Mercurial > repos > bgruening > locarna_multiple
diff locarna_multiple.xml @ 0:008f5c13670e draft default tip
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/locarna commit 1d1d9aac8cb96d043be07f2e4059baa3b05c2afc
| author | bgruening |
|---|---|
| date | Wed, 28 Dec 2016 18:47:18 -0500 |
| parents | |
| children |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/locarna_multiple.xml Wed Dec 28 18:47:18 2016 -0500 @@ -0,0 +1,311 @@ +<tool id="locarna_multiple" name="LocARNA Multiple Aligner (mlocarna)" version="@VERSION@.0"> + <description> + Multiple Alignment and Folding of RNAs + </description> + + <macros> + <import>macros.xml</import> + </macros> + + <expand macro="requirements" /> + + <expand macro="stdio" /> + + <expand macro="version" /> + + <command><![CDATA[ + mlocarna + + '$input_data' + #if 'stockholm' in str($outputs).split(","): + --stockholm + #end if + + --tgtdir mlocarna_results + --width 60 + + ## -------------------- alignment mode and specific options + + #if str($alignment_mode.alignment_mode_selector) == "global_locarna" + $alignment_mode.free_endgaps + #else if str($alignment_mode.alignment_mode_selector) == "local_locarna" + --sequ-local on + #else if str($alignment_mode.alignment_mode_selector) == "probabilistic" + --probabilistic + $alignment_mode.consistency_transformation + + #if str($alignment_mode.iterate) == "true" + --iterate + --iterations $alignment_mode.iterations + #end if + #else if str($alignment_mode.alignment_mode_selector) == "sparse" + --sparse + #end if + + ## -------------------- scoring parameters + + --indel $Scoring.indel + --indel-opening $Scoring.indel_opening + --struct-weight $Scoring.struct_weight + --tau $Scoring.tau + + #if str($Scoring.sequence_score.sequence_score_selector) == "match" + --match $Scoring.sequence_score.match + --mismatch $Scoring.sequence_score.mismatch + #else if str($Scoring.sequence_score.sequence_score_selector) == "ribosum" + --use-ribosum true + #else if str($Scoring.sequence_score.sequence_score_selector) == "ribofit" + --ribofit true + #end if + + ## -------------------- folding parameters + + #if $Folding.plfold_span>=0 + --plfold-span $Folding.plfold_span + --plfold-winsize $Folding.plfold_winsize + #end if + + #if float($Folding.rnafold_temperature) != 37.0 + --rnafold-temperature $Folding.rnafold_temperature + #end if + + $Folding.alifold_consensus_dp + + ## -------------------- heuristic parameters + + -p $Heuristics.min_prob + --max-diff-am $Heuristics.max_diff_am + --max-diff $Heuristics.max_diff + --max-diff-at-am $Heuristics.max_diff_at_am + --max-bps-length-ratio $Heuristics.max_bps_length_ratio + + + ## -------------------- other parameters + + #if str($Constraint.bed_anchors.bed_anchors_selector) == "yes" + --anchor-constraints $Constraint.bed_anchors.bed_anchors_file + #end if + + $Constraint.lonely_pairs + + #if $Constraint.maxBPspan != -1 + --maxBPspan $Constraint.maxBPspan + #end if + + $Constraint.ignore_constraints + + $stdout_verbosity + + #if str($stdout_verbosity) != "--quiet": + > '$stdout' + #end if + + #if 'clustal_strict' in str($outputs).split(",") + && grep -v '^#' mlocarna_results/results/result.aln > mlocarna_results/results/result.strict-aln + #end if + + ]]></command> + + <inputs> + <conditional name="input_data_type"> + <param name="input_data_type_selector" type="select" label="Input type"> + <option value="fasta">Fasta input (strict)</option> + <option value="text">Fasta-like input with LocARNA constraints</option> + </param> + <when value="fasta"> + <param name="input_data" type="data" format="fasta" label="Sequence input" + help="Sequence input in pure fasta format" + /> + </when> + <when value="text"> + <param name="input_data" type="data" format="text" label="Sequence input" + help="Sequence input in fasta format with locarna-specific extensions" + /> + </when> + </conditional> + <conditional name="alignment_mode"> + <param name="alignment_mode_selector" type="select" label="Alignment mode" + help="Note that local alignment mode usually requires to turn off + the 'max-diff' heuristic (maximal difference for alignment traces)." + > + <option value="global_locarna">Global alignment + (LocARNA)</option> + <option value="local_locarna">Local alignment (LocARNA)</option> + <option value="probabilistic">Probabilistic alignment (LocARNA-P)</option> + <option value="sparse">Global alignment (SPARSE)</option> + </param> + <when value="global_locarna"> + <param name="free_endgaps" type="select" label="Free endgaps" + help="Specify whether gaps at the ends (all, 5', or 3' ends) + of the sequences should be penalized or allowed for free."