diff test-data/related_mitogenome.fasta @ 0:f6065bc6e428 draft default tip

"planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
author bgruening
date Sat, 29 May 2021 12:50:32 +0000
parents
children
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/related_mitogenome.fasta	Sat May 29 12:50:32 2021 +0000
@@ -0,0 +1,222 @@
+>MW539688.1 Theretra latreillii lucasii mitochondrion, complete genome
+TTTGATTATTTTTAGTATATAAATTAATAGAATATTTATTCTTTCTTAAGTTTTCAAAACAAATGCTTTA
+ACAAGCTCATTAATTAATTAAAGATTAATTTATCTCAGTATTTACTTAAAATAGGGTTTAATAAGAAATA
+ACTAAAATATAAAATTGTTAAAATTTGTCCTGTAATAACATATGGGTTTTCTACAGGTCGAGCTCCAATT
+CAAGTTAATAAAATAATTATAATAATAAAAAATCAAAATAATAATTGATTTAATGGATAAAATTGTAATC
+CTTGGATTTTTTTGTTGAATGTAAAAGGTAAGATAATTAAAATTAAAATTGATATGACTAAAGCAATTAC
+TCCTCCTAATTTATTGGGAATTGATCGTAAAATTGCATAAGCAAATAAAAAATATCATTCAGGTTGAATG
+TGAATTGGAGTTACTAATGGGTTTGCAGGAATGAAATTATCAGGGTCTCCTAATAAATATGGATTAATTA
+AAGTTAATATAGTTAGTAAAAAAATTAAAATAATAAATCCGATTAAATCTTTGAAAGTAAAAAATGGGTG
+AAATGGGATTTTATCTAAATTTCTGTTAATTCCTAAGGGATTGTTAGATCCAGTTTGATGAAGAAATAAT
+AAATGAATTATAGTTAATATTAAAATAATAAATGGTAGTAGAAAATGGAAAGTATAAAAACGAGTTAATG
+TTGCATTATCTACTGCAAATCCTCCTCAGATTCAATTTACTAATATATTTCCTAAGTATGGAATTGCTGA
+TAATAAATTAGTAATAACTGTTGCCCCTCAAAATGATATTTGTCCTCAAGGTAATACATATCCTATAAAT
+GCTGTTGCTATTAATATAAATAAAATAATAACTCCTACTAATCATGTATATATTAAATTAAATGATTCAT
+AATAAATACCTCGTCCAATATGAATGTAAATACAAATAAAAAAAAATGATGCTCCATTTGCGTGAAGAGT
+TCGAATTATTCAGCCATAATTTACATTTCGACAAATGTAATTTACTCTGTAAAAAGCTATTTCAATATTA
+GCTGTATAATATATAGTTAAAAATAATCCTGTTAAAATTTGGATTATTAAACATAAAGCAAGGAGAGATC
+CAAAATTTCATCAAATTGAAATGTTTGATGGGGTGGGTAAATCAATTAGGGATCCATTAATAATTTTTAA
+AATTGGGTGAGTTTTTCGAATTGGTTTGAATATATTTATCATTAATTTCTAAAGATTCGTAATGGCCCAT
+AAAAAATATTAGTAATTTTAACAATTGCAATTAGTGTAATAAATAAATAAATAATTAATAGTAATATTAA
+TATTGAAAAATTATTATTATATAATTTATTTAAATTAATTTTATTTTCATTATTAAAAAATATAAAATTT
+AATAAGTTGTTTATTTCTGAGTTATTAATTAAATTTATTCAATTTAGATTTTTATAAAATAAAAATTGAA
+TTATAATTATTAAAATTAATAATGATATGAGAATAATTTTTATTTTATTTGATAAGGAAAATATTTCATT
