comparison test-data/E.coli_contigs.fasta @ 0:d0a712cf0518 draft default tip

planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
author bgruening
date Thu, 27 Sep 2018 15:27:40 -0400
parents
children
comparison
equal deleted inserted replaced
-1:000000000000 0:d0a712cf0518
1 >contig_1
2 AAGAAACATAAACAGAACGTCAGTAATCCAGCAAACTGACGGTTACGAAATAGGCGCGGC
3 GACAATAATCTCGTTCTTTCACCACCTCCGGCGTCAGATTCGGATTCACAGCACATCGGG
4 ACCAACGCGTTGGTGCAAACGGATGCGTGGTCCAGTTGTTCCGGGAGTCAACATCTCTAC
5 AGGCTTGAGGACCGCAAATCTCATGGAGCCCCAGTATCGCAGTTTTGTTGCACTATCCCG
6 CGTGTTTCAGGCGAGTGTTCTACCTCGAGTAGCCCGTTACAGAAGTCAAATGCGGCTCTA
7 GCACGAGTCGTAAAGAGGTGGCACCCCGCTAGGAGGGGCTAAGCATTGGCTCAGGAAACT
8 GCTGTATTAAAGAATTCGGTTGTACGGTTCCGCAAGTGAGGTCGGCCTCTAGGTCAAAAG
9 CGTCCAGTAAAGCTAATATTGTCACCGATAAGGTTGATTAACTGCTCGAAGGAAATTTAA
10 AACCATTGAGGAGGATAAGAGCGATATCGCAGTGGACCCAATTAGTGGTTCATTCTATTG
11 CCAGCGACCCATGTATATTCGGAACGTGAGGGTGAAACGTGCCTCCATGTAGAGCTTCAG
12 AGCAGGCATTAGATGCTGGTACAGCCTTTTCGTCGTCATTAATCGGGGTAAGTTACTTAA
13 TGCGACAACAGGATGCGCTTTTCGGGGCAAAATTGAAGAGCGTAGTCATGCGGGCGAACG
14 CCAGTGCGTGCTCGCCAGTAGCGTCGCACTGCATTAAGAAGCCGTTTGCGCCAGCCGTTA
15 AAGAGCGTTTCTGGTTCTACGGTGATAATATGATTTCTGGTGATCCGTGTTGCACCGGAC
16 CCATAGTTCCAGCACTTTCTTCAGTTCTAGTGATAGCGCGCCTGATATGGCTTTCGGAGA
17 TACACCCCAACCCAACGCTTTCATGATAACCGCGATCGGGTGGGAGCCGTTAGACACCAC
18 CCGTTATCATAGGCCACTGGTCAGTTAATTAAATGCAGAGTGCCCCGGCAAACATTTCCT
19 CGCCCCGATAATCGCTCCTGGGAAGAATCATGCTTCCCTGGATGTACGAACGAGAATTGA
20 CCCGCGGCGCCCGCATGGGAGATCGTGCGATTCGTCTGCCAGTTGTGCTTCTTTCGCCGC
21 CTGGTTGTACAACATGCCGTGCGGTTTGACATGACGCATTACGCGCTATCCAGCGCACGG
22 GAAATTCCTTCAGGCGCCACCAATTTTAGATACAGCGTCTGGGCGTAAACGGGGTTTCTG
23 GCGGCATCCAGCTGACGCGCTGCGAAATAAAATTTTCCCCTGTCGGGAAAACTCGGGTGA
24 GCGCCAATCGCGACACCATTTTATTGCTTCCACGCACGCAGCCTGCATGATTTGCGCATC
25 GCCTGCATGAAATCCACAGGCAATATTGTGCAGAGGAAACCAGCGTTAATAGCTCTGCGT
26 TGCTGGCGCATCGCTTCGCCCAAGTTCGGCGTTCAGGTCAATTTTCATTGTGCAGCCGCC
27 ACGCTAATTGTTCAAAAGTAACTGTTGCTGATTTGCCGTGCTTTTTAGTGCCTCTTCCAG
28 TGAACACTGGACAAAATGAATCGGCTGACCGAGCGGCGAATTTGCGCCAGATGGTACATA
29 TCAGCCTCTCAATGATACAGGCAATACGCGGGTAACCACCGGTGGTCTTGCCGTCGTTCA
30 TCAACACAATACTGCTGCCCGTCCTCTTGGCACCTGCACCACGCCCGGTGACAAACCGTG
31 AGATAACAGTTCGCGATCGGTGGTGCGTTTTAAATGTCCCCTGTAAGCGATAGCCATGCG
32 GTTATTTGCGAGCCGGCTGCCAGGCGAACGCCAGAATGCATATCCTGCGAGGCGCGATTG
33 AACTCATGATATTCCGAGTGGCGGCAAGGCGCGAATTGCGGTTGCCCCACAGCAGCTGTT
34 TAACGCCCTGCGCTTCCATAGAATTGGTACGCTTCGATTTGCCAATCGGGAGTCGGTCAC
35 CATCCTTCAGTAAACGGCCTTCCCAGCCCGCCAATCCCCATTTGCAATCACTGCGCGGTG
36 CTGCATGAGCCCATTACCGGCGGAACATCAATACCACCCGCGACCGCCAGATAACTGCGC
37 ATGTAGCGTCTTCGTGGAGGCATCCGTCAGCGTTAAACGCTGGCCTGCTGTTTTCATCGG
38 CAATCGCCAGCCGGTCCAGACGCATTATCATCCAGCCGCGCTGTCGCAACCGGCACCCGT
39 CAGAGCCGAAACCACCCATCAGTTTCGAACCTAACAGTTAACTGACCGAGCGCTGATCTC
40 CATAGCGGGGGCATTGGCGTCATTACCACCAGTATAAGTGCAATGCGTAACGCGGGCATA
41 TCAGTGCGCCGCAGTGGCTGATATCCGACTGGCGAAACCGTGACGACCGCCATCCTGCAC
42 GCGCGTATACATGCCCGCACGAATAATCTTCAGCATACTCCCTCCTTCTGCGTACAAAGC
43 CGCGGAACCTGTCTCCAGGGACGGTGTAATACAAGATGGGTTCGTCACGCGCGCCGGATT
44 AATAAGGACGATGAGTGAGGTATGACCAATCAACTGCCAGCCACCCGGCGTTGCCATAGG
45 GATAAACACCAGTGCGGCCCGCCGATCCCGACAGAACCTGCCGCTGAAAGCCACCGCGGT
