annotate test-data/sample_overlaps.sam @ 8:e100a765370e draft default tip

planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit 3ff7b4745ccf85b6cf5a5c64625f9bde6f582b0f
author bgruening
date Wed, 19 Oct 2022 16:12:55 +0000
parents 51fd3136069d
children
Ignore whitespace changes - Everywhere: Within whitespace: At end of lines:
rev   line source
0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
1 @PG ID:minimap2 PN:minimap2 VN:2.1.1-r369-dirty CL:minimap2 -Qax map-ont sample_layout.fasta sample_reads.fastq
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
2 @SQ SN:utg000001l LN:47564
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
3 1 0 utg000001l 29076 60 28S21M1D12M1D15M1I16M3D3M2I10M1D2M3D7M2I2M4I4M1I21M1D6M1D15M2I27M1I15M1D23M1I5M1I2M7I7M3D1M2D5M1I6M6D4M1D9M1I4M2D4M1I1M1I4M1I38M5I2M3D10M1D9M1D3M1I7M5D29M1D2M3I8M4I4M1D2M6D10M4I1M1D16M3D2M6I5M2D2M1I5M4D28M1D13M1D9M2D5M2I8M1I3M3I21M1D4M1D7M2D4M2D9M4I4M1D30M2I3M1I5M2D3M1D10M1I7M2D7M1I12M1D2M1D14M1I6M1D5M1D3M3I7M1D5M1I3M1D3M1D8M2D7M1I24M1D6M3I14M1D13M3D13M2I6M2D5M3I16M1D5M2I11M1I2M1D1M1D4M1D3M1D2M1I18M1D12M1D40M1D6M1D2M2D5M1I6M3D3M1D6M2I1M1D7M2D3M3D11M2I3M1I18M2I6M2D4M1D8M4D6M1D3M1D5M1I9M2I37M1I3M1D1M1D3M2D4M2I25M1I10M1D1M2I18M2I5M1I6M1D6M1D18M2I2M1D1M2D1M1D6M1D6M1I36M1D2M1D9M1I33M1I18M1I17M2I2M1I2M1I5M1D5M1I2M3I3M2I1M2I5M1D2M2D3M1D2M1D4M7I19M1D8M2I20M1I10M1D9M1D3M1D2M1I31M1D8M2I3M2D5M1D6M2I1M1I10M1I7M3I2M1D20M3D20M1I2M2I4M1I4M2I7M1I17M1I15M2D1M1D21M1D20M2I3M1D8M1D3M2D15M1I5M2I5M1D7M1I10M3D32M1I20M2I20M38S * 0 0 AGGTAGCCTGTTTTATGAGTGGGGATTACAAAGGATGGTCATCGGTCACGTGACAGTACGGGTACCTGACGGCCGTCACACTGCTTTCACGCTGGCTAGGAAAAGCCGGCCCGCCTTTGTAGGGCCAATGTCCCCGACGATTTTCCGCCCTCAGCGTACCGTTTATCGTACAGTTTCAGCTATCGTCACATTACTGAGCGTCCCGGGGTTCGCATTCACACTGCCACACTGATATCCGCATTTTAGCGGTCATTTCAGTTTGCTGTGTCAGGGAAAGCGGAGGATTGCGCAGGCCTGTAGTAAGCGTGAGCGTCAGGCGGTGCTTCAGGAACACTTCTTCGTTCGCTGAATATCTGGTTGCCCTGCGCCAAACGACCGGCGTTCATTCCCGTTTGCCGTATAATAAATGCATCCCACGATTGGCGGCATGATCCAGAAACTGGGCTCAGTTTGCCTTCCTCCGTGTCCTCCATGCTCAGCGGACCCGCGACATAATGTTTGCCGTCTTTATTCTGCTCAATTTGACGACGCCCGGGCATTCACACTTATCGACTGGCGGCATCCTTCCACTCTGTTCGAAACCCTCCAGTGCTTAGTTATCCTCCGTCATAGCCGGACTTTTCCAGCAGCTCCTGCCGAGGTATGAGGATTGCTTCTTGCCTTTGGAAAATCGAGGTAACCTTCCGCATCATGCCGCCCGACCGACGGCCTCCACGAATGCCGATTTGCCAACGTGTTCCACTGCGAGATAAACATAATCGCTGGCCCGGTTTGATATTGATACTGCGGCTATCCAGTACAGCGCCGTACCAAGATAACGCGTGCTGGTTTCAATGGCTGTCTGATATCCGCAATCTGCTTTTCAGGGGACCAGAACTCAAACTGTACCGTCCGTATAAACGGCAAGATGCGGCGTGGCGGTTATCTGAAGACCCCGGCGTCAGCTCAATCCTCGACGGTGCTGCAGCAATCAGAACGGAATACCATAAGGACCCGCTTAATCGCGCGCCCGCATTTACCGCCCGGTGACTGTCGACCTGTAGTTCCCCAGCGCCAGTGCGTGAAGCGGTATGTGGTTTCCGTCGTCCGCTGCCGTGCTGACCAGCCGCTCACTGCCGTCGTCGTCCGTTACGGTCACGGCCAGCAGGAAACTCACGCCGGTCCCTAGGCTTCGGTGTGTCCCATCGCGCCAGCACCTGATATTCCATGTTGTAGCAGTACTTCTGCGGTCAGGTGCAGTGAGGGGCGGGCGGGATCACCATTCACCGTGCCACTCTGTTCGCCGTTACACTGCACCCGTTATCCACGATGGCCTCTTTTCCGGCACATGCTGCACGCGGGGCGATGGCATACGTGCCGTCGTCGTTCTCACGGATACTCACGCAGCGGAACAGTCACCTCTGGCTGGCGCAGCGAGCGGTTCGGCAAGCTTCAGCTCCCATACGGTGGGTCAGCAACACCGTCAGGAACACGGCTCACTTTACCTTCAGCCGTCGGTGACGACTGAACCTCCACGCTGACCGGATTGCCATTTCCGTCAACCCGAGGGATGACGGGGTCAAGGAGGATGGCAGCGTGATTCAATCCGTCGAGCGTCAGCGTCCGGTATTGGCTGTTCACACAGGCACACGACCACCGGTTAACTGATACCGGCATCATAGTCATCATGGCGCAGATTTCAATAACATCGCCCGGTACCATGGGGCAACGGATTCTGCGCCGACGGTATGAAATCCACGTCCGTTTCCAGCAGTTCTTGTTTTAATCATAGCCACATGCCCGGCGCGGTGCCTGCCCCGGCTGGTACAGCCAAAGGCATCCATCTTCGTAACATTACGACCTGTAACGGGCAATGGCCTGCGTATCTTCAACAAGCTCTGTCGCCGTCTCGAGTAGATAC * tp:A:P cm:i:20 s1:i:190 s2:i:0 NM:i:485 ms:i:968 AS:i:968 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
4 2 0 utg000001l 26590 60 49S4M1I21M1D7M2D3M1I25M1I12M2I7M1D6M4D3M1I3M1D3M2I11M1D4M2I12M8I1M2I5M2I8M2I4M1I1M4I27M1I19M2I5M3I17M1I1M2I11M1I1M2D8M11I5M1D15M2D10M2D9M3I1M1I3M1D3M1I6M1I26M2I7M1I15M1I23M3D6M6I9M1I12M1I2M1I3M2I16M2D4M2I13M1I9M1D30M2I16M1D3M1D14M8D15M1D7M1D12M1I7M9I2M2D7M1I15M6I2M1D32M1I6M1D5M1D7M1I1M1I32M1D10M1I6M1I21M1D8M1D2M1I4M2I9M2D3M5D11M3I5M1D10M3I7M2D3M1D2M1D3M1D11M3D10M3I2M1I3M3I2M2I11M1D7M2I7M3I12M1I4M1I4M4I5M3I38M5I3M7I7M3D4M2I11M3D26M4D7M2I11M1D1M1D14M2I9M3I24M3D11M1D41M2I12M1I23M4I3M1D15M2I2M1D9M2D3M1I2M2D15M1I6M2D8M1I12M3D7M2D13M3I9M6D5M1I16M4I46M4D11M2I6M1I10M2I21M1I28M1I2M1I6M3D1M1D11M2I5M1D3M1D19M1I8M2D6M1D10M1I5M1D3M1I12M3I6M2I37M1D6M1I38M3I15M1I24M2I10M1D28M1D11M2I3M2D7M6I5M1I17M1I5M1D11M2I22M2D9M1D1M1D8M3I3M2I8M2D1M2D18M1I6M2I9M5I23M6I15M1D13M1I13M1I23M2D4M2D15M2D7M1I11M1I20M2D3M1D5M1D10M1I6M1D10M1D14M1I16M1I4M1D2M1I5M1D9M1D28M1I9M2I8M2I11M3I8M1I26M1D4M2I5M2I3M1I5M1D5M3I4M1I5M3D5M1I12M1I10M2I8M2I14M2D14M5I6M1D3M1D7M2D3M2I4M1I13M1D6M1D8M2D2M1I29M1D14M2I3M2D30M2I4M1D4M1I6M1I14M2I2M2D9M2I3M1I7M1I1M1I45M1I2M1D7M2I3M1I3M1D14M2I16M2D13M3I2M1D8M1I9M1I21M1D6M1D15M1I27M2I15M1D9M2D12M1I5M1I2M2I7M2D2M1D5M1I4M4D3M2D1M1D14M4I10M2I15M3D10M3D14M4I11M1D9M1D11M4D11M2I3M2D24M6D1M2D4M2I9M3I2M1D16M3D2M2I3M1I1M1I7M1D5M1I21M1I8M1D7M1I12M2D2M2D5M2I4M1I4M1I21M1D6M3I10M1D4M1D11M6I3M1D8M1I15M1I31M1I8M2D6M1I30M1I6M1D5M1D20M1I2M1I10M1D12M1D26M3I14M1D4M2D7M3D25M4I18M3D2M2I11M1I2M1D1M1D3M1I8M1I7M1I11M2I13M2I39M1D14M1D30M1D3M1I16M1I3M1I3M1I15M3I6M2D13M4D3M4D13M1I5M1I5M1D1M1D6M5I1M4I1M1D4M3I13M1D1M1D21M1D5M1I3M2I4M4D12M1D19M2I18M1D16M3I9M1I6M2D21M2D19M1D12M1I35M2I4M1I7M1D2M2I2M1I17M2I2M1I2M1I5M1D5M1I5M1D4M1D5M2I1M1I11M1D6M1D3M1D15M2I5M2I15M1I20M1I4M2I3M3I18M2I12M2D27M2I1M5I8M1I4M3I7M1I13M1D1M2D4M2I4M2I9M3I4M6I2M2I3M1D6M1I9M1I15M4D3M1I3M1D6M2D1M1D10M1I4M1I3M5D3M1I4M1D5M4I46M2D17M2I3M5I10M1I25M1I19M1I23M2I5M4I11M2D4M1D2M1D4M1D11M1D2M1D6M1I11M2I11M3D11M2D10M2D7M2D1M2D8M1I3M2D22M1D25M3I8M2I19M1I9M2D6M4I10M1D3M1I3M1I3M2I35M1I28M2D3M1D8M9I6M3D4M1D34M4I5M1D9M1I11M1I1M1I4M1D11M1I5M2I9M1D5M2I12M1I13M1D9M1I13M1I7M1I11M1I5M3D6M2D7M1I16M1D10M1D3M1D7M3D24M1I16M1I3M2D1M1I9M2I12M1I8M1I14M1I5M1I1M3D1M1D2M1D6M1D5M1D13M5I4M1I8M6I8M3I8M2D9M2D28M1D8M2I7M4I9M1D3M1I4M5D2M1D5M2D2M1I12M4D4M1I1M1I8M2D4M1D1M2D22M2D7M1D12M1D33M1I7M2D2M1I6M1I18M1D3M2D17M1I36M1I5M1I6M1D10M1I7M1D3M1I2M3I10M1I4M1I20M1D1M3I14M1I10M1D2M2D9M2D1M1D15M4I1M1I6M2I6M2I3M1D10M1D6M1D18M1I1M2D13M1D6M1I5M4D3M1I6M3D5M3I53M1I5M1I2M1I7M1D5M4I6M4I5M2I21M1I4M1D8M1I5M3D9M1I3M6I2M1I5M2D16M1I27M1I5M1D21M1I14M1D2M1D5M2D12M1D4M1D8M1D6M2I6M2D15M1I37M1D3M1I9M1I17M1D2M1D10M3I7M2D19M2I2M2I7M1I13M1I10M2D2M3I18M1I2M1D6M1D33M2D11M1I4M1D19M1D7M1D4M1I19M10I15M1I5M2I11M2I2M1D3M1D1M3D7M1I8M2D19M1I17M1D27M1I2M1I4M1D1M1D2M1I3M2D8M1D3M2I2M4I6M2I28M1D16M3I1M1D11M1I2M2I3M1D6M3I3M1I5M1I2M1D3M1D22M1I15M1I7M1I1M2I22M1D8M1I14M4I22M1D26M1I4M2I6M3I30M2D10M1I16M1D11M1D1M2I18M1D37M2I15M1I2M2D9M1I4M1I8M3I2M1I3M3I6M1I6M2D28M1I16M4D6M1I3M2D6M1D24M1D29M2D6M1D1M2I10M2I6M37I5M1D10M1D5M2D35M1I1M2D2M1I8M1I4M1I8M1I15M3D5M1I13M1I2M1I5M4D5M1I1M2D6M1I5M1D1M2I9M5I15M2D6M1D2M2D8M1I2M3I3M1D8M2I3M7I6M2D11M1D7M1I1M2D1M2D4M1I4M1I4M1D15M3I13M1D1M1D1M2D11M1I3M1D1M1D3M1D6M1D11M1I8M1I5M3D7M2D6M2D7M1I1M1I13M1I2M1I13M1D6M1D8M2I4M1I7M3D1M2D4M1I5M2D2M1D23M1D2M1I2M1I11M1D6M1I11M3I10M1I1M1I3M3I15M6D5M4I7M8I4M4I6M1I2M3D5M1I16M2D9M1D5M1D4M1D10M3I12M1D14M1D4M2I10M3I4M1I9M1D6M3I6M1D22M1D24M2I7M1I7M1I2M1I23M1I8M1D10M2I2M2I2M1D12M1D5M1D15M1I10M1D7M1I22M5I9M1D7M1D6M1I34M2D11M3D20M2I3M2D1M1I6M2I12M1I4M1I1M1I10M3I3M1I3M1I4M1I7M2I1M1D6M1D12M3D5M1I6M1D13M2D4M1I2M1I1M2I22M1D13M2D7M1D3M1D4M1D30M1I4M1I7M1D6M1I3M3I3M4I2M1D5M1D5M1I10M2D4M4D28M1I5M1I3M1I4M1D19M1I3M4I1M2I9M2D9M2D11M1I23M1I10M2D12M1D11M3D6M1I10M1D7M2D13M2D22M2D9M1I4M2I6M1I11M2I29M1D48M1D4M1D20M2D12M1I12M2I2M1I4M1D3M3D1M1D2M1D12M2I1M1I2M1I1M1I7M4I4M1D4M1I9M1I8M2D11M1I1M1I3M1I6M1I8M2I2M1D30M8S * 0 0 ATCTTGATAGAGATTTCTAGGGGTATGCGTTAATGATCAGAAGCTCCCAATCAGGTTCAGTCAGGCTGGCGGCATCATTTCCGGCAAAATACGGTAATTATTTTCGCCGTGTAGAAAGCCCTGCCACATAGGCTAGAGTCGCAAGCTTCTTCGGTTGTTTACCCGCAAGCGTTAGTCATGGTGGTGGTAGCCAAAATCTGGATCATTCTCCCGAGCGCTGCGGCCAGTTCATTCAGCGTATTCAGTTGCGTCAGGTGACGCGTCGATAACATCTGCTGCAATCGCGGCCAGTACAAAAGCGGTTTCGCAATCTGGGTTTGTTTGTTCCTTGACATCCGGTTGGTGCTGTTGGCGTTCCGGTCAGTGCCGGACTGTTGAGGTTGGCTTTTTCTGTTCGTTTCATCCATTACCACCTTAACCGCCTTTGGCGTTGCAGCAAGCGTTTCAGACGTGCTGTTGGTTGCACTGCTGAGCTGCTATCCGGATTTCTCGTTGTCCGCATCCTCAAGCGCGACAGCTGAAGCTATATCTTCTGCACGTTTTGCCGAATTTGCACGTATTGCCGCCGCTTCTGCCGCGCTCGCATTTGCTCTGCGATGCTGATACCGCACTTCCCGCAGCCTCCCTTCCCTTCGTGATGCCGTTGACGGCACTCCCCGCCGCCGCTGTTTGCGTCGTGCCCCGGCAGGATGAGGGGCGCGTTCCATGCTGTTTCAGATGACCTGGCATTGCGTCTCGGACGTTTTGCCTCACTGGCAGAATTTCTGCCGCCGTTGCCGAGGAAGCTGCACGACTCGGCACTTGATGATGCGTTCGTTTCTGATGATTTTGTGCCTCTTGTTGTACCGGGCATCTCGTGCTGAAGGAGTGGGGGCCTCTGACGCTTTCGTGGCCATGCGGAGGCAGAATTGGCTGATCTTTTAGTCGACTTTGGCTTAGCAGCATTCGTTTCTGTAACGTTTTCGCCGCACCGGCACTGGGCCGCCCGCGTTTTGAGAGAACTCTGCGGCTGCGGCACTTTTCCGCTTCAGTGGCCTTGCTGATGCCGCCTCTTCTGCCGCTACGGGCAGCTTCCTGAGCTGACGGATGCAGCCTGTCCGGCGGACGTGCTGTGGCGGCGCGTCGGGTCAGTTGCATCAGAGTCACAAGCTAGGCCGCGACCTGAGCAGCTGATGCACTGGCATCGCCGGCTGATTTCTTCGCGTCTGCCGTACTCTGTGCCACCACGAAGACGCGTTACGCTGGGAGCTCTTCCACCATGAGTTCGACGAAGCGACGCAGCACCTCCATGGATGGCATCATCCTCGCGTCATGGCACACAGAGAAACCTTCAGCGTCCCCGGTTGTGAATCTTCATACGGTGATGGTCCCGGCGTGCGATGGAAAACCCGTCAACCTGCAGGATATCTGACACTGTACTGACCGTACTCCACATCCATGCTGTAACGCCCGGCTTCATCCGGATTCTCTGAGCCCACCGTGTTTGCCCCACCACCGTGGTGCTGTTAATGTCTGGCTTTCAGCTGAATGGTGCAGTTCTTGACTAGTTTTCCTGTGCCTATCTTTCAGACTCCTGAAATCTTTACTGCCATATTCACCGCAAAAGCCCACCGGTTCCGGCGGGCTGTCATAACACTGTGTTACGCCTGGCTAATCAGAATTTATAACCGACCCCAACGATGAATCCGTTTAGATCGCCAGTCGCCACTGCCGGCCCAGCCTTCATAGACAGCAAGATAATGAACGGACGGACGCTGCCGGATTAATCTGTATACCTGCACTCCACGCCAACCAGGTATGCCGCATTGCATTTCGTCCCTGGCAGTGGTCGTCTCTTATCTTTCAATACCCGGGAGTGATTTCCGTCTTACGGTAATGCGGCTTGTACTGCCGGATAAGCGACTGTGAGCCACTCCATGGCTGAGAAGCCGCACTGATTTACTGATTTGTAAAACCGGTCCGGCCATCACGCCCTAACTAACGTCCACGCAGGCTCTCATAGTGAAGAAACGTATCCTCCCCGGTCATCACTGTGCTTGCTCTTTTCGACGGTGGGGACCCCAGGGAAGCCATCCCCCACTGTCCGTCAGCTCAACGGTACTTCACGTTAATGCCTTTCAGATGACTCACATCTATCCCGCCGACAACGACGGCAATGATCGGTTTCATTGAAAATAGCCCACCGTAAACGTACCATGTCCACGCGTCGCACGGCCGGAGTACTGTCACCGCAAGTGCGGCAAAGACAGCAACGGCAATACACACATTACTCGCATCGTTCACCTCCTCACTGTTTTATAATAAACGCCCGTTCCCGGACGACCCTCTGTAACACTCAGACCACGCTTTCGTTTCACAGCGCCTGTTTCTTAATCACCTAAGACCTGCACGCATCGCTGGCAAACGTATACGGCGGAATATCTGCCGAATGCGTTGCCGTGACCTTAAGCGTGAACGTCAGGATCACGTTTCCCCGAACCATGCATGTCAACAATACGGGAGAACACCTGTACCGCCTCGTTCGCCGCCATGAGCTAATCACGCACCGTTCATCAGTACTTTCAGATAACACATGAATACGTTGTCCCTGCCGCTGACAGCTTACCCTTATTTCACTATGAAACGTCAGGGAACGAAGCACCACTATCTGGCGATCAAAGGATGGTCATCGGTCTACGTGACAGGTTCCTAGATAGCTGACGGCCGTCAACCCTGCTTTCACGCTGGCCGGAAAAGCCCTAGCCGCCCCGCTCTTTACAATGTCCCCGACGATTTTCCGCCCTCAGCGTACCGTTTATCGTACAGTTCAGCTATCGTCACATTACTGAGCGTCCCCGGAGTTCGCATTCACACTGCCACTGATATCCGCATTTTAGCGGTCAGCTTTCGTAGCGTCCGTGTTAGGAAAGGCCACCGAGGATTGCCGCCGTAATGGTGGGGCCGTCAGGCGCTTCAGGAACACGTCGTTCATAGTGAATATCTGGTTGCCCTGCGCCAAACATCGGCGTTTCATTCCCGTTGCCGGGTCAATAAATGCGATACGATTGGCGGCAACCAGAAACTGGCTGAGTTTGCCTTCCTCCGTGTCCTCCATGCTGAGGCCAATACCCGAGACATAATGTTTGCCGTCCTTTGGTCTGCTCAATTTTGACAGCCACGGGCATTCCCACTGTATCAACTGGCATCCTTCCACTCTTTCGAAAACTCCTCCTCCAGTTGCTGGCGTTATCCTCCGTTACATAGCTCGACTTTTTCCAGCAGCTCCTTGCCGAGATGGGATTCGGTTATCTTGCCTTTGGAAAATCCAGGTAACCTTCCGCATCATCGCTCGCCCGACCGACGGCCTCCACGAATGCCGATTCAACGGTGTTCACACTGCCGGATATAAATAATAATCATGGCCGGTTTGATATTGATACTGGCGGCTATCCAGTACAGCGCCGTACCAATAACGCGTGCTGGTTTCAACCTGTCTGATATCCGCAGCAATCTGCTTTCCCGAACCAGAACTCAAACTGTACCGTCCGGGTCATAAACGGCACAGATGCGGCGTGGGGGCGGTTATCTGGAAAATAGCCCGGCGTCAGCTCAATCCTCGACGGTGCTGCCCCTTGCGGCAATCCGGAACCATGATACCGACGCCGTACGCCCTGCTGCCCCCACGCATTTACCGCCCGTCAACTGTCAGCCTGTAGTTCCCCCAGCGCCAGTTGCGTGAAGCGTATCTTATGCGTCTTTCAGCGCCGTCGACCAGTAATTCATGGCCTCAAGCCTGCCGTCGTCCGTTACCACGTCAGACGGAGCAGGAACTCGACGGTCCCTCACCGTCCTTGTCCCATCGCGCCAGCAGCTGATATTCCCGCTGTCTGCAGTACTTCTGCGGTCAGGTGAGGCTGCAGCGCCGGGCGGCGTGACACCATTCACCGTGCCTCTGTTCGCCGTCAAAGTGCGCCCCGTTATCCACGATGGCCTCTTTTCCGGCACATGCTGCACGGCGGTGAAGATGGCATCGTCTGCCGTCGTCGTTCTCACGGATACTCACGCAGCGGAACAGTCGCAGCGTAGGCAGCGTCGGCAGCTTCTCAGCTCCAGGGCCGTATTCAGCAACACCGTTGAAGGAACACGGCTCATTTTACCTTCACGCCGTCGGTGAGACGGTGACTCTGACCCTCCACGCTGACCCTAGATTGCCACTTCGTCAACCAGGCTTATCAGCGCGGTACATCGGAGAGGATGGCAGCGTGAGCATTTCACGGTCGAGCGTCAGCTAGGCTTCGGGTCTGGCTGTTCTCACCCCATGGATCAAGGCTACCGCGTGTGCTGATACCGGCATAGTCATCATCGCAAGATTCAATAACATCGCCCGCTTAATGGCGAAGCCCTTCTGCGCCGGCCGACGCTGAAATCCCACGGTCTGCGTTTCCAGCAGTTCTGTTTAATCAGCCACAGCCCGGCCGGTGTTCTTGGTGCGCCTGCCCCCGGCTGGTACAGCCAAAGGCATCCATCTTCGTAACATTACGACCGTAACGGGCAATGGCCTGCGTATCTTCGACAACAGCTCTGTCGCCGTCTCCCAGCCGTTGTTCGGGTCAATCCAGTTCACCTCAAACCGGCATTATGGCGGTCCTTCAGGGCGCTGAAGCTGTAGCGGAACGGCGCGCCATCATCCGGCATCACCACATTATGCGGTTATAGGTCCACGTCTTATCCCACGACGGTCCTGTTGCTGCACGAACGTCAGTCGTATGCCCGTTCCATACCGGCATACAGCGCAGGCGCCGAGCAGAAATCGCTGAGCACATCCACGCCTTACGCTCTGTGTCAGGTGAGCATTACAGGTGATGCGCGGCTCCGTGCAGCCAAAGCAAACCGTCCGGCACTGACTGGTCGCAGTACTGGCCGATGACATACAGCGCCCAGCTTTATCCCACATCCGCAGCATCACAGACGTTTCCCCATGCCCGTAGCGCGGATGGGTCAGGCATATCCACAGACACCCAGGCCATGTTGTGCTGTATGCCCGGTTAAACGTTCCGTCCCAGATCTCGCTGTATTGCCGCGTCTTGGATTATAAGTCGGACGGCACCTGGCAGAATACGCCGGCAGATGATTACGGCTCACCTGCGGCTGGCTGCCGAACTGCTCCGAGTCCACCTGCACGCCGACCAGTGCCGTGTTCGGGAGCACTGTTTCACATCGATGATTTCAGTGTATGACGACCAGCGTTTGTTCTGCAGCACTGGTCGTGTGGTGCTGTCCGGCGTCATCCTTTACGGTGCGCGTGCATCCGTACTTAAACGGGCGCTATGCGGCGTGTACCAGGCTCCACCACCGAGGCCAGATACTGCAGGTAGGTCGCCTTAATGGTGATGTCTTTTCCGTCACCCAGCCACCGTTACGTTGTATCTAAACCAGCAGGCGACTTCCGACGGATTCCTGTCACCCTTTGAGGTGGTTTCCACCAGTGCCTGTACACCCGACTAAAGCGCGACGGTCGATGTTTGCAGACGTAATGGTGCGGGTACTGCGGGCGTCATATTTCACTTCCGTACCCAGCACCGTCTCGGAGCCGGGAGGATCAAATCCCTCCGGCGGAGTCGTGGGACTCCTGCTCACCCAGCCCCGGAACACCAAGGGTGACACCGGATATGTTGGTATTCCCCTCAGTGTCCAGCACCGGCGTACTGTTCAGCAACGGACCCTTTTAAGCCCATCCACCGGACTTCAATCGGCCTTCGCTGATGGCATCGATCACACTCAGCAACTGCGTGGACTTCAAGGTTTTCGCTTCGCGCGGGGTATCCCCTTACTGCTTCCTTTACCCATTCCTCACGCTCCATAAATGACAAAACCGCCCGCAGGCGGTTGCGCATAAAACATTTTGCATCCCTCATCTAGACCAATCACACAACCTGACCACCGTCCCTTCGTCCTGCCCCGATTTCCGTGACGACTGGAGATCCACGATTACCCTAGCGCATTTCCCGTACAGAACAGGCAGAACATTGCGGCCTGGCAACCATGTTATCCAGTGAGGAGAAATAGGTGTTGCTTACCGTATCCGTTGTCTGTACGGGGGTTCCCTTTCGGTGCCTCAGCATCTGCGCCACACCACCGAGCACCATACTGGCACCGAGAGAAAGAGCATGCCGGTCATACCACCGGCTCCAATGGGTGCCCCATGCTGCAAGGGTGGCTCCGGCGGTAAAGAATGATCCGGCAATGGGCGGCAGCCCCCAGGACAATCTGGAATACGCCAGCCCTGACTTGGCCCCGGCGACTCTGGGAACAATATGAATTACAGCGCCATCAGGCAGAGTCTCATGTAACTGCGCCGTTAACCCGGACGTGCCTGACGTCCCGCCCGGCAATCCGTACCTGATACCAGCCGTCGCTCAGTTCTGACGAAACGCCGGGAGCTGTGTGGCCAGTGCCCATCAAGCTTCAGCCCCCGTTTTCACGAAGGTCGATGCGGCGACCAAATCGTTGTAAATCCCGTAAAGGCAGATGCGCGCCATGCCGCGAATGATAGAGGAGTGTGCGTCGCTGCAGGATTTGTCGTCGCTTACCTCTCGTTTGCTCAGTTGTTCAGGAATATGGTGCAGCATAGCCGCCGTCGCCGCAGTAAATTGCGGCGTGATTCCGGCACTGATGAACCAACAGCACAGCAGCACATCGCCCGGCTGTGCCGTGGACAACGCACCTGATACAGCCCCGTCGCCTCCAGATTATCCAGATAGAGATTCTCTGGCCGTTACGCCACCAGTCATCCTCACGATGAAAGTCCGGCATCTCAATCCCGCCAGATATGATAAGCAGCATCCCGGAACAGTGTGTGACAGTCCGTCACCGTGCTCAAAAGCGCCGCCCGGTGGATGCGGCACAAGGGAACTTATGAATCGTCCTCCCCGGCAGACCAGCCACCACGGCAAATCACTCTGCACCTGCAGCCGCCGGTCGAGCCACTCAGCCAGAGGCAGACCACCCGGGGTGGCTGGTCGAGACCAGCGCCAATCTCATCCTGCATTTCTGCCTGCAGCCCAGTCTTCCGGCGACATACGGAAATACGCCTCCGGCTCACCGGAGATATTCACGCAGGGAAATATTTCCGCTCCCGGCGTGAGTCACGAATGACGCACGACTCCGCTGGCGCACATCGCCGGGCGTGCGGCCAGAATCATGATTCTGTCGTCTTGTCATGGGATTTACTGCGAAAGTTTGTTAATGGAAAGGAAACCGCCAAAGTTGCCGACGTTATTGCTAAGAACTTACAACCGCTCAGGCATTTGCTGCATTTATCCTTCGTGATATCGGACGTTGTATGGTCATATTCACGGTGACAGCCGAAGACGACCGCTATACCGCACTCGTCACCGCGATAGTAGTCCAGGTGCAGGTGTTGGCCAGCATGATACGTCCCGGAAAAACAGCGCCATCCGTTTCCGTCGGCGTGACAGTACAAAGGAGGCACTCACCGCGCTCAGTTCGCTGCACTGCTCAATGCGCCAGCGGCTGATCACCTCCTGCTCCGGATCGGCGTAACTGTTTCCGTTGTATAGACGAAGTTCACCGCATCCAGAGAACGGGCGTAAACCTAATCGCCGGACCACCCGTTCCGCCGACCAGACTCTGCATATCTTCCGCCATCCCGGTGACCATACCGTACAGGTTAGAAACCCGTCAAGCGTGGGGCGCGTGATTAGCCTGGGTCCTTTGCCATTCAGTTCAAAACCGCTCCCGCGTAGAATGGGATACGGCTGATATATACTGTCGCCCCCTGCCAGGGACCGGCTCAGCTTTTCGTTCTGCTCATTACCCGATAAATAACGTTCTCCACCGACCTCTGTCAGGTCGATTTCCCGAGAGCACCACGCTGGCCGACTGCTCCGCACGGGTGCATTCATTCAGTGTTTCCTGCCGGATATCCTGCATCAGTTCACGCCTGTTCAAACTCTGCCTACAACTCAACACGCAGCATACTGACCCCGGGACATAATAGGGTTCACAGGTCACCTTTATCTGCCGCCCTCATAAGGCGGCGTCCACAGAAAGATTTCCAGCCCCCGTGCTCTTCCAGAAACGACCCACTCCAGTACCGTGGCCTCCTCACGGGGGACAGAAGGCGTCACGCTGTACGTTCAGGTTGGCATTCAGCCGGCAGGCGCTCGCTGAGAATAGCCATCACCAAAGCGCACCCTTTCGTACAGAGACGGGACCGAAGCCACATCCATAAGGTATCTCATTTGCTTTCCATGGAAGGTCTTCATCGTCCACCTCCGGAGAACAGGCCACCATCACGCAATCTGTGTCTGAATTTCATCACGGCATCCTTGCGGTAAGTCAACACGCGCCTTCAGAGCAGCCGTACTATCTGCCCGTTCCGTGCCGTCGTTGTTAATCACATGCTGGTTATTCTGCTCAACGTCCCGGACGCCTGCGACCGGCTGTCTGCCATGCTGCCCGGTGTACCCAACATAACCGCCGGTGGCATAGCGCCGCATCAAGCCGGTGAAGAAATTCCCCGCCAATCCGGCTCGTTGCCTCCCTTCGTGAAGACAAACTCACCACGTGAACAATCCGCTGGCTCGTTTGCCGCCGGTTCCCGTAAATCCTCCGGTCCAAAATGGAATTTCGCCCGCAGCGGCCTGAATGGCTGTACCGCCTGACGCGGATGCGCCGCTCAGACCACAGCCCGCCAATGGCGCTGCCGATACTCCCGACAATCCCACCATTGCCTGCTTAAGCAGAATTTCTGTCATCATGGACAGCACGGAACGGTGAAGCTGCGCCAGTTCTGCTGCACTGCCGTCTACAGCATCGCCGCCAGATTCTGTGCAATACCATCAAAGGTCTGCGTGGCTGCACCTTTTTACTGCGACATACTGTCCCGTGGCGCTCTTCCCACTGCTATTCCCAGCCGGACTTCAGGCCTGCCATCCAGTTCCCGCGAAGCTGGTCTTCAAGTCGTTA * tp:A:P cm:i:149 s1:i:1466 s2:i:0 NM:i:2202 ms:i:5494 AS:i:5511 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
5 3 0 utg000001l 18263 60 366S719M1I3M1I19M1I1M1I4M3D9M2D2M2D30M1D6M2D3M1D1M3D6M2I9M1I5M1D6M2I6M1I23M1D2M2D5M1D5M1I10M1I6M1D4M1I18M4D6M1D8M2D2M1I5M1I5M3D10M2D4M5D7M1I1M2D2M1D5M1I2M2D8M3D10M2D15M1D10M2I1M1I5M1D9M4D9M7D5M2I4M4D3M1D6M1D1M1D7M2D2M4D5M1D30M3I2M2I8M1D3M3D8M1D3M2D5M1D1M1D3M1I1M2I13M2I11M2D14M1D2M1I11M1I4M1D3M2D9M1D7M2D16M1D10M1I6M1D18M5D1M1D5M3D7M1D2M1I3M2D5M3D4M2I11M2I4M1I12M1D1M1D1M1D6M1D1M1D17M2I1M1D5M1I3M2I1M3I5M1D3M1I10M1D3M1D7M1I1M1I8M2I4M6I1M2I12M1I5M1D3M2D10M9D4M1I9M3D8M3I12M6D2M8D4M6D23M1I14M1I12M2D20M1I7M2D2M2I1M1I7M4I13M1I3M1I9M3D10M1D4M2D9M1I1M2I9M2I5M1I3M1I16M1I1M1I4M1D1M6D9M1D11M1I6M6I9M5D2M1D4M2I4M2D16M2D6M5D11M9D3M2D5M4I13M3I3M1I1M1I4M2D4M1I10M2I21M1I23M1D25M1I17M2D13M1D9M1D1M3D10M2D12M1D5M1I15M4D21M1I7M1D2M2D1M1D3M1D1M1D6M1D12M2D1M1D6M1I23M2I5M1D11M3I1M2I11M1D2M1D7M1D14M4D4M1D7M1D1M2I7M3D6M2D2M1D5M1D2M1D3M2I5M1D5M1I4M2D9M7I29M9D7M1D27M2I5M1D4M1I13M1I5M1D2M2I2M3I7M4D6M2D2M2I3M3I3M1I4M1I5M1I6M1D10M1D5M3I5M2I3M2I4M3I4M1D2M3I5M2D2M1I3M3D5M1D4M1I10M4D3M2D21M2I36M2D10M3D19M2I2M2I4M1I4M1D3M1D3M4D17M1I15M1I6M5D7M3D5M2I23M2I13M3D9M1D6M3D3M1D2M1D5M1D3M1I1M1I13M1D3M1D2M1D43M2D2M1D28M3D3M2D8M4D29M2I27M1D13M1I1M2D8M5D15M4D3M9D6M2I5M1D2M2D2M1I7M2D4M3D18M1D11M1D3M1D12M3D4M1I4M3D5M2D3M1I3M1I2M1I4M1I2M1D2M1D3M2D12M1I8M1D34M1D12M2D10M2I11M1D10M3I19M1I5M1D3M2D6M10D6M5D2M3D3M3D2M5D7M2I4M2D10M1D2M4D4M6D12M3I2M2I9M2I7M1D15M3D3M5D11M6D15M1D5M1I4M2I3M1D6M1I10M2D2M3D1M1D3M2I3M2I9M3I3M1I12M1D11M2D79M1I10M2D3M1D5M2D2M3D11M1D12M3D16M2D9M1D11M3D9M1D4M1I13M1I9M1I13M2D3M4D2M1D4M5D10M2D12M1D11M1D6M5D3M1D3M1D7M3I10M2D1M1D5M2I14M1D3M2D6M1D4M1D10M1D9M3D1M1D1M1D7M4D10M1I16M5D7M3D3M2D14M1D10M1D1M1D8M1I7M1D1M1D3M1D13M2D4M1D8M2D8M3D1M2D9M2D2M1I3M1I6M1D2M3D3M1D4M2I7M1I12M4D3M22D28M1D10M1D14M2D3M1I3M1D10M5I5M1I9M5I8M2I9M1I3M1D7M1D2M1D9M2D8M2D3M2D13M1D15M1D3M2I10M1I2M2D3M2D12M2D6M1I7M2I18M1D7M2D6M3D1M1D11M4D19M1D1M2D4M1I5M1I5M2D5M1I7M2D7M1I7M1D2M1D5M2D5M2D10M3D2M1D7M1D7M1D1M1D4M2D8M3D3M3D6M4I4M3I5M1I16M1D13M1I3M3D2M1D2M2D13M2D25M1D6M1D3M3I7M1I5M2D2M1I3M1I6M2I20M1I8M1I7M1I1M2I6M2I4M1D4M1D6M1D18M1D6M1D10M1I4M2D6M3D2M2D3M6I3M3I3M1I8M2D4M7I1M1I2M3I9M2I12M2I5M1D14M1D7M3I14M2I3M8I32M1I3M5I6M2I6M1I17M3I5M1D12M1D5M1I21M2D2M8D13M2I1M2I8M2I1M1I6M1D7M4D6M5D5M2D6M3D3M1I5M1D4M4D19M1D16M1I24M5I1M1I8M1D3M1I9M1D6M2D2M5D12M4I4M1D1M1D2M3I6M2I3M4I20M4D20M2D3M1I7M1I2M2I2M1I5M8D7M1D7M2I19M2I2M2D1M2D7M3I7M3D4M4D3M2D4M1I18M1D3M2D3M1D4M1I7M1D7M1I1M1I13M1D3M1D13M1I25M3I7M4I7M1D12M5D3M2D2M1D10M1D6M2D6M2I4M1I16M2D1M1I7M1D4M1I11M2D5M1I6M3D23M2D6M1D32M3I22M1D8M2I3M1D9M1I8M1D1M1D11M1D1M2D4M1I8M1I2M1I2M1I1M1I12M2I3M1I7M1D3M1D24M5I1M1D5M2I2M1D5M1D29M2I1M2I11M9D6M1D30M3I6M2D7M1I9M1D2M2D3M3D6M4D4M1D7M5D2M1I2M1D7M3D1M1I3M1D27M4I8M1I6M1D19M1I18M2I2M1I7M9I12M3D17M1D2M1D3M2D3M1I4M1D4M4D11M1D7M1I4M2D28M2D4M4D13M2D1M1D4M1I52M2I18M1I6M5I7M1D10M4D5M2I12M1D8M1D4M1I1M1I4M2D9M1D12M3D4M1D10M1I1M2D5M5D2M2D2M2D2M1D3M2D9M1D6M5D17M1D10M2D5M2D4M1I3M1I3M2I9M1D3M1D5M1I6M2I2M1I4M1D11M2I5M1I6M2I1M1D4M1D9M2I12M1I5M2D4M2D5M1D6M3D1M1D19M1I12M3I1M3I8M2D4M2D4M2D4M2I4M3D24M2D10M3D8M1D1M1D10M3I2M1D6M1I2M2D17M1I4M1D9M1D4M1I9M4I12M1D6M2D2M1I2M1I4M1D12M1D6M1D6M1I9M4D15M2I21M1D9M2D6M1D4M1I5M2D8M1D5M3D5M1I4M1D2M1D10M1D5M3D3M4D1M1D16M2D5M1I9M3I10M1D2M1D3M2I4M2D5M2I14M1I12M1I9M2I4M1I7M3I28M1I2M2D14M3D13M1D15M1I3M3I7M1D2M1I7M1D3M3D1M1D8M1I6M2I6M3D21M1I5M1D3M1D3M2D9M3D3M1I3M2I6M3I5M6I7M1I10M1D15M2I28M2I5M5D18M2I20M1D5M1I2M4I1M1I6M2D7M2I7M4I2M4I4M2I6M4D12M2D2M3I7M2D3M8D7M1D4M2D10M1I1M2I29M5D5M1I5M1I1M2D6M1D2M2I13M1D16M2I2M1I7M1D1M2D3M2I5M2D9M1I9M3D3M1I3M1D5M1I2M2D3M1D1M3D19M2D7M1D13M1D22M1I6M1D3M1D2M2D14M2I19M2D3M1D2M1D25M1D20M3I5M2I1M1D4M1I2M1D5M1D5M1D4M1D1M1D8M2D2M1D2M3D1M6D2M8D25M1D10M1D13M183S * 0 0 