+TGATGCAATACTTGAAACATAAATAAATAAAACTAATAATCCTCCTAAAAAAGTTAAAAAAAGAATATAA
+GAGAATCAATAGGTTTTAATTAATATTCCTGATAATAAACATGTTATTAATGTTTGAATTAAAATTAATA
+TTCCTATTGATAATGGGTGGTTTAAAAAATATATTATTATTGATATAAAAATAATGAGTATAGATAAATT
+TAATTTTATCATTTATAATCAAAAAATAGTTTATTAAAATAATAATTTTGGAGATTATAGATAAAGAATT
+TTCTTTTTTTTTGAGTTTTTAAAGATATTTCTTAATTTTGATTTACAAGACCAATGTTTTTTTTTAAACT
+ATAAAAACTAAATTAATGATAATTTTAAATATATGATTTATTTTTATTTTAATATTTTTTATTGGGAATT
+TGATTTTTGTTTCAAAAAATAAGCATTTATTAATTGTTTTATTAAGATTAGAATTTATTGTTTTAAGAAT
+TTTTTTTTTTTTTTTAGTATTTTTAATAATAATTGATTATGATATATATATATTAATGGTATTTTTAGTT
+TTTTCTGTTTGTGAAGGTTCATTAGGGTTATCTATTTTAGTTTCTATAATTCGAACTCATGGTAATGATT
+ATTTTCAAAGATTTAATTTAATTTAAAAATGATAAAAATTTTATTTTATATAATTTTTATAATTCCTTTA
+TGTTTTATAAAGAAAATATTTTGAATGGTTCAAATATTATTATTAATATTAATATTTATTTATATAAATT
+TATCAGTAAGTTTGATTAGTTGTAATTTAAGTTATATATATTCTTGTGATTTAATTTCTTTTGGGTTGAT
+TTTATTAAGAATTTGGATTTGTTCTTTGATAATTATATCTAGAGAAAATTTATTTAAAATAAATTATTAT
+GTTAATTTTTTTTTATTAAATATTATAATTTTAATAATTTTATTATTTTTAACTTTTAGAGTAATAAATT
+TATTCATATTTTATTTATTTTTTGAGGGTAGATTAATTCCTACATTGTTATTAATTATTGGGTGGGGGTA
+TCAACCTGAACGGATTCAAGCTGGAATATATTTAATATTTTATACTTTATTTGCTTCATTACCATTATTA
+ATAGGGTTATTTTATATTTATATAGAAATTAATAGAATAGTATTTTATTTTTTAAAATTTTTTAATATAA
+ATTTTATTTTATTATATATTAGAATAGTTTTAGCTTTTTTAGTAAAAATACCTATATATTTTGTTCATTT
+ATGGCTTCCTAAAGCTCATGTAGAAGCTCCTGTATCAGGGTCTATAATTTTAGCTGGGATTATATTAAAG
+TTAGGAGGTTATGGGTTATTGCGAGTTTTAATTTTTTTACAAGAAATTAATTTAAAATTAAATTATATGT
+GAATTATTATTAGATTATTGGGGGGTTTTTATATTAGTCTAAAATGTTTTTGTCAAGTAGATATTAAATC
+ATTAATTGCTTATTCTTCAGTTTCTCATATAAGAATTGTAATTAGAGGGATTATAGTAATAAATTATTGA
+GGATATTTTGGTGCATATATTATAATAATTGGTCATGGGTTATGTTCTTCAGGGATATTTTGTCTCGCTA
+ATATTAATTATGAACGATTACATAGACGAAGATTATTTATTAATAAGGGTATGATAAATTTTATACCTTC
+AATAAGATTGTGATGATTTTTATTAATGTCTTCAAATATATCAGCTCCTCCATCTTTAAATTTATTAGGG
+GAAATTAGTTTAATTAATAGAATAATAAGATGATCTTGAATATCAATAATAATATTAATATTAATTTCTT
+TTTTTAGAGCTGGGTATAGATTATATTTATATTCTTATATTCAACATGGTAAGATTTTTCAAGGGGTATA
+TAGATTTTATTGTGGTGTTTCTCGTGAATATTTATTATTATTATTACATTGATTACCTTTAAATATTATA
+ATTTTAAAAATTGAATATTTAATAATTTAATAAAATTTAAATAATTTAATTAAAATATTGATTTGTGGAA
