACCCGGCCTCCCCGGGGTGGAGCGAG
GAGGAGCGCGAGGAGGTCGCCGCGCTCCGCGAGCGGGAGCGGGATCTGGCCGGGGTGATC
GTGACGCACGAGCTGTGGGCGAGCGTGCCGGCCGGGGAGCGGATGCGGGCCCGCGACGCA
CTCAAGCACGCCCACGAGGCCCCGGCCGCAGCCGGGGCGGCGGGGGCGCGGGGCTGA
>orf00010 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGTCACAAGCCAATCACAGGACATCCGGCACTCCCACGGCCGAGCCCGTTGGAACAGCA
GAGGAGATCGTCATGGCAAGTAGCAACCGCGCCGTCACCTTCCAGAACCCGAAGGAGATG
CGCGTCGAGTCTCTGGATTTCCCGAAGCTTCAGATGCCGAACGGGAAGAAAGCCCCGCAC
GGCGTCATCCTCAGGATCGTCGCCACCAACATCTGCGGGAGCGATCTGCACATCTACCGT
GGGTCCTTCCCGGTGCCCCAGGGTATGGTGATGGGCCACGAAATGACCGGGGAGGTCATC
GAGGTCGGCCCCGACGTCGAGTTCCTCAGCGAGGGCGACCTCGTCTCCGTCCCCTTCAAC
GTCGCCTGCGGCCGATGCCGCAACTGCCGGGCCCGCCGGACCGACGTCTGCGAGACCACG
AACCCTGAGGTGTCCTGCGGAGCGTACGGCTTCAACCTGGGCGACTGGACCGGTGGACAG
GCCGAGTACTTGTTCGTCCCTTATGCCGACTTCCAGCTCCTGCGCTTCCCGGACAGGGAC
CAGGCCATGGCGAAGATCCGTGACCTGGCGCTGCTCTCGGACATCCTGCCCACCGCGTTC
CACGGCCTCATGGAGGCCGGCGCCAAACCGGGCTCCACCGTGTACATCGCCGGCGCCGGC
CCGGTCGGCCGCTGCGGCGCAGCAGCGGCGCGGCTCCTCGGGGCGTCCTGCATCATCGTC
GGCGACTACCACAAGGACCGCCTGGAGCTGATGAAGAAGAACGGCTGCGAGACGATCGAC
CTGAGCCAGGACGCAGCGCTCACCGACCAGATCGAGGCCATCCTGGGCGAACCCATGGTC
GACTGCGCAGTCGACTACGTCGGCACCGAGGCACACGGCATCGGCCGCGAGGCAGAGGAC
ATGGACCCGGCCCACGCCCTCAACCAGGTGCTCGACGCCACCCGCGCGGGCGGAGCCACC
GGAGTCATCGGCGTCTACGGTCCCGACCCGCTCGCGAAGTCGAAGGCCGAGCAGCAGGGA
ACGTACCCGATCGACTTCGGCAAGGCCTGGATCAAGTCGCCGCGGCTCGCCGCCGGGCAG
GCACCGATCATGCACTACAACCGTGAGCTGATGATGGCGATTCTGTGGGACCGCATGCCC
TACTTGAGCGCGATGCTCAACACGAAGGTGATCAGCCTCGACGACGCCCCTGACGCCTAC
GCGACCTTCGACACCGGCGTGTCCGAGAAGTTCATCATCGATCCCCACGGCCTCATTGCC
GCCTGA
>orf00011 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGACCAACGACTTGCACGGCAGGAAGATCGCAATCCTGGCCACGGACGGCGTTGAGCGC
GTCGAGCTCGAAGAACCTCTCGGCGCACTGCTGGGTGCTGGAGCGCAGGCTGAACTCCTG
TCCCTCCACACCGGCGAAATCAACGCGCGCCAGATGGACATCGAGCCGGCCGGAACCTTC
ACCGTGGACAAGAAGGTCGCCGACGCCCGGATGGGTGACTACGACGCGCTCCTGCTGCCC
GGCGGCACCATGAACCCCGACCAGCTGCGCGCCGACCCCGACGCCGTCGCCTTCGTGAGG
GGGTTCGTGGAGACAGGGAAGCCCGTTGCCACCATCTGCCACGGACCCTGGACCCTGGCC
GAGGCTGACGTGCTGCACGGTCGCCGCCTCACCTCTTGGCCCAGCATTCGGACTGACCTG
CGCAACGCCGGCGCCGAGGTCGTCGACGAGGAGGTCGTAATTGACCGCCAGCTGATCTCC
AGCCGCGGCCCGCAGGACCTCTCTGCCTTCTGCAAGGCGATCGTCGAACGCTTCGCCAAC
GCACCGCAACCCACCTGA
>orf00012 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGTCTTGCGGAGGTGGGGCAGCAGGAGAAGATCTCTTCGTGCGGTACTCCGTCCCCCGG
GGACGCGCCCGCACGACTGCGGGGACCGGCCCGGCCAACGTCAAGGCGTACAACCGGCAG
CTGTGGGCCCTGATCGCGCAGGGTAAAGCCAAGCTGGCCTGGATCGTTTTCCAGGAGCTG
TCGCTGGACCGAGCACCGAGCCTCCCAGCACCTTCGGCCACCGAGAGGGCAGTCGGGCCA
AGGTCCTCCTCCCTCATCGACGGCAGCTGA
>orf00013 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGACAACGCAGGTCAGCAAAGCGGTTCTGGTGCGCCTCGAAGCGCTGCCCGGCAGGGAA
GACGACGTCCGCGACTTCTTGAACCAGGCGCTGTCGGTCGTCATGGGGGAGCCCAAGACC
GTCAGGTGGATCGGAATCCAGTTCGGACCATCGTCGTTCGGGATCTTCGATGCCTTTCCC
GACGATGAGGGACGTCAGACGCATCTGTCGGGTGCGGTCGCCAAAGCGCTCGGCGAGAAG
ACGGGTGAGCTCTTCGAGGAGCCCACAATCGAGCAACTCGATGTCGTCGTGGAGAAGCAG
CCCGCGTAG
>orf00016 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGAGGAATCTCCACGGCGTCCAGGTCACCAACAGGGGCTGGATGAGCATCTTCGTCAGC
AGTATCTCCTACACCGCGACAGTCAAAGCGTCAAGCGGTAGGGGTGATCGGCGAGCAGTG
GCAGATGGGTCGGCGCATCGGGCGTAG
>orf00017 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGCCGGCAGACACCATCGTACTGTTCCGGCAAAAAGCGCTCATTCTCCACAACGCCCGG
GATATCGCCGAGATCGTCCGCCAGCTGCTGGGGGAGCCCTGGCCGGTCGAGCCGGAGAAC
CTGTCGAGCCGGAGGACCTATCGAGCATCTCGCCCTATCTGA
>orf00018 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGGACTTGGTGGTCCAAAGCCTTGGCCACCGTTACATCCAGGAGGAAGTTATGGCGGAT
CCGCGGGCGGTCAGCCTTCCTTGTGGGGTTGCGGTCACGGCGCTCGGTCAAGGTACCTGG
GGGATGGGGGAGAATCCCGGGCGCCGCGCGGCCGAGGTGTCGGCCTTGCGTGCCGGGCTG
GACCTGGGGATGACTCTTGTCGACACCGCCGAGATGTACGGGGACGGCGCGGCGGAGGAG
GTGGTCGCCGAGGCGGTGGCCGGACGGCGGGACGAGGTCTTCTTGGTCAGCAAGGTGCTT
CCCTCCCATGCGGACGCCCGCGGAGTGGCCGAGGCCTGCCGGGGGAGCCTGCGCCGTCTG
CGCACGGACCGGATCGATCTGTATCTGCTGCACTGGCGTGGAGCCGTGCAGCTGGAGGAG
ACGGTTGAGGCGTTCGAGGCCTTGGTGCGGGAGGGTGCCATCCGCTCCTGGGGTGTGAGC
AACCTGGACGTGGATGATCTCGCGGACCTGCCGCCTGGAGCCGGGCCGCAGACCGATCAG
GTGCTGTACAACCTCAGCCGTCGAGGGCCTGAGTACGGTCTGCTGCCCAGGTGTCGTGAA
CTATCGATCCCCGTGATGGCGTACTCGCCGGTCGAGCAGGGCCGACTGCTCCGCCACACG
GCGCTGCGGGACGTGGCAGCCGCCCACGGTGCGACGCCCGCGCAGATCGCCCTGGCCTGG
GTCCTGCGGCACGAGGACGTCATTGCCATCCCGAAGGCGTCCTCCCGCGCGCACGTCGAG
GAGAACAGAACAGCTCTGGAGGTGGACCTGACCGCCGAGGACCTCGCGATGCTGGACCGG
GCGTTCCCGCCCCCGAAGAGCAAACGCCCGCTGGAGATGCTGTGA
>orf00019 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGGGTGGTGCTCGTGGACGGGCAGGAGGTCGGGGGCGGCTCCCCGCGCGGCGCCAGCTG
GCGGACGGGTGGCGGTACCACGTCGCGCTCCCGCTCTACCGCACCGTGGGCGGGGAGGGC
CTGGAGGTCGAGGCGGCGCAGTACGAGGTGTGGGTACGCGCGCCCGAGCACGTACGGCCC
GTCGAGGATGTCGACTACACGGGCATGCCGACCACGGCGCTCCCGGCGCCCTCGCTCGTG
GACGTGGCGCTCGGCCCGCGCAGGCCCGCCGGGTGGGTGCTCGCGAAGAGCGGCGGCGGG
CGCCGTGGGCCCTCCCGTGCGGTGCTGCACACCGTCGACTGCGCCGAGGCGCCGCCCGGC
CTCCCGGTCCTGCGGGTGGAACAGGCGCTCAACGCCGCCGAGCACCCCGCCACCCGGGCC
TGCGCCCTGTGCGGCGCCGCCGCCGAACTCGACCCGCTCCTCCGGGGCTTCGACCCTCAC
GACGAGGACACGGGCGCTTCTCCCTGA
>orf00022 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGGCACCGGCCGACGTCTGCCTGGAGGCGGTCTGTGAGGAGCCGCGCGAGCGGGTCGAC
GGCGTGCTCTACGCCTGCCCCGCCCACGGGGCCGAGGCGGCCTCGCGGATCACCGAGGCG
GGATGGACCGCGCTGGTCAAAGTGATGGGGCCCGCGAGCCGGGCCAGGTGCGAGGTCTTC
GACGGCGCCACCCGCGAGGCACGTCACCTCCTGGGCGCGTAG
>orf00023 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
TTGCTCGGGGGCCACGTTGGTCACACATCCTGCCGCACTTGCCCCACGCTCTCGTGGAGC
CAGCCCATACAGCCACGGCACCCTCAACCCCGACACGATCACCCTCGTACGTTTCACACT
TCCCCCATTAGCTCGGCAGTCGAGTACCGCATCCTGAACGTCCGCACGTGGGAGGCCGGG
GACGACGCGGGCCTGGATGCCGCGTGGGTCGATGAGGTCGTGGTGGACCTCGGTTCGCAG
TGGGGCCAGTACGAGTACGTCACCAACATCGGCTTCGCCGCCTGA
>orf00024 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGAACAAGGGCTTCAAGAAAAAGCGGGTAGTCGCTATAGCGGCCGCGTCCGTCATGATG
CCGCTCGTGGCCGCCGTTCCGGCGAGTGCCACCACCGGCGCGGAGGTCCGGGACGGTGCA
CGGTCCTTCACCGTCCGCCTCGACATCGGGAAGGGCACCCGGGGCTGTTCCGGGGTTCTG
GTCGACGCCCAATGGGTCCTTACCGCGCGAAGCTGCTTCGCCGACAACCCGGCCACGAGC
ATCGACATCCCCGCAGGAGCGCCCGCGCTCCGCACGACCGCCACTGTCGGCCGTACCGAC
CTCACCACAGGGACCGGCGAGGTCCGCGAGGTCGTCCAGCTCGTTCCGCGCACCGACCGC
GACGTGACGCTCGCCCGGCTCGACAAGCCCGTCGCCGGGGTGGCTCCCGTCACCGTCGGT
ACTCAGCAGCCGAGCGCCGGCGAGGCCCTGACCGCCGCCGGATTCGGCCGTACGAAGACC
GAGTGGGCCCCGCTGCGCCTGCACACCGCCACCCTCGGCATCGACGCCGTCCAGAGCCAG
GACATCAGCTTCCACGGGCAGGACGGACAGGCCCTGTGTGCGGGGGACACCGGCGGCCCG
CTGCTGCGCGAGAGTGGCGGCAACGCCGAACTCGTCGGCATCAACTCCCGTTCCTACCAG
GGAGGGTGCTTCGGTATCGAGGCGACGGAGACCCGCTCCGACGGAATCTCCTCGCGCGTC
GACGATCTCGGCGACTGGATCGCGAAGAACAGGCTCGCCGCTCGCGCCCCGGAGCAGATC
AAGCACCTCACCACCGGCGACTTCAACCGCGACGGGCACCCCGACATCGCGGCGATCCTC
GACGACAACAACTTGTACGCCTTCTACGGCACGAGTGACGGCAAGCTCACCTATGGCCGC
GAGCTGTGGGCGCACGACGGCACCTGGGGTTCCAAGGCCCGCATCCTGGGCGGCGACTTC
AACGGCGACGGCAACGCCGACATCGCGGCTCTCAAGGACGACGGCGCCTTCCACAACTAC
GCCGGAACCAGCGGCGACCTGCTCAGCCCGGCGGCAAGCATGTGGAAGGACAAGACCTTC
GCGAGCTACCTGCCGACGACGTACCGTGCCAAGGGCTGGACGCGCGACGGCCTCGTTGCC
ATCGCGCCCACCGGCCGCCTCTACGCGTACGCGACCGGGGCCAACGGCATCCTCACCGAC
AGTCGCACCGAGGTGTGGCACGACGCCACCTGGGACAAGAAGTTCCTCACCAGCGCCGAC
TTCAACGGGGACGGCCTCAACGACATCGCCGCGATCTCCCAGAAGGGCGAACTGGCCCTC
TACCCGGGGAAGACGGACGGTACATTCGCCAACGCCAAACTGATGTGGGACGACGCGAGC
TGGGGCGGCTTCCACGCCCTGCTGAGCGGCGATTTCAACGGTGACGGCAACGCCGACATC
GTTGTTCTCAACAGCGTCGACCACCTCTACCTCTACCCCGGAGACGGTAAGGGCGGGCTC
GGCACCCGCCGCAGCATGTGGCCCGCCATAGGCTGA
>orf00027 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGTCCGTGACGACTACGGATGCACAGATGACACTGAATTCGCGCTCACGCGCCCTTCTC
GCGGTCGCCGCCGCGACGCTCTCGCTGGCCGGCGTCTCCACACTGGCCTCCGCCGACGGG
AAGGACTCCCCGTCCGTCCAAGCGGCAGCGGCGGAGCAGCCCGGGTACGCGGTCGAGACC
TTCGACTATCCCGGCGCCGACCGCATCGCCGCCGAGCAGGGCATCACGCTGCGCCGGGGT
GACGGCCACATCGTCCTCGCGGAGTGCGACGACTCCAGCCCCATGATCAAGGTGTGGACC
CGTAAGAGCGCGGCCGGGAGGTTCTGCTTCCGCAGCACCGCCTCCACCGGGTCCCTCACC
CTGGAGGTCCCCGACGTCTACGCCATCGAGACCGTCCAGCGGGCCGTGCACGCGGAGTTG
GAGGCCGAGGGCAAGTCAGTGGAAGTGGACGTGAAGAAGGACGAGTTCAAGGGAGTGGGC
GAGGGAGTCGGCGACGCCCCCACGGTTCTCCTCGAACTCCGCGTCACCGGCTGA
>orf00031 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGGGTGTCGCCGTGCTGCTCGCCCTGACGGCCGGGATGCTCGGTCCGGCGCCGGCCTCC
GCGCTCGACCCCGACCCGGACGAGGACGACTACACGCCGGTCGCGTACCTGCCGGCGACC
GACCGGGGAAAGGTGCTCACGGCGTGGGAGGAGGGCGGGCCGGGCGTCAAGGCAGCCGCC
GAGGCAGCCCTGCTCGGCTCGGACGCCGACGTACGGAAGTTCCTGGACGGGGAGGAGGCG
CTCGCGCGGACGGCGGACGACCGCGTCGCCACGGTCCAGATCCTCTCGCTCGGCGGGCGC
GCCGTCCGCGAGGCGGCCGAGGAGGCCCTCGCGGGCCCCGAGGAAGGCCTCGCCGACTTC
CTGAAGGACGGCTGGAAGGAGCCTCTGGAACAGGACCAGCGCGTCCAGGTCACCCAGATC
ATCTCCTCCGCGGCCGGACCGCAGGTGGCGGCCGACGGGCGCAAAGCGCTCAACGGGGGT
ATGGAGGAGGTACGGAAGTTCCTCTCCGAGGGGCAGTACACCGCCGCTGACAACGATGCC
AGGGTGCAGGTCGTCCAGATCATGAGCACCGGCGGGCAGGCCACCAAGGAGGCCGCCCGC
GTCGCGCTCAACGGCGACATCAACGACATCCGCGAGTTCCTGGAGGTCGGGCAGCACACT
GCCCGTGCCCGCGACCAGGAGCAGGCCACGGTGGCCGATCTCGCCACGCAGGCCACCGAG
GCCGGGCGGCAGGCGCGGGTGGAGACCGACCGCGCCAAGGAAGCGTCGGATCGCGCGATC
AAGGCGACGAAGCTCGCCAAGGAGGCGGCGCAGAAGGCGGCCAAGGAGACCGAGGCCGCG
AAGGACGACGCCGTCAGGGCGTCGAACGCGGCAGGTCGTGCCGCCGACGCCGCGCGCGGT
GCCGCACGGGCCGCGCAGGTGGCCATCGACGCCGCCAGCGCCGCCAACCGGGCCGCCCGC
GTCGCGGCCAACGCCGCCGCCCAGGCAGCCTCCGCGGCAGCCGCCGCGGCCAACGCCGCC
GCTCGGGCCCGGAACGCCGCCGCGGCAGCGGCCACCGACGCGGGGAAGGCGTCCGCCGCC
CGCTCCGCGGCCGAGGACGCCCTGGACGCCGCCAAGGGCGCGAAGAAGGCCGCCCAGGCC
GCCGACTTCGCCGCCACCGCCGTCGTCGAGGCGGCCGGCGCCGCCCAGGCAGCCGCCAGT
GCCGGGCAGAACGCCGACGCCGCGGCGTCGGCCGCGTCCGAGGCGAGCGGCCAGGCCGGC
GTCTCCGACGCGCAGGCCGCACGGGCCAGGGCCGCCGCCGCCGAGGCGCACCGGCACGCC
GCCGAGGCGACGGCCGCCGCCAACCGGGCCGACTCGCTCGCGGCGAAGTCGGCCAAGGCG
GCGCGTGAGGCGAGGGACGCCGCCAACGCCTCTGCCGAGCACGCCGAGAAGGCGGCTGCC
GCCGCCAAGGAGGCCGCGGAGCACGCGGGCGAGGCAGCCACCGCCGCGGCCGAGTCCACC
AAGCACGCCGCTGCCGCGAAGACCGCCGCGGACGCGGCGAGCGCCGCGGTCCAGCAGGCC
AAGGACACGTTCACGCTCGCCCGCGAGGTCGAGGCCGAGGAGCTGGCCTCCCGCACGGCC
GGAGCCGTCGAGCAAGCGCGTTCGCTGCGGGACCAGGACGACGAGCGCATCGCCGAGGGC
AAGAAGCAGGCCGACGCCGCCGCCGCGCTCGACTCCGAGGCAACGGAGCTGGCCGAGGAG
ATCTCCGCGTCCGGCGAGAACACCGACGCCCTCGCGCCCAAGGCACGCAAGGTCGCGCTC
AACACCGTCAAGACACGAGGCCCGTGGAGCGTCAGCGCCGCCGAGGTCGCCCTCGCGGGC
TCCGCCGACGACGTCGTGCGGTACGTGGCCGAGGGCCGCGAGGAGGCCGCCGCTCTCGAT
CGGCGCGCGCGTGCCGAGACGCTCGCCACCGACTCGACGTCGGCGGACGTGCGGACAGCC
GCCGCCGCTGTCGTGGAGGAAGGCGACGCCCCGATCCAGGAGTTCCTGAGGACGGGACAG
TTCCAGGCGGTCTCCAATGACCTCCGCGTGCGCATCACCCAGTTGATGAACGGTGCGGGC
CCCGGCGTCAAGGAGGCGGGCCAGGCCGCGCTCAACGACGGTTCCCCCGCGAAACTGCGG
GACTTCGTCGACAGCGGCTACTACGTGCAGCGGGCCAACGACGAACGCGTCCAGGCGACG
CAGCTCGTCGGTTCCGGGACACCGGAGGAGAAGGCCGCCGCGCGCATCGCCCTGGAGGGA
CCGCCGCAGGTCCTGCACGCCTTCACCGAGACCGGCCGTTTCAAGGCCAAGCGGCAGGAC
CTGCTCACCGCGACCCACACGGCGCGAGTCCAGGGCCTGATAGCCAGCGCCGCCAAGGTG
GCGGCCGTCGCCCAGCAGAACGCGGCGCTCGCCGGTGAGACGGCGGCGAAGGCGCGCAAG
GCCGCCGCCGAGGCGAAGAAGTACGCGGACCAGGCGAAGGCGTCGGCCGAGCAGGCCGCG
TCCTACAGCAAGGACGCCGACGCCTCCGCCGACGCGGCGCAGAAGTCGGCCGACCAGGCG
GCGAAGTCGGCGAAGACGGCCCGCGCCGCCGAGGCCGACGCCCACGCCGCCGCCCGGGAC
GCGGACCACTCCGTCGCCCGCGCCGAGGCGTCCGCCGCCTCCGCGCACGGCTCCGCCAAC
TCCGCCTGGGCCGCCGCCGGTGCGGCACGCGCCTCCGCCGAGGCGGCGGGCAAGGACGCC
GACGCCGCGGCCGAGGCGATGACCGAGGCGCTGAACGTCGCCGCCGAGAAGCAGTGGGCG
GAAATCCGCAAGGCGCTGGAGGACGAGCAGGACCGGGCCGACCAGGCGTCCCTCCAGGAG
CTGGAGGAGTACTTCGCCGACCTGGCCAAGCAGCAGGAGAGCGGCGACACCGACTGGTGG
GACCTCGCCACCCTGGGGCACACGGTCCTGGACACGGCCGGGCTGGTGCCCGGTTTCGGG
GAGATCGCCGACGGTATCAACTGCGGCTGGTACGGAGCCGAGGGCGACAGCCTGAACGCG
GGCCTCTCCTGCGCGGCGATGATCCCCTTCGTCGGCTGGGGCGCGACCGGCGGGAAGTGG
GGCAAGCGCGGTGTTGACGCGATCGAGGCGTTCAACAAGGCCATGCGTGCGGAGGGGAAG
GTCCCGCACATATGGTCGGCCAATCCTCGCAAGGGCCGCAACAACGTTCAGAACGCCTAC
AGCCACTGGAAAGACCACGGCGCCCAGTTCCCCGAGCTGAACAACGCGCTGGACTACGTC
AAGAAAGCGCGGCAGTACGGGGACATGGCACTGGCGCAAAAGCCGGTGAAGGGCTATCGC
GTCTTCTCGCAGAACGGCGGTGCGGTGGCGATCTTCGACGAGAGCAACGGCGCTTGGGCC
GCCTTCACGAAGGACGGGATCCCGCAGACCATGTACAAGCCCGAGCCACGCAGCCAGAGC
AATCCCAACGGGTACGCGACCACCATCGAGGACTGGCTCGCCGAGCCCGGCCGCGGCACA
GAGATACGCTGA
>orf00033 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGGCTGAAGAGGAAGAGTGGACGAAGGTCCCGGTCGAAGAGGTCTGCCGGGTGTGCGGC
CTCTATGCCGAGGGGGCCCTGTGGGACGAGTACGGGGCGCCGCAGTACCTCACCTGCCCT
TGCTGCGGTGTGGAGTCCGGGCTCGGTGACGCGTCCTACGAAATGGTCACGTGGAACCGG
GCGCGATGGCTTGAGTCCGGCGCGGAATGGCAAGAGCCCGAGTTCCGTCCCACGAACTGG
AGCCTGGAAGAGCAACTGGCCTGTATTCCCGCCAAGTGGCGCTGA
>orf00036 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGGGAGCCGTGCGCAGGCTGGTCGACGAGGCCACCGGCGAAGTCGTGCCCTATGCCCCG
TACGCCTTCTCCGGCGGCGGACACGTCCAGGTCGACAAGGCGCGCGTCGCGGCCATCACC
GAGAGCCGCACGTTCACGCCGAGCCAGAAGTACTTGATCCTGTGGTGGATCGGCACGTCA
CCGCCCGGCATGGAACCGCTGCGCCTCACCGGCGCGGACATCGCGAAACGGGTCGGCATG
ACCCCCGACGCGGTCGGCAAGATCAACCGGGCCCTGCGCCGGCGGCGCATCCTGATCGAA
CGCGGCCGGGTGGGCAGCTACCGCTTCTACCGGATCAGCCCCTACATCGCTTTCCACGGC
AGCGGAGTCGAGCAGCGCGAAGCGATCACGCTGTGCAACCCGCCCGACATCCCAGGCTTC
GACAAGGACGCCCGCACGGCAGCGCAGGAGGCGCAGTGA
>orf00038 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGCTGACGCGCTCGGCAGGCCTGACGGCCAACCAGCGCCTCGTCCTCATGCTCTACGCG
ACGCACAAAACCGACCGCTCCGGCGCCGTCCCGGTGACCGCCGCCGAGCTTGCCGCGCAC
CTCGGGCTCGCGCCCACCGTGTTCTCCCGCACCCGTCGCCAGCTCGTCGCGGGTGGATGG
CTGGAGGAATCGGAACGGTTCGGTCACATCCGCTTCTACCGCCTCGCCCCGAAGAGCACC
GGAGAGCAGGTCGTGGTCCCCCTGCGCCGGACCGGCACCCGCTGA
>orf00039 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGCATGTGGGACGCCTGAGGGACGGGCTCATCAACATGGACGCACCCCACCCCTTCAAC
GCGGGGCCGGACGGGTCCCGGACGCCGGTCGAGGAATGCAAGAGCGTCAGAAGCCCACGA
GGACCTCATGCCCGATTCCGGGAAGCCACCCCCCCCTCCCTCATGTACTCCACGTGCATT
TACCCGGTTCCTGGGAACTGGCAGGCAGATCCTGGGAACTGGCAGGCAGATCCCAGGATC
GTGGTGTCCGACAACGTTTCAGCAGGTCGGAGGGGATTTCCTGGCGCCGCCCTCTAA
>orf00041 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGAAGCCGATGTTGGTGACGTACTCGTACTGGCCCCACTGCGAACCCAGGTCGACCACG
ACCTCGTCGACCCACCCGGCACCGGCGCAGGTTGAGGGTGCGGTCCGAAATCGTGAGCCC
GGCCTCCCGGGCGGCGGCGAGCTGGCGGGGGCTGCCGGTGAGGGGGCGCAGAGGGGCCGT
GAGGTGACGGCGGGTGGTGACCGGGGAGGCGACGAAGCCCGCGAGGCTGTCGAGGCCGCG
GGGCGCGACGACGCTCTCGTGCACGGCGAGGCCCGCGCGCCACCGGAATATGCGCACGCC
TGA
>orf00043 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGCACGTGTCCACGTTTTCCGGAGGACTCATGAAGATCGGCATTGTCGGCGCGGGACAC
ATCGGCGGGAACCTCACCCGCCGTCTGACGGCGCTCGGGCATGACGTGAGCGTGGCCAAT
TCGCGTGGCCCACAGACGCTGTCCGAGCTCGCCGAGGAGACCGGGGCCACCGCGGTTCCC
GTCGCCGAGGCGGGGCAGGGCGCGGACATCTTCGTGGTCACGATCCCGGTGAAGAACATC
CCCGACCTGCCCGCCGGGCTCCTCGACGGCGCGACGGAGGGGTTCGTCCTCATCGACACC
GGCAACTACTACCCGCAGCGCGACGGCCGGATCGCCGGGATCGAGGACGAGGGCCTCACC
GAGAGCCGATGGACCGAGCGTCAGCTCGGGCACCCGGTGGTGAAGGTCTTCAACGCCACC
TACGCCCAGGACCTCCTGGACAAGCCGCGCCCCGCAGGCGCCGCCGACCGCATCGCCCTG
CCCCTCACCGGTGACGACGAGGAGGCGAAGAAGACCGTGACGTCCCTGCTCGACGAACTC
GGCTTCGACGCCGTCGACGCGGGCGGCCTCGACGAATCCTGGCGCCAGCAGCCCGGCACC
CCGGTCTACGGGCTGGCCGCGGGCGCCGACGAGGTCGTCGCCGCGCTGGCCGCCGCCACC
CCGGAGCGTCCAGCGCAATTCCGCGCCTGA
>orf00047 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGGAGTTCATGCTCTGGGCCGGAGACCTGATCTGCGTACGCCGCACCCCCACCTGGCAA
CGCCTCCTCGACCTCCCCGAGCGCCACCTGGCCACCGCACTGCACACCAACCGCCTCACC
GACGAGGAATGCCTCACCGCCCTCCTCACCCACGCCGCCCGCGCCCTCGGCATCGCCACC
ACCGCCGACCTCGCCGACTACCTCCGCATCTCCACCCGCACCACCGCCGCTCTCCTCCCG
CACACCCCACTGCTGCCCGCCACCGTCGAAGGATGGACCGAACCGGCCTGGGCCCACCCC
GACGCCCTCACCCCACCCGCCCCGGCAGACGACCCACCCGTCTTCCTCGGCCCCTTCGAC
AACCTCATCTTCAACCGCCCCCGCACCCAACGCCTCTTCGGCTTCACCCACACCCTGGAG
GCCTACAAACCCGCCGCGAAGCGCGAGCACGGCTACTACGTCTGCCCCCTCCTCCACCAC
GACCAGCTCATCGCCCGCGCAGACCTCACCCGCACCACACACGCCGTCACGATCACCCAG
ACAAGCACCGAAACCAACGCGCCCGGGAACGCCAGCGCTCTTATCCACGAAGCTCTGCAA
CACCTCACCCACGCCGCACAGTGA
>orf00049 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGGGCACCGCCACGATGACCCTGACCGCGACCGCCGCCGGGAGCGTCGCCGCCCGCTGG
CCCTGGTGGACGACCCTCCTCCTCGTCCTCGCCGCCAACCTCACCAACCCGCCCCTCAAC
GCCGCCCTGCGTTCCTCCTGGCGGCGCCTGGTCACCACACCCACCCAGCTCAAGACGGTC
CACTCGGCCGACAGCATCCTCGAAGAAGCCGGCTTCGTCGTCGCCCCCCTGACCGCCGGA
GTCCTCATCACCTGGCTCGGCCCCGTGGCCGCCTACGAAAGCGCCACCGCCCTCTACCTC
ACCGTCATCGCCCTCTACCTCACCGCCGCCCGCCTCTGGGGCCTCACCCCCACCAAACCC
CCCGCCGCGCAGGCCGGGCGGAGCGAGCGCGCGCGGCGCGCGCACCGCTGGCTCGGGCCA
CTCGCCCAGCCCCGCATCATCGGGATCATGATCCCCATGCTCGTCATGGGCACCCTGTTC
GGCGGGACCAGCATCTACGTCCCCGCCTACAGCCAGCACGAGCACGCCACCACCCTCATC
GGCCCCCTCCTCGCCGCCACCAGCGCCGGCGGCGTCCTCGGCGGCCTCCTCTACGCCCTC
CTGCCCACCCAGCGCCTGGCCCCCTGGACCCTCTACCGGCTCCTGACCGCAGGGTTCGCG
CTGCCCGCCTGCTTCCTCCTGGCCGCCCGCCCCCCCTGGGCCCTCGCCCTCCTCCTCCTG
CTCAGCGGCTTGTTCGTCACCCCGCTGTTCATCACCGCGTTCCTCCTCATCGACACCCAC
GCCACCGACGACGTCCGCACCGAGGCCAACACGTGGGTAGGCGCGAGCACGGACGTGGCC
AACGGCGTCGTCGCCGCCGTCATCGGCGCCCTCACCGCCCACAACAGCTTCACCACCGCC