GTTGCTTGTGCAGGTTACAGGATCCGATCTGCTCGATCCTGAAGAATTTGCCGAGCCCGAGTGGACTCGCACTGCCGTGAGGCATCGAAGGCAGTGCAAGTATCGGAAGCGGAAGCATTTCACGCGTGACGGATCCGGATTGAATGGGTAATCGAAACGCATTCCATCGAATGGCGCACACTCGACCCCGCGAACTTCCACTCGGACAGCACCAGAAGCGAAATGCACCTCACGTAGGAAGCGTATCCTGTCAACGTGGGACGCCTTAAAATGAACTAAATCGACTGATCCACGCGAGGTCTAATGGAACGTTCGGATCTTGTTACGCCTGACCGGAAGCCGAATGAAAGGCGCGAATGGACCATTTCTTGTTGTTCGCCATCCTGAGGAAGACTCCTGTTGACTCAATGCACTGGTACCGGGAAGAGTTCCGGCAGTTAATCGAACAAGACCCGTTAACTATCGACTATTACGCATCGCTATTACGATTGGCAATCGTAATGGCCTCTTCTTCCCTGCGACTTCCTATCTGCATATGATGTCGAAGGAAGCGTGCTCCGCATTCATTAAGGAGTGAGATCGGTTTATACCAAAGATAACGCTTGTAAAATGCTGGACGATTTCGCGTCGTCTTCACAGCGATCCCAGTACTGTAGTGTCAGATGATGACGTACTCAACATCGCTATTGACGTATCTTACTGTTTCTTTACATAAACATTGCTGATACCGTTTAGCTGAAACGACCATTGCAAGGATTTATAAATGAGCATCGATGAGTCGGAGGAAAACGATTCTCCGTAGTCAAGTTAGAGTCGCTTCCTGCAACTACGAATGTTATGTAGATGAAGGTATAGATAGAGTCGCTACAAATATTCAATAAAGTTTATAAGTCGGACTAAATCCCCATTCTGCAATGTGCCAAAATGACTGATACGTGCCACGTGGTGACTCAGAATACGTGGGAACGATACTTGCCTCTGTACAAACATAGATGATTAAACCCAAGAGAAGAAGACTCCGGGATTAGATTTCTCCCACTCCCTCCGGGTTTGTTTATGGAGATGATAAATGCACTTCCGTACAGAGAAGTGGAACCGAGCCATTCAACGAGTTATCGAATAGAAGTAACGACTGATAATAGACGGGTCGATATGGCCAGGTAACAGGACGTAACCAATATTCGAATTGAAGAACTCAAAAGAATACAAGCCGCCTGATGGCTTTGGTCGGGCACGCGACTTTGCGATGTACTTGACATTCAGGAGTGGAACGCACGCCAGCGACGTCAAGAAGCTGCCATCGCTTCCTTCCTTCCGAATGCATATTCCCTACGGTTACGAGTCGAAGAGTATCTGTTCCACGAATCAGCGGTAAATTATCAAGTGGACACTCGACAGTAACAGGGCGTCGAAGTCACGAACGGAAGTGAAGCTTAGCTCGGATTTACCTCTAATTTATAAGAACAATGGATCATGGTTCGCTACATGATCAAGACGGGTAAAGAGTTTGGATTAGCATAAAGCGAATCGCAATCACTGAAGCTATACAGGCCAACATTAGTTATTTTCAGACAAACAAGCCTGACAGCGAGAATCAAATACTTCGCTTCCTTCGCTTCATGGCCTTGATCGCTACGAAAATCCTGACGGGAAGGAAGAAGACTAGTTAAATAGCAGGACTTAAAGCAAGCTAGGCGATGCCTGATCATCGACTTGAAGACCAAAGGAATTGCGCTGAATGCTCAATGGATACATAGACGAGGCAAGGCGGCGTCAGCCAAGTCAATCAAATACGGCTAGGCCGGATCGGTCCAAGAGCTGAAGCATAACAACAAACCATGTGCCTGCCTACGAGCAAATCAGAGGTAAGGAGATTTCGAAGAAAATTTATCAAGCATAAGAATCATCAGATGTTGGCTCAGACTTGCAATGGAACTGGCTGTTGTCACGGGCAACGAGTTGGTACTTTATGCAGAAGAAATGAAGTGGTCCTGATATCGTAGATGGATATGTCGTCACAAAGCAAAGCTTAGGCGTAAAATTGCCATGCCAACAGCATTGCATATTGATGCTCTCGGAATATCAATGAAGGAAACACTTGATGTCGTCAAAGGGAAGATCGGCTAAGAAATAATTGGATACGCTTCGTGCCGAACCGCTTCCAGTATCGGGTTTTATGCGGACGAAAACGGATCAGGTCTTTCCTTCGAAGGGATTCTAGCTTTTCACGGTTGCGCAGTTTGTCTGCAAGACTCTATGAGAAGCAGATAAGCGATAAGTTTATAAACATTCTCGGGCATAAGTCTAGACCATGGCATCACAGTATCGGGCAGAGGAAGGGTGGACAAATTGAAATCAAATAATACTTTATTTGACGGTGACCTGTTCGTTGCAACAAATTACCAATCGTTTTATAATCCCCTGCTCCTGAACGGAGAAACGTAAATGATATAAATATCAATATTAAATCGATTTGCATAAAACAGACTACATAATACTGTAAACACAACATATGCGATCTATGAATCAACTATTAGTATTAGTACTGTGACAGTTAATAGGAAGGTACTTTATTCTTGCTCAATTTTGTCATCAAACCTGTCGCACTCCAGAGAAGCACAAAGCCCCAATCCAGTGCCGACCTTTGTGTGCCACCTACGACCTGCATAACCAGTAAAGAAAGACCATTCGTACTGTCGATGCCTGGGACGTATTCTTTTCGTTGAATAAACTTCTAAGACAAGATTAACGGTACTTTCTCGCCATAACTGTAGTGAATGTCGTTATAGGCGGAGCGAAGTTAACACTTGACGCGGAAGGATTAGCTATCTATCGCTTATTAGTACTTGAAACGCTTCTTCAGAAGCCTGAAGGCTAATCGTTTGATGGGGTCTATGCATTAATAGACCACTGACCTGTTGTATAAACAGTGCACCATGCAACATGAATAACAGTGTGGGTCTAGGAAGCAAGCTCCCACTCTTCCGAACTAATACGATGCCCCGTTAAGTTCAATACTAATTTGATGGAAGCCGAAGAGGAGCATATAACTTAAAGAGGATCTTGTTGCCGCCAAATAAATTGCGGTCGTTTAATAAAATTAAGCGTATATATGTTGGGATTTAGTTATTGAAATAGGGTATTCCTGCAGTAGAAAAATAAGGCATTCCTACGAGCAGATGGTCCGAATGACTATTCCTTTGTCAAATGTTTTATCTTGAGTTGTTAACGACCGTGAAATGGCTCGAAATTGCCGTACTTCCAGAAGGAAGCACGACTTATTCATTAATAGATAAATTCAGTCAACTCCTGAAATGTTTCCTTGACGTAAGCAGGCTTATATACTGTTGACTCAAGGGTCTAGCGATGACTTTAACAGACCTTCTTAAAGCTATTCAGGATTTAGTAGTATGTAAAATCGATTAGCCAATAGTCCAAAATGAAAGCGTCCTTAACAAGTCGCCAGCTCTTCGAGGCGTCAACTCGTCAAAATCCGAAGGAATTTAGTGTCGACGTCATTGCTCGCACGTATAAAGGGGTTCGATGCTTCCTTCCTCCTCCTTTCGGACCTTGCGTGCACTGCTAAGCGCAATTCATGCTTTGACGGCCGATTCTATTGGGACTAACGGAACATCGTTGCGAGTGGAAGTGCGTGGACAATTTAACGACGCAATAGATCGACACTGAATATTTCTCTGAAAATAATAGACTTATCGAGTCAAGAATCCCAAAGGAAGATCTGGAGATTGCTTGTTTCAGTTCGTTTAGTGCATTTGATCCTTTTACTCCTCAAACTCATCTCGAAAGGTACAATACTTTATATTGACTCAAGAATGCTGCCAGCAATAGTTTAAAATCACCCGATCTCCCTTACGAATTCGGGTTTACGGATTTATTGGTTGTATGAGTAGATAGAAAGACTGGCTTGAATAGTAAAACGGATAGTGATGAACTTTCAACAGTCGAGAAGCCACTTCATTTCTAATAACAGGATCAGACGTAATGAACACAGATTCAAGTGACGATGACGCACGTTGACAGGTCTAACTCAGAAATATCTGCTTCGAATGGCCTCCTTCCGATTTCCTGTTATACAAGATCGTAGATGTGTCGTGAAAGGTCATTAGTTTTATTCAGTGAACCAGGTTTGATATGCAGTCCACTTCTCTGCTTACGGAATCACTAATGTTACCGCCGATGCACGCCAATGGTGTAGCAATAATTGCGACTCATTCCCCAGTAGTACTGAAGAGATTCCAAATCCTGCATGTGAAAGTCCACGTCAAGAGAAGCAATAAATATTATCCGTCCCACTTGAGACATTCGGTGAGAACTTAGTTTTTAACTGTAGTCTTCTTTTATTCCATCGCCGTGCTTCCTCACTTATTATCGCACCCGAGCCGATCGGAGGCTCTTGAAACCATTCTAAATTATAATGGTCATGATAGGATTAGAAGGTCGACCGTTTAAAGCGATGATAATGAACAGATGAAGGTAAAGTACAAGTAACGTCCGCGCTCCAGAGAACTTATAGCGAAATGCTTAATAAATGCTCGAACTATTGCAGATAAATCGAAATAATTCATTATACTTCTAGGTTTAAGAAGAACGACAAACACAGTAGAAGGAGGCAGCCCGACATATTGCCTCTAACACATCGTAGCCACGTGTTGGTACGTAACAGTTAATTAGAAAAGCTTTGAATAATCTCGAGATAAAACAATTAGAACACACTATTACGAATGATGGTGTTTCATCAGGTAAAATGTCATTTTGGTAGTAAAGACAAGCTATAATCATTTCTTCTATTGCACATTATCCTGAATTTTGGTGATGCCTATTAATTTATCCCACTCGAGGGGAAGCCAATATGGAGAAAGTCAAGTTTTCCTCGCACTCCTGGCCTCCAAGCAATGGTTCGTATGACATCAACATTTTCGTAGCAATGGGTGCAAATTTCGTTTCTAGAACCCTGGTGCTCTATCAGTTTTATGTTGAATGCCCGGCGAACTGGAGCTAAGGCAGGAAGACAACACAGAGCTCTTCATCATTTCTTCGACTATTAAATATTGCTAACAGGTATCGTTTATAAGGAAGGACTGAGTGATCTACGGAATGAACTCTTTCGTAAAATTATAAGGAATAGGTCGACCGCATTTCCCCTCGCGTCAGAATTTATTGAAGCAAATCTGAACCTATTATAGATTTACAATGACTTCCCCAATTATTGGAAGAAAGAGTTATGTATCGTGGGACTCGAAGATTTTCAGGGATTAGAATATGATGAAGACAGAGAAAATTACGACGGCTTGGAAGGAACGAATTTTTATGGGGGCTGTTTTACAAATCCGGTGACTTGCTCAATTCCAAATCCCCTTCGCTTCCCATTCCACGGCAGAGAAGGACGTTTGACTTGTCCTATGGGCAAGCATTTAGGACAGTGGATCAGTCATAGATGGTCGTAGAGATACAAATTCTCATGCAAATATGTAAATCGGTGAGACTGAAATCATTCACTGAACAGCACTATCGAAGTTCACAGCCCGAAGCTGCAGAAGCTGGGCCCCATATCTCCTATGACCGGCTGTTAGCACTACAAGCCAACTCTAATTTTGATACATAATGAATGATAATAATATTAAAACTTCCTTGACTAATTTACTATTCTGATAAGAATCATTGCACGTAAATAAATGTATTACATTGACAGTTAAGCAGTTGATTTATCACCTCTAAATATATCAGCATCAGCATGCAACGTAGACTTAGAGAGTTTATGACTAACGGAAGAAGCAATGATTTATCTCGACGTGCTCAAATGCTGCATTGATACGACGTTGACCTGAATTATTTCGCTTGAATTTGAATGTTGACTTCTCGGAACCGCAGAACAGTAACATTTATTATTCAAAACAAACCAGTCGCGCTTCTCGTTGGTAACAATAATGTTATTGAAAATGGAAAATGATTGACCGTGACGCTTGGCTAAAATTCTTCTACAGAGGAAGCGATCTAGACGAGCAAAGGCTCTTATTTCATGTACATTGAAGAAAATGACATTAGTCGATTTATTACAAATGAATATGTTAACATTGGTAACAGTTAGTCAGACTTGCACAAAGAAATTACCTTCATATTTAACTGAATCATCTATTAAATCAGAAAGACATCGTATAGATACCTAAAGTACCCCGTATCCCTGCTCCTATAATCTATGGCAGAATGTATAACTGCTGACTCCGAACGGAAGGAATCAATGGGTGACGATGTGATTCGCCAACATCATTCGACTCTTTATTTGATGAAGCCAGGAGAATAACTTATTTAAATTAAAAGATTACTCCATAAGCACGTGTCATTTAGCACGTAATATGACAATAAATAATTCTGACATGAGACCAGCGTCTAAACTGTAGATACTAAAATACTTCGACAGAAGTCTGGAGGCATAGGAGATAGACTTTTACGGTTGCCTCCATTCAACATTAATTTGATAAATTCCATCCAATTGATTTAATCAATACAACAATTTGAAGATCAAGCAGATAAATATACTTTTGGAGGTTGCAGCTGACAGCCAAAATACAAATGCCTATGGCCTTCATTCGATCAGGCTGACGAGGCAAGCATCTACTCAATAAACCAATGATACATACAATGCCAATTAGATGAAGCCCAGAAGGAAGAATTGATTCAAATAATAATCAAATATTCCTCCGATAATTCGGAACGAAGAAAAACCGACTTTACGAATATCAACAGCAGACCCTGAACTGACGAAAACATATTTCATGCGTCCTGTTAGTCTAAAGCATTGGCTTATGTAACACTGAACAATCGATCATAGAACTTCTCATTATTCTCCTGAAGATAATAATCGCCAAATAAACCAATACTGAGCTTACAATATACTAACTAACGGAAAGGCTGCCGAGACGTTGCGGCCATAGAAATGATTACTCATAAGGAAGCACCGACGACCTAAGGTCCGATTCCTGTAACTGACCATTCAGCACCCGATATTCTTCTGCAGCTTCCAGCAACGAGGTTTCTTCCTTCTGTTGCAATTCCCAGATCTGCAGCATGATCCTGAAGCCTCAAATATGCTCACTGGCCTCTGCATCAGGCCTTACTCTCCGGCAGATCGAACAGTTTTTCTGCTTCTATCCTGCTTCACGAGCGATCCGTTCCACTTCTGGGTCTAACTCCCGGCTATAACCATAGAATTTTCTAGTAAAACGCGTCAGGACTTCTATCGCTACTTCCGATCGAAGCTTAAGACATGTCATAGACGCTTTTACCCGATGGTCTTCAACGGAGATCCTAAGATCCCTCATCACTGTTAGGAAACTTAAATCCAGTCGGAATAAGTCTCTTTTGAAGTCGGATGCAGGCAGAAGCCGCTAGTATGAGGCGAAACTATGCGTCACCTTCACAATAAATTCATTAGTTCATAGATCTACTTTATTTATATTGTTCACTCATTCTAATCCATTATGCAAGCCTCAATAGGTTAAATCGAATGTTTTACTTCCACCGTTGACGCGGCTTGCTCCTGCTGTGTCCTTTGAACCAATACTGAAGAAGGAATCGGAAGCCAAGGGTCAACCGTAGATGTGGGTGCCTAGATACGACTGTATGCCTGAAGTGTAAGGCAGCCACGCTGTACCGGACAATGGCTGACTGTGGCTGCCTGACTGTCCGTTTCGATAAAGCCAATACTGTGTGCTCCATTCCTTTAACTGTGATAACTTCTTAATGGTTGCTGTTCCATACTGACTCAGCCAGAACTGTTCATCCTGAATAGACGTCCTTGATCGAACGGCGCCCGGCCCTGTTGGAGATCCCTCCGCGTGTTATTCGTCGATTTGGTGCGTAATCGAAACTGCCTGTCGTTGCCGTAATCAAACGACGGCTTGGTTCTTTAATGCCCAAATCGATCCTAATGCGACGCGCGTGGTGTGCGACCTGTAATTCCATCCTGTTACAACCACATGAAATGGCTCAATTCCCTTAATTTAAGCCTCGCATATTAGAAGCACAGTAGGATACGCGACAGCAAGTTGGGCTCAACGTGTCC * tp:A:P cm:i:180 s1:i:1139 s2:i:0 NM:i:2534 ms:i:1952 AS:i:1908 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
6 4 16 utg000001l 40457 60 4300S11M7D17M2D4M1I3M1D11M1D3M1I2M4D17M1I25M1D1M1D14M3D9M1I1M2D3M1D20M2D9M2I2M2I12M3I13M1D6M1D4M3I3M1D9M1I2M2D10M6I7M1D5M1D7M2D6M2I2M1D4M1D6M2I7M1I17M1I20M3I3M2I2M1I7M1D9M1D4M1D6M2D5M1I2M2D3M2I1M1I4M3I1M1I4M2I9M3D6M2D16M2D1M1I3M1D4M6I8M1D13M2I1M5I2M2I9M1D4M1D2M1I1M2I6M1D21M2D14M3D21M1D6M1I7M1I3M3I37M1I1M2D7M1D16M2I31M2I28M3D16M5I12M2D4M2D3M1I13M2D7M1D1M1D2M1D10M3I4M2D3M1D29M1I4M2D4M1D3M1D5M1I2M1I7M1I8M3D15M2D9M1I12M1D3M1I1M1I5M1I6M2D15M1D14M2D1M1D9M1D6M2I19M1D22M1D8M3D3M1I3M1I1M2I13M4D14M2D12M2I3M1D3M4D14M1D11M1I3M2I9M1D6M1D3M1D1M3I4M1I1M2D17M1I9M1D5M1I1M2I3M2I3M2I2M4I11M1I12M1I13M2I11M2D6M1I11M1D3M1D3M2D3M5D5M2I1M1D3M1I2M1D5M1I2M1I9M1D9M1I18M1I3M2D2M1D1M1D1M2D3M2I3M1I23M1I6M1D5M1D9M1I5M1I5M1I3M1I4M1I3M1D20M2D5M2I23M3I2M1I12M5I3M1I2M1D9M2I10M1I7M1I2M2I21M2I9M1D12M1D1M2I9M2D12M2D6M3I8M1D4M1I18M2D6M4I15M1D7M1I1M1I9M4I2M1I4M5I4M3D2M1I12M2I2M2I6M1I5M1I5M2D2M1I3M1I13M2I8M1I2M1I56M1I9M1I3M1I8M4I3M1I42M1D8M3D12M4D25M1I8M1D14M1D12M3D4M2D6M1D2M1D13M2I5M2D1M1I14M2I9M1D35M1I26M2I9M2I11M1I12M2D23M1I19M1D3M3I8M2I7M1I3M1D18M1I11M8I12M2I2M2I3M1I2M2D9M2D9M1D11M3I7M2D22M1I4M2D3M2I3M2I8M1I29M1D3M2D2M2D11M1I4M1D2M1D7M5I4M1D12M2D3M1I5M1D5M1D9M1I3M4I5M1I21M2I36M1I3M1D14M2I11M2I10M3D12M9D23M3D2M1D2M1I6M1D4M1D2M1D8M2D7M1D19M1D20M3D8M1D5M1I2M1D18M2D20M1I7M4I12M1D4M1D3M1D9M3I10M1I6M3I2M4I15M4D17M1D9M1I14M2D12M2D18M1D8M4D14M1D2M2I2M1I1M1I23M1D30M1I32M1D13M3I22M1I1M1I4M2I6M1D3M1I33M3D3M1D13M1I23M3D12M1I7M2I6M2D5M1I2M1I6M1I7M1D1M2D13M1D28M3D6M3D6M4I1M3I2M2I7M3D9M1D18M1I11M1I12M3I4M1D9M1D12M1D5M2I11M2I9M2D8M2I4M1D5M1D9M1I6M3D17M1D6M3D10M1D15M3I2M1I2M1D18M2I1M2I5M2I2M1D2M1I9M2I8M1I2M2I19M5D6M2D5M4I5M1I5M1I4M1D5M1I12M1I6M1I20M1I3M1D20M4D9M5I8M1I4M2D6M1D1M1D5M1D29M3D3M1D8M3D4M1I11M2I19M1I10M3I3M2I9M6D2M2I5M2I1M1D12M1I7M1D12M1D1M2D1M1D4M2I2M2I9M1D12M2D42M1I1M2D33M4D7M3I11M4D4M1D2M4I7M2D11M4I13M1I3M3I1M3I3M1D14M1D6M1I7M2D4M3D8M1I7M2I6M1D6M4I2M3I5M1I4M1I20M3D10M3I6M2I11M1I12M6I8M1D17M3D39M4I7M2I9M2I9M4I6M1I7M2I1M1I9M3I14M2D6M1I2M2D10M1D4M1D23M2I4M1I1M2I5M2D4M1I8M1I10M2D2M1I14M1I10M1I4M2D2M10D7M1I26M1I9M1I1M2I3M3I5M3I5M2I5M2I5M1I1M3I10M1D6M1I9M2D4M2I49M1I4M1I4M1I7M1I12M4I2M1I3M1I31M1I8M4D11M2I7M2D8M4I2M5I2M1I10M3D2M1I5M1D6M1I1M1I21M2D2M2D1M3D10M3D7M1I8M2I10M1D3M1D17M2D7M1I5M4I2M1I3M1D4M1D6M1D15M1D15M1D6M3D8M4I15M3I7M1D3M3D6M3I12M3D10M3D7M1I6M1D6M2D1M1D6M1I2M2D11M2D10M2D8M3D1M1I9M3D6M1D10M1D8M1I2M1I12M2I3M4D6M1D5M1D10M1I3M1D1M1D5M2D10M3D11M1I12M1D2M3I8M1I14M2D13M4D7M1D7M1D15M1I5M1D1M2D6M3D10M2I7M1D4M2I19M1D8M2I5M1D5M2D1M1I4M1D2M1D4M3D3M4D12M1I5M2I3M1I1M2D2M1I14M2I15M2D4M2D5M2D5M4D8M1D4M1I12M1D5M1D37M1D5M7I3M1D1M1D13M3D2M2D10M4D9M1D3M1D1M1D11M1I13M1D18M1I2M1I28M2I6M4D2M1D6M1D2M2D3M1I14M3I1M1I12M1D1M1D2M2D11M3D5M1I2M2D27M2D7M1D4M1D15M4D13M1D3M1D15M4D6M2D3M1D6M2I6M1I4M1D12M1D6M1D37M1D10M1D4M2D5M5I8M2I5M1D4M2I3M1D9M1D3M1D12M1D8M1I1M2D2M2D2M1D6M1I4M1I6M1D5M1I3M4I2M1D5M2I6M1I4M2D6M1D3M1D4M2D3M1I2M3I28M1I16M1I1M3D6M1D7M1I18M1I4M1I3M3D5M1D3M2I22M1D3M1D11M1D5M2D5M2D16M3I11M1D4M2D12M1D1M1D13M3I3M1I6M3D13M1I10M2D1M1D16M4I9M1I18M1D23M1I11M1I9M1D5M1I3M1I4M4I5M2I10M2I8M1I3M4D16M1D3M6D7M1D3M2I3M3I3M1D20M3D4M3D3M4D4M6D4M3D3M1D4M2I14M1D13M1D2M1I10M1I18M1D21M3I8M1I21M2I4M2I18M1D12M1I9M3D3M2D5M2I2M5I15M2D2M1I16M2D8M2I2M3D3M1I3M1D17M1I6M2D6M1D10M4D4M1I3M2D3M2D2M2I2M1I4M2D2M3D35M2I8M5I3M1D4M1I2M2I3M1I25M1I15M1I9M3I5M1D2M1D4M3D4M2D2M3I10M3D22M2D8M1I5M2D33M4I12M1D3M2D6M1I4M1D8M1D6M1I8M2I7M3D13M2D12M1D27M1I16M1I4M1I6M46S * 0 0 TAAACGTATTCTGCTTCTTATACGAGACCTCTGCCTTAATCAGCATCTCCTGCGCGGTATCAGGACGGACCAATATCCAGCACCGCACCCCACATGGATTTGAATGCCCGTACCCTGTCTGCCCAGTAGCCCGTCCTAGTTTTCTTATTCACGGCGGCGGAGGTCTTATCATCAAATGCTTCGCGTTGCGGCCGCCGCCTGCAATGCCCCGGCTTCATCGCCGGAACGGACTCAGACATACGGATCTGCTGGCTAAATTATGGAAACTGCGGCTAGTACTGCCCGTCGACGTCGGGTCTGTCAGCTTCCCGAAGGAGTACGTAAGGCTACTGCTTGTCCTACGCCGGATGCAGGAGAGAAGGACGCGCCACTCGGCTGATGGACGCAATCATGAGCCTCAATGCTAGCTCGCTCCGTCCCCGACCAGGTGCGGCGCTATCACTGGCTTGGTTAAACTACTGCCTTGCTGCCTGCCCGGCTCTGGACAGGACCAGCATACGGATCTTGCCGTCCGTCAGTCGCTGATTGCCAGAAAGGACAGCGTTTGTTGAAATCTAGCACGAATTGATGAGTTGCCCTGATACCAGCGGATGCCAGCGCAACGGTCCCCACCGCCATGAGGCGCCAGGATACATGGCAGGGTGATTCACGCAATGGCACCGCGGAAATAATGGGATTCATCGAAGGGAGTCCTTAGCGTACCTGTGCCCCTGTTGCAGCAGGATTACGACGGACTTTGCCCGCCTTGCAAGCTTGCGGTCAAGTTCAGTAACTTACGGATACGCACTGGCGGTATTTATACTGTACCGACGGAAATCGCCCCGTTTCTGTGCAGCAGCCGGCCTGTTACTCGGGCTAATTCATCAAACGACTGTAGCGGCTTTTTCGATCATTTCTTACAGAAAATGACGCCTGACTCTCTACATCTTAGTCGTCAACCTGAGCAGTAGAGACTCAAATACGACGAAGATCGGCCCAAGGTTCATTAGATACCGACTCCTCGGCGATCCCGGTACCCATGATATTTAAGCATTAGTCATATCGTGATGTTCACAAGTGCGGAAGCGGATATTCATTCCGTGAGGGCACGGCACTAGCCGGCAAGCCGGGCCGCCGCTTTCTGCATCAGCACATCATTCAGGCTCTTCGTCACTCCGCGCTTCATGCTAAGACTGAATCCATGATCGGGATCATGTAATCGCTGAAAATAAGGCTGAGGGGACGGTGTACGTCAGCCGGAAAATTGTAAGTCCAGCAGAACATCAGCATGAAATAATGGGTACTGTAAAGCCTGCCAGTAGGCGCATACTCGTGGATGACATGACCCTGAAGGCAGGCACGCCAGTTGGGTCGCCCCATCTCACGCGTTTCAGGGCAAACCCCAGCTGACGTCGAACATTCGCCCCGCAAGAACAGGCTCTGCGGGCCCGGGGCGTCGGACTGTCTGTCCGAGGGATTATTCACCAAACTCATACATACCAGACAGCCGCTCCACGTTTTCATCATGAGAAAATTGCCTCTGTAGGCCGTACAATAACTAATTTCCTGCTCAATCTCTGTTTAACGGCTTCATTCATGGACGGCATCGGTGCGTCTTCTTGCGATGGTTATGCCACGAGGGAATAAGGTCGCCAGAACGCGCCGGTCTGATGGCGTCCTCCACAGTAAACTTCCGGTTGCTGTTTGACTCCGCCTGTTCTGCCTGCCGTTTCATCAGCGATGCTCAATGCACCGTCAGGACAGTCGACCGTGACGGTACCGTTATGTTCAAATGATTCGGTTTTGGAGGAACATCGTGACTCCCGGATTAACTCGTGGTGACGGCGTAATTTCTGCGGACCGCAGCAAACTCACCATTACCGTAAGATACAAACCGGAATTGACCTGCCTGCAGCAACGCCGTTCACGGTGATGGTGAGTATACTGACGACAGCGGTGGCTTTTGTTCACAGACAGCGCACGAAAGCTCTGTCCTGGTTTACGCCTCCGGCTGGAAGCGACCTACATTTAGTGGTGCTCTGCCTTTCACCGCTGCAGGCGTCACGGTCATCCTGTTGCCGGCTTTACCGTGCTGCGATCTTGCCATCGACGGACGTCCACAGTTTTGTCAATCGTTCACCGTGCGGGCATCATCTCCTTGGTCGCCGTCAACGGCTTACGATACTGCTGACCCAGCCACGGAACACAATACGGACCGTGCGATGCGTCGAAGCGGATTTATCTAACGACGCGCCATATCGCCTTCCATTAAACCGCCAGCATGCCTGCTTCCGCTGCTGGCGGGGCATCGACGAGCGTGGCGACTCTTATCTCGGCAGATTTCTTGCCCTGCCCCAGTTACCGTCCAGTCTGCACTTTTCATCATCGGCGATAGCTGTCATAGGACCGGCTGTCAGGTTCGCCGGGCGTCAGGTCTTTAACTTTCAGACCGACCAGTCAACGTCTGAAAGCGACTCGCGTGACGGTACGCTCCCCTTATAAACCCACGCTGGTCCCGGCACCTTCCTCACGGCATTGGGGGATTTGGTACAGGCAGCTAGCGCGTACGCCGCTTCATAGGTCACCCAAGGTTACGATCGGCTGAAACTCAAGCCCGATCATCGTCGCGCCGGGTACGCCTCTAGATACTGATCAGAGTAAATCTGACAGTGCCGGATATCGCTGATAAGGGATAAATCCGGGACTCCATCCAAAGAATGGCAGCTCTGAATCCGGCGCATATGAGCAGGCAGGAAATGCGATATGCAGCTCCGCCTCATGACCCTGTCCAGCTCTTCACCCTTTAAGTGCCGCCGGTGAGATAACGGGGACTGCTGCCGGAAATCCGCTGTATGCCAAACCTCCGCGGTAATATTCAACGTGCCGCGTCGGTGTCGTATCCTTCTTCGAGTGCAGGTACGGCTGCACGGAGTTCAGAGGTTTCATCGCTTCCTTACCGGAGCGTTGATGATGCTGCAGCATAGGGAGCTCGTGGAAGACGTTCATACGCCGTATTACCCTGATGATCTTTTGTTTAAACGCCGTCGTGATGCCAAGCGATCGGATTTCACCACAGGACTTCGGTGACTCGATAGCTTTCCCAGCCACGCTGCATGACATGCCACCCATCATTTTTCAGTTGCTGAATACGACCAAACGGGAATAAGGGTTATACCACAAGCACGGTGCCGCCACCTTCAGGATGAACGCTGCGCAGGTTTACTAACTCTTCGGCGCGAAAGGACAACCCGCATCTCAGCTTTACTACGGGCAAATCCCCCGGTTAACTTTGATTCTGGCCTGCGCGGATTTGACGTGGCCCTTTGAGCCTCTTCCTTTACCAGTTCCGTCCTGTCTCACGGGCAACCTGTGACGCCGACTTCGTCATCTCCGGATGAAGCAACGCGGTTAATGGCCAGTTACTGCGGACTGCAGAGCGACGCCGTCGGGCATCGGCTGAGGAGTTCAACGGCCTGCGTAAGACTTTATGGTCACACTCCCCCTTCAGGCGACGGTTAACGGGCAGGGCAATCGTCCAAGCGAATATACGACAACTTCCGCCATCATCCGGCCAACCCGATAATTACCCAGAGAAATTTTCCCACCGATGGTCATGTCGGGTTCACGCCCGATAAGCTGCCGCACCTCATCAGTCCGGACAACAACAGGAAATGCGATGGAGCCTTCAACGCGCACGCCTTATGTCCGGCATAGCTGATATTTCAGTTAGGTCAACGACCGTATCACCTAAGCTGACTGCTGCGACCGGATGTAATGGCTGACGTTCCCAGTACCCGCGCCATCGTTTCATCGGCGGGCAATGGCAGCATTACGAACAGGCTATCGAAATCAGCCACAGGCCTCCCCGTATTCTTGCATTCTGGCCAGGCCGCGCTCTGTCAGTCTGTTCGGTCACACCGGCAGAGACACGAAACCGTCCCGGCAGCACAAATGCCACCATTCATCCGTGAATGTAAGAGCTTATGCAGCTTCACCAGTGCCACGACCGTGACCAGTCGACGTATCCAGAATCACGCTCAGCGGCTCCTCTGATCCCACCTCATTTGTTTACTGTCCATTCAGCACATTTCCCCTTGAGGGTATTTATGACCGGCAGTTTCATCCGTGTCATCACACTCTGGTTCTTACTCACACGGAGCGGTTCTTCTCCTTTCGTCCCGTCAGGCTGACATCACGGTTCAGTCCCAGGCTCGGAGACGGGCAATCAGTTCATTCGTGATGATCGCTGGCCACAGAGAAACACTCTAGCAAAGGATGATTACGAGTTGTAAGGACCAACAGCGATCATAGAGCATGATGTCAGCAGCATCATGACTGAATCATGGTGAACTCAACGGCCGGATCGCCGTGAGTAGATTTTCGAGTAACGGTGCAGAGGCGTTAATGCCTTCGCGCTTAGTCCGCATCCTGAATGCAGCCATGTAGGGACCGCGTGCCTGAGTGATCAGTTCCATTCCGGAGCAGATGCGTGTTGCCGGCAGGAAGTTCTTTGACTCGTCAGTTTCACGTACTGTTCGAATACACGACGAGATACGATCGCGATAAGCCATCCCCTTAGCTAAAGACGCTTTGGGACGAGTGATCTTCTACGCTGTCTCTGAGCTCGGAATTAGAGCCACGAAGACGGGTAATCCAGCTTCTCCTTGTGACTTGAAGGAACGAGACTCCAACGCGCCCATGTCCGCAATCGAACACGATATTACGCCACGGCTGGCGTAGGCGGGGCCTACCATGCGATATGTCCATCGTCGGTCAGTCACTAATCCTTGTCACGGTGCTCGACCCCGTGCCGCCGGACTGCGTGATGTTATTCCTCACTGCGGCCATGGACCTGGACCGGATCGAAGGCTTCAAGGGTTCTATGTATTTGGCCTTGCCTAAGCACGACGGCAGAAACTGCCTGCGATCTTCGACTGAGCAATGGCTAGCCTTCTTCGTCACGCATGTTCTGCATCATGATGCTAGAACCGGCGGTAAGCCGGGTCCGCCAGATTCTGCGGATCCTCATGTAAGCGACGGAAGGCGTCATCTTGGGGGATTCATTCATGCTTCGGGCTGACATATCCCGGGGCGTAAATTCAGGAGGTGGAGCCGCCACGGGAACGCCACACTCACGGAACAATTCATGCGAAACCGTACAGCGCCATTTACCAGTCCCAGTTGAGACGCGATAGACTTTCGTCGCGTGAAGGGATAGCTCACGGAAAAGAACCGGAAACAGCACCGTAAACTTAAATTCTGCGGCCATTTGCCGCCAGCAGTTAGCGGCTTTAGTACATCGACATAAAATGCTAGGACCGTCTAACAGGCGGCCTTCCTGATGAAGGGTAAACTAAACGATGCCGTCATGCCCGGCAAACGCGGTCGTTTTTCTGTGCTCGTGTCCCTGGCGCCTCGGCCGCCTAGCATCCCTAATATAAGACCGGGTCAAGACTTAAACGTGCTAAGCAAGTGACGTCGAGGCGCGTCTGGTCAGCAGCAACCGCAAGAATGCCAACGGAAGGGGCACCGTCTGCTGCTAAGCCACGCAAGAGGCAGCTTAGAGCTGATTCAGCAGGTCGTATTGCAGGCGGTCGCACTCAAATCCGCCGGGGTGCGGTCTGCTCTACGGTTATCTACTGTTGCCCTGCGGCTGGTACTCGGTAAAGCTTCTTGCTCGTTCCAACACTCGGTAAACAACTGTGTGGTTCAGCAAATCGTTAACGGCAGGTTAAGATGCCGGGTTACCTGCAGCCAGCGTGCCGGCCCCTGCATGACGACAGTACACTCCACGCATAGTACTGCGCTGCCTGTGCCACTCTGTGGTGCTGCGGCGAGAATGCGCGGCGGCTATTTCACGGTCAAGCCCGGGGGTTTGCCCAGCACGCGCCTGTTCACTTCGCGTCGTGAAGCCTCCCTACAGTTGAGGATCCCCATAATAATGCGCTGTTTCTGCCGCAGACCCGCTGCGGTACTTGTCTCTTAGCAGCGTCGTTCCGGCTGCGCCCAGCGGTGCGGCGTTCTCGCCTCCCGCCTGAGCACCACGTCATTCAGGACGTCATGCTCGGTGAAGCAGTGGCTGAAACAGTCGGTGATTGAGTCTCTTTGGGTATTCGCCTCCTGTGGGAGACGGGATTTACGTGCGGTAAGCTCAGTGCATCACGCATGACGGTGATCGCATCGGTGCTGTTAACAGTTCATCAGCCAGTCCGGCATCAATGGCCTCCTGACCGCTGTACATGCAGCCTGCTATCGAGCACAAGCCTGCACGGACCCGGTATGCCACCCTTCTGCTCCAAACCATCTCTTAGTTGCGTCCATCCGGGACTGCAGTGTCTCCCCGACGTCATCCGGAAGATGGCTGTAGGCGATGCCGTCCACCTTATGGCGGCCGCCGCTGTAAATCAGCGTGATTTCCACCCTGTTTCTCCAGCAGCACCGTAATTACTGTGAGCTCATCATGACGCCGATGGAGGTGGGAGCCGGGCGCTGTCTGCGTGACCAGACGCCGGGAGGCGGCAACGGGCAAGCAGGAGCAGGACTGACCTGCACTATGCACAGTTCATGTCGTTGAGGGGCACAGCCGGGTTTTATCTGTCTACGCACTGGCGATGATGTCAGCGCAGTTCAAATCCGCCGAGCGCGGTCAGCGCCGGCGTGTCCATATCGAGCAGAATGCGTCAGATCGGATCCGACTCGAGCTGTTGCGATCAAGACGGCGATAATGCCGTTGTAACCGTCATCTCGAGTACGGCTGCGGCAGCGCCGCCCGCGTCCGGCTGACCAGGTCGTGCCGGACACCGGCACCGACGGCGATGCCGTTCAGTGACTGATAACTGCGGCTACTGTCCTTGGTAGCGTCATCATACCGGATAATGCCCGTCGCGAGTGCCTCCTAACCAGGCGTCGTCGCCGACACGATCGTCAGTGCTGATCCCAAGCTGGCCTGCAAGCAAGAAATAAACCTAGGAATAGGGTTCAACATCACTAGGCTCATCGACGGTCATGGTGGCAATATGCGGAGATTATTACAGCTGGTAGTTCTGGTTCTCTCCTCTGTGCTTGTCTACGGCGCAGCCCGCAACTCACGGAATTCTTCCTGCAGCCGCCCAGGCGGTTTAAGACCGGCTGCACGGCGCCTCCATCGTTTCACGACCTGCTGGGCAAATTTCCTGATAGTGGTACCGGGGTCCTAGACTTCTCGTGTCCATACTCAGTTCAGCTTCTATCAGCCGGACGCTTCCTGAACTTCTTTCAGACCATCGATGGCCATACGACCGGAGCCTAATCAGTCGCAGTTCCCCAGGCAATGCACGGGCTTCCTGAAAACTGAAGCGCTGAATTTACAAAGTAGTCTACACAGCGAACGATGGCCTCTTCCAGCAAGAACATCTGGCTCGCCTGACTGGATGCGACGAATTTTGGCCGCCTAGATAAATCACGGACTCGTCATCCCACGACTGATGTCCGTGGTAGGTGGTATGGGCGTAATTCCGGAAAGCTCGTCATACGAGACACCCAGCAGCATGTATACCCCCGGACTCAAGGCAGTGACTCAAACACGAGTAGCCGTTATCCGTATTCCTGAGCCGTATTGCAGGTTGAGTGAGTTACCGGCATCAGTGCGGTACTTTTGCCTCCCCAGCCGGACCCGGGCCCTGCGGCGTAATACGCGGCACTTCCTCAATCCAGGCCCGTCCTTCCCGGGCGGCTCCGACTGTCCCCCAGAATAAATCCATCGCTGACGGGTGACGATCCAGCTCACTCTCATGATGAATGGCGTATCTAGCATCGCCTTCACAATGGCGCCTAGGTGCAGCTGCGTGTTTCTGGAATGCAGCGTGCGGCTTTATTCATCTTACTCATCACCGCTGTAAAACATTTTGCACCCGCGAGTCTGCCCGTCCTCGCACGGGTTCAAACGTGAATGAACGAGGCGCGCGCCCGCCGGGACTCAACTCGGGGTTCATGTCATTTCTGCGGATCCAGCCAGGATACCCGTCGTGACGTAACCCCTACCGCCCGACCTAGATGTCATTAATCTGCACACCGGCACGGCACTTGTCCGCCGGCTGTCATTCTGTTCTGCGATGCTGATGCGCTTCGGGCTGACCATCCGACGCGTCTTACCATAGAAAAGCCGCGACGAACTGGTCCCAGGCCTGAACGAACAGTTCACCGTTAAAGCGGTGCATGAGACATTCCCCGAATCATCATGGTAAACGTGCGGTCGCTCAACGTCGTCAATGCAGGCAGCATATTTCATGGGGACTCTTTCCATGCTTGCCGCTTCAACCTCGGCGAACGGAAGACGGGCTTCTTCCTCCAATGCCCAGATAGCCAGCTTGGGCGATGACTGATAGATGGAAAGACAAGGCCATAGAATATTAATGCCTGATGCAGCTGGATGGCGTTGGCGGCATAGCCGTTATTATGCGGTAGATCGGTCTGCGCGGGCATGTCAATTGCCACGGTAAAGTTGGCGGACAGGCTGCAGCATCCTTCACCCCTTACGATTCACGACCGCAAACCACTCCCCCGCCCAAATCCTAGCTGCCACCGCCGCCGTGTATAACCGGCTGCATATTCTACGGGGCCGTCATGCCGTCGATCCAGAATGGGAATGGTGGCGTTTCACATAAAAATCCTGCAGGTTGCTCCTCGGTGCGTCTGTATTCATGCCGCCGGTCTGCATCGCTGCCTTGCAATATATTTTGCGGTAGATACAAACTAGACGGTTAGTCATTCAACTGTACCTTTGCCTATAGCGTTTGATTCATATATTCATTAGTAGGTTAGATGCAGAGTGCTCAAAGCGCATGAAGGGCAAGTTCTTCCTGTCGTCAGATTCATCCTGGCTGGATAAGGCACGGCGTAATCTGCCCACTATTTCTTGTTACTATTGTATGCACCATCCTCTTCCTGCAGAGCGGCCTCGGAGAGCAGGACACTGAGATCCAGCTGCCAGCGGGAAATACTGATGCGCACCTAGGCGCCAGCATAAACATGAGACCGTCAGTTAGTCGGGTGCAGTTGCGGGCTTTAGTCTAGCACACGGTCTTTCCTTGATAGTTTTTCGACCTCTGCATGAGCAGTCATAGCTGCTGCGTGCCGTCAGATCAAAATATCGGTTATTCCGGAACCATATAGAAGGCAGGGGAACGGTTTAAGCCCTTCGGCGTCAGTGTGAAGCGGTTAAAATCTGCTCTGTCCTTCGCGGTATCCGTAGTACCGATTCAAGGTAAATAACCCCGTTTTGTTCGCTTAATGGATGCTGGACGCAGGGCTTCGTAAACTACGCTGCCCTTTAATGGGGATCACGGACCAGATGTTTTTCCGGAGGTCCACACAATAGCTTGGTCACGTACAATCCCGCCAGGTTGTAGAGCAGATACGGATATCGACACTTTCTTAAGTTCCGGCGGTCGGTTTATTAGTTGATGGCCCCACCTGTACGCAGCACCCGTCTGTTCATCGTGGTGGCGGCCCATAATAATGGTCGATAACCACCCAGGCTTTCTCCTCAGGCCCCATCGCCATACAGGGATTTCGTCTCAGTCCAGCTGGGAGTCGATACAGCGGTCATAGATAAGCCACGGTCAGGAACGGCTATGAATAATGCTGTCCTCTGCTTAGATACCTGTCAGCATCCGATAACGTTCGCTAATTTTCCTCACGTCTCACAGCGTACTTTTATAGAAGGTTTTACGTTTTCCCGTATCCCCTTCGTTTCATCCAGTCTTTGACAATCTAAGAGCCCTATGGTAGAACGGGCTGTACGTAGATGTGAAAATAATGTCAGGCTCAATCTCTTCAGCGGATGACGAAAACAGAGAATGCCATCACGGAGTACGCGTGCCAGTCTTTCTAAGATATAACGGCGGCAACCATAAAGTCAGCTCCCTGCTGAAGGGTGGGCAGAGAAGGCATTATCCGGAGATAAACACGGCGGTCGTGATCCGTCATTTGAGCCAAAACGGCGTCTTTGTCGCCAAATTTAAGATACTGCCCCAGCAATGCGGCAGGCAACATGAAATGGACCTGCGGATTCACTGAGGGTCCAACACGTATGACACCTGCTCTCATTATGCGTGGAGCCACGGATGGACTTTACAGACCGAGCTTCAATACGGTGTCCCAGAGGAAGAACGTCGTCCAGAGCTTCGGCTGTCAAGAGTAGATAAAAGCAGCAAGTCATCATATAAGATCACCTCACACTGATTCACCTTGGATTTAGAGTGCGGTTGCTACGGCGCCAGAGATCAAAGGACGCATGTACTTATGAACGCTTCATGGTGAGTGTTATCCCGGTGCTTTTGCCAGACCTAGGCCAGGCCAGCAGGCGACGGAATATCACGAACCAGTGGTAAAAGTCGTCATTTCATAAAGATTGGGGCATCACATCGTCGGCAAGCGATACATGTTGCTGCGTAGGCTCTATAACAAAGTAGGGATAACAGAGCAGCACTTTTGAATAACCGACGCATGGGCAATAATTCACATTCACCTGACCGGATGTAGTCGCTGCGATCCCATTCAACTCTGATGGCCCATCTTGAAAGGCAGTGTTTCCCGGAGCCCTTCCTGGTATGCGTGATTCTTTCGGAGATAGATAGGATTAGGCATTCTGTATACGGATCAACAAAAGGCGTAGATCTGCGAGCTTCAGAACCTATTAGAACCCTTTAAATCTGTTCAGCGACCTTTAACGGGGCTCTACCATTATCAGGTTAACCTTAGATGAGCGGCCGGCTGCTTTATGTTCATGGCTTTGATATGATATCCCGTTCTCAGGAAATCAACATGTCGTTTTCCAGTTCGAAAACGCCGGTGCATAGACAGGCCAGGAGTCGAGAATACTGGCAATTTGGGCTTGCGATCCGCGACAGCACGAAAGTACAGAATGCGGTCACCTTCAATGCATATAGGGGTCTGGCATTCTAGAGTTCCTGTGCGTAGTCGGCACGCGTAAGGGTCGGCTTCGTACTCAATAGTTCTCTTGGCTGGAGATCTGCCTCGCCCTGTATTCGCTTCACTCTCAATCGCCCTACCTTTCGTTCTAATTTCAGCATCCCTTCGGCATACCATTTGTGCTTATGACGGCGGGGCAAGAGTCATAACACCCCTCATTACCCTTGCCACCGCCACTCACAGAACGGCATTCTCCCTTTCTGCGTTCAACCGTGACTGTACCATACTCGCACCGAAAATGTTCACTCAGCTGCCTTTGTTGACTTCCATTGTTCATTCCACGGACAAACAGAGAAGAAAGGAACGACGAGCTCAAAGCTCGTTTCAGCTCACTGTCCTTTTCCTGGTCATTCAGGGTATTTGGCAAATAAACATTAAGTCTGACGAAGAAGAACGGAAACGCCTTAAACCGGAAAATTTTCATAACAGGCGAAACACGAGTGCCTCAAAGCAGGATTAGACGCCGCACTACGAAGTAAGC * tp:A:P cm:i:67 s1:i:660 s2:i:0 zd:i:2 NM:i:2041 ms:i:3030 AS:i:3030 nn:i:0 SA:Z:utg000001l,36050,-,27S2397M35D9007S,60,650;
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
7 4 2064 utg000001l 36050 60 27H6M1I28M4I7M1I39M3D12M1D6M1D15M1I4M1I7M2I28M1I2M5D5M1D16M2D15M2D1M2D6M2D15M2I11M1I3M1I9M1I1M1I1M1I4M6D13M3D8M1D8M4I5M1I5M2I5M3D3M2D16M1I4M2I10M1D17M1I14M3I8M1I9M1I5M2D6M1D6M5D12M1D7M3I14M1I7M1D2M1I8M1I4M1I11M1I4M1D8M1D26M2I4M2I1M1I10M1I11M1I4M2D5M2D10M1D5M1D5M1D9M2I2M1I4M1D4M1D7M3I10M3D8M2I12M5D14M4I1M1D5M1I21M1D4M1I3M1I10M2D7M1I3M3D7M1I5M1D4M1D3M1D2M4D7M1I2M3D4M4I20M2I5M1D11M1D4M2I5M4I2M1I4M1D1M3D7M1I7M3I7M3D9M1D3M1D4M1D29M2I1M1D5M2D6M1I2M3D2M1I3M3D1M1D8M2D5M1I13M1D22M1D10M2I3M3I6M1D1M2D2M3D7M1D2M1D3M1D2M1D8M2D5M2I3M1D11M2D6M1D10M2D1M2D3M1D2M1D2M2I28M1D6M2D4M1I11M1D5M4D2M1D6M3D4M1I2M2I6M1D6M1I1M2I1M1I4M1D5M3D12M1I8M2I24M2D1M1D19M3I25M1D10M2I19M2I11M1D28M2D26M1D9M1D2M2I6M1I11M2I15M1I12M1I4M2D9M2D25M3D20M1I13M1I4M2D10M4I11M2I32M2I9M1I17M1I1M1I5M4I7M1D10M1D12M2D61M2D12M1I4M1D3M3D5M1D2M1D2M2D49M1D5M1I21M2I10M1I1M2D1M2D24M3I5M1I8M2D5M2D6M3D28M1I2M1D6M1D3M3I10M1D4M3D21M1I4M2I2M1I10M4D11M3I4M1I23M5D3M1D2M1D15M1D5M1D7M1D1M1D12M1D1M1D2M1D1M2D1M1D16M2D5M2I7M2I6M1I14M1I5M2I1M2I6M5I4M1I26M1I2M1I1M1I14M1I6M1I7M3I3M1D5M3I9M1I7M1D1M1D8M1D11M1I5M2I13M2D9M1I3M1D6M1D11M1I7M1I22M1I11M1I12M5D3M1I14M2D6M1I20M9007H * 0 0 CCTCTGCCTTAATCAGCATCTCCTGCGCGGTATCAGGACGGACCAATATCCAGCACCGCACCCCACATGGATTTGAATGCCCGTACCCTGTCTGCCCAGTAGCCCGTCCTAGTTTTCTTATTCACGGCGGCGGAGGTCTTATCATCAAATGCTTCGCGTTGCGGCCGCCGCCTGCAATGCCCCGGCTTCATCGCCGGAACGGACTCAGACATACGGATCTGCTGGCTAAATTATGGAAACTGCGGCTAGTACTGCCCGTCGACGTCGGGTCTGTCAGCTTCCCGAAGGAGTACGTAAGGCTACTGCTTGTCCTACGCCGGATGCAGGAGAGAAGGACGCGCCACTCGGCTGATGGACGCAATCATGAGCCTCAATGCTAGCTCGCTCCGTCCCCGACCAGGTGCGGCGCTATCACTGGCTTGGTTAAACTACTGCCTTGCTGCCTGCCCGGCTCTGGACAGGACCAGCATACGGATCTTGCCGTCCGTCAGTCGCTGATTGCCAGAAAGGACAGCGTTTGTTGAAATCTAGCACGAATTGATGAGTTGCCCTGATACCAGCGGATGCCAGCGCAACGGTCCCCACCGCCATGAGGCGCCAGGATACATGGCAGGGTGATTCACGCAATGGCACCGCGGAAATAATGGGATTCATCGAAGGGAGTCCTTAGCGTACCTGTGCCCCTGTTGCAGCAGGATTACGACGGACTTTGCCCGCCTTGCAAGCTTGCGGTCAAGTTCAGTAACTTACGGATACGCACTGGCGGTATTTATACTGTACCGACGGAAATCGCCCCGTTTCTGTGCAGCAGCCGGCCTGTTACTCGGGCTAATTCATCAAACGACTGTAGCGGCTTTTTCGATCATTTCTTACAGAAAATGACGCCTGACTCTCTACATCTTAGTCGTCAACCTGAGCAGTAGAGACTCAAATACGACGAAGATCGGCCCAAGGTTCATTAGATACCGACTCCTCGGCGATCCCGGTACCCATGATATTTAAGCATTAGTCATATCGTGATGTTCACAAGTGCGGAAGCGGATATTCATTCCGTGAGGGCACGGCACTAGCCGGCAAGCCGGGCCGCCGCTTTCTGCATCAGCACATCATTCAGGCTCTTCGTCACTCCGCGCTTCATGCTAAGACTGAATCCATGATCGGGATCATGTAATCGCTGAAAATAAGGCTGAGGGGACGGTGTACGTCAGCCGGAAAATTGTAAGTCCAGCAGAACATCAGCATGAAATAATGGGTACTGTAAAGCCTGCCAGTAGGCGCATACTCGTGGATGACATGACCCTGAAGGCAGGCACGCCAGTTGGGTCGCCCCATCTCACGCGTTTCAGGGCAAACCCCAGCTGACGTCGAACATTCGCCCCGCAAGAACAGGCTCTGCGGGCCCGGGGCGTCGGACTGTCTGTCCGAGGGATTATTCACCAAACTCATACATACCAGACAGCCGCTCCACGTTTTCATCATGAGAAAATTGCCTCTGTAGGCCGTACAATAACTAATTTCCTGCTCAATCTCTGTTTAACGGCTTCATTCATGGACGGCATCGGTGCGTCTTCTTGCGATGGTTATGCCACGAGGGAATAAGGTCGCCAGAACGCGCCGGTCTGATGGCGTCCTCCACAGTAAACTTCCGGTTGCTGTTTGACTCCGCCTGTTCTGCCTGCCGTTTCATCAGCGATGCTCAATGCACCGTCAGGACAGTCGACCGTGACGGTACCGTTATGTTCAAATGATTCGGTTTTGGAGGAACATCGTGACTCCCGGATTAACTCGTGGTGACGGCGTAATTTCTGCGGACCGCAGCAAACTCACCATTACCGTAAGATACAAACCGGAATTGACCTGCCTGCAGCAACGCCGTTCACGGTGATGGTGAGTATACTGACGACAGCGGTGGCTTTTGTTCACAGACAGCGCACGAAAGCTCTGTCCTGGTTTACGCCTCCGGCTGGAAGCGACCTACATTTAGTGGTGCTCTGCCTTTCACCGCTGCAGGCGTCACGGTCATCCTGTTGCCGGCTTTACCGTGCTGCGATCTTGCCATCGACGGACGTCCACAGTTTTGTCAATCGTTCACCGTGCGGGCATCATCTCCTTGGTCGCCGTCAACGGCTTACGATACTGCTGACCCAGCCACGGAACACAATACGGACCGTGCGATGCGTCGAAGCGGATTTATCTAACGACGCGCCATATCGCCTTCCATTAAACCGCCAGCATGCCTGCTTCCGCTGCTGGCGGGGCATCGACGAGCGTGGCGACTCTTATCTCGGCAGATTTCTTGCCCTGCCCCAGTTACCGTCCAGTCTGCACTTTTCATCATCGGCGATAGCTGTCATAGGACCGGCTGTCAGGTTCGCCGGGCGTCAGGTCTTTAACTTT * tp:A:P cm:i:23 s1:i:227 s2:i:0 zd:i:1 NM:i:650 ms:i:1208 AS:i:1208 nn:i:0 SA:Z:utg000001l,40457,-,4300S7085M17D46S,60,2041;