+TCAAATATATGATATAGTATCATTTTAAATTATTAATAAAAATAATTTTTGTTTTTTTGTTTTTTTGTTT
+TTGTTTTTTTTTAGAATAATAAATTTATTTTTGATAATTTATTTTATTATAAATAATATTGTATTTTTTT
+TTGAGTGGGAAATTATTTCTTTTAATTCTGTGAGAGTTGTTATATCTATTTTATTAGATTGAATATCTTT
+AATATTTATGATGTTTGTTTTAATAATTTCTTCTGTTGTTATTTATTATAGAAAAAGTTATATAAGATCA
+GAGTTAAATTTATTTCGTTTTATTATTTTAGTTATATTATTTGTATTTTCTATAGTTTTATTAATTATTA
+GACCTAATATTATTAGAATTTTATTAGGTTGAGATGGTTTGGGGTTAGTTTCATATTGTTTAGTTATTTA
+TTATCAAAATTTAAAATCTTATAATGCTGGAATATTAACAGTTTTATCAAATCGAATTGGTGATGTAATA
+ATTTTAATAGTTATTTCTTGAATATTAAATTATGGGGGTTGAAATTATATTTTTTATTTAGATTTTATAT
+TAAATGATATATTAATGGAAATTATTAGATTAATAATTATTTTTGCTGCTATAACAAAAAGAGCTCAAAT
+TCCTTTTAGTTCTTGATTACCTGCAGCTATAGCTGCTCCTACTCCAGTATCTGCTTTAGTTCATTCTTCT
+ACTTTAGTGACTGCTGGGGTTTATTTATTAATTCGGTTTAATTTAATAATTTTAAATACTTTTTTTATTA
+AAATTTTATTGTTATTAGGTATAATGACTATGTTTATAGCTGGGATTTCTGCTAATTATGAGTTTGATTT
+AAAGAAAATTATTGCTTTATCTACTTTAAGACAATTAGGTTTAATAATAAGAATTTTAAGAATAGGTTTT
+CCTGATTTAGCATTTTTTCATTTGTTAACTCATGCTATATTTAAAGCTTTGTTATTTATATGTGCTGGGG
+TTATTATTCATATAATAAATGATATTCAAGATATTCGTTATATAGGGGGTATAAGAATATATTTACCTTT
+AACTTCATTATGTTTAAATATTTCTAATTTAGCTTTATGTGGGATTCCTTTTTTAGCTGGGTTTTATTCT
+AAGGATTTAATTTTAGAGATAGTAAGTTTTAGAAATTTAAATATATTTGTTTTTTTTTTTTATTATGTTT
+CTACTGGTTTAACTATATATTATACTATTCGTTTATTAATGTATTTAATAATTAATGATTATAATTTATT
+ATGTGTTTATAATTTATATGATGAGGATTATGTAATATTAAATAGAATATTTTTATTATTATTTATAAGA
+GTAATTAGAGGGAGTATGTTAAGATGATTTATTTTTTATTATCCATATATAATTTATTTACCTTATAATT
+TAAAAATAATAGTTATTTATGTAAGATTGTTTGGTGGTTTAATAGGGTTTTTAGTTAGAAATATAAATAT
+TTATAGATTAAATAAATTTTTAATATCTTATAGTTTAAGAAGATTTTTATGTTTAATGTGATTTATACCT
+AGTTTATCAACTTATGGTGTGAGATATTATTTTTTAAATTATGGTCAAAATTTATTAAAAATTGTAGATA
+TAGGTTGAAGAGAAATATATAGTGGTCAGGGAATAGTAAAAATTATTAAAAAATATTCTATTTTTTATAG
+AGTATTTCAAATAAATAATTTAAAAATTTATTTATTTAGATTTATTTTATGGATAATAATTTATATTTAT
+ATATTATTTATAAATATTTATTTAAATAGCTTATAATTAGAGTGTAATATTGAAGATATTAAGGAGATTG
+ATTTAATCTTTAAATATTTATAAAAAAAAGTTTTTTATTTTTACAATGAAAATGTAATGTTTTATTAATA
+AACTATATAAATATAAAAAAAAGAAATATTAATGGAATTAAACCACTAAAAATTAAGTTAGCAGCTTAAT