> + <option value="">No free endgaps</option> + <option value="--free-endgaps">Free endgaps</option> + <option value="--free-endgaps-5">Free endgaps, only 5'</option> + <option value="--free-endgaps-3">Free endgaps, only 3'</option> + </param> + </when> + <when value="local_locarna"> + </when> + <when value="probabilistic"> + <param name="consistency_transformation" type="boolean" + truevalue="--consistency-transformation" falsevalue="" + checked="true" label="Consistency transformation" + help="--consistency-transformation" /> + <param name="iterate" type="boolean" + truevalue="true" falsevalue="false" + checked="false" label="Iterative refinement" + help="--iterate" /> + <param name="iterations" type="integer" + value="1" label="Number of refinement iterations" + help="--iterations num" /> + </when> + <when value="sparse" /> + </conditional> + + <param name="outputs" type="select" display="checkboxes" multiple="True" + label="Output options"> + <option value="clustal_strict" selected="True">Output alignment + in ClustalW format</option> + <option value="clustal" selected="False">Output alignment + in constraint-annotated ClustalW format</option> + <option value="stockholm" selected="False">Output + alignment in Stockholm format</option> + <option value="pp" selected="False">Output + alignment in LocARNA's PP 2.0 format</option> + <option value="mlocarna_results" selected="False"> + Output LocARNA results archive (tar.gz)</option> + </param> + + <param name="stdout_verbosity" type="select" label="Standard output verbosity"> + <option value="--quiet">Don't report standard + output</option> + <option value="">Non verbose</option> + <option value="--verbose">Verbose</option> + <option value="--moreverbose">More verbose</option> + </param> + + <section name="Scoring" title="Scoring parameters"> + <expand macro="common_scoring_parameters" /> + </section> + + <section name="Folding" title="RNA folding parameters"> + <expand macro="plfolding_parameters" /> + <expand macro="common_folding_parameters" /> + <expand macro="alifold_consensus_parameter" /> + </section> + + <section name="Heuristics" title="Heuristic parameters"> + <expand macro="common_heuristic_parameters" /> + </section> + + <section name="Constraint" title="Constraint parameters"> + <expand macro="bed_anchors" /> + <expand macro="constraints" /> + </section> + </inputs> + + <outputs> + <expand macro="common_outputs" /> + </outputs> + + <tests> + <test> + <param name="input_data" value="archaea.fa" /> + <param name="stdout_verbosity" value="" /> + <output name="stdout" file="archaea-default.stdout" /> + </test> + <test> + <param name="input_data" value="haca.snoRNA.fa" /> + <param name="stdout_verbosity" value="" /> + <output name="stdout" file="haca.snoRNA-default.stdout" /> + </test> + <test> + <param name="input_data" value="archaea.fa" /> + <param name="stdout_verbosity" value="" /> + <param name="outputs" value="clustal" /> + <param name="alignment_mode_selector" value="probabilistic" /> + <output name="clustal" file="archaea-probabilistic.aln" /> + </test> + </tests> + + <help><![CDATA[ **MLocARNA -- Multiple alignment of RNAs** + +MLocARNA is the (general, progressive) multiple RNA alignment tool of +the LocARNA suite. It supports several alignment modes and can be +adapted to specific needs by a broad range of parameters. Thus, there +are parameters for + +* *scoring* of the alignment, e.g. influencing the cost of + insertions/deletions and the weight of sequence vs. structure + similarity. + +* *RNA folding*, which control the secondary RNA structure prediciton. + +* *heuristics*, which trade alignment accuracy vs. computation + speed. The huge complexity of simultaneous alignment and folding + generally requires some heuristics for reasonable computation times. + Some alignment instances and alignment modes will require relaxation + of the default heuristics; in particular, local, constrained, and free end gap + alignment, will often require turning off the "maximal difference for + alignment traces" heuristic. + +* *constraints*, which can be applied to include prior knowledge to + improve the quality of results and/or speed of computation. + +Technically, mlocarna constructs multiple alignments progressively +based on pairwise alignments by locarna, locarna-p, or sparse, which +perform variants of simultaneous RNA folding and alignment. + +**Input.** +Sequences can be given in plain fasta format like:: + + >fruA + CCUCGAGGGGAACCCGAAAGGGACCCGAGAGG + >fdhA + CGCCACCCUGCGAACCCAAUAUAAAAUAAUACAAGGGAGCAGGUGGCG + >vhuU + AGCUCACAACCGAACCCAUUUGGGAGGUUGUGAGCU + +Morover, mlocarna supports structure constraints for folding and anchor +constraints for alignment. Both types of constraints can be specified +in extension of the standard fasta format via 'constraint +lines'. Fasta-ish input with constraints looks like this:: + + >A + GACCCUGGGAACAUUAACUACUCUCGUUGGUGAUAAGGAACA + ..((.(....xxxxxx...................))).xxx #S + ..........000000.......................111 #1 + ..........123456.......................123 #2 + >B + ACGGAGGGAAAGCAAGCCUUCUGCGACA + .(((....xxxxxx.......))).xxx #S + ........000000...........111 #1 + ........123456...........123 #2 + +The same anchor constraints (like by the lines tagged #1, #2) can +alternatively be specified in bed format by the entries:: + + A 10 16 first_box + B 8 14 first_box + A 39 42 ACA-box + B 25 28 ACA-box + +where anchor regions (boxes) have arbitrary but matching names +and contig/sequence names correspond to the sequence names +of the fasta(-like) input. + + +**Output.** + +The final alignment is reported in standard and/or variants of the +clustal and stockholm format. Moreover, an archive with final and +intermediary results of the mlocarna run can be returned. + + +For more information, see +.. __: http://www.bioinf.uni-freiburg.de/Software/LocARNA/ + ]]></help> + + <expand macro="citations" /> + +</tool>