46 TCAGCGCCGTGGCGTGTGTAGTTGTTCCGGCAAACTCCCGAGATACGGGAAGCCCGGTTT
47 GAAAACCTAAAAACCAGACCACGTATTCCACGCATAGAGTTATGCAATTCAACAACCTGT
48 TCGCTCAACCCGCAATGCGCCGCGACCACCGCCAAATCCGGTCCGCCTGCCACCGTAAAC
49 CAAGGGGATTTCAATCAAAGCGAGACTCGTGGGTGCCAGCGCCTCGCTCCTCTCCACCAG
50 CGTTGCAAACGCTCTATGGCATCCAGCGCCAGCGACTCAGGATTACGCAAAATCACCGTG
51 ATATTTGTTCCACCTGCCGGGAAACCTGTTCAACCACATTCGGCAATATATCCACCAGAC
52 ACCCTGCGCCAGTCGCCAGGATCCCGGTTTCTGGCTAGCCAGTTCACCGGCGGTTCTCAG
53 TTCCAGCACTACCGCCGTTTCCACCTATCAGATAACAACGCGCTCGTTGCACTTTCACGT
54 GTGGGACTATTATTCGTTATGCAGGATTAGGAATATCAATACAAAGGTCACATCAAGATT
55 TCGTATTTTCACTTCAGCCACTCGCTCAATGCGCGAATACCACCACGTTCAGAGTGGCAG
56 ATGGTGACCTGCAGCATAAAATGCAATCCCTGCTCGCGGGCCTGAATGAATGGTCTTTCA
57 GAAAACTTCGCCAGGACCAACAGGCATCCACGCCAAACGCGGCGGCTATCGATAAAACTT
58 GCCCGCCGCCCGTGCACCAGGCGACGCGCTGGACCACCTCAGTCCGGTATCGCCACACCA
59 TAACGGCTTACGTCCCAGACGCTTTCAATCCAGGAAGCCAGCTGGGCAGTCCCGGCACAG
60 GCAATTGAGTTTCGCCCCACGGCACCAACGGCTCATTTCGCCCATGACCGTGATCCCCCA
61 ATGCGCCGCCAGCTGTGCCATGTTATTGCCCAGCTCAGGATGTGCGTCAAGCGGCAAATG
62 CCAGCCATATAAGGTTGATATCAGGTTTCGCCAGCAACGTTTTTAAACGGTTACGCTTCA
63 TTCCGCGAATGACCGGAGACTCTCTCCTTCCAGAAGTAGCCATGATGCACATGACCGCAT
64 CCGCGCCCAGACGCACTGCCTCATCGAGCAAAGCCTGGGTGCGTGGTGACACCGGTAACA
65 CAATTTTGCACCGTCTCTTTGCCTTCCCACTGCAAACCATTCGGCGTGGTAATCACTAAT
66 CGCCGCGCTGTTCAGCTTTTCGTTAATCAGTTGTTCCAGTTCGGTGTTTTTCATCTTCGC
67 GCCTTCCGTATTCTGATAGCTACACGTTAACATAGCGTTACCTCGCCAGGTTCGTCGATA
68 TTAATCTTTTTGACGACTTAAGAAACAAACCCGCAAAGCCCCAAAGACGCAAATTGTTTA
69 TATCATCACAGCGCTTCAGGATCTCATATTTATGCAAATCAGACAGCATTGCATAAATAA
70 GAGAGTCAATGTATCAAAGTTTTAACTTTAAGGAAACACAAGCACGCCGCGCAACTATTG
71 ACAGCTGACGTTGCGTCAATTGTGGAATTATTATGAATAAACACGCATCTAAGCCGCGCG
72 CTATTTACTGTCGTTGCGCTGCAAATCTGGGAATATTTGTGCTTTTACGGCATGCGTGCC
73 CTGCTGATTCTCTATCTGACTCACCAATCAAAACTAAAATACAACGATACTCACGCCTAC
74 GAGTTATTTAGCGCCTACTGTTCGCTGGTGGTTGTACGCCAATCCCCTGTAGCGTCGGCG
75 GATAACAGTCCTCGGCAATCGCATGGCGGGTGATGCTGGGGGGCGTTGTTGATGGCGATC
76 GGTTACGTGGTGCTGGGTGCCAGGCTGCAGATTACATCCGTCATTCCTCTATCTGTCCCT
77 GGCGATTATCGTCTTGCGGCTATGGCCTGTTTAAATCTAACGTAAGCTGTGCTGCTCGGC
78 GAGCTGTATGAGCCAACCGTCACCGCGTCGTGATGGCGTTTCTAGATGTATGCGGCATAA
79 CGTGGGGTCTATTATCGCACCTATCGCCTGTGGTTACGCCCAGGAAGATTGAACGCGATG
80 GGCTTGGCCTGGCGGCGGTTGGCATGATCGCGGTATTGAGTTTCTTATGTGGCAATCGTC
81 ATTTCACTCAGCCGCGGCGTTAACAAAGTACTGCGTGCGACAAACTTTCTCGTAGCCGAA
82 ATGGGGATGGCTGCTGGTTCTGCTGGTGGCAACGCCTGCACTGATTACCATACTGTTCTG
83 GAAAGAGTGGTCGGTATACGCCTTAATTGCGACTATTATTGGCCTGGGTGTACTGGCAAA
84 ATTTATCGCAAAGCAGAAAACCAGAAACAGCGGAAGGGAGCTGGGGTCGATTGTGACGCT
85 CACCTTCTTCAGTATGTTGTTCTGCGTGTTCGCACAACAGGGCGGTAGCTCGATTAGCCT
86 TTATATCGACCGCTTCGTTAACCGGGTGATGTTTGGTTATCACCGTTCCGACCGCGTATG
87 TTCCCGGTACGATTAATGCCTTCGCAGTTATGCTGTGCGTGTGTTCCTGGCGTGGGTGGT
88 AAAGAGAGTGTCGCGGGTAATCGTGATCCGTGCGCATATCTGGGGGAAATTTGCTCTTGG
89 CCTTGGCCTGATGAGCCTCGGATTCTGCATTCGACCTTAAGCGCCCGCTGGTCCGCAATG
90 TATGGTCACTCTTCTCTGCCACTGATGGTATTAGGCCTGGCGGTGATGCTTTGCGGAACT
91 GTTTATCGACCCGGTTGCCATGTCGCAAATTACGCGCGAAGTTCAAATCCCCGGTGACCG
92 GCGTGATGACCGGCATCTACATGCTGCTTTTCTGGCGCGAAATTGCGAACTATCTGAGGG
93 CGTGATTGCCGATCAGACATCGCAGGCTTCGTTTGATGCCTTCTAGGCGATCAACTACTC