+TTTAATTATTATATTTCTTTAATTGGAATATAAAATTCAATTTTATCATTAACAGTGATATACCTCTATT
+TTGGTTTCAATTAAATAAATAAGGAGTAAAATAACTCTTATTTTTAAGTCGAAATTAAATGCAAAATTTT
+GCTTCTTATTTTAAGATAAATTAATAAAATTAATATTTTTTGATTGCAAATCAAATGTTTTAAATAAACT
+ATAATCCTAATTAGTTCAATTTAATATATTTTGGTTTCATTCATGATATAATCCTAATAATAAGATAATG
+ATAAAAAAAAATCTAATTTTTATTCATCTAAAAAAATTTACTATTTTAAAAGTAAAAATAATAGGAAAAA
+TTAAAGCAATTTCTACATCAAAGATTAAGAAGATTACTGTAATTAAAAAAAAATGTAATGAAAATGGGAT
+TCGTGCTGATGATTTAGGGTCAAATCCACATTCAAATGGTGAACATTTTTCTCGGTCTATAAAGGATTTT
+TTTGATAGAATAATTGATAAAAATATTATAATATTAGAAATTATAATGATTATAAGTGTAATAGTTAATG
+TTAAAGTAATTATTTATATTAAATTTGAATTAAACTTTTTGATTGGAAATCAAATATACTAAATATATTA
+TATAAATAATTAATTTCCTCATCAGTAAATTGAAATATATAGGAATAATCATACAACATCTACAAAGTGT
+CAGTATCAGGCTGCTGCTTCAAATCCGAAATGATGATTTCTTGAAAAATGTTTATTTAATTGTCGAATGA
+AACAAATAATTAAAAAAAGAGTTCCAATAATTACATGGAGACCATGAAATCCTGTTGCTATAAAAAATGT
+AGATCCGTAAATTCTATCAGAAATAGAGAATGGAGCTTCAATATATTCATATGCTTGTAAAATAGTGAAG
+TAAATTCCTAATGAAATTGTTAAAAATAAACTTTGAATAACTTGGGTATAATTATTTTCTATTAGTGAGT
+GATGAGCTCAAGTAACAGTTATTCCTGATCTAATTAAAATAATAGTATTTAATAGGGGAATTTGAAAAGG
+ATTAAATGGAAAAATTCTTATTGGTGGTCAAATAGCACCAATTTCAATATTTGGTGATAAGCTTCTATGA
+AAAAAAGCTCAAAAAAAAGAAATAAAAAATAAAATTTCTGAAACAATAAATAAAATTATACCTCATTGTA
+ATCCTTTAGTTACTAAAATTGTGTGTTTACCTTGAAATGTTCCTTCTCGACAAACATCTCGTCATCATTG
+ATAAAAAGTTAAAATTGTAATAATATATCCTAAAATTAATAGATTTATATTAAAGTTGTGAAATCATTTT
+ATTATTCCGGTTACTAATGTTAATACTCCAATTGATCCAGTTAAAGGTCAAGGGCTATAATCTACTAAAT
+GATATGGGTGATAGTTGAAATTATTTTTCATTAATTAACTTCTCTAGAATATAATGTTCTTAAAATAGCA
+ATTACATAAGATTGAATTACTGCTACTGCAGATTCTAAAATTAAAAGAAGAATTTGAATTAAAATTAAAA
+TTATAATAAAAATATAAGATAGATTATTTCCTGTTCTTCTTAGTAATGTTATTAATAGATGTCCTGCAAT
+TATATTAGCTGTTAATCGAACAGCTAAAGTTCCAGGACGAATAATATTACTAATAGTTTCAATTAATACT
+ATAAATGGTATTAATACTGTTGGTGTTCCTTGGGGGATTATATGTGAAAATATATGTTGATAATTATTAA
+TTCAACCATATAATATAAATCTTAATCATAAAGGTAATGATATTGATAATGTTAGAGTTAAGTGTCTTGT
+TCTAGTAAAAATATATGGAAATAATCCTAAAAAATTATTAAATAAAATAAAAGAGAATAAGGAAATAAAA
+ATAAAAGTTGATCCACTAAAATAGTTATTTTTTAATAAGGTTTTAAATTCATTGTGTAGTGTATTTAAAA