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
8 5 0 utg000001l 1 60 62S9M6D20M1D11M1I20M2D13M1I29M1I1M1I9M2D7M1D4M2I13M2D4M3I25M3D7M2D1M2D4M1I32M1I10M1I19M3I2M1D5M2D4M1I6M1I27M2I1M1I4M4D8M1I4M1I48M2I7M1D14M1I15M1D5M1D2M2D2M3D15M1D5M2I12M2I10M3I9M3D5M1D18M1I24M3D10M1D22M1I2M1D21M1I5M1D10M1I10M1D6M1I37M1D16M2I5M1I11M2I5M3I4M1D1M1D30M1D3M1I3M2D17M1I7M1D14M3D35M1I8M1D2M3D2M3D30M1I3M1D45M1I22M5I6M1I6M1I7M1I30M2I11M1D6M4I5M2D3M2D6M1D10M4I1M2I10M1D12M2I3M1I6M4I12M2D7M1D5M1I14M1I6M1I8M1I10M1I4M1D6M2D8M8I7M1I3M2D1M1D6M1I4M6D2M2I7M4D2M3I9M1I20M1I3M1D32M1D18M1I11M1I5M3I3M1D20M1I36M2I21M1D10M3I23M2I17M2D11M2D9M1I2M4D4M5I5M1D9M1D5M1I12M2D5M1I6M1D2M2D9M2D11M1D11M1I5M2I1M1I1M1I2M1I17M4I13M3I2M1D5M1D1M2I6M3D19M2I30M4I27M1I11M2D31M2I4M3D2M1I5M3I10M3I35M5I5M2D3M5I28M4D15M1D17M3D41M1D17M1I1M2I6M1D7M1D9M1I5M1I12M2I22M1I12M3I1M2D3M3D3M1D1M1D2M2I5M1I5M1D5M1D14M2I1M1D3M1I10M2I7M1I10M1D37M1D17M1D22M3I12M4D3M1D8M2I1M1D2M1I2M2D9M1D2M2I9M2I9M2I1M1D2M2D8M2D11M1I7M1I11M6D16M4D4M1I18M5D5M1I11M1D9M1D10M1D5M2D4M3I1M1D4M3D3M1D11M1I10M1I14M1D19M1I2M4I13M3D24M1I26M1I7M1I7M1I10M1I5M1I13M3I15M1I12M1I3M1I15M1D7M1D19M4I17M1D23M1I3M3D7M1D18M1I5M1I5M2D8M1D15M2I4M1D18M1I19M1I13M1D28M5D7M1D4M1I5M4I3M7I12M5D2M1D5M2D2M1I30M3I2M2I4M1D32M1I6M1D6M1D27M5D2M1D7M1I17M1D4M1D14M1D21M7I3M4I7M1D10M1D22M1I13M2D10M4D13M5D42M1D1M2I7M2I12M1I3M4I18M6D10M2I5M1I8M2I10M1D6M1D17M1I23M1I15M1I2M1I9M3D2M1I12M5I5M1I4M1I10M1I5M1I5M1I10M1D8M4I6M1I9M1D6M1I4M3D4M1I14M3D3M1I6M1I3M2I4M1I2M1I2M2I6M2D6M1D7M1I3M1D1M1D31M1D4M3I8M6I6M1I14M1I12M1I11M5D7M4I5M2D12M2D13M1I2M3I38M1D11M1I1M1I19M1D7M1I3M2I12M2D2M1D2M1I31M1D14M1D4M1D17M2D14M1D7M1I3M1I8M3I7M1D2M2I18M1D16M1D8M1I12M1D3M2D5M3I10M2I10M2I4M1I17M2I11M2I29M2D4M2I4M2I20M4I3M1I18M1D7M1D7M1I4M1D7M1D12M3D4M3D10M1I6M1I3M2D2M1I21M1D6M1D10M2D14M2I4M1I3M1I2M1D10M1D17M1I9M1D6M3D12M7I18M1I13M1I2M2D7M1D13M4I2M1I11M1D21M2I14M1I8M3I7M2D6M1I4M1I7M1D2M3I1M1D16M3D10M1D10M1D6M1D8M1I8M1D8M1I2M1D17M1I9M1D7M3D5M3D15M2I9M1I14M2D22M1I3M1D5M1I3M1I4M1D9M2I1M1D3M2D10M1D21M1I8M1I48M3I3M3D12M2I13M1I22M1D5M3D9M2D41M1I10M3I13M1I21M1I20M7I26M3I11M3D4M1D2M3I15M2I17M12I1M3I11M2D18M2I15M1I4M1D24M1I31M2I18M1I6M3I3M1I15M1D31M4D1M2D5M3I1M3I10M1D3M2D2M3I8M2D12M2I32M2D10M3D13M1D2M1D3M4I3M1I48M1D13M1D3M3I15M1D4M2D3M2I3M3I4M1I7M1I4M4D9M2I2M10I14M3I13M1I5M2I5M1D55M1I4M3I28M1D14M3D30M1I7M3D6M1D6M16S * 0 0 AGTCGCTGTTATACTAAATCACCAGTCTCAGTTCCGTACTAGGCGCAGCCCGGACCCACTTTAAAGTGATAATGATTATCATCTACATATCACAACGTGCGTGGGAGGCCATCAAACCACGTCATAATCAATTATGAACGCAGGTATCGTATTAATTGATCTGCATGCTAACTTAACGTAAAAACACTTCACAGACAATACAAATCAGCGACACTGAATACGGGGCAACCTCATGTCGAAGAACAGAACCCCGATAAACAACAAGCAACATCCGCTTTTCCTAACCAAATGATTTGAACAAATTAACATCGCTCTTGGCAAAAAGTCCGGGAATTTCTCAGCCTGGGTCATTGAAGCCTGCCGTCGGAGACGTCAGACAGAGCCGAGCATATACATCAATTAAAGTGATGAAGAATGAACATCCCGCGTTCCTTTCCCTCCGAACAGGACGATATTGTAAATTCACTTAATTACGAGGCATTGCAGTAATTGAGTGCAGTTTTACCACTTTCCAACCACAGTGACAGACTGCGTGTGAGGCTCTGTCACAGACTAAATAGCGTTGAATGATTAGCAGTTATGGTGAGTCAACCACAGGAATAATCCTTCATATTATTGATTTCCTTCACCAACGCTGCCTCATTGCTGAATGCTTCCAGAGACACCTTATGTTCGTACATGCAATTACAACATCAGGGTAACTCATAGAAATGGTGCTATTAAGCATATTTTTACGCCGAATCAGATCGCACGGCTTATGATCATCAGCAGATTGTTCTTTGTTCGTTTTGTGCTCCATGCGCTTGCTCTTCATCTGAGCGGTTAAATATTACTTCAATCTTTCTGTATGAAGATTTGAGCACGTTGGCCTTACATACATCTTCCTGTTGTATTTCCCTCCAGAATGCCAGCAGGACCGCACTTTGTTACGCAACCAATACTATTAAGTGAAAACATTCCTAATATTTGACATAAATCATCAACAAACAAGGTAGAGGAGGTCAGACCAGATTGAAACGATAAAAACGATAATGCAAACTACGCGCCCCTTATCTACATGGAAGGTTTTACCAATGGCTCAGGTTGCCATTTTAAAACGAAGAAATATTCGATCAAGTGCGAAAAGAGATTTAGACTGACTGTGAATTGTTTATTCGAACTAAAACGTCACAACGTCTCACATCTATTTATGACTATCTAGCCACAGATAATATTCATCGTGTTGTTAGAAAACGATAACACCGTGTTAATAAAAGGACTTAAATTGACGTAAATGTTAAATTCTCAAGAAACACGCATGTATAGAAACGTCCTATGATAGGTCGAAATCAAGAGAATCGCATTTCAGCAATACCGGGGAAAATCTTTAAAGATGCAGAGTTTTCCGATGAGTTATACAATATCCATGAACATAAAGATATTACTATACCTTTGTAATAATTCATTACTATTTACTGGAGCATTCAGAACAACACTACACAAATCTTTCCACGCTAAAATCATAACGTTGCTGTTCCTTCCGTGTCTAAGCATCCCGTTGTCCCGGCATAATGCAATACGTGTGACGCGCTAAACCGTGTGCAGCATCGTTTAATTATTCTTCCAAAGCTCCCGCAGAGAAGTTCCCCGGCTACATAGGCTCTTAAGCTAGTTAATCAATCCGGGAATACAATGACGATTCATCGCAGCTCTACATTAATAAATATTAACAATATGAAATTTCAACTCATTGTTTAGGGGTTTTGTTTAATAATTTTCTACACATACGATTCCTGCGAACTTCAAAGCATCGGGAATAACACCATGAAAAATGCTACTCGCTACTGCCTGGCCTGCTTATTACAGGATGTGCTCAACAGACGTTTACTGTTCAAACAAACCGATAGCAGGTACCTACCCACCAAAGGAACCATCACCATCATTTCTTCGTTTCTGGAATTGGCAGAAGAAAACTGTCATGCAGCCAAATTTGTGGCGGCGCAGAAAATGTTGTTAAACGAAGCCCAGCAAACATTGCGTAAATGGATTGCTCATTTTATTACCTTTAGGCATTTATACTCCGCTGGAAGCGCGTGTGTATTGCTCCAATAATTGCATGAGTTGCCCATCGATATATGAGGTAATCTATTGCACTGCTCATTAAGTTATCTTCTGGGTTCCTCTTCCAGTTTGTTTTGCATAGTGATCAGCCTCTCTCTGAGGGTGAAATAATCCCGTTCAGCGGGGTCTGCCATTTGGGGAGGGTGCATTATCCACGCCGGAGGCGGTGGTGCTTCACGCACTGACTGACCGCAGACTGCTTTGATGTGCAACCGACGACCACCGGCAACATCATCGCAGAGCATCATTTCAGCTTTAGCATCAGCACTCCTTCGTGTATTTTTGCATGGCAGGCAGCAAGCATACGCTGAACGCATCTGCATGTCAGTAATGCCGCGTTCCCGCTGATTCAGTTCTGGCATTTGTCGCGCTGGCTTTGTAGGTAATGGCGTTATCACGTAATGATTAACAGCCCATAGAACCGACAGGCAGACGATGATGCAGATAACCAGAGCGGAGATAAGTAATCGCGGTAACTGCTCATACATCAATCTCTCGACCGTTCCGCCCGCTTCTTTGAATTTTGCAATCAAGCGTATGTCAGCCTTATGCTCGAACTGAGATGACCAGCGCCCCGGCAGTGAAGCCCAGATTGCTGCAACGGTCGATTGCCTGACTGACGGATATCACCACGATCAATCATAGGTAAAGCGCCATCTCCTTAATCTGCTGCCGGCCACAGCGTCCTGACTTTTCGGAGAAGTCTTTCGGCCAAGCTGCAGCTGCGGTAGGCATCCCACCAACGGGAAAGAAGCTGGTAGCGTCCAGCGCCTGTTGATTGGGGTTTGGGTTTAGCGTGACAAGTTTGCAGGGGGTTACGGAGTAATCAGTAAATTAGGCTCTCCGCCTACCAATACCTTTAACCATGATTTCTGGTTTTCTGACGTTAAGGTCCAAGTTCCTCCGACCACGCCAGCATATCGAGGAACGCCTTACGTTATTATTATTTCTACCATCTTCTACTCCGGCTTTTGAGCGAAGCCGTTTGATAAGCGAACCGGGCAGTCAGTACCGATGAGCCGATAAACACGCTCGTTACCCAAGGTAATACTACCGAGATGCTACTTAGTTAAGCGAAGTCGAGAAGGTCACGAAGGATGAACTAGGCGATAATGGCGCACATCGTTGCGTCGATTAATGTTTTGTAAACGCACCGCCATTATATCTGCCCGGGAAGGTAAGCCCCATTGCAAACCGCAAGGATTTCCGCGATGCCTTGTTCCTTTGCCGCACGAGATGGCGGCCAACACAGGTCATGTTTTCTGGCATCTTCACGTCTTACCCCCAATAAGGGGATTTGCTCTACGTCAATTAGGAATAAGGTCGATTACTGATAGAACAAATCCAGGCTACACTGTGTTTTAGTAATCAGATTGTGTTCTGTGACAGGATATGCACGGCAAAACGGCAGGAGATGTTAGCGCATACTCGTCGCCTCCGCTTTCACGAAGGTCATGTGTAAAAGGCCGCAACCGTAACTACTATTACTAATGAATTCAGAGACAGAATGGCTACGGCTCAGTTTGGGTTGTGCTGTTGCTGGTTTAGGCGATGAATGACACGCTTGGAAGCATTTATGATCCCGGTTCTGCTTCCGGTATTCGCTTAATTCAAGAGCACAACGGAAAGAGCAGCTGGCTAACCAGGCCTCGCCGACTCTTCACGATTATCGACTCAATGCTCCTTACCTGTTGTGCAGATATCGACAAATCCCGAAACCCGTTATGCAGGCCTCTAACTATTACCTGCACGTATTTCGGGATTGGAATTCAAGACCTCTCTGCCTGCGATGGTTGGAGTCCAACGATACGTCGAAGTAAGACTAGGCGGAATCGTAGTAAGGGCGCCGCTCTTTTCTTCATCTACTACCACAACGAGTGAATTAACCATCGTTGAGTCAAATTACCCAATTTTATTCAATGATCAATCATGCCGCCGTTAATAACTGTTGCCATCCGCGTGAATAATCATGCTGCCAACGTGTGACCGCATTCACAAATGTCTGCGATTGACTCTTCTTTGTGGCATTGCACCAGAGAGCGTCATACAGCGGCGGCTTAACAGTGCGTGACCAGGTGGGTTGGTAAGGTTTGGGATTAGCATCGTCACAGCGCGATATGCTGCGCTTGCATGCGGCGAAGTACTTGAACGCCTTTGCATCTTCGCACTCTTTCTGGACAACTCTCCCACAGCTCTGTTTGTGGCAAATGATAAATGCACGGCTGTACCATGGCAATCTCTGCATCTTGCCCCGGCGTCGCGGCACTGAGCAGCACGGCAATAATCCGCATAGAGCGAATGTTGCGAGCAGGTGCATCCTTTGCCTTAGAGACTATTTCCTTCAAGCTTTGCCACCACGGTATTTCCCCGATACCTTGTGCAAATTGCATCAGATAATAGTTGATAGCCTTTTGTTTGTCGTTCTGGCTGAGTTCGTGCTTACCGAATGCAGCCGACCGAATCCGGCTTGTGATTGCGCCGTCCCCAAGCAGCCACTCCATCAGTAAGGGAAAGAGGTCAGAAGCCGTGGCCGGTGAGTCGCTCATCATCGGGCGTGGTTTTGTATGAATGAAATTTAGCTACGCTTTCGAGTCTCATGCGCCTTCCCTAGTATCCTGAATCAATGTTAGGTTCCGCAGAACATGCACGCTTATCGATATACATGTTGGTTGGCCAAACTTGAGTGGTTTCACTGCTGGCGTATGACCAAAGATGAACGTGTTGGCGCCTTTATTTCTTTCGCACGATCCCGTTTGTGTGAGTTGCTGATTCGTTCTAAGTTCCAGATTTACCTTAGTGATGATCAACGCTTTCCAAACTCGTATTCGTCAAAGGGATAATCGGCGTGGCAGATAACATATTTTATCTTTGCTCACCAGTTCACATGATTAACGGAAGTTCTTAAGAGTACTGCTTTATGGGCAAGAGCTTTAGCCAGAAGAATTTCTTTGTAATCGAGGATTAAAGAACCAGCCACCGCCATTAAGCAGCCACGTATTGAAGCTGCACTGATTATCGTTCAAGATATGATAAGCCATCACAATCATCATTTGCTGCCTGGTTTCCACGTACAGCTCTGAACCAGGGGAATGTGATTAATTCCCGGCATTCAACGTTCTCTGCACCACGATCAACCAAAATCGCCCCCACCGAGATAAGCAGGTCTTTTGTTGTCAAATCCAATCGTATCCAGTTTGTTCATAAGCTGTCATTTGGCACTGCGTTAAATGCCAACCCAAATATTTCGTAGTATTTGCTGCCATCAATTTTCGTAATAGCGCATCTCTTTCACTCCATCCGCGATACATGAACCAGGTAACGTCGTTGACGATGGCGTGCATTTCCGCGTCTTTATCATCAACGTATTTTCCGACTGGCCCGTACCCAGCCACTTCAGTCTGCGTGCTACTTCTGTCTGATTTCCGTATGTTTCAACGAGCATGTTCTGGAATGGTTTTACTGAGAACGTCTTCATGCGGCCTCACCTTCTGCTATTTCGCAGGTCTTTGAGTTTCTGTTGGTACTCTGCCTTGATCGCCTGTGCACTCTTCGATAGTCTCAGCGATGGCGGTTATGGTTTGAATTCGATTTCGTCTACTGCTTCCCTGCCCGATGCGGCTAATCAGTTCGACGGCGATACGAACGAGATTTCATTTTGTGCCTGTGCG * tp:A:P cm:i:127 s1:i:1139 s2:i:0 NM:i:1320 ms:i:4118 AS:i:4118 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
9 6 4 * 0 0 * * 0 0 CATCTTGTGCTGTTTGGCCTGGCTCAACCGCGGTATTTGGCCTTGTCGTCCATTCCGTTAAGTTCCGTTCTTGTTAATCTACTCTGTTTGACCACCCCTCGAAAGAAGCTAAACGAATTATGAAAGGCTGTTGGTCGTTCCTTGCTTTCTTTGATCGGACCGAACAATCGACAGAACAAAACATCATTTTAAAGTTGGGCGTATCCGTACCAGTCAGAACGATGAACAGGGAATTACCGTTTAGCGTAATTAGATAACCGGTGTCTCTGTCACGTGCCCGAGGTACAAACCGGTGCTGAAAAAGTACGGATTGGTACGAAAGCCTGGGGGTAGGACGGAGTCTAAGAGTGTAAGATGCCAGCATGAACCTTACGGACTCATTAAGGCGCGCCCTATCGACGAAAAACAGGACCGAATACGGTACCAGCCCGAAATTACTTTGGTTCGTCTGTCCACGGCAGGTGAACTTACAGAGTGTGACCTACATCCCGTCGTCAAGCTTTTTCGCGCGGACGCGACCCGACAGGGTGGTCTTCCTGAAACGGGCCACCATAAAGCCAGGAACAAATAATAACTATCGATTAATGGTACTGGCTAGGCGTCACAGTTGACCAGATGGTAAATTTGTAAGCGTGACGCTCGTTTTAATGAGAGCCCAAGACCGCCGTTTAACTGCCTGATACGTCAATATTACCCCGAAACCAACCCAAGGACGCCTGGGAAACGGCCGTCCCATGCTACATAAACCGTATGGCATAAGCCACAGCGACCCCTTAGTAATGCCCCTTATCCAAAGTCCGCTCGTTATGTCGAGCTTGGTGTTTATTACCGTACGAACACCGAGCGAGCACGCGTGACTGTTGAGCCAACTTGTGACCACTGTGAGAGCATTCTATTGATCTGAGCGTGCTTATGATGGGGTTGGCCCAAAGGACTAGAGAACCCAGGCACGTTTTAAGTAATCGTCTCTTTGGTGCGGCGCCGGGCCAAAGGCGGTGGGGGTCAAATTATGTGTAAAGTCTCTATATGGTGTTTTATGACTTAGCCGAGGAGGACTGAAGAGCACGTCCTTCGGTACCAAGGATGTAATGCTCGTTATCCCAAGGTTCGACTCATTGACCCATCAAGGCTAGATTGAGAGTGCTTAATTCATAGAATGATATCCCCGCTTTTATCGTTAATGTCACTTGGGGGTCAGGCAGCAGTGGATCTCTAACAAAGACGAGTTCCCCGACTCTGAACTTAGCCGACGAGGCGTGTTTCTCCAGATCGCTCACTTAGTATATGATACCCACCGGGGACTGATCCACTTAGATTTAGAAGACCGGGACTTAGACTGGCTGATCCCTTTGGGTTTCGTACCATTGCCCGTACTGACAGTGGGATCTAAGTTCGCGACCTTAAAGGTCAAGCGCGTTCAGATATTAGATTCCACGGGTTGAAACCGAAAGGGGACCGACCGAGAAATCCAACGTGAAACCGACGCCGACCCGTGACGTACCGGCGATGAACGTCTAAGTATCTTAAAATAAGGCTAAGTGCACCGTTCCGACTCGGTCGTACCTGACCCCGGTTGACGCCCATATGGAACCGCTATCAATCTCATGAGCCCATCGGAGGAAGGTGTCTGATGACCGGATCGTTCGATCACACGACCATGAACAACCTTCCTTGATTATACAAACGGGACCCGACGGACCCCCAAGAAAGACTGTCGAGGTTGGGTACCCATGTGACTCCTTAGATGACCTGAAGCCGTGTGACGCTTAAACAGCGGTATGTTCGATCCCCAGTCGAGCAACTCGATTGTCTGAAGCGACCGGTACATAAGTACATCACGAACAAAACGGGTTAGTACCGAACTGAATTCGACCCCACGAAAGATTATAAAATCCCCTAATGACGACAGGACTGGGGTTGACCCCGTCCGTTCATTACGAAGACCCGATATGTTTGACCCAGCATAATATGACGCTGAAGTCAGAACGTATGGCAGAACACTTCTGGACAGCACGACAAGTAGAAGGCTCTTGGGTCCTGGTGGCTGAATGTTTACAGATGAGCTCGATTCTGTATCAGGTGGCCTCGGGCGGATATGTCAGACCAGCGAAGACAATAAATTGTACGATTTAACTGGCCGCGCCACTCGGCCCAGCCCGACGTGACATGACAAATTCGGCCCTGCACTCTGACCGCAGTACGGCTGACCGACGGGAAACATTAAGAAGACGACCTAATGTAGGGTTTGCTGGCTTAATTTAAATACTAAGAGCTGTACGACCATTGCACATACGGCAGGGACGAGCTATCGCTTTGGTTGAACCACACAGTCCCCGATCTGGGCTCTGACGACATTAGTGACAGTCCGGCATCGGTGTAAGGGTTGCGGGAGTTGCGTCTTAGTTAACCACGAGTAAAGCGTATTATCACTCGCGTGTCTAAAGCGTACCCCAATGCATCCCAACGATCGTGAAGGTAAATACGTAGCCCCCACAAAACCATTACTCCAAGTAATATGTGCGTGTTGCGCTCGAGGTCAGCAGCTGGGCCTGGTACTGGCTAAATACCGGCGCGCTCGCGTCCAATTAGATGGGAAAGTTTTACGATGACTATCTGATTGACGTTGAAACGAAGGGCTAAGAGGTTCGGAACTGTCATGAAGCTTACGGTGGACGCTGTTACCGTGGGTCCGTCGGCCCGGGTGGCACAGTTCTGCTGGGTTCGAATAGAGTTTAATTAACACCGAGGACATACGACGCAGCCCATGGCATGACATAGGGAGCTGACGTCCGGTTGTCAGATCTAACTGGCCCGGTTACCGTGGGCTCTTGGAGCACCCTGAACTGGCTGACGATACGAGACTCTACTTACCGCATGATTGAAGTAGAACCTACCGTTCCTTAAGATTTTGAGTTGTGAATAGCGTTCACCATTTGAGTATTTCTAAGATTACCACAGAGCCGGTAGCCTAGGAACCAGCATTAGAAGAGGACTAGAGCCGGTGTAAAAGGCCGTATTACCCCCGATCATCCCTCTGGCCCAGTCAAAGGACTGATTGGGTTCTAAGGATTACGGCACCACGGCTAGTACCCACGTACTGGGTGGGTCAGATTGAGGGTCCCCCGCTCCGCGTCCCGCAGCTGACTGAAGAGCAGCCGTACCCACGACTTAAGTGAACTAGATATGGGGCGTAAGGCTGGGCGGTAGGACAACCTTAAGCCGGTTTTGAGTCAGTAGAGCCTGCTGTAGGGACTTGTCTATTGTAGCTCATGTCCCAGATCAGGGGTAAACCCCGGGCCGTAGCGTTGAAGCACCCGATCTGCTTCGTGACGTGACGTGTAGTCAGGCCCCGTGGGTCGCCATGAGTCGAGCGAGGCCCAATGTTTTAATGTTATCTGAGAAGCTAACGTTCACGACTTAAATTAGATCCACTAAATCCTTTCCAAGGGACGCCGGTCAGCTGGCAGAGCCTGGGACCCCGTTCTTATCACATGAACTGTTGACAAGGAATTTATACAGACATAAGTTATCTATCCCCGTACCTGTGAGCATGCTTCCGCCCGGGTCTTGACCCGCATGTTAGCAGGCGGTCTCCTTTAGGCATGAGCGTTCGGGACCATTTAAGCCGACGATGGGCTCTGAAGGACTTTGGGTTGACCGACCCCGTAAGGCTCCCGCGAGCAGGTTGACGGACAAGACTGACCCATAGAGTATTGAACGACATCCCTCGTCCGGCCTGATCTTATACGACGCGTTATTTACTTACATCGATGACTGCTAAACGATGAGTGCATGAGCCACTCATGATGCGGCCAGCGGACGTAAGTGGCGTATGTAAATCACCCCTTCCGATGGCGCGAGTTGACGCGGTAGACATACAGCCCGTCCCCTTTAGTAAGACAACTCGTCATGTAGCGTGAACCCGACCTAATTTACTATATGGCCGGTTTTAAGCCTGTAGCCGCGTTAAGCAGACTGATCGGACATCCATCGTGGTAGGTCGTAATAGACAAGTAATGCTGGGCCGTCTGTAGACTTAGTCTAAAGCATTTGGATCCACAGCCCATTGTATGTAATCACAGCCCCTAACTATTCGGATTACGATTTATCCACGTCACCCGGATATCGTCCCCATGAAGCGGCTAAGAACCGATACATGATGATTATATCTGAGACTTATGCATTTAACAGGCGATGTCAGGCCTGTTGCACGGGCGCTAAATGTGAAGACTCAAGCAAGCTATTTGGCTGACCGTGCTGAAGGGACCCCGTCCATGTTGAATGACCATCACAGACGCGCCCGACTTTTACTAAGTGTCACTGACTGGCGTATATTTACGTTAGAACGTTGTTATGGCACGGACGTAAGAAGGATTAGAGCGTCAGAAACAGATCAGTGATATGTTGGGGCCCGAATTAGTCGCCGAGCATGACGTGACGACTTAGGTAGATGAAACCCGGGAGGACCGGAAACCTAAGGCATCGCGGACGTTCAATAATATTACCAACAGTAGTTGATATGTCACAACGGGGCGCCCCACTAGCCCTACCGGGCTGACCCCAACTGAGCCAGGCTTTTGACCCAAGAGGCGAGCCCGGTACCGTATAATGTCGGAACACTCTACGGCCCGGCGACGATAAAGATTATCACATACCCAGTTATCGGTAAAGATGACCCGTGATGACTAAAGCTTCCGCGAGTGCATGAAGTCGCCGTAATATGACCGTTATATGCACTCAGCACCGCTGGCTATCGTAATACCACGAGCCATCGTAATCCGTTGTCGGAATTATAACTAAGAGCGAATTGAGGGGTGTTCTACCGGCCGGCTGTTACGCAGTACCTACGAACTAGGACGCGGTCCCGGACCGTAAGAGCCATAAGATGGCGTACGTACGGCCACTAATAGACCCCGCCTATCTGACGGCAGGCCTTGGACTGACTTTCGTGACTGTAAGAAGGCTTTAAGTTGGCATTAGTCTCGTCCTGGTTATCTCGATACACCGCCACACTTAATTCTGACGCGTCAAACGTTCCCTTCTCAATGTTATGAGCTGAGCCGGGGGTACGCCTCGAGCCCGAAGCGGCCCGTTTTACCTAACTACGGCACCTAACGTTTATCACTTGCCCGCTCCCGATAGTTCCGTATTCACCTTTATTGCTTACCGAGCCCCAGCTGGCTCCTCAACAGGATTAAAGTTTGGTTCATAGGTTTGATTATACCGTCAAGTCCGGCAGGTAACAAGTTGACCGCGATCGACTCCCGATGCGATGACTTAGAGCCAATACTGTTACTTTCTAGGAACTTGTTCATTAGACAGTACCGTTTACGAATTAACCATCACGCCTACTTTGACGGGTCGGCCGGGTACGTACCACTCGCGTAGTCTACCTGAAGTGCGCGTCCCCAAAGTAGATACAGTAATCGGGCCACTCCGTCGGGCCTACCTACTGCTGAGACATGAAAGATCGCCAAACCTAGTTGTAAGCGGTTGGCCGGGCTTCTATCTATTCGTAGCGGCCTCCGAAGTACGTGAACGTCAAAGAATCCGTCCGTAACAACCGATGCGCGGACCCAGACGGAGGGATTAGTCGGAGTACTAGCACGAACACAGTCCTAAGTACTTAACGAGCGGCCGCTACGACTCGAACACCCTATACTCGAGGTCTACATGATTTAGTCAGACCTGGTTCGTTGATCCAGCCGGTCCGCGGACTTACGAACTGGTGTAACAGGTCGAGCGGCCTTGCGCTATCAGAGTTACGAAGAACTGTAATCACTTAGTCCTTGCGAACGATCCTGACCGGGAGGGTCCGGACGTCAATGAACAGAAGACTTATCAGAGCGGCCTAAGTTTGACATAGGTAGTAGGTCCAAATGGTTGAATTGCCGTCGTTACGACATCCCCCATGAACCCTGGACTTAATTCGAAAGCTTGCGATCATAGCAGATGTATAACTATGTATTATGAACTGGTACCGGTTCTTTAACTGTGAAGGTGATATCGATGACATGCATCAAGTTCTGGTTGAATTCTAATGGCGCCTCGACGTAGCGTCTCGCGCTCCTACTGACTAACATTGATGTTGACCTGACAACGCGGAGAGCTGGCGCCATTGTACGAGCCCGCTGGTACTCCGCAACCGAGCTGACCGCCACGTCCAAGAGGGAACTAGGCGATCATCACAGCGATAGGATGAGGGGAGCGGTGGGTTGACGTGGACAGTTATGATGGATCAGGCGGTGGATTGAAGTCGAGCATCCGTGGGCTTGGATTCGATTTCCTTAGTAGGCTGTACAGAGGCGGCGGCCAACCGAATAGGTGGAATTCGGAGATCGGCTCTACCGTATGATGGCGTGGAATATGAGTCGTGTCTTAACTCGAGCGACTCGAGGGACGTGAGGCGGGATCGGGGTTCGAGCGATAGAGTCAAAGAGGTCTAAGCTGACTGGATGAGAGAAACGCGATGGGCAGCAGGCATGAGTAACGGAGGTTATAGCCGGCCCGGTTACTAGGCATGCTGGGTGGAGCACAGCTGCATGCGTTGAATTGGATTGGATTCGATTGAATTGATCAGGATTGAATTGAATGGATTCGAGTACAGACAGAGAATGGCGATTACCCGGCATTTACACCATCCGGTAATGCCTCGTGTGCTTTACTAGGTGGGATCCGGCAGGCCGTCCTGAAGACGGCAGGGGCCTCCTTCTTGGCCCGTCGTATCTTTTATGAGACTAAAATTTTGCCCCTACGCTATCATGTGGCTGTAAACGGTTACCAGGCGTTTGGGCAATCAAACCCCGATGGCTGTCGCTCCGATCGTTAACGCAAACCATCATGATACGTGCGGACTTATGACACTCTAGCTAGCTGATAAGGACTCAGCCAATAACCGTTGAACAGATTGACCTGAGGAGGGACCCCGAATGGGACTATTTTGACTTCGCGACTTTTTACCGGCCTGTTTAGTGCGTGCTCGTTTGGCCCCCATCATAGCTCCGATGCACGGGTGGGCCAAATGGGCCAATACGGGACTATCGGCCGTGCTTGATATCGATCGCCGTGCCGCTACTTGAGCGTACGTGAGAGTCTCGAGTGGCTCATACCCCATCGTCCGTGTATCCCCAGGTCTGTACGGGATGACCCCATCATGATATTAGTGATGATCGGTTCTACGATTGGTGATGGTCGGTGGGACTCGTAGTTAGATGTGTAACTGTCGCACGTCCGGCAGATCGTACAATCCGTAATGTCGTCACCGGGGTATTGGCGGTACCCGATCACGATTTGCTGGATCCAACGCTGTGTATGTAAATTGGTAAGATTTTACGCACCGTGACGGAACCGCCTCTGACGACATAGTGCTGTCGACATATTAAGACTCGACGGCGACTGGTAAGCCACAATCGAATGAGAGACCTTACGGGGGTGCGATGCCCGCTCATTGGTAAGAGCTAGCGCGGGTAATGAAGTAGTTGACCCCTGAGGTAACCGCTTCGCCGACGTACAACGGGTCGTCGCGGCCTCCGTCTGGTTTCATTACTTGCTAAGTGGGGTTCACGGCGTGACGGACTAGAGATCACCGAACGGTGTACGTACCAATGTGGACCGTCCGTCCGTAAGATACGCTAAGTACTAGAACATAGACCGTAAGGACCGTGACGCTTACAGCTATAATCTTCGGGCCAAAGGCCATAATACTATGCTTCGAGCCGATGGACGCACATTTGCGTGCTTGTCTTAGGCCAAACAAAGGATTTAGTCCTATTGGCTAACGATTATGAACTAGGTTCTTACATAAACAGTCGGATTCGGTAACTTAGTTGATCGTTTACTAAACCCGTACACGAGTTAACCCGGGGTCATAGTGTTCCTCAACGAAGTAGGAATGTTATACGCGCCGTGACCGTACCCTTTAACGGTGATAGCTCCTTACATCTACATCGCTCGATGAAACGCTAAGTAAGAACAGGTCAGACAGACCGGATTTGACTTAGACACGGCCATACGACCCTGTCTTGGGCTGTGCGCTGTGTAACACCAACCCTAAGAAGACCCATATCCGTTATCAACCGGCCGTTAAACAGTACTCCACCATTGACCCGCCTTACCACCTTTACCGTATCAAGCGCCTTGTCGAAACCTGTGGACTTGTAGGTTGTGACTCAGTAGGCGACCAAGCCCGACTAAAGTCACGAACGTTCTTACGGCAATGTTCTAGACTTATGACGTGTTTAGCGTGCTCTGAATCCTCTGATGCGGGCAGCTCCTTCCTGATGTACGACTGTCTACCCCGATGGGCCTACTCACGGTTGAATGAACTGTTCGACTGTTTATCGTCCAGTATGGTGGCGTTTAAAGCTGTTCCATAATTAGGACTGTGAGGTTCGGTTATCTGGTTAAGCCGGGTGGCCCCGCTGAACGCGCTCTTTATATTACGACAGGATACAGGTATCTTACATAAATGTTACGTCTTACCGTAGGGCTCCGTGCCCGGATCCGCGAACTTAATAGCTCCCGCTCTACTTATGCTATAATGATTAGGGTGAAGAGAGTTAATTGGACTGCAGCGGTTGAGATCTATTTCCTTTGAATTAGGGCCCATTGCGGCCAGGGCCTAGATCGCTCGTCACCGTTATTACACGTATCAGAGGGAGATAGTTTGAGTCCTCTGGCTAAACCGGGACCTACGAAAAAGTCGATTTAGGACCTTGGCCGACAGTAGCTGGCGTTTAACAGACATCCTAGATGTGAGGTGAGAGTCCAATTGATACGTATGCATGAACAGAGCACTCGAACCCTAACTAAGTCTGCAGGGTACAATATCCGCGGTTCCGGGTTGACAGTTCGGGCCATGACCAATGGTGGGCCTATCAGGTCTGTGAGCCCGTTAGATGATCGTACCGGGCCCCTGAGGTGGCGTGGCTACGACTTCGTCCGGGCTCCGGGCAGAGTAAACCAATCTTATTTCGTTGAAACAAACGAGGGCGGCCGTAATACGTTTAGCAACCCGCACGTCAGACCACGCCTGGTCGCTCGACTGGGTAAGGCTTAACCTGAAGTTAGTTAATAGCCGACTTGGGGTTAGGGGTACATCGTAGTACTAGGTCAGCCTACTTCTAGGCTCCCGCATGGGGCGGACATTTAGGCCCTGGGTGAAGCGACAGACCTGACGCGTTCGGACGTCTGAGCCCACGGCCTAAGTACGTGGTTGGCGTGCTAGTTTAAGCCTGGCTCAACCGGATTAAGTGAACGCTACCTAAACGAAGGCGAGGTTGACCCAACCCGCCTATCAAAGAGAACAGCGACTGCCACTCGATAACAGACGCTCCGTAAGTCAAACCATGTGATACGTCTGGTTGGGCGTCTATCGCCACGAGTATATCCAGCAGGTAAGTTGTAAGAAGCAGACAACGACATGGAATCTATAAGGTTATGTTGTGACGATGAACCTAGTGATTTCGTACTTCACGCGACTTACCGTCTCTTGAATAGCCCGAAGACTGCAGCATAACGACAGACAAAACTAATAAGAGGGTACCGAAGGGTACCGAGTAACAGACTCGAAGAGCTAAGAAGAGCTTGACCGGCCTTACGAGCTGAGAAGACCCTACCGATTAAAGACCGAACAAGCACTGAATGTAAACAATCGATAGTACAAGAACGTATGATGGCGGTACCATAGGCCTGAAGCTAGAAAGCCGAACAGTCCGACTGCCCTGTTAATCTTAAGCAACAAAGTCTAGTATGTAGCATCCTCTAACTTATGTCAGACGCGACCCGTAACAGCATAATCAAAGCCAAACGATAAGCCGGATTGTGCGGCCGTGAGTTTAGATTGGAGGTATAGGCTAAATTAGCCTGTTATCGAAAGAGAATCCGCCGTATACCAAGAGACGCTGCTACACAACCTTATGACATCCTACAAGTCCGTACCAGGGACACTATGGGGACGGCGCGCTAAGCAGGCGATTGACAGCATAAACGGTAAAAACGGGCCCGTATCGAGCGTAATGAACAGAGCCAGGACGACAGCCCAAGACGGCACCATTAAGGACATCTAAAGACCTGGGGTAACCCCGTCGAATGTTTAGATAAGAAAAGACCTGGGCTGAAGACTTACGCCTACATATGAATACCCGGTGGATAGATGGTGACCAGCACGAACATTATTGTCTAAGTAAAAGTTGAGCCCACGATACGCTTTATTGACAGAATATCTGGGCTCCTTGACTTACATGATAAGACTCTACGATCACCGTTCCCGCCGTGGTCCGACCACAATGGTGTAAGCATACATCGTGATGGGGTCAGGCAGATGGGCTAGCCGGGCGTCATTTTATCACTATGAACAGTTGAGGCCGTGCGACGGTTGAGCAACCGCCTATCGATTACACGGTGTTACAACAGCCTTTACCATTAGATGGGCACTGGCGGGGTTTTAGCTAATTGATTTACCAAAGAGCGACCCGGCGTGTAATTGAAATTGGCTGTGGGTCCGTTATTACACCGGGCCTTTCTTTAAATTCGGATAAGGTGTAAGACAGAGCCCGTCTATAAGCGTCTACCGTACGTTCCAAGACACCTGTGTATTAACACGACGAACCGAACGATCAGAGCCGGGCTCTGTATCTTAGCCTGAGTTGACATGACAGGATTAGCATTGGCGTGAAGCCCAATACTTATCCGTTCTCCAGGCTGTAGGGCTACGTTCAATAGCGTGAACCGAATTATGTTCGTTTGGGTCTTAGAAATCCTTTGACTTCGCTAGACTTGAGTCTATCCATAGGCATTAATTACGTTATTTACCGGAATCGGAAACCACCGTGACCGTTTGGCCCCTCCGGCGGCGTAATGGATTAGCGTCTGGTCTTAAAGACCTGTGGAGCGAAAGTGGGACGCCTGGTCGTCTTTAGATCAATGTGACCTGTAAAATGTCCGTTCTAGAGTTTGGGCGGTATGGTCAAGAGGACAGGTAACAGTAT *
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