94 CATCAATTATGCATATATTGAAGTATTTGATCAAATTACCTGGGGCGCACTCCGTGTGTA
95 GGACTGGTACTGATGATTTGGCTGTATCAGGCGCTGAATTCTTTCAGAAACCGCGCTGGC
96 GCTTGGGAGTCCTGGACCTCAGCACCCCCGATGCCTGATGCGACGCTTGACGCCTTTATC
97 ATAGGCCTACGTATTTCCTGCAATTTATTGAATTTGCACAATTTGTAGGCTGGATAAGGC
98 GTTCACGCCGGATCCGGCATCTGGGCTCGATTGCCTGACGCGTCTGTTATTTCCCTTCCG
99 CGCCGCCTCTACGCTGCCAACGTTTGTACTCGCTTCTTCTGACTCGACTATCGGTTGCGG
100 ATAATCCAGCGTCACACCTGCTTTCTGCGCCCATTCCAACGCTCATGCACCACTTTCCCT
101 GGCACATCGCGCAGTTCCGTCTCACTGGCGGATAAACTCCTCATGATCAACGGTTCTCGC
102 CCTGGGTTGTCGGGTTGAAATACGAAATACGGCTGCATCGGTTCCGGTTTGACCGCTCAT
103 CACTGCCAGCCACCGTTATTGGCTGCCAAAGTCAGATGATCAGCTGCGGGTAAATGAAAT
104 ATCGCTCGCCTTCGCGCCAGTCGATCAATAATTCTTCACCCATAAACTGGCTGTAATTAC
105 TTATCGGCCTGAGCTCGTGCAGGCCAGCCATGTCCCTTTAGACCTGACGCATAGCGGCAT
106 CAACAATCGGGTATCCCGTTTTGCCTTCCTGCCAGGCCTGTAAATGTGCCGGGATTGCTC
107 TGCCACTGTACACGATTCCGTCCAGGCAATAAATGACGATGTTTACCACAACGAGGGTGA
108 TACGTTATCAGGTGACGGTAAAACTCGCGCCATTACAGCTCATTAAGCCATAACTACCGC
109 TCACAGGGCGTCCAGCGCCTGCGGCTGTTCAGCCAACAAGGCGATGCGACTACAAGCTGG
110 CGAGGTAGGGACCCGCCCGTTGCCATAGGGGCTGGCGCGACAATAAAGCTGGTGCCTTCT
111 TCATGCCGGAAACCTGCTCGCGTTGTTGCTCATATTCTCCGGCACCGTTCTGGCAAAAAC
112 TGGCGTGACCGCGTAATCGCCGCTTTTTCTTTACACCGGAAAATGCGCAGTATCGAAAGA
113 CTGACGAGGAGATTCAGGGCATCGATACTCGTGGCGAGGGCTCTATCGATCCGCTACTAC
114 GAATTTTGGCGCAGCGACGCACTCCGGCATCCCTTCCCGCAGCCGTTTCAGCCCAGGCAT
115 TCTTAAAGGCGTAAAGACTTTACATCTCGTGATTACCGGTCATCACCGCGCCAGGCGGCA
116 GGATCACGCTGTCATCAAATCCTTCACACCACCGTTACGCAGCTCTTTCGGACTTCCAAC
117 ATCCCGCGCCCGCTCATTCACTTCAGCCACTCTGATAGTTATAAACAGGTGGGTAACGCG
118 TTTTCCCGCGCACACCTGTTTAACTATTTCGACACTGGCGACAAAGTCAGGCCGACTTCA
119 CGGAACAATAAAACAGGAATACCTTTTCCGCAAGCGCTATTTGTAGCCCATTCAGTTGAG
120 CATTAAGTCCCTCCTGACGCGGCGACATGTTATGCGGTCGCCCACCACTGGCGTGGTGTA
121 GCGATATACAACGCCAGCACGCGTGTGCAGACGAATTGCGGCAGGCGGCAGCCAGTGCGA
122 GATTATCGTGCAGACGTAATTGATCCTCGAAACCAGACCAGATGGGTAGTCATAAAACTC
123 CTGAATAATGGCGCAATTAATCACACGCGGCCAAAGTTCGAAATAACGACTGCCCTGAAA
124 GCAGGCGTCAGGATAAAGCGCCATATAGTGTTTGTGATACGCATCAGCGGCGCAAGAATC
125 TATTGCCTCTCACCCACGGCGATAACTGTCTAAGCGCAGCCAGCTGCTGGCGTTCGTGGA
126 ATCAATATGCGGCGAAAATAAGCCCTGAACGTGCATCACAAACATTGGTGTAATCCTGCG
127 CGGGTTGGCGGGGTGAGAAAGCAACGCTCTACGCGTTAGCGGTAATCTGGTTGTAATCAT
128 CCAGATTTGCCACTGGTGACAGTATCAGCCACGAATGGCGGGCACGTTGCGGTACCACTC
129 CGGCTGAGAATGCGCAGAAAGGGGATGTCTATAGCGAAGCTGTGATAATCGGAGAAGCGC
130 GTTATCTGGCGCCCTCCAGCACCCTCATGTTCTCTTTCGGTTACGATGGCTCACCTGGAG
131 GGCAATGGAGCGGAATGAGATACGGATTAGGGTGCTGTCGACCAAAATCGTTGCGGATTT
132 CATTGTTACCTGCTCCTGAGCGGTTTACGAGGAACAACCCGACTTATCAGGTGTCCAGCA
133 ACGTTGAGAAGGTGATACTTTGTGAAGTCTCATCCACTCCTGTTACAGCAGGACAGACAA
134 ATTTACGAAAGGCCACTGCTCAGACGATAGGACGTGACGTCAGGTAGTTTCGCGGCACAT
135 AGCTGCCTTTCTACTTCAGCGTGAAATTGCTATCAATAAGCTCATTACTAGCACATCTGC
136 AAAACAATATGAAGACGACGGTTTCTTCTCTTGCCGTGACTCTCCTTCACTAATTGCGTA
137 ACTGTCATGCTGTGGGATTATATTTTAATTCTTTCAGCGGAAATCCCTCGAAGGCTTTAT
138 TGGCGGCCGCCTGGTTTCCTTTTACAGCGAATAAATAATCACCTCCCTGTTTTTGTATCT
139 TCTCTTGCAATATCTTTCTGGGCAACCCATTCGCATCGGTTTTGATGATTTTTCCTGTTA
140 GATGAGCAGCATGGTTAAGAAGTTCAGGGCGACCCTAGTGATCTCCATTGGATTTCTTAT
141 CCGCTTTGATTATGATCAGGTGACCAGACTGTGCATTGTTGAGAAACGCAGGGACTTGAC