+TGAAGTTTCAAATTATATAATGTCGATTAGGGATTAATCAAAATGAATAAGGAATAAATATTAATCCTAA
+AAAAGTTCTAATTCAATTAATTGGTAAATTAAGTAGATTTGTTGAAGGGTCAAAAATTGAAAATAAGTTA
+CTTATCATTTTCAAATTAAATTATTTTTAGGTTTTATATTAATTATGTTATTTTTTATATTATTTGAATT
+ATAATAAATATAATAATTTATAATATTAAAAATAATAAAAATAATAATAAAAAAAATTAAAGATAGAATT
+CAATTAATAGGTATTATTTGAGGGATAAAAGAATATTACTTATGTAATAATTTAAATTTGACATATTTAT
+GTTATAAATTAACTAATTCTTTTCATTAGAAGTAGTTGCTAATTTACTATTAAGTGGTTTAAGAGACCAA
+TACTTGCTTTCAGTCATCTAATGAAGAATAATTATTAATTCAATTAATAAAATTTTTTATTGAAATTCTT
+TCGATAACAATTGGTATAAATCTATGATTTGCTCCACAAATTTCAGAACATTGTCCGTAATAAATTCCAG
+GACGATTAATAAAAAAATTAGTTTGATTTAATCGTCCAGGATTAGCATCTACTTTTACTCCTAGAGAAGG
+AATAGTTCATGAATGAATTACATCAGTTGCGGTTACTATAATTCGAATTTGATTATTTATTGGTAAAATA
+ATTCGATTATCAACATCTAATAGTCGAAAATTATTTGAATTTAGTTCATTTGAAGGGATTATATAAGAAT
+CAAATTCAATATTATGGAAATCTGAGTATTCATATCTTCAATACCATTGATGACCAATAGATTTTAGTGT
+AATTAATGGGTTATTTAATTCATCTAATAAATATAATAATCGTAGTGAAGGTAATGCAATAAAAATTAAT
+GTAATAGCAGGTAAGATAGTTCAAATTATTTCAATTATTTGACCTTCTAATAAAAATCGATTAATATATT
+TATTAAAAAATAAATTTAATATTAAATATCCTACTAAAATAGTAATTATAATTAAAATAATTAAAGTATG
+ATCGTGGAAAAAGATGATTTGTTCTATTAATGGTGATGTTCCATTTTGTAAATTTAAATTAGATCAGGTT
+GCCATTTCTAAAAAAAGGATAATCCTTTATAAATGGGGTTTAAATCCATTACATATAATCTGCCATATTA
+GAAATTTCTTAAAATTGGGAGTTCATTATAAGAATGTTCGGCAGGTGGAAGATTTTGGTATCATTCAATT
+GATGAAGGTATGTTTAATGGAAATAGTGCAATTCGTTGATAAATTATTGATTCTCAAATAATAATTAATA
+TTATTATTACAGCTAATAGTGAGATATAAGATCCTAAAGATGAAATTAAATTTCAAGAAGTGTAAGAATC
+TGGATAATCTGAATATCGTCGAGGTATACCTGCTAACCCTAAAAAATGTTGGGGAAAGAAAGTTAAATTT
+ACTCCTAAGAATATAATAAAAAATTGAATTTTTAATAAATAAGGGTTTAAAGATAGACCTGAAAATAAAG
+GATATCAGTGAATAAATCCTCCTATAATAGCAAATACAGCTCCTATAGATAAAACATAATGAAAATGTGC
+AACGACATAATAAGTATCATGTAAAGTAATATCAATTGATGAGTTAGCTAAAATAACTCCTGTTAATCCT
+CCAACAGTAAATAAAAATACAAATCCTAATCTTCATAAAATTGAAGGTCTGTAATTAATTTGAGTTCCGT
+GAAGAGTTGCTATTCAACTAAAAATTTTAATTCCTGTTGGAACGGCAATAATTATAGTTGCTGAAGTAAA
+GTAAGCTCGTGTATCAATATCTATTCCTACTGTAAATATATGATGAGCTCAAACAATAAATCCCAATAAA
+CCAATTGCTATTATAGCATAAATTATTCCTAAACATCCGAATGTTTCTTTTTTAGTTCTTTCTTGTGAAA