10 7 16 utg000001l 41574 60 4666S11M2D3M1D6M1I1M2D6M3I11M1I4M1D3M4D5M2D3M2I6M1I11M1D23M1I6M1D14M1D5M5I9M2D8M6D5M2I2M1D3M1D4M1D2M1D4M1D3M2D2M3D3M3D8M1D39M1I5M2D5M2D4M1D2M3D4M1D5M1I17M3D8M3D17M5D1M5D4M1I6M1D1M1D4M1D9M1D1M2D5M4D23M2D14M1D10M1D11M1D13M1D9M1D14M1D3M1I9M1I24M1I5M2D6M2D22M2I2M4D20M1I4M2D1M1D4M3D4M2D1M1D7M1I7M4D7M3D8M1D1M2D2M2D1M3D6M1D6M1I5M1D11M1D4M1D1M2D12M1I10M2D4M1D19M1D1M1D10M5D1M1D2M2D12M1I6M5D6M2D13M2D1M1D6M5D10M1D10M2D13M2D8M1D4M1D22M5D3M1I9M1D2M2I7M1D1M1D3M1D4M1D4M2I5M1D7M3I7M1D2M2D7M1I15M2D1M1D7M1D4M12D10M2D2M3D2M2D6M1D5M4D1M2D7M3D3M2D8M2D4M2I2M1D7M4D2M1D5M2D7M4D4M5D12M4I4M1I4M1I1M1I7M1I1M2I8M1D30M6D24M1D2M1D9M1I7M1I2M1D5M2D2M1D1M1D4M1D5M1I9M1I3M2D9M3D16M2D1M1D8M2D10M3D19M1D5M1I14M2D1M1D7M7D11M1D5M1I2M1D10M2D1M1D5M1D7M1D2M1I6M3D6M2D6M1I3M1D11M1D9M2D6M1D3M1I5M1D7M1D21M2D34M3I4M1D5M1I10M1D2M3D3M3D4M3I5M1I10M1I7M2D5M3D2M1I2M3D1M3D8M3D11M1D3M1D5M1D3M2D6M1D3M2I5M1I21M1D8M1D1M3D2M2D2M2D7M5D1M2D1M2D4M1D4M1I12M3D1M1I2M1D2M1D2M3D24M2D13M1I18M2D18M3D5M1I7M1D8M5D2M1D2M1D4M2I29M3D4M1I12M1I19M1D4M1I14M1D2M3D13M2D4M1D8M1I6M10D7M1I7M1D7M1D7M1D5M1D17M1I5M1I2M2D10M2I4M1D5M1I9M1I9M1I5M1D10M1D6M6D15M1D7M1D9M3D7M4D4M3I18M1D8M8D13M3D3M7D2M1D8M2D2M5D6M2D2M1D8M1D4M2D15M2D4M1D3M1D5M2I3M6D3M1D1M1D5M1D8M1I3M1D22M2D5M1I14M3D7M3D2M2D18M1D15M1I38M1D6M1D4M1I2M2D17M1D12M2D4M2I16M2D20M1D7M4D7M1D4M1I3M1D6M1D21M1D3M1D8M1D9M7D2M2D2M1D23M1D10M3D4M1D17M1D3M3D2M2D5M2D6M2D11M1D6M2I7M1D14M1D10M2D8M3D14M3D6M1D6M2I5M1D19M1I9M8D1M3D5M3D2M3D3M1D6M5D11M1D8M3D5M1D3M1D3M3D3M1D2M1D6M7D10M1D4M2D5M4D3M3D10M1I5M1D5M3D1M1D5M1D5M1I8M1I9M1D26M3D21M2D6M1D6M1D3M2D13M1D4M2D9M3D18M1D16M1I4M4D16M1I16M3D3M2D6M1I20M2D5M2I21M1D5M1D6M1D23M1D18M1D1M1D28M4D6M1D3M1D3M1D10M4D10M1D2M1D21M2D11M1I8M5D19M4D1M2D5M2D6M1D5M3D2M1I13M1I1M1I11M1D7M1D10M2D3M1D1M1D9M5D5M2D2M3D2M1I3M1I3M3D4M2D15M2I4M2D2M3D6M4D3M1D5M2D4M5D2M2D7M2D4M3D4M2D1M1D6M3D12M2D25M1D4M1D6M3D7M1D6M11D7M2I8M1I6M10D6M1D6M3D14M2D7M3D18M1D6M1I1M1I3M1I3M1D2M1D6M2D4M1D6M3D1M2D11M2D5M1D5M1D4M5D4M1D10M1D2M1D12M1D4M1D2M1D3M1D14M4D4M1D4M1I1M2D3M2D4M1D5M3D2M1D2M4D12M5D3M1D3M4I4M2I18M4D10M1D6M3D2M1I2M2D13M6I2M1I3M1I26M44D7M1I3M2I4M1I2M1D6M4D10M1I5M1D6M5I2M2I1M4I9M2D5M2D11M2I3M1I8M1D2M1D6M1D7M2D16M5D2M1D1M1D4M1I1M4D6M1I8M1D10M3I11M1D6M1I22M1D8M1D16M1D4M2D4M4D6M2D15M1D3M1I10M2D12M3D4M1D15M1D1M2I8M1I4M1D18M2D2M2D15M1D16M3D39M2D2M2D16M1D3M2D2M1D4M2D1M3D4M3D4M1D1M3D12M1I6M2I4M2D2M1D10M2D4M1I3M1D14M1I11M2I9M2D8M1D7M1D2M2D5M1D26M2D1M5D5M1D1M2D3M1I2M1D6M3D3M1D12M1D13M1D1M2I16M3D4M1D2M5D14M2D11M1I1M2D4M1D6M2D8M1D3M3D9M1I3M1D18M1I1M2D2M1D15M4D3M3D5M3D17M3D6M1D6M2D12M1D6M1D11M680S * 0 0 TTAAATAACAAACTGTAGATGTGTGTGGTCTGCTTCTTACCGCTCTCTTACTTACTTCTCATAGCAAGCAGGAAGGCACCGAAGAATCCCACATGGTTGGAATGCCCGCGGTCTGTCTTGCCCAGTACCCTCGTCGCTGTTCTCTTTCAGGCGGCGGTCTGGTCGTAATCTCCCTTCGTGCGGCCTCGTTCGCCCTGCCTGCCCCGGCTTCATCTCTAGAACTAGATGCACTTACAATGAGTACCCAATCTGCCCCCACGTTATGGATCGGCTCATCGCCGTTCGACCTAGTCGGGTGTGGTCCTTCCTAAGGCTTCAGCGTATTGTCTACTCACGCCGGGTGCAGGAGCACTCTCATGATGGGGGTGGCTCCTCCTTTCCCCTAGCTCCCTTGCTGAGTACTCGGTCTGCTAACGTAGCCCTGCTGCCTGCCCGGGACTCACAGCCACCATCTGCCGTACGTCGCCTGATGCCGGAAGCACAGCGTTTGTTGCAATGGATTGATGCTCTCCGGCTAGCGCACCCTTCACCGCTCGCCCGGAGGCGCGGAGCGCCCCAAGGAGGTCCTGCCCCATGTTGCAGCGGATAGCCCTCAACTTCTACGGCCTCTGCCGTGACTACGTCAATGAGTCTGTGCTCGCCTCCGGGATTACTTACAGCTACGGCATGCCCCCTTCATTCTGTGCGACCCCTGGCTAACTTCCCTCATGATGTTCGGCCTGTAGATTCGATATTCAAATCCCGCTATCTCGCGCCCTCTCTTAGCCTCGTGACTTGAACCAATCGCGCCTCGCGTATAGCCTCCTCAGTACAACAATTCAGCCCCTCCGGGTGGCTCGCTGCGGTACCTTCTCTTCATGGTACTCATTAATCAACGTCATGTCATCGGAAGCGCTTCTCTTCCTTCCCCTTCCGGCCATAGCCGAGCACTCGCCTTGGGTTTCTTAATGGGCTAATTTCATCCTGTCAAGCGACCTTCGTGGTTCTCCTCGCAGCGGTTTCGCCTGAAATCCGGGGCTGCCTTGAGCTGTACCGTAAGCCTGATGGCATAGCCACCTGGAGGCAAAGGTGCGCGAGGATTGGAAGGAGGAAAGCCTGTAAAGTGCCGTCAGCAACAGTGCAAGTAATGGGGGCAGCAACTGCCGCCTTTACTATCGCCGATCGCGCCCGTTCACCGCGACCCCTATAGTTCCGCCTTCGCCGCATCGGCTGCTCCATGCGTCCGTCAACTGTCTTTCCATTATTGACACCTCTCATAAATAGCTCCTCGGCCGGTCGCTCGCCTTTTAAGGCTATTACAGCCGTCAATGTGATACCACTATTCTTACTTATAAATCTCTTTTATAGCTTTAGTTCAGCGACTCCTGCCGTCGTACTTGCCTAATCGTCGCCCCCGACGAGATATCGCCTCGGAGCGTCGCCATTCTGACCATTCTTCGCTTCTTTGCGCTTGCCTTCTTATGACCGCCTATTGTTGTTACTTAAGTCTATACGCGCTTAAGTGCTATCAGAGGACATGACGTCCAGACCACGTATAGAGAAACCCACGGCGCAGAATGAGAGGAACATGACTTAGACCAATCAGTGACATGTAATTTTGAACTAAGCAACTACCATTACCGTAATACAACCGGAATGTTGACCTTGCTGCAGCAACTAGAGTCACGGTGATAGTCATACCACTGACCGACGGTGGCTTTGTTTGATGGACACGCACGAAATATTGTCGGTTACTATGGTAGAGCTGGAAGGTCAACTAAGGTGCTCTGCCCTTCACATGAGCTGAAGGCGTCACGGTCATGCCGGTTGCCTGTCATAGTTGTGATCTTGTAAGTGACGTAAAGTAATTGGTACGTGCAGGCGGTACTTCCTTCTAGGTCACATGCTTACGATACTGCTGACCCACTGAACACAGCGAAGGAGTCGGGAATTACATAGCACGGTACTTCCTGCCTCCGCTCGCTCCTGCCTTCTCGGCATCCAGCGTGAAGTGGTATCTCAGCACTTTGGTCCCTGCCCGATGTCTAAGTCCAGTCTGCATCTTCATCATCGAGATAAGGTAGTCACAATAGAGCGTCAGTTCTAAGCGTCAGGTCTTTAACTTTAAGACGCGACCAGTCAACGTTGAACAGTGATTCACGTAAGGTCGCCTCAGTAAACCACAGGTCCGGCACTTTTACTAGCATTGTAGGATTTGACAGTAAGGCGACCGTAATACTTTCATATAATAAGTCAATTCGGCTGAACTCAACCTACGATGTCGTCCCAGAGCTTAGTACTACATACACTATATGATCAAATCTACGTGACATAGGGATATCGATAAGGATAATCTAATCCATCACGATCATATCTGAATCTAATAGCAGCAGGAAAGCGCGGAGAGGCAGGTGCAGGTTTCTATAGTTGTATTTACAGCCGGTGAGATAAACGGCAACTTCATAGAAAGTGGGCTCCACCAAACATCTATAAGGTCAAAAATTCCTGCTTCCTGCGGCTCCTGCACGAGTGCACGTATTCAGCTCATTGCTTACCATCTAAGTTGATGCTGCATAGATAGCCATATTTAGAAGACGTTCACGTATCCTTAATATTTGTTTAACGTGGTCGGAGCAGTAAGGATAGGGGATTCACACACATCATGGGTAACGAGTTTTCTACATACACGCTGCATGACATCTTAAGGATAGGTTTTTCAGTGAATAACTCAGGGAATACAGAATCACCAAGCACGCTGCCATAGTTAAGGAACGCTGCCTTTACGCTGCGACGCGTCTGAGGAGGAAATAACAGGGGCATTACCAGCTTTACAGGCAAATCCCCGGTTAACTTTGATTCTACTTAGATTTGACCGTGGCCTTCATAGCCTTCCTTGGCATACGCAGCGATAGCACGAGGCACCGAAGGGAATGGTACCGGTGAAGCAACGGGTTTAATAATTTAAGCGTAAGAGCACCGTTACTGAGGTACGGAGGCGATTTTCAACGGGTGAGTAAGACTTCTCTCTCCTTCTCGCTTCCTCGGCACGGTGACCTCAGAGTCACACCGTCATAAGATGACTTCAGATGTAGCTCAGCAAACATTACCCAGAAATTTTCGGAGCAGATGGTCAGTGTCTCACGCTTAAGTGCCGCATACCTAAACAAAATCAGTAAAAGGCTGGAGTGCAACGGGGCACGCTGTCAGCATAGCTGATATTTTCCAGGTCATCAAACACGTCTACAGACTAATATGACGAGCAGGATGTAATGGCTGTAGTTCCCATACCCGGTATCGTTTCATACTCAGGGTGAATGAGCATCGAACAGTACCCAAACCACTACAGGCCTCCCCGTTATTGCCTTCATCCGATATGTCCGTCATGGGCTGCCACACCGGCAGAGACGAAACGCCGTCGGCAGTACACAATTCACATCACCACGTGAGTGCAAGTGATGTAAGTATGCAGCATGAGAAGAAGGAGGAAGTCAGAAGTATCCCAGAATCACGGTATCCATGCTAGCATCTAAGGCCCGTTTACTTTAAGTCACACTTCCCCGTCAGGCTGTCTGACGGCTTCCTCCTTCTCTCGGCCTCTTCTCGGCCACACGAGCGCCATTCTTCTTTCGTCCGTCAGGCTGACATCACGTTCGGTCGATGTCATAGAGCGGAGACGGCGTAAATCATGATGTCGTCATGGATCCTCCACAGAAATAGCTAACGGTTACGAGTTGTACGACGCATACATAGATAGAGCAGCATCAGGCTGCTGACTGAATCATGGTAAACACGGATCAGTGGTTCGCCGGAGTCATAGCTGAGAAAGCGATTATTAAGTCACGCTTGCTGTCCCGATCCTGAATGCAGTCATAGGTAGCGACAATCAACCTGTCGCTGAGCTCTCATACGTGTTTGTCTACGGAAGTTCTTTACCGTTTCACGTACTGTTAGGAATAACTAAAGATGGCCATCTGGTAATAAGCCCTTATAGACACCGTCGCAGTCGCATAGGCGCAGCTCGAAGCGAGTAAGACGCCTATATCTAGTCTCTTGACGGCTTTGGAATAGAACGGAACATGTCAGGTCAGCTCAATTTGACACTACATGGCGTCGCCCCTTCTCGCGTTCGATGGTGTCGGTCGGTATACGTAAATGTCACCAATTGCTCTATACGTGCTCAGGACTGCGTATTACTATGCGCACTTAGCCATCACTAACGGATCGAAGGCTTCACGGTCATGTAGTATTGCCCTTAATAAAGCAGAAATGCCTGCATCTGTCGACTGAGCAAGGCCAGCTCGTAATTCTGCATGAGTCGGTCCATGAGAAGTGACAGGTACAGATTCTGCCAATGTCCTCATGCAGGGCGACGATGATGCCGTGGTTCATGCTTCATGATGGGCTAAATATCTAAGCGTAATTCAGGTGGAGCTCACAGGGAACGATAACTACGGAAACACGGGCGAAACATACAGGTTTACCAGTCAGAGGCAACGGAGAGAAGCGCGGGCGAGGAAGGTATCACGGAAAAGGACGTAAGAAACAGTAAGATCAACTTAGTCCTGCCGGTTAAGAGCGTGGCGGTTGTGGTACTAACATTCAAAAGGGCTGAAAATTCCTTGCGCTCGTAGCGGTCCTGCCGTTCAGCAAACGGTACCTACGTTTTGGTCGTCGCTGAGCACGGCCCAGCACATCCTCAACGAACGTAGGGACTTGTCAGAACGTAAGCGGTAGGCTTGGTAAGCATAACCGCAAGAATGCCAACGGCAGAGACGTCGGTGGTGCCATCCCACGCATCAGCTTACGGCTGAGGTCCATCAGCGTCATTTAAGAAGTGCCCTGATCCACCTATCGAGGGTCCTTATCAGCCGTATACTGTTGCCCTTAGGCTGGTAATGGTAAAGGTTTCTTTGCCTGATAACTTGATAACTGTGTCAGCTAAATCGTAGACCGATCACCATCCCGTACCTGCAGCCGTAGTGGGACGCAAGGAGGAATAAGCGCGCATTAATATCTGTCTTAAGAATGCGGCGGCCGTTCACGGTCATACCGGGGTTTCTGCCAGCACGCGTCCTGTTGTCGCGTCGTGAGCCTCTCACAGTTGAGCATTCGCCATAATGCGGCTGTTTCCTTCTGCTCCTGCTTCTCGTGAGGCGTTCGTCCGGCTGCGTCACCAAAGCAGTTCACCGTCTAAGGCTAAAAGTCCAATAGTTATGCGGGGTCGCTGGAGACCGTAATTGATCTTTGGTACGTAGATAGCAGATTAACGTGATCTCCTGCATACGCTCGGTGGTACAATACAGTGATATTTAAGTCGGCATAAGTCGCTGCGGTAGACCTATAGTACATGTACTGCGGCTCTAAGTGTACAATATGCACGGACAGCTTATATTACGTTGTGCGCAACATCTGATATTGCGTCCGTAAATGCAGTGTCGCCGGACGTCATCCGGAAGATGAGGTGATGCCATCACTTATTATCGTCCGCTGTAATCAGGGTCATTCCACACCCTGTTTCTCAGCAGTACACGTAATTACGGAGAGAGAGGAAGCGATGGAGGAATGCTCTACCGGGAGCGGCGACCAACTCTGCTTCAGTCATGTCACGTGGCAAGCAACAGGACTAATCTACAGTTTATGTTAGCAAGGGCATGTCAGCGTAATGCCCTCGTGCCTTCCCACGGCTTGTCCATGTAGAGCAGAATGCCGTCATTAAGATCGCTGGCAGCCTGTTTAAAGGGAGATCGTTGTCTCAGTCGACGTACCCCAGTACGGCTGCATGCAGCCCGTCCAGCTCACCGTGCCGGACAAGCAGCACGGCTGCCGTTCATCTGATAACTTAGGCCTGTCGTGGTCCGTCATCATACAGCGTAATGCCAGCGTCGCTTAGCCTCGCTGGCAGTCAGCTTCGCCGACACCGATACGTCAGGCTGATCTAAACATGGCTGCAGGCACAAACGCAACCTAGATAGCGAGGTTCATCATTAAGGGCTCATTAAAGGCCATGCTGGCAATATGCGGAGATTACTAAGCTCTGATGTCTATATTCTCCTCTCTGTTGATTGATCAGGAATAAATCAAAGTGCTGCAGCCGGAATAGGAGCAGAAGGAGGCACGGCGCATTGTTTCACGGACTTATGGCAAATTTCTGATATAGTACTTTACTAGGTTTTTGCGCCTCTTCTCCTGCCTCTCTTCTAAAGCTTCTGAGACAACCATCTGATGTCTTCAGACCGTAAGCTATCCAGTCTAAGTCCCCAAGCACTGCGGGCTTCCTGAAAACTGAAGCGCTTTGAAGGTAATCAGAATGAACGATGGCTCTTCCATAAGAACATCTGGCTCGCCTGACGCATGCGACGAATTTTCACCTAGATAAAGTACTCCAATACTGGGTCGGACTGGCCGTCGTCGTGGAGTAGGTATGGCGTAATTCCGGAAGCGGTAAGCCAGAGACATCATGAGCATCTACCAAGCAGTACTGCTCAACACGAGTAGCCGTTATCGGTGGGCCTCTACGTCTGCAGGTATTCAGTGATACAGGCATCATGCTGCGGTACCTTTGGCCTCCAGCCGACCGGGGTGCGTAATACGGCATTTGACCAATCCAGCTCAGCGTCGCCCTATGCTCCTCTGTGTTCTAGCCAGAAGACGCAGAGGGAGGAAGCGAGCAGGAGGTACCTTCACGGCTATGCACTTCCCTTCTTCCATAAGTCGGATATGTCATGGAATAATAGCTGTAAACATTTAGCACTAGAGTCTGCCCGTCTGACACGGTTCAAAACGTGAATGAACGGAGGCGCCGGGTAACTCACGGGGTATCATGTCACTTTCTGCGGCATCCAGCCAGGATACCCGTCCTCTATGACGTAATATCCCAGCACGCTACATGTCATTAACTTAGACATGCACGGCAGTCGTCTATGTTGTCATTATTGTTTAGTGCTGATGCGGTCGGGCTGACCATCAGAACTTGTCACGGAAAGCCGCGACGAACTGGTATCCCAGGCTGACGAACAGTCATAATTAGCGGTACAGTCGCCGAATCATCATGGTAACGTGCGTTTCACCAACGTCAATGCAGCAGTCAATAGGGCACTCTTCATGCCGCTTCACTGGGGAAAAGCACGGCTTCTTCCTCCCATGCCAGATAGCCAGCGGGAGTATGACGGAGCTAAAGACCGACGATATGATCTGATGCAGCTGGATGGCGTTTATTGGAGAGGCCACGGAGGGGCATCGGAAGAAATTGTCAACTCGCTGCTCCCTTCTCCTGCTTCCCAACTGCCCTCAAACGCTGCTCTCATGCTGGACTATTCTAGATAGCGGTCGGCCGTCAGACAGTGGGAATGGTGGCGTTTTCATACATAAATCCTGCAGTACCCGGGTCGCTGTGTCATGCCGGTCGCACTTCAGCGGCAATATATTTTAGTCACGCATATAGTCAACTCTAAGTGCGTCGTCTTCTGTACTGTTAGCCAGGTTACCTGTCATCAGTATCATGCAGTGCTGAAGCATGAAAGTTCTTCTTCTAGCGTCATTCACTCTCCGCGGATAAGGCACGGCGTAATCTGCCATGTTCTTGTTTATTGATGCTAATACTCTTCTGCAGGCTCGCCAGCAGGACTGAGATCCAGCTGCCAGCGGAAATACTGATGCCAGGCCTCAGCGCATAAAGCAGTCGATGCTCATTGGGTCGCTTTTATGTCACAGTATTTTGCCTGCCATCATAAGTCGACCTGCTGTTGGTCAGGAGGCGAGCGGAGAATGAATGGAGGCGAGAGTTATTTAGAATGAACGGACCGGGAAGCTTCTCGCTTCGGGGTGCGGCTTCCTAGTGATGCTGTCACGGTATCGGTAAGTCAATCATGGTAGCGTTTGTTTCGTGGGATGCTCTAAGCTTCGTAGACGGTTTAGCCGTAATGGGGATAGTCTCGAACAGCCCAGTTTTAGAGCGTCATACAAGTGGTAATCCCGGCCCAGTGGCTTCCATCGGATATGACATTCTGCACCATTCGGCGGTATAGTTTTATTGATGGCCTCATCACGCATGATAGTCGTTGTCATCGTCGTGAGGCCATAATAATCTGCTTCAAGAGCCAGCTTCTACGGCCCCCATCCCCATACGGATTTGGTCGTCAGAGGGAGTCGATACCGTCAGTACTACAAGTCAGGAAAGCCTATGAATAATGCTCTTTCATGGTTAATACTTCAGCATGTAAAAGTTCATTTTCGCCTCCACGTTGTACCGAGCGTGGTGTTAGGAAGAACCGAGAGGCATGAAGGAGCTCCCCGTATGCCGGCTGGAGTGCCATGTCACAATGTGATCACTATGTCAACGGCTGCAATGGTCGCTTCGCCCCTTCTCCGCTCCAAACAGAGAATGCCAGATCTACCAGTACGTCCGGTCTTCTAAGATAACGGCGATCAGTAAATCAGTAGTGCTGGCCGGATGACTAAGCATTATTAGGCTGGCAGATAAAACACAGCCGGAGGGTACTCAGGCGTCATTGAGGCCAACGGCGTCTCTTTGTCGCCAATTACACTGCTCCTCAGCAATGCGGCACAGGCAACATGAACGCATAAATTAGGATTAACTGGCTGCAATAGTAAGTGACACTATGCTCTCACTTTGTCGTGGATAGATGGACTTTACAGACGAGCCTTCAATACGCTTACCCAGGAACGTCGGAGAGCCTTCCTGTTCAATATCAGTAAAGCAGCAAGTCCATATACCTAATACTAATGACCGAATGGAGGCTTATACCGCAGCCAGAGGAATAAGGGACTCAGTTATCAACGCTTCATGGTGCCGTGTTATCTAAGGTGCTTTACATACCAAGGGCCATGAGCAGGACGGAATATCGCTGCTCCTCTATTCCTTCTCTAGTCTCCGGCATCATCGTCGGCAACCAATAAGGGTGTTGCCTATGCTTATGCTCTATAACGGCTACCAACAGCATTTAGGAATAACCGACTATAAGCTGTACGATTCACCCACTGTATTACCTTGCCCCATCGCATTCATGATGAGCGCTGAAAGGCAGTATTCAGCCTTCGTATGCGGATTTCTTCGGAGATATAATTAAGTGGCCCATTCAACAGCGTTCTGTGGCTGCTATGAACATGAGCGACCCGGCGGACAACTTAGAGGCCCTTTATACTTAACTTCATCTGTCACTGATACCAAGTGTATCATTCAGCCGTCCGGCGCTGCTTTGTTGTTGGCTTTGATGAGCGGAATGGGAAGAATAGAGTGGAGCGGGTATTGACGCCGTGCACCGACCTAGAGCCGTCGAGAATACTGGCAATTTACCTGCGATCCAGCACAGCACGAAAGTACAGAATGCTTCCTATTCAAGAATCTGATGTCGTTTGTAATGTGGGTCATGCGCTTAGTCGGCGTTCCTTCTCCTCCTCTTCTGAGACTCGCAGCCTGATAGGGTCGTCTTCACTCTAAGCGCCTCATCTTCGTTCACTTCATCATCCCTTTCTGATACCATTTTTATGACGACCGGTGCAGAGTCATAACCACTACGCTTACCTGCCACCGCTCGCAACGGCATTCCTGTTCTGGTCGGATCTGATCAGATACTCACGAAATGTCAGCTCATGCTTTTGTTGACTTTCCATTGTTCGGTTTCACGGACAAACAGAAAGGAAATAAGAGCTAAAGGCCTTCATAGTGGTTCCTTCTTTCCAGGTATTTAAATAACATTAAGTATGACGAAGAAGAACGCAACGGTGAGGAAGCGCAATACCGCTACAATTATAAAATTAGAGCCCTCAGAGACCCG * tp:A:P cm:i:27 s1:i:177 s2:i:0 NM:i:1735 ms:i:538 AS:i:430 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
11 8 0 utg000001l 20836 60 22S9M2I57M2D11M2I2M1D15M4D17M1I15M1D3M1D3M1I24M2I8M2I9M2I24M3I21M2D31M1D20M1I6M1D10M1D20M2I7M1D13M1I7M4D6M1D22M2I7M3I46M2D6M1I17M1D8M1D27M1I2M2D21M1D11M1D3M1D13M2D9M1D11M3D7M1D25M1I5M1I7M1I6M1I34M2D13M1I3M1D4M1D10M3I2M1I4M6D39M2I13M3D4M2D5M1D2M1D4M1I25M1I17M3I15M1D33M2I4M3D6M2D12M3D7M1D4M1D13M3D4M1D13M1I6M1D12M1I8M1I4M2D4M1I12M1I26M1D15M1I13M1I6M1I22M3I1M1D8M2I11M2I10M2D18M2D46M1D13M1I6M3I12M4D2M1D14M1I11M1I17M2I7M1I8M2D14M1I10M1I8M1I18M1I3M1D4M1D5M3D21M1I2M1I21M1D17M2D23M1I23M1D13M1D1M1D3M1D18M2D10M4D3M2D32M1D3M2D3M1I15M4D2M2D3M22D39M1D33M5I5M1I7M6I4M2I6M2I9M1I3M1D2M1D6M3I6M2I6M1D11M1D18M6D4M1D15M1I23M2D6M1I7M1I13M1D12M2D15M1I1M1I6M2D23M1D7M1I7M7I3M1D6M1D4M7I9M1I7M1D10M1D20M1D11M2I12M1D5M1D5M2D35M1D10M13I6M1D6M1I1M2I8M4I2M2I8M3I1M1D7M1I10M2I6M1I7M1D4M3I6M2I8M1I10M1I2M2I8M1I10M3I6M1I4M3I3M3I3M5I7M1I8M1D25M1D9M2I8M1I4M3I4M1I10M1I5M1I11M1I8M6I1M1I3M2I8M5I6M1I6M2I2M1I25M4I2M6I8M4I6M3I4M7I29M2I10M2I10M2I12M1D18M1D5M1I29M2I4M1I4M1I3M1I15M2I4M1I3M1D1M1D5M2I7M2I1M1D5M4D2M1I4M2I1M1D9M1D1M2D5M4D65M1I9M7I4M1I11M2D3M2D1M1D5M4D6M1D6M1I4M7I1M2I3M3I2M3I3M1I19M1I11M1I14M1I13M1I3M5I1M1D7M2I7M2I6M2D4M2D6M3D3M3D9M7I2M2D7M1D4M3I1M1I8M6D12M1I4M1D7M1I2M1I2M1I2M1I7M1D8M4I7M1D8M1I16M1D9M1I7M1I14M1I1M1I6M7I8M3D7M3I3M4I4M4D10M4I12M9I20M2D1M1I7M1D3M2I1M1I9M1I9M2I2M1D6M1I15M1D3M3I5M1D40M1I1M1I11M7I5M2I9M1D5M2D17M1D3M4I2M1I16M1I10M1I2M1I1M1I13M1I1M1I7M2I1M1I4M1D25M2I4M2I10M1D18M1I19M3D4M3I13M1I16M3I37M1D19M2D2M1D2M1I8M9I8M1I12M1I3M1D19M1D15M1I9M1I6M1I13M2I16M2I2M1I7M9I46M1D1M1D4M2D27M2I5M3D23M2I30M2I1M1D9M1I39M1I10M1I14M5I16M1D1M4D10M4I1M1I6M1D13M2D8M1I2M2I24M4I2M3I4M2D4M1I2M2D3M2I1M1D3M1D3M1D3M1D1M2I19M1I7M1D10M1D15M1I8M1I7M1I3M1I3M2I9M1D3M1D11M2I2M1I4M1D11M1I8M2I3M2I1M1D4M1I3M2I7M3I17M1D15M2I2M1I2M1D3M1I16M1I4M1I8M1I4M2I15M1D5M1D10M1I13M2I10M1I15M1I13M1I11M3I2M1D22M1I15M1I9M1I14M2I5M1I10M6I2M3I5M3I2M1I1M1I19M1D15M4D15M2I21M1D10M2I13M1D39M1I14M1I11M1I11M1D4M1D1M1D11M2I4M2I4M1I2M4I6M3I3M1I9M1I15M1I15M1D9M1I21M1I36M3I4M1I6M1I3M1I1M1I20M1I1M1I3M2I3M1I4M6D6M2I8M1I2M2I15M2D6M1I2M1I10M1I12M1D5M1D7M1D1M3I6M1I8M4I8M1I10M5I2M1D12M1I5M2I24M2I11M1D5M2I14M1I3M1I4M7I1M1I9M1D14M2D4M1I6M4I1M1I5M1D11M3D3M1I4M1I3M2I6M1I7M2I2M1I6M1I1M2I18M2D7M1I1M2I5M2I5M1I15M4I38M2I15M2I4M1I21M2I7M1I7M1D2M1I22M1I2M2D12M2D2M5D6M1I3M6I4M4I4M6D5M2D5M2D7M1I5M1D10M1I11M1D1M1D5M1I22M1D16M2I6M1I4M1I16M2I12M1I29M1D13M1D10M1D5M2D3M1D6M1D20M1I6M1D3M1D18M7I17M5I3M1I20M1I5M1D7M2D4M1I3M2I27M2I26M2I4M3I6M6I6M1I12M4I29M2I6M1D2M2I15M1D7M1I6M4I1M1D20M3D3M1D5M3I17M1I6M1D13M2D2M4I2M4I4M3I22M1I4M1D36M3D13M3D13M1I3M1I10M1I2M2D10M3D7M1I1M1I3M4D2M1D6M2I11M3I2M1I4M1I9M3I8M2I11M3I2M4I33M3I14M1I1M2I21M4I4M1I7M1I1M3I4M1I3M2I4M2D2M1I6M1I10M2D10M3I2M1D5M1D2M1D16M1I23M2I7M1I13M2I2M3I23M3D6M1I2M2I3M2I2M4I14M1I2M3I3M2D4M2I5M6I24M1I9M1I7M1I20M2D18M1D3M1D14M8D9M1D26M1I7M8I2M1D17M1I14M1I5M1I3M1D24M1D9M4I37M1D19M3I18M1D11M1I6M1D2M1D4M2D2M1D18M3I9M2I1M1D9M1D4M2I29M4I9M2D10M1D9M2I8M7I17M4I6M2I21M1D19M3I15M4I2M3I7M3D7M1D17M5D18M3I7M1D12M2D24M1I4M3D11M1D10M1I21M2I11M7I3M1I7M1I2M4I1M2I9M2D1M1I9M1D18M1D11M2D3M2D23M1I5M2D3M1I6M2D4M2D21M2I1M1I14M2D22M1I45M4D11M2I6M1I59M1I2M2D4M1D3M2D8M3I6M2D12M1I11M1I8M2D6M1D10M1I5M1D3M1I6M1D2M2I3M4I13M4I10M2D17M1I26M1D3M3D10M3D19M2I18M1I28M1I13M1D11M2I3M2D7M1I2M1I3M2I17M3I5M1D27M1I2M2I4M2D9M2I1M1I13M1I31M1I6M2I9M4I14M2D7M3I15M1D35M2I3M1D9M1I1M2D19M1D4M3I6M1I6M1I8M1I17M1D10M1D10M1I3M4I2M1D6M2I20M1I21M3I46M4I14M2I1M1I7M4I4M2D5M1I3M1I13M1D12M1D4M2I7M1D4M1I2M1I1M1I4M1I3M4D3M1D6M1I12M1D17M2I9M2D3M2D14M1I11M2D5M2D3M2I1M1I3M1I33M1I10M3I19M1D6M2I4M1I11M3I5M1D12M1D9M2I6M4I9M1I15M1D12M1D1M2I6M2I2M1I4M1D22M1I11M1I9M2D1M1I12M3I12M1I18M3D3M3I17M1I12M1I17M8I14M5D2M4D15M2I29M1D6M4D13M1I5M1I2M2I7M1D16M3D26M4I10M2I8M3D10M3D11M2I2M1I12M1D10M1I18M2D11M1I24M6D1M2D4M2I7M1D20M3D2M2I3M1I1M1I7M1D14M1I4M1D15M1D15M1I7M3D5M1I29M1D7M1D13M1D11M1I9M1I3M1I13M2I2M1I39M2D8M1I28M1I6M1D5M1D3M3I17M1I3M1I13M2I5M1D1M2D8M6I7M3D2M1I7M3I6M1I8M1D13M3D4M1I9M12S * 0 0 ATTGGGTGCTTGGTGTTAACCTTATCTATCGCTTATTAGTACTTGAAACGGTTCTTCAGAACCCTGAAGTCGCTAATCGTTCGGCGATACTATATGCATTAATAGACTATATCGTTGGTATAAACAGTGCACCATGCAACATGAATAACAGTGGGTTATCCAAAGGAAGCAGAAAGCTAAATATGGGGAAAACTACAATACGATGCCCCGTTAAGTTCAATACTACTAATTTTGTAGATGGAAAACGTATGTAATAGAGAGTAACTTAAAGAGAGATCCTGTGTTGAGCCAAATAAATTGCGGTTATTTTAATAAATTAAGGGTTACTATATGTTGGAGTTTAGTGTTATTGAAGAGGCGGGTATAATTCCTGCAGTAGAAAATAAGGCATTCCTACGAGCAGATGGTTGCACGAATGACTATTCCTTTGTTACAATGTTTTATCTTACTGTCTTTGATGGCTGCATGTGAAAATGCGATATCGAAATGTTAAATTGGTTTTGTAGTCAAAAGAAGAAGTAAGCACTTATTCATTAATAGATAAATTCAGTCAACTCCTGAAATGTTTTCCTTAGGTGAAAGCATTGACTATGTTAATCTCAGCAAATTAAGCGATGGTTTAAACATAAACCTTCTTTAAAGCCTATTCAGGATTTAGTAGTATGGCCAAATCGATTAGCCGACATTGAAGATGAAGCGTCCTTAACATCGCCGTCATGAGGGGTAACTCTTTCAGAAATTCATGGACAGTTCGCACGTGTGTTAAATGGTTCAGAATTGTCAGATTCCACTTTTCATTTAATAGAAAGGATGCTCCCGGATTCAGTGATTATATAACTACGTTGAGGTGACGGTTAATTCTATGCCCAGCACGAACATTCATGTGCTTTATCGGGCGGAATGGGTGTAAAACACGACCGTTGAATGGAATGATTGGTGCAATCACCAACCCAGAAATAATGAATAGTTTTCTCTGGAAAATAAGTAGACTTATCGAGGTCAAGAATCCCAAAGGGATATTTTCGATCGCTTGTTTCAGTTTCGTTTAGTGCATTTTAATGCTTTTACTCCTCCTAAAGAACAACCTGATACCCAGCAAAGGTACACAATACTTTTATATTGGACTCAAGAATGCTGCCAGCAATAGTTTAAAGGGTACTAGGCGATCTCCGGTTAGAATTCATTTCAGCATTTATTGGTTGTATGGTGAGAGTAGATAGAAAGACAACTCTGGCTTTGAAGCTATCAAAAACTAAGTAGTGATGAAAACTTTTCCAAATATGGAACTCATCAGCCTCCATTTCTAAATATGAAGAGTTAAGACGTAATGAACCACACCAATTCAAGTGGACGATGATAAATTCACTAAATTGTTTTATGACAATATCCGAAATATGCTTCGAATGAGCTCTGACATGCAATTGTTTTATTTACTATCACAAGATTAGTAGATGTCGTTGTGAAAGTCATTAGTTTTATTCGATGAACCAGAGGTTCATCTGCATCATTTGCTCTCTGCTTTTACGAACATTAAGCGACTTACTCGATGCACGCAATGGTGGCAATAATTGCAACTCATTCCCCAGTAGTACTGCAAGAGGTTCCAAATCCTGCATGTGGAAGGTCCTACGTCAAGAGAAGCAATAAATATTATCCGTCCGGGTTATTGAGACATTCGGTGAGAACTTAGTTTTGTAACTCGTGAGGTGTTTTACTTGAAGTGACAATTCTGGATACCACCACTTATGCAGTCCGTTGATTCAGAGCTTTCTTATGAAACCATTCTAAATTATAATGGTCAGATAGGATTAGAAGTCGAACCGTTTAAAGCGATACCTCATCAGATGAACAGAGATGAAGGTAAAGTACAATGAAAACTACCTCTTCCGCGCGGGAGCAGAACTTAGCTAAGAGAGAGAAATGCTTAATAAATGCTCGGAAGGTATGATGCAGATAAATGTTAGAAATAATTTCGCATTACTCACTTCCCACTTTGCAGAAGAACAACAATATAGAATATTAAGCTCGACAGGTCAGTTATTTACCTACGACAGGACACCCTCTTACAGCCCTACAACCTTAGTAGTTGGTAAGTGGACAAAGGTTAAATTAGAAAAGCTTTATGAAAATAATCTCCAGATAAAACAAACCCGCTAGAACATATTACGATGACATGCTTGTTTCATCAGGTGAAAAATGTCCATTTTGTGGTGATATAGAACAGACAAATATAGATCATTTCTTCCTATTGCACATTATCCTGAATTTTCGGCTTACTGCCTATTAATTTAGTTCCATCGTGCCGCGACTGCAATATGGGAGAGAAAGGTCAAGTTTTCGCAGTAGATGAGGTACACCAAGCGATTCATCCCTATCGACAAGGACATTTTTCGTGAGCAATGTCGGGTATATCCAAATTTCACGGGTTTCCTAGAACTCCGGCTGCTATCAGTTTTATGTTGAATGCCCGGCGACTCTGGAGGCAGGAAGACAAACACAGAGCTCTTCATCATTCAAGCTATTAAATATTGCTAACAGGTATCGTTTTAGAGGCAGGAAAGCACACTTGAAGTGAAGTGATCAAAGGAAACTCTTTCGTAAAGTTATAGGAAATATAGTTCAACCGCAACGTTTCAGCAGCTACAGTCACCAGAATTTATTGAAGCAAATCTGAAACCTATTATAGATTTGAATGACTTCCCCAATTATTGGAAAGAGTCGTATCAGTGCCTAGCAAAACTCGAAAGATTTTCAGAGGGATGTAGAATATGATGAAAGAGAAAATTACGACGCTTATCGGAAGTGAACGAATACTTTTATGAGGGAGGCTGTTTGTACAAATCGGTAGTAACTTGCTAACCAATTCCGGCGGTGGCAGCCAGAGTGGCAACAGTGCAGCAGGCGAAGGTTGTAATGTCCGCTCCGGCACAGCAGTTCTAGGGACAGTGGCGTACAGTCATAGATACGTCGTGGGGAGGTGGTCACAAATTCTCATGCAAAATACTGTAAATCGGTAGCAACTGGAAATCATTCAACACCGCACTATCGGAAGTTCACCAGCCAGCCGCAGCACGTTCCTGCAAGTACGACGTGTAGTCCGGCTCTAATATCTCCTATGAGCAACGTGTTAGCAGAGCCAAGCCACAACTCTAATTTAATACATAATGAATGATAATAATATAATAAAATTTCCTGTGTAACTAATTGTTTATGGTTTCTGATAAGAATCATGCAAAAGATCAAACAACTTGTATTACATTGACAGTTAAGCAGTTAATTTATCACCCTAACTATATCAGCATCTAGCATGCAACGCATCGACAAAATGGAGTTTTATGACTAAAACCATGGGAAGAAGACTTAAAGATTTATCGCACTTGCTCAAATGCTGCACTTGATAATATTTTGACTCCTGAATTATTTCGCTTGAATTTGAATCTAATTCCTCCAAACCGCAGAACAGTAACATTTATTATTTAAAAACAAAACCAGATTGAGGATATGACATTTGGTATGACAATAATGTTATTGAAGCAAATGGAAAATGATCCATTAATGGCTTGGCTAAATTCCGCAATACGATAGAAAACAAGGCGATTTAGAAATGTATAGTAGCGAGGCAAAAAGGCTACTCTTATTTCATGTACATTGAAGAAATGACATTGAGTTATTACAAATGAAAGTATGTTAAACATTGGTAAAAAGTTAGTCAGACTTGCACAAAGAAATTACCTTCATATTTAACTGAATCATCTATTATTAAATCAGAAAGACGATGGGTCGCTAATCCTAAAGATTACGAATTATTACATGCCTTAGCTATAATCGGCAGAATGTATAACTGCTGTAACTCTCTTGGCATACAAATAAACAATCCAATGGACTACGATGTGATTTCGCCAACATCATTCGACTCTTTATTTGATGAAGCCAGAGAATAACTTATTTAAAATTAAAGATCACTCCATAAGCAAATTGTCATTAGCATGATACAATATGACAATAAATAATTCCTGAATATTAAAGGAGCGTCTAAAACTGTAGATAAGCCTAAATATCATTGGGACAGAAGTTAGTTGACTATACAATGTCACAAGCTTTAAGAAACGACTTTTAAAGGACGGTTATCACATTCAAACATTAATTTTATGATAAACAATTCCATCCAATTGATTTAATCAATACAACATTTGAAGATCAAGCAGATAAATATATTTTGGCGTTATGCAGCTGACAGAGCCCCAAAATAACAAATGCCTATGGCTTCATTTGGATATCAGAGCTATGAGCCAGAAAAGCAAGCATCTACTCCAATAAACCAATACATACAATGCCAATTATAGATGAAGACTTCAGGTAATGTGGAATTGATTCAATAAAGATAATCAAAATGTATTTCATGGAAAAATAGTTAGAGAAAACGAAGAAAAACCGACTTTAGAAAACATCAACAGCATAACTCAAACATGACGAAAAACCATATTTCATGCGTTCAGTTCTTAAAGGCAATTGGCGAACCTTGTGGCTTAAACACTATGAATGAACAATTGAGTCATAGAACTTCCATTATTCTCCTGAAGATAATAATCGCCAAATAAACCAATACTCAGCTTACAATATACTAACTAACCGCATGACGTTATTTCATACAACGTTTCTGCGGCAGCTCACAAACGATTACTCCATAACATAGGACAGCAGGCCACTCAATATCAGGTGCAGTTGATGTATCAACACGGTTCGAGCCCCCAATACCGTCGACTTCCTTCCAGGGCTTCCAGCAACGAGGTTTCTTCCTTCGTTTGATTCAGATCTGCAGCATCCTGAAGCGGGGCAATATGCTCACTGGCTACCTGCATCAGGCTTTTTGTTTCTTCCGCCTCCCGGATCTCGGAACAGTTTTTCTGCTTCCGTGGTTCCTTCACGAGCGTTGCCGTTCCACTTCTGATATTCCCTCCCATGAGATAACCGAACACACTTTTCCGGTAACGACTGAGTTCAGAAATAAAGATAACGCGTCGCCGGAAGCAACCCACGTCATAGACGGTTTTACCCCGAGCGATGGTCTTCAACGAGACATGCCACGATGCCTCATCACTGTTGGAAAACAGCCACAAAGCCGCAGCCGGAATATCTGGCGCTTGCAATATCGGTACTGTTTGCAGGCAGACGGTATGAGGCGGAATATATGCGTCACCTTCACCAATAAATTCATTAGTTCCGGCCAGCATATTATAAATTTATGGTCCGTGGTTGTTCACTCATTCGAATGCCATTATGCAAGCCTCACAATATAGTTAAATGCAATGTGGAGTTGACGGTGTTTCCGCGTTACCCGCAGCGTTAACGGTGATGTGTCCGTGTGAACCGGGATACCTGAAAGAATGGGCATGAGCACCCGATAACAAACCGGATGCCTGGTGCGCACCAATACCAACTGTATGCGCATGTGCACTAAGCACTGAGGGGCGACTTATGGGACAATGAGTACTGTCTCGGTGAACTGTCGTTCGATAATAAAGCAGGCATCTTGTGCTGCTTCCTTTAACTGTGATAAACTTCCTGTAATGGTTAGCCTGTTCTCATACCTGACTCCAGCCAGAAATCTGTTCATCCTTAAAACCACTTGTGGGCATGAGCACCGCGGCCCCTGTTGAACCGCTCAGACTGTGAGCATGATCCGCGGTTATTCGTCGATTTGGTGCTCGTAATGAAACTGCCTGTTGTTTTCCTTTTTATGCGGCGTAATCAAACCACGCCGGCTTAGTTTTCGTCCCCCAAATCCGTACCGGATGCACTGGCACCTTGGGTGTGCGACTTAATTCAGCATCCTGTTCCTGAGACAATACAGCACGAACGCTGGCGGGTTTCCCCTTGATGTCCAGCCTCGAGGCGCATATCAGGAGGAAGCACACCCGATGAATACGCGACAGCAAGTTTTGTAGTAGGCTGATTTGTCAAACGCCGCCTGCCCCTGCATCAGGACTTAGCCAGACGGAACGATATTGATGACCACGGGATCGGCGCACCTGCCGAGACCCGAATTCTCACCGGCCCCAAGGTATTCATAAGAACATCTGCAACGGAATTTTGCCAGAATATCCCTGCCAACCTGAGTCAGTTCAGTCAGGCTGGCATGAATTTCCGCGACCGCGGTAATTTATTTTTCGCCGTGGAAAGCCCTGCCAGCGCCGTCAGTGTCGCATTCTTCGGTTGTTTACCCGCAGGGCCGCGTTAGTCATGGTGGCTAAATCTGGATCATTCCCGGCAGCGCTGCGGCCAGTTCATTCAGCGTATTCAGTGCGTCGATAGGTGACGCGTCGATACTCATCTGCAATCGCGGCCAGTCAACAAAGCGGTGTTCGCATCGGTATGATGTTTGTTGCGGCTCCGCTTTGGTGCTGTTGGCGTTCCGGTCATGCCGGCTACGTCGATGGGCTTTCTCTGTTCGTTTCATCCATTACCACCTTAACCGCCTTTGGCGTTGCATCGCACAAGCGTTCAAGACGTGCTGTTGGTTGCACTGCTGAGCTGCATGAGGCTTCTTTCTCGTTGTCCTCGCATCCTCAAGCGACAGGCATAGCTATGAAGCTATCTTCTGCACGTTTTGCCGAATTTTTGCACCGTATTGCCGCCGCTTCTGCCGCACTTTTGCTCTGCGATGCTGATACCGCACTTCCCGCAGCCTCTGTCGCCTTCGTGGATGCCGTTGACGGCACTCCCGCCGCCGCTGTTTTGCGTCTTACGAGCGAGGGAACTCCGTTCCGCTGCCTGTTCAGATGACCTGGCATTCGTCTCGCACGTTGTGCCGCGCCGCTGGCAGAATTTCTGCCGCCGTTGCCGAGGAAGCTGCACGACCGGCACTTACCGTAATGCGTTCGTTTCTGATGATTTTGCTGCCTCTTTTGAGGCCACGCATCTCGTGCTGAAGTGGCGGCGCGCTTGACGCTTTCGTGACCCAAGGCGGTAGGAGGCAGACGTGGCGGCTGATCTTATTTGTGACGGGCAGCATTCGTTTCTGACGTGTTTTCGCGCACCGGACGCGCTCTGAGCCGCGCGTTTTTAGAACCTCTGCGGCTGCGGCACTTTTCGCTTCAGTGGCCCTTGCTGTGATGCCGCTTCTGCGCCGGAGGACCCTTCCTGAGCTGACGATGCAGCCTGTCCGGCGACGTGCTGGCGGCGCGTCGGGCTTACTAGTTGCATCAGTCAAGGGCCGCGACCTGAGCAGCTGAATGCACTGGCATCGCCGGCTGATTTCCTTCGCGTCTGCCGTACTCTGATTGCCACCACGGCTGTTGAAGGACGACACGACGGCTACTTCACCTCTCCACCATCAGTTCAGACGACGCCTCATCTCCATCGGGCATCATCCTCCGTCATGGCACAGAGAAAATCAAGTGCCGTCCCCGGTCGAAATCTTCATACACGGTACTGTTAGCGGCGTGCGATGGTGGAAAAACCGTCAACCTGCAGGATAGAACCTGTACTGACCGTACTCCACATCCATGCTGTAACGCCCGGCTTCATCCGGATTCTCTGAGCCCACCGTGTTCACCACCACCGTGGTGCTGTTACGTCTGGCTTTCAGCTGAATGGTGCAGTTCTGTACGGTTTCCTGTGCAGCGTCTTCAGGACTCCTGAAAATCTTTACTGCCATATTCACCCCAAAAGCCCACCGGTTCCGGCGGGCTGTATTCAACCACTGTGTTACCTGGCTAAGCAATCAGAATTTAACCGACCCCAACGATGGCGATCCGTCAGTACGCCAGTCGCCATGCCGGAGCCTTCAGCAATATCAACAACGACGCTGACGCTGCCGGATTAATCGTATACCTGCGGCATCACGCCACTGAGGTAACGCCGCATTGCATTTCGTCCCTGGCAGTGGTCGTCTCCTTTCATATACCCGGGAGTGATTTCCGCGTCTTACGGTAATCCATTGTACTGCCGGACCTACAGCGACTGTGAGCCACCTCCGGCCATGGCGTACCGCACTGACCTGCTTACTGATTTGTAAAACCGGTCCGGCCATCACGCTCACATAACGTCCACGCAGGCTCATAGTGAAACGTATCCTCCCCGGTCATCACTGTGCTGCTCTTTTCGACGCGGCGAATCCCCAGGAAGCCATGCCCCCACACTGTCCGTCAGCCATAACGACGGTATTTCACGTTTAATCCCTTTCAGATGACTCACATCGTATCCCCGCCGACAACGACGGCACCGGATTACCCGGTTTTCACTTGAAAATAGCCCACCGTAAACGTACCATGTCCGCTTTCCGCGCACGGGCTCGAGTGACTGTCACCGCAAGTGCGGCAAAGACAGCAACGAAGGCAATACACAGGTCTACGCATCTAGCGTTTCTCACCTGTTTTATAATAAACGCCGTTCCCGGACGAACCTCTGTAACACACTCAGACCGCTGGATGCCCGCCTGTTTCTTAATCACCAGACCTGCACATCGCTGGCAAACGTAAAGCGGAATATCTGCCGAATTGCCGTTAACGTAAGCGTGAACTGTCAGGATCACGTTTCCCCGACCCGCTGGCAGGCGTCAACAATACGGGAGAAGAACACCTGTACCGCCTCGTTCGCCGCGCCGCTCATAAATCACACCCGCACGTTCATCAGTATTTCAGATAACACATCGAACAAACCGTTGTCCCTGCCGCTGACAGTCTACCTTACTTCAGCGAAACGTCTACTGAGGAAGCACCACTATCTGGCGATCAAAAGGATGGTCTATCGGTCACTAGACAGTACGGGCAGATACCTGACGGCCAGTCCACTGCTTTCACGCTGGCTAGGGGAAAGCCGCGCTCACGCGCCTTTACAATGTCCCCGACGATTTTCCGCCCTCAGCGTACCGTTTATCACAGTTTTCAGCTATCGTCGTACATTACTGAGCGTCCGGGGTTCGCATTCACACTGCCTGATATCCGCATTTTAGCGGTCAGCTTTCCGTTGCTGTTAAGGGAAGGGCCGGAGGATTGCCACGCCGCTGGTAATGGGTTGGGGGCCGTCAGGCGCTTCAGGAACACGTCGTTCAGCTGAATATCTGGTTGCCCTGCGCCACAAACATCGGCGTTTCATTCCCCCGTTTGCCGGGTCAATAAATGCGATACGATTGGCGGCAACCAGAAACGGCCGTTGCCCTTCCTCCGTGTCCTCCATGCTGAGGCCAATACCCGGACATAAATGTTGCCGTCTTTGGTCTGCTCAATTTGACAGCCCACATGGCATTCCACTTATCACTGGCATCCTTCCACTCTTTCGAATTCCCTCCAGTCTGCTGGCGTTATCCTCCGTCAGCTCGGTCTTTTTCCAGCATATTCCCTTGCCGAGATGGGATTCGGTTATCTTGCCTTTGGAAATCCAGGTAATTCTCCGCATCATCGCTCGCCCGACCGACGGCCTCCACGAATGCCGATTTGCCAACGGTGTTCACACTGCGGGATATAAAGTAAGCTAATCTCACGCTTTTGGGTCGATATAGCTGGGCGGCTATCCAGTACAAGCGCCGTACCAAGATAACGCGTGCTTGGTTTCAATCCGTTAAGTTT * tp:A:P cm:i:162 s1:i:1507 s2:i:0 NM:i:2303 ms:i:6250 AS:i:6252 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