142 ATATGAAACGCTTCCCTTACGGCGACTCTGTGGTCATAAGAATGCCGCGTGCGAGTCTTT
143 TCGACCAATTGCGATGACGTGCTGTACATCTGAAGAATGGTAGTCAAGCATCCAGTTAAT
144 AAAGCTCCATGAAATTTCGCAGGACAGACACAGAGTACCAACTCTGGCAATGGTATCGTA
145 GAAGAGGAACCACCATTTTGCAAAATCACCAGTATTGCTTTGCTAAAAATCGAGGTCGTT
146 TCCCCGAAAAATCCTCTATATCTTCCCAGCCTTCTGCACCAGAAATAACGGCACAAATAG
147 TCAACAGTAGTGAATATCCGATAATTTATGTTCTCACTTTTCCAGCGCTTGTCTGTACAA
148 TCGGGGATAATAGAAATATGTTCCATCAATTTTTAGATGCGTCGCATTTTGTTCTCCTTA
149 ATTATGTAAGAAAGTATTTGATTGAGTCAAGCTATAGAAACAAGGCTTTCAGGTAAGCAG
150 GAATATCTCAATGTTTGGCAACCTAACATAAAAGCTTCGGCGAAGCTGTACTTTAGAGTA
151 CAAACAGCAGGGAAAAGATTACGAAAGCCCGCTCCCCCGCACAGAGACGTGACGGAGATA
152 GAGTATTCTATCCATGGCTGCTTTTCGCAGCTTACAGTCTTAACCCTGCCTTTGAATACC
153 TTATCATTCGTTATAGTAATGCAGCGATGTGCCGTATGCGTATGAAAAGCTAATTCTGCG
154 GCGTCTCCTCCTCTTATTTCGCAGTGGTCTTCACTTCATTACCACGTCCAGAGACGCCAG
155 TGCATAGAGCTTATATTCGCACGTGCCAGTGGTTTCGGATTGCTGTGGGCGAAACTTTTC
156 TGCGGTTAAAATCAGCAGAACTGATATAATATCATGACCGTCCACTTTCTGGCTCTTCTT
157 TTGTTCTGCTATATTATTGACCGAAAGGAGACTATGCCACGCATAATTTCTTCAGTGCTT
158 TCTACATTCAAACGTGAAATCAAGCAGTTCATCAGGGACATCGCAAACAATATGAAGACG
159 GATTTCTTCTCTGCCGTGACTCTTTCACTCATTGCGTAACTGTCATGCCTCTGGATTGAC
160 TTTAATTCTTTCAGCGGAAGTTTTTCCGCCAAAGGCTTTATTAAGCCGCCCCTGGTTTCC
161 CTTTTACAGCGAATAAATAATCACCTCCCTGTTTTTGTATCTTCTCTGCAATATCTTTCG
162 GCACGAGCATCGCATCAGTTGTGATGATGTTTTCCTCCTTTAAACTACTCCAGGTTGCAC
163 AGGAGAAGTTTTGCAGGGGTAGCTGTAGTACTCGCATTGGGATTTTCTTGCGCGTCTTGA
164 CCCTGCAGGATGACCAGACTGTGGCATTGTTGAGAACGGAGCACTAATGACATGAATCGC
165 TCCCCCTGCGGCGACTCTTGTCAGATAGAGTCGCCGGATGCGCTTTTCCACATCAATTGG
166 AACTTGACGTCGTTGTCATGATGAATGGACCACATCACAGCATCCAGTCAATAAAGCACT
167 CGCGAAATTTTGCAGGACTGATACAGGACTACAACTGTGGCAAATAGTATCGTGAACAGG
168 AATACCATTTTCGCAAAATCCACCATAGTGCTGCCAAGAAATCGGAGATGTGTTTCCCGC
169 GAAATCCTGGTATCTTCCCAACGTCCTAGCACCGAGATAAACGACGGCAAACAGTAGTCA
170 ACATTGTCGATGCCTGACAATTTATATGCTCTACTTTCCAGCGCTTATATCTGTCATCGG
171 GAATAATAGAAATATGTTCTCGATCAATTTTTAAGTTCCGATTTGTTCACCTTATTTGAT
172 GCTAAGGAGTATTTGATCAGTGTGTAAGGGTAGAAAGGCGCTTTAGGTAATAAGGAATAT
173 CTCAACCGTGTAAACGTCAAAATGCGAATTATTTAGTACAAAAAGTAGCGTTACGTATCT
174 TTCCCTGGGATACAACTCTGGCAATGGTATCGTGAACAGGGAGATGACGCCCAAACGTAC
175 CATCGCATAGTGGGTTCAAAAAGTGCGAGATGTGTTTCCCCCGAAATCGCTCCTATCTTC
176 CCAACCTTCTGCACCAGAAAATAACGGCACAAATAGTCCAACAGTGAGGATATCTGACAA
177 TTATGCACCCGACTTTCCAGGCTTGTCTGTAATCGGGTGTAATAGAAAATATGTTCCATC
178 AATTTTTAAGTTCCATTTGTTCACCTTATTTATGTAAGGAGTATTTGATCATGTATAAGC
179 TGAAAAACAGCTTTAGACAAGATACAGTATCTCAATTGTTGAACTTAAAAATTCGAAGAT
180 TATTAGTACAAAAGTAGCGTTACGTATCTTTCCCTGCAAATGTGGAACGCAAAATAAACA
181 CCTAGGTTCGCATGAGTTATATAATTTTTCACCAATGATTAATTTGTTTCTCAGGAAGAG
182 ATGTGCATCTCTCTTTGGTACTACGAATGAGTTCGATGCTGTATCTTTATTAAACATTCG
183 TAAGACTCGATTTTGTTCGGGAGATGTGCTGTCATTCGAGCATAAGTTGGTTTCTCATCT
184 TTAAAATATTTTACCATGATTGAATTATCAAGGACATGCCAACAACTGAACTGATCACTG
185 CTCTTTTGATAGATACCCGCTCTTATATAACTTCTCTAAACCGATCGCCGAGAAACGCCC
186 GTTTTTCTGGTGTATTTATCAACTCCTGCAACGTTCCTTTTGATGGCATGATTTTCATTA
187 AGGCGTAGGCTGACCCGACGGAATTAAGAGTCTCGCGCTTGGTGTGAATTTATTATTTTT
188 ACATGTACCCAGTTCTGTTTGCCAATAATACTACCGATGTCCTCGATTCGTGATACCATC
189 TCCACATGGCTTTATTATTTAAGACAGGAAACGCGGAAAAAATAGTACCCTTAGCGAAAA