+TAATATGGGAAATTATACCAAATCCTGGTAAAATTAAAATATAAACTTCTGGATGACCGAAAAATCAAAA
+TAAATGTTGATATAAAATAGGGTCTCCTCCTCCAGCAGGATCAAAAAATGATGTATTAAGATTTCGGTCA
+GTTAATAATATTGTAATTGCTCCAGCTAATACTGGTAAAGATAGAAGTAATAAAAATGCTGTAATACCAA
+CAGCTCACACAAATAATGGTATTTGATCAAATGATAAACTATTAATTTTTATATTAATAATTGTGGTAAT
+AAAATTAATAGCTCCTATAATTGAGGAAATTCCAGCTAAGTGAAGAGAAAAAATAGCTAGATCTACTGAA
+CTTCCACTATGAGCAATATTAGAAGAAAGAGGGGGGTAAACTGTTCAACCAGTTCCTGCTCCGTTTTCAA
+CAATACTTCTAGAAATTAGAAGAGTTAAAGATGGGGGGAGAAGTCAAAATCTTATATTATTTATTCGTGG
+AAATGCTATATCAGGTGCTCCTAATATTAAAGGAACTAATCAATTACCAAATCCTCCAATTATGATTGGT
+ATTACTATAAAAAAAATTATAATAAATGCATGAGCTGTAACAATTGTATTATAAATTTGATCATCTCCAA
+TTAAAGATCCGGGGGTTCCTAATTCTGCTCGAATTAATAATCTTAATGAAGTTCCTACTATTCCTGCTCA
+AATTCCAAAAATAAAGTATAATGTTCCAATATCTTTATGATTTGTGGAGTAAAGTCATTTTCGCTTGAAA
+ATAAAATGGCTGAGTTAAAAGCGATAAATTGTAAATTTATTTACGAGAAATATTCTCTTTTATTAAGTCT
+TATATTCAATAATGATATAAAATTGCAAATTTTAAGGGGTAAATTATTTACTAAGGCTTAAAGAATATTT
+CTTTATATATAATTTTGAAGATTATTAGTTTATTTAACTTAAAACCTTATATAAATAAAAAAGTTCTAAA
+AATTATTCCTATAATGGAAATTATTGAAAAAAAATTAATTAAATTTATTAATTTATTTTTAAAATTAATT
+TTAAATCATTTTATTTTAAAGTAATTGAATATAAATGATGAATAAATAATTCGAATATAAAAATAAATAG
+TAATTAATCTTCTTATAATTATAATAAATGTTAAAAAATAAAATTTATTTATTATTAAAAAATTAATAAT
+AATTCATTTTGGTAAAAATCCTAAAAAAGGTGGTAATCCACCTAATGATAAGAAATTAATTAATAAATTT
+AATTTAATTATAAAATTTATATTATTAATAAATAGTTGATTAATGAAAAATATATTTAAATTGTAAAATA
+AAAAAAATATAATTCTAATTAAAAATGAGTATATTAAAAAATAAAATATTCATAAATTTTCTCTAATTAA
+TAAGGTAAAAATTATTCAACCTAAATTATTAATTGAGGAAAATGCTATTAGTTTTCGTAAAGAAGTTTGA
+TTTAATCCTCCAATAGCTCCGGTTATTACATTTATAATAATGATAAAATATAAAAAATTAAAATTTAAAT
+AATAAGAAAGTAAAATTAATGGGGTAATTTTTTGTCAAGTTATTAAAATAAAGTTATTAAATCATGATAA
+TCCTTCTGAAATATTAGGGAATCAAAAATGGAATGGGGTTGAACCTATTTTTATTAATAATGATGAATTG
+ATTATAATTGATATAAAATTATTTATTTCAAAATTTTTTATTAAAATTATTTTTAATAGAATTGAAAATA
+AAAAATTTATTGATGCAATAGATTGGGTAAGAAAATATTTTAATGAAGCTTCAGAAGCTAATAAATTATT
+TGAATTAGAAATTAGGGGGATAAAACTTAATAAATTAATTTCTAAACCAATTCAACACCCAAATCAAGAA
+TTTGAAGAAATTGAAATTATAGTTCTAAAAAATAAAATAAATAAAAAAAATATTTTATTTGAATTAAATA