CTGACCGTCCTCACCGCCTGCGCCGCCCTCGGCCTCCTGACCGCACTCCTCCTCCCCGCC
CCCGAGAAGAGCACCGTGCCCGAAACCTCCCCACACGTGCCCGCCAACGACGCACCGGCC
ACGACCGCGTGA
>orf00050 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGGTTGATGTCGCGTTCACCGCGCTCTACCCGTGGAGCCTGCCGCCCGACAAGCCGCGT
ACCGACCGGGCGGCCGCCCGGTCGGAGCGCGACCTGTACGCGGCGCATTTCCGGCACGCG
CGGATCGCCCGGCTGCCCGCGGACTGCCCGCCGTGGGCGCTCGGCCAGGATCTCGGCTGG
GTGGTGCGCTCCCCGGTCACCGCGACCCTGACGCCGCTGTCGGACACGGACGTCGCCGTG
CCCGAGGACGAGGACGTCAGAGCGGTGAGCCGCCGCGCGGGCGGCGGGCAGATGTGGCGC
CGCGGCCCCGACTGGATCGCCGTTCCCGACCAGGGCGGAAGCTGGCTGCGCCGCTACGAC
TTCCGCAACTCCAGCGGGCAGTGGGAGGCGATGTTCCTGCCCAACGGACAGGGCACCGTG
GAGTGGCATCTCGGCGTCGCGGTCCGCCTCCCGCAGCCGTACTTCCTCATGGTCCTGCCC
CTGGACCCGCCCCTGCCCGGCCTCCACGTCCCCGTCGGGATCATCGGCGCGAAGACCGTG
AACACCATGACGGACATCAGCATCGCCATCCACCCCACCCACCCCGTCGCCGTCCGCCGC
GAGCAGCCCGTCGCGCGCCTCGTGCTGCTGCACCCCGACACCCTCCGCGCCACCAGCACC
ACCACCCCCCTCACCGCCGCGCCCCCCGCACCCGCGTCGAGCCCACCCGACCCCGCCGGG
CCGGCCGCACCGGTCGCTGCGCCCAACACCACGATCCTGGACGCCTCATGA
>orf00051 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGGCACGTAACGTCGAGTTCTTCTCGACCGACACCGACGACGGCACGATCTCGGTCGTG
GCGAAGGCCGGGCCTGGCGAGCACCGGCGGATCGACCAGATCCGGGTCGGCAACGCGCCG
CGCGGCGGCGTGAAGTTCACGAGGTCCGGGCGCGGGTTCGTGTGCAACACCTCGCAGAAC
ACGATCAGCGAGATCGACCCGGTCGCCCACACCGAGGTGCGGCGGATCGAGGTCGGGCAC
GGCCCGCGCGGCCAGGGGCTGCTGCCCGGCGACACGTACCTGCTCGTCTCCAACTCCGGC
TCCGACACCGTCAGCATCGTCGACCTCGAGCTGAACGTCGAGATCCACCAGGTGCCGGTG
GGCCGCGACCCGCGGCACATGGGGATCAGCGCGGACGGCCGGAGTGCGTGGGTGTGCGTG
TGGGGCGCCGGCTACGTGAGCAAGCTCGACCTCACGGCGCTGGTGGAACGGCAGGACGCC
GCCGGGGTCACCGAGGTCGCGCGGATTCCCGTCGACGCGAAGGCCCACCCCTACAGCCTC
GGCATCGACCCCTCCGGTCGCAGGGTGTTCGTCGCGAACACGCAGGCCACCTACGTGACG
GTGATCGACACCGCCACCCACGAGACCCACCGTGTCGACGTCGGCTTCATCGGCGGCCGT
GGGGTGGCCTTCTCCCCGGACGGGCGCCACGCGCTGATCACGGTCGAGTCCATCAGCCGG
GTCTACGTCATCGACGTCGACACCCTCGCCGTTACCCGGCACATCCCCGTCGGCGGCGGC
CCCCGCGGCCTCGTCGTCGACCCCGCCGACTCCACCGCGTACGTCACGAACTTCTCCCGC
ACGAACCTGCGCGCGGTGGCCCCGGAGCTCGACTACGACCCCAACACCCTCACCGTCATC
GACCTCGGCAGCGCGCCTCTCGACCGCGAGGAGGGCGTCTTCGACACCGAGCCCCTCTAC
GTCGGCTTCGGCCCCTGCTCGGTGACGATGTTCGACCTCGACACCCTGCCCGAGCAGGAA
CGCCAGCGCCGCACCGAGCGCCTCACCACCTGA
>orf00054 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGCAGGCGTTCGCCACGCCCGTGGCGCGGTGCCCGTACCCGGAGGCCGCAGCCGTGCGG
GATGTCCTCACCGAGGCGGTCCTCTCCCGCCTGGGGGAGGGGAAGGTGTTCGGCTACAAG
CAGGAGACCTCCCGGGACCTGACCACATGGGGTGTGGCGGAGCTGGACGCGCTGACGGGC
TGGGTCGGCCGGATGACGCGTCAGCTGGTGGAGAAGCTGGCCGGCGTCCCGCTGGGGGAG
GCGTTCGCGCGCTCGGCGGGCCGGGAGGGCGAGGGTGCGGGGGTGCGGGCGGCGGGGATC
GTGGCGTCGCGGAGCTGGGCGAGCGTGTACCGGGCGGGTGACCGGCATGCGGCGCACTTC
CACCCGAACACGGCCTGGTCGGCGATCTACTACCTGACCGCTCCCGGTGTGTGTGAGCTG
GACCTGCTCGATCCCCGCCCCGTGGGCTACTTCGATGCGGGGATCGTCTTCGCGGGGGAG
GACCAGCGGATGCGGCTCTCCTGCTCACCCGGCGACCTCGTGATCATTCCGGGGTGGCTG
CGTCACGAGGTGCCCGAATTCCAGGACGACGAGGTGCGTATTTCCCTTTCCTGGAACCTG
AACTACTCGCTCCATCGCGGCTGA
>orf00055 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGCGGGCTCGCGCGGGGCGGCGGCGGTGCGGGGCCGGGGACCTTGCGGGTGCCGGTGCT
GTGCGCCTGTGGCTGCGCCGCTTCTGCTCCCGTGCGGGGCAGGTTTTCTCTGTGGTGCTG
CAGGTGGGGGTTGCGTTTTGGTGGTAG
>orf00056 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGGATTGGGACGCTCACACCGAAGAGGTGCGCCTCGCGACCATCGCGCTGCCCACGGTG
GTCTCCGATCTCCTCGGGCGCCTCACGGACGAGATCGAGAAGCTGACCAGGTCGTCACCA
CTCGCTGCGGCACGCGCCGCGCACCTCATGCAGGTCGCTGCGAAGCAGGCCGGCCGGTGG
CCCGCGCAGAAGGCCCTGAACGACACCGACCGACACGATGCGGCCGTTGCGCTGGTCGTC
AGCGAGAACGGCGCGCGCTCGTTGCTGGCGCATCTCGGTGATGTCAGCCTGTACGGCTGA
>orf00057 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGTCTCACAGACGAGGCAGCGGCCCGGGCACTGAGGCCGCGCTTGCCCACGAGTTCTCC
CAGCGGATCCTGATCGCCATCTCCAACGGCACCAACGCCGTCGCGGCGAAACAGTCATCC
GCCGACGCGGTCGTCGCCTCTGGTGCGCTCGCCTGTTCCCTCGAGAGCGGCGTGCGGGCT
CGGAGCGGGCGGCGACTTTCTGGTTTTTGGGGCGGCGGCGGCTGGGAGGGGGCATTGTCG
GAGCACCGTATCTGTAGCGCGGGTGGCGAGCGGCGGGTGGAGGAAGTTGTGGTGGAGCGG
GAGACGTGGACGGACCCGGAGTTCGGCTCCGAGCACGAGGGATGGGTCGGTGTTCTGCTT
GAGGACGGCACGGTCCCACCACCTGTTTTCTTCGGCTCGGAGAGCAGCGCTCATCACAGC
GAGGTGGCTCAGTGGAGCGTGTACATCGGCAGGTACCCCTACGGGCCGCGCGCCGCTGCG
CTGCGGGGAGCCTGTGCGTGCGGCTGGACCGGGCCCGCGCACGTGCTGGACTGGGGAAGA
TCGGCGACCGGGAACTGCAACTCGCCGGAGCCAACGCAGCGGACAACTGTGTAG
>orf00058 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
TTGCGAGACCAGTACGCCGACCACCTCAGCGCCTTCGGCGCCGCGGCAACTGAAGGAATC
CAAGGTGTCCTGGACGAGAGCAACTACGGGCAGCTGAGCTCCCTCGACTTCGACGAGACC
GAGCAGGGCATCTTCGTCTCTTTCACGATCGACCTGAGCGGCGAGGTCGCGGAGCGCTGG
GGATCCGACGTCTACACCCGCCGCTACCTGATCATCAGGACGCAGGACGGACCTGTTGAC
CCGGTGGAATTCGGTGCCTCTCTCCTGCACACGAGTGTGATGGAAGACCTGGACACCGCT
GGCAGACGCTCCGCGCGGTAG
>orf00060 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGCGACGCGCGGCCATCGCTACCGGAGCCAGCATCGCCAGCACCATCGGGCTCCTCATC
GCCGGCACAGTCCCTGCACATGCGGCGGGTGAGAACTGGGCCGTCTACTCCACCCACTTC
TCGCCCAAGGGACACGACATCCCGCTGCGGTACGGGCGGCACGACAACACGGCCGGGCAC
ACGACGGGCTTCGGGAAATACCACATCGAGGACCGCGGACACCTGCTCGGTGTCTCCTGG
AGCACGTTCAAGAAGGACATCGACGAGACTCTCGACAGTCCGACCATCAAGTGCAGCAAA
AAGAACACCACATGGACGTGCGACTCCAACAAGATCAACGGGGTGAACTCGACGTGGGGC
AACATGAAGGTGTCGTACACCCACAGCACCTCGGGCACCCCCGACGGCCGCGCCCGTGGG
ATCATCACGGCCTACTACCTCAACGACTGCGGTTGCTTCGCCGCTGAGGAGAAGACCTCA
AAGTGA
>orf00063 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGGTCAAGGTGAGGGAGTACTGGCGCGGCGGCACGAAGGTACGGGCGCATACCCGCCTG
CCTCCCGGCGCGCGCAAGCAGCTGACCATCGCTCTCGTCGCCGTGGCGGCCGTCTTCGTC
TTCAGCCACACCGGCCCCGCCACCGAGGCGTCAGAGCCGCGCCGGCCATCGACGAACCGC
TCCACACCGCCACCTGCGCCCGCAAGGGAGAAGGAGGAGCCGAGGCCGGGGCCGAGCTGG
ACCGTCACCTACCCCATCCCCTGGGACCGCGACGGCTCCTGA
>orf00065 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGACCTCCCGCACCCTGGCCGCGACCGCCGCCGCCTTCCACGCCTTCTACGACCTCAAC
CACTTCGCCTACCGCGACTACGCCGGCGCCCTCCTCCCCACCGATGAAGCCCACATCCTC
GTCACCCACGTCTTCACCCTCCTTGCCACCGACTGGCCCCGCGTCATCGGCCGCCCCAAC
CCCGCCGCCTTCGCCTGGGCCCTCTTCACCCACCACATCGCCCTGCGCACCGGCACCCCA
CGCACCCCCGCACAGGACGCCGCACTCCTCTACGACACCCTCCACCACAGCATCAACACC
ATTGCCACCCTCACCGGAACCGAACCCACCCTCGTCGGCACCCTCATCACCGCCACCCGC
CGCTAA
>orf00066 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGAGTGTTCGCCCGCCCGCGCCCCGCTCCTGCCAGGACTGCGGCACACCGCTGGAACCC
GAGCCCGCCCGCTCCGGCCGGCCCGCCGCCCGCTGCGCGCACTGCCGTACCCGCACCCCG
GCCCAGCGGCAGAAAGAAGAAGAGGACCGGCAGACGCGCGCCTTCTGCGAAGACGTGCTG
CACGCCGCCACCGACACCGTCGCCCGCCACGCCGCGGCGCTGCTGCACCAGGCTTACGGC
ACCACGGCCCCCACCGGCGACCTCCTCACCACCGTCGCGTGCCTGCAGCGCGCGCTGACC
GTCGTGGAGGCCGCCACCGTCGCCCGGGCCCGCGCTCTGCACGAAACCCACGCCACCGTC
GCCGCCCACCTCTCCGTCTCGGCGGACCACGTCCGCAAGAAGTACGACAAGAAGCACCTC
GACCGCGTCCTCGCCCCCTACATGGACCCGTGGAACCCGACCCCCGTCTTCGCCGCGACG
GACTCCGAAGGCCCGCCGGGCCAGGAGCCCTCCCTGCCCCGCGCCCAGGAGTGCTCCGAA
CGCCGGGCCGCCGACCGCCTGCGCGCCGCGCTCTCCCACACGATGCGCCGCTCCGCGGCC
TCGCAGCGCGCCGTCGCCGAGGCGATCAGAAGGCACCCCTCCTACGTCTCCCGGCTCCTG
TCGGGGGAAAAGCCCCTGCACTGGCCCCACGTGCGGGACTTCGCCCGCGTCCTCGGCATC
GCCGAGCGCCTCCTCCTGCCCCTCTACAACGTCGCCGCCGGCATCGAACCGCCCCCGGAG
ACCGATCCCGTCGCCTACCTGCGCGACTACCTCGCCGGCCTCCTCCTCTCCTGCGGCCAC
ACCCCCCACACCCTCGGCGACGCCCTCGCCTCCACCGTGCACCCCACCGCTGTCCGCGAA
GCCCTGCACGGCCCGGGCGTCCCCGACTGGGCCGTGCACAAGCAACTCGCCGCCGCCCTG
TTCAGCCTGCCCAGCGACATGCGCCCCCTCTGGCAGGCCGCCCACCACCACGCCGTCGCC
CAGGCACGCACCTCGACGCCCTCGCCGTTGCGCGCCGAGCACTTCGGCTGA
>orf00068 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
TTGGCGGTCACCGTGCGCGGAAACCTCCTCACCGGGGCGCTCACCATGCCCTGGCTCCTC
ATCACGGGCACCTCGTCGCCCTGGACCGCTCCCGTCCTGGCCGCGCTGAGCACGGCCGCG
GTCGGCTCCAGCGTCGTCTACCGGCGCGTTTGGCAGCGCTGA
>orf00069 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGCGCCACGGCTCCGGGATGGACTGCGCAGAGCGGGCCGGCATGTTCGTGACCGAGCGC
GCTCAGGGCCAAGCTGAATCACGGGAGAGGCCGGGTGTGCGGGTCTGGGGTATCCCGTAG
>orf00070 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGCCTGGTGCGCGACATCACTCGCCGCGCCGATGCCGCGCGAACCGGCAGCGTCCGGTC
GGGCGGCGTGCGGGTGCCTCGATGCCGGCGACGAGGATCTGGGCGCGCGCGGCGTGA
>orf00071 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGATGATCAACGAGATCGGCCCTCGCATGGCCGGGGAGCGTCTGATGTACAACCGGGCC
GTCAGGGTCGACCAGCCACGTAGTTGGCTGTTCGTCTCGGGGCACGAGGCTCGCGACGAC
GACGGCGGCATCGCTCACCGGGGCGACATGGCCGGACAGATGGAACTGACGCTGCGGCGG
CTGGGCGAGACCGTGGCCGAGGGCGGAATGAAGATGGCGGACGTGGTACAGATCCGCGTC
TTCACCACCGATCTCACCTCGTGCAAGGCCCACTACGGCGTCCTCTTGGATGCACTCGCG
GCGGTGGACTGCCGACCTGCCAGTCTGCTGGCAGAGGTCAGCGCTTTGTCCGACGAAGAC
ATGCTGATCGAGATCGAGGCCGTAGCGGTGTGCTGA
>orf00074 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGCATCGCATCCGGACGGTCTGGCCCGGCTTCCGGCCCTTCTCGGTACGCCGGCTGGTG
CTCGTGGGCGGGTTCGCGCGGGGGCGCTTGAGGCGAGCTGTTGATGGGGAGATATGA
>orf00076 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGGGGTGGAAAGATGAGTTTCAGATCGCGATGGGACAACTGGGCGAAATACGGGAACAG
TTGGGGCGTCTCGAGGGGCGCCTCGACGATCCGACGGCGGGGCTTGTCGCCCTGCATGGA
CAGGTCGAGCAGGCCCGGACGAAGATCCTGGAGAACGTGCAGGGAGGCACGACCGGGCTG
CGCGAGGAGAATCGCGAGCTGCGACGTCGGCAAGAACGCATGATCAGCGATCTGAGCGAG
GCGAGGGCGGAGCTGAGCCGTCCGGCCCCGACCCGTGCGGATCTGTTGGAGAGCCCGGTC
TCACACGTACCGGAGCTGGCCGAGGAGAAACCGAGTCAGGAGACCGACGCGCCCGGCCCG
GCCCTCACCGTTGTGGGATCCCAGGACGGCAAACGCCCCACCACGGATGAGCCGGAGCAC
GCCCTGCCCACGAATGACCTCTCGGGAGACAGCATGCGCAACTATGACCGGGCCGTCCGT
GCGGAGCGGGACCAAGACCGTGATCTGCGGCCGTCGGTCGAAGCCGCCTACCGGGGCACC
AGCGCCCCCGCCGGCCCGGCATCGACCTCTGGCTCTCCGGAGAAGGGCCTCCGGGTTGCC
CACGGCGTCCTGCTCCTACGCGCCGCGGGGGTGGCCTCGGCCGAGGTGGTCGCGCACCGG
GACACCTGGGAGTGGCTGGCTTCTCTCGCCTCCGAGCACGCCCACTTCCGCGCCCCGTTC
GCGGTCGAGGACTCCGGAGAGGGGCGGGTACGGGTCGTGGTGTCCGGGCGTTCACTCATC
GCGCTGCTGATCACGTTGTGGGACACGCGAGCCGACGCCGAGTCCCCGGACGGGGACTGG
GCGATGGCGGTGACGACCTACACCAGGATGGCGAACGAGCTCTCCGAGGCCACCGGCGGC
GACCACGAAATAGCCGGCGCCATCCGCATCGTCCTGGACGACGGCGTTCCGGAGGAGCGG
AGGGAGTAG
>orf00083 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGAAGGAGAGGGTGCCCTTCCCTTTCGGGATGATCCCTGAGCGCTGCTATTCCGGCGGT
GGCGTACGGGCCGCGCAGGGCGACGGTTATGACTGCGACTCCTACGGCACTGTCCAGACG
ACGAAGGAAACCGGCACCGCCGGCACCCAGAACCCCTACCGCTTCGTCGGCGGCACCTAC
GACCGCACCACCGGCTACGTTAAGTTCGGCCAGCGCTGGTACGACCCCACCACCGGCCGC
TTCACCACCCAGGACAAGTACAGCTTCCTTGCCAACCCCGGACGGGGCAACCGCTACGCC
TATGCCGGCGGCGATCCAATCAACAACACCGACCCGCTCGGGCTCTTTTCGTTCGCTGAT
ACGGTCGGGATCGTCGCTGGTGGCCTGGCAGGAGCTGCCGGGGTGGCTGTGGTGGCGGGT
ACGTGCGCGCTGACAGCTGGAGCAGGATGCGTGGCGGGGGCTCTCATCACCGGTGCCATG
TGGGGTGCAGGTGGAGGGGCGCTCGGATCTACTCTCGCTGGCGGAGACTCTGCCGAAAAA
AGCAATGGGACACTTGGCGGTCTCGTCGGGGGAGCCACGGGCGGACTCGCGTCTCTGCTT
TTCGGATAG
>orf00084 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGCGAGACAAAGAGATCGCTCTGTACGTGGCGGGGGTTTGCCTTACTCTGGGGCTCGCC
TTCTCTCTATATAGAGAAAATTACACCCTCGCAATCCTGGCGGCATTTGCGCTGATCGTC
AACGGATTCGCAATCTCTCAGGAGAGGAGAAAGAAAGGCGACTAA
>orf00086 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGTCTTCATCCAGCGTCCGCAGACGCTCGGTTCAGGTGGGGATCGCGACGGCTGTTGTG
TCGGCCGTGGCGGTGTGGGGAATGCCGGCCGCGTACGCGGCGGCTCCTGACGCTCCGTCG
CAGCTGGTGGCGCTGACGGAGAGCACGGCGCCGTACGTGACGGCGAAGGTGGTGGCGCCG
TCGGGGAGCGGGAAGGTGACGGCGAAGTTCTACGCCGGCACATATGCGGCCAACGGTGAC
AACGACCTCGCGGACGGCAAGGAGGTGACGGTCGATTCGGGTGAGGTAGCACGGCTGAAG
CTGCCCGACATGCGGATCGGGACGCAGTTCACCTGGCAGGTCAAGGCCTGCGTCGACGAC
GACTGCTCCGACCTCTCCCCCCTCCAGACCACCCGGGTCAGCCCGATGACGGGCGCGGGC
GAGAGGCCCGGGGCCACGCGCCTGCAGTTCTCGACGGGCGACTCGACGGCCGCGCAGGTC
GATGTCGGCTCGGGCAATCTTCTGGTCAACGCCTCCGGGCTGACCTTGCCGGGGGTCAGT
GGTGACGTGGGCCTGGGGGCGGCGTACAACAGTGCGGCGATCGGCACGGATGCGACCTCG
GCGAAGTCGCCACTGGGGTACGGGTGGCGGCTGACCCCCTACGAGGTCGAACTGAAGGAA
CGCGGGGACGGCTCGGTCACCTACTACGGCCAGGGCGGGATCACCGGCCTGTTCGTGAAG
TCGGGCAGCGGGTTCACGACGCCGGGCGGGTTCAAGGCCGACCTGAAGAAGAACAACGAC
GGCACCTACACCCTCACCGACCACGGCTCCCAGTCGAAGCAGACCTTCACCAGCGCGGGC
AAGCTGACGAAGATCACCGACCGCAACGACAACGCCACCACGCTCTCGTGGAACGGCGAC
CTGCCCGACACCATCGTCACCACCCGCGGCACCAAGACGCAGCGCACGGCCGTGTACGCC
TCGGCGAACGGGCGGGTCACGACGCTGACGCAGACCGCCTCGGACGGCAAGAAGCGCTCC
GTCACCTACACCGTCGATGCTGCCGGAGACCTGGTGTCGATCAAGGACACCCTGGGCCGC
ACCACCAGCTTCACCTACACCGGGCACAAGATGACCTCGGTGACCAATCCCGGGGGTGGG
GTGACGCGTTTCGAGATCGGCGCGATCGGCGCCACGAAGATCACCCAGGAGAACAAGGCC
GCCGGCTCGCCCGGAGACTCCGTCACCCGCCTGTCCTACGCGGACCCGGACAAGACGGTG
ATGGCGTCCCCCAACACCGACCAGACGAAGACCGTGACCGCCGTTCCGCACACCACCTAC
GAGCTGACCGACAACAACTCGGCGCGGGTGGCGAAGGCGACGGACGCGGAGGGCCGGGAG
CGCTCGAAGACGTACACGGCGAACTTCGACACCGCCTCCTCGACGGACGGCTCGGGCGCG
AGCGCGGGCACGACCACGAACACCTTCGGCGCCAACGACGGCGAATCGCTGACCAAGTCG
CAGGGTGCGGACGGCTCGACGTTCTCCGCCGCGTACGGCAACACGGCGGCGGGCTCGAAG
TTCTCGCCCTCGGAATCGACGGACGGGCAGTCGAACAAGTCCGCCTACTCCTACAACGGC
GCGGGGAACCTGGCCTCCTCGAGCAACGCGGAGGCGGCCGAGGCGAAGGTCGACTACAAC
GACGACGGCACCGTCAAGACCAGCACCGACCCCGGCAACAGCACGGACACGTCGTACACG
TACGACGGCGACAAGCAGCTCACCAAGGTCGACCCGGCCGGCGGCTCGCTCAAGTCCCAG
TCGTACACGTACGACGCCTGGGGCCGCCTGGCCGTTGCCACGGACGGCCGGGGCCTCACG
ACCACAACGACGTACGACGACGCCGACCGCGTGACGAAGGTCGACTACTCGGACAGCACC
CCTGATGTCTCCTACACCTACGACGCTTTCGGCCGTACGAAGACCCGCACCGACGGGACG
GGGACGGTCACCTATGGGTACGACGATCTCGGCGCGATGACGTCGCGGACCGCGACGTCG
GGCGGGGGCACGCTGGCGTACTCGTATGACAAGAACGGCAACCGCCTCAGCACCACTGAC
GCGCGCGGCACCACGCAGTACAAGTACGACCAGGCCGACAAGCTCACCCAGGCGATCACC
GATGCCCCGTCGACCAAGACGAAGATCGGGTTCAGCTACGACGATCGCGGCCGGCGCACG
GACACGTACTACGGCACCAACGACGCGAAGACGATCTTCAAGGCGCGCGTGCACCAGGAC
TACGACAAGTCCGGCCGCATCAGCCGCGTCTGGGCCGACCAGGGCCCGGCGACCGACACG
ACCCGCCAGTTCGACGCCACGTACTGCCGCAGCCTCGGCTCCACCTCGTCCTGCTCGACC
GAGAAGGCCGACAACACCGACCTGATCCAGTGGAGTAAGGACAACCTGAGCGGCAAGACC
ACCAAGTACACGTACGACAAGGCCAACCGGCTGACGAAGGTCGCAACCGACGGGGGTGGC
AAGACGTACACCTACACGTACGACGCCCGCGGCAACCGCAAGTCCTCGTCCGACGGCAGC
GCGGATCAGTCCCTGGCTTTCGACGCCGCCAACCAGATCACCAGCGACGGCTACACGTAC
GACGCCCAGGGCAACCAGACCAAGACCGCCAAGCTGTCCACGCTCACCTACGACGGCGCC
AACCGCATGACCGGCGCCAAGACGGCCAAGGGCACCAGCAACTACACCTACGCCGGCGAG
GACGCCACCGAGCTCGTCTCCCAGACCAGCGACGAGGGCGAGAAGACCGACTACGTCTAC
GGCGCCCCCGACCAGTACGGCATGCCCGTCATCGAACAGGTCACGCTGAAGGAGGGCACG
GCGTACATCGACCACGACCCCACCACCGGCCAGCCCCTCTCGCTCCGGACAACGAACGAG
TACGAGGCGTACTACATCGTCGACGGCATCGGAAACCCGGTCCAGTTCATCAACCAGTCC
ACGGTCCAGTCCACGATCTACGACTACGACCCCTACGGCACCGTCCAGACGACGAAGGAA
ACCGGCACCGCCGGCACCCAGAACCCCTACCGCTTCGTCGGCGGCACCTACGACAAAACC
ACCGGCTACGTAAAATTCGGCCAGCGCTGGTACGACCCCACCACCGGCCGCTTCACCACA
CAAGACAAACTCAGTTTCTTCGCGAATCCCGCACGCGGAAACCGCTACGCGTACGCAGGA
AGTGATCCTGCCAACGCGGCAGACCCAACCGGCCAGGATTACTACGACTGCGCCTTCGCG
GGACTCGTGTTTGTCGGGGCAGCGGGAACGGCAGTTCTCAGCAGCGGAGGCACAGCCCTT
TTCGGTGGCGCCGCTGCGGTAGGAGCCGGTGGTCAGTCGTACAGGGCTTGCCCCAAGGAA
GCCAAAGAGGGTCCCGGGCGGAAGAACTCGCTGAAGGCAGCAATAACCCCGATATGGAAA
ATTCTGTAA
>orf00089 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGGGTGGCGGGGCTGGTTCGGGGGTGTTGGTGGTGGCGGATGGCGGTGGCGAGCAGCAG
TCCCACGACGCAGGCGGTGAGGCCCCAGAGGCCGAAAGCGAGGGCGAGGGTGTGAAGGCT
GGGCATGGAGCGGGCTCCGTGATCTGTGCGCTCGACGACACCGAGTGCGGCGAAATTGTG
TTTTCTGAGTGA
>orf00090 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGTCGAAGCTCGCGGAGCCGTGCTCGGGGTTGTTCGCAGGGCGCCGGGGTACCACGGCG
GCGGGCAGTACGGTGATCGGACCAGAGAACGAGACGACGGGAGCGCCGGTCGGGTCCATG
GTCGCTTTGGCGACGGTTCTCGAGCCGAGCTTGCCCGCAGTATGTCTCGTGACTCGGCGT
CCCGCTGAGGGCACACGCCCGCCCGGGGGGCAGAGGTCGTGTGCGTCGGTGGTGACGGGT
CGCAAGCGCATGCTGAGCATCTGGCGGATGCCATGCCGTCCCGTCATCACGCTCCGCGCA
AGCCATGCGGCATGTGAGCCCGCATGCCTACATCTCCCCGGCGAGCGCCTCCCGTGCCTC
TTCGGGGCCGGACCGGCTGCGCAGGGCGTCGCTGAGGCCGGTGACCTCGAGCAGGCGCAG
TACTGCGCCACCAGCGCCGGCCAGGGCGACGGGGCGGCGTGCACGGGTTTGGAGGAGGAG
ATTGAGGGTCTGGGAGTCGGCGAAGGTGACCTCGCTCAGGTCGAAGACGACAGGTCCTCC
GAAGCGGCTCAGGGCATCGTCCACTGCTTCCTCCACGTCCTCGGCGCTGTCCATGTCGAT
GTCCCCGCCCAGAGCGATGAGCCACACGCCCTGCCACAGCGTGCTGCGCAGGACCGGGTG
ACCCGCTCTCCTTCCAACATTTGTCATGCGGCAACTATCCAGGGCCCCTCTGACAATGCC
GCCCCCGGGTGTCCCTCCGGGCAACGCACACGCTCAGGGGTATCCGTTCGCGGACAGAGG
GTAGGCGCGAGCTATCCGAAAAGAGGAGCAAGGGTGCTTTCCCTGGAGTCCGCTGAACTC
ACCGCCGTTGACGCGCGACTCCTGGCACAGACGTACGCGGCCGCCCACTGCCCGCGCGTG
GACCGTGCCGCGGTGGCCCTGGTCGTGGCCGAGCTGCTCGCGAACGCCGAACGTCACACC
GCTGGGAGCTGGCGGCTCGTGGTCAGCCACAGCACTCGCCTGCTGAGCATCGCCGTCCAC
GACCTGGGCCGTCTTCTCCCTCTACCTGGCAAAGTGGCGTTCGACGGCACCGGGCAATTC
GGTCTGCGCATCATCCGCGGTCTCAGCGATCACTTCTCCGTCCACTCCGGCCCGACGGGA
AAGACCGTCACCGCACAGTGGCACCTCGCCACCCTCTGA
>orf00094 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
TTGCGCCTGTCCCGCACCATCCCCGCCGCCCTCACCGCGCTCGCTCTCAGCACCGCGCTC
GCCCCCACCGCGGCCGCCGCCGACCTTCCAGCCGCTCCCGGCGACACCGTGACCCTCCCG
CTCCGCAAGGCCATCGCCGCCCTCGACACCCGGGCCGAGAAGCGCACCGGCTACGAGCGG
ACAAAGTTCAAGCACTGGATCGACGAAGACCGCGACGGGTGCACCACGCGCAACGAGGTC
CTGCTCGCAGAGGCCGTCACCGCGCCCGAGGAAGGCGCCCGGTGCAAGCTGAGCGGCGGC
ACATGGCACTCCGCCTACGACGACACCACCATCACCGGGCCCGGCGGTCTCGACATCGAC
CACTTCGTCCCCCTCGCCGAAGCCTGGGACAGCGGCGCCTCCGAGTGGAGCGCGAAGGAC
CGCGAGCGGTACGCGAACGACCTTGGCGACGACCGCAGCTTGATCGCGGTCTCAGCGAAG