190 TAGTAAAACAATCATGATGTTTTAGCTTGTATTTCGCAATCAGCTAACACCAAAAACTAA
191 CAAATATCATCAGCAAAAAGAACAAAACTCTTTCATTTTCTTATTCCTCTCGATGTTCGT
192 CTGTTTCATCTTAGCAAACTCTCACCACAAATCGATAGTATCCTGGCTGTTGCGCTCCAC
193 CATCGGGTTTATTGATGTCTTGGGAATAAATAGGGTTCTGCACAAGTACCATCCTGGTGG
194 TAATTGAGTTGTTGGCCAATTTGTCTGTGGCAGGTAATCACTTGCTGTCTTTGTATCCAT
195 CCCTGGATACTCGGGGAATCATCATCCTGTGGCGTACAAGTCAGATTTGGTTTTACCCAC
196 TTCCTGCAATACAGTGTAGTCGTAAGGGCTTAATGCTCTGAAGAATGTTTGAAAACATTA
197 GGCGAGGACTACTGGCGCTGGCTCAATAGGATATGGCAGTCTTAATTGTTTCGCGATGTC
198 CGGCAATTTACTTGGGATCGCGTAGGCGGTTTGTTGGGTCTCGCTCCATATCCGCCATTA
199 TTTAAGTGTCGCGCATTTTGATCCGCCAGTCCCATTGAATCTATATACTCGAACCGGATT
200 CAGCGGATACTGATAAAATTCCATCCCCCTTCAGCCCAATTCGATCGATCCTGAGTGATA
201 TACCTCCCCCCTGCAGCGGGTCATAATAGCGGTGGCGGTTGTAATACAGGCCGGACTCCT
202 CATCGACTACCATGCTGCTGCCCCGGCAGGCGGATCAGCTAAGCTGCAGCATGATGCGGG
203 TTCTCTTCATTCAGCAGGTTGCCCCATTCATCGTATTCTGCGCACCATTCTGTGCCGCCT
204 TCCGTGCTGACAAGCGCCAGCGGCAGGCCGCGCAGTGATCGCAGTGGTCACAGGTGGATT
205 TTCGCGCCGGCGTGTACACCGGGTCCATCTGGTTTTTGCATCTGCTCCACCGTCAGGCCG
206 CACCGATGCCAGCCAGCGGCGGCTTTCCTCACTCACCCGATGTCAGTCAGGATTTCACTT
207 TTCCAGCCGGTCGAGCATCTGCACCAGCACCGGCGGAACACCACACTGCCACCGTCTTCG
208 CCGCCGGACTGCTGAAGGGTATCCGCCAGAGCGCTGCGGCGCTGCGTTTTTCGCCAGCTC
209 ACCGGTGGCGGTTCGGACCCTGATGAGTGGCGTGAAGCTCCCCGGCTGATAAATCGTCTG
210 GATGCGGGTTCTGTCGTTCTGTATCGTGGTCAGGCGGTCGCCGTCCCAGCCGTACCAGGT
211 CACTTGCGGTTTCTCGTGACAGCGACATCCAGCCCGTCAGGTCCCGTTCACGTCGCCACA
212 CCCGTTTTGCCACCCTGCGGCCCAGCGGGTCGTAAAGATACGCGGCTTTCGACCAGCGGC
213 TCTGCATATTGTGTTGCTCGCGTGTAGTGCACCAGCCGGTGCTGACTGTCGTAATGGTAC
214 CGGTGGGTGCGCTCATCATCCGTGCGGATAACCCCTTCGCGCGGATGAGGTCGGTTTCTC
215 CGTCAGCCTGCCGTGACGGTCATACCCGGTAAAGATAGCGCGTCACGGGCGATACGGTTA
216 TCCGGCCACATGCTGCTGAGGGTGCTGTCCGGGTGCAGCGCTCCGGGTCGGGCAGGCGGT
217 TACCTGCCGGGTCTGTGGCATACGGGATATCAATGCCCAGAGTTACATATAATAATAAGA
218 GCAATTAACTTAATTTTATTTGTTTATAATGCGCTTACTTAATACAAACCATTGAATATA
219 CCCTCCTGACAGAAAATAAAGCGATATTATTATCGCCATAATATACTTACTATCAATCCT
220 TACGCCAATAATGTCTGATACAGTCCCTATAAATATTAGAGCAATAAAGAATACTATGCC
221 CTGTTGGAAAACATATTACCATCATTCCATAAGACATGAGACTAATTAACTCGCTCACAT
222 CACGCAAGTGGAGTCTAATAGTGAAAGTCTATGCATGGAAAAGAATAGTATTAAAAGCGA
223 TAAAGCCAGCCATATAGCTCTGAATAAAAAAATAATATTTCATTACATCACTCCGGTGAA
224 TACAAATCTAATAAAACGTCCAATGTTATTTTCCGGAGCACTTCATGCTTACATGTTTCT
225 AAAGAATCATTAGACCACGTCTTGGCAGTTTTTAAATCTAGCCCTAAATTTACTAGGTGT
226 GAATATATCAGGCAATACAGAATAACGCGGCCTTACCTCTTTAAACTTCCCTTTTACACA
227 GTTCTCCACACTACTATTATCGGTTTCAACGAGGTCACAACGGCCAGCAGCTTCTTTTTG
228 TATCATTACTTGCTTTACCTGGCCCCCATAGACCATCTCCTTTTGATTCTCCCCGTTGGT
229 CTTGGCCACCCAAGTATAGTCCCCTTTACCATCTGGGACACAAAGATATTGATGATAGAA
230 CGGATTCCCCCATATATCTGACCGCTTCTTTCACCAGTTCCGCCCATTGAATGCAGTGGC
231 TTAATGCATTTTTAGTGTTTCTAATCCTAATGGATCTATATTTGAGATCTGGATTCAACG
232 GATACTGATAAAAATTCCATCCCACGCTTTCAGCCCAATCCGGATCCTGAGTAGTATATC
233 GCCCCTGCAGCGGGTCATAATAGCGGTGGCGGTTGTAATACAGGCCGGACTCCTCATCAT
234 ACTGCTGCCCCGGCAGGCGGATAAGCTGCATGCAGCTGATGCGGGTTCTCTTCATTCAGC
235 AGGTTACCCCATTCATCGTATTCTGCGTACCACGCTGTTGTCGCTTCCGTGCTGATAAGC
236 GGCCAGCGGCAGGCCGCGATGGTCTGCAGTGGTACAGGTGAATTTTTCGCGCCGGCGTGT