12 9 0 utg000001l 1 60 56S9M6D20M1D34M3I18M2I1M1D17M3I14M2D25M2D5M1I3M1I1M1I2M1I1M1I2M3D22M1I10M6D9M4D6M1D9M1I8M3I4M1D16M1I3M1I3M2D10M1D6M3I5M1I1M2I14M1I4M2D8M1D59M1D14M1I19M3D2M2D1M2D6M1I11M1D5M1I18M1I3M2D16M1D35M2D18M3D39M3I11M1I5M2I2M1I13M1D6M2I15M1D2M1D1M1D16M1D19M3I2M2I5M1I6M1I4M1I38M1D3M1I3M2D8M2I25M1D7M3D28M1D4M1I12M3D1M4D9M3D17M1I3M1D7M4I12M2D3M4I5M1D22M1D10M1I6M1I4M1I1M1I5M1I5M2I2M1I17M1I16M1I8M1D6M3I5M2D3M2D6M1D7M2I27M1I18M1I17M1D1M3I13M1I4M1I20M1I4M1D19M1D1M2D6M4I7M1I8M3D1M1D3M1D17M1I15M1D16M1D13M1D7M1I5M1D8M1I1M1I6M1I4M2D4M1I13M1D12M2D1M1D17M2D6M6D25M2D15M2D15M3I5M1D10M4D8M4D20M3I15M1D12M1I7M3D11M2D9M2D1M1D9M1D7M1D3M1I9M1D12M1D13M1I1M1I4M1D5M1D1M2I6M1I2M1D19M2I16M2I8M2D8M1I29M1I5M2D11M1D18M3I25M3I21M2I3M1D3M1I7M2I7M1I2M1I1M1I3M1I15M1I10M4D33M2D2M1I10M2I2M1I11M1D7M1I3M1I14M2I11M2I6M1D11M1I11M1I7M1I15M2D10M2I12M3I1M2D3M3D3M1D1M1D12M1D1M2I19M1D3M1D28M3D13M1I2M2D8M1I7M1I4M4I3M2D7M1D7M3I2M2I4M4I11M2D10M2D6M1D1M1D7M4D13M1D2M2D3M1D8M1D5M1I2M2D3M1I1M1I4M2D4M1D1M2D12M5I5M2D14M1I1M1I3M1D10M2I14M1I10M3D5M5D12M4I4M2D2M1D4M1D2M5I3M1I5M2I5M1I3M3D5M1I8M1D1M2D20M1I19M2I4M1D4M3I4M1D1M1D2M1I21M1D4M3D7M2I1M2I16M1I2M2I22M1I33M1I12M2I11M3I15M1D6M3I3M1I1M2I2M1I10M1I6M1I9M1D7M3I6M5I2M3I11M1I9M1D6M1I12M1I20M1D5M3I1M2I13M1D25M3I6M1D5M1I30M1D7M2D3M1I1M2I1M1D4M1I6M2D6M4I3M1I4M1I8M1I8M1D3M1I1M1I2M1D2M1D3M2I3M1D8M2I5M3I1M1I2M1I3M3I3M1I11M1I3M2I1M2I24M5I12M1I28M2D2M2D27M2D13M3I9M1I2M1I8M2I2M1D2M2D19M2D6M1I9M1D4M2I2M1D13M2D8M3D5M2I4M1D1M2I5M5D19M4I30M1D16M6I3M1D14M6D10M1I6M2I17M1D6M1D9M2D1M1D4M1I38M1I2M1I3M1I5M1I3M2D7M2I6M3I8M1D2M1I39M1I1M1I2M1I5M4D1M1I2M4I7M2D6M3I15M3D9M4I1M1I6M2I10M2D8M3D1M1D17M1D1M1D38M4I2M2I23M1I11M5D7M1I5M2D8M1I3M3D3M1I1M3D8M3I28M1D9M1D4M1D5M2D6M2I10M2I14M2I14M3I4M1D13M1I9M2D7M1D37M2D3M1D28M1I10M1D35M1D17M1I16M1I13M2I4M1I4M1D4M4I6M1D7M3I3M1D5M3I1M1I7M1D7M2I2M1D6M1D5M1I2M3D4M2D13M1D3M3I13M2I8M2D4M1I4M2I7M1I4M1D7M1D11M1D2M2I1M2I2M2I23M1D25M1D7M1D7M4D12M3I4M2I4M1I1M1I2M1I29M1I17M2I14M4I2M2I17M1I3M2I9M1I2M2D9M1I9M2I6M3I22M1D9M1I2M1I4M1I5M1D3M2I22M1I11M1D2M3I1M1D4M1I10M3D11M1I3M2I8M1I2M1I6M1D8M1I29M1I5M2I6M1I6M1D4M3I1M2D12M1D13M2D2M1D19M1I2M1I17M4I1M1D18M1D9M2I1M1D6M4D5M1D13M2D17M1I47M4D6M1I4M1I12M1D18M8D15M2I9M1D5M1I3M2I13M1I12M2I1M1I7M2I3M3I4M1I9M1I7M4D10M6I7M1I17M2I12M1D1M1D17M1I8M1D2M2I15M5I7M1I6M1I55M1D12M3I2M2D3M1D9M1I1M1I10M1D17M1D17M3I6M1I15M2D16M5I8M1D7M5D8M2I4M1I2M4I1M1I4M1D8M4I5M2D10M1I3M2I6M11I9M1I13M1D2M1D10M2D15M1I7M1D4M1I13M4I28M1I8M2I8M1D12M1I8M1D5M1D9M4I2M1I6M1I4M2D3M1D7M2I2M9I6M2I4M1D16M1D4M2I5M1D34M1I8M1D9M1I3M1I4M2I19M3I3M1D5M1D12M4D35M1I3M1D8M1D16M2D4M1I2M1I11M1I14M1D5M1I9M3I5M1I16M3I7M1I16M1D6M1D5M1I3M2I1M1I6M2D17M1I5M1I5M1D4M3D2M1D11M1I3M1I6M1D18M2D3M1I14M3D27M3D4M2D6M4D16M3D1M1I9M1D10M2I7M2D12M1I14M2I17M1D2M1D14M2D24M2D25M1I5M1D12M2I15M2D2M2D6M3I17M1I3M1I4M1I3M1D14M1I10M1D6M1I3M2I3M4I4M3I8M3I5M3I18M1D9M1D33M2I3M3D1M1I33M1I11M2I7M1I4M3I2M2I4M1I3M1I5M3I5M3I12M2I5M1I6M1I12M1I2M1I9M3I6M1I8M2I1M1D9M4I3M1I7M7D13M1I10M1I4M1I7M1I10M1I12M2D22M1I4M1I2M1I7M1I7M2I11M1I4M1D4M1D1M1D23M5I1M1I16M1I1M1I26M1I7M1D2M1D7M1I8M1D1M1D13M1I9M2I13M2I5M3D13M1I5M3D51M1D7M3I2M1I11M1D4M3D14M1I1M1I7M1I3M3D9M1D19M2I7M1D23M1I12M1I12M1D3M1D13M2I17M2D10M1I11M3D8M1I3M2I16M1I8M2I6M1D2M5I4M1I2M2I5M2I16M4I5M1I19M2I3M3I3M1D4M1D1M1D5M1I4M2I3M3I10M1I4M2I8M1D5M3D10M2I4M1D5M1D3M1D52M3D3M1D15M1I2M3I1M2I4M1D16M2I13M2I15M5I20M1D22M4I40M2D17M3I7M3D9M1D6M4I6M1I8M1D33M3D2M1I11M2I17M1D9M1I15M5D26M1D5M4D17M2D6M3D16M1I34M2D8M2I35M1I21M1D4M3D11M1I5M2I22M1D8M176S * 0 0 TTGCTCGCGTATACACGGTATGGCCTGTCCAATCTTAATACGAGAAAGGACCCGTCAAAGTGATAATGATTATCATCTACATATCACAACGTGCGTGGAGGCCATCAAACCACGTCAAAGCGTAATCAATTATGACGCAGTAGATCGTATTAATTGATCTGCGGCATCAACTTAACGTAAAACCAACTTCAGACAATACAAATCAGCGACTAGCAACTAACGCGACCTCATGTCAACGAAGAACACGTAAGAACAACAGCAACATCCGCTTTCTAACCAAAATGATTGACGAACAATTAACATCGCTGGGTCAACAGGGTCGGGAATTTCGGCCTCATGAGTACGTATTGAAGCCTGCCGTTCGAAGCGTCAGAAAGAGAGCATATACATCAATTAAAGTGATGAAGAATGAACATCCCGCGTTCTTCCCTCCGAACAGGACGATATTGTAAATTCACTTAATTACAGGGCATTGCAAGTAATTGAGTGCAGTTTACCACTTTCCTGACAGATGAAGACTGCGTGTTGGCTCTGTCACAGACTAAATAGTTTGAATGATTAGCAGTTGGTGATCAGTCAACCACGAATAATCCTTCATATTATTATCGTGCTTCACCAACGCTGCCTCAAATTGCTCTGAATCGTCTCTCTCAGAGACATTATGTTCTATACATGCAATTACAAATAGGTAACTCATAGAAATGGTGCTATTAAGCATATTTTCAACTAACGAAGTCAGATCCACGCGAGGATCATCTGAGCAGATTGTTCTTTATTCATTTTGTGCTCCATGCGCTTGCTGTCCTCATCTAGCGGTTAAAATATTATTCAAATTTTCTGTATGAAGATTTGAGCACGTTGGCTTACATACATCTGTCGTTTGTATTTCCCAGAATGCCAGCAGGACCGCACTTTGTTACGTACGCAACCAATGATGCCCTGACTAAAACATTCCTAATATTGACATAATCATCAACAAAACACAAGGAGAGTCAGACCAGATCGTGAAACGATAAAAACGATAATTGCAAATGACGCGCCTCGTATCACATGGAAGGTTTACCAATGGCTCAGGTTGCCAGCGTCCACGAAATTTGCCGATCAAGTGCGAAAAGATTTAGACTGTGAACTTGTTTTTATTCTAAACACCGACCGTCACAACGTCTCACAATGCTATTTACTATCTAGCCACAGATAATATTCACATCGTGTTAGAAAGCCAACACCGTGTTAATAAAGGGACTTAAAAGGTTGTAAATGTTAAATTCTCAAGAAACAGCATCTGCCCAAACGTCTATGATAGGTTGAATCACGAAGTGACGCACTTCGACCCAATACAGGGAAGTGGTTAAAGCAGGAGTTTCCGATGAGTCAATATCCATGAACATAAATATTACGTTGATAATTCATTACTATTTACTGAGCATTCAGAACACCACAAATCTTTCGACCCTAAATCCATAACGTCGGTTTCTTCCGTGTCAGCACCGGGGCGTTGGCGGCATAAGTGCAATACGTGTACGCGCTAAAACCCTTGTGCATCGTTTTAATTATTCCCGGACACTCCCGCAGGAAGTTCCCGTCAGGCTGTGGACATGTTAATCCGGAATACAATGACGATTCATCGCACCTGACATACATTAATAAATATTAACAATATGAAATTTCAACCGCCATTGTTTAGGGTTTGTTTAATTTTCTACACATACAATTCTGCGATGGTTCAAAGCATCGGGAGAAAGCCATGAAAAATGTGAGCTCGCTACTGCTGGCCTGCTTATTACAGGATGTGCTCAACAGACGTTTGAACTTTCAAAACAAACCGGCAGCACATCAGGCATCAAAGGAAACCATCACCCATCATTTCTTCGTTTCTGGAATTGGGCAGAAGAAAACTGTCGACTGCAGCCAAAATTTGTGTGGCGGCACGAAAGTGTTTGTTAAAACAGAAACCCAGAGCAAACATTCGTAAATGGATTGCTCGGTTGTTTTAATTTTAGGCATTTACTCCGCTTGGAAGCGCGTGTATTGCTCACAATAATTGCATGAGTTGCCCATCGATATGGGCAATGGGTACTTGGACTGCTCATTAATATTCTGGGTTCCTTCCAGTTGTTTTGCAGTGATCAGCCTCTCGGCCGGATGAACGGAATCCGCGTTCTACTAATCCGTGTCCCGTCGAACGGAAGAAGCAACGGTGCATTATCCGCATTCGCTTCGACGATGACGCAGACTGCTTTGGGTGCATGGGACAACGGACGACGCAACGACTCATCGCAAATCCCGACGCTTTCGACAGCTTGACGACTCCCTCATCTACGTTATTTTGCATCGAACGGAATCCCAACGGGTAGAACGGGATGACTGCACTGTCAGCTCCTAATCCCGTTTCCAAGAAGCGTGCCTCCTTTCTCCTGGCATTCTCATCCCGTGTTGTAGTAATGGCGTTATCAATGATGATGATTAACAGCCAGCATGGTAAGGGGCAGCATCTAAGCTGCAGATAACCAGAGCGAGATAATCGCATGTAGTCAATGCTCATACATCAATCTCTCTGACCGTTCGCCCGCTTCTTTGAATTTGCAATCAGGCTGTCAGCCTTATGCTCGAAATGACCATAACCAGCGCCCGGCAGTAGTGAAGCCCATTATTGCTGCATGAACAGCTGTCCAATTGCCTGAACTGATCATGACGCCAATCAATCATAATAGGTAGAAGAATCTAGCTCCAAGCGCTCCTTAATCTGCTGCAATGCCACAGCGTCCTGACTTTTCCAGAGAAGTCTTTCAACGGACCCAAGCTGCTTGCGGTAGGCATCCCACCAACGGGAAGAAATAAATGGGCCGTCCGGCGCCTGTTGATTTAGGGTTTGGGTTTATGTATCATTGACAGTCTGCGAGGTAATCGGAGTAATCAGAGGCAGCTCAGCCTCCCGCTACAAATGACGTCAAACTAGATATTTCTGGTTTTCGTCTGACGTCCGTCAGTATCCATTTCCCTCCGGACGACGAACGCCAGCATATCGCGGAACGCCTTGATCAGTTTGATTATTACATTTCTACCATCTTCTACTCCGGCTTTTAGCAGCGAAGCGTTTGATAAGCGAACGATCGAGTCAGTATCTAAGATGTAGCCGGACTAAACACGGCCTGTCAAGACGAGATTGCTACTTAGTCCGCTGAAGTCGAAGGTCAACGCAGCACGAACTAGGCGATAACCCGCTAGCACTCCCGTTGCGTCGATTACTGTTTTGTAATAGAACGCACATGCTCATTATTGGACGCGAATGACCCCATTGCAAACGCGCAAGGATTCCCCGATGCCTTGTTCCTTTGTTGTAGAGAATGGCGGCCAACAGGTCATGTTTTCTGGCATCTTCGGTTACCCCCAATAAGGGGATTTGCTCTATTTAATTAGGAATAAGGTCGATCTACTGAACGGAACAAAGGTCGAGGCTACTGTGTTTTAGATCAGATTTGTTCGTGACCGATATGCACGGGCAAAACGGCAGGAGGTTGTTAGGCGACCTCCTGCGGCCAGGGTTTTCACGAAGGTCATGTGTAAAGGCCGCAGGGCCGTCAACTATTACTAATGAATTCAAAGACAGTGGCTACGGCCGTTTGGGTTGTGCTGTTGCTCGGCGGCGATGACGCCTGTTCAATAGGGAGATTTGAGTCATTTCTGCTTCCGGTATTCGCTTAATTCAGCACAACGGAAAGAGGCACTGAGACCAGGCTCGCCGACTCTTCACGATTATCGACTCAATGCTCTTACCTGTTGTGCAGTTAAAACGGGTCGAAAACCCGTTTTATGCAGGCTCTAACTATTACCTGCGAAGTACTGTTTCGGGATTGCATTTTGCAGACCTCTGCCTGCGATGGTTGGAGTTCCAGACGATACGTCGAAGTAAGACAGGCGGAATCGGTAGTAAGCGCCCCTCTATTTCATCTCACTACAACGAGCGAATTAACCCATCGTTGAGTCAAATTACCCAATTTATTCAAGTAAGTCAATATCATGCTAGTTAATATGTTGTTCGATGGAGTGCAATCATTCATGCGCTAACGTGTTGACGCATCGGTAAAAATGTTGCGATTAACTTCTTTGTGGCATTGCACCAGCGTCATACAGCCGGCTTAACAGTGCGTGACAGAGGTGGCTCGTACACGTGGTTTGGGATTAGCATCGTCACAGCGCGATGCTCTGCTGCCTTGTGCTGGCGGCATCCTTGAATAGCCCGACGCCTTTGCATCTTCCCACTCTTTCTAGACAACTCCCACAGCTCTGTGTTTTGACGAAAGTGATGTAACCGCACGGCCTGTACCATGGCAATCTCTGCATCTTGCGCGCGGCGAGGCGTCGCGGCACTGAGCACTAGGCAATAATCCGCATAAGGCGTAAATGTTGCGAGCACTTGCAATCACTTTGCCTTGTAGTATTTCTCCTTCAAGCTTTTGCCACCACGTGTTCCCCGATACCTTGTGTGCATTGGGCATCAGATAGTTGATATAGCCTTTTGTTGTCGTTCTGGCTGAGTTTCGTGCTTACAGAATGCAACGCATGGAGGCAGTCGCACGGCTTGTACTTGCGCCATCCCCATAGCATCCATCACATCAGTACTAGGAAAGAGAGTCAAGAAGCCGTGTAAGCGTGGTCAGTCGCACTCATCATCGGGCTTTGTAGAATGAAGTTCATCTAGCTACGGTTTTCAGTCTCAGTGCGCCTTCTCCCTGTACCTGAATCAATGTTAGGTTCCCGAACATGCGCCGGTATCGATACATTTGGTTGGCAAGACTTGAGTGGTTTCACTGCTGGCGTATGACCAAAGATGAACGTGTCCCTTTGATTTCTGTTCACGATCCCGTTTGTGAGTTGCTGATTCGTTCGCGGTTCCAGATTGACCTGCTGATGATCAACTGGGCTTTCCAAACTGCGTATTCGTCAATTAGGGATAATCACGGCGTGGCAGGATAACATATTTTATCTTAACGAGTTCACTCTAGATGATTGGACGGAAGTTCATCTGCTATTTATGGGCAAGGTCTAGCCAGAATTTCTTCTGTCGTAATCGAGATTAAAGAACCAGCCGCCACCGCCATGTAAGCATGCCAGTGATTAACGTTTCCACGCTCTGATAAGCCATCAATCATCATTTGCTCATGGTTTCCACGTACAATAGCTGACCAGGGAAGTCGTGATTAATTCAGGCATTCAACGTTCTCTGCACGATCAACCAAATGCTCCCCACCGAGATAAGCAGGTCTTTGTTGTCGAATCCAGCACGATCGTATCCGCGTTGTTCATCGAACTTCGTGTAGCATCCGTGCAGATCGCGGCGCGACTCGTATATTTCATGTAAATTTGCGGGTCATTGTATGCCATCAATTTTTCGTAATAGCCCATCTCTTTCACCTCCATCCGCGATGAACCATGAGAACGGTCGTTAACAATGTCCATCGTGCATTTTCCCGTCTTTATCATCAACCGTATTTTCGTATGAATGCACCGCGACTAAGTTTCAGTCTGCGTTGCCTTCACTTCTCCTTTCCGTATGTTTCGAACGAGCATGTCTGGAATGGTTTTACTATGAGACGTCATGCGGCCTCATTCTGCTATTTCGCAGGTCTTTGAGTTTCTGTTGGTGATATGCCTGTGATCGCCTTGCACTCTGTCGATAGTCCAGCGATGGCGGTTATGGTTTGATTGTTCGATTTCGTCTACTGCTTCCTGCCCGATGCTACTAATCAGTTCGACGCGAGTACCGGAACGAGATTTCCGCTTTGTGCCTTGCCACCACGCATTGCTGCGTGAATATTGCGTTCATTAAATCGGAGTCGATGATCATGCAGCAGTTATTCTGTAAGTAATGTCCGGCATCCCACTGAGCGACGTACAAGCGTTCTAATCCGCACGATACATGGTAAGTCGCGGTCTCTTTCTGATGAAGGCGTTTACGGCATTGTTTGGCTTGTTTAATCCAGTGACTGCGGCTGCTTTAAGGCGAGTCGCGTAATCTTAAGTTTATCTTTCGTTTCTGCTCCTCGTCGTCGTTTCTTCTCTGCTGCTTTTCGCTTTCGCGCTTTCTTTATTCGTCGTTCGAGTGCTATCTTGGTTCCACACTCTGGAGAGCACCACATGATTAGCGAATGCAGGTGAAACCATTCCCGGCATTCATCGTTTTACATCGTCTTCGCGCTGGTTTTAGCCATCATCTTCTTCTCCTCGTGCATCGAGCTATTCGGATCGCTCATCAGTTCTGCGCGACCGATCGACGCCACGTGAACTTCCAGCACATGCAGCTTCTGACCGCGAAGTCCTAGCGCAGGACGTTAAAGCTGCTCGCTCGCCGACGCTTTCTTGTTCTGACTTCGATTTAGTTAATCACCTTGTTTTCCTCGCACGACGTCTTATAAGGGGTCCCACAGGTGAGCCGTGTAGTTGAAGGTTTTTACGTCAGTAATTCTTTGTGGGATTGGCTTGGGTTTATATTTCTGGTGCGTTTCTTCGTTGGAAGGTATTTGCAGTTTTCTACAGATTATGTCGGTGATACTTCGTCGCTGTCTTCTCACACGTCCTCCTTTTCCTGCGGTGGTAACACCCTGTTGGTTCTTTCAATAACGAGACAAGATCCGATTCCAGTAAGGAGTGTACTTGGTCGGAAGCGGTTATCTTCTTTGCATTCACCGCAGCCAGACGACACCCGCATCAGATGCAGCTTCCTCCCGAAGTCGAAATCAAGCTGCCCTCGACAAAGAGCGACTCTTTCGCATGACTGATGAAATACCAGCCGGTATCGAATCTTTTATAATTATACAGTCCTGATACGAGGCTTGATAATCATTTTCGTGAATACATTGTTCGCGATACCGTCCCCAGCGACATTCTTCCTCGGTACATAATCTCCTTTGGCGTTTCCCGATGTCCGTCACGCACATGGGATGCCGTGATATACATGCCTACGGAACCCGTTGGATCCTCCTCATCTTTGCGACTACAAGTCCGATTTGCGTTGGGTTTAATGCAGAATATGCATATTTACCAGATGTTCCGGTATTGCAAATCGCGAATGGTTGTTGCCGTCGCCCATGCGGATATCTTCCTTCTCATAAAGTCTGACAGTTCAGCACAGATATCTTGATTCCAGGCGTTGGCTTCGTTAGGCCGCTTCGGTTCATCAGCTCTGATGCCAATCAATCCACGTGGTGGACCTCCCTCGCCGAAATGGTCATCACAGAGAGTATGTTGGTGAAGGGAACGAGTTCCTTAATGATCGTCATCGGAATGCGCAATCCTAAGCCGACGTATGGAGTGCCATATTTCTTTACAGTGAGACCTGGCTTCGATCAGGCATTCGCGTCTGAATATCCTTTGGTTCCCATACCGTATAACCATTTGGCTGTCCAAGCTCTAGGTTGATATCACTGAGCTGCAATACCGGTGAGCGTATATCCAAAGGGGCTAGAGCGAACTTCACAACTTCCCCCGCCTGACAAACCGATATGTCACTTGGATGTTCACATGGCTATCTTGGCCGGCGGACGTAATGCACGTCTTTACCTGCCCGTCGCTTTGCTCCATTAGCCAGAGCATAAATATGCTGACGTCCTTGAGCAGGGGACTAACGACATTTATATGCAGCCCTGTCTCCCCATCTCGTGTTCCACTCCGAGCCAGTCTCGCTTCGTCTGACCACTTAACTCACGCTCTGTACCGAATGCCTGTACAGCTCTAATAGCTGCGCAAATTCACACGCATCCTTAGTGGTTGACCGCTTACTACAAAGCCATTCCCGGCCAAGGTCAGGAACAACATCCTGCTGCTTTAATGCTGCGGTAAACACACACTTCGAGCTTTCTGCATCCAGCCAGCGACCATGCCATTCAACCTGACGGAGAAGGTCTAAGCAGGCCATAGCTTCTTCCTGTTTTGGTCTAAGCTGCATTGCGTTTCGGACATCATAGACTGATGAGTGGTTACCTAGAAAGGATTTGATTCGTGTAATTAGTAGGGAGGAGTGTCGGTACTGACGATCCAACATCAGTTTTGTATAGACCTTCTTGCCTGGGATCGAATGTTCGGATAGTTAATGTTTGTTAGGTGACTTTATACCTATCTACGCCGATA * tp:A:P cm:i:136 s1:i:1176 s2:i:0 NM:i:2029 ms:i:4396 AS:i:4396 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
13 10 16 utg000001l 29357 60 866S8M3D8M1D3M1D7M2I7M2I4M1I7M1D10M1I9M3D1M2D16M1I18M4I6M4D7M3D9M3I2M2D10M1D3M3D2M2I3M3I1M1I7M1I1M2D3M1I29M1D13M1I1M1I8M3D7M1D11M1D2M4D2M1I6M1D12M2I1M3D12M1D5M2D1M3I5M1I9M2I4M2I7M1I5M2I25M1I8M1D11M1I2M4I6M1D3M1D9M3D15M1D17M1I11M3D30M2I8M3I18M5D5M3D6M1I20M1I5M1I7M5I3M1D6M2D9M1I2M1D1M1D11M1I3M1I18M6D23M1D3M2I1M1I2M1D4M1I9M1D1M1D21M2D1M1D10M2D3M1D6M4I8M1I7M1I27M2D13M4D2M1D4M1I2M5D5M1D5M2I1M1I4M2D23M1I7M1I3M1D1M1D24M3D12M1I5M1D19M2I6M4I3M1I41M2D4M3D8M3D1M1D23M2D10M1I52M2D10M4I6M2D13M1I5M2I3M1D5M3D5M3D8M1D15M1I13M1I5M1I6M1D19M2I7M5D3M1I5M1I7M1I11M1I3M2D8M2I3M1D8M3I8M1D8M1D5M3D17M2D17M1I3M5I9M1I8M1I8M1D6M2D2M2I2M1I8M2D2M2D4M2D7M2D8M2D7M1I4M7D3M1D35M2D9M1D7M4D30M2I4M1I19M1I6M1D14M1I4M5I5M1D15M5D2M1D3M1D7M1D2M1D4M1I10M1I14M3D10M1D5M1I5M1D1M2D7M5D11M2D3M4I2M4I2M1I5M4D10M1D5M1I1M1I4M4I10M1D6M1I5M1D9M2I6M1D7M2D1M1D8M2D2M1D3M7D7M1D9M1D2M2D3M3I3M3I2M2I3M1D2M1D18M8I13M2I7M1I6M2D2M1I7M1D1M1D1M1D2M2D15M3I1M1I7M1I20M1I9M1I5M1D19M1I10M2I1M1D2M1I40M1I6M1I7M1I5M1D5M1I7M2D3M1D5M2D19M2D40M3D5M1I8M1D1M2I1M1I6M1I2M2D1M1I5M1I2M2D5M2D1M1I5M1D2M6D1M1D8M4I11M1D5M1D3M2I4M1D3M1I6M2I8M8D4M3D4M1I3M1I9M1D1M1D6M1D11M1D7M4D1M1D2M1D5M3D3M1I2M2D4M1I11M1I5M3D1M1D5M2D2M1I8M1D5M3D5M2I3M3D7M1D1M1D4M3D2M1D12M1D1M1D7M1D12M1D3M2D6M3D19M1I11M1I6M2I6M1D3M1D6M1I3M1D3M1D5M1D1M1D3M1D13M3I29M1I12M1D3M1D4M1I6M1D3M3I10M1D5M1D9M4D6M1D1M2I14M2D2M2D1M3D5M3I9M2D2M1I12M3I13M1D1M3I13M1I9M1D6M2D9M1D1M2D13M1D18M1I6M3D3M3I3M1D18M1D5M1I9M1D10M1D6M1I5M1I2M1I7M1D5M1I17M1I19M1D17M1D15M2D2M1D1M2D3M2I11M2I7M1D5M1I11M2D19M1D7M1D8M3D3M1D2M2D3M1D3M9D5M4D9M4I5M2I2M1D8M1I4M3I1M1I5M1I4M3I24M1D8M1D3M1I9M1I14M1D2M2I5M1I4M1I2M1I4M1I1M3D8M1D7M3I2M1D5M1D11M1D8M2I3M2I8M1D7M1D12M1I2M2D4M1D16M2I18M2D8M2D5M1I12M1D7M1D7M1D11M1D11M12I15M1I8M5D3M1D6M2I3M1D15M2D8M1I3M1D10M2I8M1D5M1D8M1D10M1I3M3I6M1D5M1I4M1I3M2D8M1I2M1I4M1I4M1I8M2I18M1D3M1D16M1D5M2I1M2I3M1I3M1I12M3I8M1I2M1D3M2D3M5I15M1I1M2D12M2I6M2I3M1D6M1D9M1D6M1D8M1I11M4D4M4D5M2I2M1I4M2I43M1D9M2D10M1D14M2I11M1D11M4I6M1I7M1I8M2D7M3D24M1D6M3I31M1D12M1I34M1D4M1D2M2I5M1D2M4D4M2D4M1D4M3D5M4I12M1D15M1D9M2I9M1D4M1I6M3I1M1I7M2I5M7I1M1D2M1I4M3I5M3I1M1I2M12I13M1D5M2D3M5D27M1I1M2D2M1I20M1I3M1I1M2D9M3D5M1I6M1D6M5D2M1D3M3I5M1D8M1I15M3I7M3D4M1D1M2D3M2D1M1I3M2D19M1I4M3I4M2D5M2I16M6D10M1I4M1D15M2I5M1D2M4D3M2D13M1I3M1D1M1D3M1D6M1D11M1I2M1I6M1I7M5D2M1D8M5D2M1I4M2I4M1D7M1I2M1I8M1D16M6D9M3D3M1D8M2D2M1D15M2D6M1D4M3I8M1I7M1D6M1I2M2D8M2D22M6D6M2I4M2I15M2I3M1I3M1D15M3D9M2D4M1D4M1D22M1D1M1D3M1D8M1D4M2I7M1I7M1I9M1D1M1D3M3I30M1D16M2I3M1D11M1I35M2D1M1D9M2I2M1D1M1D10M8D3M1D6M2I4M1I1M1I12M1I2M1D7M1D9M1D4M6D2M2D3M2D1M1D4M1D2M1D7M2D4M1D6M1I2M1D31M1D1M1D19M2I3M2D7M2I10M1D10M1D3M2I2M3I3M1I4M3I2M1I6M2D1M1D10M1D3M1D3M1I5M1D5M2D5M2D10M1I30M1D9M1D5M3D14M3D20M1D9M1D7M1D6M3I6M4I4M1D9M1D10M4D1M3D9M3D12M2D8M1I3M1I4M1D12M1D5M1D2M1I3M3I12M3D4M2D23M4D7M1I8M1I6M3I2M3I2M2I10M1I8M3D2M1D15M1D5M2D1M1I7M2D3M2D22M2D2M1I8M4D3M4I3M1D9M2I8M1D3M1D5M1I36M3I14M1I10M1D14M2I3M4D4M2D1M3D9M1D17M2I3M3D1M1D2M1D12M2I1M1I2M1I1M1I16M1I11M2D27M1I54M3I20M1I8M4D5M2D11M1D6M1D21M1D3M2I5M1D1M2D3M1D2M4D1M4D12M4I2M1I7M5D12M2D8M1D6M1D13M2I17M1I1M1I13M1I8M1D10M1D7M1D12M1D17M1I5M3I6M4D1M1D1M3D16M2I7M1D13M1I14M1D17M5I3M3I9M1I8M1D21M3I2M5I10M1D3M1I2M6I1M1I38M1D9M2D30M1I13M50S * 0 0 AAACAGAACGTACCTGATCCGTCTATACTACGTATTGACGTACTTCACGTTAATGCCTGTATACGACTCAATGGTATCCCGCCCGACAGACGGGACAATGTCAGGGTTTCACTTGAAATAGCCCATCAACCATCATGTTACTATGCCTAACGGGCCGGGATGACTGTACCGCAATGCGGGCACACGTAAAAGCGCAACCACACGTCTACCGCATGGTTCAGTTCTGGATGTTTGTAATCAACGCCCGTTTCTAGGACATATAACTAGGTAACATCTACTAACTATGTTTCACCCCTCCTCCTGTTCTTATCTAGCTCTCCTACTCCTCGCCATCGTGGTCTCGGCCCTTCTCTTCTGCCCAACTTGATACGGCGCGAAAGCCAGCAGATCACAGGCTTCCCGAGAACGCGCTGCAGGTAACATACGGGGAAACACCTGTACCGCCTCCTGGGTCTAGCCCATAACGGACCATAAAGTAACTAACTATTTACGTATCTGTTTAGATAACATCGAACCTTTGCTTGTAGTAATCACGCTTATCTATCAACGTTACTAAATATAATTCACTACCTAGAATCAAAAACCGATATGCCCATCTTATCAATCTAGTACGATCGTATACCTGACTATACAGTTACACCGCCTGATCGTTTAGGCCCGGAAGCTCGAGGCCGCCTTTACAATGTCCCGACCATTTTTCCGCCCTCAGCGTGATCCGTTTATCGTACAGTTTTCAGCTCGTAGACATTACTGAGCGTCCGGAGTCGCATTCACACTGCCACTGATATCCGCATTTTAGAGGGTACTATAGCTTCGTCCGTTAAGGGTTGGAAAGGCCGGAGGATTGCCGCTGGTAATGGTGGGGCCGTCAGGCGCTTCAGGAGACACGTCGTCTTCATAGAATATCATGGTTGCCCTGCTGCACAAACATCGGCTTTCATTCCCGTTTGCCGGGTCAATAAATGCGATACCGCAGATTGGCGCAACGAGAAACGGGCTAAGTTGCCTTCCTCGTGTCCTCCCCATGCTGAGGCTAATACCCGCGACATAATGTTTGCCGTCTTTGGTCTGCTCAATTTGACGACCCCACATGGCATTCATTATCACTGACTGCAGATCCTTCGAAAATTCCTCTTCCAGCCGGGAGGTCCCTCCGGGAGTGCAGGCGCTTCCAGAGCAATGCCCCGGAAGGAGGCATGGGATTCGGTTATCTTGCCTTTGAAAAATCCAGGGTCTCTTCCTGCCCTGATGAGCCTCCCCGCCTCATTCGCCCGCATTCCCTTCAAACGGTGTTTACACTGCGGATATAAAATAATCATGGCCCGGTTTGATATTGATACCATGGCGGCTATCCAGTACAGCTAAGTCACCAACGCGTGCTGAGTCGTGACTTGAGTCTGATATCCAATCTGCTTTTAGGGAACCAGAGACTCTCAAACTGTACCGTCGGGTCATAAACGGGCAAGATGCGGCGTGAGTCTGAAATAGCCCGGCGTCAGCTAGTGACTCTGACGCCTAGTGCCGGTGCGGCAATCCGGAACCGATACCGACGCCGGATCGCCCTGCTCTGCCCACGCATTTTACCGCCCGGACTGTCAGCCTGTAGTTCCAGCGCCAGTTGCGTGAAGCGTATGTATTCGTGTCCGTTGAGCGTAGACCAGCCGCTCACTGCCGTCGATCCGCTGTTACGGTCAGACGGAGCAGGAAACTCACGGTCCCCACCTTCGGGTGTCCCATCGCGCCAGCACCTGATATTCCCCGGTGTTGGTCTGCAGTGACTTCTGCGGTCAGGTGCTGCACCGCTGGCGGCGTAACATTCATTCAAGCTGTTCCCCGTCAAAGTAGCCCCGTTATCCACGATGGCCTCTTTTCTAGCACATGCTGCACGGCGGTGATGGCATACGTGCCGTCGTTCACGGATACTGACGCGGCCGGAACGTCCTCGGCAGCGTGGGCGGCAGCTTCAGCTCCATACGCTGTATTCAAGACACCGTCAGGAAACACGGGCTCATTACCTTCACGCCGTCGGTAAAGGCTGACTCGCACTCAGGAATGGCAGTCGCATTTCGAGGAACCAGGCGAGTACGGAGGGGAGATGGAGGATGTAAGCGATGCACGAGCGTCAGCGTCCGGGGTCTGGCTGTTTCAGCCAAGCCAGGACAATCACGGATGCTGATACCGGCATAGCGTCCTCCTTCGCCAGGCTTCTCCTCAGCCAGTTCCCTGGCTTCGCTTCTCTGCCTGAAATCCACGGTCTGCGTTTCCAGCAGTCCTGTTTAATCAGCCACGGCAGGCGTGTGCCTGCCCCGGCTGGTACAGCCTAAGAAGCATCCATCTTCGTAACATTACGACCGTAACGGCAATGGCCTGCGTGAGTCTTCAACAAGTGTGTCGCGTCTACGAGCCGTGTTCGGGTCAATCGAGTTCACCTCCAACGGCATTATGGCGGTCCTTCATAGGGCGTGAAGCTGTAGCGAACGGTGGCCACCCTAGATAAGGCCGGGGGTAGGTTACTGCTTTATCACGGTCCTCGCACGTCTTATCGACGGTTAGGTCTGCCCGTAGTCCTCAGATCTTACAGTCGACCCGCTCATAAGAAACGCCGAGCAATACGGGACCTGGGCAGCCGCGTGTCAGGTACGCATTACAGCTAGTATTGTGGTCGGCGCTGCCAAAGCTTAGGGGACTCAATTCAGCATACGTCGGTGCTCTGGTCTAAGTATGACATCACACGCCCATTTATCCACATCCGCCTAGATCAAGACGTTTCTCCATGCCGTAGCGCGATCGGTACAGCATATCCCACAGACACCAGGCCATGTTGTTGCTGTATGCCGGTTTAAACGTTCCGTCCCAGATACCCTGTATTGCCGCGGTCTGCGGTATAGTTTGACGGCACCTGCAGAATACGCCCGCGCAGATGATAATTACGGCTCACCTGCTGGCTGCCGAACTGTAGCGCGCGTTGACCTGCACGACCAGTGCTAGGTCGCGAGGATCGATGCAGGAGGCATGCCCCATAGCCAGGAAGAAGTATCTATTACCGGCAGCTCTCGGCTTCCGGCTCCTCCTGCCTTGGGACTTCCCTCGGGGTGCGGCTTACCATACGAGGCAGATAACTGCGAGGTGAGTTTTGCCTTAATGGTGATGTCTTTCTAGTACTACAGCTACGTTATCGTATTGAACCAGCAGGGCAATTCCGACGGATTCCTGTCACTTTGAGGTTTCCACCAGTGCCTGTACACCCGAAGGTAAAGCGCAGACGTTCATGTTGCAGAATCTGCATCGTCGGTGATCGGCGTGTCACCTCTTCACTTCCGTACCCAGCACCGTCTCCACGTCTAAGGATTCAATCCTCAGGCGGAGTCTGATGCTCCTGCTACCAGCCGGAACACCGTGACACGGATATGTTGGTATTCTAGCCGGTCCAGCACCGGCGATTACTGTCATGATAGGACGCTTTAAGCCATCCAAGGACCTTCAATCGGGCCCTTCGCTGATGATCCAGTACTCAGCAACTTCGTGGACTTCAGGTTGTCCTTCGCTTCGCGCGTTCGCTCCCTTACTGCTTCCTTTACCATTCCCTCACGCTCATAAACTACAAACCGCCCGCAGGCGGTTTCACATAAACAGTGCATCAGCGACCAAGTACCACAAGCTGACACCGTCCCTTCGTCTGCCGTGCGATCTCCTGAGAAACCGGTGACCCCACGCGCATTTCCCCGTACGAACACGGCAGAACATTGCCGGGGCAACCATGTTATCAGTGAGGAAATAGGTATGTTCATTATTATAGGGTTACGGGCCATTTGTTCTGTGCCCGGATTCAGTCCCTGTCACACCACTTAAGAGCACCATACTGGCACCGAGAGAACAGGATGCCGGTCATACCACCGGCCCCAATGGCTCCTTTCCGAGTTCTCGCGGAGGAGAGGAGCGGGAAGAATGCGGAGAGGAGAGTTCGCCGCGGACAATCTTGGAAGATACGCCACCTGACTTGGCCCGGCGACTCTGGGAACATATGAATTACAGCAGGCCATCAGGCAGAGTCTCATGTAACTGCGTTACGACCCGGACGTGCTGACGTCCCGCCCGGCAATCGTACTGATACCAGCCGGGTTCGCTAATTCTGACGAAACGCCGGGAGCTGTGTGATGCCCGGATGGCTTCAGCCCCGTTTTCACGAAGCATCATGCGGCGACCAAAAGCCTTTAAATGCCGTAAAGCAGATGCGCTGCCCCGATGCCCGTGACGCCAGAGGAGTGTGCGTCGCTGCCATTTGTCCGGTGTACCTCTCTCGTTTGCTCAGTTGTCAGGAATATGCTGCAGCATCGCCGTTGGTCCGCAGTAGTAAATGCGGCGTGATTCGGCACTGATGATGAACCAAACAGCACAGCAGGATCGCCCGGCTGTGCCGCCTGACGGCACCTGATAAGACCCGTCTCTCCAGATTATCCAGATAGAGATTCTGATAGAGTTACAGTCCTGACATAGATGAAAGTCCGGCATCTCAATGCCCCAGATGATAAGCAGCCGGAACAGTGTAACAGTCGTCACACGGTGCTCCCAAAGCGCCGCCCGGGTGATGCGGCTGGCACACGAGAACTGTCTGAATCGTCGCTCAAGACCAGCCACCACGGCAAATCAACTGCACCTTGCAGCCGCCGGTCGGCCTCACTCAGCAGGCAGACCACCGGGGTGTCCTAACAGCGCCACAATCTCACCCTGCATTTCGCCTCAAGGAGAGCTGCGAGGAAGCAGGGAAATAAGCCCCGCGGAGGATGGAGATATTCACGCAGGGAAATATCTTTCCCCCTCGGCGGTGCTTCGGATCGCCGAAGCCTCGCCTCCTGGAGAGCTCCCCTTCGCGTGCCGGATCTCGGCTTCTTCTGTGTCATGGGATTTACTGCTTTGTTAATGGAAAGGAAGCCGCCAAAGTTGCCGACGTTATGCCAAAATGTACAACATCCAGGCATTTGCTGCATTTATCTTCGTGATATCGACGTTGGCTGGTCATATTCATCCGACAGCCGTAGGACCTCAACTAATCCGTACCGCGATAGATCAGCTTAAGTGTTGTCAGCATGATACGTCCGGAAAACATAGCCATCGTTTCGTCGGCGTGGAATAGTAAAGGAGGACTCAAGCGTGAGTCGCTGCACTGCTCAATGCGCCAGCGGCTGATCACCTCCTTGCTCCAAATCGTGAATCTGTTTCCGTTGACGACGAATTTACCGCATCCAGAAAACGGCGTTAACGATCGACTACCGTTCCGCTAACCAGACTCTGCATATCTTCTCATCCCGGTGACATATACCGTACAGGTTAGAGAAGCGTCAGCGTGCGGTACTGGTGCCTTTGCCATTCAGTTCAAACCGCTCCTAGCGAATGGGATACGGCTGATACTGTCGCCCCGCCAGTGACGGCTCACCTTTCGTTCTGCTCATTACAGAAAAGACGTTCGCATGACCTCTGTCAGGTCGATTTGCCCAGCACCACGCTGGCCAGGACTGCTCAAACGGTGCATTCATTCAGTGTTTCCTGCCGGATATCCTGCATTTCACCCACCTGTTCAAACTCTGCTGAACTCAACACGCAGCATACTGACCCGCGACCATTTTAGCAGTATAGCTTTGCCCGCAGAGCAGGCGTGGAGGTACAGAAATGAATTCCAGAGAGCGCTCTCCAATTATCGTGGCTCCTCTCGGATAAGAGGGATCGGCTTCTCTTTCCAGGTTTGGCATTCAGCCCTGAAGGCGCTCGCTGAGAATAGCCATACCAAAGCGCACCTTCTTACAGAAGGGACGAACAGCCACATCCATACCGGGTTTCGTACTTTCCAGCAGAGGCTTCCATTAGGTCAGCGGGGAACAGGCCACCATCACGCATCTGTGTCTGAATTTCATCACGGCACCCTGCGGGCGTACTACTACGCCTTCAGAGCAGCCGGACTATCTTACGTTCGTCGTCGTTGTTAATACCACATGGTTATTCTTATCAAACGTTTGACGCCTTAGACGGCTGTCCATGCTGCCCGGTACCGACATAACCGCCGGTGGCATAGCCGGGATAGTCGGTAAAGATTCCCCACGGTACGGCTGGTTGCCTCCTTCGTGAAGACTCACCACGTGAACACATCCCCTGAGCCTATGTAGCTCATATTTGCCGCCGGTTCCCAAATCCTCCGGTTTAAAATGGGAATTTCCCGCAGCGGCCTGAATGGCTGTACCGCCCCGACGGATGCGCCCCACCAACAGCCCGCCAATGGCCTGCGATACCTCCAGACATGCCCCACCATTGCCTGCTTATTAAGACCGATTTCTGTCATCATGGGACAGCACGGAACGGGTGAAGCTTAGGGTTCTGTACTGCCGGTCAGCATCGCCCCCATATTCTGTGCAATACCATCAAAGGTCTGCGTGGCTGCATTTACCTGCGACATACTGTCCGGCGCTCTCTTCCCACTCACTCCAGCCGGACTTCAGGCCTTGGTTCAGTTCCCGCGAAGCTGGTCTTCAGCCCAGGTCTTTTCTGCTGCTGACATGACGTTATTCTCGCCCTCGATCGCCCTCTTCCTTCGGCGCTTCCTTCTCGCGGCTTCCCGGTGCTTCGCCTGCTTCGCGTAAGAGCATTAGGGACCGAGCGCGTTGCCCGTTGCTGCTGTGCGAATTTATCCTGCTGCGCCCGCTGAGCCGTTCAGGCGCTCCTGATACGTACTTGTCGCCAAGTGCATCAGCTGGCGTTGTACTCATGCGTCTCATTTTATGCGCCAGCAGGAGAGTTCTCTTCCTTTAAGACAGCTGGCGACGTTTAGCCGCCTCTCCCGGATCTAGAACTGACTCTCCGTCTCCACAAATCCCGGCGCTCTTATGCTGGCTGATTTTCTCATTTGCTCGGCATGCTTCTCGAGCGTTCGTGGAGTTCTTGGGCCTGAAGCGATGATTCAACGAGGGCAGCATGAGCACTGTCTTCCTGACGATCGCCCGCAGACACCTTCACGCTGGACTGTTTCGGCTTTTTCAGCGTCGCTTCATAATCCTGTCGCCCTAGTCCCACGTGTGTCTTAATCCTGCGCTTAACAAGCATAGAG * tp:A:P cm:i:71 s1:i:638 s2:i:0 NM:i:1933 ms:i:2004 AS:i:2004 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