ACGAACCGCAGCAAGGCCGACCAGGACCCGGCCACCTGGATGCCACCGGCCGCCTCCTAC
CGCTGCACCTACGTCACGACCTGGACCACTGTGAAGACCAGGTGGGGCCTGTCGGCCGAT
ACCTCCGAGAAGGCGACCCTGGAGCGCGTGGCGGGGGACTGCCCGAACGTGCCGATCAAG
GTCGAACTGGCCCGCTGA
>orf00101 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGATCTCGGCTGGGGGTGGGTGTCGTGCGTGGCGGCGTGGGTGGGGTGAGGGTGGGGGG
ATGGAGTATCCGGTGCGGGTCGGGCTTGCCCGCGCGGCCGCCGCGCTCCCGGCCGGCGAC
GGGTGGTGGTACGAGCCGAAGTACGACGGCGACCGGTGCGTCCTGTGGCGGCTCGACACT
GTCCGCCTCCAGTCCCGTACGAGCAGGGACATCACCGCCGCCTGGCCCGACCTCACCACC
CCCGCCACGGACCTGCCGCGCGGAACCGTCCTCGACGGCGAAATCGTCATCTACCGCGAC
GGCATGCTCGACTTCGGCGCCGTACGGGCCCGGTCCTCCAGCCGCGGGCGGCGCCTGCAG
GACCTCGTCACCCGCCACCCCGCCCACTACGCCGCCTTCGACGTCCTCATGCACCAGGGC
CAGGACGTGCGGGCCCTGCCGTACGAGGCGCGACGCGCCCTGCTCCTGACCGTCCTCGAG
CCGCTCGGGCCCCCGCTCCAGGCCACCCCCGCCACCGACGACCACGACGTCGCGACCGTG
TGGATGACGAGCCTGCGCCCCCAGGGCATCGAGGGGATCGTCGCCAAACGCGGCACAAGC
CCGTACCCGGTGGGCCGCCGCGAGTGGGTGAAGGTGCGTCACGCCGACACCGTCGACGGC
GTCGTCACCGGCTACCAGGGCCTGCCCTCACGGCCCTCGCACCTCTTCGTCCTCCTGGCC
GACGGGCGGACCGTACGCTCGCAGCACCTCCCCGCCGCGCTCGCCGCCGAACTCGGCCAC
CACCTGCCCGGGCACGACACCGGCACCACCCACGACCCCGACACCGGCCCCCTCCACCTC
ACCGACGCCGCACTCGAGGTGGAGGTCCTCGCGGGCTCCACCCGGCACGCCACCGCCACC
GTCACCCGCCTGCGCACCTGA
>orf00103 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGGCGGCCTGCTCCTCGTCGGAAGCGGCCAGCACTGGGGGACCCGCCAATCCAGCCGCT
TCGGCGAAGCCTGCCTCCGACAAGGGCTCCGGGAACGCGGACCCCGCGGGCGGAGGTCAG
ACTTCCACCACACCGGCCAGTGCGGACCCGTCGGACTGCGCTGCCGCCGACAAGCCGGAG
TGCGTGGTCGACATCGGGTCCATCGAGATGGAAGAAGGCAAGCTCGCTGACGGGCCGCCC
CAGACGCGCTGA
>orf00105 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGCGTGCAAGCAAGCGAGCTCGGTGGAGCGTTCTGTCGGGTGCGGCGGCACTCGCTTTT
TCTGTCCTGACCGTGTCGCCGGCGGTGGCTGACGAGGCGCCGCCGGGGATGGTGGAAGTG
ACCCTCCCGGCCGACATCGAGATGGTCGAGGGCACGCCCGTAGCGCCGGGCGAGGAGCCT
TCCACAGGGCTCTCGAAGGCGGCCGCGGTGGACCGTGTCTGTCTCGGATTGACGGTGACC
ATTGGTTCTCAGGGCTGCTTCCAGCCCTACGGTGACGTCGTCTTCTCCGGTGACACGCAG
GCGGACGGCCGGTCCTCTGTCACCATCGTCTACACCGACTACGGTCGCGAGCCCTTCGGC
TGTTACAACAGCACAGGGGCGAACACCTGGGTCAAGTGCAACAAGAATTACCGGGAGGAC
GGCAACGTCTACCTCAAGGTCCTCCGCTACGACAAGCCCACGGGCAAGTACTACCAGCCT
GAGGCGAAGTCCAGCTGGATCCCGGTCGACGGCCAGTGA
>orf00106 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGCAGCGGCCCGGCACCCTGCTCCCCGCGACCCGCGGGTACTCGCCCGCCCCTCCCGAA
GCGGCCCACTTGGTGTTGTCGGGTCAGGCGCGCAGGCGGCTGACGGTGAGGGTGGCGTGT
GTGTGGGGGGCATGA
>orf00107 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGGGCGAGGACGACGACAGCGGCGGGATGGAGCCGGGCGGGCCCGAGGATCCGGACTAC
CTGGTGGGCGAGCGCACCAGCCGCCCCACCGCGGCAGAGCGGCGGGAGGAGGCGGAGGGG
CTGTCCCGGCCGCTCGGCGACCCGGACGAGGCCGCGCACCGCTCCGCGCGCGGGCCCGCC
CCCGGGCCGGTAGCGGGGAGAGAGGTGCGCGTTCCCGTCCAGCCCGGCCCGCAGGACCGC
GAGCAGTTGCCCCGCCCCACCGAGCCCGCGCCCCAGGCCTCGCCCACGCCCGCATCGGGC
TCGGCCGAGGAGGGCGGCGCCGGGACGTCACCGCGCCCGCACGGCCCGCAGGAGCCGTCG
GCGCAGGCCGGAGGGTGA
>orf00108 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGAGGACCACCCGGCAACAGCGGCGCCGCTCGCGCGCGCTCTTCCGCAGCGCCCGCTCG
GCGGTGAAAGGACTGCGCCTGCCCGAGGGGGCCGGCCTCGAGGAGGCGGCCGTGCGCGTC
GCCCTGCACATCGGCAGGCCCCTGGCTCTCCTGCCCGCTGAGGAGCTGCCCCTCAACGGC
GCCCTGACTCGCGCCATGGACGGCACCCTCGCCGTCCGCGTCCCCGTCCGCGGCGCGTTT
CGGGAGCAGCCGGATACCTATCTCGTGCACCTGGCCTGCCGGGGCCTGGCCCGCGCCCTC
CTCGGCGTTCCCGGGGATCCCCGTGCGGGCATCGACTACCGCACCGAGCCGGAGCGGCTC
GTCGAGCTGACCGCCACCGAACTCGGCGTGCGCCTGCGGCCCGCCACCGCCGACGCACAC
GGCCTCTGA
>orf00110 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGCGGTCGCTGCGCGCGCTGGGCGGCATGGCGCCGCTGCCGGCCCGCGGCCTCGTGCTC
GGTGCGCGCGCAGCCGCTCCTCGAGGACGCGCTGGCGCTCGGCGGTGGGGAGGTCGGCTG
CTCCTGGTCGAGCTCGGCACCGAGGCGGGAGCGGTGCGCGCGGCGGACGTGGATCACGTT
GCCGCAGCTCTCGCAGGGCTGGTTGGTGTCCAGGCTGATCCCGTCGTCGCACCGCAGGTC
CGAGCAGGCCGGGCGAGGCTGCGGTGCAGCAACCACGGGTAG
>orf00112 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGGACACCGTGCACACGACCGCTGCCCTCCTCCCGGACCCCGCCGAACTCCGCGCGCAC
CTGCGCGCGCTGGCAGTGCTGGACCAGGCGATCTGCCGCGACCCGCGGTTCCCCCGCTAT
TCCTTCTCCACCACCTGGGGGCCTGGGACGGAGGCGGCCTTGATGGACAACGGCTCGGGT
GACGACTTCTCCGTCCTCTTCACCCCGGTCGGTGTGCTCGTCCGCGGCTTCGACCACGAG
TCGGAGATGAGCCCGTACGCCACGGACGACGAACAGGTCTGGCCCGGTGTCATCGACGAG
GTGCCCGCCGCGCTGCGCCCGCTCCTGGACGACCCGACCTTCGTCGACGAGGGCCTCGGC
GCCCCGCGGGTCACCGCCTGCCTGTGGTGGGAGACCGGCGCCAACGCCTGGCGCACCGGC
TCGGGCATCGAGTTCCCCTCGGGCAACCCGGACCCGGACGGCTCCGGACACCTCTTCCAC
CTCCTCACCGACCGCTCCCCCGAGGCCGCCCAGTCCCACTTCGAGGAGGCCTACGGGCGG
CCCGTCCCCCTCGACACCGTCCGCCACGTCCTCGCGGGCCATCCCCTGGCCCCCGAAGCC
GCCCGCGGCCTCAACCCGGCCGCCCTCTCCGACGAGGCACTGCTCGGCCGGATCGCCGCC
AACCCCGAGGTCGGGGCCTACCTCGCCCGCGACGGCGAGTTCGACCTCACGCGGACCGAC
CCCATCGAGCCGATCACCCTGCCCGGCGGTCTCCCGGTGGAGCCCGTGGCCGGCTGCAGC
GCGGGAGGCACCCACTACCTCTGCGGCCCGGCTGGCTCCGACCGCGTCCGCCCCGTCCTC
TACACCGACTCCGAGGGCCAGGCTTCCCTCATCGCGGAATCCCTCGCCGAGGCCCTGACC
CTGGCCATCGCCCTTCCCTCCTGGCACGACGCCCTGGCCGGCGTTCGTCCCCCCGCGCTC
AACACCGACTACCTTGAGGACAACCCGGACCACCCCGAGGTCCGCGACCGCCTCCTCGCC
GCCCTCCGCCTACCCCCGGCCACCGAGCCCGAGGTCCTGACCCGCCTCCTCACCACGGCC
GCCCGCACCGTCCCGGACGGCTACCTCCCTTCGGTCGAAGGCGACGAAGACACCACCTTC
GAACCGATGCTCCGTCTACCGACCGAGTAG
>orf00115 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGTTGGTGCTCGTCTACCGGTACATCGAGCAGGTGAATCGCAACCGGAGCGTCCGGATG
GTCGTGTACCTCGTGGATCTTGGCGAGGGGGCCCTCCCGGTGAACGCGGCGAAAAACCTC
CTGCTGGAGGAGGCGAGCGGTGGCGAGGAGGCGGCGAAGGCGGCATGGCAGGACGCGGGC
CTGCCCGAAGCGGGCGTGGTGACGTACGCGGAGTTGGACCGGGCGCGCGGCAGACTCCGC
TGA
>orf00116 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGGCTATCACCTCTCACCCCCCTCTGGTTCTCCGTCTGGTCGTGACGGGGGGAGGCACG
GGCGGGCATACCTACCCGGCCCTGACCGCTGTGCGTACGTTGCGGGAGCTGTTGAGGGCG
CGGGGGCGTTCTCTCGATGTGCTGTGGATCGGCAGCGCCGACAGTTTGGAGGCGCGTGTT
GCCGAGGCAGAGGGGATCGCGTTCACGGCGGTGGCCACGGGGAAGGTGAGGCGCTCGTCG
AATCCGTTGAGGATGGTCTCGCCTGCGAATGTGCGGGACATGGCGCGCGTTCCGCTCGGT
GTGGCGCAGGCGCGCAAGGCGGTCGCGGGTTTCCGGCCACATGTGGTGCTCGCGACGGGC
GGGTACGTGGCTGTGCCGACGGGGCTCGCTGCCCGGATGTGCAGGGTTCCGCTTGTGCTG
CATGAGCAGACGGTGCGGCTGGGGCTGGCCAACCGGAGGCTCGCGGGGAGCGCCTCTCGG
ATCGCGGTCTCCTCGGAGTCGACGCTGCCGCTTCTGCCGGAGAGTGTGCGCTCTCTCGCG
GTGGTCACGGGAAATCCGGTGCGTCCAGAGGTGCTGACCGGGCATCCGGGCAAGGCCGTG
GCGGCCCTGGGGCTGGGCTTCGATCTGGCCCTGCCCACGGTCTACGTCACGGGCGGGGCG
CAGGGCTCGCAGCAGATCAACGAGGTCGTCGGCGGGGAGCTGCCGTGGCTCTTGGAGCGG
GCCAACGTGGTGCACCAGTGTGGTCCTGCGCATTACGAGTCGCTGGCCGCGCGTGCGGCG
ACGCTTCCTGCTCACCTGGCGGTCCGCTACCACGTGACGCCCTTTGTCGGCGCGGAGCTG
CCCGATGTGCTGGCCTTGGCCTCCGTGGTGATCTCGCGCAGTGGCGCGGGGACGCTCGCC
GAGCTGACTGCCCTGGGCAAGCCGGCGGTCTTCATTCCACTCGCGTCGGCGGCCGGGAAT
GAGCAGGCCCACAATGCCCGGCACCTGGAGGAGTCCGGCGCGGCCGTCGCGCTCGTGGGA
GAGGTCGGCGGGGAACGGCTCCGCGCGGCGGTGGCCCCCCTGCTGGAAGATCCTTTGCGC
AGGGAGGCCATGGCTGTGGCGGCACGGGCTCAGGGTCGCCCGGATGCGGCGGACAGGCTG
GTGGACGTGCTGCTGACCGCCGCATCGGAATGA
>orf00117 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGGGGTCCGCTCCGCTCGCGCGGAGGTCACCCGCCGAGCTGACCGGGCCAGTCGGCTGC
TGCGCCGTGGCCTACTCCGTTGAGCGACAGACGAATGCGCCGCATCGGCGGGTCGGCCAC
GGCGATCCGCGCGGTCATCGCATCACCCACACGAATTTCCCTGGCAGGCTCTGCTGCGAG
CAGTTCGGAGCTGTGAATCAGCCCTGCAATCCCATTACCAAGATCCACGAAGGCGCCGAA
CGGCACGACCTTGGTGACCCGACCACTGACAATGCTGCCCACGCGCTCAGCCCAGACCAG
CCATGGATTTTCCTGCAGGGCGGCCAAGGACAGCACAGCCTGCCCATGCAACTCGGTGTC
CAGGGCCAGAACCTCAGCACTCACACGCTGCCCCAGCGATACCACTTCATGGGCAGAGGA
GATCCATTGCCACGAAACCTCGGGCGGAGGAATGAACCCGACCGAAGTCTCCGGCGCTCC
GTCGAGATCGACGAACACGCCAAAGGTCTCGACCCGGCTTACCATCCCAGCCACTACATC
GCCTGGGCGGAGCAACTGGAGGAAGTCTTTCAAGACCTTTGA
>orf00118 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGACCTCCGGGACCGCCGCGCTCCACACGGCGCTCGTCGCGGCCGGCGTCCAGCCCGGC
GCCGAGGTGATCGTGCCGTCCATGACGTTCTGCGCCACCGTGCAGACCATCCTCGCCGTC
GGCGCGACCCCACGGTTCATCGACATCGACGCCACCACCCTGTGCGTCACCCCGGACCTG
ATCAAAGAAGCGATCACCGACGCCACAACCGCTGTGATGCCGGTGCTCTTCGGCGGCCGG
GCCATCGACCTCACCCCGATCCGCGAGGACCTCGCCCACCGCGGCATCACGGTCATCGAG
GACGCCGCGCACGCCTTCGGCTCCCGCAACCCCGACGGCACCGGATTCGTCGGCAGCGAC
AACTCAGTGCTGACCTGCTTCTCCTTCGGCGCCATCAAGAACCTGACCTGCGGCCAGGGC
GGCGCCGTCATTCCCCGCACCCCCGACGAAGCGCACACCCTCCGCCGCCTGAGACTGCTG
GGAATCGAACAGTCCCAGAGCGAACGCGCCGAGACCACCACCTACCAGGTAGGCGGCTTC
GGACTGCGCTACCCGCTCTCGGCGCTCAACGCCGCGATCGGCCTCGCCCAGCTCGACCAC
TTCGACGAGACCGCCGTCACCCGGCGCCGCCTCTGGCGCGCCTACCGCACCGCCCTCTCC
GGCCTTCGCGACGTGCCCCTCATCGACGTCGGCGCCGACCGCGCCGTCCCGCACCTGTGC
CAGATCCGCGTACCGCGACGGGACGAAGTCTTCGCACACCTGCGCAAGGCGCACATCGGC
GTCGGCGTGCACTACCCGCCCAACCATCTCCAGCCCGCCTTCGCACCCTGGAGCCGGTCG
CTGCCCGCAACCGAACAGGCCGGCGAGGAGATCCTGAGCCTGCCCTTCCACCAGCACCTC
ACCGAGGCCGACATCGCCCTCGTCGTGCACGCCCTACGCGCCGCGCTCGAAGCGACAACC
ATCACTCCCCAGGCCTAG
>orf00120 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGCTGAGCGAGGCTCCCGCTCTCCCCTTCGCCGACGCCACGATGATCATCTCGACGCGG
GACGCCGACGCCATCGCCGACGCGCTAGGCGACGTCCGTCCCGCCGGGATCGTGGGAGGC
GCGAGCGACGCCGCCCTGGCCACCTGGCACACCCTGAGCCAGCGCTACTGCGCCCCCTAC
GTGTACCCGGAGGGCGCGCTCGCCGCCGGTGACAAGGGAGCCTTCCACGCGATCACCGCG
TCCTGCGGGGTGAGCGGATACGGGTGGATCGCGTCGGAGGACGAGGAAGAAGTCGTCGCG
AAGGCAGCAGGGTTGCGCTTCCCGCTCATGATCAAGCCCACGGACGGGTCGGGCAGCAAG
GGCGTGACCCAGATCGACGCGCCAGAGGAGCTTTCCGGTGCTGTCGCGTACGCCCGCTCG
TACTCCGCCTCCCGCACCGTGATCGCCGAGGAGTTCGTCCCGGGACGCCCCGTGACCGTC
GATGTGTTCATGCGCGACGGCAGGGCCGTGATGACCTCCATCAAGGATGAGGACTTCATC
GACGGGGGCTTCGTCCTCCGGCGAATGCGCACCGCGCAGCTCGCGCCACCCGCCCAACGC
CACCTCGAAGCCACCGCCGAGCGACTGTGCCGTGCGCTCGGCATCGACAACGGGCCGGCG
AACTTCGACATGGTCCTCGGCCCGGACGGCCAAGAGCACGTCATCGAGGCCAACGCACGC
CTCGGAGGAGACGGCATCCCGCGACTGCTCGCTGCCGCGTACGGCATCGACGTCGTACGG
GCGCTCATCTCCCTCGCCCTCGGACAAGCCTTCCACGACCACCTGACACCCACGCGCGCC
GCGCACGCGGCCCTGGAGCTGATCGGCTCGCCGCACGCCACGGAAGGCGAACTGATCACG
TGGGAAGGCATCGCCGAAGCCCGCGGTGTCCCCGGCATCACCGATATCGAGATATACGCC
AAGCCGGGCGATCTCGTACGCCCCCACGACCAGTCCGGCCACAAGATCGGCATGATCGTC
GCCGCAGGCGCCACGGAAGCCCAAGCGCTCGCGGCCCTGGAAAGCGCGAGCACCCTGCTC
AGGCCGATCATCCGCCCCAAGGAGGGATCGTGA
>orf00121 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGGAACATGTGCTCGTCACAGGCGGCGCCGGCTTCATCGGCTCGCACTTCGTGAAGAGG
CTCATCACGGCTGAAGACGTGGCCCGCGTCACCGTGCTCGACGCCCTCACCTATGCCGGT
CATGTCGAGAACCTCGGCACGGCCTTCTTCTCCGACAAGCTGCGCTTCGTCCACGGCAAT
GTGCAGGACGCCGACCTCGTGAACGACGTCATGGCGTCCGGCCCCACCGCCGTCGTGCAC
TTCGCCGCGGAATCCCACGTCGGCCGCTCCTACGGAGCGGCGAGAGAGTTCCTGTCCACG
AACGCCCTCGGGACGCAAGTGCTCGTAGACGCCGCTCACCGCCACACCATCGGCAAGTTC
GTCCACGTCTCGACCGACGAGGTCTACGGCCCGCTCGTCCAGGGGAGCGCCACCGAGCAG
GCGGCGCTCCGCCCCTCCGTCCCCTACGCCGTCTCCAAGGCTGCCGGTGACCTGGTAGCG
CTCGGCGCCTACCAGACCCTCGGACTCCCTGTGTGTGTGACGCGCAGCAGCAACAACTAC
GGGCCGTACCAGTACCCCGAGAAGATCATTCCCCTGTTCCTCACCCGGCTCCTGCGGGGG
ATGCCGGTGACCTTGCACGACCGGGGCCAGCATGTGCGCAACTGGCTGCACGTCGAGGAC
AACTGCGCCGGGATCGAGGCCGTCCTGCGCGACGGTAAGCCCGGCGAGGTCTACAACCTC
GGTGGCGGAGCCGACCTGTCGAGCAAGGACCTGACCGGATACCTGCTCGCCGTGTGCGGC
GCGACGTGGGACGCCGTCACCTACATCCCCGACCGCCCGGCCAACGACATCCGCTACTCG
ATCGACTGGGCCAAGGCCCGCGACCAGCTCGGCTACCGGCCCAAGCGCCGCCTAGAGGAC
GGGCTCGCCGAGACTGCGGAGTGGTACCGCCGAAACCCCGACCGGTGGGCGCCCATCGCA
CGCGGCAAGATCCCCGCCGTCCCCCTCGCCCGCACCATCCCTTCCGGAAAGGGAAGCCCG
CATGCCTGA
>orf00122 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGAGTCACGACGCGCTCGCGCTGCGCGTCAACGAACTCACCTGGCATGCCGGAATTCGC
ACGCAGTACACCAATACGAGTGTTTCCAACTGGGTGAAACGCGGCATGCTCCCCCGCCCT
CCGACACCCGACTGCATCGCCGCTGCGCTGGGCGAACACCTGGGCCGACCGGTCCACGTC
ACCGACATCGGCATGAGCGAACCGCGCGGCACGATTCCCGACATAGGGTTGGATTTCCCG
CGTGAGACCGCCGACGCCGTACACGGCGTCCTCGCCTTCTGGAGACACGTGGACCGCAGA
GCATTCCTGAACCGCAGTTTCGCCATCGGCGCCTTCGCCGTCCCGGTCACCCGGTGGCTC
GCCGTCCCCGCCGACGCCGCGAGCAGTCACCACGATGCTGGAGGCCAGCGCGTGGGGCGC
GAGGATATCGCCCACTTGTGGACCGCCGTCGAGGAGGCCCGCGTGGCGGACTCCCAGTTC
GGCGGAGGGAACTGGAAGGCGTCCTCCACAGCCGCATGCCTGCGCGAGTACGCCACCCCC
CTGCTGAAGGGCACCTACACCGAGGAGACCGGCAAAGCCCTCTTCGGGGTCACCGCCGAA
CTGACCCGGCAGATCGGCTGGTCCGCCTTCGACGCCGGGCACCAGGGCGCCGCCCAGCGG
CACTTCATCCAGGCCCTGCGCCTGGCGCGCGCCGCCGCGGACGTCCAGGCCGGCGCCTAC
ATCCTCACGACCATGTCCCTGGCCGCCTTCCTGCGCGGCCACCCGACCGAAGCCGTCGAC
ATGGCCGAGGGAGCCTACGAGCGCGCGAAAAACCTCCCGAACGCCGAGAAGGTCCTCTCG
TTCGCGAAACTCGCACAGGCTCGAGCGCACGCCCGCGCCGGGCAAACACGCGAGGCGACC
ACCGCACTCGCCCTGTCAGAAAACCTCCTCGACCGGACTCGCACGGAGACGGCTCCGGCG
TGGATGGCCTACTACACCCGCGAGCGCCTGGCCACCGACGCCACCGAGATCTACCGCGAC
CTGGGCCGCACACACGACGCGCTCACCTGGAGCCAGCAGGCCGACACCATGCCAGCCCAG
CGCTACACCCGCGCGGTCGGCATCCGGCTCGCGGTGGAAGCATCCGCGCACCTGCACAAC
AACGACCTGGAACAGGGCCTGGCCGTGGCCGACCACTCAGTGCAGCTCCTGTCAAAAGTC
CGTTCCGCTCGCGCCCACGGGTACGTCCACAGCCTCACGACCATGCTGGCGACCCGACAG
CGCGACAAGCGCGTCACCGCCTTCATCGAACACGCTCGCCGGAACCTGCCTGCCCCAAGC
TAG
>orf00123 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGAAGCTGGACGACCGGCCCGGAGCATCCCCGCGCGTGGGCTCGACTTCTTGGGTGACT
CTACGCGTCAGCCCATCTGCGGAGCATCCCCGCGCGCGCGGGCTCGACGGTGCGTGGAGT
TTCGATCTCACCCCGAACGCCGGAGCATCCCCGCGCGCGCGGGCTCGACCCGCCGCTTCA
CCGGGCGGACGAGTCCCTCTCGGGAGCATCCCCGCGCGCGCGGGCTCGACCCGGAGCGTC
CACGCCGTGTTCGTCGTGGTGGTGGAGCATCCCCGCGCGCGCGGGCTCGACACGGGCCAG
ATCGCCGCCCGCGTCGTCGCTCACGGAGCATCCCCGCGCGCGCGGGCTCGACCATAA
>orf00127 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGTTAAGCACTACGGCGGCTAGACGGAGCATCCCCGCGCGCGCGGGCTCGACCATCACC
GTGACCAACGTCGCCACCGGCGAATCCGGAGCATCCCCGCGCGCGCGGGCTCGACACTTG
TTGACCTGCAGTTCTACTGGCAGAAGTGGCCTTTTTTATTCAGTTGTTTTTGGGACGGGC
GGAGAGAACAAGGCCGTCGAAGTCGACCGGTTGCCAGCGGTTGCGGCCTGCGGTGCGGAC
TGCCCAACCCTGTTCGTTGCGGGCTGGTTCGACCAGGATTGCTTGGCCGTCGCCGATGCG
GGCGGCGAGGAGTTCCCAGAGGCGGTCTCGGATGCGGCGGCTGGGATTGCCGACGAAGAC
GCCTGCGCTGGCTTCGATCATCCAGCGGGTTAG
>orf00129 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGCCCTACCTCTCCCGCATCCGCATCAACCCTCTGCGCACCGCGAGCCGCACCCTCCTC
GCCAGCCCCCGCGCCCTGCACGCCCAGGTCCAAGGCGGCGTCCCGACCCTCCCGAACGAG
TCCCGCACCCTGTGGCGCCTGGACGCGGACAACCCCCACCGCCCCGAGCTGTTCGTTCTC
ACCGCCGGAAAACCCGACTGGACCCACCTCGTCGAACAGGCCGGGTGGCCCGGCGCGGAC
GGCGAGCACTACGCGGTACGGGACTACGCGCCCCTGCTCGGACAGCTGGCGCAGGGCCGG
GAGTTCGCCTTCCGCCTGACCGCCAACCCCGTCCAGAACACCAACCGCCCCGACAAGCCC
ACCGAGCGCCAGCAAGAACGCCTCGACGGCGGCACACGACGCAGCTTCCGCCTCGGCCAC
CGCACCGCCGCCTCGCAGCTCGGCTGGTTCCTGACCCGCACAGCCCGCTGGGGCTTCGAC
GTCCCCGCCGCCTCCCACCTGGACGGCACCCGCGACGACCAAGACGAACCACCACGCGAC
GTGCGTATCAGCACCCGCCGACGCCACTCCTTCGGCAAGCCGACCCGCGCCTCCAAGGAA
GACCGGGTAATCATGCACATGGTGACCTTCGAGGGAAAACTCCGCGTCACCGACCCCAGC
CTCCTCACCCAGCGGCTGCTGGCCGGGATCGGCCCTTCCAAGGCGTACGGCTGCGGGCTC
CTCACCCTCGCCCCTGTGCCCGCGAAGGCGTGA
>orf00131 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
TTGCGGGACTACCACACCGTCAGCGACTACCGCGGCCGCCCGCTCCTGGCCGCCGCGGTG
AACGCCAAGGGCACCCAGAGACTCACCGGCCCCGCCAAGTACACCCACATCACCCAGCGC
TTCTACCTCCAGGACGCTGTCTTCCTCGCCGCGATCGAGGGCCCGGCGCACTTCATCACC
ACCCTCGAAAACGCGGTACGCCACCCGGCCTTCCCGCTCGCTCTCGGCCGCCGCTCGTGC
GTCCCCGCGCAGCCGCTCGTCCTGGGGCAGCGCACCGGACCGCTGGAGGAGGTACTGCGC
GCGGAACCCTGGCACGTCACCGATGCCGTCCGGAAGCGGTGGGGACGCCGCAACGGCAAC
GCCGCCCACGTCGACCTGCCCCTCACCCTCGACGACCCGGCCGGCGACGACACGCGCGAG
GACCTGCCCCTGTCCTTCGCGCCTACCAGCAGGGCCTACACCAGCCGCCGCGTCCGGCAC
ACCTACGCCGCCGCCCCCACCGGCCTCACACCCCACCCCGACCAGCCGCCATCCACCGGC
GGCCACGACCCCTTCGCCCTCCTGGGCTGGTGA
>orf00132 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGGCCGACATCTGGTGGAAAGCCGACCCCCACGACCTGCACCGTCTCACCGACCGCGTC
TCCAGCGTCTACGTCGAACGCAGTCATCTCGACCGCGACGAGAACGCCGTCGTCATCATC
AATAAGCGACAAACCGTCCGTGTCCCCGCCGCCATGGTGGCCGTCATGCTCCTCGGCCCC
GGCACCCGCACCACCCACGCGGCCATCCGGCTGCTCGCCGACTCCGGCACCACGGTCTGC
TGGGTCGGTGAACAAGGTGTCCGTATGTACGCTGCCGGCCTCGGCCCCAGCCGGGGCGCC
GGCCTCCTGCACCGCCAGGCATGGCTCGTCACCCGGCCCAAAGAGCGCCTGGCCGTAGCG
CGAGCCATGTACAGCATGCGCTTCCCCGGCGAAGATGTATCGGCCCTGACCATGCAACAA
CTCCGCGGGCGCGAAGGCACACGCGTCCGCAAGCAGTACCACCACCACGCGGAACGCACC
GGAGTGCCCTGGAACGGTCGCGTCTACGTCGCCGGCGACGCCCACGCCGCCGGCGATGAC
CTCAACCGGCTCCTGTCCGCCGCCAACGCAGCCCTCTACGGCATCTGTCACGCCGTCATC
ACCGGCCTCGGCGCCAGCCCAGGACTCGGCTTCGTCCACACCGGCAAAGCCACCTCCTTC
GTCCTGGACATCGCCGACCTCTACAAAGCCGAATACACCATCCCCCTCGCCTTCGACCTC
ACCGCCCAAGGACTCACCGAAGAACGCGACGCACGACTCGGCCTCCGCGACCTCATTACC
CGTGACAAACTCCTCACGCGCATCGTCACCGACGTGAAAAACCTCCTCACGCCCGAAGGA
GCCGAGTTCGAGGACTCCGAAGCCAACCTCCTGTGGGACGAACAGGTCGGCGCAGTTTCC
GGGGGAACCAACTACGCCGACTCAGCAGATTTGTCCGTCTACGGAATAGGAGACAACCAC
ATCGCGGTCATCGGTCCCGATCTCGACGAAACCGGCCCCACCTCATGA
>orf00133 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGCCACAGCGCCTTTTCATCGACGTGCACATCGTCCAGACGGTCCCGCCCGCCAACGTG
AACCGTGACGACCAGGGGAACCCGAAAGAGGCCGTCTACGGTGGCGCACGGCGCTCGCGC
GTCTCCTCCCAGGCGTGGAAGCGGGCGACGCGCAAGCACTTCGACACCACGGTGCCCGAG
CCGGACCGCGCGACCCGCACCAGGCGCCTGACCAGCGAACTCGCCAAGCGGATCGTGCGT
GACACGAAGCTGGAGCGTGACAAGGCCGACCGGCTCGCCGGCGCGTTGTTGACCCGGCTC
AACCTGAGCCAGGGGAAGAAGGCCAGCGACACCGCCTACCTGCTTTTCTACGGCAACGCC
CAGCTCGACACGGTCGCCGCTCTCGTCAGCGGGCAGGCCCACGACCTGGCCGCGCTGGAT
GACGAGAAACTCGCCGCAGAGCTCAAGGACTTGCCCGTCGCCGACGCCTTCAGCACCGGA