237 ATACCGGGTCCATCTGGCTTTTGCATCTGCGCCACCGTCAGGCCGCACGATGCCAGCCAG
238 CGCGGCTTTCCTCACTCACCCGGTCAGCCAGGATTTCACTTTTCCAGCCGGTCGAGAGCA
239 TCTGCACCAGCACCGGCGGGAAACACCAGACTGCCACCGTCTTCGCCACCGGACTGCTGA
240 AGGGTATCCGCCAGGCTGCGGCGCTGCGTTTTTCGCCAGCTCACCGGTGGCGGTTTCAAC
241 CCTGATGAGTGGCGTGAAGCTCCCCGGCTGATAAAAATCGTCTGGATGCGGGTTCTGTCG
242 TTCTGTATCGTGGTCAGGCGGTCGCCGTCCCAGCCGTACCAGGTCACTTGCGGTTTCCGT
243 GACAGCGACATCCCGAGCCCGTCATTGGGTCCCGTTCACGCCGCCATACCCGTTTTTGCC
244 ACCCTGCGGCCCAGCGGGTCGTAAAGATAGCGACTTTCGACCAGCGGCTCTGCATATTGT
245 GTCCGCGTGTAGTGCACCAGCCGGTGCTGACTGTCGTAATGGTACCGGTGGGTGCGCTCA
246 TCATCCGTGCGGATAACCCCTTCCGGGATGAGGTCGGTTTTCTCTGTCAGCCTGCCGTGA
247 CGGTCATACCGGTAAAGATAGTGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTG
248 AGGCGCTGTGCGGGTGCAGCTCCGGGTCCGGGCAGGCGGTTACCTGCCGGGTCTGTGGTA
249 TACGGGATGCGGATATCCAGATTCGCTGCGGTGGTGTGAACGCCGGTCAGCCTGCCGGTG
250 GTGCTGTAGCTGTAACTCCGGGTCTGGCGCGGGCTGCTGATGCGCGATGAGTTCGCCGTT
251 GTCGTTACCAGGTGTAATCGCGGTCAGACAGCAGGCTGTTCAGGTGCTGGCTCTGTAACT
252 GCCCGGCAGGGGTATAAGCGGTGGTGAGTTCATAACGGCCGAAGCTGCGCAGCGTTTCCC
253 GGTGCAGGCGGTCGCGGGTGTACTCCACCAGCGGTGTGTCGCCCGAGTTTCATGCCTGAC
254 AGCCAGCCGCTGCCGTAGGTCAGCCATTCCACGGCGGGCAGGCTGTTCCGGTATACAGCG
255 GTTCGCCAGTCCCTGTGCGTTGTACGCATGTCTGGTCTCATGCTGCCAGAGCAGTTCATT
256 CGTCTGCGGATGATGCACCGTCAGGTGTTCACTGGCGAGGCGGCCTTTAGCTGTCATAAC
257 CATAGTGCACCGTCACCCGGTGCCCTTCGCTGATATGGCTGATGTCTGTCAGCCAGCCGC
258 GTTTCCGTCATACTGCCACCGCTCTGCGGTTTCGCCATTCACGGTGCGGTGCGTGAGGCG
259 GTCTGCTTCGTCATAGTGCCAGTGGGTGACCAGCCCCTCATCCTCGCTGCGGATAAGTTT
260 GCCGGTCAGGTCGTGGTGATAACGCTGTGTGCGGCCGTCAAAGCCGGTTTCCTGTATCAG
261 CCGGTCGAGTACATCGTAACGCGAAGGTGGTGTGGCTGCCGTTTTTCACTGGTCAGGCGG
262 ATGACCCGTCCGGCAGCATCGGTATTCCATACTGCGCGTCAGACGCCCTGCGTGGTACAG
263 ATGGCTTTTCCCCACGCATCGTACTGTGTCCCGTTTCTGCTGCCGTCCGGGGCAATGACG
264 GTGGTCAGGTCACCCGGCGGCGTTGTATTCATACCGCGTTTCATGGCCCTGCGTGTCTTT
265 CACGGCAATTAACTGTCCACGGCTGTCGTATGCGCGGTACTGACTCAGCCCTTCCTCGCG
266 GTGCACCGCCGTCACCTGACCAAAACGGTCACTGGTCATAGCGGGTTACATAACCGGAAC
267 AGTCAGTGAAGCTCAGCAACTGACCGTAACGGCTCCACGTCATGGTTTTCCGGCTGCCGG
268 TGGCATCTTTCCCGTTGCGCAGGGTAAGTCACTGTGTGGATTATCATAACGGTAGCGGGT
269 GATATCGCCGTCAGGGGCAGTTTCCTGAATCAGACGGCCCCATTCATCATATTCCCGGCG
270 TATTTCCAGCCCGTCAGGCCCGGTGGCTGACGTTAACTGGCTGTGGTGGTTATAGTAAAA
271 CGCCGATGCCCTGCCATCCGGCGTGGTGATGCGCGTGATGAGGCCCGTCACCACATCCGA
272 GACTCGTATTCTGTTGTCCTGCCTGCGGCATCCGTCTGTGCCCTGAGCCTGCCCACCGCG
273 TCAAACTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTCACCACCCGCTTCAGCC
274 CGCCTTCACCCTGCGTGTGCAGGACTTCACGGCGGTTCAGAGCTGTCGGTGATGGTGATG
275 CGGTCCTTCTCATACTGATACGTGTAACTTAAGCCTGCCGGGTTTAGCTGTTCTGTCACC
276 CGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGTGTGACGGTGCGCCACC
277 ATCCGGCCCCGGTATTTATCATCGTAAGTAAAGCTGCGCACCTGTGTATTGCTGCGGTCA
278 TACACGCCGCCAGTTCGCCGCGGGGCGTCGAGGCCCATAGCGCACCAGCGGCGCGGCAGG
279 TAAATTCTCCGGGTATTCCGGGTCGTGCGTCAGCCACACGGCAGACAGACGGATGCCGTT
280 GTAGCGAGCCATATTCGGTGTAACCCGGCAGGGTATCAGGAAAGACTGGACGGTTCCGTC
281 CCGCCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCAGTACC
282 AGCCGGAAGTGACGCCCGGCACCATCCCGTCACGCCGGTGATTTCGCCGCTGAATTCACC
283 GGCGGCTTCGCGGTGGAACGTCTGTGTGCGCCCGAAGCGGTCCACCCGAGCCCGGTCAGT