14 11 0 utg000001l 40352 60 2106S10M1I6M1I8M1I9M1I12M2D22M2I3M1I2M2D3M2D3M1D13M2I18M3D7M1D6M6I2M1D4M1I4M1D19M1D4M1I9M1D17M1I1M2I3M1I31M1I5M1I7M3I9M1D14M1D2M2I8M3I13M3D24M1D26M1D20M1I3M1I17M1D11M1D4M1D32M2I9M1D23M1D8M2I1M1I34M2D18M1D15M1I3M4I5M3I3M1D20M1I1M1I4M2D17M3I31M2D2M5I5M1I4M1D10M1D13M1I14M3D29M1I3M1I6M2D6M1D5M1I3M2D6M1I16M3I12M1I13M1D1M1D3M2D5M3D4M1I10M3I15M1I12M1D4M2D8M1I6M2D2M2D6M2D3M1D4M2D6M1I14M1I17M1D5M1I1M3I9M7D4M1I11M1I13M2I5M1D5M2I6M2D21M3D10M1D41M2D2M1D11M1D7M2I13M1I11M3D17M1D23M3I21M1D20M1I3M1D35M2I20M1D7M1I12M1I5M1D4M1D5M1I7M1D6M3I4M3D2M1I4M1D6M1I4M1D1M1D7M1D10M8D3M1D4M1D7M1D8M6I3M4I5M4I3M1I6M2I8M2I2M2D13M5D3M4D10M1D5M1I10M5I4M1I1M4D6M1I4M2I4M2I2M1D8M6I2M6I4M2D3M6I5M3D12M4I3M3I2M1I27M3I10M1I2M1D3M2I24M1I5M3D14M2D19M2I6M1I24M1I2M1D7M2D3M1I10M1I10M1D10M1I14M3I1M1I14M2I5M1I15M1I2M1I1M1I68M1I25M1I7M1I58M3D11M2D3M1I13M1I6M3I29M2D38M1D2M1I7M1D13M2I4M2I8M1D8M1I50M2D6M5I4M2D1M1D8M1D1M2I44M2D7M1D7M3I10M1D5M3D3M1I30M2I1M1D7M1I28M1D7M1I3M1D26M2I5M2D12M1D6M5I24M1D2M1D4M1D8M1D24M1I10M3D3M1I21M1I3M1I2M2D5M2D26M1I4M2D34M1I23M1D15M7D21M2D2M1I3M1I2M2D18M1I15M1D10M1D4M4I8M1I4M1I24M1I6M1D9M5D2M1D6M1I11M2I11M2I22M2I12M1D2M1D12M1D4M1I9M1D11M3D12M1I20M1I2M1D9M1D3M1D22M2I4M1D6M1I14M1I48M2I5M2I5M1I4M2I7M1I5M1I8M1D22M1I5M1I4M1D6M1I16M2I4M2I1M1I13M1I9M3I4M2I7M1D9M4I10M1I30M1I2M1D7M1D3M1I6M2D2M1D9M1I36M2D21M1I3M1D26M1D20M3I11M1D4M1I11M3I13M3I2M3I9M1I5M1D5M4I2M1D4M1D10M2D6M1I7M1I7M1D15M1I30M1D8M1I1M2I9M1D26M2D19M6I5M2D14M3D6M1I4M5D1M1D8M3D9M2I15M1I2M5I6M1I6M1D5M1D11M1D18M1I13M2I4M1I13M1D22M1I16M2D14M2D4M1D33M1I28M1I13M1I8M1I3M2D5M1I2M1I6M5D5M1D12M1D15M1I4M1I13M1I11M1I18M1I18M1I13M3D21M1D34M1I4M2I6M4I3M3I21M4I2M1I5M1D7M3D8M1I19M1I8M2I1M1D2M2D15M1I5M3I2M2I4M1I4M2I11M2I1M2I17M2I1M1I23M2D13M2I45M5I10M1I6M2I13M5I13M1I7M2I1M4D1M1I22M1I3M1I6M1I4M1I7M2D16M2I5M2D14M2I29M2I8M2D6M2I1M1I14M1I7M2I6M3D12M3I10M2I2M1I6M3D4M1D7M1I5M1I6M1D4M1I16M1D11M1I9M3I16M3D14M2I2M1D7M2I1M1I4M1D7M1D6M2I1M1D3M2I11M1I10M3D2M2D4M2I27M2I15M1I5M1I5M1I2M1I1M1I9M1I19M1D8M2I10M2D7M1D12M2D4M1D3M1D17M2I4M1D20M1I3M1I25M1D7M3D29M1D19M1D5M2D4M1I4M1I5M2D6M1D6M2I8M1D8M3D7M1I3M2D10M2D12M2D10M2D6M2I10M1D6M2I18M1D4M2D3M1D5M1D13M1D1M1D24M3D8M2D12M2I19M2D13M4D4M1I13M4I3M3I4M1D4M1D6M1D30M1I12M1I6M1I5M1I15M1I2M3D11M3D5M5D3M1D7M2I12M1I3M1I42M2D5M2D27M1D5M2D14M1I20M1D9M1D2M1I2M2D17M1D4M1D9M1I35M1I12M1I7M1I4M1I10M4I1M2I3M1I29M4D3M3I2M2D16M1I22M1D1M2D7M3I7M1D2M1D7M4I1M4I28M1D4M1D20M2I16M1D12M1I12M1D19M2I3M4I1M1I17M1D11M1I3M1D13M1I2M2I45M1D13M3D21M1I2M2I1M1I11M5I7M2D3M1D6M1D24M1D4M2I14M2I21M2D5M1I2M3I4M1I14M1D18M1I2M1I32M2I42M1D11M2D32M1D15M2D11M1D17M3I4M1D6M2I10M1I4M2D22M1D3M1I13M1D33M3D26M1I9M2D21M1D3M1I1M3I30M1I1M1I15M1D9M2D2M3D18M1I1M1I18M1D4M3D17M2D8M1I8M1D8M1I8M1D6M1I7M3I14M1I15M2I2M1I5M1I1M1I3M1D3M1I1M1I6M1D12M1I12M2D8M1I5M1D11M1I1M2D15M2I2M2I10M2I2M1D14M2I11M1D6M2D16M2D3M3D27M2I6M1D8M1I17M3I1M1D11M1D3M2D6M1D15M1D19M1D6M1I4M1I12M1D12M2D1M1D28M1D4M2D9M1D12M1D9M1I10M138S * 0 0 AGTAGTGTTGCTGGGCTAACCTTGCCGTTCGGGAAGCGGATTTATGAAACGGTATCGCGCTTCACATTAAACCACGCCAGCAGCGCCTGCGATTCCCTGCTCTCCGGGCATCCACGCCAGCGTGAAGCCTCGGGTCGCGGCAGATTTCTGCCCCTGCCCGGTGGCAGTCCAGTCTGCAACCTTCATCATGAGATAGCTGTCGTCATAGGACTCAGCGGTCAGTTCGCCGGGCGTCAGGTCTTTAACTTTTGCCAGACCCGACCAGTCAACGTCTGAAAGCATTCGCGTAGATTACCGCTCCCGGTAAACCCACAGCCTGTTGAGGCACCTTTCACGGCATTGTAGGATTTGGTACAGGCAGCGTCCTCCACATTTCATAGGCATCGACATAAGTCAGATCGGCTGAACTCCACAAGCCCGCATCATCGTCGCGCCGGTAGTCATAGCCGGGTGGCCACCATACTGGTGATCAAATTGGTAGACAGTGCCTGGATATCGCTCATCACATCTGGATAAATCCGACTCCATTCATCCACGCATCCAGCTCTGAATCCGGCACCTGAGCGGCAGGAAAACTTCGATATGCAGCTCCGCCTGCCAGGATGCCCTGTCCAGCTCTTCGCCCGTGTATTCAGCCCACCGGTGAGAGATAAACGGCATGGACTTGCCGCTGAAAATCCGCCTCAAGTAAAAACAGCGGGGCGACCATCAAAAACGTCGCCCCCGGGCTGTTAATGCTTCTCCAGTGCATCCAGAGTACGGCTGCACGGAGTCCAGTATGTTTCATCGCTTTATCCGGTCCTCAGTTTGATGCTGCAGGCATAGCCCAGCTGATTGGAAGACGTTCTAATCGCCTATCCAATGACTTTGTTTAAACGCCGTGGTTAGCACAGCGCCATCGGGATTTTCACCACAACCTATCATATTTTGGGGTAAAAGCCACGCTGCCAACCCTTAAGCACATCCGCATGTTTCAGTTGCTGAATAAACGCGCCGGGAAGTACAGCGACGGTTACCCACCACAAGCACGCTGCCGCCACCTTTCAGGGATGAACGGGCTCGTGCTTTTACGACGCCGCTCGGCGCGAAAGATGACGCGCATTACCCAGCTTGATTACGGGCAAATCCCCCGGTTAACTTTGATTCTGCCTGTGGATTTGACCGTGGCTTTCATAGCCTGGCCTGTCTTTCCTTTACCAGTTTCCGGCGTACCTTTGTCTCCACGGGCAACCTGTGACGCCGACTGCGGGATATCGCGGATGAAGCAACGCGGTTAATGGCCATTGCGGCGGCACCAGGCACCGCGTTTCGCTGATACGGCTGAGGTTTTCAACGGACCCGCCTGCTCAAGACCTTTTGGTACATACATCCCCCTTTCAGCGGACGGTTAACGGCAGGCTATCACACGCGTCTAGGTAAGGATGACAACTCCATCATCTAGGTGAAACCCGATCTACCCAGAAATTTTCCTCACCGATGGTCACTCATCGTGTGCCGCCACGCAGCTGCCGCTCTAATGCATCAGTCCGGACAAACAGGACGGGCTGGAGGGCTATTCAACGCGCACGCTGTCCGGCATAGTAGTATTTTCAGGTATATCATCAAAACACCACGTATCGCCGCACCTGACTGCTCACCGGATGTAATGGTGGCTGACGTTCCATGTACCCGCGTATCGTTTCATCGGCGCGGGCAAGTGGGCAGCATCGAACAGGTTATCGAAATCAGCCACAGCGCCTCCCGTTATTGCATTCTGACAGGCCGCGCTCTGTCATTTCGGCTGCCACACCGGCAGAGACGGAAACGCGTTCCCGGCAGCACAAATGCCACAGGTTCATCCCGCGTGGCGTGAAGTGCATCAGTGCAGCTTCACCAGTGCCACGTCAATCCAAGTTCAGACGTATCCAGAATCACCACGGTATCCGGCTGCGCTGATCCCACAGCGGTTTCCATGTCCGTCAGCACATTTCCCCCGGCTGAGGGGGTGTTAACCGGCAATTTCATCCGTGTCATCAAGCTCCCTCTCTCTTTCAGGTGCCACACGCCCCGGTTTTTACTTCTTTCGTCCCTAGAGTCAGGCTCAACTAACTAGTTCAGTGTTTATACGAGCGGAGACGGGCAATCCAGTTCATGATTTCGTCATGGACTCCTCCACAGAAACAATGGCCCCGAAGGGCCATGATCGAGTTACTAACGAACTCATCAGAGTCAGCCAGCAGCATCAGTGCTTATGAATCGACTAAATCTGACGGACCCTGCGCCGGATCGCCGGTGTCACCCAGTTTTTAGCCAACGGGCACAAGCAGTTTTAGATGCCTTCGCGCTGTGCGTCCGCATCCTGAATGCAGGCCGGCCGGGGTGTGCGCAGACGCGTGCCTGAGTGTTCCCCAGCATCAAGATGGCGTGTTGTCCGGCAGGAAGTTCTTTTGACCCCGTTTCCACGTACTGTCCGGAATACACGACGATGGGCCACATCGCCATACATCCCCTTATAGGACACCGCTTGCCAGGTCTTTCACGCTGTCTCCAGCTCGGAATTAGAGCCACGACGGGTATCCAGCTTCTCCTTGACGGCTTTGAAGGAAACGGAACAGCGCCAGCCTTTCGGATCGAACACGATGATATTGCGCCACCGCTGGCGTTCAGAGCGGCTTCGATATCGTCGGTCGGGTCATACGGCGTGACTTGTCACGCTTGCTCCACTCCGTGCGCCTAAATGCGTGATGTTATTATTCTCCTCACTGCGTAACGGGTCCACCTACCTTAACGGATCCGAAGGCTTCACGGTCATGGTGTATTTGCCTTAAGCACGGCAGAAACTGCCTGCATCTCTTCGACCTGAGCAAATAGGCCAGCTGCGTACGCAGTGTTGCAGGCTTGATGCGACGCGGCGGTAGTAAGCCGGGTCGGGCCAGATTCTGCGTGATTCATCCGGCAGGCGACGCAGGGTCATCTGCGGATTCACTTCGCCTGCTTCTGAGTGGCATATCCCGGCGTAATTCAGGATGAGCCCACGGAGAACGGATAACCTCAAGCGGAAACAATCGGCGAACGTGATCTCAGCTAGGTCAGTCCCGGAATTTGTAGAGAGATAGACTTTCTCCGTGTGAAGGGGATAGCTCACGGAAAAGGAAGCAGAAACAGCGGATCAACTTAAATTTCTGCTCATTTGCCGCCAGCAGTTGGGCGGTCTTACATCGACATAAAATCCCGTAAAAAGCCGGACAAGGCGGCCTTCAGTGATGAAGGGTAAAGTTAAACGATGCTGATTGCCGTTCCGGCGACAAACGCGGTCCGTTTTTCGTCTCGTCGCTGGCAGCCTCCGATCAGAGCACATCCTCATAACGGAACGTGCTCAACTTGTAGAACGTCAGCGTGGTAGTGTCTGGTCAGCAGCAACCGCAAGAATCGAAAGGCAGGGATTATGGTGGTATGGCCAACGGCAAGAGCCCGTCGGTGAGTGAGGGCATAGGTCGCAGCGCTGGCACTGACCCGCCCATCGGGGGCGTACTGCGGCATGTTCGCACTCAGATTAGCCGCCGGGCTGAGGATTTGCGTATAACAGTATCCTGTTAGGTCCAACATGGGACCCCTGTTGGTCTAGATCCTAGCATGAACGCCTACGTGCCGCGAGCCGTCTCGGGGACCCCTCTGCCGTAGCTGCAGCCAGCGGTGCCGGTGCCCCCTGCATCAGACGATCCAGCGCAGTGTCACTGCGCGCCGTGGCACTCTGTGATGCTGCGGCCAGAATGCGAGTGGCTTTCACGGTCATACGGGGTTTCTTGCCAGCACGATCGTGCCTGTTCTTCGCGTCCGTGAGCCTCCTACAAGTTGAGGATCCCCATAATGCGGCTGTTTCTTACGCAACCGCTTGCGGTGATCTGCGCGTTCTCACGTCCGGCTGCTAGCCGCGCTCGCGTTCTCGCTCGCGCTGGGCTGGCACCACGTCAGTAGACGTCAGCCTGCGAAGCAGTGGCTGAAACAGTTGTTGATTGAGTCTCTGTTGGTCATTCGCCCTCCTGAGAGACGGGATTACGGTGCATCCAGTGCATCACGCATGACGGTGATCGCATCGGTGCTGTTAACAAGTTCATCAGCCAGTCCGGCAGCATCAATGGCCTCCGTAAATGGGTGTGTACTGCAGCCTCGGTATCCAGCACAACCTGCACGGACAGAGCGGTATATGCCGACACCTTCTGCGCAAACATCTGCGGGTTGCGTCCGTATCGATAAATGCAGTGTCTCCCAGGACGTCATCCGGAAGATGGCTGTAGGGTTGCCATCCACCTTATGGCTGCCCTGTAATCATAATCTATTTCCACTGCGTTTCTCCAGCGCAGCACCGTAATTACTGTGAGCCATCATGACGGATGGAGCTGTCCGTCCGGCGGTCTGCGTGACCCCTCCGGAGGCGGCACTGGCAAGCAACTGACTTAAGACTGCAGTTCATTTACCGTTGGCAAGCGCCCATACCGGTTTTATGTCACGCACACGGGCGATGATGTCAGCGCAGAGTCAAATGCCCCGCCACCGGCCTAAATCGCGTGTCCATATCGAGCAGAATGCGTCCACCATCGGATCGCTGGCAGCCTGTTGCAGACGGTGCGATAATGCGTTGTAACCGGTCATCCCCGAGTACGGCTGCAGCGCCCGTCCGGCTGACGAGCGTGCCGGACACCGGCAGCACGGCGATGCCGTTCATGACCTGATAACTGCGGGCCTGTCGGTGTCCGTCAGTATCCATCGGATAATGCCAGCGTCGCGAGTGCCTCCTGGAGATCAGGCTGTCGCCGGACACCGCATCCGTCAGGCTGCTGATCCCAAGCTGGCTGCAAGAAAGCGCACAAAAGAAAACCCGCGCATAGGCGGGTTCAAGGCATCAGCGGCTCATTAAAGCGGTTGGCAATATGCGGGGAGATTACGCATAGCTCTGCTGTCACTTCTCCTCCTCTGTTGATTGTCGCGAGCCCAGATTCAATGCCTGCAGCCGCGAGGCGGGCGTCAGACCGGCTTAAAACGGCGCTCCATCGTTTCGACTGACCTGCTGGCAAAATTTCCTGATAGTCGTCACTACGCGTTTTGCGCACTCTTTCTCGTAGGTACTCAGTCTAGCTTCTATCAGCATCACCGCTTCCTGAATCTCCGTCGGAGACCATCGCCAGCCACGAAGCCGGCACGGAGCCCTATCGATCGCAGTTCCCCCAGGCACTGCGGGCTTCCCTGAAACTGAAAGCGCGCGTTGAAGGTAACGTTACGACGCGGCGAACGATTGGCCTCTTCAGCCAGAACGAGCACGAAACATCGTGCCCTCGCCTGACGGGATGCGACGAATTTTCGCCGCCCCATAAACTGCCCACGATAGTTTCGCAAGCCGTGCTGTCGGAGTAGCTCATCTGGGCGTAATTCCGGGAAAGCTGCGTACGAGACACCCAGCCCGGCGGACCGATATACCGCAGCAGTGACTGCTCAACACGGAGTAGCCGTTATCTTACGTATCCTGAGCGTCTTGCAGGTTCAGTGAGTCACCCGGCATCACAAGATTATGCGGTACTTTTGCCCTCCCATGAGCTGACGGCGCTGCGGCGTAACTGAAGCAGGTTTCACCAATCCAGCCGGTCATGCTTTTCCCGCCTGCTCCTGACTGTTCTAGCCAGAATAGAGCAATCCATCGGGACTGCGTATCCAGCTCACTCTCATTGGTGGCATACACCGCCTTAGATCACAATGGCTCTGCAGCTGCGTTCTGCAGCGTCAAGCATCTTCATCTGCTCCCCATCACGCTGTAAACACAGCGGATTTGCTATAGAGGTCTGCCGTCCTCCACGGGTTCAAAATAGGCAGACCCGAACGAGGCTCCTGCCCGCCGGGTAACTCACGGGTATTCAGGTTCCTTTCTGCGGCATCCAGCCAGGATACGTCCTCGCTGACGGTATCCCATAGCCGCGACGCTGTCATTAATCTGCACACCGGCACGGCATTTCCGGCTGTCGCCGGTGGTTGTTTCGGGTGCCTGATGCGCTTCGAGTGAACTCATCCGACCGTCCCTGAAACGCCGCGACGGACTGGTATCCCCAGGGCCTGAACGAACGAGTTCACCGTTGCTATGAATTCGACTCGACTTCTTCCCGAATCATCATGCTTAAACGTGCGTTTCGCTCAACGTCAATGCAGCAAGCAGTCATCCTCGGCAAACTCTTTCCATGCCGCTTTCATGACGCGGGCGAAAATAGGCACGGGCTTCTTCCTCCGCATTACTGCCCATAAGCTCCAGCTTGGGCGATGACTGAGCCGGAAAAGACCCCGACAAACTATTAATGCGGGTGGGTGCCCGTTGCGATGCGGGCTCGCACCCCGTTATTGCGTACTAGAGATCGTCCCGGGCGGATCAATTGCCACGGGTAAAGTTGGGCAACAGGGCTGCATCCACACTTTCACTCGGTGGGTTCCACGACCGCAACTGCCCTCCAAATCTTGAGCCCTGCCGCCACCGTGTGATAACCGGCATATTCGGCGCAGCGATGTTAGGTCGGTCCGTAGAGAAGGGTGGAATGGTGGGCGTTTGCCACTACGGACAGTCGCTGCAGGTCCCTGCGTCGGTGTGCCTCATGCCGGTCTGCACTTCCTCAGCTCTGCATTACTTTTCAGGTCAGACGCCGAAATGGCTGGGCTAACGCCCCTTCGTGCGTCTTTCTGTATCCTGTTGCCCCGTTTACCTATCGTCATCAGGTTGCACTGCAGTGCACGGCAGCGTGCAAGTTCTTCCGTCGCCGTCATTCATCCTCTCCGATAAGGCACGGGCGTAATCTTATTGCCAGTGTTTTCTGTTGGTTGCTGCACCATCCTCCTTCAATGAGAGCCCAGCAGGCACTGGCAATCTAGAGCTGCCAGCGGGAAATAATGCACGCATCCCGCCGCCAGCGCATAAACGAAGCAGTTGTGAGTCTCGCCTTGCAGTTGCTTTTGCGTGCTAGCCACAGTATTTTTCCTGCCATCCACCCATTTTCGACCTCTGCTCTTCAGCAGTCATTAGTGCGCTTCGTCAATCAACTATCCGGGTTATTCGGGGAATGAAACGCACCGGGAAGCGGTTTCAATCCCCTTCCGGCGTCAGTGTGAAGCGGTTATAATCTGCTCTTTCGCGGTATCCGTACCGATTCGGTAAGGTAAACCCCGTTTGTTTCGCCTTACGTGGCATGCTGGCCACCAAGGCCTTCCGTAGACGCTTACCCCTTTAATGGGGATTACTGAACAGCCCATGTTTCGAGCGTTCATACACACAATGGTATGCTCATAATCAATCCCGCCAGTATCCCAGCAGATACGGATATCGACATTTCTGCACCATTCCGGCGGGTATAGGTTTATTAACCCTCATCCACGCACAGCAGCGTCTGTTCATCGTCGTGGCGGCCCATAATCAATCTGCCGGTCAACTTATCCGGAGCCAGCTTTCCTCACCATCCCCCATCCCCCGACGCGCATTTCGTAGCGGTCCAGCTGGGGAGTGGGATACCCGGGAGTCAAGCACGAGAGAGACGCGGAGGGCGGACAGTAATGCTCTTCCGCTCTGCTAATACTATTCAGCATCCGGACGTTCGCCAATTTTCGCCTCCCACGTCTCACCGAGCGTGGTGTTTACGAAGGTTTTACGTTTTCCGTATCCCTTTCAGTTTCATCCAGTCTTTGACAACTGCACCCGGACTGCGTGCCGTACACTGTCCCATGCAAAGGTCACCACTGTCAGGTGGCTCAATCTCTTCACCGCTGACGAAAAACCAGAGAATTGCCATCGACGGTATCAGATCCCAGAGGTTGTCTTTTCGCAGATATAACGGGCATCAGTACACGTCACTCAGCTCCTGCTGGCGGATCTACGCAGGCATTATGCTCGCAGGAAACACGGCCCTGGAGGGATCATCCGGCGTTGGAGCATTTGAGGCCAAACGGCGTCTCTTTGTCGCCAAATTTAAGATACTGCTCTCCTCCCCGCAATGCGGGCAGGCAACATGAAAGCCGCATAAAATGCGGGTACGCATTCGTAGCACGCTCGTGAATATCTGACAGGTGCCTCTACTTTTGTGAGTTAGAACGGATGGACTTAGAGCCAAACCGAGCCTTCAATACGCTTGTCACCCAGGAACGTCGGAGAGCTTCCTGTTCAATATCATCAAAAGCAGCAAGTTCTATACCTATAACCCGCCACATCCTCCACCGACTTTCACGGTAGTTTTGCCGCTTTACCGCCCAGCAGGAGCAAGAAGTGAGGCAGCCAGGCGTGAAAGCCCCATGGCGTGTGTAGCCACCCGGTGCTTTTGCCATACACGGGGCCAGCGCCAGCAAGAGGACGGAATATCACGAATAGTCGGCTCAACGTGCGGGTTTTCATAAAGTTCTCGGCATCACCATCCGTCGGGGACCCACTCGGGTGTCCCTGCTTATGCTCTATAAAGTAGGCATAAACCCCAGCAGCATTTTGGAATAACCGACGGGCAGACTTCACCACATTCTTCACTCACGGTGATCCGGTGCGTTGCCCATCGCATTCATGATGGCCCGCTGAAAAGGCAGTGTTTCCAAGCGCCCTTCCTGGTATGCGGATTCTTTCGGAGATAGTAATTAGCATCCGCCCATTGCCAACGGCGTCTGTGGCTCCGTGGTGAACAGTGAGCACGAAGCCCGGCGCGGACAAATGCCGCAGCCTAGTTTAACCTGACTGTTCGATATATTCACTCAGCAACCCCGGTATCACGTTTCATCCTAAGCGGCTGCTTGTTCATGGCTTTGATGATATCCCGTTTCCAGGAAATGACATGTCGGGTTTTCCGTTTAGAAAACGCCGGTGCACCGACAGGGAGCCCGTCGAGAATACTGGCAATTTCACGCTTGCACGATCCCGACAGCACGAAAGTACAGAATGCGGTTTCCCACTTCAGGCGTACCTGGCATTCTGTGCTTCCTGTGCCTCGTCGCTGCGTGCACGCGTAAGTCGATGGCGTTCATTGATCCAATAGTTCCTGGCTGGAGATTCTGCCTCGGTGGCCTGCCGCAGTTCTTCAACCTCCAGGGCCGCAGCTTTCGTTCTCAATTTCAGCATCCCTTATGCATACCATTTTATGAATGCAGGTCATAAAGCACCTCTCAGCTTGGATTTGCCTCGACGAACGGGCATTCCCTGTTCCTGCCAGTTCTGAATCGTGACTAGATACTCGCACCGAAAATGTCAGCCAGCTGCTTTTGTTGATTTGCATGTTCATTCTAAAGGACAAAACGACGCCAGTAAAATGCTGGATGTTCCTTCCGGGCCTATACTAAATAAACATTAAGTTATGAAGCAAAGAAGAACGCGAAAGCCGGTAAACCGGAAAATTTTCATAAATAGCAAACGCCGCGAGGTCGCCGCCACGA * tp:A:P cm:i:136 s1:i:1291 s2:i:0 zd:i:2 NM:i:1635 ms:i:5086 AS:i:5086 nn:i:0 SA:Z:utg000001l,38255,+,18S228M4I9155S,27,38;
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
15 11 2048 utg000001l 38255 27 18H19M1I7M1D5M1D8M1I3M2I26M2I7M2I26M1I4M1D4M1D14M1I26M1I11M1D12M1D3M1D3M1I2M1I11M3D6M1I21M9155H * 0 0 ACCTTGCCGTTCGGGAAGCGGATTTATGAAACGGTATCGCGCTTCACATTAAACCACGCCAGCAGCGCCTGCGATTCCCTGCTCTCCGGGCATCCACGCCAGCGTGAAGCCTCGGGTCGCGGCAGATTTCTGCCCCTGCCCGGTGGCAGTCCAGTCTGCAACCTTCATCATGAGATAGCTGTCGTCATAGGACTCAGCGGTCAGTTCGCCGGGCGTCAGGTCTTTAACTTTT * tp:A:P cm:i:6 s1:i:57 s2:i:0 zd:i:1 NM:i:38 ms:i:228 AS:i:228 nn:i:0 SA:Z:utg000001l,40352,+,2106S7061M100I138S,60,1635;
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
16 12 4 * 0 0 * * 0 0 CGTGAGTGGTTAACAGCGCCTTAGTGCCCTGCTGCGTAGCTAACAAGGCTGCAGCCTGCTCTTATCTCTCCGGCAGATTTCCAAATGCCAGCGTGAAGCGCGGTTCTCTTAGCAAGATTTCTGGCGCCGGCAGTCTGCATCTTCATCATGAGATAGCTGTCGTCATAGATCAGCCGTCAGTTCGCCGGGCGTCAGGTCTTTGATTACTTTTGCCAGACGCGACCAGTCAACGTGAAAGCGACTTCGCGTAAGGGTCACCGCTCCTAGTCAAACCGCACTGTTATCGAGCAGCTTTCACGGCATTAGGATTTGGTACCACAGGCAGCGTTCACATTTCATAGGTAATGACATAAGTCAGATCGGCTGGAAGTACCTAAGCCCGCATCATCGTCGCGCCGTAGTCATAGCCGCTGGCCACCATACTGGTGATCAAATCGTGACAGGGTCGGGATATCATTCATCACAACATGATCCGGGACTCCCATCCACGCATCCAGCTCTGAATCCTAAGCGGCCGGACGGCAGGAAAACTTCGATATGCAGCTCCGCCTGCCATATTATCATGTCCAGCTCTTCACCGTGTATTCCAGCGCCGGTGAAGATAAACGGCAACTGCCGCAAATCCGCCTCATCAAAGCCTCGGCGACCATCAAAACGTCGCGGTGTGCTATTGCTTCTCCAGTGCATCCAGTACGGCTGCACCGTTGCGTTATGTTTCATCGGATTTATTACCATCCTCAGTTGATGCCTGCAGCACAGCCCAGCTCTTTCGAAGACGTTCACGCCGTATCCGCTCAATATTTTGTTTAAACGCCGTGGTCAGCGGCAGCGCCATCGGGATAGTGCATTCACCACATCAATCGGTAACGGCTTTTTCCCATTACACGCTGCATGACATGCCACCGGCCTTTTCAGTTGCTGAATGGTAACGCGCCGGGGAATACGACGGTTACCCACCACAAGCACGCTGCCGCCTTTCAGGGATGAACGCTGCCCCTTTTACGACGCCTGCCTGAGGCGAAGGACAACCCGCGCATTACCCAGCTTGATTAAAGCGATAAATCCCCCGGTTAATTGATTCTGGCCTGCGGATTTTGACCGTGAGGCTTTTCAGCTCGCCTGGCCTTTCCTTTACCAGTTCCGGCGTGTTGTCTCACGGCAACCTGTGACGCAGGACTGGGAGATATCGCGGATGAAGCAACGCGGTTAGTATCCATTGCGGCGGCACCAGGCACCCCCGTTTTCGCTGATACGGCTGCTATTTCAACGGCCTGCTCAAGACCTTTTATGGCCATACATCCCCCGCCGTTTCAGCGGCACCGTTATAACTGAGCGGGATACGCCCCCATTTAAGACCCGCCAGATGACGACAACTTCCCGCTCATCATCCGGCTCGAAGTCATGGCGATCTACAGAAATTTTCCTCACCATGATGGTCGGCTCTAATGTTGTACCAGCTAGGATTAGAGCTACATCAGTCCAATAAAACAAAGTAGAACCGTAGGGATAGGCCTTCAACACGAAGCTTTATGAGCAGCATAGTATGTTCAGGTACTTAAAAACAAGTACGTTCTTGTTT *
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
17 13 0 utg000001l 28356 60 29S9M1D503M1D5M3I10M1I40M1I22M1D6M2I10M1I33M2I9M1I10M1I14M2D11M1D5M1I3M1I9M4D2M1I10M1I28M2I3M1I3M1I7M1I4M1I3M1I12M1I5M3D3M1D10M1I1M3D14M1I8M1I13M2I1M1I5M1I3M1I4M1D3M4D14M2I21M1I10M1I3M1D5M2D12M1I7M2I7M1D9M2I7M3D3M1D10M5D7M1D1M2D1M2D6M1D4M1D3M1I3M1D21M1I12M1D5M1I5M1I3M2I2M1I6M4D10M1I23M1I7M6D1M2D4M1D27M3D2M2I3M1I1M1I7M1D8M2I26M1D7M1I8M4I7M3D5M1I6M1I30M1I15M1D27M1D8M2D2M1D29M1I9M2D1M1D24M1I8M1I6M1D5M2D2M3I13M2I24M3I5M2D25M3I16M1D11M3D19M2D5M3I5M1I10M3D5M1I10M1I2M1D1M1D29M1D10M1D4M1I2M1I4M2I7M2D22M1D5M2I5M1D12M3I1M1I6M2D4M1D3M3D1M1D19M1I11M1I10M2I21M4D6M1D3M1D5M1I10M3I1M1I9M7I10M1D16M1D2M1D16M1D8M5D15M1I2M2I18M2I4M2I33M1I1M1I9M5D19M1D3M1D18M1D63M1I17M2I2M1I2M1D1M1D4M1I4M1I3M1I5M1I3M1D2M1D9M3D10M2I6M3I8M1I4M2I13M1D9M4I2M2I5M1D5M2D9M2D5M1D22M2D13M1I1M2I5M1D2M1D3M1I10M1I9M1I2M1I22M3D9M1I5M3I3M3I9M1D1M1D5M1I16M4D12M2D1M1D13M3D4M1I3M1D5M1D5M1I1M2D10M2D31M2D6M1I3M2I3M3D4M3D35M2I17M1I13M2I10M5I1M1D14M2D4M1D2M1D4M1D8M2D4M4I6M1D4M1I8M1D9M1D1M1D17M2D2M9D1M1D5M1I8M1I3M1I3M2I30M1D1M1D2M1D19M1D39M2I5M1I2M2I13M3I2M2I2M2I6M2I4M1I17M2I25M1I5M2D6M2I5M2I5M3D4M1D14M3I20M1I12M5I12M1D8M1I10M1I6M3I5M1D50M2I6M1I7M1I11M1I9M4D18M1D7M2D20M1D11M2I16M1I7M2I6M1I6M2D1M1I9M5I4M1D7M2I10M1D13M3D5M1D3M2I8M1D1M1D16M2I3M1I7M1D2M2D6M2D2M1D8M1I1M2D7M1I6M3D9M5I4M1I7M1I19M1D1M1D9M3D7M2D2M1I11M2D2M1D3M1I10M3D3M1D1M2D9M1D1M1D4M2I6M2D7M1D12M1D3M1D29M1I3M1D7M1I5M1D18M1D3M2D8M2D2M1D4M1D6M2I2M1I15M2I9M2I5M1I8M2D12M1I5M2D8M1D1M1D19M2D6M1D1M3I24M3D11M4D11M2I3M4I9M8I1M1I7M1D4M1I6M1D4M1D1M1D17M2D1M1I14M1D18M1I9M2D4M1I57M1I2M1I7M1D5M3I18M2D7M1D3M1I5M1D27M1I12M2D12M1I9M2I23M1D20M1D24M2I16M1D1M1D15M1D11M4I8M3I3M1I17M1D10M1I22M1I13M1I4M1D13M3I7M2D12M7I7M2I4M2I9M2D18M1D7M1D12M1I11M1I4M1I6M1D1M2D8M3I10M2D4M1I6M1D4M1D10M1I2M1D7M1I7M1D4M1I19M13I15M1I9M2I4M1D3M2D7M1D9M1D9M1D14M2I24M1I6M4D22M3I15M3I6M1I5M5I3M1I2M1I24M1D16M1I13M9I1M5I2M1I3M1I7M2D3M1D5M2D3M2D10M5I8M1I13M2I9M2I1M2I22M1D8M1I13M4I4M3D17M2I20M1I17M1D12M2D18M1D7M4I13M2I17M1I13M3D7M3I49M1D13M1D2M2I11M4I1M1I6M1I9M1I7M1I22M1D13M4D4M3D3M3I13M2I19M1D10M1I8M3I1M1I11M2I21M1D3M57I6M3I6M6I1M1I3M1D7M1D7M1D6M2I8M5I12M1I1M2D2M1I8M1I3M2D7M1I5M1D1M2I8M3D5M1I12M3I9M1D7M1I4M1I5M1I7M2I10M1I2M1I8M1I4M2D9M1I3M1D2M1D3M2I5M1D1M2I1M2I6M2I1M3I4M2D5M2I8M2D2M3I7M2D1M2D4M1I4M1I4M1D15M6D8M7I3M1I2M2I11M1I1M1I2M1D1M1D5M4D13M1I4M1D6M2D2M1D7M2D6M5D13M2I5M1I2M1I2M1I11M1D8M1D1M2D14M3D1M1D6M3D3M1I3M2I23M1D2M1I2M1I8M2D20M1D5M1D6M1I4M3D6M3D10M4I11M4D6M4I10M5I3M1I2M3I2M2I5M2D5M1D3M2D4M1D4M1D14M2I8M1D5M1D3M1I6M1I1M2D10M1I5M1I2M11I9M5D6M1D9M2I36M3I13M2I2M1D1M1D6M2I1M1I9M3I4M1D9M2D7M2D6M2I12M6I8M1D1M4D8M1I11M3I7M1I22M1I10M2I7M1D6M1I26M1I5M1I3M2D9M1I25M2I3M2D1M1D5M2I10M1D6M4I4M1D5M1I3M1I4M2I2M3D2M1D4M1I19M2D6M1I6M1D2M1D11M2I11M2D8M3I20M3D2M2I5M1I10M2D3M1I10M2D2M1I17M1I6M2D6M7I6M1I8M1I6M1I8M2D1M1D4M4D4M2I24M1D2M1D4M3I1M2I6M1I1M2D19M3I10M3I9M2D4M1I7M1I2M3I6M1I8M3I2M1D3M2I11M1D11M1D11M3D1M1D6M1I18M2D1M1D10M3D12M4I7M2D2M2D14M6I15M3I78M1D10M1I1M1I12M2I2M3D14M2D12M2D5M1D4M1D12M4I1M2I10M5I2M1I1M1I5M2D27M2I1M1D10M1I8M2I2M1D11M1D18M5I9M1D6M1I18M2I16M1D21M2I2M4D2M1D12M1I2M2I28M1I6M2I7M4D3M3D12M2D8M2D5M1D5M2D2M1I6M2I13M1I4M4I1M1I4M2I16M1I10M1D9M1D6M3I10M1I26M3D1M3D17M7I7M4I13M1I18M1D7M1I9M3I2M2I7M1I15M1D7M1I2M1I4M1I3M1I3M1I7M1D4M2I50M2D12M1D6M1D10M1I17M5I7M5D13M1D14M1I1M1I4M1I5M1I3M1I3M1D2M1D11M2D4M1I3M1D8M1D6M2I6M1D5M1D8M1D6M3I18M1I3M3I1M1I24M3I7M1D3M1D8M1D4M2I18M2I2M1D12M3I16M2I9M1I7M1I8M3I2M2I17M3I28M1I1M3D11M1I25M1I1M3I2M1D6M1I34M2D26M3I2M1D5M1D7M1I2M4I10M2D18M2D5M5I1M1I11M3I8M1D7M2D9M1I26M1I5M4I2M1D8M2I6M5I3M1I2M1D9M3I2M3I1M1D15M1D10M1D9M1I21M1I7M1I2M1I4M1D5M1D1M3I9M1D53M1D6M1D9M5D1M1D11M1I2M3I2M2D7M1D6M1D6M1D2M1I14M1I3M1I5M2D8M1I4M1D5M2I4M1I5M2I11M1I10M1D5M1I19M2D1M1D8M1I3M1D5M1D7M2D2M1D13M2D16M1D3M2I13M3D5M2I10M1D3M1D6M2D39M3D10M1D7M1D2M1D15M1I27M1D7M1D10M1I6M1D1M1D14M5I8M1I9M4I13M1I8M1I27M1D18M1I5M2D9M4D6M1I1M1I26M2D3M3I3M2D3M1D31M1I5M3D12M1D8M1I2M1I3M1I2M1D5M1I2M1I1M4I3M1I2M2I16M1I11M1I1M1I3M1I7M3D17M2D9M6I7M2I16M1I11M4D10M3D17M8I12M5I7M3I7M1I11M2D4M2I5M1D7M1I5M2D10M1D3M2D4M1I16M1I23M1I10M1D7M1I6M1I11M8I12M2I8M1D11M1D12M1D13M1I7M1I6M1I3M3I5M2D25M1D22M1D22M2I34M1D1M2I21M1D2M4I34M1I4M1I9M2I13M2I1M1D3M1D13M2I2M3I2M2D6M1D12M1I6M1I9M1D1M1D2M1I16M1I4M2I1M2I5M1I16M1I1M2D4M1I29M3I21M7S * 0 0 AGTCACGAGCCCATTGACTGGTCGACCACTGAGCCATCTCCGTACCGTACGCACTGACCTGCTTACTGATTTGTTAAACCGTTTGGAGTACGCTCAACGTCCACGCAGGCTCTCATAGAACGTATCCTCCTAGTGTCATCACTGTGCTGCTCTTTTCGACGCGGCAAATGGAGGGAAGCCATCAGCGCCAAAGTGTCCGTCAGCTCATAACGGTATTCACGTTAATCCCTTCAGATGACTCACACCGGTATCCCCGCAGGACAAAGACGCAATGTACCCGTTTCACTTGAAAATAGCCCACGTAAACGTACCATGTCAGGTCGCGCACGGGCCGGAGTGACTGTCTACGCAAGTGCGGCAAAGACAGGACGGCAATACACATTACGCATCGTTCACCTCACTGTTTATAATAAACGCCCGTTCCCGGACGGAACCTGTAACTAGACCAACGCTGATTACCGCCAGGCCTGTTCTTAATCACCAAGACCTGCACATCGCTGAAACGTATACGGCGACGAATATCTGCCGAATGCCGTGGACGTACGGCGTCAAACCATTCAGGATCACGTTTCCCCGACCCGCTGGCAGGGTCAACAATACGGGGAGAACACCTGTACCGCCTCGTTCGCCGCGCCATCAAATAAGTACCGCACCGTTCATCAGTACTTTCAGATAACACATCGAATGGGTTTACTTGTACGCTGACAGTACGCGTACTTCTAGAACGTCAGGAAGAGACAGATAGTCTGGCGATCAAAAGGATGGTCATCGGTCACGGTGACGGGCGACTGGATCAGTCGACGCGGTACGTTACACTGCCTCCAACGCTGGCGCAAAGCCTCAGGCCGCCTTTACAATGTCCCCGACGGATTTTCCGCCCTCAGCGTACGCTTATCGTACAGTTTTCAGCTATCGTCACACATTACTGAGCGTCCCGCGATTCGCATTCACAATTGCCACTGATATCCGCATTTTAGCGTCAGCTTTCCGTCCGTGTTAAGGGAAAGGCCGGGAGGATTGCCGCTGGTGAGCGTACGCCTGTCATAGGAGGAAGCCGTCGTTCATGAATATCTGGTTGCCCTGCGGCCACAAACAAATACGGCGTTTCATTCCCGTTTTGCTCATTAATAAATGCGATACCGATTGGCGGCAACCAACGCTCAGTTTGCCTTCCTGCGTGTCCTCCATGCTGAGGCCAAGATCTAGAGACATAATGTTTGCCGTCTTTGGTCTGCTCAATTTTGACAGCCAACCACATGGCATTCCACTTAGTCACTGGCATCCTTCCACTCTTTTAGAAAACCTCCTCCAGTCTGCTGGCGTTATCCGCGTCAGCTCGACTTTTCAGATGCTTGCTAGATGGCATTCGGTTATCTTGCCTTTGAAAAATCCATGACCTTCCGCATCATCGCTCGCCCGAATAGACGGCCTCCACGAATGCGATTTGCCAACGGTGTTTACACCTGCGGATATAAAGTAATAATCAGCATGGATGTTTGATATTGATACTGGCGGCTATCCAGTACACCTAGATTACAAGATAACGCGTGCTGGTTTCAACCTGTCTGATATCCGCAATCTGCTTTTCCCAAACGCAACTCAAACTGTACCGTCGGGTCATAACGGCAAGATGCGGCGTGGCGGTTATCGAAACTACTCACATGGAGTCATAGATCCTCGACGGTGCTGCCGGTGCCAAGGCAATCGAGAACGATACCGACGCCGGATCGCCTTGCTGCCCCACGCATTTACCGCCCGGACTGTCATGCTCGTAGTTCCCCAGCGCCAGAGTTGCGTGAAGCGGTATGTGGTTTCCGTCGTCCGGTATGAGGGGCCCACGTTAGTACAGCCGGACATGCCGTCGTCGGGTGTTACGTCAGACGGAGCAGGAACTCACGGGCCACCTTCGGTGTGTGTCCCATCGCGCCAGCACCTGATATTCCGCCGCTGTCTGCAGTGACTTCTGCGGTCAGGTGCGTCGCACCGCTGGCGTGACACCATTCACCGTTCATCTGTTCGCCGTCAAAGTGCGCCCCGTTATCACGATGGCCTCTTTTCCGGCACATGCTGCACGGCGGTGATGGCATACGTGCCGTCGTCGTTCTCACGGATACTCACGCATGGAACAGTCGCCGGGCCGCAGCGTCGGCAGCTTCAGCTTCATAATACGAGCCTGTATTCAAGCAACACCGTCAGGAACAGGCTCATTTGATCACTAGTTTAGACGTATAGACTGAACCCTCACGCTGACCGGATTGCCACTTCGTCAACCAGGGTATGGGTAAGGCGTACCCGGGCAGCACCGTGATTTCGACGGTCGAGCGTCAGCGTCCGGGTCTGGCTGTTCACCGCCAAGAGCACACAACCACCGGTGATACCGGCATAGTCATCATGGCAGATTTCAATAACATCGCCCGGTACGGGCGTGACGCTTCTGCTGAACGCTGAAATCACGGTCTGCGTTTCCAGCAGTTCGTTTTAATCAGCGCACTAAGCGCGCTGTGCCTGCCCCGGCTGGTACAGCCAAAGGCATCATCTCTTCGTAACATTACGACCGTGACGGGCAATGGGGTCTGCGTATCTTCAACAAGCTCTGTCGCCGTCTCCCAGCCGTTGTTTAGTCGCGACCGAGGTTCTACCTCAACGCATTATGGGCGGTCCTTCAGGCGCTGAAGCTGCTCGAATGGCGCGCCATCAGGTGATGCGGCATCACCACATTACTGCGGTTAAGTCACGTCTTATCCGACGGTCGTTATGCACGAACGTCAGCGTCTGCCCGCGTTCCATACACCGGCATACAGCGCATCGCCGAGCAGGCATGACGAACTCAGCCGACATCCCACGCCTTACGCTGTGTAGTCAGGTACGCATTACAGGTGATGCGGCGCTCCCCGTCCGCCAAAGCCGTCCGGCACGCACTGGTCTCACACGTACTGGCCGATGACATACAGCGCCCATTTATCTAGAACTACCGCCGCACCAAGACGACGTTCCCCATGCCCGTGGCCCCGGATGGTACGCATATCCCACGACACCAGGCCATGTTGTTGCTGTATGCCGGTTTAAAACGTTCCGTCCCAGATACCGCTGTATTGCCGCGTCTGCGGGTTATAGTTCGACGCACCTGCAGAATACGCCCGCGCAGATATAATTACTAAACGGCTCACCTGCTGGCTGCCGAAATGAGCTCCGCATTGACCTGCACGCCGACCACGAGTGCGTGTTCGGGTAGCACGTTCACATCGATGATTGCCGTATGACGACCACAGGGTTTTGTTCTGCAGCTGGTCTGTGGTGCTGTCCGTAGACCCTTAGCAGTGGATATTCCAAACGGCGCGGCGGCTGACCAGGTTACCCATCACACCGAGGCCAGATACTGGGGTGGTTTTGCCCTTAATGGTGATGTCTTTTTCCGTTACGAGACCCGTTACGTTGTATCGACCAAGGCAGGCGACTTCCGACGGATTCCTGTCACCTTTGAGGTGGTTTCCACCAGTGCCTGTACACCGAAGGTAAAGCGACGGTCGATGTTTGCAGACGTAATGGTGCGTGATCGCGTGTCATAGTTTCATTTCCGTACCCACAGCAGCGTCCCTCCAGGATGGAGGTCGACCCCAACGCGCGTATATGCTCCGTAGCCAGCCCGGAACACCACGTGACACCGGATATGTTGGTATTCCCTCGATGTTAAGCACCGGCTACTGTTCAGCAGGACAGGGGTTTTAAGCCAGGTATAATAGCAGGACTTCGAATCGGCCTTGCTGATGGCATCGATTACGCTCAGCAACTGCGTGGACTTCAGGTTGTCCTTCGCTTCCCTAGGGGTCCCCCTTACTGCTTCCTTTACCCATTCCTCACGCTCCATAAATGACAAAGCGCCCGCAGGCGGTTCCACATAAACATTTTGCATCAGCGACCAATTACAAGCGACTCACGTCCCTTCGTCTGCCGTGCTGATCTCCGGCGGAAACCACGCGTACCCACGCGCATTTCGAGTGCTAAGAACAGGCAGAACACTTGCCCTGGCAACCATGTTATCCAGTGGAGAAATAGGTGTTCTGCTTACCAGCGTTATCCGTTGTCTTAATGGGGAGTCCGGCTTTCGGTGCCAGCCCGAACCTGCGCCTACACACCACCGAGCACCATACTGCACCGAGAGAAAACAGGATGCCCGTCATACCACCGGCCCCAATCGCTTGCCCCCATGCTGCAAGGGTGGCTCCGGCGGTAAAGAATGGACGTGGAACGGGCAATGAGCGGCAGCCCCCATAATCTGAATACGCCACCTGACTTAGCCCGGCGACTCATGGGAACAATATATGGAATTAAGCCATCAGGCCGCATAGTCTCATGTGGACTGCCGTTGACTCGAACTGTCCTGACGTCTGCCGCCCGGCAATCCGTACCTGATACCAGCCGTCCTGCTCAGTTTCTGACGCAACGCCGGGAGCTGTGTAGCCATGCCCGGATGGCTTCAGCCCGTTTGCACCGAAGGTCGATGCGGAGGACCAAATCGTTGTAAATCCCCGCTGAAGGTGCACTCCATGCCCCGTGACGCCAGAGGGAGTGTGTGCGTCGGGTGCCATTTGTCGGGTAGGTAGTCACCTCTCGTTTGCTCAGTTGTTCAGGAATATGGTGCAGCAGCTCGCCGTCGCCGCAGTAAATAATTGGGGCGATCGTCCGGCACTGATGAACCAAACAGGCCAGCACTACAGCACATCGCCCGGCTGTGCCGTCCGACAACGGCACCTGATACAGCCCCGTCGCCTCCAGATTATCCAGATAGAGATTCTGGCGTTACGCCACCAGTCATCTTAACCACGATGAAAGTCCGGCATCTCAAATGCGCCAGGTACTCACATCCCGGAACAGTGTAACAGTTAGTCACACGTGCTCGACTAAAGCGCCGCGCCCGGTGAGATGCGGCACACAGGAACTTATGAATCGTCCCCCGCTGGCAGACCAGCCACCACGGCAAATCATGGTACATGCAGCCGCCGGTCGGCTCACTCAGCCGAGAGCGACCACCGGGGTGGCCTTTGCGACCAGCGCCACAAATCTCAGCCCTGCATTTCTGCCTGCAGCCGTCTTCCGGCGACATACCTGAAATACGCCTCCGAGCTATCACCGGAGATATTCACGCAGGGAAATATCTTTCTCCTAGGCGCGGCGTGCTTATGCCACGAAGCCGCACGACTCCTCCGCTGGGCGCACATCGCTAAATCGGCGTGCTAGGAGAGAGAGAAATCTGCCCATGATTTCGTCTGTCTTGTCATTCTTAAGAGGATTTACTGTAGAAAGTTGTTAATATGGAAAGGAAATGAAGCCGCCAAAGTTGCCGACGTTATTGCGAACTTACAACCGGCTCAGGCATTTGCTGCATTTATCCTTCGTGATATTAGGACGTTGTGGCCGCTCAGTCATATTCATCCGCGACAGCCGGAACTCGCTATAACCGCACTCGTCGCCGACTCGTAGTTAGAGGTGGTGCACGGTGTCGCCAGCATGATACGTCTAGAAAATAAGCGCCAATCCGTTTCCGTCGGCGTGACAGTACAAAGGAGGCACTATTCCACCGCGCTCAGGTTCGCTGCACTGCTCGAATGCGCCAGGCTGATCACCTCCTGGCAAATTGGGGTAACTGTTTCCGTTGACGAAGTTCACACCGCATCCAGGAAAACGGGCGTAAACCTTACGGACCACCGTTCCGCCAGACCAACTCTGCGGCATATCTTCCGCCATCCCGGTGACCATACCGTACAGGTCGAAACCGTTCGGCGTGGGGTCCTGGTGTCCTTCATTCAGAGTTTCAAAATGGCCTCCCCGGGTGAATGGATACGGCTGATACCGTGGTCCTCGCGTGCCAGGTGACCGGGTAGCTTTCGTTCTGCTCATTACAGAAAGATAACGTTCTCCACGACCCTGTCAGGTCGATTTCCAGAGCACCACGGCGCCGGCCGAATGCCTCCGCACGGGTGCATTCGAATTGAATGTTTCCTGATCGGATATCCTGCATCAGTTCACCACCTGTTCAACTGCCTCAAATACGGACGCCCGCATCAATATACGCAGCTGGAATAATTTTGCGCAGGTCACTTTATCTGCCGCCATAAGCCACCGGCGGCGTCCACAGAGAAAGGCATTTCCAGCCCCCGTGCTCTTTGCGAAACGACTCCAGTACGGATGTGGCCTCCTCACGGGGGACGAAAACCGTCACGCCGTACGTTTTCAGGTTGGCATTCAGCCCCAACGCAGGCGCTCGCTGAGAATAGCCATCTAAAGCGCACTTTCTTACAGAAGGGTGGGACGAAGCCATCCATACCGGGTTTCACTTTCCAGCGCAAAGTCTTCCATCGTCCACCTCCGGGAACAGGCCACCCATCACGCATCTGTCTTAACGGATTCCTGACGGGCACTGTGCGCATCAGGTCCATACACCGCCGCTTCAGAGCATCGACCTATCTGCCCGTTCGTGCCGTCGTGTCTATCACCACGACCTGGTTATTGCTCAAAACGTCCCGGACGCTGCGACCGGCCCTGTCTTCCATGCTGCCCGGTGTAAGCTAACGGACCGCCGGGCTCACGGCCGCGCATCAGCCGTAAAGATTCCCCACGCCGCCAATCCGGCTCGGTTGCCTCCTAGCTTCGTCGAAGACAAATGACCACCACGGTGAACAATCCCGCTGGCTCTATTGCCGCCGTTCCCGTAAATCCTCCGGTTGCAAAATGAACTTCGCCGCAGCGGCCTGAATCGATGGCAGCTGGTTGACGCGCTGACCCCGCTGCCGCCCAACAGCCCCGCCAATGGCGCTGCCAATACTCCCGACAATCCCCACCATTGCCTGCTTAAGCAGAATTTCTGTCATCATGGACAGGACGGAACGGGTGAGACGCTGCGCCGTTTTGCTCACTGCCGCCGGTTGCATCGCCGGGTCTGTGTTGCAATACCATCAAAGGTCTGCTGTGGCTGCACCGTCTTGTGACATGCATACTGTCCGTGGCGCTCTCTTCCTAAGCCACTCCAGCCGGACTTCAGGCCTGCCATCGAGTTCCGCGAAGCTGGTCTTCACGGCCGCCCAGGTCTTTCTGCCTGACATGACGTTATTCAGCGCCAGCGGATTATCGCCACCGTTCCTTCAGGCGCTGTTCCGTGGCCTTCCCGTTCTGCATTAACGGTTACTCGTGCCCCCGGCTTTTCGCATCGACCCATCGGCTTTGCCCGTTGCTGCTGTGCGAATTCTCATGCTGCGCTCCACCGGAGTTCAGGCGGTGCCCTGATACGATTAACCTTATGCCAAGTGCAGCCCAGCTGGCGTTGTACTCCAGCGTCTCATCATCTTTATGGCGCCAGCAGGGATTTCTCCTGTGCAAGACAGCTGGCGACGTTGGTGGCCACCGCCTCTACGCCCCAGTACCGCGAACTGACTCTCCGCCTTCCCAAATCCAGGGCGCTGCTGGCTCCGATTTTCTCATTTGCTCCGGCATCGTCTCCGCGCCGTCTAGAGTTCTGCCTGAAGCGTCAGCAGGGCAGCATGAGACCTGTCTTCCTGACGTACGCCCGGCAGACACCTTCACGCTGGACTGTTCGGCTTTTCAGCGTCGCTTCATAATCCTTTTCCGCCGGCCTCATTGTTGTAATCCGCTGCAGGATTTTCCCGTCTTTCAGTGCCGTATGTTCAGTTCTTCCTGACGGGCGGTATTTCTCCAGCGGCGTCTGCAGCCGTTCGTAAGCCTTCTGCGCCTCTTCGGTATTTCAGCCGTGACGGTCTATCGGTATCGCTCTGCTGCTGCGCATCTTTTGTCCGTTTGCTTGCTTATAGGGCCTTCTTTCGGGCGGCTCGTCAAGCGCAAGACGAACCGCTTTTCACGATCATCCCCCAGTAACGGCGCCCGCCTTCATCATCGTTAACAAAATAATCATCCTTGCTAGCAGATTCCAGATGTCGTCTGCTTCTTATACGCAGCCTCTGCCTTAATCAGCATCTCCTGCGCGGTACTAACCAGACCAATATCCAGCACCGCATCCCACATGGATTTGAATGCCAGCAGTCCTGTCTGCCCAGGTCTCCAGCGTGCCATGTCTCTTTCTCGAGTAGGCGGCCGGTGGTCATCAAACCCTTTTATGCGAGCCTCGTCGTTCGCCCCCTGCCTGCAATCCCCGGCTTCATCGCCGGGAACGCTGCAACTGAGCAACATACGCAATCTTATGGCCGACACGTTATGGAACTGGTGGCGAGCCATTGCCGTCACTACCTACGCGACGTCGGGTCTTAGTCAGCTTCCCGAAGGCTTTCAGCGACCTTGTCCACCTCGGACCCCGCCACTGCAGAGGAGAAACGCGCCACTGGGCTGATGGACGCAATCTGAGCCTCACGCCTTACCCCCGCCTTAACCAGTGCCTGAGTACTGGCTGTCTGGTTAAACGTCAGCCCTGCCGCCTGCCGGCTGGACAGGACCAGCATACGATCTGCCCGTTCAGTCCGCCTGATTTGCCGGAAAGAGGACCAGCGTTTTTGTTGAAGTGCATAAAGGGTCGTTGCCCTGATACCAGGCATACGCGACGCACCGAGTCCCCACCGCCAGCGGCCCCACCATCGGCGCATGATCGCACCGGCAGCATCCCCTGAACATGGGGATCATCCGCCGAAGGAGTCCTTCATGCCCCCTGTTGCAGCAGGATCAGACCCGACTTTGCCGCCTGCAAGCTGCGTGACCCGCGGTGAACTGTGCAGTGCAGCATACGCATGGCGGCTTTATACTGCCCGACGAAATCCCCGCCTTTCTTCAGCCGGACACTGTCATCCCGGCTCAGCCGACTGTTCAACGAACGACTGCCCATGTGTTTTTCGCATCACTTTCCGTACCAGAAAATGACGCTGACTCTGGCCATCTGCTTCGTCAATCTGGCCGCATCCAGAGACTCAAATCAACGACCAGATCGCCTACGCCCGTTGTCATACGGACTCCTCCTGCGATCCCTTCTGATACTGTCATCAGCATTACGTCATCCTCCAGTCCATAGTGCCACGATACAAGGCGGCGACCGGGGGATAACTTCATTCCCCGTCCGGGCGCTAACTCCGGACAGCGGCAAGCCCTGCCGCTTTTCTGCATATCACCTAATTAACATCATCTTCAGGCTCTCTTCGTCATCCTCGCGCCGGTTCAGACTGAAATCCAGGGATGAGGATGATGCATATCCGGCGAAGATCGCTGACGAAAAACAGGCTGAGCACGGTACCATTCAGCGGAAAATGCACCATATCCAGCAAACCATGAAAATAATGGGTACTGTAAAAGCGGTGCCAGTCGGCATACTCCGTGCATCACTCCCGGCAAAGCATCGGCACGCCAGTTGTTAGGACGGGTCGCCCCAACTCTCACGCCCATTCAGGGCAAACTCAGCTCACGTTGAACACTTTCCCCGAAGAAACAGGCCTCCTGCGGGCCCGGCGTCCTCTGTCTGTTCAGGGGACTGTTCACCACAAAGCCATACGACCAGACAGCCGGTACACCACGGGCTTTCAGCATGAGAAATTGCCTCCGTGGCCAGGTGGTAAGCATTTCCTGCTCAATCTTTACAGTAACGGCTTCATTCATGGACGGCATCTGCGTCTTCCTGCGGATGGTTATGCGCCACAGGGACCCCTACAGAACGCGCCGGTTCTTTGTCCATCGTCTTGCCACAGTAAACGTTGCGGTTTGCTGTCTATCACGCCTGTTCTGCTTACGCGTTCATCGCATCAGGCGAGATGCTCAATGCGCTGCAGGGCTGACAGTTCAGAAAGCGTGACGGTCACACCGTTATGTTCAACGGATTCGGTCGTTTG * tp:A:P cm:i:208 s1:i:1626 s2:i:0 NM:i:2586 ms:i:5218 AS:i:5255 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
18 14 4 * 0 0 * * 0 0 GGCTTTATGTTACGTTATACTAGGTCACCGAACCTGTCGGTCGCCAAAGATAGCAGTCGGGCTCCTCGCATCTATTAACTAACCAACTAGGTACAGATAATTCGTTGGCAGCGACTGTACCGACCTTCATGGCGTAGATTACTCCCAGGTAACTAGCTGTAATTATTGATGCGGCCTAACTTATGCCTAGCTGTCATAATACAAACAGATCAAGGCTACTGATACAGGCGAGCCGTGGACGAGGGACCGTAGCGCGAGCTACCGAGCATAACCACGTTTAAATGAGCCCATACCTGTGAGCGTAGCTCTAGTGTAAGGGCCAGGGTTAAGGAATTTTACCGGCAATAATAGTGCGTCCAAACATTGAAGATTGGTCACTGTCATTTGGCAATAGCTCCGTCGAGGGTAAAAGGCACATCAGATCAATTAACAAGTACTGGCCGATACATCCTACCGTTTGTCCTCAGCGAGCCGCTCATGGTCTAAATTAGACTAGCCTTCGAGGGCATTGCGGGTAAGCTTGAGTTGCAAAGGCTTTTACCCCTTTTAAAGTACGCTGTAACAAATCGATGTCGGTATTCTAAGCGAGCCAGTTCAGTGATCGAGTTGATCGATCCTGGGCCGCAGGGAGCTTACTGTCATATCTTATGTAACCCAATTTATTTCTATCGAAAGCCGGTTCACTAATACTTGTCTATGAGATCGTCTGGCACTGGTTACGTCCTCCCATCCGGGACCCAACAGAAGTATTCTATTGCGCCACCTCATGTTTTGGCCTCGAGTCGCGGTGGGGCAAGGGATATGTCCCAGATTGATTTCTTTGGTCGGTTTTCTCTGCTGTGCTCTCATTCATCCTAGCGTGCCTCTTACTTGCCGTATTTCATCTGTGAGGTTTAGGCCGTTACCGTATTACACCATCTGTCGGTTATTTCGCCTCGCAGAATCTAGGCACTCCGCTTTGTTGGGTCGCATGAGATGATGGATAAATGAGGACGGTGTCCGCTCTTTATAATCGATAGCCACTCGCACTACAAAGAGAAGTCAAATATAGAAAGTCGGCGGGCTACCCGGCTGCTATACGACAACGATCACAAATGGAAAGGTCTAAACCGGCCAAAATTGCCCACGTCCAGAAATAGTGAGTGGCTGCGAGACCGGATTCTTCCTATTAGCGTGTTTATTTAACTCGTACAAGCGTCTAAATATTCGTCTACATTAGTCACTTTAGACTAAAGCTTATCAGCCAAAGCTCTTCAGCCATCATGTCAGCAAGCCCGATAACGGACAAGCCTGTTTGTCAGGGTCTTAAAGTGTAATGTTCGTAGCTATTCTAAGGAGCCCATCTTACAGGCGCAACGTCCTGGCGTAAATTACCGTAGGAAGTACACGTCACAGCGAGTACTAGGGAGATCTGTGCCTAGCGAGGAATTTTCTACAATGGATCCATATCGATAATACCTATCCTCCTTTGGCTCGTGTTATTCGATCACTTTGGATGTTGGCCGTAACACAATCTTTCTACACGTAAAACGTTAGGTCTGTTTAGTTGGGGCCCGATGTTGCAGGATAAGCTTGGGCGATACGTTACCACCGCCATCCCTGTGTTAAACGTTTAATGCTTCCCAAACTAGAGGGATTTAAGGCGTCACAGGGGGTGCTAATTAATCGGGAGGTCTAATGAGTTAACCAAGTACACCGCATCGCCTCTATCCCTGGCAGTTTCGGTTGATATCTGCGGTCAATGTTGTTTAATTTTAGGGATAGCGTCGTTGCGCGGTCAGGCATGCTTAAGGAGATAACGAGCAAGTGGCTACCGCTAGCTGTAGGTACATGCCTTATTACAGGGTGTTATACGGCACAACGTTACTGTCAAACCATCTCATACCGAGCAGGCTTAGCACCAAGGAAGACCATCGCGGTACGTCTTCAATAGTTTCTTAACCATTGAGCAGGGGACTGTCGACTATGCAGGCCGTATTTGTACCGCTCTAGGCACAACTTTGTTGATAATATTGGCCCCATCCCAGCAATAAATGTCTATCAAGTCACCGTCGTGCCTGTCCTCATACCATTTATAGTGGAAGGCCAGTCTGTGTAAAGAAGCACCGTGTCTAATAATTGGTAGGGCTCCAACTCGGCAGCCTTAATGCATCCTTAACAATAACTTTGGTGTTATTTCGATTGTTTTAAGGTAATGATCGATAACTGGATGGCGCGGCTGCCCGTTCGGGGTCCGTGAGCAGGAAGCTGCATTGGTGCGCCAAGGGATAGCGGTTCGGTCAGCAAAGCTCTAAGTGGTAGCTAAAGACTTAGTTCTATCGGTGTCTGCCATGAGAGCCACTATACAGCGGCATAATCACTCGCAGGCGGGGTGATTTCACTTTATAGATGGCTATACTTCGTGTATGTTTGCTAAGTGGGGCCAACTAGTCTGGGCATCTGCTGTCGCTGGGTTTAAGCCATTTCCTAAGATGATTTAGGGCGTCTCTCCAGTTCTAAGCCGTTGTAATACATGGCAGATTTACTCCATGGGTACCTACTATAGCGTAAAGGCAATAGATGGAGACTGGTAACCGGATACCGAGCTAGTACGATAAGTGGCTCTAGCCGTAAGTAAAGAGCGTACTCTATCTCGTTCCTAATTCTTTGCAATTTTGAGTACACTCGATTCGGCCTGCTCTGTAACAGTGACAATACAGGCTAAATAACAGTGAAACGATGTGCTTCTGTCACTGGCTTCGCACTTGTTAAAGTACCTGGACTGTAGCGATCGGTGGCCTAAGCCGGCTAAGGATACACTGTAATGTATAGTCGAGGGCCTAAGCGTCCTGTATTTCAGGCAAGGCAGCGGTTCTTTCAAAGGTCCTTAGTTCGAAGGGCATCCAAGCGGATAGCGGCAAGAAGCTGGCTCGTCCGGCACGGTCGTTACAGTTTGGGTTGTAATTAGCGTGCGGATACCAGAGGGAGGACCGTAAGGGATAATCGGTAACTAAACACCTACATCGTCTAACCAATTTCTGGTTTTGCAACGTTCGGTTAGCGGTTCTATAGCAATAGCGCCAGCATATCGAAGCCTGCCGTTGATTACTTGTGATATTCTACATCATTCGCTCCAACAAGTTCGAGCGAAGCGTTGATAAGCAATGAGTGAGAGTCAGGTTGTATAGAATGTGTAGCGATAGCCACCGTCGCGGGGCGCCAAGGCTAAGAGAATTAATTAAATCCAACCGAGTCGAGGAGGGTCTGGGGCGCGAATGAGACCAGGCAAGGGACTACTGGGGCCCTGGAGCTACGTCTGCTTCAGTCGGCTCGGCTTTGCTCCGCACCACGATCATCTGCCTCGTAAGCCAAGTAGCTAGCGAGAGTGTGCGACTCGAATTGGTGCTCCGAGTCCTGTTTAGTTGTTGTAGCGGCACCGATGAAGCGGGACAGGCGCGGTGCTGTTTCTGGCTAGCAACTTCGGTTCTTACCCGCGACCACGCATTTGTCATGAGTTTAGTGCGGAGGCTCGGTAATTACTGGCTCGCCACCAACACATGCCGAGCGGGTGTTGCTCGATCGGATTTGGTTCTGATCAAGCGATATGCGGGCAGGCAAGGGGAATGTTAGGCAGCCCGGTGCAGGCGTCACAGGGGCCTGCTGTGTAAGCGCATATCGTGCTCTATCCTAATGAATTTCGGATAGCGTACCGACACTACACTAGCCGTTAATGTCCTGTTGTTAATGGGGCATGGCCCTGCGTCGGGATTTGGTACATTTTGTAATCGTCCTGTCATTAGATGTCAAAATGAGAAAGAAAAGAGACCAACCTGAGGGGCATACTAGATATTTACCTAGAGAACCCTGAGTTAGTATTACGTTGTTAGAAACAGATCACAGATAGTTATGCCAACTATATAAGGGCATTATTAGGTCAGAATATTAAAGTTGCAGTGTTAAATATGCCTGCGATACAGTTGGAATTTAGAGGCACCGATACGTCAGAACTCTCAAGGACAGGGATCGGTAGTAAGGACATATTTCAGTACACCAACGACGAGATTAAACAGAACGTTAGTTAGGTTATAACAGTTTTATTTAGGTAAGTCATAACCACTGCCGTTAGGTATGTTACAAACCGTGAAGGTTAAGTCATTAATTACACGAGATGTCAAGTGGTCCGATTAGTATATTTGGTTGTGAGAAGTCCACCACCGAGTAGTTCCAAGTATAGAGAGGTAACAGTCCGTACAGGTAATTAAATTTGGGATGAGAGCTTTGGCTAGAAAGTACACTTAGTCAACTCCGGCGATGACATTACAAACACATAGGTTTGCTATGTCAGAAGGTACTTTTAGTGTAAAGGTAACTACAGAGACATCTGATATGTTTTGGCGAAAGTACATACAGGGTATAGAATATTACATGGCAGATGTACTTAAGTTACACAAGGCGTTAGACCGACAGGTAAGGAGGACAATCCATAAAGCGATGTTGGAGCACATAGTCCAGTACACTTTACATCGTACCGTTCTATTTACAACAGTCTAAATGGTTCCTCAATACTTGTGTTAAGTTGGGCGATTAAGATAAGTTGTAACGATTTTGTTATACCAATAGTTCGTAATTTACTTACCCATTGCAGCCATGGAAGGAGTCGATAAATTGTAATTTGTAAAGTGACAGGCGAACTAAGTCACCAACCATGATGACAGGGAAGGCAGTCGGAGTCAATAATTAAAATTTGGCCAATCGGGCAATAGGTACAGGCCGTTGGCGATGGGGTCATAAGCTGTTCGATTAGATACACCAACATTGTAACCTAAAGTATTGTGATAGACAGTGTAAAGTATTTAAATTTAGAGAAAACCATAGAGATGTAATATAGATTGGGATTGGCTAGTGGTATTAGAAGTTTTCCTGCTGGCCGTATAGATGGCTGTCCTAATCGGGGTTGTAATTTCGCCGAGTCCCGTTAGTTAGTCGTTGGCGTCCCAATCGTAAATACTGATCAATAGGCTTTAAACGATCTTCGTTAGGATAACGTAGATGAGTCAAATATAATTTTTATGTTAATAGAAGTTTCCAATATATGATAACTGAACTATTTCGTAATTAAAGTCAAGATTATAAGGGATGTTAAACAACCTTTAACGCAAAATTTTAACTAAGAGAGTTTTATTTGGTGTAGAAGGTAACAAGAGTACAAAAGGGATAAACACAACGAGGACAGTGGTACATGGTAACTATTAGTAACGTTTTTACATGGTGACAAAGCCTATCTAACCTTTATAGCACTATAATATTTTAGGTCAATAGCGAGAAGTTAGTCAATTCAAAAATACCATTGCTCAACGTTCTCTGCCTCGATCGGCCGTATACGAGCTAGCGGTGTTTTGTCCAATTACAGTCGTAAAGTACAAAGTTTAAACTAAAATAGTTGAGTCAAATAATTCAAAGGGTCAACAAACACAAGTATTTCGGACTTGCTTAAGATGAGTTTTAAGTAACTAAGTAACGTTGATAGAACCACGAGATAGTCCGGGCGACGTCAGTTTAGATGAGGTCCAAGGTTTCAACCGTCTTTATCACTCTTTTATCACGTACCAAAGCATTTCAAGGTTAATTCGGCGTCAAGTCTCTTTCAATTAATACTGTTTCGATAGCGAGCACGTTGATGGCAGGAATGGTTTATACCCAAAGCTCGTCTAATCAGTAATAATTTGGTCCTTTCAT *
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
19 15 0 utg000001l 43287 60 11S13M1I5M1I13M2I10M1D17M2I15M1I44M1D13M1I3M1I6M1I13M1D9M2I14M2I32M1I12M1I6M2I9M2D17M1I40M1I1M2D11M4I23M3D7M3I5M1D2M3D34M1D7M2D25M3I19M2I1M1I4M1I9M1I7M1I1M1I3M2D7M2D7M1I1M3I12M1D45M1D42M1I7M1I16M1I24M1D10M5D15M2D13M1D1M2I2M1I6M1I12M1I6M1I6M1D7M2D18M2D9M3I7M1D1M2I4M1I2M2I4M3D4M2I12M1I20M1D4M1D5M1D9M3I2M1D21M1I1M1I5M1D6M2I22M1I2M1I2M1I17M1I7M1D5M2I5M3D3M1D5M2D9M1D21M1I13M2I32M2I22M1I4M3D20M2D6M1D25M1D8M3I1M1I5M1I5M3I10M1D9M1D10M3D7M1I4M2I10M2I13M2I12M4I13M3D9M1I11M2I14M1D3M2I8M3D5M1D5M2D49M1D11M1I6M1D4M3D2M2I9M2I3M4I3M1I5M3I5M1D5M1I7M1I5M1I18M2I2M1I5M1I25M4D6M2D5M1D18M2I30M1D4M3I15M1I16M1D55M1D3M1I10M3I21M5I7M3D6M1D6M1I10M1D2M1I3M3I2M1I22M1D5M3I8M1D11M3I4M1D33M1I35M1D6M2I21M1D18M3D6M1D1M2I11M2I28M2I6M2I1M2I30M1D15M1D6M3D34M1I16M1D5M2I9M2D2M1I5M1I4M4I16M1D6M3D9M1I3M2D8M1D27M2D4M1I2M2D10M3D16M1I4M1D4M2D3M1D19M1D1M1D11M2I2M1D6M1D3M2D9M2D31M2D7M1D5M1D20M2I12M1D7M1I1M1I11M1D2M1D13M1D3M1D29M1D5M1I4M2I8M2I2M1D10M6D9M3I37M2D2M2I15M2D2M2D1M1D4M2D22M1D5M1D10M3I31M2I5M3D33M1D27M1I1M2I37M1I3M2D10M1I15M2I8M1D6M2D1M1D5M1D1M1D24M4I10M4I17M2I5M3I3M1I28M1D4M1D7M2D8M2I19M1D18M1D11M1D9M6I5M2I1M1D3M1D5M1D4M2D4M1D6M1D46M2I1M1I14M1I32M3I37M1D9M1D1M2I18M2D4M3D1M1D16M2I3M3I12M8I3M1D2M1D6M1I4M1I10M1D12M4I15M2I33M498S * 0 0 CTATCTGTTTAACCTCGGTTTTGCGCACTCTTTTCTCGTAGTATGATGAGTCCGTCTCTATCAGCAGTACCGCGTTTCCTGAACTTCTTTCCAGACCATCGATGGCCAACGACCGCAGCCTATCCAGTCGCAGTTCCCCAGGCACTGCGGGCATTCCTGAAAAACTGAAGCGCTTTTGAAGGTAACGTCACACGGCGGAAATGATGGCCTCTTCGAGCCAGCACAGAAACATGGGCTCGCCTGACGGGATGCGAGACGAATTTGCCGCCCCATAAATGACGCCACGACTCGTTCGCACTGGCCCGTGCCGTGGAGTAGCTCGATGGGCGTAATTCCGGCCGGGAAAGCTGCTCATACGAGACGAGCCCGTGGGGCAGCATACCGCAGCAGTGACTGCTCAAACACGGAGTAGCGTTATCTAATCTGAGCCGTCTGCAGGTTCAGTGAGTCACCCGGCATCAGGTGCTGGTGTACTTTTGCGCCTCCCAGCCGCGTAACCACTGCGGCATCATCAGCGCGGCAATTTCACCAATCCAGCCGGTCAGCCTTTCTTTGCTGCTCCTGACTGTTCGCGCCAGAATAAAATCCATCGCTGACTGCGTATCCAGCTCACTCTCAATGGTGACCGGCATACATCGCCTACCAATGGCGCTCTGCAGCTGCGTGTTCTGCATGTCGGAGCATCTTCATCGTGCTCCATCACGTAGGTAAAAAGATTTTGCACCGCGAGGTCTGCAGTGTCCCCACGGGTCCAACGTGAATGAAAGCGAGGCGCGCCCGCCGGGTAACGACGCAACTTGGGGCCATGAGTCCATTTCTGCGGCATCCAGCCAGGATATCCGCGTCCTGACTGATATCCCACGCACGCCGCACCGCTGTCATTAGTACGTGCACCGGCACGGGGCAGTTCCGGCTGTCGCCGGTAATATGTTTCGGGTTGCTGATGCGCTTCGGGCTGACCATATCCGGAATGTTTAGAAAAGCCGCGACGAACTGGTATCCCAGGTGCTGAACGAACAGAATTCACCGTTAAAGGCGTGCATGGCCACCTTTCGTCCGAATCATCATGGTAAACGTGCCGTTTCGCTCAACGTCAATGCAGCAGCAGTATCCTCGGCAAACTCTTTCCATGCCCTTCAACCTCGCGGGAAAGGCACGTGAGGCTTCCTCCCCCGATGCCGATAGCGCCAGCTTGGGAGATGACACTGAGCCCGCAAAAAGACCCGACGATATGATCCTGATGGGTCCAGCTGGATGGCGTTGGCGGCACCCGTTATTGCGTACCAGATCGTCTGCGCGGAACATTGCCAATAAATTGGGATAGAAGGCTGCATCGGATTTCACTCGGTGGGTTCCACGACCGCAACTGCCTCCAAATCCTGCTGCCCGCCTCTTAACCGGGATGGTTTGGCGCATACAATGTATTCATGCGTCCGGGCCCCAGAAGGGTGGGAATGGTGGGCGTTTTGGGAGTACATAAAATCCTGCAGGTCTCCCTGCGTCGGTCATGCCGGTTGCACTTCCAGCTCTGCAATATATGTTTCAGGTCAGACGGAAGTGGCCGTAACTCGGCCACCTTCGTCCGTCTTTCTGTACTGTTGCCACCCGTTTACCTGTCATCAGGTCATGCAGTGCCGCACGGGCAGCGGCAAGTCTTCCGTCTTCGTCAGTCAGGGTACCCTCTGGATAAGGCACGGGCGTACGTAATCCCAGTGTTCCTGTTGGTTCGTCGTGACACCATCCTCTTCCTGCAGGCTCGCCAGCAGGCACTATCGAGATCCAATGCCAGCGGAGAGAATATCACTGATGCGCAGCGCCGCCAGCGCATAAACGAAAGCAGTCGAGTGCCTCATTGCGTCGCTTTGCTGTCCACAGTATATTTTCCTGCCATCCACCCATTTTCGACCTGCTCTTCACAGTCACTATGCTGCGCTTCGGGGGTCAGATCAAAATATCCGGGTTATTCGGGGAAGTAGGCTGACGGCACCGGGAAGCGGTTCATCCCCTTCGGCGTCAGTGTGAAGCGGTTACAATCTGCTCTTTCGCGGTATCCGTACCGATTTCGGGTAAGGTAATGGGCGTTTGTTCGTTTTGCTTTGTTCACACTGCTGTACGACGCACCGGCTTTCCGTAGACGGATGCCCCTTTAATGGGGATACCAGGGACGGCCCATGTTTTTCGAGCGTTCGCTACAATGGTCCTCAGTCAATCCCGCCATGTATCCCAGCAGATACGGGATATCGACATTTCTGCACCATTCTAGGCGGGTAAGGTTTTATTAACCCTCATCCACGCAGCAGCGTCTGTTCATCGTCGTGGCGCTCACCATAATAATCTGCCGGTCACGTTCGATGGAGCTTTCCTCTCACCCGGCCCCCATCCCCATACGCATTTCGTCGTTAAGCTGGGAGTCGATACCGGCGGTCAGTACAGGCCACGCCCGTCACCAGGAACGGGCGCTGAATAATGCTCTTTCCGCTCTGCCATCACTTCAGCATCCGGACGTTCTCATGATTTCGCCTCCCACGTCTCACGAGTGGTGTTGACGAAGGTTTTACGTTTTCCCGTATCCCCTTTTCGTTTTCATCCAGTCTTTGACAATCTGCACCCAGGTGAACGGGCTGTACGCTGTCCAGATGCGGAAAGTACACTGTCAGATAGCTCAATCTCTTCAGCATGGATGACGAAAACCAGAGAATGCCATCACGGGTCTAAGTCCGTCTTTCGCACCAGATAACGGGCATCATAGTAAAGTTATTCCTCTCATCGGTGGATGACGCAGGCATTATGCTCTAGCGCAGAGATAAGATAACACGCTGGAGGGGATAATCATCCGGCGTCCATTTGAGGCCAAACGGCGTCTCTTTGTCGCCAAATTTAATACTGCTCCCTCCCCCGCAATGCGGGCAGGCAACATGAAAACGCATAAATGCGGGGATTCACTGGCCTATCATGGACCGTAATTGACAGTGCCTCATTTGGCTGGAGCCACGGATGGACTTTACAGACCGAGCCTTCAATACGCTTGTCGTCACCCAGGAACGTCGCGAGAGCCTTCCTGTTCAATATCATCATCAAAACAGGCAGCAAGTTCATCATAACCCGCCTGACGCAGCGACTTTCACGCCTGCTTTTTGCCGCTTTACCGCCGGCACGAAGCCACGCCGTGTATCGGGCCCAACGCTTCATGGCTGTAGTAGCCTGTATCCCGGTGCTTTTTGCCATACACGGGGCCAGCTAGGGAGAGCAGCGACGGAAGATATCACGAATAGTCGGCTCAACGTGGGTTTTCGGGGTCCAAAACAGCTCCATCCATTAAGCGAATACCCTCCGCCTTGCTCGTAGTCATACAACGGACGAGGCTCTACGAGGCAAAAGAGGTCTTTGGAAAATAACGCTGAAGACGTGAACGACGAGGGTGTCGACGAACATGTAGTCGGTGCCCTATACTTCCTTCATGGGTCTAGGTGGCGGACCGAACATGTTCAACGAGACAAAAGTCAAGTGGTGAATTCATTTTCGCTGGAGGAGCTCATACGATTAGCGACTTAAGGAACAGCGACTTCATGATAGCGTCTTAGGCGGACTAGTACATCCCTCGAATAGGGGCTAGATCCGCAACCTGTTAATAAACTGTTCGACGTGGTTTGTCGAAAGGCCAAAACGAAACCCGCGGTGGCGTTGATGACAGGACGGCTGATTTGTTCGTAGCAGATTCTCTTACGTATTAAACGCGTTTGAGGAAGTAAAACGGTACTGATTTCCGATTTTCGTGCGCAACGCAGGCCGA * tp:A:P cm:i:99 s1:i:885 s2:i:0 NM:i:668 ms:i:2802 AS:i:2802 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
20 16 0 utg000001l 23539 60 150S9M1I1M1I9M1I11M1I9M1I3M2D13M1I8M1I10M3I8M1D4M2D12M3D8M1I2M1I14M2D2M1D3M2D4M1I1M1I24M1D2M1I2M1I9M1D8M4I2M1I8M2I2M2D16M3D9M1I7M1I8M3I2M1I4M1D6M7I18M1I3M3I4M3I3M7I23M2I4M1I16M2I10M1D13M1I9M1I9M2I7M1D11M2I5M1D6M2D1M1D20M1D8M3I4M2I1M1D7M1D1M2D5M2I1M2I3M1I3M1I7M3I2M2I4M1I14M3I2M1I5M1I11M1I10M1I2M1I1M1I9M4I7M4I10M1D25M1I4M2I7M2I3M1D4M1D1M1D33M1I16M1D15M1D29M3I1M1D6M1D13M1I6M2D2M1D2M1I8M6I8M1D7M3D1M1I3M1D4M3I21M1D12M1D4M3I7M1I9M1I4M1I16M3I2M1I7M5I1M3I43M1I2M4D4M1D1M1D25M2I35M4I16M2I9M1I6M1D2M5I3M1I27M4I7M2I5M3I5M2I19M5I7M2D9M4D10M4I1M2I6M1D10M2I3M4I10M1I2M1I10M1I16M1I2M1I7M1I12M2I3M4D7M2I16M3D2M5I13M1D3M2I14M2D11M1I4M1I2M4D6M1I2M3I3M2I11M1D7M1I16M4I1M1I3M2I14M1I6M1D4M2D2M2D2M2D6M2I8M2I2M1I2M1D3M1I16M1I4M1I8M1I4M2I7M1I3M2D9M1D37M1I11M1D12M1I4M3I21M1I20M2I8M1I7M1I14M1I17M2I1M1I26M1D15M4D6M2I10M1I18M2D11M2I11M1D12M2D19M1D6M1I24M1D16M4D10M3I1M2I4M2I6M2D6M8I4M2D19M1I15M1D5M1I4M2I15M3I18M1I24M3I10M1I3M1I22M1I1M1I6M3D2M1I6M3I4M2I8M1I2M2I3M1I7M2D12M2I1M1I2M4D14M1I2M1I6M1D7M1D1M2I6M1I2M1I1M2I2M3I2M1I2M1I7M1I25M1I20M2I20M2D5M2D5M2I6M1I6M9I2M2I5M1D3M2I14M1D14M1D25M1I3M2I6M1I9M2I7M1I3M2I12M2D5M2I5M1I1M2I5M2I5M1I2M1D15M1I1M1I5M1I29M5I8M1D13M1D6M1D13M1D6M1I3M2D7M1D2M1I5M2I9M1I6M1I10M2D4M1I3M1D3M1D2M1D1M2D8M4I10M1D10M1I12M2I6M2D2M1D16M1I14M1D7M2D20M1D4M1I34M1D17M1D1M1D5M2I8M1I5M1D2M1D12M1D1M1D14M4I21M3I5M1D3M1D13M1D16M1I2M1I3M4I14M2D7M1I8M2D6M1I1M2I16M2D9M3D17M2I5M2I1M2I5M3I5M3I5M1I13M1I8M2D6M1I15M1D9M1I2M1I8M4D12M1D1M2I3M1I1M2I15M2D4M1I31M2I18M4I4M2I13M1I17M2I2M3I1M2D2M1I9M1I3M3D9M2I1M1D1M2I15M4D2M1I11M1I7M2I8M1D9M1D3M1D4M1D1M1D6M2D9M2I3M2I7M3I5M2D10M5I9M1I10M1I1M4I1M2I26M1D1M1D7M3I2M3I6M1D4M2I1M2I7M2D4M2D2M3I3M2D2M1D3M1I5M1D7M1I6M1I1M1I2M1I4M9I2M1I9M6I1M3I7M4I13M1D1M1D6M1I4M2I5M1D4M1D12M2D3M1D3M3I7M2I3M1I7M1D6M1D7M1D7M1I1M6I4M1D4M1D5M1D11M4D3M2I18M4I8M1D10M2I3M5D3M3D3M8D3M2I1M1I3M2D9M1D10M1I2M1D4M2D3M1D12M2D1M1D5M1D19M1I6M1I4M5I3M1I4M4I3M7I11M4I8M5D2M1D3M1I10M1D13M7I7M2D35M1I10M1D10M9I6M1I16M2D3M1D1M1D5M2D8M2I13M3D4M2D1M2D5M2I7M1D5M3I8M2D8M1D1M1D8M3I4M1I1M2I5M4D4M1D23M1I6M1I6M1D3M2I16M4D3M2D13M4D9M1I2M2I8M2I9M2I12M1I3M5I5M1D6M2I5M1D7M5D26M2I9M1I6M5D10M4I13M4D1M1D3M4D6M2D5M1I6M1D21M1D27M1I2M1I18M1D1M1D5M2D2M3I5M2D3M2D2M1I5M5I2M2D8M3D19M2D4M3D14M1D9M1D3M3I1M3I4M2D12M1D1M1D3M1I6M3D3M1D6M2D23M5I3M1I4M3D6M2D1M3I6M1D1M1D4M4I2M1I4M1D7M2D1M1D5M1D11M3D6M3I3M1D8M1I11M1D10M1I6M1D11M1D3M7I13M1I3M2D8M4D2M1D5M2D4M1I10M1I8M4D1M1D3M3I12M2D3M2I11M1D10M2I3M1D8M2D3M4I5M1D4M2D3M1D8M1D4M2I7M3I15M2D4M1I5M1I10M2D12M1I18M6D4M5I10M2I20M8D10M3D2M1D3M1D22M1I7M5D1M1D5M1D5M6I10M1D5M2I1M1I2M2I2M2I7M1I2M1D8M1D2M3I3M4I5M1D4M1I40M6I6M2D11M2D1M1D4M1D7M3I4M2I2M1I7M2D7M1I1M2I10M1I3M1I7M1D3M2D5M1I10M1I1M2D6M2D8M2I4M2I8M1I19M1D6M1I1M1I6M2D9M1I9M1D3M1D8M2I4M1I16M2D3M1D14M1I2M4D9M1I9M2I7M2I6M1D9M3D5M1D2M2D1M1D4M3I3M4I2M1I1M1I8M2I6M1D8M5I1M2I10M2I11M4D13M1D13M136S * 0 0 CGTCCTGTGAGGCATCGACTTGTCATAGATTTGAATAACTTCCCCAATTATTAGAAAGAGTTATTATCAGGTGCCCAGCAACTCGAAGATTTTCAGAGGGATCTAGAATATGGGTCGAACATACGCAAATTACGACGCTTACCGCGGAAGTGAACGAATGATTTTATATGAGGGAGGCTGTTTGGCCAAATCCGGTAACTTGCTATCCAATTCCTAGGCAAGTCATTGGCATGAATCGCATGCAGGCGAAGGACGTTGTAATGTCTCCTAACCAGCAGTTCCTAGGGACAGTGCGTACAGTCATACATCGTCGGTGGAGGTGGTCACAATTCTCATGCAAAAATATGTAAAATCGGGCCTAACTGGAAATCATTCAACCGCACTATCGGAAGTTCACCAGCCATGCGCTCGCACGTTCCTGCAAGTACGACGTGTCTGCGGCGGCCCATATCTCCTATGAGCAGCAACGTGTTAGCAGCCAGCCAAGCCAACTCTAATTTTAATACATAATGAATGATAATAATAATATTAAATTTCCTGTGTAACTAATTTACTATGGGTTTCTGATAGAATCATTGCAAAGATCAAACAATTATTACATTGACAGTTAAGCGTTAATTTATCACCTGACAAATATATCAGCATCCTAGCATTTCTAATCGTACCCAACTTAGAGGTTTTAGTACCAAACCCATGGGAAGAAAGACTTAAAGATTTATCGCACTTGCTCAAATGCTGCAATTGAATACAGATGTTTTTACCCTGAATTATTTCGCTTGAATTTGAATCAATTCCTCCAAACCTGGCAGAACGAACATTTATTATTCAAAAACAAACCAGATTGTAGGATATGACATTTGGTAACAATAATGTTATCCAAATGGAAAATGATCCATTAATGGCTTGGGCCTAAATTCCGCAATACGATAGAAAAACAAGGCGATTTAGAAATGTATAGCGAGGCAAAGGCTCTTATTTCATCTTGGCCGTCGAAGAAAATGACATGCGTTGGTCAATGAAGAGATATGTTAAACATTGGTCAAAAGTTAGTCAGACTTGCACAAAAGAAATTACCTTCATATTTACTGAATCATCTATTATTAAATCAGAAAGACGATGGGTCGCTACATTAAAAAGATCGAATTATTACATGCCTTAGCTATAATCTATGGCAGAATGTATAACTGCTGTAACTCTCTTGTGAAATAAAATAATAAACAATCCAATGCGTGACGTGGCCCTTGATTTCGCCAACATCATTCGACTCTTTATTTGTCTGATGAAACGCCAGGGAGAATAACACTTATTTAAATTAAAGATTACTCCATAAGCATTGTCATTTAGCATGATACAATACTGACAATAAATAATTCCGTTGAAATGAGATATTAAAGGATGTCCCTAACTGGTAGATAAGCCCAAAATATCACTTCGACAGAAGAGTCGGTTGACTATACAGCCAAGCTTGCAGAAACTACAACGTCCACCGACGGTTATCACAGCTTCAAACATTAATTTGATAACAATTCCATCTAATGATGTCAAGGCCAAGCCAACAGTCGAAGATCAAGCATAAATATATTTGGCGGCGTTATGCAGCCTGACAGGCCAAAGACAAATCCGAGCCATTGGGTCAATCAGAGCTATGAGCCAGAAAAGCAAGCATCTACTCCAATAAACCAATACATACATCCCAATGTTACATGAAAGACTTCAGGTAATGCGAATTGATTCAAATAATAATCAAATGGTATTTCATGGAAATAGTTAGAGAAAACTATGAAGAAAGGCGATTTAGAAGACTATCAACAGCAGACTCAAACGAACTACGAACAACCATACTTCATGCGTTCAGTCTTAAAGCAATTGGCGGTGATGTAAACACCTGAACAATTGAGTCATAGAACTTCCATTATTCTCCTGAACCAATAATAATCACAAATAAACCAATACTCATTTACAATATACTAACTAACCGCAGAACGTTATTTCACAACGTTTCTGCGGCAGAAACAAACCATTACTCCATAACAGGGACAGCAGCGCTCAATATCGATGCAGTTGATGGTGAATCAACACGGTTCAGGCACCGCATCTGATATTCTTCCGGCTTCCAGCAACGAGGTTTCTTCCTTCGTTCGATTCCATAATCTGCAGCATCCTGAAACGGAGCGCAATATGCTCACTGGGCTACCTGCATCAGGCTTTTTGTTTCTTCCCCTCCCGGATCCGGAACAGTTTTCTGCATTCCTAGATTATCCTTCACCCCAGGGTTGCCGTTCCACTTCTGATATTCCCCTCCCCGGCGATAACCAGGACATTTCCGTAACGACTGAAGCGTTCAGAAATAAAGTAACGCGTCGCGCATGGATAAACGCGCACGTCATAGACGGTTTTACCCCGATGATCTTCAACGAGATGCCACGATGCCTCATATCAATGTTGAAACAGCGCCAAGCCCCGGACCGCATCTGGCGCTGTATGCATATCGGTACTGTTGCAGGCGGCAGACCGTATCCCGGGGAATATGCGTCACCTTCACCAATAATTCATTAGTTCCGGCCAGCATATTATAATTTATGGTCCTGTGTTGTTCACTCATTGCTGAATGCCATTATGCAAGCCTCACAATATAGTTAGTGCAATGTTTTGACGGGTGTTTTCCGCGTTACCCGCAGCGTTAACGGTGATGGTGTGTTAGTTGAACCAATACTGAAGAATGGCATGAGCACGAGACGACTCGATGCTGATCGACATCAAGATAACCCCTCTATCTGCCGCATGTGCACTCACGGCGGCCGGACACTAGTGGGGACAATGAGTGACTGTGGCTGCCCTGACTGTCCGTTTTCGATAAGCACTAATACCCTGTGCTCATTCCTTTAACTTAATAAATTCCTGTAATGGTTAGTGCTCATACCTGACTCCAGCCAGAACTGTTCATCCTTAAACCATTGTGGGCATGAGCACCCGCTCGCCCTGTTGAACCCGGCCATCTGTAGGCTGATAGCCCCCGTGTTATTCGATCGTCGATTTGATGCTGTAATACCCAAATCTGCTGTTGTTTTCGTCCCGTAATCAAACGACGATGTGGTCATTTTCGTCCCCAAATCGATTGGCCATGCACTGGCACTGTGGGTGTGCGACTTAATTCCATCCTGTTCCCCACAACCCAAGAGCGACGAATGGCGGGTTTCCCGTGGATGTCCGCCTCAGCGCAAGCCAGGAAGCACACCATCCATCACGCGACAGCAAGTTTGGGTAGTAGCTGATGTCAAACGCCTGCCCTGCATCGCCGACTTAGCCAGACCGAATGGGTAGTATGGTAAGGGTGTAAGCGCACCGTAGAAGGTAGCCGAATTTACTAAACGCGGATAGGTGCCAATAGATATGCATACAGAATTTTGCCCAAACTTAAAGTGTAGATAGCGTGAGATTTGAGTCAGCAGTGAGGCGTCAACCATTTCGCAAAATACGGTAATTTATTTTTACTAGGTTAGAAACCCTGCATAGCGCCGTCAGTCAGCATTCTTCGGCTTTGTTTACCGCAAGGCGTTAGTCATGGTGGGTCAAAGTGTAATCATTCCCGAGCGCTGCGCGGCCAGTTCATTCAGCGTATTCAGGGTCACGTCTCAACCTCGCGTCAACAGCTGACTGCAATCGGCGTATACAAATTACTGAGCACGGGGTTGTTTCGCATGACTTGTTCTTGTCGAGGGCCGCGGTCTTACGTACGTTTGCGTTCCATGTCAATTGAGTGGGTTCCATTGAGGTTGATTTCTTTCGTTCATCCATTACTAGCCGTAACTAGGTCTTATTCGAAGGAGGTTTCAAGGTCCTTTGGTCCGACCCTCCTGCAGCTGTAAACATTTTACGTTGTTAGGATACCATAGAGCTGGGCATTCCGCTATCTTTAAAGGTTTGCCCCGTGCTATCTTTACGTGCCACACTTTTATATGCGATACGCTCATCGCCAAGCTTCTGAGGATCCTCTGTCGCATTCGTGGATGCGCGTTAATGGCATCCCCCGCGCCTAGGCTGTTGGCTGTCTTGCGCGAGCCTGAAGAGGCGGGCGTCGACTGCTGTTTCGATTTAATGGTATATGAAGGTCGTCTCAGCGTTTTTAAAGGTTCGAGAGTTTCTGCTAAATTCTGCCGAGGAAGCTGCACGACAGGCTCTATCGGCACTTGATGATGCGTTCGTTTGATACTTTTAATCGTTGCGAGCGGGGCGAATGGATTTGAAGCATGGCACTAGCTGTAAATTTCGTGGGCGGTTGGGAGGCAGAAAGTGTGAGTAAGGCTTTGTACCTATGCAGCATTCGTGTTCTGTACGTTTCGCGCACGGCGTAATGGGCGCGTTTGAGTGCCTCGGGCTATTTTTACATTGGCTGTAATAGTCCTGATGCGGTCGTAGGGGCAGCTTCCTGAGCTGTAGAAGCTGCGGTCGACCATCCGTCCGGCGACGTGCTGGCGGCGCGTGCTGAGTCAGAGTTGCATCAAGTCTCCCGCCACTAGAGATAGGAGCTGATGCATGCATCGGATTTTCGTTCGCGTTAGGGTACTCTGTGCCACCGCCTCGCGTTACGCGCTCCTTCTGGGCCCAATACAGTTTAAGACGAAACCGACTAAGCGTATGGCATGATGGTAGAGTTTAACCAACACAGAGATCATTCCAGCGTTAGAGTTGAATCTTCATACACGGTATGGTCCCGGCGTCCATCTTGATATGAAAACCGTCACTGCCAGGATAATTACTGATTATCCCACATCCATGCTGTAACGGACAGCCGCGGCTTTCATGTAAGATTCTATCACTAGGGGTTGTTACCACTAGGGCGCGTATGGTCTAGTCAGTTAGGGCACGTACAGTGCGTTGTACTAGTTTTCATGTGCCGTCTTTCAGATATCCTAAACGGGCTGTATTTACTTAAAACTTCGCGCCACACCGCGTTAAGCGGGCTGTCAGACATGTGTTAGTAAGGGTCAGAATTTATACAATTACCCAACGATGAATGCGTCAGATTACCGAGTCGCCTGCCATCCTTCGAGCTGAGAGTAATACAACTAAACGAAGCTAGCCCTTACTAGATTAGTGTAATCTGAAACAAACAAGGGTGAGGTATGCTGGCATTGCACTTTCGTCCTAGGCGTATTGGTCCTTTCATATACCCGGGAGTGATTTCGTTAATAGATCGTGAGGTCACTTAATACGGGAGTCAGCGCTCCATGGGACTGAATGCTAAGTAGTACTGATTTGTAGACTGCGGTCCTTAAGGTCTACAGCCAACGTCCCGAGTAAGGATAGCGCTGTAGCAACGTATCCTCCCCATGTCATCACTGTGCTGCTCTTTTCGCACCCAACGCGGACCCCAGGGAACTAAGGCCATAGGTTTGGCATCGTTGAGCTCAACGGTACTGGTCACGTTATTGCCCTTTCAGATACTCACCGCCAATCGCCGCTAACAAAGGCAATGTACTCCCGGTTTTCGCTTGGCGACTAGCCCACGTAAACTATTATAGTTTAGGTCGCACGGGCTCGAATATACGTCAGGCAAGTCGGCGGACAAGAACATGAATGTAACAAGTACGCATCGTTCTACCTGTTTATAGACAGAAGCCCGCGTTCCCAGGGACAGACCTGGCACCCCAAGCATACCCAAGCCTTAGAGCGCCCTGTTCTTGTAATCACAAGATATAAGTGGCACACATGGCTGGCAAACGTATAAGCGAATATCTGCCGATGCGTTGGACGCGTGACGATTCGGTAGAATGTAATAAGTTCCTAGGATAGGCTGGCCGTCAATACCGGAGAACATGTACCCTGAGTTCGCCTAGGCAGGATAGACTAGTTATCACGAGCGTTCATCAGTACTTTTACAATAACAATAC * tp:A:P cm:i:41 s1:i:388 s2:i:0 NM:i:1865 ms:i:1312 AS:i:858 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
