view test-data/streptomyces_Tu6071_genomic.fasta @ 1:b7b320f4c595 draft default tip

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit a4b0969b33a68a0ea9ba12291f6694aec24f13ed
author iuc
date Tue, 30 Oct 2018 18:51:01 -0400
parents a4136c1534be
children
line wrap: on
line source

>gi|333022496:2500-3701 Streptomyces sp. Tu6071 chromosome, whole genome shotgun sequence
CCGAGGAGGCGAAGACCGGCGCGCGCGCCGTGGCACCGTGATCCGCATGGGCGGCACCTCGACCAGAGCG
CCCGCATCGTGGTCCTCGCCAGGCGGCAGGCGCCTGACCCGGGCGGTCGCACGTGGAGGTCGCTCAGCTT
CCCGAGTGCGCGCGGATGCTTGGCGGCGGCCATCGGCGTTTTTAGTGGCTGCCCGATGTGGTGTCGGTGG
ACGGCTTGCCAGGGAGCCCGTCTGCGCCCGTAGCGTGCTCGGTGGCGGCCCAGGTGGCGAGAAGCCGCAG
GGTGTCGTGGTCGGGGGTGCCGGGGGCGGCGCTGTAGGCGGTCAGGGTCAGTCCCGGCTGAGCCGGTAGT
TCCATGGCGTCGAAGTCGAGGGCGAGGACGCCGACAGCGGGGTGGTGGAACGCTTTGCGGCCCGTGTGAT
GCAGGCGCACGTTGTGCCTGGCCCAAGCGGTGCGGAACTCATCGCTGCGGGTGACGAGCTCCCCGATCAG
TCCGGTCAGCCCGGTGTCATGCGGGGCTCGTCCGGCTTCGGTACGCAGGAGGGAGACGGTGGTGTTCACG
GCTTCCTCCCAGTGGGGGAAGAATTCGCGGCCTGTGGGGTCGAGGAACTGGAAGCGCGCGATGTTGACCG
GTTCGCGTGCGCCGGTGGCGTAGAGCGGGCTGTACAGGGCGCGGCCCAGGGGGTTGGTGGCCAGGACGTC
AAGGCGGCCGTTTCGGATGAAGGCCGGGCATTCGCCCATGGAGCGCAGGACGCGCAGCACGCTGTCGGGC
AGGGGGCCGCGGGCGCGCTTGGTGCGACGGGCGGGCCGGTGGGCGGCGGCGCGGGCCAGGTCGTACAGGT
GAGCGCGTTCGGCGTCGTCGAGCTGGAGAGCGTTCGCGAGCGCGTCAAGGACTTCTTCGGAGGCTCCGGC
GAGGTGGCCGCGCTCCAGGCGGACGTAGTAGTCGATGCTGACGCCGGCGAGCAGGGCGACTTCCTCGCGG
CGCAGGCCGGGCACGCGCCGGTTGCCGCCGTAGGCGGGCAGCCCGGCCTGCTGCGGGGTGATCCTGGCGC
GGCGGGAGCCAAGGAATTCGCGGATGTCGCTCGCGGTACTCATGCCTTCCACGCTAAGCCGGACGGCGCA
GACGTGGGGGGGCCTGTCAGTACCTGTAACAGCAAGCCCTTCTTCCCCTTCTTGACCTGGTGTTTCCTCG
AAGTCGCAGGCC