CACCCGGTCGGTGTGGCGCTGTTCGGCCGCATGGTCGCCGACATCCCCAAGCTCAATGTC
GACGCCGCCGTGCAGGTGGCGCACGCGCTGTCGACGCACGAGACACAGCTGGAGTTCGAC
TACTTCACCGCCGTCGACGACAAGACCGAGAAGGAGGAGACCGGCGCCGGGATGATCGGC
ACCATCGCCTTCAACTCCGCGACGCTGTACCGGTATGCCACGGTGGGTTTCGCCCAGCTC
GCCGACAATTTGGGCGGTGACACCGAAGCGGCCCTCGATGCCCTGGACCGCTTCGTCGAC
AGCTTCGCCCGCTCCGTGCCCACCGGCTACCAGAACTCCTTCGCCCACCGCACCCGGCCC
AGCCTCGTCGCCGTCGTGGTCCGCGAGGACCAGCCCGTCAACCTCGTCACCGCCTTCGAG
GAACCCGTCGTGTCGGAAGCCGGCATCCAAGCCGCGTCGGTACGCAGCCTGGCCCACGAG
TACGCGGCGGCCCGCAGCGCGTGGGGCGACGTCCCAGTGCACGCGGCGGCGACCCACACC
TTCGCCTCCGGCAAGCCGGGCGCGACGGAGACCGTGGAGGCGCTCACCGAAGCCTTCGGC
ACCTCGGTCCCCTTCGACGAGCTGCGCTCGGGCCTGCGCGCGTGCGTCAGCGCCGTCCTG
GAGGCCCAGGGATGA
>orf00134 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGACCGAACAGCGCTCTGCCGCGCAGAGGATCTGGCACCGCCACATCGCCGCGGACGGC
ACCTGGCGCACCACGAAAGGCACCGCGGCCGCGAAGCGGCCGCCGGGCGAGGACCTCGCC
GTGCTGCGCCGGGGCCTGACCCGTCCCGCCGGCACCGTGCTGGAGATGTTCCCCTTCTAC
ACCTGCCCCATCGACGACTTCGCCGCCCGCAAGGGGCAGATGTCCGCCGAGCAGGAAGCC
GAGCACATCGCGCTCGCCCTGTACGGCCTGCACCAGCAAAGCCAGGACCGTCCCATGCAC
CAGCCCGGCGTCGGGCTGGGCCGGGCGATGCTCGTGTTGCGCGGCCACGACAAGACCAGT
GCGGACGCGGTCGACCGGCGTTTCCAGCAGACCTTCTCCACCACGTCCCTGACGGCGCTG
CAGAGCCGGCTGCGCGGGCTGGTCACCCAGCTCAAAGACATCAAGTGCCCGCTCGACTAC
GACCGCCTGATCCTCGACGTCCAGGACTGGAGTCGCCCCGCAACGCGCTCACGAGTGCGG
CGGCGCTGGGGCCTGGACTACTACGGCTGGACCCAGCGCTCCAAGGAATCGTGA
>orf00135 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGGGGTTTGGGTTTTCCCTGCTCGAGGAGCGGTGGCTGCGTGTGCCGCCGGCGGTCGGC
GGTCTGGCGCGGGAGCGTTCGCTGAGTACGGTGCTGCTGGACGCGCACGAGTTCGGGGAC
CTGGCGGTGGAGAGTGCCACCCAGCGGCCGGCGGTACTGCGGCAGCTGCTTCTTCCGGTG
GTCGTCGATGCGCTGGGCCGTCCCGCTGACGAGCGGGAATGGACGCAATGGTTCGCCGCC
GGGCGCTGGACGCCCGAGCAGCGCGCGCGGCTCACCGCGTATCTGGACGCGTACCGTGAG
GCGTTCGGTCTCTTCGATCCGGTGCGGCCATTTGCGCAGGTGGCCGGGCTGCACACCCCG
AGGGGGGAGACGAAGAATGCCGCCCTGATCGTGCCGCACGCGGCGACCGGGAACAACGTC
CCGCTGTTCGCCTCGCGTACGGAAGGGGACGTGTTCGCTCTGACGCCGGCGCAGGCCGTG
CTCTGGCTGCTGCACACCCACTGCTGGGATACGGCGGCGATCAAGACCGGGGCGGTCGGC
GACCCGCAGGCGAAGGCGGGCAAGACCACAGGGAACCCGACGGGCCCGCTTGGCCAGATG
GGCGTCACGCTCCTGGCGGGCAGGACCCTGTTCGAGACGCTGCTGCTGAACCTCCCCGTG
GGCGCCGCTCCCGTGTCGGCGGATCTGCCGCAATGGCGGCGACGGGATGCCGAGCATCCG
CTGTCGGCCGGGACGCCGCGCTGGCAGGAGCGTCTCCCGCAGGGGCTGCTGGATTTGTGG
ACCTGGCAGTCCCGCCGGGCCCTGCTCGTTCCCGAGGCCACCGAGGAGGGCGTGCGTGTG
ACGCGAGTCCTGGTCGCGGCCGGGGACCGGATGCCGTACACGCCGGAGATCGAGCCGCAC
ACCATGTGGCGCACGGAACCCACGGGTGGCCGCAAGCCCGCCAAGAACAAGGGACGCATT
GTGCCGCCGCGCCGGCCGTTGCGTCTTCAGCCGGGGAAGGCCGTGTGGCGGGGCCTGGAC
GCGCTCCTCGCCACGGAACGTGCGACGCGGGAGGCGGGGGAGGGGACGAGCGGGTTCGTG
ACGAGCAAGGTACTGGATCAGGCCGGAGGTCTCGTCGCCGAGCTTGGTGAGGGCTACCCG
CTGCGGGTGGAGCTCACGGGTGTCGCCTACGGCAATCAGTCGGCGGTCGTCGACGACGTC
ATGCACGACGCGCTCCCCCTCCCGCTGGCCGCGCTCGAGGTGGACAGCTTCGTCCGCTCC
GCTCTGCTGGAAGTGTGCGAGCAGGCGGAGCAACTGGCCGCCGCCGTCAACCATCTCTCC
GCCGACCTGCGTCGCGCGCTTGGCACCGAGCCCATTCCGTGGGACCGGGGCCAGCGTCCC
GGCGAACTCGTCCTGCACGCCCTCGATCCGCTGGTGCGGCGGCTGCTGGCCGGGATACGG
CATGTGGACGACCTCGAACGTATCGATGCCGGGCAGCTGGCGTGGGAGCAGCTCGCCTGG
AGCCGGGCCTGGGCGGTCGCGGACCGGCTGCTCCAGGCCGTACCGGTCAGCGCGTTCGCG
GGCCGGAGCACTTCTCAGGGGGAAGGGAAGCCTGAGCGGACCCACCGTGTCTCGCTCGCC
GAGTCGTTCTTCCTCAAACGCCGCGCGGAAATTTTGCACCGGGCCGCCGCTGCCCGGCGC
GAGAGCACCGCGGGCGTCGCAGAACCGGCCGGCCTGCCCACCGCATCCTGA
>orf00136 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
TTGAAACCTTCTCTGTTTAACCTACGCACACCCACCACGCGCGCGGGCAGGTTTCCCGCA
ATCCGATGCGAGAATCCGTTGACCGACAACCGACCCCACCCCTGGCGCTGTCCGCGGGGA
TGA
>orf00138 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGTTCCGGGCCGCTTCGAGGAGACAGGCAGCATCGCCCGGTTGCCCCCGCGCCTGCGGG
ATCCTCCAAGCTGGACCTCATATGGCAGGACCCGTCTGGCGTCGACCCCGCGCACGCGGA
GATCCTCCGTTGAGGCCGCAGCCGGGCATCCACTCGCTCAGGTCGCGGGTACCCTCCTAC
CCGTCGATCCACCGGTCGTGA
>orf00139 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGTCGCCGCGGCGGTGGGGGGGTGGGGGCCTGCGGGTGCGGGTCAGCCCATCTGGGTTC
GGGCGGTGCCCTTGTATCACGGGGTCGGGGGTGGCGGGTGTCGTTTTGGTGATTCTCCTT
ATCGTTTGTGCAGTTCAGAGGGTGTTGTCGGTGGTGCCGTTTACGATCCGGTTCTCGAAT
TCGTGTGTGAGGTGGGGGTTTTCGGTGGATGTGAATGAGCTGGCGTTGAGGTACGGCGCG
GCGGTGGTGCGGGGGCTGGAGACGTTGTGGGGGAAGTCGCGGGAGAGGGCTGCGGGGAGG
ACGAGTCTTCTGCTGGGGCATCTGCTGGATACGGCGGCGGTTGCGGAGCTGATGTGGGAG
GAGTTCTTGGCGCCGGCGACGCGTTCGGCGCTGGATGAGGTGGCGGGTGGGGTGGGGTGT
GGGCGTGGGTTGTTTGTGTGGTTGTGCGCGGTGCATGACTGCGGGAAGGCGACGCCTGCG
CATCAGCGGTTGTGGGATGAGGGGGCTGAGGCGGTTCGTGCTGCTGGGTTGACGTGGCAC
GAGCCTTCGGCTGTAGCGGGGGCGAAGCAGCGTTGGCGGCACGACTGGGCCGGTGGGCTG
ATCGTTCGGGAGTTGCTGGGGGAGGTGGGGTGGAGTGGCGAGCAGGTGGACTGGGTGTGG
CCGCTGGTCGCCGGTCACCACGGGGCTTTCCCGACGCTGAAGGACGTGCGTGAACCGGGG
TCCGCGAAGCGGCAGTTGCGCGGGATCGGGGTGTGGCGGGAGGTTCAGCGCGCACTGCTC
GATGTGGTCTCGCGCGAGGTGGGCTTTGCGGGGCCGGCGGAGGTGGAGCCTGTGGTTGTT
CCGTCGAGGGCATTGCAGTTGCAGGTGAGTGGTCTGGTGGTGATGGCGGACTGGATCGCG
AGCGACGAGCGGTACTTCGGTGGGGTCGATGACCTGCGAGAGGTGAGTGCGGAGGGTTCT
CGTCGGCGGGCCGCGGGGGCGTGGAAGGCGCTGGGGCTGCGTGGTGGCTGGGGTGAGCGG
GGTGTGCCGGGGCGGGAGGTTTTTGCGGGGCGGTTCGGGTGTGTGCCGCGGCCGGCGCAG
CGGATGGTCGTCGACGCGATGGGGGATATGGGGGGTGCGGGGCTGGTGGTGGTGGAGGCT
CCGACGGGGGAGGGGAAGACGGAGGCGGCGCTGTTCGCCGCGGAGGTTCTGGCGGCGCGG
TTTGGTGCGGACGGTGTGTTCGTGGGGATGCCGACGCAGGCGACGAGTGACCCGATGTTC
TCCCGGGTGCGTGGGTGGCTGGGGGCGGTTTCGGAGGAGTTCGCGTCGCGGGTGGTGCTG
TTGCACGGCAAGCGGGCGTTCAACCGGGAGTGGAAGGGGCTGGTGGAGGAGGGGGCGGGG
GCGAGGGAGGCCTTTGGTGGGGTGGATGAGTTCGGTTTGGCTGGTGATCCGTTCGGTGTG
AGCGGGGAGGGGGGTGGGGAGCTGGAGTGTCAGGCTCTGGTGGAGTGGTTTTTGGGGTCG
AAGCGGGGTCTGCTGGCTCCGTTCGTGGTGGGGACGGTTGATCAGCTGCTGTATGCGGCG
ACGCGGACGCGGCATGTGATGTTGCGGATGGCGGGGCTGGGCGGGAAGGTCGTGGTGCTG
GACGAGGTGCACGCGTGCGACGTGTACATGAGTCAGTTCTTGCACGAGGCGTTGCGGTGG
CTGGGGCAGGCGGGGGTCCCGGTGGTGGTGCTGTCGGCGACGCTGGCCCCGGCGCAGCGG
CGGGGCTTGCTGGAGGCGTATCTGGCGGGTGCGGCGTCCGTGGAGGAGTTGCGGGTCGAG
GTGCCGGCCGCTGAGGGGTATCCGAGTGTGACGACCGCGTGGTCGCCGGCTGGGGGCGAG
CCGCAGATCCGGGTTCGGGCGACGGGTAGCTGGCGGGCGGATCTCGGGGTTGAGGTGCGG
GTGGTTCCTGAGGCGGTTCCGGGGCGGGGGAGTTCGCGTGAGGAGCGGGAGCGGGCGCAG
GCTTCTGCGGATGCGCGGGTGGGGGAGTTGCTGGCCGGTGAGCTTGCCGGGGGTGGTACG
GCGCTGGTGATCCGTAATTCGGTGGCGCGGGCGCAGAGCCTTTTCGAGGAGTTGCGGGGG
CGTTTTGGCGGGGATGAGGTGCGGTTGCTGCACGCGCGGTTCACGGTGGCGCGGCGTGCG
GAGCTGACGGAGGAGTGTTTGCGGCTGCTGGGGCCGGGGGCGGGGCGTTCGCGTTCGGGG
CGGTTGGTCGTGGTGGCGACGCAGCTTGCGGAGCAGTCTTTCGATGTGGATGCGGATGTG
CTGGTCACGGATGTGGCGCCGGTGGATCTTTTGTTGCAGCGCGTGGGGCGCTTGCACCGG
CACGAGGGCACGTGGAGGCCGGAGGGGCTGCGGGTTCCGCGTGTCTTCGTGACGGGTTTC
AGTCCTCGTGAGGGGCGGGAGCCGGAGTTCGTGTCCGCGAGTGAGGGGATCTACGGGCGT
CATCTGCTGTTGCGGACGGCGGCCGTACTGCCCGGTGCGGGTGTGGGGGCGAAGGCGGGT
GCGGGCGGGGTGTGGCCGGTTCCGGGGCGGGTGCCCGCTCTGGTCGAGGAGGTGTACGGG
GATGAGGAGTCGCTCTTGCCCGAGGGGTGGCGTACGGCGGGTGAGGCGGCCCGGAGCGAG
CAGGAGACGCAGGACCGGGAGCGGGCGCAGAACGCGCGGCAGTTTTTGCTGACGGGGCCG
GGTGAGCACGAGCGGCGGACGCTGGCCGGGTTGCATTACGGCGGGGGGACGGCGGGCGGC
GGTGAGGACGCGTTGCGGGCGGCGGTACGGGACGGGGACGAGTCCGTGGAGGTCGTGCTC
GTGCGCCGCGACGGGGACGACGGAGCGTTCCGGACGCTTGCGGGGCGGGCGCTGAGTGTC
AACGGGGACGTGGCTCCAGAGGTGCTGGAGGAGGTACTCGGTTCCGTGGTGCGGCTGCCC
GCGAAGTTCACCAAGGCGGCCGCAGGGCTGGCGCCGCTGCCGGGCTGGCACGGGCATCCG
TGGCTCGGCCGCAGCCGTGCTCTGGTGCTGGACGCCTCGGGTAGGGCCCGGCTGGGCGAT
TTCGCGGTGGCGTACGACGGCGTGCTGGGGTTGCGGCAGGTATGA
>orf00141 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGGGGATCAGTCGCGCCGCCGAGCGGCTTTCGGGGGTTTTCGGGGGTTACGGTGTTGAC
GTGGAGGGTGAGAGCTGGTGGGGGCGAGCTGTTGTTTCTGTTCTGGGCTCAGTAGCCGGC
CGGAAAGCAACTGAAGGAAAACCGGCAGACCGGCTGGTATGA
>orf00144 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGCCACTGGTCCTCATCCCGACCGACACCGTGGGAAGATCCCCGCGTGCGCGGGGCCGA
CAGTTCGAGCGCGGGCGAGCGGCCGTCCTGCGTCGGAAGATCCCCGCGTGCGCGGGGCCG
ACCCGTGCACCTGATCGGCGAACAGCTCACGACCAGGAAGATCCCCGCGTGCGCGGGGCC
GACACCTTGCCCCTTGTTGTCACGCCGACGCTGGTTCGGAAGATCCCCGCGTGCGCGGGG
CCGACGTGCCGTTCCAGATGCTCTACCGGCTGTGGGACGGAAGATCCCCGCGTGCGCGGG
GCCGACGCCCGCTCGAGCGCGGCCTCGCTGAACGAGACCGGAAGATCCCCGCGTGCGCGG
GGCCGACGCGCCGACGCGCCGCCAGGCGGCCCGCAGACGCGGAAGATCCCCGCGTGCGCG
GGGCCGACCCGTTGA
>orf00145 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGCGCGGGGTCGACGCCCGCCGTGCCGAGCCGGAGGCACCCGGCCTGGGAAGATCCCCG
CGGGCGCGGGGCCGACCACCTCCCTCGCTTCGGCCTCGCGGAGGCGATCGGAGGATCCCC
GCGGGCGCGGGGCCGACCGGAGCCGACTCGGCGGACAGGTACGGCTTGTCCGGAGGATCC
CCGCGCTCGCGGGGCCGACGCGCCGACGCGCCGCCGCGAGGCGTGCAGCCGCGGAGGATC
CCCGCGTGCGCGGGGCCGACCGGTGGAGCCTGCGACGACTGCCCCTGA
>orf00146 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGTGCGTCGGTGTTCCCACCGATCGTTGCCCCCGCGCCTGCGGGGATTTTCCGGACCTC
TTCGAGTCGTTCGCCGCCCTCGCCCGGTTGCCCCCGCGCCTGCGGGGATTTTCCCTCACC
AGCTACGACCGTCCCACCGCCCGGAACGTTGCCCCCGCGCCTGCGGGGATTTTCCGAGCA
GCCGCAGACCACCGACGTGTGGAACGTGGTCGCCCCCGCGTCGGCGGGGATTTTCCGTCC
ACCCCCGCCGCCTCGGCCCCGGACATGTGGTTGCCCCCGCACCTGCGGAGATGCTCCGGT
TCGGTGGGCGGAGTGCCACGGCTCGATCGGGGCCGGGTTGTCGCCGTGTTCGTTGGTGTC
ATCGCCTATGGGCTTCTCCTCTTCTTGGTGGATGAGGTGTTCTGCGTCCCGAGTGGGGCG
GAAGTCGTAGGTCACTCTGGGCTGCACGGCCCCTTCTCAGCGTAG
>orf00149 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGTGGTGCGAGACCACGCTCCAGCCCGGCATCGACGACATCGACCTCGGCGCCCGCCCC
GCCACCCGCACCGGGCCAGCCTGGTTCCCCCGCGGCTGCCGCCGCTGCTGCTACGGCAGG
GACGAACGATAA
>orf00151 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGATCTGCGGCAGCCCCTATCGCAAGCCCGTGCACGCCGCGACCTACGGGGCCGGGCGC
AGGAGGCGCAGCATGACCTCGACTCTCCTCCCGAGGGCCCACCCCGGGTGCGCATGGCTG
ACCGAAACCCTGCTCGACCCGTCCCCCGCCTACGCCGACTGGCAGCGGGAACGGCTCGCG
CCGGTGCCCTCGACGGGAATCTGGCGGGTCGTCGAGGCCCCGCTCTACCCGTCGATCGAC
GCCTTGTGCGTGCTCCGGATGAGCGGCAACGCCGGTCCCGTCCAGGGGTCCTCCGACGCT
CGCCGCGCCTGGTGGCTCGTGGCCGCCGGGACCGCGACCCTCCTCACCGACGTCCCGGGC
ACCCTCGCCCACCCCGCCGGGTGGGTGCTCGACTGCCCCGCACCCGGCATCGGCGCCGCC
GGGCGCACTTGGCTGCACCCGCCCTACGGCACCGGTCTCCTCACTCCCGCACGCCTCCTC
CGTGAAGCGCTCCTCGACGCGCGGGAGATGGAGGTGATGGAGCGGTGA
>orf00152 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGTCGTTACGGTTCATCGGGATCGACCCGAACACAGGAGACAAGGAGAGCCCGACCGTC
TGGGTGGACGAGGAGCACAGCGAGCTGGTCTTCCAGGGCTGGGTGCCGTCACCGGCCCTG
GAGGCGGAGTGCACGGCCACGGAGGTACCGGGCCACGCGAAGGGGATTCCCGAGGGGGAA
GCGGTCGTCCGCATCCCGGCCCGGATGGTGGAGATGGTGAGGGAGGCGTGCGATGCCATC
GAGCAAGCCCACGTTCGATGA
>orf00153 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGCGCGACGCCTACGCCGTGGACTACGAGAAGGGTCCCTTCGCGGACTGGCGCGCCGGA
CACCGGCTCAACCCGGCGGAACGCGAGACCTGGTGGCGTCCGTGGCTCGACCTCATCAGC
GAAACGGTCGACCGCGGCGCGGAAGTGCGGCGCGCGCGGATCGTGTCCGAGCCGGTCAGC
GAGTACACCCGCTTCCTCTACGACGGCACCTTCACCAATGTGGCCGCCGGGGAGCAGGTC
CGCTGGCTGCCCCGACGCCAGGCATCCGACATTCCCCTGCCGGGCAATGACTTCTGGCTC
TTCGACGGCGTGTGGGTGCACTGGAACCACTTCGCCGGGGACGGGTCATCGCTCGGCGCG
GAGATCACCGACGATCCCCGCGCGGCGGCTGTGTGCCGTGACGCCTTCGAGCAGGTGTGG
GAACGAGCTACACCGCACGACGAGTACAAGATCCGCTGA
>orf00154 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGGCCGAGCGGCTGCGCGACCTCCGCCGAGCCGCAGGGCTCACGGTGACAGAGCTGGGG
GCGGCGTGCGGCTGGCACCACGCAAAGACGTCCCGGATCGAGAACGCCCGTACCGCGCCC
TCGGCCAAGGACATCACCGCCTGGTGCCGTGCATGCGGAGTTGAGGCGCTGACCGGGGAC
CTGGTGGCGCAGTCCCTCAACGCCGAGTCGATGTACAGCGAGTGGCGCGACCAGATGCGG
GGCGGAATAAAGCGCCTCCAGGAGTCCTTGACGGACTTCTACCGGGAGACGCGCCTGTTC
CGGGTCTACTCCTCCACGCTCATCCCCGGGCTGTTGCAGACGGAGGGATACGCCGCGGGC
CTCCTCACGGCCATCGCCGACTTCCGCCAGATCCCGGTGAACGACGGGGCGGAGGCGGGC
GCCGCCCGGGTGGCCCGGTCTCGGGTCATCTACGAGCCCGGCCACCGCTTCGTCCTCCTG
ATCGAGGAGGCCGCCCTCTACTACCGGATCGGCGACGACGAGGCAATGGCCGCCCAACTC
GGCTTTCTCCTCACGGCTGGTGCCCTGCCCGCCGTGTCGCTGGGCATCGTCCCCTCGTCG
CACCCACAGCGTCGGCAGTGGCCGCACGAGACGTTCCACATGTACGACGACGCCTTCGTG
TCGGTCGAACTGCTCTCCGCGCAGGTGAAGCTGACCCAGCCCTCCGAGATCGCCCTGTAT
TTGCGGGCGTTCGAAGAGCTGCGGAGCATGGCCGTCTACGGCGCGGACGCGCGCGCTCTG
GTCGTGCGGGCGATCGACGCGTTGCGGTAG
>orf00157 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGACGCACGGCTACGAGGACGAGTGGGGGCCATCCCCGCGCGTGCGGGGACCATTCGAT
GTGGCAGTGCTCGCTCTGCGGCACCTGGGGGCCATCCCCGCGCGTGCGGGGACCATCCGC
ATCCGTGAAACCCGAGAAGGCGACCTTCGGGGCCATCCCCGCGCGTGCGGGGACCATTTC
GACTTCCGGCATGTCGCTGACCTGCTGTTTGGGCCATCCCCGCGCGTGCGGGGACCATAC
CGTCTGGAAGTCCTCGTCGGGGGTGTCCATGGGGCCATCCCCGCGCGTGCGGGGACCATC
AGCACGGGCATCCCAGGCCACGACCGAGCGTGGGGCCATCCCCGCGCGTGCGGGGACCAT
ACTTCGTGA
>orf00158 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGAACGTCTACAACGGCGGAGGATCCCCGCGGGCGCGGGGCCGACTTCTGCGAGAAGGT
CGCGCAGCGCTTCGCCCGCGGAGGATCCCCGCGCTCGCGGGGCCGACGCCGATGAGCGCG
GTGGCGGTGGAGGCCGCCGTGGAGGATCCCCGCGTGTGCGGGGACCATCCCACGGTCGTC
TTACCGACGGACCCAGCCCGGGGGCCATCCCCGCGCGTGCGGGGACCATAG
>orf00160 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGGGTTTCGGGGGTTACGGTGTTGATGTGGAGGGTGAGAGCTGGTGGAGACGGGCTGTT
GTTTCTGTTCTGGGCTCAGCGGCCGGTCGGAAAGCAACTGAAGGAAAACCGGCAGACCCG
CTGGTATGA
>orf00164 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGGCTGCCCGGAGGATCCCCGCGCTCGCGGGGCCGACTACAGCTCCGTCCCCGAGATGT
GGAGCTTGTACGGAGGATCCCCGCGCTCGCGGGGCCGACACTTGCTGA
>orf00169 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGTGCGGGGTCGACTCCACCAGCGAGATGACCGCGAGGGGAGAGTCCCCGCGGGGACGG
GGCCAACGAGGCGGTGCTCCTCGCCGTACGACGTACTCACGGAGGATCCCCGCACACGCG
GGGCCAACTTCAACCGCGCCGACGAGCCCGGCCGGGGCGGCAGAGGATCCCCGCGCTCGC
GGGGCCGACTTCGCACCACCATCCTGTCTCGTCTCGACGCCCGGAGGATCCCCGCGCTCG
CGGGGCCGACTCGAGCACGGTCACGGTGTCGTGCTCGCTGAACGGAGGATCCCCGCGTGC
GCGGGGCCGACCTGGCCGAGACCCTCGCGACCCTGTCCCTCAAGGGAGGATCCCCGCGAG
CGCAGGGTCGACCCGCCCCTCGCCACCCGGCCTCGGGAAGACCGGGGAGGATCCCCGCGC
ACGCGGGGCCGACGCTCATCCGCGCGCCGGGCCAGACTCACGCGCGGGGAGGATCCCCGC
GCTCGCGGGGCCGACCTAGGCGGCGGTGAGCGTGCGCTCGGTCAGGGCGGAGGATCCCCG
CGCTCGCGGGGCCGACGCGAGCCGGAACTCGCCCGCCTCCGCACCGAGCGGAGGATCCCC
GCGCTCGCGGGGCCGACAGGGCCCCCGCCAGAGTTCCTCGGAGAGCACCCGGAGGATCCC
CGCGCTCGCGGGGCCGACCGCCTCGAAGTCCACGCCTCCCCGGACAGCGGCGGAGGATCC
CCGCGCTCGCGGGGCCGACGTGGTCGAACACGATGTGCGCGGACAGGTCGAGGGAGGATC
CCCGCGCTCGCGGGGCCGACGCGGGGCGGACCTGCATCCGGGTGCCGTCCGGAGGATCCC
CGCGCTCGCGGGGCCGACCTCGTCGGTGACCGGGATGTGATCCCATCCCCAGGAGGATCC
CCGCGCTCGCGGGGCCGACTGCATGGCCCGGTCGGCCGCGCGAAGGGAGAGCGGAGGATC
CCCGCGCTCGCGGGGCCGACCGGCCGCCGTGGCGCCGCCATAGCCTCCTCCACGGAGGAT
CCCCGCGCTCGCGGGGCCGACGATACCCAGTCAGGAGACGTCATGGCTCTACACGGAGGA
TCCCCGCGCTCGCGGGGCCGACCGGGGTCCCGGTGGTGCTGTAGCCGCCAAGCTCGGAGG
ATCCCCGCGCTCGCGGGGCCGACGAGCTCTGGGAGGACAAGGACGCACTGGGCAAGGGAG
GATCCCCGCGCTCGCGGGGCCGACGCCGTCGCGGCGTTCCTCACGGTGCAGGCGACCCGG
AGGATCCCCGCGCTCGCGGGGCCGACGCATCGGGTCCCCTGTTCGGGGGCGACCACGGCG
GAGGATCCCCGCGCTCGCGGGGCCGACTCCTGGGGAGATGAGGTGGTGCACGTCAAGGAC
GGAGGATCCCCGCGCTCGCGGGGCCGACGGGCGCTACCGCCTCGGGGAGACCTTGCAGAG
CGGAGGATCCCCGCGCTCGCGGGGCCGACCACTCGCCCCTGGTGA
>orf00172 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGCGCATCAAACGTCCCGCAGAGGTTGTTCCCTACCAGCACTTTCAAAGACTCCCCTTG
AAATTATTTTTCATCGAGACTCTGAATTTCTTTTTTCCCGGCAAGCGCAAGGGGTTGTGA
>orf00174 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
TTGGCAACGACCCCTCGTGTGTGGCGTTTGGCCGACTACGAGCAGACCCAGATCATCAGC
TGGAGCTGCAACTCCATCAGGCTGACGATGAAGGTCCATAGCTCGTAG
>orf00175 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGGAGTTCGGTGCGGCGTTCCCAGCGGACGGCGAGGCGTTTGAACTGGTGGAACAGGGC
GATGGTCTACTCAACGACGTAAGCGGAGTTTGCCCAGGCCCTTGA
>orf00178 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGTCACTCCTCAACGCCGTCGTCGCCGACCCCCGCGCACGCGGGGATCTTCCGGAGTTG
GCGTTCTGGTCTGCGGACCGGAGGGGGCCGGCCCCGCGTCCGCGGGGATCCTCCGCGGCA
GACCGCCGACGCCGAGGCCGTAGCGCAGTCGGCCCCGCGTCCGCGGGGATCCTCCGCGGT
ACGTCAGGTCGTTGGTCGTCGCGTTCGGGTCGGCCCCGCGCTCGCGGGGATCCTCCGGCC
ACGACCTCGGCGGCGGCCAGGATGAGGACGTCGGCCCCGCGCTCGCGGGGATCCTCCGTT
CACCTGTCCGCTCTTCTGCCCGGCAACCTGGTCGACCCCGCGCTCGCGGGGATCCTCCTT
GCGAGACGCCTCCTGCACGTCCCCGAGCGCCGTCGACCCCGCGCTCGCGGGGATCCTCCG
CGGCTGATGGTGGAGGGCGGTGGGACGATCCAGTCGGCCCCGCGCTCGCGGGGATCCTCC
TCGTCGGCGGGAAGTCGTGAGGACGTGACGGGAGTCGGCCCCGCGCTCGCGGGGATCCTC
CGGCGGCGACGGCGCGCTCCAGGCGCTCTCGCTCGTCGGCCCCGCGCTCGCGGGGATCCT
CCGTCCATCTACGAGGACACCGCCGCGCACGTCCTGTCGGCCCCGCGCCCGCGGGGATCC
TCCCGAGATGAACCGGTCCGCCGCGCCGAGCCCGGCCGTCGGCCCCGCGCTGCGGGGATT
CTCCCTCCATGCCCGGTCAACGCCCGACCCCCGACCGGACTGGCTGGAGCACCGGCGAAG
TCGGTGGCCGAACACCGCGAATCTCCACCTGCTGATCAACAACGAGACCGCCACCAAGAC
CAGCCGAGCCAGTAA
>orf00180 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGACGTCGACCGAAGCAGCAGCAATCGCTCTACAGGACCATGCCGCCCTCTGGAGCATG
GGGGAAATCCGTGCGAGCGATGTCGTCAATGCCGCCTGTGAGGCGCTCGTCGCCGGACTC
GACACCCCCGGCCTTCGAGTCCTCGCCGCCTGCACACGCGCCGAGTCGGACTACGACGTC
CACGAGTTGCTTCCTGAGGCACTCAACGAACTCGGCCTCACCTTTTATCCCATCGCCAGC
GATGCCGGCCAAGAAGCCGCTGCCCGAGCGCTCGCACGCCGCATGCTCGCGGGTGAGCTG
ACACCTCGGGAGTTCACAGTCCGCATTCACCAGCGCTACGGACATGAGCTGCCACTGACT
GAGCGGCTCGCCGAACTCGATGACGAGTACGACGTCCTCGAATACGGCGACGGAACCGTG
GACCACGTTGATGTCGAGGTCACCGCCGAAGCGCGCCGCCTCGCAGCCCACCCCCACGTT
CCAGCCGAATCCACGGACACGCCCAGCTGA
>orf00184 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGCGCGGGGCCGACATCACGGAGGGTGCCCCAGTGCGCGTGGTCGGCCTGACGCTCCGC