+AATAATAAATATTAAATAATTACTATATAGTAATATCAAAAATTTAAAAAATTTTTATATTAAATTATAT
+TTTAGTGTATGATGCACAATAGTTTTTGATACTATTAGGTATAGTTTAATTCTATAAAATATAATAAAGG
+TAGAAAAACTACTTAATTTATCCTATCAGAATAATCCTTTAATCAGGCACTTTATTTTTAAAAAAAAGGG
+TTATCCTTTATATTTGAGGTATGAGCCCAAAAGCTTATTTTAGCTTATTTTTAATAATTTTTTTTTTTAT
+TTATATGAATTTTTTTTACAAATGGTCTAAAAAAATTTTAAATTAATTTTATTTATAATTAATTTATTTG
+TAAATATATGTATATTTATATATATATATATATGTATATTAAAAATTTAATTTATTAATCATTTTATAAT
+ATATTAATTTTTTAATTTATATATATATATATTAATATATTAAATTATTGTAAAAAAATAAATAATAATT
+ATATAAATTTAATATTATTTATTAAATTATAAAATTTTATATAGCAATTTTATATTTATATTTAATATTA
+TTTAGAGAGAGAGAGAAAATATAAATTGTTTAATAATTTATATTAATTATTTTAATTAATTAATATAATT
+AATATATATATTAATTATTTATATATAAAAAAAAAAAAAAAAAAAATTCTATGTGAAAAATTTTACATAT
+AAATAAATTTTTTATGGTTTATAAATTTTATTTTAAATTTATTTTACATGTAAATTTTAGTGTTATATAT
+TAATTATTTAAATAATATTTAATTTTAATGCAGTAATTAATTTTAAAAATTTAAGAAATTAAGATTTAGT
+AATATTTAAATTAATAACTAATTTTGTGCCAGCAGTTGCGGTTATACAAAAATTAATTTAAAATTTTTTA
+GTAATTAATAAGTAATGTTAATTAATAATTTAAATAAGAAATTATTAGGTGAAATTTTAATTTTTTAAAA
+ATTATTTATATATTATGATTTAATAAATTTTGTAAAAAACTAGGATTAGATACCCTATTATTAAAAATTA
+AATTTTTAATACTAAAATAGTAAATAATTTATTGAAACTTAAATAATTTGGCGGTATTTTAGTTTATTTA
+GAGGAATCTGTTTAATAATTGATAATCCACGAATAAATTTACTTAATTTAAAATTTTGTATATCGTTGTT
+AAAAAAATATTTTATAATAATAATAATATTTAAAAATTTTTATATAAAATGAAATCAGATCAAGATGCAG
+ATTATAATTAAGAATATAATGGATTACAATAAATTTATTTAAATTGGATTTTAATATGAAAAGATTAAAT
+GAAATTGGATTTAAATGTAATTTTATAAAATTTTATAAAATGATTAATAATTAAAATATGTACATATTGC
+CCGTCGCTTTCATTTATAAATTGGAATAAGTCGTAACAAAGTAGAGGTACTGGAAAGTGTTTCTAGAAAG
+ATCAAATTAGAGCTTGAATAAAGTATTTCATTTACATTGAAAAGATATTATATAAATTAATTAATTTGGG
+GGGTAAAATTAATAATTTATATTTAATAAAAGAAATTTTAATATTAGAAATATTTAATGGGGGTTAAAGT
+ATTTTTAATTGAAAAAATTTAAAATTTTATAGTGAATTAGTATTGTGAAAGAATTTTGAAATAATAATTT
+AAATAATAATTAATTTGAAAGTAAATTTTATTTATTGTATCTTGTGTATCAGAGTTTATTAAAAATTTTT
+TATTTATATAAATTTCTCGAATTTAAAAGAGTTAATTAATTAAAAATTTTATTGTTTCATAAATATTTTA
+AATAATTAATTAGAAATGAAATGTTAATCGTTTTTAAATATATCTAGTTATTTTAGAAAAAAATTTAATT
+TTTAATTTAAATTTAAAATTAATTAATTAATTAATTAATTTTAAATTTAAATTTAATATTTTAAGGGATA