284 ACCCGGTACGGCGGCAGCGGCGCAGGCAGCACCTCATCCGCTTCCCGGCACCCGCTCACA
285 CCAGCCGAGCAGCCACCACGGCCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACT
286 TAAGCGGAGTTCTTCCGGCAGCGCCTGCCAGAGTGCGGCCAGCCGGTAGATCACTTCATC
287 CAGTTTCGCCACGCCGCCGCGCACCAGCCACAGTGACTCGCTGCGGCTGTAACCGTCCTC
288 ACCGGGAAACAGGTGCTCAAAATACAGGCTTCTGCCGCCGTTATCACTGAGTATCAGTGT
289 GTTATCGCGCAGCTGTAAGCGAGGATATCCGCAGGCATTTTCCAGCCGGGGCCGAGGCTC
290 CCCACCGGCGCGGGCTTTTGTCCGGTAACTGCTGTAGGTGCGGGAGAGAATGAACGGCAG
291 CGGGCCGGGCAGGGCGATGTCGGTTTCACCGGGAAGGACCTTTGCACCGAGCAGCGGACT
292 TGACCGGATGGCCGGACGTCACGCCCGCCGGCGCACGACGAACAGGCCACAGCCAGTCGG
293 GGGCAGCGAGTGCGTACCCCGGCTGAACCCTGGACAATGCTACCGCCATACTGCGTCATG
294 TCGCCCTGACGCGCCGCCCGATTTTCCGCTCATCTGCTCATCCTTGTTTTTATCGGGTTA
295 TTTGTCTGCTGACAGGCGAAACCCTACAGATTTATAAGAAAGCCTTAAGTGAGATATCTG
296 TCAGATAAGAACAATTAGGAAAATATTTATATATTTCATGAATATATGTTTCGATTGGTA
297 TAACGATGTCTAAATATTCCTCTGAACATCTTCCTGATACAAAAACCGCCAGCGTTTCCG
298 CTGGCGTTTTCTCAATGTGATTCAAAACTCAGCAATCAATAAAAATCACCAGTTGCCTTT
299 TCGGCCTGATCCATCACAGCACCGGTTTATCGCTGGTTTTCGACCAGACGCGATGCAGGT
300 AGCTGTAAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCAAGCGCCAGAAACGCC
301 CGCTGCAACCGCGCATAAGTACGGCGTAAAAAGATACAGCCATGCAGGATATTCTCTGTA
302 GAGTTCCATACTTTTCTCCCCCTTTTGTATCTACCCGGTGAATGGCACCGGAAAAATGAA
303 TTTGTTTATCTGATGAAAAAGTAGTACCGCCTTTTTGTGTAATTTTACTACTCATCCGAC
304 CACTTATTTGTGCTTATTGATGGTTTATTTACATTCATCCTGTACATTCAAGTTACACAA
305 AAGTTAAATTAATACTACAACATGTAGTTAAAATCATGGCTTTTGCCATTTTTATACTTT
306 TTACACCCCGCCCGCAGATTTTGCGAAATCTTTGCGCAGCCGAGAATTCTACGGCCTTCC
307 GGTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGCAGGCGTGCTAACCGGCGTATT
308 GCTGGTGTTTTTATTACTGGGTTATCTGGTTTATGCCCTGATCAATGCGGAGGCGTTCTG
309 ATGGCTCGCGCAAGGAGCTTCTTACTGATCGCCACGTTTTTACTGGTGTTAATGGTGCTG
310 GCGCGTCCTTTAGGCAGCGGGCTGAGCGCGGCTGATTAATGACATTCCTCTTCCCGGTAC
311 AACGGGCGTTGAGCGCGTACTTTTTCGCGGACTTGGCGTCTCTGACCGTGAGATGAACTG
312 GAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTT
313 ATGTTGCTCGGTTCACACTAGTCTGCCGCTGTAATCTGGACACCAGCAGTTGCCGAGGGC
314 TGTCGTGCGATGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCACCAATACCAACTGGC
315 AATCTTGTAGCGTGAAACCACGTTGAGCTACTTTTCAGCCAGATGGCGGGCTTAACGGTG
316 CAAAACTTTCTTTCTGCCGCCAGCGGGATTGCGGTGATTTTTGCCCTCATCCGTGCGTTT
317 ACCCGCCAGAGCATAGCAGCACGCTGCGGGAATGCCTGCGTACATCCTGCTACGCATCAC
318 GTTATGGGTGCTAGTCCCTCGTGGCGTTGTTGATTGCACGTTTGTATTCAACAAGGTGCG
319 CTGCAAAACTTTCTGCCTTATCAGGCTGTGAATAGCCGTTGAAGGCGCGCAACAGCTGTT
320 ACCCATGGGGCCTGTAGCTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGG
321 CTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCCCAACCGCACTGACCAACTTCG
322 TGCAGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGCCTTTGCCTTTGGTGAAGTGAT
323 GGGCGATCGCCGCCAGGGGCGCATGTTGCTGTGGGCGATGTCAGTGATTTGTCATCTGCG
324 TAGGCGTGGTGCGTGGTAAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGA
325 CAGCAGCATCAATATGGAAGGTAAAAGAGCCGTTTGCGTGCTGGTCAGTAGCCTGTTTCG
326 CGTCGTGACGGGCGGCTTCCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTACCGCTC
327 TGCGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGAAAGGGTGTTCGGCGGTGTCG
328 GTTCTGAGTCTTTACGCATGATGCTGTTTGTCCTGCTGGCGGTGTTTATTGCCGGGCTGA