GTGCGAGAAATTGAGGGCCTGGCTGGCGAGGGCTTGGCTCCACCACCCGGAGCATCCCCG
CGTGCGCGGGGCCGACGGGACGTAAGGGCTGCTCACGGAGCATCCCCGCGTGCGCGGGGC
CGACGTGCGGGATGTGGATACTCATGCCGCCACCGCCGGAGCATCCCCGGGTGCGCGGGG
CCGACGTATGCGGGAGCTGCGGGCGGACGGATGGCCCAGGAGCATCCCCGCGTGCGCGGG
GCCGACCTCGCTCTCGTCCTCGACGACGGCGGGGAGACCGGAGCATCCCCGCGTGCGCGG
GGCCGACCCCACGCCGGTCGAGAGCGGCGCTCCACCACCCGGAGCATCCCCGCGTGCGCG
GGGCCGACGGGACGTAAGGGCTGCTCACGGAGCATCCCCGCGTGCGCGGGGCCGACGTGC
GGGATGTGGATACTCATGCCGCCACCGCCGGAGCATCCCCGCGTGCGCGGGGCCGACCTC
GCTCTCGTCCTCGACGACGGCGGGGAGACCGGAGCATCCCCGCGTGCGCGGGGCCGACCT
CGGATCAGACTGGTCATCCGCTCCGGCATCAGGAGCATCCCCGCGCTCGCGGGGCCGACC
GCGACGGCTGGGGACCCCTCGATGCCTGGTACGGAGCATCCCCGCGCTCGCGGGGCCGAC
GGCTCTCTCGGGGCCACGGCTCCAGCTCCTCTCGGAGCATCCCCGCGCTCGCGGGGCCGA
CGACCGCCACACCTATGCATCACGACCCGAAGGCGGAGCATCCCCGCGCTCGCGGGGCCG
ACGGCGCCGGGACCTCGCCGAACGACCCGGACGACGGAGCATCCCCGCGCTCGCGGGGCC
GACCTCCTCTCCCTGGCCGAAGTCCTCTTCGCGGTCGGAGCATCCCCGCGCTCGCGGGGC
CGACTGGTCGTTGCGCAGGATGGAGATGACCAGGCGCGGAGCATCCCCGCGCTCGCGGGG
CCGACCGGGAAGGGCCGGAGGGCGCAATCCCCCGGCCCGGAGCATCCCCGCGCTCGCGGG
GCCGACTGCGGACGCCTTGTAGTTGACGTGCGCGACGCCGGAGCATCCCCGCGCTCGCGG
GGCCGACGCGCTTGGGCTCACGAGCAGCTTCGTCGTGGGCGGAGCATCCCCGCGCTCGCG
GGGCCGACACTTGCTGACCTGCAGTCATACCAGCGAGTCTGCCGGTTTTCCTTCAGTTGC
TTTCCGGCCGGTCGCTGA
>orf00186 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGCGCGGGGCCGACCGTGGTCCGGCTGCCCGAGGAGCAGCGCGGGGAGGAGCATCCCCG
CGTGCGCGGGGCCGACGGCCAGAGCAGCGCGTCGACAAGACCCCGCAGCGGAGCATCCCC
GCGTGCGCGGGGCCGACCGTCGGGGCGGGACGATGTGGCCGCAGTCCGGCGGAGCATCCC
CGCGTGCGCGGGGCCGACTGCGAGAGGCGGCTGGTGATGCGCTGGCCGAGCGGAGCATCC
CCGCGTGCGCGGGGCCGACGGCCCATCGCGGGCCAACCCCAGTGGAACGGCCGGAGCATC
CCCGCGTGCGCGGGGCCGACCTGCAGCGTCCGGTCATCGTGCGCGTAG
>orf00190 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGACGACCAGCGCCCTCGTGCCGGTCGGAGGATCCCCGCGCATGCGGGGACGACCCGGG
GTGAGGGTGTCCGTCATGACGTGCTCTCGGAGGATCCCCGCGCATGCGGGGACGACGTCG
CGCGGGCGCGCAGCCATTCCAGCGCCCGCGGAGGATCCCCGCGCATGCGGGGACGACGGC
CAGCTGCGAGGCGCAGCTTCGCGCGCACAGGGAGGATCCCCGCGCATGCGGGGACGACAG
CTCGACACGGGCGGTGATGGCGTTGACCAGCGGAGGATCCCCGCGCATGCGGGGACGACG
TTCGTGCACGCCGAAGGCCCCGTACGCAGAACGGAGGATCCCCGCGCATGCGGGGACGAC
CGGATCAGGTTGACGTTCTTGATGCCGTTGGCCGGAGGATCCCCGCGCATGCGGGGACGA
CGTGACCTCCTCCAGGGCGGCCCGGGTCACGGCCGGAGGATCCCCGCGCATGCGGGGACG
ACCCACTCCGGCTCGCGCGGGTACCACCCCTCCTCGGAGGATCCCCGCGCATGCGGGGAC
GACCGCGTGTTGGTGCTCGCCTGCCGCATGTGCTCCGGAGGATCCCCGCGCATGCGGGGA
CGACCCGGACGTCGACAGCCCGTTGGCCGTCAGCGCCGGAGGATCCCCGCGCATGCGGGG
ACGACCACGCGTCCAGATACCGCTGGTACAACCGGTGCGGAGGATCCCCGCGCATGCGGG
GACGACCCACGGCCCGGCTTCCACCCCGCACAAGACCGCGGAGGATCCCCGCGCATGCGG
GGACGACCCCACCGTCCCGAGCGGCGGCAGGCTCATGGGCGGAGGATCCCCGCGCATGCG
GGGACGACACTTTCTGACCTGCGGTCATACCGGCTGGTCCGCCAGTTTTCCTTCGGTCGC
TTTTCAAACGGCCGCGGAGCCCAGGATAGAAACGACCGCCCGACCCCAGCCCCAGTAGCT
CTCACCACCGCTCATACGAACACCGTAGCCCCGCCCAGCCACCCCCGTAACGCCACCGAT
CCCGGGAGCGCGGGGTCGTCCCTCCTCCCCGTCGCCCGCACCCCTCAGGAGATCCCCACA
CCCGTAGGGCCGACCCGAGGTCGTCGTCGTGGTCGCCGAGGACGACCGGAGGGTCCCCGC
GCCCCCAGGGCCAACGCCAGGAACATCTCACGAGCCTGA
>orf00193 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGACCGCCCCACACGAGCACTACCAGCCCACCGACGACGCCCCGCCCATGCGGACCTTC
GCCGACCTCCGCGCCGCACTACGCCGGCACGGCTACCCCAGCGACCTCGACCAGTTCGAC
AGGGAACTCGCTGCCACCGACCTCGACGACCTCACTCACGTCCGCGAGATCACCCAGGCA
TACCGGCACCGTGTCCTCCTCCACCGCGACGCGGACGCGGCCACCGCCATCTCCCGCTCC
AGCCAGGACATCGAGGCGGAACTGCGGCGCAAGATGAGCGAGGCCGACCGGTGA
>orf00195 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGGTACGCCGCCGTCTCGAGGAGCAGCCCGACCAGCCCAGCGCCCGTCCGCTGCCCGAT
CGAGGAACGCGCAGCGCGACCTACGCCTACGAGCTCCTCCCCGAGCAGACCGGCGGCCGC
GGTATCAGCGTCGTCTACCGCTACGCCGAGAACCTCGACGCGGTCTTAATCCTGTGGCTC
ATCGCCGGGCCCTGA
>orf00200 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
TTGGCCCCGCGCCTGCGGGGATCCTCCGAAAATCACCGCGCACTCCGCGCGGGCAGGCGC
GTTGGCCCCGCGCCTGCGGGGATCCTCCGTGGAGCGGCTGTTGCGCGAGCGCGCCCTGCG
CGTTGGCCCCGCGCCTGCGGGGATCCTCCGACCGGCCGGGGCTCACGGCAGCAGGTCACG
CAGTTGGCCCCGCGCCTGCGGGGATCCTCCCCAGCCCAGCATCGAGGACGCGTTGCCCTG
CGGGTTGGCCCCGCGCCTGCGGGGATCCTCCGAGGATCGGCACGACGCCGTGAGCGCCGG
CCACGTTGGCCCCGCGCCTGCGGGGATCCTCCTCCCTCGCCGGTGATGGGGTTAGGCACG
GGCGGGTTGGCCCCGCGCCTGCGGGGATACTCCGCCAGTGAGCACTGGCGCCTCGCGCGA
GCTGGCGTTGGCCCCGCGCCTGCGGGGATCCTCCGTTTCGTACGGCGGGGTCCAGGCCGG
TCAGGCGGTTGGCCCCGCGCCTGCGGGGATCCTCCGGTCTCGCCGGTCAGGGTGACGCGG
GCGACCCAGTTGGCCCCGCGCCTGCGGGGATCCTCCGGAGCACCAGGCGGACGGCGTCCG
CACCGAGTGGTTGGCCCCGCGCCTGCGGGGATCCTCCTCGCGGGCTCCCCTCTCGGTCAG
GGCTCTTGGGGTTGGCCCCGCGCCCGCGGGGATCCTCCGTGGGCCCGCTCGAGCGCGGGG
AACCTTTGCAAGTCGGCCCCGCGAGCGCAGGGATCCTCCAGATCGCGGCCCTCTTCGTCG
GTGGGGTCATGCGTCGGCCCTGCGGGCGCGGGGATCCTCCGGTCACCAGCTCGACCACCA
CGGCGGTCAACTTGTTGGCCCTGCGGGCGCGGGGATCTTCCGCACGGTCAGCGGAGCTAC
TGGCGGACCAACAGGTCGACCACGCGCACGCGGGGATCTTCCGACGATCAGGCCGACGAT
CACGTTTCGTACCCCGTCGACCCCGCGCGCGCGGGGATCCTCCGGCTGCTGCAGGCGAAC
TGGCGGGCGCCGGGTTGCCCTCGCGCTGGCGGGGATCTTCCGACCGCTCGGGGCGGCGCG
CGCTGGCTGAGCCTGTCGGCACCGCGCTCGTGGGGATCAGTCGCGCCGCCGAGCGGATTA
CGGGAGTTACGGTGTTGA
>orf00201 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGAGAGCTGCTGGGGTCGGGCGGTCATTTCTGTCCTGGGCTCAGCGACCGGCCGGAAAG
CAACTGAAGGAAAACTGGCAGACCAGCCGGTATGACCGCAGGTCGGCAAGCGTCGTCCCC
GCGGGCGCGGGGATCCTTCTCTGA
>orf00203 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
TTGGACGCCAGCACCGAAGGATCCCCGCGCCCGCGGGGACGACGATCCCTCCACCTCGGC
GGCCAGACCGTAGCCCGAAGGATCCCCGCGCCCGCGGGGACGACGGGCGGTCAGCGTCTC
GTACCCCCGCCCGGCCAGAAGGATCCCCGCGCCCGCGGGGACGACGACGTCCAGATCATC
ACGTTCAAGCGCATCTCCGAAGGATCCCCGCGCCCGCGGGGACGACTCGTCGCAGAAGCG
GATGAGGAAGTCGAGGACCGAAGGATCCCCGCGCCCGCGGGGACGACCGCGCACGTGCCA
GCGTCCCCGGCCGCGCAGGAGGAAGGATCCCCGCGCCCGCGGGGACGACCACCGTTCGGC
GGAACGGCGAGGCGAGCGTGTCGAAGGATCCCCGCGCCCGCGGGGACGACTTCTGGGCGT
CAGATGCCGAGGTCGAGGCCGAGGAAGGATCCCCGCGCCCGCGGGGACGACGACCCCGGA
CTGCCAGAACACGACGCCCCTCCCGAAGGATCCCCGCGCCCGCGGGGACGACCCGGGCGA
GACGAGGGCTTCACCTTGATCAAGGTGAAGGATCCCCGCGCCCGCGGGGACGACTCGCGG
GACTCGGCGGCATGA
>orf00207 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGAGGGCGACCCCGGGAGGCCGGTCGGCCCCGCGAGCGCGGGGATCCTCCGCGGTCCTG
TCCGCGCGGTGGTCCTGGCCAGAGGTGTCGGCCCCGCAGGCGCGGGGATCCTCCGACGGA
GAACTGGGTGGTCGAGGCGATCCAGGCGTCGGCCCCGCGCTCGCGGGGGTCCTCCGGTGT
GCGGCGCACTTCGGGAATCCGCTTCGCCCCGTCGGCCCCGCGTGCGCGGGGATCCTCCGC
TGGAGAGCGGCAGCACGCGCATCCTGGCGAGGTCGACTCGCGCTCGCGGGGGATCCTCCG
GCCCCGTGTGCTCCGCCCTCGGCCCGCTGGGTCCCGGCCCCGCGCTCGCAGGGGCCCTCC
TCCCTCGGCTGCCTCGCCGACGTGTTCAGGGCCATCGGCCCAGCGCTTGCGGGATCCTCC
GGGACTCTTGCGCGAGGCCGCAGGCACACCGAGCGTCGACCCCGCGCTCGCAGGGATCGT
CCGCGCTCTCGGTGTGGCTGGCCGGCGATACGGTGTACGTGTGGGGGTGAGAGCTGGTGG
GTTCGGGCGGTTGTTTCTGTTCTGGGCTCAGCGGCCGGACCGGAAAGCCACCGAAGGGAT
ACTGGCAGACCCGCTGGTATGACTGCAGGTCAGCAAGTGTTGGCCCCGCGCCTGCGGGGA
TCCTCCGGCCGGGGGGCTGCTCGCGTGGTCGGTGGAGCAGTTGGCCCCGCGCCTGCGGGG
ATCCTCCGGCCGGGGGGCTGCTCGCGTGGTCGGTGGAGCAGTTGGCCCCGCGCCTGCGGG
GATCCTCCGGGGCAGCGCCTGAACTCGTCCAGCTTCGTGGAGTTGGCCCCGCGCCTGCGG
GGATCCTCCGGTCCTCGGCAGCGGCTGGCGGGCAGAGGCTGA
>orf00209 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
TTGGCCCCGCGCCTGCGGGGATCCTCCGCTTTCGTGGACGCGTCCGAGATCGACCCGATC
GTTGGCCCCGCGCCTGCGGGGATCCTCCCTCCTCATGGTCCGCACGGGGCGCCGTCAGGT
GGTTGGCCCCGCGCCTGCGGGGATCCTCCGTCCACCCCCACCCCCGAGCGCGAGCCCGCG
TTGTTGGCCCCGCGCCTGCGGGGATCCTCCGGTATTGATCGGCACACCGAAACCTGA
>orf00210 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGCTGGCCCCGCGCCTGCGGGGATCCTCCCAGACGGCACATCACCGCAAATCTCTACGA
ACGGTTGGCCCCGCGCCCGCGGGGATCCTCCGACGAGAGCGGCGCCGCCGGGCCGGGTGA
>orf00211 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGCGCGGGGATCCTCCGCGGCTCGCCGACCAGATCCTCAAGACCCCCGAATCGGCCCCG
CGCTCGCGGGGATCCTCCGAGGCCCGTGTCCGCCGCGCGCCCCGCCTCCGCGTCGGCCCC
GCGCGCGGGGATCTTTAG
>orf00216 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGCTCCAGACCGGCCTGCACGCCCGTCGGAAGATCCCCGCGCACGCGGGGCAACGGGCC
GCGCGAGGCCAGCGGGAAGTTAATCCGCGGAAAATCCCCGCAGGCGCGGGGGCAACGACC
CGCTCCTGGTCCGCGTCGGCCTCTGGGCAGGAAGATCCCCGCACACGCGGGGACGAGGTG
CTTTTCATGACGGATGCTGAGGCCAGGGAAGGAAGATACCCGCACACGCGGGGACGACAC
GCCGCGAGCTCGAAGAGCCTCAAGTTCGGCTGGAAGATCCCCGCGCATGCGGGGACGACC
ATCACGCACAGTCGGTCAGCTCCTAGTGCTGGGGAGGATCCCCGCGCATGCGGGGACGAC
GGCACGGGACTCCCGGCCCGCTCCCTGAAACCGGGAGGATCCCCGCGCATGCGGGGACGA
CGCCGTAGATCAGCCCGTCGGACTGGTCGGGCTCGGAGGATCCCCGCGCATGCGGGGACG
ACTTCCTCAGCGCATCCATGCGGTAGAAGTCGTACGGAGGATCCCCGCGCATGCGGGGAC
GACCTCAGGCTCGGGCGCGAGGGCCAGGGTCTCCCCGGAGGATCCCCGCGCATGCGGGGA
CGACACTTTCTGACCTGTGGTCATACCGGCTGGTCTGCCAGTTTTCCTTCGGTCGCTTTT
CAAACGGCCGCGGAGCCCAGGACAGAAACGACCGCCCAACACCAGCCCCAGTAG
>orf00219 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
TTGTCGAACATCGAGCCGTACGGGCTCGTCTGTCGTCCCCGCGTGCGCGGGGATCCTCCG
GGCTACGCGCTCCTCTTCGACCAGGACTTGGGGTCGGCCTCGCGTGCGCGGGGATCCTCT
GCTGCTGGTGGGTGA
>orf00220 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGCGCGGGGCCGACCTCGTTCGTCACGCCCGGCCCGTCGCCCCGGAGGGAGCATCCCCG
CGCTCGCGGGGCCGACCCGTCGAACTCGCGGTCGGCGTAGCAGGTTCCCGGAGGATCCCC
GCGCTCGCGGGGCCGACATCCGGTCTACGGGCCGGAAGTACCAGCCCGCCGGAGGATCCC
CGCGCTCGCGGGGCCGACAAGGCCGATCGCACGCTGCATCCAGCGCACATCGGAGGATCC
CCGCGCTCGCGGGGCCGACCGAGGCCGCGCACGCGAAGCTCGCCGACGAGCTGGAGGATC
CCCGCGCTCGCGGGGCCGACACTTGCTGACCTGCAGTCATACCAGCGGGTCTGCCAGTTT
TCCAGCAGTTGCTTTCCGGCCGGTCGCTAA
>orf00221 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
TTGCGAAAGGCCCAGATCATTGAGGCCGCAAACACGGCGGCGGGGCGCACCGTGGTCCGG
GCCGTACGGGTCCTCGCCCCCAGCACCGGCCCCGCGCCCACCCCGGCCCCGGCCACTGCC
GACGGCGAAGGCACCGCCGCACCCACGCCCGTACGGACCCGGGAGAACGCCTCGCCCGGA
TACCGCCCTGCGCTCCGCGCCCACCAGCAGGCAGCCCCCGCCCAGCGCGTCGACCACGAC
GTCCTCAAGGCCGACCGCCGCGCCGGCGAGCGCCAGGCGGCCGCGATGCGCGCCCTGTCC
CACCACGCCTTCCCCGACGAAGTGCCCCGTCTCTCGGCGCGCGAGGACGTCGACGCGGAG
CGGCGCACCGGTGCCGAGATCGAGGCGGCCGCACGTCGCCGGGCCCGCGCGGACCGGGCC
CCGCGTCGTGCGATCCCGTAA
>orf00223 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGGGCAACCCGCTCCAGCTGACCGCGACGATGCGTACCCGGCTGCTCGCCGCGGTGCGC
GCTCTGGTGTCCGATCCCGCCCTGGACGGGGCGGGCGACCCCGCGCGCCTGGCGGCGGTA
GTGCTGATGGCGAAGGCCACGGTGGCAACCGACTACAGCACGCGGATCACCGCGACGGAG
CTGGGTCGGTGGATCGGGCTGAAGAAGTCCCGGGTCGCGCACCACGTAGTACCGGAGCTG
CGCGAGCGTGGCGTGCTGGGCTCGAACGGGACGACGAACGCTGCCGGGTGGATGACGGGC
CTGGAGTGCTGGGTGATCCCGATGTACCGGGCGCAGCACGGCGGGGACCGTAGGCACGTC
CTGGCGCTGTCGCGGGTGGAGCTGGTCGTGCTCCTAGCGCTGATCGAGGTGCTGTTCGCG
CCGGGCTGGGAACACCGGGACGGCCGGGTAACCCCGGCCGGGATGCTCGCGGGGCGTACG
GGGCGCGGGGCGGCGACGGACCGGCTCGGGCTGCTGCTGATGGTGCTGTCGTCGAACTCC
AGAGGGTGGCTGCAGCTGTGCTCGGGCAGCGTGGACACCGGGCGGGGCCGTCCGGCGGCG
ACGGTGGCGCGGCTGATGGGCTGCACGGCGGCGGCCGGGGCGAAGAGCCTCAAGCGGCTC
CAGGAGCAGGGCGTGCTGTCGGTGGACCGGCGGGAGACGGCGTCGGGTCTGCATGCGCGC
AGTCGGGTCCGGCTGCTGCCGGTGGCCAGGGCGCACGGGATCGCTGTCCGGGAGGCCCGC
GGGGCCGCCGGCGCGGTGTTTTCAGACCTCGCCGTTACTGCATCCGGCGATCTTGAGACG
ACGGTTGAGACTGTGTCCCCTGTGGTTACTGGGGTTCAGGGTACCGGGATGGGCCAGGAG
CCTGATTCGGCAGACCGCGCCGATGCTGCACACCTTCACGCCTCTCACGCTTCTGGGGCT
ACTCCTGCTGATCAAGTTGAGGACTCCTCGGGTTTTTCCGGCGAAGGCCGTGGGGGGACC
CCGCCGTCGCCGGACCGCGCGAGCGCGCGTGAGGAGGGCCCGCTGCGCGGGGAAAAGCGT
GAGGAGTCCCCCTCGTCGAGCAGCAGTGAAAAGCGCGGGCCGGGCCCGGCGGTGACCCTG
GTGCCGGAGCCTCAGGGCTGCGCTCAAGGCCGTCAGCAACCGAAGCAGGCTCCAGCGCCG
CTGCCGCCGGAGGATCTGCGGGCGGTCCTGGAGCCGGTGGACTGGATGTGGGCGCAGCTG
CCCAGGCCGGGGCTGCGCCGCGTCGTCGAGGCGGCCGCGCACGCCGAGCTCGCCGTCCTG
CAGGGCCTCGTGGGCCGTACGGATGCGCCGCAGGTCCTCGGTGCCCGGCTGTTCCGGCGC
CTGGGGGAGCAGATCCGTACGGGCGGCGTGATCCGGGATCCGGCGGGCTGGCTGCTCGCG
CGGGGGTTGCCGCAGCGCCAGCAGTGCGGGGACGTGCGCTGCGACGACCGCATCCTGCTC
GACTCCGGGCAGGCGTGCCCGCGGTGCGAGGACCGGCAGGTCGATCGCCGTGCGCAGCGT
CGCCGGATCGCCGCCGAGGTCGAGGAGCGGCTCCCGTACGCGGGGGAGGAGGAGCGGCGC
GCGGCGACTGTGCGGCAGCTGCACGAGGACGTAAGGGCCGCCGGGTGGGCGCGCGAGTGG
GAGTGGGAGCGGGTCCGGGCGCGGCAGGCCGCGGCCCGCGCACGCGCCGATGCCGCCCGC
CAGGACCAGCCGGAGCCCACCGCTCCCGCCCTGGGCGCGCTCCCGGCGCCGCGGGCTCGG
GTGCTGGCGTCCCGTACGGCCGCCCCCGCTGTGGCGCCTGCCGGGCGACAGGTCCGCGAG
GTCGTCGACGAGCTCGTGCTGGAGGAGCTGACTCGCGAGCAGATCCTCGACTGGCGCGCC
CGCGCCACCTACGACCACCAGGTCGTTCTCGACCACATCGCCCGCTACGGCGAGCACTCC
GCGCAGCGGCTGTTCACCCGCGCGCTCGTCGCCACCGTCCACCGCGTGACCGGCCGCGAC
CACCTCACCCTCACCACGAGCCCCTGGGGGATCGCATGA
>orf00226 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGCAACTACCCCTCGGGCTGGCCGCAACCTCCAAAGCCAGGACGCGACATGAAGCAGAG
TACCCGGAGTTCACCCCGGTCAGACAGGTGGAGCCACGGTTCCGGCGTGAGGATCACACC
GCCGACGGACGTTACCCCTGTCCCTCCTACCGCCGCACACGCGTGACCGCCCGGAGCGGG
GCTGCCCCCGCTCTCGCCGTCATGCCCACACGCCTCATCCCCGAGCGCCGCGTTGTCGGC
GTCTCGGGGCAGACCCCACCCGCTGCGGGGGGTCGGATGACGTAG
>orf00228 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGACGCAACAGGAGCTGGCAGCCCGGTTGAATGGACGGTCCGCTGGCTGGATGAGCCAG
GTAGAACGCGGAATCCAGCCGGTACGTCGCGTCGATGTTCTCCAGGAGATTGCTGACGCG
CTGGGTGTCTCCATCCAGATGCTCGACCCCAGCTCCCCGATTTTCACCCCTTCGGTTCCA
CCTGTCACCGAGGCCACCAACGACCTCGACGGTGCTCGAACCGTCATCTCAGGGCACCCC
GCGATCGGCCTCATCACCGGGGTCGAGGAATCGGGAGCCATTGACCTTGGTGCGCTCGAA
GAGTCCGTCGAGCAGATTTGGGAGTACACCCACCGCAATGCGTATCCGGAGATCAGCGAG
ACAATCGCCGCGCTGCTCCCTCAGCTGGAACGTGCCGTACGCACCGTCCCCGCCCCGGAC
CGGCCTGTCGCCTACCGGAACCTGGCGCGGGCGTACCAAGCACTCGCCGCCGCCTTCGCT
CGGCAGGGCGATTCTCGCTCATCATGGGTGTCCGCTGACCGGGCAGTAGCCGCCGGCGAG
AGATCCGGTGACATTTTCCTCGTGCACGCGGGGATCTTCCGCATGGTGCACGCCTTCGTC
CGCCTGGGGCACAACCAGGAAGCCGAACACGCGGTCACCGAAGCGGTCGCAGCTCTCCAA
CGGCGCGCGGACCTCCCCCCGGAGGGCCTGTCCGTGCTCGGCTCGCTCCACCTCGCAAAA
GCGCTGGTTCACGCCAGGTCTGGGCAACGCTCGGAGGCCCGCGCGGAACTGGAGAGCGCG
AGACGGGTAGCGGAGCAGATCGGCGAGGACCGCAATGACTACAACCTCGAATTCGGCCCG
ACCAATGTCATGATCCAGACAGTCTCAACCGCCCTGGATCTCGGTGATGCCGGGGAGGCT
CTCGACATAGGGCAATCCATCGATGCCGCCTCGTTGTCGCCCGAGCGCCAAGCTAGGTTG
TTGATGGACTTGGGGCGAGCCCACGCGCAGCGGCGACACACGCCCGACGCAGTCGAATGC
CTGCTGCGCGCGGAGGAAATGTCACCGGACCTAGTACGTCAGCACAGCGCGGCCCGGGCC
GCGATCAGAGAGCTGTTGCTCGTGAGCGGGCCGAAGGCGTCCGCCGATCTGGTGGCTCTG
GCCGCGCGGGCGTCCGCGGCGGAATGA
>orf00229 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGACCATCCCAGGAGGAGAAGTGAGCGGATACGCACTCGTCGTGCGGTTCACCACCCGT
GACGCCGACTCAGCCAAGAAGTTCGACGCCCTCGTGAGTCGCACTTTGGAGGGCATCCGC
TACGAACCCGGCACTCTCGCCTACGTCGTCCATGTCCCGGAGGGCGAACCACTGGTCCGC
GTGTTCTATGAGCTCTACGCGAGCTACGACGCGTTTCAGATCCACGAGGCGCAGCCCCAT
ACGCAGCGGATGCTCAGCGAGCGAGAGCAGTACCTCGACGGCAGCGAGGTCACGTTTCTC
AACGAGCTGATGGGCAAGCGCCCGACGGAGACGACATGA
>orf00230 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGGTCACGGGTGGAAACACCAACGACTGCACCCGGTTCCCCGCCGTGATGGAAGCGATC
CGCGTGCCCCGGATCGGACCCGGCCGTCCCCGGGTCCGGCCCGATCACGTCCTAGGCGAC
AAGGGCTACAGCTCGAAGGCGATCCGCGCCTGGCTCCGTCGCAAGGGCATCGCCCACACG
ATTCCCGAGCGGGCCGACCAGGCCCGCAACCGGGCCCGGCGGGGCAGCCGCGGAGGCCGC
CCGCCGGCCTTCGACCGCGAGGTCTACAAGCACCGCAACGTCGTGGAGCGGTGCTTCAAC
CGTCTGAAGCAGTGGCGCGGGATCGCCACCCGGTACGACAAGACTGCCGAGTCCTACGAA
GCAGCTGTCACGCTCGCGTCACTCCTGATGTGGGCGTGA
>orf00231 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGGATCATGGTGTCGTGATACGTCGCCATGAACTGTCGGATGCCGAGTGGGAGTTCGTC
CGGCCGCTGCTGCCCGAGTCGTTGCGGGGACGCAAGCGGTTGGACGATCGCAGGGTCCTG
AACGGGATCGTGTGGAAGTTCCGGACCGGGACGGCCTGGCGGGACGTGCCCGAGCGCTAT
GGCCCGTGGGCCACGCTGCATACGCGTTTCCGCAGGTGGGCGGCGGACGGGACGTTCGAC
CGGATGCTCCGCGCCGCCCAGGCGAAAGCGGATGCGGCGGGCGACGTCGACTGGCTGGTG
TCCGTCGACTCGACGATCGTCCGCGCTCACCAGCACGCGGCCGGGGCCCGAAAAGGGGGC
TCCGCGACCCGGCCCTCGGCCGGTCAAGAGGCGGTCTGA
>orf00232 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGGAGGCCACGCAGGCCCGCCGTATCTCGCTGGTGTGCCCGGACTGCCGCACCTGGGTG
GCCGTGACCCCGCACCGGGGTACCTACCTCCTCAAGCTCGTCCCGCACCACACCGGTCGT
GCTGGCGTCGACGCCGCGATCCGCTGCCGCTCCAGCAACCGCCTCGTCGACGTGGACCTC
ACCGACTCCATGTGGCGCCGCCAGTACGACGAGTGGGCGCGCGAGGAGCGTCTCGCCGTC
GACCTCACCCGCCACCGCCGAGCCACCGTCCAGACCCTCAAAGTCGCCCGGCCCCAGCAG
CGGCCTGCCGACCGGCGCGCGCAGTGGGAGCGCGCGGTGCCCGCCGCCCGCCAGGCCGAC
GCCGCCCGCGCGGTCCCCGCCGACGCGCTCCCCACCACTCGCGGCCGGGCCGTCGACGGC
CCCGCCGGCGCCCCGCCGGCCCTGCGCCGCCAGAGTGCCGGGGACCGCCGTTCCGTCCGC
GCCCTGGCCACCGGCACCCTGCGCGCTCTGGCCGACGCCCGCCAGGACCGGCTCGCGGGC
GACGGGCTCGCCGAGCACCTCACCCGCGCCGCGTACCTGCACCTGGCCACCCTCTGGCGC
CGCCCCCTGACCCCGGCCGACCAGCCCGCACACACCGCGCTCATCGCTGCGGTCAGGGCC
GCGCTGCCCGCGCCAGTCCCGGGCGAGACCGTCGCCGCGTACATCACCCGCTGCCGCAGG
TCCCCGCTCGCCGCCGCATGA
>orf00233 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGTCCGCTACCGACCCGCTGACTGAGTTCGACACGGAGACGCTCGCGCTCCTGGAGGCG
GTCGAGGTGCCGCTCCCCGCGTTCGGCGACCTGGACCTGGACGTCGCCTTCGGCACGCCG
CTGGAGATGTACGACCTGGTGACCGCAGACGAGCTGGCCCGATGGGACGCCGTCTCCGTG
GTGAAGAAAGGCCGGGCCCGGGCGCGCGAGGAGGTTGTTGCGGCCTCCGGGGCGCGGCGG
GATGCGGCGCGGGACATCCTCGCCGCCGATCCGACCGTCACCGAGCGGGTCCGCGAGCGC
CTCGTCGACATCCTCATCCCCGCCGCGCGGCAGCTGCGGATCGACCGCACCGTCGTCGTG
TCGTTCGCGGAGTCCGAGGTGCTGGCGGCCTGA
>orf00234 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGACCGGGCGACAGGGTCGAGACGACGATCGCGTCCAGGGGGCTGACGCGGGAGGTACG