+AGCTTTAATTTAAATTTTTATAATAATTATTTTTAAATTTTTGAAAATTTTATAATTTATATTGTTAATA
+AATTTTAATTTATTATAAATAATTTCAATAAAATTAAAAATTTAATTAAAATTTAATTTTTTATAAAAAA
+ATTTTTTTTTATTATATAAAATTAATTATAATGATAAAATTAGTATATATATATATGTTATGTAATATAA
+ATAATTATTTAATTGATTAATAAAATAAATTATAATTATAAAAAAGTTATTTTAAAGGAATTCGACAAAA
+AGTTATATTCACCTGTTTATCAAAAACATGTCTTTTTGATTAATAATTTAAAGTCTAATCTGCCCACTGA
+TTTAATAATTGAAGGGCTGCAGTATATTGACTGTACAAAGGTAGCATAATCATTAGTCTCTTAATTGGTG
+ACTTGTATGAAAGATTGGATGAAATATAGATTGTCTCTAAAATATTTAATAGAAATTAATTTTTTAATTA
+AAAAGTTAAAATAAATTAAAAAGACGAGAAGACCCTATAGAGTTTTATAATTAATTAATTTTTAAATTTT
+TAATTAATGGTTTATTTTAAAAATTAATAATTATTTTATTGGGGTGATAAAAAAATAAATTAAACTTTTT
+TTAATTAAAAACATAAATAAGTGGTTAATTGATCCAATATTTTTGATTAAAAGAAAAAATTACCTTAGGG
+ATAACAGCGTTATTTTTTTTTTTAGCTCAAATAAGAAAAAAAGTTTGCGACCTCGATGTTGGATTAAGAT
+AAAATTTAAATGCAGAAGTTTAAAATTTTGATCTGTTCGATCATTAAAATCTTACATGATCTGAGTTCAA
+ACCGGTGTAAGCCAGGTTGGTTTCTATCTTTTAAATATTTTTATATTTTAGTACGAAAGGATTAAATATT
+ATAATTAAATTAAATTAAGTTGAATTTTATTAATTTAATTAATAAATTTAACTATTTTGGCAGAGAAATG
+TAATGATTTTAGAAGTCATCAACGTATAATTAATTATATATATAGTAAATGATAGTAATTGATTTTTTAA
+TAATTTTAGTTGGTTTTTTAATTTTAGTTTTAGGGGTTTTGATTGGGGTTGCTTATTTAACTTTATTAGA
+GCGAAAAGTTTTAGGTTATATTCAAATTCGAAAAGGTCCTAATAAAGTTGGTTTAATTGGGATTTTTCAA
+CCATTTTCTGATGCAATTAAGTTATTTACTAAAGAAACTACTTATCCTAATTTTTCTAATTATTATTGTT
+ATTATTTTTCTCCTGTTGTTAGATTTGTTTTATCTTTAATTATTTGGGTATTAATTCCTTATTATTTTAA
+CTTAATTAGATTTAGTTTAGGATTAATATTTTTTCTTTGTTGTACTAGAATAGGGGTTTATACAGTTATG
+ATTGCTGGTTGATCTTCAAATTCTAATTATGCATTACTTGGGGGGTTACGAGCTGTTGCTCAAACAATTT
+CTTATGAAGTTAGAATGGCTTTAATTTTATTATCTAGAATTATTATAATTATAGATTTCAATTTATTAAG
+TTTTTTTTATTATCAGAAAATAATTTGAATAATGTTTATGATAATTCCATTATCATTAATATGAGTTTCA
+TCAATATTAGCTGAAACTAATCGTACTCCTTTTGATTTTGCTGAAGGTGAAAGAGAATTGGTTTCAGGAT
+TTAATATTGAATATAGAAGTGGGGGATTTGCTTTGATTTTTTTAGCTGAATATTCTAGAATTTTATTTAT
+AAGAATTTTATTTATTATTATTTATATAGGGGGTTATGATTTAAGAGTAATTTTTTATTTAAAATTAAGA
+TTAATTTCTTTTTTATTTATTTGAGTTCGGGGTACTTTACCTCGTTATCGATATGATAAATTAATATATT
+TAGCTTGAAAAAGATATTTACCAGTTTCATTAAATTTTTTATTATTTTTTTTAGGGTTAAAAATTTTTTT
+TTAATTTGATTATTTTTAGTATAT
+