329 TGATTGGTCGTACACCGGAATATCTGGGTACAAAATCGACGTACGCGAGATGAAACTGAC
330 TGCACTGGCAATTCTGGTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGAT
331 GACCGACGCCGGACGGTGAGCGCCATGCTCAACCCTGGCCCGCACTGGTTTTAGCGAAGT
332 GCTGTACGCCGGTGTCATACCCGCCGCTAACAACAACGGCAGCGCTTTGCCGGATCCCAG
333 CGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGGTTGCTTCGG
334 GTGATTATCCCGGTGATGGCAATTGCCGGTTCGCTGGTGAGAGCCAAGCCGCCAGCTCCG
335 GCACATGCTGCCAACGCACGGCCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTTGCT
336 GGTTGGCGCACTGACCTTTATCCCTGCCCTGGCGCTTGGTCCCGTGGCGGAATACCTCTC
337 CTGATGATATTGAGTGAGCACTGAATATGAGTCGTAAACAACTGGCGCTATTCGAACCAA
338 CACTTGTCGTTCAGGCAGCTGAAAGAAGCGGTGAAAATTAAACCCGCAGGGCGCAATGGC
339 GCAATCCGGTAGATGTTTATCGTCTGTATCGGCAGTCTGCTGACCACCTGTATTAGCATC
340 GCGATGGCAAGCGGTGCGCAGTGCCCGGCAATGCGCTGTTTAGCGCGGCCGTTGGCTGTG
341 GGTCTGCGATACTGTTAGCTAAGTTTGCCACCGCCGAGTGAGCGTGGCAGAAGGCCGCAG
342 TAAAGCGCAGGCCAACAGTCTGAAAAAGGGGTGACTGCCTTTGCCCGCAAGCTGCGTGAG
343 ACACGAGATATGGCGCTGCGGCGGACAAAGTTCCTTGCCGACCAACTTCGTAAAGGCGAT
344 ATCGTACTGGTAGAAGCTGGCGATATTATCCCCTGCGATGGTGAAGTTATTGAAGGGGGT
345 GCATCGGTCGATGAAAGCGCCAGCCCACCGAAACGGCAACCGTGTGTATCCGTGAATCGC
346 GGCGGCGATTTGCCGCGTCACCACGGCGGCACGTAGCGTGATTCTGGACGCGAGCTGCCC
347 GGTCATTGTAGCGGTATAGACGGCGAGACATGTCTGCATCGCGATCGACTCGCCGATGGT
348 GGAAGTGCGCAGCTGAGGGGACTGAGAACGAATCGCCCTGACCATTCTGGTGGTACATCG
349 CCCGTGACTATCGTCTTTGCTGGCAGCGCCACAGCGCGTGACGGTTTTCACGCTGTGCTG
350 CGCGCGGTACTGCTGCAGTCAGCGTAACGGGTCACTGGTGGCGCTGCTGGTCTGTCTGAG
351 CAACCACAGCAGATGCGCGGCCTGTTGTCATGTCCGGCGTCGCCGGGATGAGCCGGATGA
352 CTAGGCGCGAATGTGATTGCCACCAGCGGACGGGCAGATTCGAGAGCGGCACGGCAGGTG
353 ACGTTGACGGTCCTGCTACTGGATAAAGACCCGGGCACCATCACACTCGGTATAACCGTC
354 AGGCGTCGGAGTTTATCGCGCGCGCAGGCGTGGGATGAAAACAGCGCTGGCTCGACGCTC
355 GGATGACTGGCTTCGCTGAGCGGCGATCCGAAACGCCGGAAGGCCGCAGTATTGTGTGAT
356 CCTCGCCAAGCAGCGTTTTAACCTGCGCGAGCGCGATGTGCAGTCGCTGAGGTTGCCACC
357 TTTGTACCGTTTGATCTGCGCAAAGCCGGTCGAGCGCCGTAATCGACAACCTGACAACGA
358 TGATCGCGTAAAGGTTCTGTCGATGCCATTCGTCGCCATGTTGAGTAGACGCTATTTCAG
359 GTTCAAAGTCGATCCGATGCGCGTCAGGGAGCCACGCCGCTGGTGGTGGAAGGTTCTCGT
360 GTGCTGGGCGTTATCGTGATGAAAGATATCGTCAAAGGCGGTATTAAAGAGCGCTTCGCC
361 CAGCTGCGCAAAATGGAATTAAACGGTGATGATTACCGGCGATAACCGTCCTGACTGCCG
362 CCGCGATTGCGGGCGCGGAAGACCGGTGCGTCGATGATTTTCTCGCCGAAGCGACACCGG
363 AGGCCAAGCTGGCATTGATCCGTCAGTATCAGCGGCGGAAGGTCGTTTGGTAGCGATGAC
364 CGGCGACGGCACCAACGATGCTCCGGCTGGCGCAGGCAGATGTCGCGTGGCGATGAACTC
365 CGGCACCCAGGCGGCGAAAGAGGCGGTAATATGGTCGATCTCGACTCTAACCCGACCAAG
366 TCCGATTTCGAGGTGGTGCACATTGGCAAACAGATGCTGATGACCCGTGAGCTCGCTGAC
367 CACCTTCAGCATTGCCAACGGATGGCGAAGTACTTCGCGATTATTCGTATCGCGGCAACG
368 GTTACGCAAATGCGCTGAACATCATGTGCCTGCATTCGCCCGACTCGGAAGCAATCCTCA
369 TGCGGTGATTTTCGAACTCTACCCTGATTATCGTCTTTTGATTCCCCCGGGCGTTATAAA
370 CCGCTTAGGTTAACGAGGTTCTGCCATGTTGCGCCGGGTAACTTGGATTTACGGTCTGGG
371 TGGGCTGCTGCTGTTTTATCGCACCAAAGTCATTAAGGTGGTTCGAATCGTTTGCGGTCT
372 GGTGTGAGTTTACCATGAGTGGATTACGTTCATTATCAACATTTATCTTCTGTTATTGAT
373 TACTGGCGGCGTTTACCCGCTTCACGGTCACTGGGGCAATGGTGGTTTCCCTGGCAGGCC
374 AATGGTTTCGTTGATTCGTGAATGTAAGCGGCGGTTCGGCATTAATCGGCAGAATTTGTC
375 ACCGGCAACGGCTTTCATGGTCGCCCGTCGGCAACGGCAGAAATGCCCCGACCAGGTCCA
376 GCAACAGAAG