GGTGCGGCCCCGGCGCGTACGGGCCGTGGGCATGGCGAGCTCGGGCATGGCGACTCCTCG
GCAGGAGAAGGGAGGGGGATTCGCGGGGCGGGTGCTCTCTCCGCCCACCAGGTCCACGAG
CCAGCGGCCCACGTCCTGGCGGACAGACAGCGCATCAGCGCTGAGGTCATACAGCAGTCC
TGCCAGCCAGGGGGTTTGGTGGTGCTACCGCCTCCGGCCACCTGCCCGACTCCGAAGAGA
CGAGCCGCAGAAACTGCGGTGGCGACACGACCGACGCTACGCACACTTTTCGTGCTAGTC
AATACTTCAGTGCTAGGCAGTGTCTTCAAATGA
>orf00236 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGGGTGGTCGAGGTACGGCCGCCGTGGCCGTCGCAGTCCGAGCAGGCGATGCCCGCGGC
GTGGTTCAGGCGGGCGCGCTGCTCGGCGGCGGTACGCGGCGCGCGACGACCGGCGGGGAT
ACGGGTGTCGGCCTGGCGGGCCTCGGCGAGCATCCGGTCCTCGAACGTCGCGGCGGTGCG
CTGAGGGTGGGGGCGGGCGGGCTCGGTCGGCGGCTGCGGCTGACGGCCCCCGGTCTCGTG
CGGCTGCGGGCGGGTCGGGAGCGGGTCGCGCTGGACGCGCGGCGAGCGGGGCAGGGTAGC
GTTCGGCATGCGAACTCCATCTCGTGA
>orf00238 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGCCGACCACCTCCCCCACCTCCCAGCCGATCCCCGCGCCCGCGCCGACGCTGTGCCGC
TACCGGCGCGAGCACGGCGACCCGACGACCTGGACCACCTCGGAGATTGAGGGCTGGCTG
CACCGCCAGGACGCCGCCCACGCCGACCTCACGACGCACGCGAAGGGAACCCGATGA
>orf00239 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGAACGTCCGTGACGTGGTGGCCCGCGTTGAAAGCGCGCGCCGCCGTCCGCCCGGCGAG
GGCGAGCAAACGGCGCGCGCGGGGATGCGCGGGTCCGTGGGAGAGCGCCCGCGCCGCGAG
GAGTTGCGCGGCGCGGGCGCGTCTTATGTGGGGCACGCCCACCGCTACTTCGCGGGAGCG
GGCGGCGGCGGGGGCGGGGTCTGCCCGCACTCGCAGGGCGACATGGCGACGCTCTGGAAC
GGTTTGCCGTCCGCGCCGGTGTGGTTGTAG
>orf00240 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGGGCGAGACCGGCCCGGGGGCCGTGCAGCTCGAGGAGGCCAAGAAGATCTGCACGGGC
TGCCCCGTCCGCGCCCTGTGCCTGGAGTTCGCGCTCGACTCCCGCCAGCAGGACGGCGTG
TGGGGCGGCATCTCCGCCGAGGAACGCCGCCGCATGCGCCGGCGCCGCGCATGGCCCGCG
ACCACGGACACCCCCGCCGCGTGA
>orf00242 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGCCCGATCAGCCGCAGCCCACCACCGAGCAGGTTGCCCAGGCCATCGTCGACGCCGCC
ACCAGCGGGGACCAGGCGTTCACCGAGACGGTCGCCAACTCCTACACGACCGAGCAGCTC
GAAGCGGCCCAGGCCTACCTCACGCAGGGACGCTGA
>orf00244 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGAGGGGAGTCGGACAGCCCGAACCACGACCACTCAGTAAGGGAGTTAATCCCATGGCC
TTTCTCCAGCGCCTCGTCAGCCCGCTGCGCCGCATAAACGCCGACCCCGACAAGCTCGTG
GAAGAGGCGTGGACGCACATCGCGGAGGCGGAGCGGAACCACGGCCTGTGGCCCGCGATG
AGCGCCCTCACCGACCTCGCCACAGCCAAGGTCCAGGTCGCCCAGTACCTCAAGGAGCAC
CGCGACACGTGA
>orf00246 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGACCGCCGTCGATATCCGCAAGCCCGAAACGGTCCGCCCGGACGACGACGACCAGCAC
TCCTGGCCCGTCCCGGCCCCGGCCGACCACACCGATCACGACCAGGAGCAGCCCGGCTCC
CAGCAGCACGACCAGGACGACCGGGACGACGACCCGCGCACCATGCGGCTGCTCGCCGTC
GTCGCTGGCGTCGGCGGCCTGGTCCTCGCCGGGATCGGTTTCACCGGCTCCTACAACACG
CTGCGCCACCTCGCGGAGAGCAAGGGCTTCGGGACTTTCTCCTACGCCTTCCCCGTCGGT
ATCGACGCCGGCATCCTCGTGCTGCTCGCGCTCGATCTGTACATGATGCGCAAGCGGATG
CCGTGGCCGATCCTTCGCTGGACCGCGCACGGCCTGACCGTCGCGACCGTCGCTTTCAAC
GCGGCCGCCGCCGGCCCGGTGACCGAGGACCCGCTCGCTGCGTCCATGCACGGCGTCATC
CCGGTGCTGTTCATCATCGCCGTGGAGGCCGCTCGCCACTACATCGGCCGGATGGCCGAC
CTGCTCGCCGGTGAGACCCCGCTCGGGTCGGTCCCGCTGACCCGCTGGATCCTCGCCCCG
CTGTCCACGCCGCGCCTGGCCCGTCGGATGCGGTTGTACAACCTCCCCTACAAGGAGGTC
GCCGCCCAGCACCAGGCGTTGCGGATCTACCGCGAGGGCCTGCGCCAGAAGTACGAGAAC
CACGAGCAGAGCTGGCGCCGGGCGGCGACGCCGGACGAGCTGCTGCCGTTCAAGCTGGCC
CCGTTCGGGTTCAGCGTGGAGCGCGCTCTCGGGGTCCCGCTGGAGGAAGAGACCAAGCGC
CTCCAGCGGGCGGCGCGGGCCGCTGTTCAGCGTGCTGAGGCTGAGATTCAGCGCGTGCGC
ACCGATGTTCAACTGGGCGAGGCCCGCATTCAGGCGGAGGTCGACAAGATCCGTGGCGAG
GGTCGCCTGAAGATCGCCCGGGCTGAAGCGGAACGCGAGGCTCAGGCGGAGATTCAGGCC
GCCGAGGCCGATGCTCAACTGCGTGAGGCGCAGCGTCAGCACGCGCTCAAGCTCGCGGAG
GACCAGGCTGCGGCCGAAGCGCAGGAGCTCGCCGACGAGACCGAGAAGCGGCGCACGCTC
TCCCGGATCGACCGGGAGAAGGTGCAGGCCAGTTGGGGTCTGGAGCAGAAGCAGATGGCC
ACCGAGGCCACCGAGCGCGAGCGCCGTATCCAGGCCGATGCCGCCGCCCGCGCCCAGCGC
GAGGAGATCACACGGCAGGCCGGCATCGCGGAGCAGGCGGAGCGGCGCGCGCGGGCGCTC
GCCGGGGAGAGGGCGGCCCTGGAAGAGGCCGCTGAACGCGAGAGGAAGGAGGCTGAACAT
CGCGCCGCGACGGTGAACACGATCTTGGAGGCGCAGCGCGGAGCCGAGTCGATCGCCGTG
TCGAAGGCCCGCGAGCAGGCCGCGATCGAGGACGCCGCCGCCCGCAAGGCGCGTGCGGCT
GAACACGAGGCGGCGGCGGTTGAAGCCGCGGCGCGCGCCCGCATGACCCAGGTCGACTGG
GATGTGCAGCGGGTCTCCGCGATGATCCAGGCCCGGGGCGATAGCGCGGTCACCGTCCGC
GTCATCGCTGACGAGCTGGGCATCTCCACCGGCTCCGCGCAGGACCGCAAGACCAAGGCG
CTCGCCCTGCTCAGGGGCGAGTCCACCGGCGATCTCGAGCGGGCTGCGGCCTGA
>orf00247 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGGGCCACAGGCCGTTCACGAAGAGGTCGAACAGGGCGAGGACGGTGGAGATCACCGCG
ATGACCGTGGCCAGCAGAGCGGGCAGCGGGTTGCGCGGGACGAAGACGTCGTCCGTCATC
TTGCTCGGGGTCGGGGTGGCCGTCGTGGTACTCATCGGGCACCCCCACTGGTAG
>orf00249 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGGCAGACACCGCGACCGCGACCCCTGAAACCACCGCCGACACCACCGGCGACGGGGCC
ACGGACACCGCCGAATACACCGTCGTCACCGAGCCCGAGACCACCACCGACACGGCCTCG
GACAAGCCGAAAGCCAACCGGTCGCGGCCGAGGGCGATGCCGCTGCTGATCCACGGCGGC
AACGCAACCGGAATCGCCGCAGGCGTCGCCTACGGACTCGCCGGAGTGCCCGGTCTCATC
GCCGCCGGCGCGGCCGGAGCCGCGGTCGGCGCCGCCGCGCTGGCGGGCCGCAAGAAGCGC
TCGAAGGTCTCCGCCGCCCGCACGAACGCCGCGAGCAACCGCTCCGGCGGCGGGACGCAC
CGCTCCGGAGGTGGCGCGGGCAAGGGCGGCCTGCTCGGACGCGGCGGCGGTCGCGGCCGG
GGCGGCGGCGGTGCTGCTGGTGGCGGCGGCCGCGGGCCCGGGCGCGGTGGCAAGGGCGGC
GGCTGGCTGAACGGCTCCGGGTCAGGGGGCGGTGGGACCGGCACGAAGAACCGGCCCGGC
GGCGGCAAGCACGGCGCCGGTGGCGGCGGGCGCGGCCCGGGAGGAACGGGCGGCGGCAAG
CACGGCCGCGGCGGCGGCCTGGGCGGACTGCTCGGAGGTGGCAGGAACCGGCGCGGTCCC
GGCGGTCCCAACTCGCCCGGCGCGAACACCCCGAAGGGCACCGGGAACGGCAAGAACAAC
GGGGGAGGCAAGAACGGTCCCGGCGGGAAGGCCGGCGCCCACCAGCAGTCTCGCACCGGC
AAGGCCTGGCAGACCCTCAAGGGCTGGGGCAACAAGATGCGCCGCAACAACGGCGGCACC
TCGAGCTCCGGCGGCTCCGGATCCTCCGGTTCGGGCGGCGGCTCCAGCTCGGGCACCTCC
GGCTCCGGCACGAAGACCATCACGCCCGCCAAGACCCGCCTCGGTCGCGCCCTGCAGAAG
ATGCGCGGCCTCGCGAGCAAGCTCCGCCGCTCCAAGAAGAAGAGCGGCTCCACCAGCTCC
GGTGGAAGCGGCCCGACCTCGGGCCGCTTCCACCGGATGCGCCGCCTAGCCGCCCGCAAG
CTCGGGCACTGGCTGCGCTGCGCAGGCGCCGGACTCCTCGCCGGACTCGGAGGGCTGGCA
ACGCTGCCCCTCGGACTCCTGTGGGGACTGGCCCTGCTGCCGTTCAAGCGCCGCGACCCG
CTCCACGGGTTCGCGCTGCCCGTCCGTGTCGCCGGACGGATCTGGCGGTTCTTCTTCCGC
CGCTCCAAGGCCCGCCACGACAAGAGCGCCAAGGCGGACACGCTCAACCTCAAGGTCAAC
AACCCCAGGAAGGACACCGATCCCGTGACCGGACCCTCGCTCGCTGCTGGCACCACGGTG
CTGGACGGCAACAGCTCCAAGTTCGCGATGGCCATGCGCGCCGCGCACGCCTCCTACACC
GGCTACAGCCCGCGCAGCATGATGGAGGTCGCTGCCGAGTACGCCGGCCTGCCCAACGGC
ATCCGCGCCGCGGCCCTGGCGGTCCAGCAGATGGCCGTCAACGCCGACCAGAAGTACCCG
TGCAGCAAGAAGGCGCTCGCCAAGCTGAGCGAGGCCTGCGCCAAGCTGGTCGCCGCCGCC
GCTCGCGCGGACGGCATGGTCGCCTTCTTCCGCATGGTCCACGCCTTCGACATCGAGCGG
ATCGTCGCCCCGAGGACGAACGAGTGGATGTGGAACGTCACCCCGACCGGCTCCGACGCC
GCTGAGGGCGCGATGTTCATGCCCGGCCGCATCGAGTCCGGGTGCGTCCTGATGGCCGTG
CTCTACCGCACCTTCGAGCCGGTCCACATGATGCAGGTCGGCTCCGAGTTCCAGGGCATC
GCCTACGGGCTCACCGCCCTGGCCGACTGCGTCCAGGCCCTCTACGAGCGCACCATTGCC
CTCTACCCGGTCGACGACCGCGTCACCGACGAGATCGGCAAGCTCGTCTCGATGATCCGG
GCCGCGTCCGACGACGCGGACATGGCCGCGAAGCTGTTCGTGGAGGACCACAGCCGCGAG
ATCAGCCACAACACCAGCCCCCGCAAGGGCCCGGCTGCCGAGTCCATGTGGAACACCCCC
CGCTGA
>orf00253 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGCGTCACTGGGACTGGTCGCTGCCCAGCGGCCACACCACCTTCCTCGGATACGCCACC
GAGACCGCCATGACCACCGTCGCGCTCGCCCCGCTCACCGGCCTGCCCTGGCAGGCTGCC
GCCCTCACCCTGGGCAGCGCGGCCGCCGCCGGCACCGTCCACGACCTGCGCGTGAGCACC
ACCCTGGGCACGCTCACCACCCGTGCCGTCTCCTGGCTGACCGCGTCCGCATGGGCGTCC
TGGGCGCTGGCGACCGCGCCGCTGACCACCACCGGCTGGGCGAGCGGCCTGGGCCTGGCC
ACCGTCGGCCTCGCCGCCAACGCCTCCGCCAACCGCACCGAGAACACCCGCTCCGAGCGC
AAGAAGCTCCTCAAGCTCCGCCGCAAGTCGGTCGGCATCCTCCTGGACTGGGAAGACCGC
ATGAAGCGCGTCGCCCGCATCGAGGACTGCCACGGCAAGGACGTGCAGCACTGGCCCGGC
GAAGTCGGCTACACCGTGGAGATGGACCTGCCCGCCGGCGGCACCAACGTCGACGACCTC
AACGGCTACGGCCCGAAGTTCGCCAGCGACCTGCGCCTGCCCGACGGCTGCGGAGTCGAG
CTGTTCCCCGGTGCCAACCGCGGCACCATCCTGATCGAGGTCACCCTCAAGGACGTCATC
ACCGCCGACATCCCTTACCCCGAGGACTACTCCGAGATCAGCCTCACCGAGCGGTTCCCG
TTCGGCGTGTACCGCAACGGCGAGCCCGCGCTCGGCAGCCTCTGCAACGACTGCGGGATC
CTCGTGGGCGAGACCGACGCGGGCAAGACCAACACCCTGCGCGTCGTCACCGCCCAGCTC
GCCCGCATGCCCGACGCGCTGATCTGGGCGATCGACACCACCGGCGGCGGCGTCGCCCTC
CCCTGGATCACTCCGTGGGCCACCGAGGGCATCGCGTCCGCGCCGATCGTCGACTGGATC
GCGCACACCGAGGACGAAGCCCGCCTCATGCTCAAGATGGCCGCCGAGATCATCGCCGCG
CGCAAGGCCGGCTACCAGCAGCTGATGCGCGAGAGGAAGACCGACAACAAGCTGCCGATC
AGCGCGGAGATCCCCGGCATCGTCATCATCACCGACGAGACCGCCTCCCTGCCGTACGAC
ATCAAGGAGATGATCGACAAGGTCGAGCAGGAGGGCCGCGCGATGCGCGTGCGCGCACTC
GTGGCCGCCCTGCGCGCCACGCAGGACGCCATCACCGCGATGATGAAGCTGATGTCGAAG
TGGCGGGTCGGCATGACCGTCTCCGACGCCGAAGAGCTCGCCTACCTCTTCCCCGGCTAC
ATCAAGATCGACCCGAAGGACGCGCCCGTCGCAGGGTCCGGGTGGAACATGCACACCCGC
CTCGGACCGAAGAAGCCGACCGCGATGAAGGTATGGCGCCTGGTCGACGAGCTGATGGAC
ACCATCTGCCAGGCCACGGCCGGGCGACGGCCCAAGCTCGATGAGCTGTCTGCCGCGGTG
GACAGCGGCGAGCACTACCCGCAGCGGTGGGCGCGCACCCTGCCCGACCTGTACAAGGGG
CAGAAGCTCACCGAGTCCGCGCAGTACGCCGTCGACAACGCCGGTGAGATCATCGCCGCC
GCGACGCTGCTCGCCTCCGACCCGGTGCCGCAGGGCAGCAGCATGGCGTCGCCCGCTCCG
GTGGTGCCGGCCGGGTTCGAGGGGTTCGGCGGTGCAGAGGAGCTGTTCGCAGCCGTCACC
GCACAGCTGGACCCGAACGCCGCGCACCTCGCCGTCCCCACGGCTCCGGCCCCCACGCCG
GCCGCCGCGCCGACGGCACCGGCCCCGCTCCCCCGCCCTGCCCGCCCGGTCGATCCGCGC
GAGCTGGGCTGGGAGCTCCTGGCCGCCGCCGGGGCGACCGGCTACACGCCCAAGCTCCTG
CACGAAGCCCTCGCGGCGGAGATGGACCGGCGGAAGGTGGGCGACGCCCCGGCACAGCGC
ACGGTCGGCGGCTGGCTCCAGGCGTGGGCGAAGGACGGCAAGGCCATCAAGGACGACTCC
GGGCAGTACACCCGCTACGTCGCCCGCGAAGCCGCGGTCGGCCCGGCCGTCTCCGGCCCG
GCCACCCCGGCCGGGTCGGAGACGGCACCCCTGCCCGAGGGTCTGGACGCGGCCCTGGTC
CTCCAGGCCGTGGACTTGGTCGTCTCCACGCAGTTCGGGTCGGCGTCGATGCTCCAACGC
AAGCTGCGCATCGGCTTCGCCCCCGTCCAGAACCTGATGGACTTCCTCCACCAGCTGGGC
ATCGTCGGCCCGTCCGACGGCTCAAAGGCACGCGAAATCCTGGTCTCGACGGCAGACTTG
GACGCGACCATGATGAGGATCGCCGACGAACTCGGCTACACCACGCGCGACTTGGGCGCG
ATGGGCCTCGCGGCGGCTGCCGCTTCGCATGCCAAGGAGTGA
>orf00254 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGGCTGAGACCGCAGACGAGGAGATCGAGCGCCTGGAGGCCGAACGGCACTCCTACAGC
GAGACCTTCAAGAACACGTCCGACACGGACGCGGTCACGCGCGCGCACCTCCAGTCCGAG
ATGGACCGGCGCACCGACCGGATCCAGGAACTCCAGCAGCACCAGCCGCTCGGGTTCCTC
GCCCGCTGGGGGCTGCGCGCCGCCTCCCTCGCCCTGCTCTGGGGCGCCTGGGAGGTCGGC
CCCTGGTGGGCCAAGACCGGCTGCGTCCTGCTCGCTGCCTTCCTCGCCTTCTACAGCCTC
GGCTGA
>orf00255 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGGAACCCCGCGACCTCACCCTCACCGACCAGACCCCCGCCCCGCCCGCCGTCGCACTC
CCCTACGAGGGCCTGGAAAAGATCTGGGAGCTGTTCCCCGACGCCCGACCCGGCGCCGGC
GGCCTGCCCGCCCCCACCCCGCACACCGCCGTCGGCCTGCCCACCGACGAGGCGTACATG
GCCCGGGTCTACGACCTGGTCCGCCGGGAAGAGGCACTGAACCACATCCGCGCGCAGTAC
CAGCAGGCCGCCGCGCACGTCGCCCTCGCCCCGGCCCCGGTCTACCCCCAGATCGTCGCC
CAGACCCCGGCTCCCGCCCTGCCGCCCGCCCCGGCCCCCGAGCCCCAGCGCGCGGTGCCG
GCGTACGTGTGGAAGTACAGCGCGCTCACCCTGTCCACCGGCGGCTGCATCGCGCTCACC
GGCGTCGGCATCGGAGCCGCCGCCCCGACCCTCGCCCAGATCCCCGCCATCCTCACCGCG
ACCGGCCAGGTCCTGATGAGCGGGACCGTCCTGGTCGTCGTCGTCCTCCTGCTGCTCGCC
CTGCGCGGCACCGGGGGCGGCGGCGGGCGCGGCGGCAACACCTTCAACATCCGCAAAGCG
GTCTTCCGGCGCAACACCTTCCGGGGATGA
>orf00257 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
TTGGCTACCAACGACCCCAACACGCGCGCCGAGAACGACCTCACCACGAAGGTCGCGACG
ACCAAGACGCCCCCGCGCCTCAAGACCGCCCGCGCCTGGTGGACCCAGGCGTGGAACGAA
GGCGGCATCCTGTACTCGCTGTGGGACGACGTCCGCCAGGCACCCGACGCCGGATGGCAC
GGCATGGCCAACTGGATCAAGACCGCCCTCGGCATGATCGCGTTCTCGTTCGTCGTGTTC
CTCTTCACCGGCGCCGTCGACGTCCTGATGGACGCCGTGGACCACCTCCTGACCGCCGTG
CCCACGGTCCAGATCAGCGACAACACCTCCAGCGGCGTGTGGGCCACGATCGACAACCCG
ATCCGCTCCTACATCGCCGCCCACAGCGCGGACCTGCCGATCAGCGGGGCCACCGTCTAC
ACCCTGTGGCGGTTCACCGGCCTGTTCTGCCTGGTCGCCGGGTTCTTCACCCGCAACAAC
GGCGTCCGTCTGACCTGGACGGCCTGGGGCGCGGCAGGCATCGCGATGGTGTGGACGACC
ACCCCGGACACCAGCCGCACCGTCGCCACCGCCGTCGCCCTGCTGGCCTGGACGCTCGCC
TCCGCCTTCGCACTGCGCGGCCTCAACCTGCGCCCCCGCGTGCTCACCAACATCGGCGCA
CCGCAGATCACCGTCCAGCCCGAGATCCACGTCCCCGTCCAGCCCGGCCCCGCTGACAAC
GACAACATCCGCCACCTGCGCTGA
>orf00258 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGGCCCTCACCCTCTTCACCCGCCGCCCCGAGCCCGCCCCCACCGAGGAGGTCCTCCAC
CCCGCGCGCTGCCCCGAGACCGGTGAGTCCTGGACGCCCGAAGGCGTCACCGTCGCCGAG
CGCTACTACAACCTCGCGGGCGCGGTTGTCCTCGTCTACACCGCCGACACCTCGACGAGC
CCCGGCACCTACTACGCGGTCGCCTGCCTCGGCTGCCACTACGCCACCCGCCAGGACTCC
ACGTACGCGCGCTACACCCTGACCGCCGCCGCGAAGGTCGCCAACACGCACGCGAGCAGC
TGCCGGGCACTGCCCCGCACCATCCCCGCCCGCCCCGACGACGACACCGTCCGCGAACGC
CTGCACTCCTGGGTGCGCCGCGCCCGCCGCCAGGACGAGGGCGTCCAGATTTGGATCCGT
GACCTGGACCTGATGCGCCTCACCCTCCAGCGCACCACCAAGTGGATCGAGGCCGTGCTT
CATCAGCTGGCCGAGGACCAGCCGGACGTCCTCTGGATCGCGCACAGCCAGTACAGCGAC
GCCGTCGCCTACTCCGCCCGCCAGCTCCCGGAGGCCTGA
>orf00262 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGCTTCGCGCGGATCACGTGCTCCGGCACGCGGCGCTCGCGGGCCGCGTTGCGGGCGAG
GCATTCCTCGAGCGGGGTGTCGAAGAGCACGGCGTGCACCAGACGCCCGTGGTGGCGGGC
ACGCTGCACGAGGAACGTGCGCGCGGTAGGGGCGGTGTTCGTGCTGTCGGCGACGGTGGT
CAGCCCGCGTTCCAGGCGCGCGTCGAGGACGATCTCCTGCATCGCGACGACCTGCGCGTT
GGCGCTCTGGTCGCCCTCGTCGCCGGTGAGCAGGCCGCGGTAGGTGTCGAGGCAGATCCT
GGAGGCCTGCGGGAAATGGGCCGCGGCAGTCGATTTGCCTGCGGCGGGCGCCCCGACGAA
GACGATGAGGCTGCCGGGCGGGAAGCCCGCGAGCAGGCCCGCGCGGACCTTCGATGCCTC
GCGTGTGGCGCGCTCCTCGTCCTTGCGGGCGAACTCCTCGTCGATCCAGCCCTGTACGGG
AAGGCCGAGGCCTTCGGCGGCCGCGTACGGGTCGGTCATCTCCGGCCACTCGCCCTCCTC
TTCCAGGGCGGCGGCGAGGGCTGTGGCGCCGTCCGGGTCGGTCTGGGCCAGGGCGGCGAG
GGTGCGGTGCAGGTTCCACGCGGCAGCGCTCCCGGAGGCGTACGCCCACATCGTCTGCGG
GTCGGGGGCGGCCGGGATGCGCATGGACAGGCGGATGTGCGCGTGGAGCGCGAACTCGTG
CAGCGCGCGGACGTGATCGGTGGGCAGCTGTGTGTCGGACACGTTTTCTCCTCGCGTGAG
GCGGCTGAGGGACCACCGCACTGCCCCGGCCCTGGAGGAGGGCCGAGGCAACACGGAGGC
CCCTCAGCTGTGCGGGCCGGGAAGGTCGGCGGCGGCGTGCTGGACACGCGGCGGCGTGGG
GGTGGGGTCGGTGGTGCCGTGGGCGACGGCTGCGAGGGTCCGGCTGAGCCGGTGTCCCTG
CGCGACGGCGGCCTCCATGAGCTCGGTGAGGCGCGGGTCCAGGTTGTGGTGGCGGGCGCC
GACGAGAACGCCTTCGAGGCGGGCGAGGTCGAGGAGGAGTCGGTCTCGGACGTCGAGGAC
GGAGGGCTGGAGGGACAGCGCGGTCGGGTGCTTCGCGATGGCGAGCGCCGCGTGGTCGGC
GAATTGTGCGTTCGCGGTCTCGGTCTGTTCGGCGAGCGCGCTGTCGATCGCGCGGGTGGT
GGTGTGGGCGCGGTGCCGGCCGAACCGGGCGGCGAGCGTGTCGAGGCGATGACGAGTGAG
GGGCATGAGGGCTCCGGTGTTCGGGGCGGGGTGGGGCTCCGGGACGGCCGGGCGCTGGGC
CTGCGGCCGTCCCGCACCGGTCAGCGGCCCGCGCGGCGGCGGGCGTCGGCGAGGATGCTC
TGCGCGTCGGGGTGGGCTTTGACGGCGTTGGACAGCGCGTCCCACCACCGGCGGGCGTAG
>orf00263 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGAGCGGCACCCCGAACGCCAGGACCGGGCAGGGCTGGGACCGGGCGGACTTCCGGTGC
GGGCGGTGCGGCGCCCGCCGCACCGCGACCACGGAACCCGAGTACACCGCCGTTGTCGCG
GCTCACCAGCACGCGCACGCGCTGTGGGACCGGCTCACCCCCGCCGAGCGGCTCGCGCTC
ACCGAGGCCACCCGACTCGTCCTCGGCGATCTGCGCCTGAGCGCCGAGTGGCTCCACGTC
GTCACCCTGCACGCCGAGCAGACCGCAAGGAAGGACCCGACCTTCTGA
>orf00265 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGAACGCCCTCGACCGCCTGATCACAGTGCTGCGCGAGCGCAGCACTGTCACGGACACC
AACCCGCCACGCGGCTGGGTCGTCCTCCTCGCGCCCGACGGGAGCCACCTCGCCTACCTG
CCCCTGGCCGCCCCCGACATCCTCCAGCTCGCCGAGGACTGCGGCCTCGACACCACCGGG
GAGAGCGCGGACGCCGACCTGCTCTGGGACGCCCTCGACGACGCCGCCCCGCCCACCCTC
CTCACCGGGGACTGGACAGCGCTGCTCCGCGTCCACGACGGCACCAGCACAGTCGACGAG
ATCCGCCTGACCGACACCGAGCTCACCGACCTCGCCACCCTCCTCGACGACAGCGCGCGC
CGCCGCGCTGAGCGCGAGCAGCTGCACGCCGATCATCCCGAGCTCGTCGCCGAGGTCACC
GCGATCGCGGCCTGGCCCGAGGACGAACTCTCCGCCGACATCACTGCGATCGCCGCCTGG
CCGGAAGACGAGCTCGCCGCTGAAATCGAGGATCTCGCCCCGCGCAGTCAGAGCGACATC
TGCGTGCTCTACGCCGAAGTCCTCGCCCACGGCCGCCGAGTGGCTGCGACCCGCGCCCTC
GACGACTGGTTCGGCGCGGTCACCGACCCCAGCGACGAAGACCCCCGATAA
>orf00267 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGCGCGTACACATCACCTCCTTCGGGCACCTCCACGGCCCCCGCCCCCAGGACGCGGAC
ATCACCCTGGACCTGCGCCCGTTCCGCGACCCACACTTCGACCCGGCCCTGCGCGAACTG
ACCGCCCGCGACCGACGCGTCATCAAGACGGTCCTCACGACCCCCGGAATCCGCGAGCTG
ATCGCGGCGACCGTGGCGCAGGCCCGCGCCTATGCCGCCGCGCCCGCCGCCCGCGAGCGG
ACCCTGCACATCGCGGTCGGCTGCTCGGGGGGCCGACACCGCGCCGGTGTCACCGCCCAC
GTCCTCGGCCGACGCCTGCGCCGCCGCGGCCACACCGTCACCGTCGTCGACCGCGACTTA
CACCGCCCCGTCGTCGACCGCCCCGCCCCACGGTGA
>orf00270 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGGAGCAGGTGATGCCCCGGGCCCGCCGGAAGCGCCGTCGCGAGGCCCGCCGCGTCCCG
CGCAGCGACGCGCACCTGCCCGAGTACGACCGCGGGGACTGCCCCGAGGGCCTCCTCACC
CGACGGCAGTTACGCGACCTGGGACTGAGCCCCGGCGGACACGGCCCGGTCGCGGTGCTG
CGCTGCAAAGGCTGCGCCTACCGGCCCGACCAGGCGTGCAACCACCCCACCCGGGCCTGG
CTCTACAGCGTGGCGCTCGCCCGACCGAAGCGCACGCCGACGCTCGCCCAGGAATGGGCC
CTGGACAGAGCGATGGCCGCGAGGTCCACGTGCCCGGAATGCAAGCGCCGGTACTACTTC
AGGTAG
>orf00272 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGCTGAAGTATGCGCTCAGACCCAAGGCCCGTAGGTCAGCCGCCGTAGAGGCCCCACTC
GTCGAGGCCCCCGTAGATGTGCGCTTCGAGGCATTGCGGGGCGTCAAGGCCCACGGCCTC
ACCCCGGTACACGGCGATGAGGGAGTCCTTGCCCCGCCACCACGAGTCGGTCACACCCTG
TACTTCGGGTACCGGCTCGAATGCGCCGAGATCCAGTGCGTCGACGGCCTTGCGCTTGAC
CCTCGTGACGGTCGTGGCCCAGCGGCGGGCATGAGCGGCGAGCGCCAGGGATTCCACCCA
TCCGTCAGTGTTGGCATGCAGGGGCGTCCACTGGTAGGCGTCGATGCCGAACGCACCGTC
GGGGCCGATCGCGAAGCTGTAGGCCATGGAAACCCGGCAGCCCCCTGCCGGGAACGACCA
GCCTTCTGCGGGCATCTCCTCGGGGCAGTCGGCATCCAGGATGCGCGGACCGCCCTCGTA
GAACGGGGCCGGCGGCAAGGCGAGGCCGCCCCAGCGGTCCTGGAAGGCAGCAGCCCGCTC
GATCTCCGCAGCGGGGACCCCGTACTCGATCCACGCGTCGCGGTGTCGCCGGATGTCCGG
CCGGCGAACACGTATGCCCTCCGTCTCGACAAACCGCTGGGCCCTACGGCTCAGGCCGGC
AGGCGCGACCGGGACGGACGATACGGGCTGGTCAGCCATTACCGCTGCTCGCCGTCACCG
GCGTGGAGCACGGCCGACGCAATCTCCCGCACGCGCTCCGGGCTGATCCCTGTGCGCTGC
TCGACGGCGAGGGGGTGGTCGGTGGGCTCCAGCTCGACGAAGGGGCGCTCACCGACCGGA
CGGGTATGGACGCGCGTCTTCAGGTTGAGCGTCGTCGCCGGGTATACCGGAAGATCGGTG
GTGAGCCAGCCGAAGTACGGCTTCTCAGCCTCGCGGCCGGGCCTGTCCCACAGATCCGAG
GCTTGGGAGAAGCTCTCTCGGCTGAGCGAGACCCAGACGCCCCAGGAGAACACCTCGGCA
CTGCCGATGACCGGTATCTCGATCAGGCCCTTCACGAAGTAG
>orf00274 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGACCGGCCGCACCCGCACCCGCCTGAACCGGGTGCGCGCCTCCGTCGGCATCGCCCAG
CTCGCCCTCCAGCAGATCGAGGACGACATGAGCGCCGACGACGTCGACGGCCAGGAGCTC
GCCGCGATCCTGCGCGAGCTCCAGGAGGACGCCGACGTCCCCTGCGGCCTCTTCCCCGCC
CTCGCGCAGCTGGTCACCGCCGCCGCACGCCGGGCGGAGCAGATCGAGCCCGACCGCGAC
GGCGACGCCTCCTGCCCCCTGCACGAGGCCGCCGCCCTGCTCACCGACAACGCCGGGCCC
CGCCTGAACTGGGCGGCCCGCTCCCTCGACCCGCAAGGAGATCTCGCATGA
>orf00275 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGGTGGCCTTGGTGGTGGCGACCACGGCCGCGACCAGCACGGCGGTTCGGGCGCGGATG
GTCAGGGCCGGGCGAAGGGGTGGACGAGCCACGGTGATTCTCCTTGATCAGGCGGCCAGC
CGGTGGATGACCGGGGCCGTGGGGACGAAGTAG
>orf00277 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGCCCGAGCACAGCCTCGTGGTCCTCATCGGTGCGTCCGGCGCCGGGAAGTCGACGCTC
GCGCGCACCTGGCCCGCCTCGCAGGTCCTGTCCCTGGACGCACTGCGGGAGGCCGTGGCC
GACGACGCGGGCGACCAGGACGCGACCGGCGACGCCGTCGCCGCCCTGCACCTGCTCCTG
GAGGCGAGGATGCGCCGCCGGTTGTTCACGGTCGTCGACGCCACCAACGTCACGGCCGCC
GCCAGGAAGCCGCTCATCGCCGCCGCCAAGCGCCACGACATGCTCCCGATCGCGGTCGTG
TTCACCACGCCCGGCAGCATCTGCATCGAGCGGCAGGGCCCGCGGCCGGCCAACCGCACG
GTGCCGGAAGAGGTGGTTGCCCAGCAGCACGACGACATGTTCGCCTCCCGCCGCACCCTG
CGGGCCGAGGGCTTCCCCGAGATCGTCTACTCCGACAGCATCTGCCGACTCGCGCCGTAC
CTGGAGCGCCTGAGCGAGAGGCGGCAGGCCGACCTCGGGCTGGACGGTGGCGCCGGCCTC
GGTGACCTGAACCTCGTGGCCCGGGTGTTCGGCGAGAACATCCTGCCGCTGTGGCAGTGG
AAGCCCGGCTCGAACATCGCCGGCGGCGACCGCGTCGCGGAGATCCGCCTCGGTCAGCAG
TACCTCACCCTCGCCCTGCGCACCGACGTCGACGGCGAGGGCGACGTCGGGTTCGACGTG
ATGGTGCCGTGCCCGCACGACGACGAATGCACCGGCCACGCCTGGGTGCCCGCCTACAGC
GTCACCTGCCTGTTCCGCGCGCTCAACGGCGACCTGGACGACGACGAGGACATCGTCTGC
ACCGTCCACGGCCCGAACACCGACGAGGACCAGGAGGACGATCCCGAGGGCCGCGCCGAC
CTAGAAGAGCAGTTCGCGACTGCGGTCCGCGAGTGA
>orf00279 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGGCCCGCAAGCCCATCACCTGGTACATCGCCACCCCCACCGACGGCACCATCGAGATG
TCCCGCGAGGCCGGAACCCCGGTGGACCTTTCCGTCAACGTCGGCAAGGCCATCGACCAC
CCCAACCCCTGCCGCAACAAGTGGTACGACGAGAGCGGCTTCTCCTACTTCCGCATGGTC
AAGCGCGTCGGCGAGGCGCTGGAGGACACCGGTATCTGGCCCATCACCTGGCCCGTCCGG
TTGTGGATCGTGGAGCCGCTCGGGGAGACCGGCAACTGGAGCCAGCGCCACTACCCCTAC
CGGCTGCTCTCCCACCGGATCCGCGTCCTCGAGGAGACCGACGCCCACCGCGCGCTCGGA
CCCGCCGGCCTCGACGTCCTGAACGTCGTCCAGCAGGAGATCCCCGAGCGGGCCGCACGC
TGGGCCGCGGACTGGGACGCCGACCCCGAGGGCATGCGCGTCCGGACGTGGAACTGGGAG
CAGTGCGGCGGTCCCACCTGCGGCAGCGGCCGATGGGCGGACGAACTCGCCATGGCGGTC
TCGCACAACCGCCGCGAGTCGGGCGCCCAGACCTGGATCGAGCACCTAGCGCGCAACGCC
GTCGACCAGGCCCTCGCCGACACCGACGCCAGCATGACGGCCCGCTGCTACGCCTACGGC
CGCGCCACCGGCCACGCGGTAGCCGCCCAGCACCAGAGCCGCTTCGAGCCGTACGTCCTG
GACGCGCTGCGCGGCGTCGGCCTCGACTCCCCTGCCCCGGCCGTGGCCGCCTGA
>orf00280 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGGACTCCGTCCTGCACACCACGGGCCGCTTTGGCCCACGCACCCTCCTGATCACCGCC
GCTGCCGTCCCGCTGACCGGCTGGGCCGTCCACGCGACCGTGCTGCTCAAGCAGATCGCT
GCCAAGGAGAAGGACCCGCTGACCGGGCTGCTGCGCCGCGACACCTACACCGCCCGCGCC
CGCCGGATCCTCGCCCGGCACGGTGACAACACGACCGTGGTCATGGTCGACGCCGACCAC
TTCAAGCAGATCAACGACCGCGACGGCCACGAGGCGGGGGACGCGGTCCTCGCCGCGCTC
GGGCAGCGGCTCACGGCCTGGGCCGGTCCGCGCGCGGTGTGCGGGCGCCTGGGCGGCGAC
GAGTTCGCCGTCGCCCTCCCCCTGCCCGCCGAGCACCGCGCCGAGCGCCTGGAGCAGCTC
GTGCGGGCACTGCACGCGCCGGTCCGCCTCGACGACGGGCGCCTCATCCAGGTCGCGGTC
TCCGTTGGCGCCGCCACCACCGACACCCTCCACACCCGCGACCTCGCCGCGCTCCAGCGC
GCCTCGGACGCGGCCCTCTACGACGGCAAGCACACCGGCCGCGCCGTCCTCGCGACCACC
GCGCACACCCGCGTCCCCTCCATCAACGGGCGCAGGATGGGCCGTCCCGGCACCAGCGTG
TGGGGGCAGGCCGCATGA
>orf00283 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGGTGGCGCGGATGGTTCCTCATCCACGCCGGCCGCGGCACCGACCACCAGGCGCTCAC
CGACCCCCGCGTCACCTGCACCTTCCCCCGACAGCCGCTGGAGTTCGGCGCCGTCCTGGC
CGTCGCGCGCCTGACCGACTGCCACCAGGACGAGCCCGGCCGCGCCTGTTCGGCGTGGGC
CGACCCGGAGGCGTGGCACCTCACCCTCACCGACGTCACCCCGCTCCTGGAGCCGATCCC
CGCGCTCGGCCGCCTCGGCCTGTGGCGCCCCAGCTGCGAGCTCACCGCCCACGCCCTCGC
CCAACTCCCCCACCTGAAGCCGTGACGCGCGCGAACCGGCCGAAACAGCTGTGGGAGCCG
GGTCTCATCCCGGCTCCCGGCGCCCTCCTGGACTGGCGCGACGCCCGCCACCACGACGCC
CGCAACGCCTACCCCTGCACGCTGTGCGGCCACCCCACCCACCTGCGCTCCCACACCGGC
GAACCCGCCCATAAAACGTGCGCCGAAACGTGGATCGCCACCCACTACCCCGAGGCCCGC
CGCACCGCGCGCTTCGCCTCCGACCCGGCCCCCGCGCGCCGCTCCGATGCCGCCGACGAC
CACGCCTGA
>orf00285 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGCCCGTGAACCACACCCCGCGCGCCGACTCCGACCGCGCCCTCGCCTACCCCGAACCC
CCCGCCACCTCCACCTGGCACCACACCACCACGCCCCGCCCGCGCACCCGCAAGCTCACC
CCCGAGCAGCAGCGCCACAACCGCGAACGCCTCCAGCACGAGCTCAGCGCGAAGTGA
>orf00286 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGTACGCCGACCTGAACCCCGCCCAGACCGCCGAAGCCCTCGAACTCACCCCACCCAGC
CCCGACACCGAAGCAGCCGCCGCCCGCACCGTCGCCCGCCACGCCCACGGCAAGGAGGAC
CTCGTCCTCCTCCTCGACGCCCTCGGCCTCCCCCACAACGACGACACCCTCACCGCGCTG
TTCCCCCTCCTCACGGAAACCGGAGCCACCCTTCCCATGACCGCCAAGAACCCCGCCACC
GTCCTCGCCCCCGCAGTCGATATCGCGGCCTTCGACGCCGCTCCCGCTCCCGCTCCCGCT
GGCCGGAGCGTGTCTGCGTTCGAGGCCATGGCCCTCTCGATGCACACCAACGGCGACAGC
ATCCAGGGGATCTGCGCGGCCACCGGCCTGAGCGAGACCGAACTCAGCGACCTCCTCGCC
GCCCCGGCCACCGGTACCCCGGACGTCGCGCTCGCCGTCACCCCCGAGATCCAGGAACTG
CTCGACTGGGCGGCCGCGCACCCGGCCGCCTCGGTCCGCAGCCGCGCCGCCCGCATCACC
GCCGACCTGGCCGAGCTGTCCGAGCGCCGCGACAGCGAGGCCGCGCAGCGCGAGGCCGAA
GCGAAGGTCGCCAGGGCCAAGGCCGAACTGGAGAAGGCGCAGGAGGAGCTGCGCACCGTC
AAGGCCGGCACCCGCACCACCACGGCGGCCGCCGTGGCCGCCCCGATTCGCGCGGCCCTC
GGCAGCGGCCGTACCCGGGAGGAGCTCGCCGCCGTACGGGCGTGGGCGCGCGAGAACGGC
CATCAGGTCGCCGACACCGGGATCGTGCCCAAGCGGGTCCTTCAGGCGTACGACACCGCG
CACCGGGCGCCGGTCCGGAAGGCCGGCTGA
>orf00287 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGACCGACGACGCGATAGCCCTGGACGAGGAGACCGTGCCCGGCGACCTGCACGGATCG
ACGGCGCGGTTCCGCCTCACCGTCTCCCCCACGGACGAGCGCACGGACGAGATGATCCTT
CCCTGCAGCGTCACCGACCCGGCGCTCGCGCACACCGTCATCCACGACCTGGTCCCCGGC
GACAAGCTCCGCGTCACCGGCCACCTCCGGCTGCCCCGCACGCCGGACGAGCCGATGCGG
CTGGACGTCACCGAGCTCGCCGTGCTGGAGACCGCGCCGGAACTGTCCGACCCGGCCGCC
GTCACCACAGCCGTCCTCGAGCGGCACGGGCCGTACGTCTGCTGGTTCGACGCCGAGAAC
TCCGGTGAGATCCCGGTGTGGACCGAGGCCGGGGTCTGGGTCGGGCACGCCGGTGACCCG
GACGCTCTGGGCGAGCTGATCGAAGCCTTCGAGCAGCGCCAGGCCGCCAGCGGCGAGCAA
TAG
>orf00288 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGCCCATCCGTCCCGAGAACCTGCACCGCTACCCGCGCAACTGGCCCCAGATCAGTGCG
CGCATCCGCTTCGAGCGGGCGGGCGGCCGCTGCGAGTGCGAAGGCCAGTGCGGCCTGACG
CACCCGGGCGGCCGCTGCCCCGCCGTCCACGCGGAGACCCACCCCACTACCGGGTCCGTT
GTCTGCCTCACCACCGCCCACCTCAACCACACACCCGAAGACGTGCGGGACGAAAACCTC
CTCGCCGCCTGCCAGCTCTGCCACCTGCGCATCGACCACGGCCACCACCAGGTCACCCGC
GCACGCACCCTCGACGCCCGTACGGCGGCCACCGGACAGCTCGGCATCCTCGACAACGCC
GACCTGGTCCGAACCGAACCACCCACCCCGCCGCCCCGGCCGCCCGCACCCCGCACAACA
CCCGCCGACCGCCAGCAACTCACCCTCACCGACCAGGAGGCCCCCTGA
>orf00290 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGCCCAAGCAGCCCCAACCCCCGCGCACCGTCCTGGAGCGCTTCCCCGCCGGAGGCCCC
CGCGGCTCCTGGCCCGCCGAAGCGTTCGCCGCCGCCCAGCGCGCTCAAGGTGCGCGGGTG
CAGGTCGTCATGGACCTGCACACCGACCAGTTCCTCGTGGTCACCGACACCACTACCCAC
TGA
>orf00292 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGACCGAGACCGAGACCACCCGCTACACCGCCGACGTGGTCGCCCTGACTCCCGACGGC
AACGTCCTGCTGATCGAGCGCGACTGGCCGCCCTTCGAGGGCGCCTGGGCGCTGCCGGGT
GGCCACCAGGATGAGGGGGAGACCAGCCGCATGGCGGCTGCTTGGGAACTCCTGGAGGAG
ACCGGGGTCCGCGTCGACCCCGACCAGCTGCGCACGATCGGCACATGGGACCAGCCCGGC
CGCGACCCGCGCGGCAGGTACAGCACCGACGCCTACCTCGACGTCGTCCCCACCGGCACT
CCGATCACCGCCGGGGACGACACCCGCACCGCCCGCTGGTGGCCTCTGGACGCACTTCTG
GAACGGCTCGCGTTCGACCACGCCGACATCCTCCACGCGGCCACAGCGTCCAGCGCCTGA
>orf00294 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGGTCGTTTTGACGGCGCTCCACACGGGGCAGGAGCGGTGGATGAGTACCGCCCGCCGC
CGCCTGGGCACAGGCCCCCAGCCCGGTGTCCCGTTCTTGCTGGCCAAGAGGGTCGCGTCG
GATGTTGAGCCCCGCATCCCTGCGGAACGGCTCCTCGACGTGCCCGAGGCGGTCCGGGCC
GCCGCCACCCGCGCGGTGGCGGACGGGCGCCGTGTGCTCGGCACGAGACCGGCCCTCCTG
AAAACGTGA
>orf00295 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGACCGACCTGGTCGGCGGGCTGCGGGATCACGGCACGGATGCCTCGCCGCCGGAGATG
CTCACGGATCGCGCGGGATGCATACGCGCGGTCCGCCAAGACGGCGTCCGGCCGGGCAAG
ACCCGGGCCGAGCCGGCCGCACCCGTTGGCAGGCCTCCCGTCACGCTGTAG
>orf00297 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGGTCTTTCGACACCCCGACGGCGACTATGCGATCACCGCAATCTACTCCGTGCCCGAT
GACGCCTGGCATCTGGAACTGGATCTCGTGGCCGGGCAACGGAGTCTCGTGACCGCAACC
ACCCCCGACGAGGATCCGGCACGGGAGCCGACAGTGCGCTTCAACCCGAGCGCAGAACAC
ACCGACGTCCCGTACGAGGTCATGCGCTGGTTCATGCACCAGGTTGATGAAGAGATCCGT
AGCTCCCGTGCCTGGATGCGGCTGAGACCGGAGCTCGTCGAGATCGTCTATCAACTACGT
CAGGAGCACATGGGTGTCATCGACGATGACGCCTTTCCCCAGGTTCTGGCGGACATGCGT
ACCACGGTGCCTGAGGAGGACCTCCCCGCCGTTCTAGAGGCCGCCTTCGGGCGGAACCCT
GACGGCACCACCAAGACCACCCGCAAACGCCCCAGCCTGTAG
>orf00299 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGCCCTCCCCCACCGAGCTGCCCCCTCACCGGATCAGCCTGAACCCGGACAACCCGCGC
TCCTCCCTCGGCGACCTCACCGACCTCGCCGGAAGCCTCAAGGACCACGGGCAGAAGCAG
GCCATCACGGTCATGAACCGCGACGCATACATCGCCGCGAACCCCGCCGCCGAGGAGAAA
CTCGAACCCGACACGGCATACGTCGTCGTCGACGGCTCCAGCCGTCTCGCAGCAGCCCGC
GAAGCCGGCCTCACCACCGTGAAGGTCATGGTCGACGACGGCCAGGGCGGCACCAGCGAA
GAGATCCTCGAATCCGCCCTCGTCGCCAACATCCACCGCCGCGAACTCTCCGAACTGGAC
GAAGCCCGCGCCCTGCAACGACTCCTCGCCCTCCACGGCTCACAACGTGCCCTCGCCGCA
CGCCTGCACCGCTCCCAGCCATGGATCTCGACGCGCCTCGCACTCCTCGGACTCTCCGAA
GAGATGCAGAACCTGGTCGGCACCGAGAAGATCGAACACCTCCGAGCCATCGGCAACAAA
CCGGCCGAGGAGCAACCCGCAGCGCTCCAGGCGCTCAAGGACAAGGAATCCACGCAGCGC
ACCGTGCGGAGCCGGAAAGGTGCGGCCACCCAGGCGGCCGACACGGGGGAGCGGGCCGAG
AATGATTACGGCGTAATCGCCTCACCGAACGTGCCCGAGAGCAGAAAACAGCCGGCGCAT
GATTACGCCGTAATCACCTCCGCCCCCGCCTCATCATCCGAACCGCCTGAGTCGTCGCAG
CCGCCGCGCCCTCCACAGCCCGCAACTCCCCGCACAGCGCCAGCAGCTCTCATCCCGGTC
ACAGCGATCCCATGGCGGCACGTCAACGTTGTCCACCGGATCCTGCGGGAGCACATGACG
CCGGAGGACTACAAGGCGCTCCAAGAGCTCATGGCCACATGA
>orf00300 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGGTTAGTAACATCTCACCCATGAGTCAGCCCAGCGACCGCGAAAAGGTCGTCTCCAAA
CTCCCCGCCAGCCTCCGCCAACAACTCAAGATCCGTGCGGCACAACATCGCCTCGACATC
CAGATCGCCGTGGAACAAGCCATCCACGCCTGGACCGCCCTCGCCGCCTCCCCCGCAGCC
GTTGACGTCAGCGGCGCCAGCTCCTTCGCGACCTTCCTCCCCCCGGGCCAGTGGGACACC
TTCAAGAAGGCTGCCGCCGCCCGTGACGTGACTCTTACTCAGGGCCTGGCACAAGCCGTG
CAGCTGTGGCTCGACATGAACCCCTCCCCCGAGGTCATCCGTCCAGAGACAACCCGCCGC
ATCATCGTCTGCAACCAGAAAGGCGGTGTCGGCAAGACCGCCATCACGGCAGGGACAGGA
GAAGCCCTGGCCGAGAACCCTGACACCCTGCGCCCGGTACGAGTCGCCAAGCAGCTCGCC
GCCGCACAACTCGCATCACCGGAAACTGACGGCAGCAGCGACGCGCTCGAGGTAGAAAAC
CTCCCCGGCCTCGGCTTGCGCGTCCTCCTGATCGACTTCGACCCCCAATGCCACCTCACC
CGCCAGCTCGGCGCCGAGCCCCTCCCCCTCGACGGCGACAGCCTCACCAAGCACATGGGC
GGAGAGGCAAAGGGCGAACTCCGCGACCTGATCGTCGCCGTCGACCAGGAACACTTCGGC
GACCGGCTCCACATGCTGCCCGGCTGCAACGACGCCTTCCTCCTCGACGTCAAACTCGCG
TCCGTTCGCGCCAGCGAGAAAGCCCTGGAACGAGCCCTCGCCCCCCTCGAAGGTGATTAC
GACGTAATCATCGTCGACTGCCCACCCAGCCTCGGCCTCTCCATGGACGCCGCGATCTAC
TACGGCCACCGCCGCGACGGCGAAGCCCCCGGACAGTCAGGCACCCTCATCGTCGTCCAG
GCCGAAGACAGCTCCGCCGACGCCTACGACATGCTCACCACCCAGATCGACGACCTCCGC
AGCGACCTCGACGTCGTCATCGATTACCTCGGCATCGTCGTCAACCTCTACGACGCCCGC
CGCGGCTACATCGCCACCAGCTCCCTCCAGGGCTGGGTCGACATAAAGGACCCCCGCGTC
GTCGGCCTCGTCGGCGACCTCAAGGAGCAGAAGGAAGCCGTACGCATGCAACAACCGCTC
CTGTCCTACTCCCCCACCTGCACACAGTCCGTCGCCATGCGCGCCCTCGCCCGGGAGCTC
GCATGA
>orf00302 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGAGCGAGCTGCCGAGCGTGTGGGACCTTCTGGGGCGTCTGGGCCTGGCGGGCGGGGTG
GTGGTGGGGGTGGTCGGCGCCGTCGTCCTGTCGCTCGTGATCGTGCCCGCCGAGGACTTC
AACCGCGGTTTCGAGACGGGCGTGCGGGCAGTGGTGCGGTACCTGTCCGGCCGCGAGCTG
GGCAGCGGGACCGCACCAGGTGACGCGACGTGGTGGCGTCCGGCGACGAACGAGGCCCCG
GCGCCGCCCCCGAGGGCCCGGCCCCTGCGGGCGGCTGCGACGGCGGTGAAGCGGTGCGCG
GTACGCGCGAGGACGTCGGGAGTTCGGTACGGGCGGCGGGTGCGGGGACGGGTGCGCGAG
CGGTTCCCGGACGTGCTGCGGGCGGCGGGGCGCGGGGTGAGGTCGGCGGCGGGAGCGGGC
CGGGCCGCGCGGTCCCTCGCGCAGTGGCCGGCACTCGGACGGGCCGTCGCCCGGACGCTC
GCGCGGAGCGGACCGGCGGCATGGGCCGCAACGGCGGCGGCCGGGGCGGCGTGCGGGCGC
GGGGCGGGCCGGGCCGGGCGGTGGACGGTGCGGGCCGGGCGGGCGGCGTACGCGGCGGCG
GTGCGGTCGGGACGTGCCGCAGGGCGGGTGGTGAGCGGCGCGGCCGTGGGAGTGGTGCGG
GTGCTGCGGGCGTGGGGGCGGTGGCCGTACGCGGCGCGCGCGGCCGTACGGATCGCGCCG
GGGGTGCTGGCGTGGGGGGTGCTCGCGGCGCCGGGGACGACCCGCGCCGTGGTCCTGGTG
CTCCTCGGCGCCGTCGTGCTCGCAGCGCTGAGCGGGCCGTCAGGGGCCCGGTGGTGGTGT
GTGCCCCCGGCACGGGAACGGCGCGCCTAA
>orf00303 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGGACGGCCCGACCGAAGAGACCCTGTGCGTGGACGGCGCGCGGCTGCGGCGCGCGCGC
GAAGCCCGGCACCTGACGCGCCCGCAGCTCGCCTCCCTCCTCGGCGTGGGCCCCGACTGG
GTGAAGAGGGTGGAGACGGGGCAGCGCACCGAGGACAGGCTGCCGACGCTCTACCGCCTG
TGCCGCGTCCTGGGCCTGACCGACGTCGCGGAGCTGACGGGCGGGCAGACGTCCATGCCC
GTGGCGACCGGCGGGCGCCTCGCCCACCCCGGCGTCGAAGAGCTGCGAGCCGCGGTGCAC
GCGCCGCTCTTCGTTCAGGAGGAGCCCGAGGACGTCGGTGTCCTCGCCGGGCGGGTCGCC
CGGACGTGGGCGATCTGGCACGGAGTGCGCGAGCAGCGCACCGCTGTCGCAGCCGTACTT
CCCGATCTCATCCGCACCGGGCACGCCACGATGCGCGCCGCCGAGGGCCCCGAGAAGCGC
CGCGCCGCCGTGGTCCTCTCCGAGGTCTACGCCCTCGCCCAGCAGTACGCCGCGCACATC
GTCGACCCGCCCCTGTACTGGACGTTGGTGGACCGGGCCCGGATGCTCGCCGAGACGGCC
GACGACGTGCTCGCGCTCGCGGGCGCCGCCTGGGTCACCGGCAACGGCTTGCGGGCGGCG
GGGGACACGGAGGGCGCGCGGCGCGTCGCGGCCGACGCCGCCGAGACCCTGGAGCGCAGC
ACCGAAGACGGCTCCGACCGGCTACGGGGGCTGTACGGGAGCCTGTGCCTGCACGTGGCC
CTCAGCGCCGCCCAGGAGCGCCGCGAGGGCGACGCGTGGCACTGGTGGGACAAGGCCGAC
CGCGCCGCTGCCCGCCTCGGCACCGCGTACATGCACCCGTGGACGGCGTTCGGCGAGGGC
AATGTCGCCGTGCACGGGGTGAGCATCGCCGCCGACCTCGGCGCCCACGGCACCGCGCTC
CAGCGCATGACCGAGGTGGACCCGGAGACGATCCCGAGCGTCGAGCGCCGCTCCCGCTTG
TACCTCGACGCCGCGCGCGGCGAGCGCGCGCGGCGCCAGGTCGCCGCCGCCCTGACGTAC
CTGCGTCTCGCGGTGGCGACCTCGCCGGAGGCGGTGCGCTACGTCCCCGCCGGGCGCGCG
CTCGCCGAGGACCTCGCTCGTACCGCCCCCGCGCCCCTACGCCGGGCCGCGCACGAGGTC
GCCTCACTCGTCGGCGTGCCCGTCGAGTAG
>orf00305 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGACGGGCTCTCACGCTGAGAAGGTGCCGAACCTGGAGTACTACACCGATCTCCCGCGC
GCGCTGCGCCGCCCCCGCCTCGACGCCGACGGGGAGCGCTGGCTGCCCGTCGCCGTGACG
AAGGAGTGGCACAAGGAGGGGGAGGTCGTCGTGGTGTTCCTGCGGCCCGCACGCGGGGGA
GGGCGCGAGTGGATCGTGCCCCTCCCCGACCTGGACACCCTGACCCGGGAGGCGACCCCA
TGA
>orf00306 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGGTCACCCTCGGCCGCGCCCCCGCCATCACGGCCCTGCGCCTCGCCGCCGTCCTCACC
CACGCCGCCGCCGTCCTCCCCGACCTGCGCGCCGACCGCGCGGAGCCGGGCGAAGAGGAG
GACGCGGCCGACGCCGTGACCGCGCTGCGTACCGCTCTGGACCGGGTGGGCCTGCGGCTG
CCCTCTCTGGGCGCCGAGCGCCCCGCTGCCATGGGCACCGCCATGGTCGCGCTCGGCGGT
GCCGCCTCCGGCGTCGCGGTGAGCCTCGCGGACGTCCTCACCCGCACCGCCGACGCCGCC
CCGGTCCTGCGCGCCGACGCCGCCGAGCCCCCCGGCGCGGCCCGGGAGTTCTGGCCCCTG
CCCGCCGTCCTGCTCCGCGACGGGCACTGCCTGCGGTACGGGGGCGTCACCCGCGTCGCC
GCGCAGGCGCCCCGGCTGCCCGCCCCCCGCGCCTCCACCGCTCCCCGGCTCGAAGTGCGC
TGCGTGGACGGCACCACCCTCCGCATGTCCCCCCGGGCCGCGCTCGACGTGTACCTCCCC
CTCGCGTGGCGGCTCTCCCTCCAGGACGGCCCGCGCCCCTGA
>orf00307 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGCCTGAGCGGAACATCGAGTTCGGCGCGTACGGCGCCCAGGGCGTCAAGGGCCACGAG
TTCGTCGCCCGCCGCCTCGACAGCCTCGCCGGGTTCATCGCGTCCCCGGTCACCACCCGC
CGTGGCCTGACCGCGCGGCTGCGCTACCTCACGAGCAGTGCCCGCCAGCTCGCCGCCGCC
CGGGAGGCCGGGCTCACGATCTCGGACCGCACGATCAAGGCGCAGATGCAGGGCACACGC
CGCCCCTCCGCCCGTACGCTCCGCGAGATCGACGCCACTTACCGCGCGGTGCGTCGTCAG
AACGTCTCCCGGCACCTCCTGGCCCGCCTCAACCGGCAGGGCCGGGGGACCCGCGTCGAG
TTCCACCCCGTCAATCAATCCGGGGTGGAACGCCCTCGCCAGCGGGTCGTGGAGTACCGC
ACCCTCAACGTGCGCAAGTGGGAGCGGATCGTCGGCGCGTGGGAGGCCGGGGACGACGCG
GGCCTGGATGCCGCGTGGGTCGACGAGGTGGTGGTCGACCTCGGTTCGCAGTGGGGTCAG
TACGAGTACGTCACCAACATCGGCTTCGCCGCCTGA
>orf00310 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGACTGACCTACCGCACAACGAGTACATGGCCGCTGTCGCCGACGCGCTCGCCGCCCGC
GACATTGCGCCCGCACAGTGGTGGACCAGCGAAGACGACTCCGGCGCTGGCACCGACCGT
CTCGACGCCGTCTTCCAGTGGCACACCGGCGTCGCGGACCGCGACCACTGGCCGCACGGC
GTGTACCTGAGCTGGGACCAGTACGACGGATGGCGCCTCATCGAGGCCGGCGGAGGCCGG
AACATCTACGACCTTTCGCCGGATTCCCTGATCTACTGCGACCCGCGGCAGGTCGCCGCC
GACGTTCAGGCCCGGCTCACACACGGGCTCGACGGATGGTCCCCGGGCCCTATCTGCGTC
GTCGGCGCCCGGTGGGACGTGCGCCCCACGATGGCCGCTGTAGAACGCTGGGAGGCGGCG
GCCTGA
>orf00311 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGCTTTTGTGGCTCCAAATTGAGACTCGACACGGGTGGTTGTGGGCGTACGACCTGGAG
CACCTCGACTTGCTACGGCGCTTCGTCCAAGCACCGCTGCGCGAACGAGCGCCCTGGTAC
GACACCGGGCAGAAGATGACGTTGGTCGCCCGTCTGCCACTATGGATCAAGCGCGCGAAG
AATCGGGACGAGATCCTGCGCGGCATTGCTCGAATCCGCGCATCACTGGTCTGTGCCTGA
>orf00316 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGTGCGAGGGCGAGGGCGTGGTAGGTGGCTCGCCGTTCGAGGGCGAGCCGGAGCAGGGC
ATCGTTCACACCCCTACCCGATCACATGTTCGATTTTTTGGGCAACCGAACCCGCGCAAA
ACGCCACATCACCGCCGTGCGCGCGCTCTGGCCGGTCGTACCCTCGCTGGTGTGACCGAT
TTCCCCGACGATCTCCTCGCGGCTCAGCGCGACCTCACCGCCGTACGCGCGACCCTTTCC
GCCCGCCTCGCGGCGCTGCCGCCCTCGGCGGAGCCGATGCCCGCGTGGGAGCGGCCGGAC
GGCTACTGGGCGGGCGCCCGTACGCACCCGGCCTCCCCGGGGTGGAGCGAGGAGGAGCGC
CAGGAGGTCGCCGCGCTCCGCGAGCGCGAACGGGATCTCGCGGCGGCGATCGTGACGCAC
GAGCTGTGGGCGAGCGTGCCGGCCGAGGAACGGATGCGGGCCCGCGACGCACTCAAGCAC
GCCCACGAGACACAGGCCGCCGAGGCGGCGGGGGCCCGGGGCTGA
>orf00317 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGCCGCCCGCCCGCGCCCGCGTCCCCGCCCTCGCGGGGGACCAGGTGACGGCGGGGGAC
GGGCGCCACCGCGTGCTCGCCGCCGTACGGGACGCGATCGCCGAGACCGGCCAAGGCCCC
TCCGTACGGGAGATCCAGCGCGTCACCGGGCTCGCGCTCGCCACCATCGCCCACCACCTG
AAGGCCCTGGAGGAGAGCGGCGCCCTCGTCCGTACGGGCCTGCACTGGCGCACCTGCCGC
CTGGGCTGA
>orf00319 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGTCGGGCCACGAAGGCGCGAGCAGCAGCGGGGCGCCGGGGGTGTGGGTGGTGCTCGCG
GACGGGCAGGAGGTGCGGGGGCGGCTCCTCGCGCGGCGCCAGCTCCCGGACGGGTGGCGC
TACCGCGTCGCGCTCCCGCTCTACCGCAACGTGGGCGGGGAGGGCCTGGAGGTCGAGGCG
GCGCAGTACGAGGTGTGGGTGCGGGCCCCCGAGCATGTGCGGCCCGTCGAGGACGTCGAC
TACACGGGCGTGCCGACCACGGCGCTCCCGGCGCCCTCGCTCGTGGAGGTGGCGCTCGGG
CCGCGCAGGCCCGCCGGGTGGGTGCTGGCGAAGAGCGGCGGCGGGCGCCGGGGGCCCTCC
CGTGCGGTGCTGCACGCCGTGGACTGCGCCGAGGCGCCGCCCGGCCTTCCGGTCCTGCGG
GTGGAACAGGCGCTCAACGCTGCCGAGCACCCCGCCACCCGGGCTTGCGCCCTGTGCGGG
GCCGGTGCGGAGCTTGATCCGCTTCTGCGGGGCTTCGACCCGCAGGAGGACGCGGTGGGA
GACCCCTGA
>orf00320 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGAGCTTCGGCCTGGTCACGATCCCCGTGAAAATGCTCCCCGCCGTCGGCGACCACAGC
ATCCACTTCCGGCAGATCCACACCGCCGACGACGGCCTCGTCCGCAACCGGAAGGTGTGC
GAACTCGACGGCAAGGAGCTGTCGGCCGACGAGATCGCGCGCGGGTACGAGGTCTCGAAG
GACACCGTGGTCCCGCTCTCGGACTCCGACTTCGACGACCTCCCCCTCCCCACCGCGCGC
GCCCTGGAGATCGAGGCGTTCGTCGACGCCTCTGAGATCGACCCCATCCAGATGGGCGAC
ACCTACTACCTCGCCGCCGACGGGCAGGTCGCCGCGAAGCCGTACGCGCTCCTGCGCGCG
GCCCTGGAGCGCACCGACAAAGTCGCCCTCGCGAAATACGCGTTCTCCGGGAAGGAGCGC
CTGGGGATGCTCCGTGTGCTCGACCAGGACGTCATCGCGCTCCAGGTCCTGCACTGGCCC
GACGAGATCCGCTCCCCCGAGGGACTCGCCCCGCCCAGCGTAGACCTCACCGAGGACGAG
ATGACCGGGGCGCTCGCCCTCATGGACACCATGGCCCGCGACGGCATCGGCGACGAAGAG
GACGAGTACCGCAACGCGGTCGAGAAGCTCGTCGAGGCGAAGGCCGAGCACCGTGCGCCG
CCGCGCGCCGAGCGCGAGGAGCAGCCGCGCGGGGAGGTCGTGGACATCATGGCCGCCCTC
CAGGACAGCGTGGACCGCGCGCAAAAAGCCCGCGGCGAGACCGGCAAGGACGCGACCGTC
CACGAGATGCCGAAGAAGCGGGCCGCGAAGAAAGCGCCGACGAAGAAGACCGCAGCCAAG
AAGGCAACGTCGAAGAAGACGACCGCGAAGAAGACGAGCCGGAAGAAGCCCGCCTGA
>orf00322 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGCGAGAATCCGGGCCCATGACGGACCCTCAGCAGCCCTCGCAGACCGACCGATCGGAT
GCCGACGACGTCGAACAGCACGCCTGTCCGAAGTGTGACACGCAGCCCGGCTCGCCGTGC
CGCTCGCGCGGCGGCGCGGTTGCCTCCGCCTACCACACCCGCCGCTTCACGATGGTGCCC
CGGCTGAAGAAGGCGCTGCGCGTGCCGACCCCGGCCGACCGCGGCCCGGGCCGGCCGTGG
CGGCCGGGCACCCCGCCGCCGACGCCGATCGATCCGGACCTGCCGAGCGCGGACATCCGC
ATCGGCTACGCACGGTGCTCGACGCTCGGGCAGGAACTCGACTCCCAGCTCGACGCGCTC
GCGGGACACGGCGTCCCAAGGGACAAGATCTTCAGCGAGAAGATCAGTACCCGGGTGCGG
GTCCGCCCGAAGTTCGAGGAGGCGCTGAGGACCGCGCGGGAGGTCAAGGCGCACGCCCCG
CACTGCCGGGTCATCTTCACCGTGTACGAGATGAAGCGCCTCGGCCGCGACGCCGCCGAG
CTCACCGCGCTCGCCGACCACCTCACCGCCCACGGCCTGGTCCTGGAGATGCTCGCCGGG
CCCTTGCCCGGCATCTACGACCCGACCGGGCCGGGGAAGCTGCTGTTCGCGTTCTTCGCC
GCGATGGCGGAGACCGAGCGGGAGAACATCCGGGAGTCCACGCTGGAGGGGCTCGACACG
GCGGCCCGCAAGGGCAAACACGGCGGCCGACCCCCGGTCATCACCGACGACATGCTCCAC
ACTGTCCTGCGGCGCCGCGCGGGCGGCGAGTCCGTCGAGCAGATCCAGCCTGACCTGATC
ATCCCCACCGGCAAGCGCAAGGGCCACAACCCCTCAGTGGCCAGCGTCTACCGGGCCCTC
GCCGAGCACGCCAAACGCGAGGCATACCCCGAAGCCGTCGCCCAGGCGCACGCCGACTTC
GCTGCCCTTCGGGCCGACGACGTCCCCGGGCCCCGCCTCGCACCCTCTGACCGAGCGTCA
CTCTGA
>orf00325 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGCTGATCGCGGGAGCCGGTATCGCCGGTCCGGCCCTGGCCCACTGGCTCAAACGGCAC
GGAATGCAGGCCACCCTCGTCGAGCGGGCCCCCGCCCCGCGGGAGGGCGGACAGACCGTG
GACCTGCGCGGTGCCGGACGGGACGTCGCCCGCAGGATGGGCCTGGAACACACCCTCCGG
GACCACGCCACCCGCGAAGAAGGCATCCGCTTCGTCGACGCGGCGAACCGCACCAGAGCC
GCCTTCACCAGCGGCGCCTTCGGCGGCCAGGGACCGATCGCCGACCTGGAGATCCTGCGC
GCCGACCTCTCGCGCATCCTCTACGAGGCCACCCACCCACACACCGAGTACCTATTCGGG
GATGAGATCACACAGCTGTCCGACACAGGAAAGAAGGTCGACGTCACCTTCCGCAACGGG
CCGGACCGTGCATTCGACCTCGTCATCGCCGCCGACGGAGCCCGCTCCCGCACCCGCGAC
CTGATCTTCGGCGACACCACCGACATCCGCCCCGTGGGCCTGACGACCGCGTACTTCACC
ATCCCCCGCGAGCCCTCGGACGGCACCTGGGCCCGCTGGCACAACGCCACCCATGGACGC
ACGGCGACCCTGCGCCCCGACAACCGGGGCACCACCCGCGCCTCCCTGTCCTACCTCTCC
CCGCCCCGCGGAGACGAACGCCTGGCACCCGACGCACAGAAGCAACTCCTGCGCCGCCTG
TTCACCGGCGCGAGCTGGGAGATTCCACGCATCCTCACCGCCATGGACACCGCCGACGAC
TTCTTCCTCGACTCCGTCATCCAGGTCCGCATGCCTTCCTGGTCCCGGGGGCGGATCGCT
GTCGTCGGCGACGCCGCGTACTGCGCCTCGCCCCTCAGCGGCATGGGCACCAGCCTCGCT
CTCACCGGCGCCTACGTCCTGGCCGGTGAACTCGCCCACCACGCGCATCACGGCAACGCG
TTCGCCCGCTACGAGCACATCCTCCGCCCCTACATCACCCGCGCCCAGCATCTACCGCCC
GGCGTTCCTCGCATCGCCTCACCCCGCACCCGGGCCGGCATCCGGGCCCTCAACACCGTC
CTGTACGCCGCCTCCCGGCCCCGCATCGCCAAAGCGCTCAACCGCTTCCTCGTACCGCCA
GCCGACACCTTCACACTGCCCCCGTACGGCCTCTGA
>orf00326 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGCGTGACCCGTCCCCCACCCGCGAGGAGACGACCGAGCCCTACCGGTGGCGGTGGCTG
ATCCTGGCGGTGATGATCGTCGCGGAGATCATGGACCTCCTGGACGCCTCGATCGTCAAC
GTCGCCGGACCGGACCTGGAGAAGTCCCTCGGCGCCGGCTCGGTCGGACTGCAGTGGGTG
ATCGGCGGCTACGCCCTCACCCTGGGCGCCGGTCTGGTGCTCGGCGGGCGGCTCGGTGAC
CGTTACGGCCGGCGCCGGATGTTCCTGATCGGACTCGCGGCCTTCACCACTGCATCGCTG
CTGTGCGCGATCGCGCCGAACATCGAGTCGCTGATCGCCTTCCGCCTGCTGCAGGGCACC
GCCGGAGCGATGCTGCTGCCCCAGGGCCTGGGTCTGCTGCGCGAGAACTTCTCCGGCCCC
GAGCTCACCAAGGTCTTCGCGATCTTCGGCCCCGTCCTCGGACTGGGCGGCATCATCGGC
CCAGTCCTGGGCGGCTTCCTCATCGAGGGCGACTTCTTCGGCCTGGGCTGGCGCTCGGTC
TTCCTGATCAACCTGCCCATCGGCATCGCGGCACTGATCGTCGCCGCGAAATTCGTGCCC
AAGAAGGCGGGCGACCGCACGGTCCGGGTCGACATGACCGGCGCCGCCCTGATCGTGGCG
TCCTGCGCCCTGCTGGTGCTGCCGCTCAACCAGGGCCAGGAGAGCGGCTGGCCGCTGTGG
ACGTGGCTGTCCATGGCCGCCTCCGCGATCGGGTTCGCCCTCTTCGCCCTCCAGCAGCGT
CGCACGGCCGCCGTGGGCCGCGAGCCGCTGGTGACCCCCGGCCTGCTGCGCAAGCCCGCC
TTCACCGTCGGGCTCGGCGGCATCGCCCTGTTCTTCGGCGGACTCATCGGCACCCAGCTC
GTCCTGACCCTGTTCCTCCAGATCGGCCAGCACTTCACCGCTGGTGACGCGGGCCTTGGC
AACCTGCCCCTCGCGGTGGGAACCGCGATCGGCGGCGCCATCAGCGGCGCGTTCCTCGCT
GACAGGATCGGCCGCAAGGTGCTCCAGATCGGACCGCTGGTCCAGCTGGCCGGCGCCGCC
GTGCTGTGGTTCGAGCTCGACGGCCTCGACTCCGCCTCGTTCTCGATCTGGGACATCGTC
CCGGGCACGACAGTGGCGGGCATCGGCGCCGGCATGGTGATCGCCGCACTGTTCAGCTTC
ATCCTGGCCGCGGTCGACGACGACGAGATCGGATCCGCCTCCGGGGTCCTGTCGGCGGTC
CAGGCGGTCGGCGGCTCCATCGGCGTCGCGGTCTTCGGCTCGGTGTTCTTCGCCCAGGCC
AAGACCGGCGACTTCACCGGCGGCTTCCACCGGGCCCTGATCGTCCAGGCATGCCTGCTG
GTGGTCTTCTTCGCGATCACCTTCCTGCTGCCCAAGAAGGGCCGCCCCGAAGACGAGCAG
CACGGCATCACCCCCGAGACCACTGCCGACGACTCCGGCACCAAGCAGCACCTCGCCATC
TGA
>orf00329 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGCGTGACGGGGTCGCTCAGCAGCGTGAGCGGCTGATGGAGTCGCTGAGGATCTACGGT
GGCCACTACTCCGAGCTCAGCCGGCGCTTCGCCGCCTGGCTGGGCCTGCACTCCACGGAC
GCGACGGCGGTCCTGGAGATCGCCGCCGCCGAGGAACGCGGCACCCCCCTGTCACCGGCG
CGGCTGAGCGAACGGATCTCCCTGTCCACCGGCGCCACCACCGCGCTGCTGAACCGCCTC
GAAGCGGCCGGGCACATCACCCGCGCCCGCGAGCACTCCGACCGGCGCATCGTCACATTG
CACAGCGGCGAGCACATCCAGGAGCGGGCGGACGAGTTCTTCGGCCCGCTCGCCCACCGC
CTCGACGCCGCGATGTCGCCCTACCCGCCCCAGTTCCTGGAACAGGTCGAAGCGTTCATG
GCCGACCTGAACGCCACCATGGACGGCCACCTCACGGAACAGAACGCAGTGGCACCGCGC
TCCCTCCGCACTCCCTGA
>orf00330 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGGATCAGCCCGCGGTGAAGTCGCCGTCCGCGGCGAGTACGGCGCCCGTAACGAAGGCG
GATCGCGGGAGACCAGGAAGCACAGGACTTCCGCGACCTCGTGCGGCTGCGCCACCCTGC
CCAGGGGGTGGACGTTCCCGAAGGACGCGAGATAGGCGCGGCTGTACGGCCACGGTGGGC
CGGCTGTCGGCGGCGACCCGGTCCCGGCTGGACGACCTGGTGGCCGAGGACGCCGGCGGG
GAGGAGTCGGCGGGCGGCGGGGTGTCATTCTTCTCCGAGCTGAAGGCGGACCCGGGCGCG
CTGGGGCTGGACAGTCTGCTGGCGGAGGTGAACAAGCTCCAGCGGGTGCGTGCGCTGGAG
CTGGCGCCGGAGCTATTCGGGGACGTGTCGGAGAAGCTGGTGGCGGCGTGGCGGGCGCGG
GCGTCGAAGGAGTACCCCTCGGACCTGCGGGCGGCAGCCGGGCCGGTGCGCTACACGCTG
CTGGCCGCGCTGTGCCATGTGCGGCAGACGGAGATCACCGACTCGCTGGTGGAGCTGTTC
ATCCAGCTGGTGCAGCGGATCAACACGCGGGCGGAGAAGAAGGTTGAGGGCGAGTTCACC
AAGGATCTCAAGCGGGTCCGTGGCAAGGAGGGGATTCTGCTGCGGCTGGCGGAGGCCGCG
GTCGCGGAGCCGGGCGGCACGGTCCGCAAGGTGATCTTCCCGGTGGCCGGGGAGTCCACG
CTGAAGGCCCTGGCGGCGGAGGCCGCGGCGAACGAGGCCCGCTACCGGGCCCGGGTGCGC
ACGGTGCTGCGGTCGTCGTACTCGGGGCACTGGCGGCGGATGCTCTCCCCGCTGCTGGGG
GCGGTGGAGCTGAAGTGCAACAACACCGCTTACCGGCCGGTGATGGACGCCATCGACCTG
CTGAAGCGGTACCTGGACCAGCCCATCGCCAAGGAGGGCGCGTTCTTCGACGAGTCGGAG
AACATCCCGCTGGCCGGGGTGGTGCGCGAGGAGTGGCGCAAGGCAGTGGTGGACGAGCGC
GGCCGCGTCGAGCGCATCCCGTACGAGCTGTGCGTGCTGGTCAGCCTGCGGGACGCGCTG
CGGCGCCGGGAGATCTGGGTCCCGGGCGCGGGCCGGTGGCAGAACCCCGAGGGCGACCTG
CCCCCCGACTTCGAGGACAACCGCGATGTCCACTACGACGCGATCCGCCAGCCGCAGGAC
CCTGGGTCCTTCATCGGGGCCCTTCAGAAGCGGCTGCGGGAGGCCCTGACCCGGCTCGAC
ACCGCGCTGGAGCTGGGCACCACGGGCGGCGTGGACATCGTCCGCAAGCACGGCGAGCCG
TGGATCAAGGTCTCGCCGCTGGGCAAGCAGGCAGAGCCGGAGAACCTCGTCGCGCTGAAG
GCGGAGATCGAACGCAGGTGGGGCACCATCGACCTGATCGACATCCTCAAGGAGGCCGAG
TTCGCCACCGGGTTCACGTCCGAGTTCGCCTCAGTCGCCACGAGGGAGGCGGTCCCGAAG
GCGGTGCTGCGGCGCCGGCTGCTGCTCGTGCTGTTCGCGCTGGGCACGAACATGGGCATC
AAGCGGGTCGCGGTCACCGGCAAGCACGGCGAGAGCGAGGCCGTCCTGCGCCGGGTGCGG
CACCTGTTCGTCAACCGCACCAACCTGCGCGCCGCCCTGGTCCGCCTGGTCAACGCCACC
TTCGCCGCCCGCGATCAGGCGTGGTGGGGCGAGGGCACCGCCTGCGCGAGCGATTCGAAG
AAGTTCGGGTCCTGGTCCAGCAACTTCATGACCGAGTGGCACCAGCGCTACCGCGGGCCC
GGGGTGATGATCTACTGGCATGTCGAGCGGAAGTCGCTGTGCGTCTACTCCCAGCTCAAG
TCCTGCTCGGCCTCCGAGGTCGCGGCGATGATCGAGGGCGTGCTGCGGCACTGCACGGAC
GTGGAGATCGACCGCCAGTACACCGACACCCACGGGGCCTCGATCGTCGGGTTCGCCTTC
GCCCACATGCTCGGCTTCAACCTGCTCCCCAGGTTGAAGAACGTCGGCTCGGCGCGGTTG
TACCGGCCGGCGGCTGGGGAGGACGACACCTGGCCGCATCTGGCGCCGGTGCTGTCGACC
AAGACGATCGACTGGGACCTGATCGCCCAGCAGTACGACCAGATCGTGAAGTACACCACC
GCCCTGCGGCTGGGCACCGCCGAGGCCGAGCAGGTCCTGCGGCGCTTCACCCGCGGAGGC
CCCAAGCACCCCACCTACCGGGCGATCGAGGAACTCGGCCGGGCGGCACGTACGGCGTTC
ATCTGTGACTACCTCGCCGACGCCGACCTGCGCCGCGAGATCAACGACGGACTCCAGGTC
GTGGAGAACTGGAACTCCGCCAACCACGACCTGCTCTACGGCAAGGACGGTGATCTGACC
GGCTCCGACAAGGAGTCCCAGGAGGTCTCGATGCTCGCGCTGCACCTGCTCCAGTCCGCG
CTGGTGCACGTCAACGCCCTGCTCCTCCAGGACATCCTCGCCGAGGAGAAATGGCAGAAG
AAGCTCACCGACGCCGACCGGCGGGCCCTGTCCCCGCTGTTTTGGACGCACGTGAACCCG
TACGGCCGGTTCGAGCTGGACATGAATTCCCACCTGGACCTCGTCGCCGCCGTGGCGGCT
TCGGTGCCCGGCCCGCGCAGCGGCGAGCCGGCCACGTCCCCGGCCTGA
>orf00332 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGCGGGAGAGAGAAACATTCGAAGAACAAGGCGCGGCGGGCGGTGAGGGGCGACGCACG
CGTCGGCACGATCCGCGCCGTCGGGAGCGGGTGCTCGACGCCGCGCTGGAGGTGCTCGTC
GAAGACGGGGTCGCCGGGATCACGCACCGCAAGGTGGCGGCCCGCGCCGACGTGCCACTG
GGCTCCGTCACCTACCACTTCGCAAGCCTGACCGAACTGTGCACGCAGGCGTTCGCCTGG
TACGTCGAACAGCGCACCGCCGAATATGAGGCCCTGTTCACCCAGGTGGCATCGCGCGAA
GACCTGATCGACGTCCTGGTGACGGTGGTCCAAGGAGGACCGGCCCGGCATCGCAGCGCG
GTTCTCGGCTTCGAACTGCATTTGGCGGCGCTGCGCGATCCCGCGCTGCGCGTCCTAACC
CAGCAGTGGACCAGCTCCAGCCGGGCGGTGCTGGCCCGCTTCACCGGGCCGCGGGCCGCC
GCCCGCCTCGATGCCCTCCTGGAAGGAATGATCATGCACGCACTGCTCTCCACGGACCAG
GAACCGCCCGAGGCGACCCGGGAGTCCCTGGCGCAGACGCTCGGCCCGGCCGCCGGGCCG
AGTAAGTGA
>orf00333 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
TTGGGCCTGGCCGGGGCCACGTGGGCGTCCCGCCTGCCGCAGATCCGGGACCGCATGGAT
CTGGACGCCGCGGCAGTGGGTCTCCTGTTGCTCCTCCTCGGGGTCGGCGGTCTGGTGGCG
TTGCCGCTGGCCGGTCTCCTCGTCACACGGGTCGGGCCGCGCCGGGCCGTCACCACGGTG
GGCGCGTTCGTAGGTGCCGGCCTCGCTGCGGTGTCGACCGGCTTCGCTCTCTGGCCACCG
TTGCTCCTCATCGGCCTCTTCGTCCTGGGCACTGCCACGGGCTTCTGGGATGTCGCGGTG
GCCGTGCACGCCGCAGCCCTCGAACGACGACTCGGTCGCGCTCTGATGCCCCGCTTCTTC
GCCGGGTTCAGCCTCGGCACCGTCGTCGGCGCCTGCCTCGGCGCGCTCCTGACGGCGCTG
GGCGTAACGGTGAGCCTGCACATCGGCGCGGTGGCCCTGCTCATCACCGTGCTGACACCC
GTGGCGGTTCGCCGCTTCCTCCCCCGGAGTGCACCCCCGGCATGGCCACCACGCAGGACG
ACGCAGGAGCCCGGACAGCGCGCATGGCGCGACCCACGCACGGTCGTCCTCGGCCTCGTC
GCCCTGGCCTTCGCGTTGGCGGAAGGAGCGGGAAGCAACTGGGTCAGCCTCACTGTCATC
GACCGCCACCGCACCACGGCCGCAGTCGCTACGCTCGCCTACGCCGCCTTCCTCGCGGCC
GTCACCCTCGGCCGCTGGCTCGGTCCGCTGATCGTCGGCCGCCTGGGCCGGCCAGGAGCA
CTGCGCGCGTCTGCGTTGGCCGCCTGCCTCGGGGTGGTCTTGTTCGCGGCCGGGCCCAGC
CTCTGGGCGGGGTTCGCGGGGACGCTGCTGTGGGGAGCGGGCGCGGCACTCGGCTTTCCC
CTCGGTCTGAGCGCCGGTTCGGACGACCCCGCCCAGGCGGCCGCGCGGGTCGGCGTGATC
ACCTCGATCGGGTACTGCGGCTTTGTCTGCAGCCCGCCCCTGTTCGGCGCCCTCGCCGAC
CGGACCGGCCTCGCACCGGCGTTGCTGGTCGTAGCCGCCGTCATGGCCGCGTGCCTCCCC
CTCGCGGGCGCCCTGAGGGACACCTCGCGGGTTGTGTATGAAGAGGCGACCGACGGCGTC
GCGCCGGGGCCCTTGCACTGA
>orf00335 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGAAGGAGCACACCGTGCCGACCAGCACACCCGTCATCCAGGTCGCCGACGCCGACCTG
GAAGACCTCCGCACCCGGCTGCGCGCCACTCGCTGGCCCGAGCCCTGGCCGGTCGACGGC
TGGCAGGCGGGTACCGACGCAGCCGAACTCCGCCGCCTCGTCATGTACTGGGCCACCGAC
TACACGTGGCGCACCCACGAAGCCGCCGTCAACGCACTGCCCTCCCATTTTGCCGACATC
GCCGGCACACGAGTGCACTACCTGCGTTACGAGGCCGAACACCCTGACGCCCTGCCGATC
GTGCTCACCCACGGCTGGCCGAGTACCGTCATGGAACTCACCATGCTCGCCGAACGACTC
GCCGCCCCCTCCCGCCACGGAGGAGACGCCCGCGACGCCTTCACCGTCATCATCCCCTCC
CTGCCCGGCTTCACCTTCTCGCCACAGCGCCCCGCCCTCACCGACGCCGAGCAGACCCAT
GACCTCTGGCACCGGCTGATGCACGACCACTTGGGCTTCCAACGCTACGCGGCCCACGGC
GGAGACCTGGGCGCCGGCGTCACCTCACGGCTCGCCGAGGCCCACCCCGAGGCCGTCGTC
GGCATTCATCTGCTCGCTGCCGCGGCCCCGGCAGAGTACGATCCGGCCTCGCTCACCCCT
GAGGAGAAGACCCACCTGTTGTCCGCCGCGGCCTGGCAGGCAGAGGAGGGCGCCTACATG
CACCAGCAGAACACCCGTCCCCTCACCCTCGCGCCCGCACTGAACGACTCGCCCGCCGGA
CTGCTCTCCTGGATCCTCGAGAAGTACCGCGCGTGGACCGACTGCGGCGGCGACCTGTCC
ACCCGCTTCGGCGACGACTTCCTCCTCACCCAGGCATCGCTCTACTGGTTCACCGGCACG
ATCTCCACGTCCTTCCGCCCGTACTACGAGTACGCGCACCAGCTCACCCGGCGCGTGCGG
CGGGTCGACGTCCCCACCGCCCTCGCCCTGTTCCCCGCAGACCTCGCCCAACCGCCCCGG
AGCTGGGCCGAGCGCACCTACCACCTCACGCGTTACACCCGTATGCCTCGCGGCGGCCAC
TTCGCCGCGCACGAGGAACCGGCCTTGCTTGCCGACGACATCACCGCGTTCTTCGGCGAC
CTCCGTTAG
>orf00336 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGGATGGACTGCATGGGAGCCCACTTCATAAGAGGCTCGACGAACACTGCGCTGGCCGA
TTCGGGATCGCACCACCGCTAACCGGGGAAATCACCACGAAGATCAACCACTGA
>orf00337 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGCCCACCGAGACCCTGCCGCCCGAGGTGCGGAATTTCATCGACGATGCGCGGCGTCAC
CTGGCTTTCTGCGCCGGGCTGCGCGCGGGCGAGGACCCGGCGTACGCGACCGTGCTCCTG
GCCGCCGCCGAGCAGGGAGAAGAAGTCCTCGCCCGGTACGAAGGCCGCGTAGCTTAG
>orf00339 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
TTGGCTTGTCTGCCTCGTGAGGAGTTTCAAATTTCTGTTTCTCGGGTTCCGTTGCGGAAA
CATCAGGTGGAGCTTATGTCGGACCTCAGGAAATGGGTTCGGGTGGCTGCCCGGGAAAGC
GCCCGTTCGGGGCGGGGGGCGCGGGCGACGGTGGTGTCCGCTACGGGTACGGGGAAGACG
ATCAGCGCGGCTGTTGCGGCGTTGGAGTTGTTCCCTTCGGGGCGGGTTCTCGTGATGGTG
CCGACGCTGGATCTGCTGGTGCAGACGGCGCAGTCGTGGCGGGCGGTGGGGCACACGGCG
CCGATGGTCGGGGTGTGCTCGCTGCCCGGGGATCTGCTCCTGGAGGAGTTGCGGGTGCGG
ACGACGACGCACCCGATCCGGCTCGCGCTGTGGGCCGGGCAGGGGCCTGTGGTCGTGCTG
GCGACGTACTCCTCGCTCGTGGGCGGGGACGGGCAGGGCGGGCCCCTGGAGGCCGCCCTG
GCGGGCTCGGGGTTGTACGGGCAGCGGATGGACGGCTTCGACCTCGCGGTCGTGGACGAG
GCGCACCGTACGGCGGGCAGCGCGGCGAAGCCCTGGGCCGCGATCCACGACAACGCCCGT
ATCCCGGCGGCGCACCGGCTCTACCTCACCGCCACCCCGCGCGTCCTCGCGCCCGCCCGC
CCCGACAGGGACGAGGACCAGGAGGAGGGCGGCGGGGAGGCGCCGGCACTCGTGACGATG
GCGAACGACCCGGAAGGCGAGTACGGGGCGTGGATTCACGAACTCGGGTTGTCCGAGGCG
ATCGAGCGGAAAATTCTTGCGCCTTTCGAGATTGATGTTTTGGAGATTACCGATCCTGAG
CCGGAATTGATGGAAGGAATGGACCGGGAGGCGCGGCGTGGGCGGCGGCTCGCCCTGCTC
CAGACTGCGTTGCTGGAGCACGCGGCCGAGCACAATCTGCGCACCGTGATGACGTTCCAT
CAGCGGGTGGAGGAGGCGGCGGCTTTCGCGGAGAAAATGCCGGAGACAGCGGCGGAGCTT
TACCGGAATGAGGTGTCGGCGGAGGATCTTGCCCTAGCCGAGGAGCTCCCGGCCTCCGAG
GTGGGCGGGGGCTTCTACGAGCTGGAGCCGGGGCGGCATGTGCGGCCGGAGCGGGTGTGG
TCGCGGTGGCTGTACGGAGAGCACCCGGTGGCCGAACGCCGTGCGGTGCTGCGGGAGTTC
GCGAACGGGATGGACTCGGCAGGGGTGCGGGTGCACCGCGCGTTCCTCGCCTCCGTCCGC
GTGCTCGGCGAGGGCGTCGACATCGTCGGGGAGCGCGGGGTCGAGGCGATCTGCTTCGCC
GACGCGCGCGGGTCCCAGGTCGAGATCGTGCAGAACATCGGCAGGGCGCTGCGCCCGAAC
CCGGACGGGCAGACGAAGACGGCGCGGATCATCGTGCCCGTCTTCTTGGAGGCCGACGAG
GACGGGGAGGGGATGGTCGCGAGCGAGGCGTACCGGCCGCTCGTGGCCGTGCTCCAGGGG
CTGCGCTCGCACTCCGAGCACCTGGTCGAGAAGCTGATGCTCCGGGCCCGGGTGCGGGCC
GAGAGCGCGAGCGCGCGCAGCGCGGAGGAGGCCGGTGCGGGGCCCGCGCGGGTCCTGTCC
GACTCCGGGACCTCTTCCCCCGCCTCCCAGGCCTCCGGGGACGTCGAAGGCGAGAACGAG
GACGACGTCGAGGCGGGCGCGGACGGCGCTGAGGCGGGCGCGGACGGCGCTGAGGAGTCG
GAGTCGGTGTTGTTGCGGTTCTCGACGCCGCGCTCGGCGTCGACCATCGCGGCCTTCCTG
CGGACGCGGGTGTACCAGCCGGAGTCGACGGTGTGGCTGGAGGGCTACGAGGCGCTGCGC
GCCTGGCGGGCCGAGCAAGGGGTGCGCGGCTTGTGCGCGGTCCCGTACGACGCCGAGGTC
GCCGCGGGGGCCTCGCGGCGGTACCCGGTCGGGCGGTGGACCACCGCGCAACGCCGCGCC
CGCCGCGAGGGCACCCTCAGCGCACACCGCATCGACCTGCTCGACGCGGAGGGCATGGTG
TGGGAGCCGCGCGAAGAGGAGTGGGAGCGCACGCTCGCCGGGCTTCGCTCCTACCGGGCC
GCGTACGGGCACCTCGCCCCCCGCCGGCGCGAAACCTGGGGCGAAGACGAGGGTGAGGAC
GTCGTACGCGTCGGGGACCTGATGGCGAACCTCCGCCGCAAGGACGGACTCGGGCGGGAC
GCGGAGCGGGCCGCCGCGCGCGCGGCCCAGCTGAGGGCCGTCGATGCGGACTGGGACTGC
CCCTGGCCGCTGGACTGGCAGCGCTGCTGTCGGCAGCTCGCGCTCCTGGCCGCCGACGAA
CCCGACGGACGCGCGCCCCGGATCGCGCGCGGGGTGCGCATCGACGGGGACGACCTCGGC
GCGTGGGTCGCGCGGCAGCAGGAACCGCGGGTGTGGGCGAAGCTCAGCACCGAGCAGCGG
GCGCGACTCGAAGCGCTCGGGCTCCGGCCTACCGAGACGGCCCCACGGCGGGGTGTGGAG
GGCACGGGGGCGGCGGGGAGCGGGAAGCGGACGGCGGCGGCGCGAACGGCCTTCCAGCGC
GGCCTCGCGGCGCTCGCGCAGTGGGTCGAGCGGGAAGGCGCGGAGAAACCCGTACCCCGC
AAACACACCGAGACCGTGAGCGTGGACGGTGAGGACGTCGACGTACGCCTCGGCGTGTGG
GTCTCGAACGTGAAGAGCCGCTTCGACGGGATGGGCGAGGACGAGCGCGGCCAGCTCACC
GCGCTCGGAGTGCCCTGGGCGGTGTAG