21 17 0 utg000001l 10787 60 379S5M1I12M1I7M1D7M2D2M1I4M2I4M1I2M2D3M1I15M1D10M2D10M1I4M1I2M2I10M3I13M1D3M3D7M1I3M2I9M1I12M3I7M5I1M1I2M1I9M1I2M1I7M1D16M3D6M1I3M3I10M2D26M1I2M2I12M3I4M1D22M2I1M1I19M1I11M2I2M1I3M1I5M1I14M1I9M2I1M1D3M1I15M1I10M2I4M1I5M4I14M1D10M1I6M1D9M1D9M4I7M1D21M5I5M2I8M4I2M1D3M3I68M5I3M1D19M2I6M1I3M1I3M1I7M2I3M1I9M1I2M1I7M1I10M1D2M2D6M4I3M1D12M4I2M1D9M1D1M1D9M3I3M2D16M2I5M1I5M2I3M3I5M3D13M1D4M2I3M1I9M2I7M2I4M1I6M2D4M1I17M1D1M2D43M1D5M1I23M1D7M2D5M3I8M1D2M1I1M1I4M3I13M1D4M1I15M2I8M5D2M3D4M4D14M1I2M3I7M3D3M1I5M1D8M4I2M1I9M2I2M1I12M1D5M1D9M2D2M1I6M1I5M1I5M1D20M2D5M3D3M1D4M1D10M1D5M2I20M1D7M1I9M2I1M1I2M2D6M5I10M1I14M1I2M1I17M1I5M1D1M2D13M3I2M1D2M1I8M1D2M5I17M4I18M1I3M4I2M3I5M1I4M1I6M1D7M2D10M3I2M3I3M3I12M10I6M4I4M1I3M1I9M6I2M1I1M1I13M4I6M1D11M1I7M1D2M2D3M1D9M3I13M4I5M4I11M5I2M3I3M3D5M2I3M7I1M1I13M2D19M1D10M1D5M2D4M1I5M1D3M3D2M1D25M1D5M1I10M2D5M1I16M1D5M1I6M1D4M1I1M1I2M1D5M2I8M1D4M1I11M3I2M3I2M1I1M1I9M1I1M1I4M2I5M1D2M2D17M4I4M1I6M3D4M5D2M2D4M1I1M1I6M2D5M1D8M5I7M1D3M2I2M4I9M3D2M1I1M1I4M3I1M3I4M5I13M10I9M5I11M1I4M2I2M2D21M2I2M2I2M2D7M1D23M4D6M4D11M2I16M6D2M2D21M2D2M4D20M2D9M2I5M1I3M2D7M1I5M1D8M1I2M1D4M6D9M1I32M1D3M1D5M1I5M1I17M1D24M1D20M1D18M1I6M3D3M5D17M1I3M1D22M3D25M1D22M1D9M1D21M1D12M1I13M1D18M2D10M2D18M1D17M1I5M1I23M1D26M1D15M2I9M1I2M1I1M1I18M6D10M1D3M2D2M1I22M1D16M1D20M2I3M1I12M1I5M1D24M2D12M4D9M3I8M2I8M1D3M1I4M1I30M3D3M1I14M8D23M1I3M4D20M1D6M1D6M5D1M1D3M1I15M4I1M1I7M2D5M2D15M1D5M2D21M2D6M3D3M1D36M1D1M1D7M1I21M1I1M2D63M1D15M1I8M1D8M1D42M3D14M3I32M1D16M1D5M2D21M1D5M2D19M3I4M1D6M1I5M2I4M2D12M3I6M1I9M1D22M1D6M1D1M1D19M2D8M2I18M3D8M2D28M4D32M2D19M1D1M2I2M3D4M1D9M1I18M1D14M4D24M1I2M2D22M1I7M6I7M1D3M1D13M1D6M3D7M5D29M1D11M1D28M1D2M5D8M1D16M1D4M1I3M4D9M3I1M1I3M4I5M1D4M1D3M1D14M2D12M1D5M1D5M3D14M3I30M1I3M1I5M2I15M2D5M1I9M1D2M1D7M1D12M2D6M1D4M2D17M3D25M1D12M1D1M2D5M1I11M5I2M1I28M1D23M5D3M2D1M2D2M1D41M1D16M1D22M1D13M2I3M1I38M1I3M1D2M1D12M3D3M2I9M1D16M3D2M1D5M1I4M3D5M1D4M1D2M1D1M1D3M1I6M1I21M2D1M1D8M2D6M2D10M4D15M3I5M1D6M4D6M5D7M2I4M3D6M3I5M1D29M3D17M1D12M1D11M2D5M1I2M2D6M2I14M2I7M1I7M1D2M1I4M2D6M1D1M4D1M1D17M1I21M3I13M3D42M3D2M1D3M1D9M2D16M3D21M3I7M1I18M2D15M1D3M3D3M1D5M1D2M2D4M2I4M1D2M1D7M2I6M1I2M1I12M3I3M2I2M5I4M1I13M1I4M3D2M1I15M2D2M2D4M1D2M1D14M1I1M1I17M3D4M2I3M1D2M1D18M7D27M2I10M4D5M2I6M1I5M1I2M4I3M2D20M1D5M1D25M1D11M1D1M1D15M1D6M1D1M1D1M1D10M2I18M2D11M1I7M20S * 0 0 AATGTTTAACCTGTGCTTTATTTAATGGCGGGTGTAATAATGCATTAATCTTAAGTTAACGCGGTTGTTACTTGCTGCATTGCCAAATTCTCAAAGTTAGCGTGCAAGAATTTAGCCCTTCAATCGCCAGGGAAATCGCAAGGGAGATGTATGTGAAGCGGTTAGTATGCAGCCGTCATTAGAAGTGAGTATACGACCCTGTTTTCTCATGTTCGCTCGGCAGGGATGTTCTCGCCGACCTTACGAACCTTTACCACTTGGAGAGAGATGGGTAAGCACAACCAAAGCCCAGTGATTCTGCAATAAGAAGGCAGTGGAGTTGAAGGTAGATCCATGACCGCACCGGATGAGGCGGCTCCATCCCATGCTTTCCTCGAATGAATGTTAATTCTCGTTACCTGAGCAGGCTGTTGCTCAGGTATTTCTGCAGCTCAGACTTGGAGGTGAGCGATTTACCTTCAAGAAACTTGATGCAGGGGATAGCGGTTTAGGTGTTGGCCAACCACAACCCACAGTACCCCCAATGATCCCATGCAATGAGAGTTGTTTAATCGTTGTGCTGGGAAAGTGCGAGATAGAAGGCCCTGAAGAGACGTTTGACCGTGGCAGGTGTTCTGGTCGCACATAGTCAACAACAATTGAGCACGAATCTTCATCGAATTAGGGGGAATTTCACTCCCCTCAGAACATAACGACGTAAATGGATTGAATTATGAAAGAATGGTTTTGATCGAGTACTTACCGCAGCATAATAAAGGGAAAGATAAGCGCTCAATAAACCTGTCTGTGTTCCCTTAATTCTCTGCCTGGCCTGATAATCATCATGTGCAGGTTGCTCCAATTATTTGTATTCATAAATCGATGGGAAGAAAAACTTTCTCTTTACCAAACAAATACTGACAAGAGTCTGGTTCAGAAGATAAATCGCTCTAAAGCTTCAGTTGAAAGTATAAGAACAGCCTCGCAGGACGAATCATTGGGATTCCCATCTTTGTTGTTGCGAAGGCGACACCATTAGTTTTGGATCAGAACCTGTTTCGGGCCGACCACATCCGATCTGACAGATTTTAATCGGGGAAAGGAATGTCATGCCTCGAGTGCGAGCGCGTTCTGCGAGTGGAGTACATGATGAGGGGAACTCACGCCCAAAGACGATGTTATGCATAATGCATGTTTAAACATCGAAACGGCCGTGAGGACTAGAAGCCAAGCTACGTATTTGGCGGCGATACTTAAAGATTAGGGGCAACAGATATTGAAGGGGAGCTTTGACTCATTGGATAGTCATTAAGCCAAAATTTAAAGGATATAAAGGTTGCCAAGGATATTATTTTACCGTCCTCAATTTTCAGCACTGCTCGTGAGTAAGAAAAGATGAAGCGGAGATATTTTAACAGAACATTATCTATCAGAAAGGCCATCTCTCAGCGCTCTGAAAATCTGAATGCTGAGCCTGAAGAGATGAGCGGCATAAGATGCTACGCAAGAATGAAAGTGATATACTGGAAGCTTTTAAAGGCAGGTGGTAATTAGGATTAATTATCAGGAGATAGTGCGGAACAGAATCATGCCTGTTGGTCGATAGTAATAATTCCTTACGTTATCTGATAGCATTTGCTATCCTTTCCCCTACTACATTCCTGGTGTTTCTTTTCAGCTCATAGAGATGGTCTTGGGGACATGTCATCATATGCAGGAACCATGATTGCAATGCGATCCTCTTCCTGCCTGCTCGTTTCTCCGATCGGAAGCAGAACGCGCCGACTGGCCATTAGAGTATGGGTATATGACATCTAGTTATTTATTACGCCTGCGTTGTTTTGAGCTTGGAGCTTGCTTTGTTTTCTGCGGGTTATTGCTTCTTTTCATCATGAAGGGCATAAGCGGCTCACATGATACGCGCTATCGCCATCGGCATTGCCTCTGCATCGTTCATTCCATATATGCATCCTTGTTTCCAACTATAATTTACCAGAACAAGAATAACCCGGCCTCAGCTACGCGGGTTTCTTTGCCTCACGATCTCCCCAAAACACATAACCATTGTATTTATGCAAACATCGGGTAAGCCTAATAGCAATTCAGATCTCTCACCTACAAACAATGCCCCCTTAAAATAAATTCATAAACATACAATATACATCATCTGCGTGATAAATTATCTCTGGCGGGTTGTACATAAATACCACTGGCGCTGTAGTACTGAGCACATCAGCATATGACGAGACCACCATGAAGGTGACTATCGATGCGTAAAAAGCAGGGGCGACGAAGTCAAAGCGAAGGCTTTGCAGCATGTGTAAACCCGCATCAACCGAAGCGGTCTCGTAGTGCGTTGGGAATCACTTACATGTCGATGCTTAATCTTATCAAGCAGCTGGATGCGGGGGTTTTCCGTTCAGCACTACAACTGCCACACACCACCAAACCTAACTGACAGAGAATCCAGATGGATGCACAAACGCCGCGAACGTCGCACCGACAGAAACAGGCTCAATGGGAAGCAGCAAATCCCTGTTGTTGTGAGCGCAAAACCAGTTTAACCGCCTATTCTCTCGCCTGAATGCGCAAACCGAATCACGAGTAGAAAGCACTAAATCCGATAGACCTTACAGTGCTGGCTGAATACCACATCGATTGAAAGCAGACTTGCAACGTATTGGACGCAAGAATCAGCGCACATGGTACCCAAGCCTGGCGAACGCGGCATAACATGCAGTGACCTCGAGAGAAAATTAAGGGAAAATCGATTCTCTCTATCTAGTTACTTAGATATTAGTGGCTTTATCTCAATATTATATGGATGCTAGCTGGCAACTAATTCAGTCCAGTAAACTCCTCAATAGGGAATAATATATGCTTTCCATTCCCATCGGGAAAAGTTTGTTCAACACACCAAGCTCAATCAACAATCATTGATGGGAATTGTTTGATGTAACCACATATCTTCCGTGCCTTCAATCACGGCTGCGCACAAACCATAGATTGCTCTTCTGTAAGGTTTGAATTACTGATCTAGCATTTATCAGCAGCATTTTGCATCTTAATGCGTTCTTAGCTTAATCGCTTATATCTGGCGCTGGCAATAGTAATAATCGATGCACATGATTGCTAGCGAAAATGCAAGAGCAAAGACGAAAACAGTGCCACACATGAGGAATACCGATTCTCATTAACATATTCAGGTTATCTGGGGTCGTAAAGCAGAAGTCCATCGAGATAACGATCATATACATGGTTCTCTCCAGAGATGCTTACCTGAACACTCGTCCAACCAGTGGATGCATTTCTATACATCAAACTGTAGGGGTTGTAATAGTTATCCATTTCTCGTAGGGGTGACACGAGAACCACTGAAGCCTGATGGTTACGACAGGCACAATCTTCCTCGCGATTCCCTCCTTCGGGTGATATGGAAGAAGAATTTGAAGGGGTCGAAGAGCATCCCTCAGTATTATGGAACAATACCAGGACTATCCGTATGAGCCGACTATTGATAAAATCAATGGTGTGGACAATTCAAGCGATGCAATGGATGCAAGCTGCAATCGAATGCATGGTTAAGCCTGAAGAAATGTTTCCGTAATGGAAGATGGGAAATATGTCGATAAATGGGCAATACGAACGGCAAACCTTGCCCTCAGAGAACTTAGTAAACCAAACAACAAAGCTGCTGATAGTGGCCTTTACGTTGGCGGTAATAACACGATAAACATGCACTGTATTCATTCCAACGAGTAGCGACTCACGTTCGAGATCATTCGCTCGTAACTAAACATCAGGAGCCGACCTGTTTGATTATTGGAAATCTTCTTTGCCTCCATTGAGGCGATTTTTATCTGTGGATATGAACACAGATGTCAAACATCAAACATCATTGATCGACTGGAAAGCATCAATAGAAATTGAAATCGACCATGACGTAATGACAGAGGAAAATTCACCAGATTAATAATTTTGGTCAGACCTGAATACCTAACTCAATAAACACGGCTGGTATTAAATGAACTTAATCATGCTGGCACAGCCTGCTGGTGTAGCAATTTCAAGCGACTTAATATGCATATCCCTCTGGTGTTTCTTGGATTCGACTGGAGGATGATGGAAATGGTCGGAAAGGATGGCCTCCAATGGATGAGCGAAGGAATAGAATTACCGATATCGATACATCAGGAATATTTGATTCAGATGATATGACTATCAGGCTCGCAGTGGGATTAGGTCTACCCGAGCAGATAATACGCTTCACTCGAGGCGTTCGTTATGTATAATAAGAGCACCATGCAAACTGCCGGGCTTGCAGGGTCGAGGTTTGCTGGCTGCCTTCCCGCAATCTTATTTACTTGAACGAATCCCGTGTAATTACGTACGATGGAAGCCTTATCGACATACTTAATCAGCCAGGAGTCCCCACGAATGGATCAAACACTTATGGCTATCCGAGCGGAGTCGCAGCCGCATTTTATTGGCGCACTTATCGAAAGATGTTTCGTGAAGCCGTCGACGCTGTAAATGGATATTAATACTGAAGTGGTAAGCAAAGCATTCACTAACCCCCTTTCCTGTTTCCTAATCAGCCGGCATTTCGCGGGCAGGTTTTGCCAGCTATTTCAGGGATTCAGCCATGAACACGTATGCCATTCAGGATGGTCTTGAGGCTCAGAGCTGAGCGTCATAGAGCAGCTCGCATTGGAATCGAAAGAGAAGGGGCAGAACTGGCACACTAAGAAAGGCCTGCCCAGCACTGTTTGAATCGCTATGCATCGATGCTTTGCAGCACGGGCCAGCAAAATCCATTACCCGTTAGATTTCGCGCCCGCGTATTTGCGTGCCGGAGCATGACCAGAACACATCCGGTACACTGTTGAAACCATTGCTCACCACCAGGTTGATATTGATTCAGAGGTATAAACGAATGAGTACTGCACTCGGACTCCGCTCGGGGAGCTGCTGGCTGAACGTCGGCATGGATTTCTGTCACTCCACAGGAACGTACCACTATTCGCCAGACGGCATTTAAAGGTGATGCCAGCGGTGCTGCGCAGTTCATCGCATTGATGATCGTTGCCAACCAGTACGGCCTTAATCCGTGTGACAAAGAAATTTACGCCTTTCCTGATAGCAGAATGGCATCGTTCCGGTGGCGGCGTTGAATGGCTGGTCCCGCATCATCAATGAAAACCAGCGTTTGGCGCATGATTGATTCCAACAAATGAATTAGCTGTACCACTTACAGATTTAGTAATCAGGCCACGGGGGAAGGGACCTTAATCATCCCAGTGCCGTGGCGCAAACCATCAAATGCGCGCGAGACCGTTCAGATACCCATGAAGGAGGCAGTATCGGACGTGGCAGTCGCATCCCAAACGGATGTTACGTCATAAAGCCATGATTCAGTGTGTGCCCGTCCTTCCGGATTTGCCTGGTCATGGTGACCTGACAAGGATGAAGCCGAGCTCGCATGTCGAAAATACTGCATACACTGCAGAACGTCAGCCGACCCGACATCACTCCGTCTACAGTGAAACCATGCACAGGAGATTAACACTCTGGACTTACCTCCGGGATAAACAGCACTGGATACAGTTTAG * tp:A:P cm:i:80 s1:i:720 s2:i:0 NM:i:1394 ms:i:2896 AS:i:2896 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
22 18 4 * 0 0 * * 0 0 GCTTCCGTTGCGGCTTATGTCTATTCAGGTGCTTGTCACTATTGGGGTTTTAGTTTGAAAAGAGCCGTTTTACCGTTCTTCTTGGTCAGACTTAATGTTTATTTACGTAACCGCGGAAAGAAGCTAAAAGTACTATGAAGGCTATTTTGGTATGTCGTTTCTTCCTTTGTTAGTGACCCAACAATGGCATTGGACAAACAACATGCGTTTCTTCCTTCCGGGTATCTATTATCAGAAGGCAGGAAGGATCGCCGTTTATCGTCCGTAGCATCCAAGGTAATGAGGTACTCTGCCGGTCACTGTAGCCGAAGGGATTGAAGTGAACACGAAGGTGCCGGGGTCAGTGAAGAAGGGCAAGCTAGGATCTCCATAAACCGAGCTTACATGACAGCCATCAATATTACGCGTGCAGGCCGACCCAAGCACAGAATGAAGAATGCCAGACGGGCCGAATGTAGAAGGCATCGATTCCTTCCCACTTCATTGGAAGGGGAAGCTCCTTGTCGGTGCCGTCCACGCTGAAAACCACATGTTGATTCCTGAAACGGATGATAAAGCTGACAAAGCAGCCCCATGAACCTGATACATTGGTATCAGACCATGAATATAACAGTCGATCTAAGTCCGCTGCGGCTTTTGCTCATCATTCAGTACTGTTCCTGAGCCACATAAACCGTTGAATGAGCTGCTAATCTATCTCCGAAAGAATCACGATAGAAGGCTGAGGAATTCCTTCGGAAGCGACCTACCGTGGATAGATGTGGTAAATTAACAGTGTCGCTTTATGTTCCCAAATGCTCTGTTGCTATTTATAAGCAGCGCACCCTATCGTATGCCGACGTATTAGGTAGCCAGCCAACGTCGAACCCACGTTTACCACTGGTTTATTCCGTCGCTTAGCCATGGCCCGTACCAAAGCACCGGATAACAACCTCATGAAGCTAATCTTTTCTAGTGGGTCTCCTTTCTCGGAAGAGCCGTGATGTTGACATGCTGGGTATCATTGAACAGTGAATCGCTGCTGACGTCTCCTGGGTACAAGGCGAAAATAGTTCTGATCAAAGCATCTTCCACGTCAAAAGGTCTAATAGTCAGATCAGGGCGCATCAGTCAATCCACTACGTTCAGGCTGCCCGCACTTTTAGCGTTTACTGTCATGTAAAGTTAGACAAATACCCTATTTGTAAAGGGACGCTTTGATACCACTACCGCATCTCCAGAAGCTCTGCCCTATTAGTCATCTAAGCAAGGCAATATTTACTCATTTATCTTAGACCAACTAGATTGGATTATCGCATTCTCTGTTTTCGTCATGTAGACAGTACTGAGCCTGACATAGATCTTTTAGATGGACATGTACAGCCGTTTAGACTAAGTCTATACAACCCACCGAACACGAAGCGTCATTAAACGTCACTGTAACACGCTCGGTACGTGGGGAGGAAAGTGGGAAGTCGTCATGGAATGATGGCAGTAGAATAAGTCAGCCGTTGATTCTCCGTCTCCGGTACCGGTACAACGCTCCCAGCTCCCGAACCGCATGAACGGCGTAGATCGGCCGGGAAGCTGGACTGATCCACATCGAGTCGTCTGACACCACGAAAGCTGAGCCTTGGTACGTTAGATAATAATAGCCGCCGAATGGCTAAGAAGTATTCTATCGCTGATTGATACGACCAGGAAGAGATTGTATGAACTAGCCGAACATGGGTTTAGAGCTGCGAATGCTAAAGGGACCGTCTACGAAAGCCGTGAAGCACCGGCATTAATGAACAAGCTTCTCCGTCTCCACAGTACTTGGTAACCGCCATAAGATTTATACGCTTCACTGACGCCGAAGGGATGAACGCTTCCGGTACGTCTATTCCGCAAACAAGACTTTATTATTAGAAGCTTACGCAGCATGACTGGAAGAGCATACCAACCGGGGCATAAATACTGTGGACATAAAGCGAACTAAGCTACTGAACCTTCGTTGCTGAGCGTGCATCAGTATTCCGCTGGCACTTATCTCATTGCTTAGTGCCTTACTTCCGAGCCTTCCGGAAGCATTGCTGAGATGAAGCACGGAATAACCAATCTAATTCATGCCGGAGCCATCTAAGCAGTATTGAGAAGGAAGTAACCTAGCGAACAGATACACGAAGGACGAATGAGTTACTATTCGATTAACTAAATATATTGCAAGCATAGCGAATCAACCGTAAGGACACAGGACCGTAAGGATTTGATGGAAGCCATTCCCCTTTGGACTAAGGACATGGACATACGCTTATATACGATTAGCATCTAAGTCTAGTAAGAGTGGGCTTTAATCCTTCGATTGCTTCCATGGAAGTCGCCAATTTACCGTGTAATCGACTACGGATGGCAATAACGATGCTCAGACGCCATCCAGCTGCCGATGATATCTTCCTGTGTTTTTCAGGCTCAGTCACTCCAAGCTCAAGGGTGGGCATCTGGGAAGAAGCCGTGCCTTCCGTTTAAATGTCGATGGAAAGAGTTCTAAGTACTTACTGCATTGACGTTGTAATGGAAACGAATTACAGGCATGTACGTACCGCCTTTACGTGAACTTGTTCGTTCATAGCGGTAAGTTCTTCCTCGGTTCCTTAGACACAGTTCCCTGTACGAGCGATCAGCATCAGCAGGACAATAAGCGGACAGCTTAAATTTGGTGCCGTGACATTAAGGAATGAGATATAATGGGTCACGGGTATGCTCCTGAGTGCTAAGAATGGACATCATCAGGTCCGTGTCTCCATCAGCCGTTTCACCAGTACGAATGAGTCCGGACGGGCATGGCTTGCAAATGTTTACCTATTAAGATGAAGACATACTCCGCTCCCTTGAGAGCGCATGCAAGGCCTTGAAGGCGTATCCGCCCATTGAGTATGGTACTAAGTCATAGTGGCTTCTGTCTTAGAACAGATGAGTCCACGAGGCGAAAGTACGGCGTGACGTAGAATTGCCGTATTACGCCGCAATACGGAGGCTTAGAAGTAAAGACTTACACTGATCGACCTGTGAGAGCTCAATGACTACCACCGTCATAACCTATTCTTACGGTCCAAGTATGATACGGTATTGAGCCGGCTTCTCCTTCCCCTTTTAGAATTACGCCAGGTACTCCACTAAACGATCAGTCTGAATCTATGGTATTTATGGCTACAAAATTCTTGCATGCGTCACATAGGAGAGCCAGGCCTGGCGCTGTTCGGACAGTCTATTCTATTCACGGTCGATTTCGGAAGGCCAGTCGGAGTGAGTAAACGGTCTGAACTGCCTCGTGACCCCACGCGATTTGTCGGAGTGTATTCTTACCGATGAGGAAAGACCTGACAGGGTCTAAACTAGATGGCTAGACTATATCTACGAAATTTTACTAAACGGGCTGCTTCGTTCCGTAGTGAACGATGGGAATGATGACCTATGAAGCCCGGGCCGCAGCATTTGAATCCGCTGGACAATCAACAGACAGAGAAGAGTACTAAGCTGTAATGCTTACCGCATATTGCCAGCATCCTTTAATGAGCCTGATGCTGACACGCTATCAGGGGTTCTTTGTGCTTGCATCAGCTTACGATCAGCAGCCTTACGATGCGTGGACAGCCTGACTGCCCAGGAGGATAGCGCACGCTGGCATTATCCGAGAAGTGACGGTACACCAACAGTCGGAAGGCAGTTCTCCAGCTCCTTCCTTAGCCCTACGGCCGGTCAGCGGAACGGTCTGACGTTTATTTGATAGTATTG *
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
23 19 4 * 0 0 * * 0 0 TGTGGGTTGTATGAATCCTAATGTCTGCCTGTTTCCCGCCGCATCTTTTATTTTAATTAGACAAAGAGACGGGTAGGGTGTGCAAACCGCACGCTGAGTATCCTCAGGGGGAGGCTTACATCTTCGTAGTAATGCCCTCGTAGCTGAGCAAGTAATCATTATTAGCCGACTTTACTAGTCCCCAGCCGTTGCTTGAACAATCTAGAATTCTACAACAGCGGTATGGCATTCTTGGTCTGCGTCAGGCGACCATCGAGCTATGTAACAGGCCACATGATGTACATAGGGACGGACATGTGTACTGCCGTGTACCTGTAGGGTCTTACAAAGATCCATTGCACGAACGTCACATTTAGAATTTTCAAACCTGGGACCAAGGCCGCTGGTAACTAGAGCGAAATGGCTAAACATAGGCCATCCCGCCTTGACATGTGTTATCTTTAATAAGGAGGAAACCAGCATTGTTGGTCGCCAGCTCTTGACAGGGTAGGCTTAACGCCGTCCTAGATTCCGTTGAGCACGTAGACTGTGCGTATGCGGTACCTGGCCGCTAAAAGGCTTTGTTGCTTCTTATTAACCGCTAATACGAGGCACCTGTTTTAAGAACGATGAAAGAACTGATCGGCCTCGGCCAGGCTATATCAAACACGAGCCGGACATGTGTCTTAAATGTTGATATGTTTGCTTTCGCATACATATCGTGCGCATTACGTTAACCATTAGTTCGACAGCTGCCGAAACACCGCGCGTCATGGCTCATCCACCTAACGGTGCACTGTCGATCGAAATGGTGGCCAGGTTCTCACGTAAGCGACAACGGATTCTTACGATGTTCACTAAAATGGTCACTACACCTTAGAAATATTTCAGATTATAACATCTGGCTCTCACACTAACGCCGCACGTTTTTGTTGCAAAGCCTTCCTTGGTGCTGTTGAGTTCCCGAATACGTACGATGAATCCAAGGACTTAAGCCACTAAGCGACGCTGTAACAAAGTAAGAGGCCAAAACATGCGCTGGTTTTACATTAAAACCTGTAAATTTAACATTTTAATTTAACAGCCAGCCGGATCGCGTTATTCTCGTTTGGGTCGGCGGCTCCCACCATATTTCCCCGCTAGTCATGTCGGTTTGCGACCTGTTTAGCGGGTGCTGTACTAACACCCAGAGGGCCTAACAAGAAAACATTGGCAGATGTTTGCCAGCGTAGTGGTTAAGCAATGGACTAGAATTTGACGACTTTCCTTTAGGTGCCCCTACACGCCCGTTGTATAGAACAGCGAAATCCATGTAACAGAGCAGTTAAACAACTTAACGACTAGGCCGGACCACCACGATTAGCATATTTCTGTCTACATGGAAAGTCCGCAGAGCGGCGTGACTTTCTAAGACGCTTTTAAGCACATGACGATATGTCAATCTGATTTAATATGAGGTGAATCTCACTTCACCCCTCTGCGTACGGACTTTAAGGCCTAACTTGTCCTTTGAATAGTCGCCGCTGAGTAAGTGGTGATTGATTGTTATAGCAGTCCTCGGCCTGGCAAACCCAAGGAGGAAAGGGTTTAGCACCCTGAGGCTTTTGCCATACACGGCCTTAGCTAGACATCGCTTTGGGTTCTTTAAAGATCTGGTACCTGCAAGAAGCCGGATCCCCGCCACGCGTTACGAGTCGGATGAGCATATCCTAGTGTGCCGGCGCTACTGCCCAAGCCTTAGTTGGCTCGATGGCGACCGGGTGTTTATTAGAAGTTTGACGCCGTGCCTTTCTGTGTATGACGGCAGGAAATATCGTCGTCATCAACGCTGTTCGTACGGACCATGAGCAAACCAGCACGAGCGCCAGCTACTGCGACGACAAAGAAAGGCCAGCAATCGCCGTCTAACGCCGAACTGGCTCCAGTGATGGCTTACACCATGCTGCGGCCCTGCGTACACAGCGGGCCAGGATGGATCCAAAGGCAAGTACCAGCAAGTGAAGCCACAGATCTGACTAGAAACCGCCCTGTATGTGGCCCAACGATAGCATACTGAAGGCGCTGGAGTCAGCTAAGGTGGCTGAAGAGGACTCGTATCCTGGCCTAGTTTACCGCTCGCAGACAATGCAACCTGTTGATAGGGGCGGTCCGTGGTGGCCTCCGTTAGCGTTTAATTATTATCAGAATAGGCTAAAAGGGCACTGTGGTGCAAATGGGCCGTACAGGTCGGTTACGACAGTTCGCCGCAAGTCGCAACATTAAGCGACGCAAGTGGGTTTGTAGTGACAGCGATGAGGCGGGTCCCGCCAGATGAGTCTTACACTAAGTACTAGAGGGATGTACTTGTGCTTCGCTGTAGAAGTCAGGTTACCGTAAACGTTGACACGTGTTAGGGATATGGTGGAGCTACTCAGTCCGCTAAACAATTGCTGCTCATTGATGCCCGTGATGGGCTGGGCTAGGCAAAGCTACAGCACCTAGAGCGCGACTCACTAAACCTGTACACTAACGGCTATGATAATAGTCAACGAGCCGCGTCTCATACGAGGTATCGCGCTCGCGCTATTTATGCTCGGGCTCGTCTTCGGCTAGTCATCTCCCGCAAACCATCCCGACTCATTATCACCCCCACGTAACGCGATGTGCTAGAACGAGTGTGTATACCATTTAGTCTAGCGTTGAAAGGCGCACCCTACACTAGAGGTTAAGGAGTGCGGCGCGTCGGCTGATGACTGAAATCGTTAGCGCGGCCAGCCACCGCCGGGGTAAACCAGCTGCCTCCACGACCTGTCTGGGCTAGCCTGAAGCCCGCAGGCCTGGAGCACGGGACTGGATAGTGTTTATTAGCCAGCCAGCGGAAAGAATATTATAAAGGCGTGTTCTTGATAGACTTAAACGAGTCTGTCCACTCAGACGAAATATAGCAAACGGGTGGAGAACGTCATAGCAGGAAAACTGTCCTCAGGCAGAGCGGCAACGATGAGTCGGCCGCGCAGCCGCTATCGGACGACGCCGCCTGCGTGCACGGAGCCCTGACTTTGGTGTCTTGTCGCGTTAACAAGCAAAGTTGTTATGGAAGAGGAACACTAAGGTCGCGACTTCTTGCCGCATATCGCCAGCATGGCCTTAAGGCCGCTAGTTGCCTGAACCTTGTCTGTGGGTCTGCTCCCTCTGTTGTACGTACCCGGGTTGTCATCCCAGCTACCAAACTCACTCTAGAGCTTTAGCGATAAAGTCCCGACATGCCAGGTGTGCCACTGCGACCCTTAACGTTGTAGAGCCGACGGACACGATGATTCCGTCACGTACGGCAGTCAGGCCAGGAACGGCACTCGCCTAGCGTTGCTGCTATGCTCAATGCCGCTGATCGACCTTAACCGCGCTTATGATACTGTTTAGTTTGTAGAAGCCAAATTTAGCGCAGGTGCCGAGGCAAACAGGCTCTGCTTACACCCATCGGCACCGTTTGGCCCTGATAGCACTCTTACTGTCCTAGATGGCTGTGACGACCGTACGTGAGCGAACCGTTTTCCACGTGCCGGTGAATAACGGCTGGTGTCTAAATAATTTTAAACCATGCACAGGCATCAGTCGCTTCAGCCTTCCATCGCTGTCACGCTGCCCGACTCTCATCTAACAGCTTTTCGTTCTTACTCATGTAGCATATAATTTTACACGACTACTGTCCGCGTGGCCTTTCCAAAACAGCGCTGACGAAATAATCACAGCACTTAGATTAGTCAAGCGCCGGCAATGTTTCCTGCCACTTAATCATCGATTTTCTGATAGACATATGTCCGCTCTGCCAACATCTCACCAGCCTGACTGACCCGACATCCATGTTTGCCACATGACGTCTGATTACAGCGCTAGCCCTAGGCCGGACGAGCGGCGCAGTTTAGTAGCCCGATTTACGTATGTCCCAGCCTAACTCCAGGAGTAACATGCTCTATAAAGAGCAGAAGGCTTCTACAATGTAGTTTCAGGTTGGCATTCATGGACCTGAACGACCCCTGGAGCGAGCGACATAGACCAAAGAGACCTCAATGACAAAGCACCGTTTATCCCAGCCCCAACCATCGCTCGGATGTCGACGTCCGACGCAGGTGCTCATTTAACGCCGCGAGAACGCCAGCGCGCTGACGCCGAACTGACTTTACATTTCACTGACGCTGGCAGACATTGTTGCATTATGGGGATTCGACACGCTAGTCCAGCATCATCAACTGTGACAGAAAGTTTATTCACACGCGTGCTTTTAACGTGTTAACTGACGCCTGGTTGGATTCTGCTCACAATACGTTGGCCAACATGTCGGAGCACCTGTCGTACGCTTAGTGCCCGGTGTACAGCCTAACCTAGTGGGCTGCAGCGACTAGATAGGGTCGCCGTAACGATTTAGCCACGAACATAGTAACGTGATAGTCTATTAAAACTAGTAAATAAAACCTAATGAGCCACTATTTACGTAAAGTTTGATTAGGTTGTACCGGACTTAGCCCGTGTACGCTGGGAAATCTTTCGCAGCAACCATCTAGTGGCCTATCGGACCCGCCCACCAACATAGCCCACCCGCATGGATACAGGACGACGTGCTTCAGTATGGCCCGACATTCTCCGCATTGCTGTGACTAAGAAGTTGACTGTCACTATGACAGCACAGTCGGACTCAGCCGTCCACCCCGTTGGTATAGGTCGGTTAGACGAGACGCTAAAAACTTTGACTTGCTATCGCCAACCTGTAATATTATAATGGCTAATTTTATTGGTTATTGACGTTGCGTGCGCTCTTTAATTAGACTGTCGTCGGAGCGACTAACGCGCCCCAACTCTTTAGCTAAAGCTAAACAGCAGTCCCAACCTGTGGCTCGCGCTTCTTTCTTAGCGTATAGTATTCTTTCACACGCCAACAGTGCTGGCACAAAGCTTCTTTTAACTGTCCAACAGGTTTAGGTGTACGTCTCGCGTTGCTTACGTGTCTCGTGTATAGCCTCCGCGGCTTTCCCATCGTAAATACCGGTCTAGTTTTGATCGACGATTTGAAGTGATCCACAGTATCTGCCCTGCCTGCCGCCGACAAGTTCGGCAGATAAATTAGCCAACCTTGTCCTCTAATGCAGCCCCTCATACCCATGTTTAACTTAAACACTTTGTTAACCAAATATGGTTTGCTTTGACCACCGCAGGCAGTTTCTCGTGTGCCAGCTAAATACAGCAAGCTTTAGTTCGTCGGGATAGCGGCTTAGATCTATCATGAGGTAATCAACATCACGGAGTCTTGAATTATCTTACCCAATTATGACCACGTCACAAGTACGAGCACCTGACTGACGTTTCGACTCATTGTCTGACAGCCATGTAGTTGACAGGTTGGCCGCATTCGAACCGATTGCGCTCCAGCTGTCCGGCCGCCAACGAGGTACAGGTACGTCGGATGTCTGTCCTATCTAATCGCCGAGACACTTCTAGAACATCTGTTTCAACGTGCGATTTTAAGTCGTTAGGTTGGCCTATCCTTTTACCGCCAACATAATTTGGACCCTTACAAAAAGAATTTCCCGTCTTTCACAACAATTGATGTTCCGTTCTTTAAACGTACTATCAGTGAATTTTACTCCAGCAGCGGTGCGCAGCCGTTTGGGACTGACACTTTAATCGACTGATTCGATTCACGGACTCTTTCAGCTCATTGAAAATTCGGGTAATACGTAGTCATCTAGGGTTTTGTCACTGTTCAGTGTACTGGACGTAACTCGTCTGTTTCGGGCCGCTGTTAAGCGCATAATCATTTGTCGATACATCGAGCACTCAGCCCTGTCATCGTCCCCTCGTAGTACTGTTAACGAAAGATGAACTGATTGCCATGTCTTGCCTTTCTGCTCGCGACAACTTGACGTATAGGAGCGCTGACCTGTAAAATGTAAAAGACAGACTTAAAGACGCGCGTGGGTCTAAAATAGTTGAGTGTGACACGTATTTACAATTGACGCACGACGATTCGCTGTTACTTTCAGACAGCCTTGGTCGGTCGTAAAAAGGACGCTGACTAATTGTCGAAATGTTTGATAATAGTTCTCACTAAGTTCAATGCGCGGATACGTCTGACACGCGCGGCATATCAAGCACTATAGGGCAATGTGACATCGTCGCACCACACGTTACTCGATATGCAGATCCATCACTTCGACCCAATGGTCTGAATTGTGGTCACCTGTCGCGACGCTTCTAAAACGTGTTTCCTCGCGCCCCTAGATCAGGAAAGGACAGAGCGCCTGATAACAAGACTTAAATAACGCAGAGGTGCTCTACTACATTGTATACGCGCTATCTCGATGCCTCCGACTCTCATGTGGTTAAACGTCAAGCGGGGTAAGATCTAGAACGATAGGCCACTACAGCGGAGGATGTAGGGTCAAGTGCTAGGTGGTTACGCAAAACAAGAGCTTTTGTTTGCGACTTAAAGCCGTAGTGCTGTGTTGAATGAGCCGCTTATGGCCGAGGCGACGGCCGGTTAGCCAGCCGCCAGGCCAAAGTAGGACCATCGTTAAAAACCCGCGGGGCACTCGGACCTGGCATGATGGCTAGAGCGGGAAATTATGTCACTGCCCCTGTTGGACGCGCTGTAGCCACTTTGCTCGCTGCTATAACGCTGCTGTGAACGGTTCATGAGTGGTCAAAAGAGCGAGCAGGCTCAGAAACCGAGCGTCTATCACTTACGGACGCGAAATGCGCCTTTCTTGCTACGCCTAATTTAGCTACGACTGTTCGGCCTATGTGCCTGTTCGCGATACTTTCGTACCCGCTAATACCTCATCTGGTAAATAACGTTAATCCCATGAGTGGAAAATCGGCCAACTAAAACCTACAGCGTCGAACAGCCACTACAAACATCGATTACATTTGATAATCAAATAACTCTGTCAGCCGTAAGCACTTGGGTTAACATGTCCTGTTAGCGCGCTCCTAGGCGATAGGCAAACTGATTGTCCCAGTCCCTGAAAGGGCGGGACGGCAGCGCCAGGCGGACCTATGCCTATTTCCATCGTAGGCTAGATGTAACTTTGAAAAATCTGTTCGTCCTACTACAGCGTCCGCGGACGACTCCAGTGGATGAGCGGGTGAAAATGTATCGTGCTGAGGATCACGGCTAACAAAAGAGCGCTGTACAGTCCGCTAGAAAGTGCCTCTTAAAAGAGCGGCTATGGGTGCAGATAGACCCTGGTATCTAGATCACGTGATGAAATACCGCACGGGTCGCTGACATCGTACTTAATGGCACGAAGCAGACGCGGGCACGAGTGCTCGCGCTTATAGGCTCTAGCGATTTCTAGGCATATCTCAGCTCTCCATTCCGACCTCTTTTTAAAGAGACCTATAAATATTAAAGGACAGGGAGTGCAGGCGTCTGATATTTGAATATTTCCTGCCGCTTATTGTCGCTGGATCAGCCATAGCACCTAGTCACGCTGTTTACAGGCTGGCGATGCTATACGTGTAAAGGGTACGCGGGTCATACTTAGCCTATGATCATCTTTTGACTCAGTCGTGTTGTGCTCAGCCGAGGATATTAGGATTGTCCATGGTGTGAGCACAAACACGCGAGACGCGCCGTCAAATGGTGATTGTCCGAACATGTCTCGTTAAAGTTCTGTCTGATAGCCACTGTTTGTACGTAGCTGATTCTAACCTCAGCAGATGACTATTGACACGGCTGCTAGGGCAAACCAGTCACAGGCACGCAGCGTGAACTGACGTGAGCCTAACAGGCTTTGGTTCATGATTAGTTTTCGCAGACTCAATAACCGGATTGTAATCTGGCTGACGGTAAGACGTTGTTCTGCATGCCGCGACGCTACTCACCCTTGGCCCATCTCATGAGTGTTGACCTTGTAATGCAGGGCGCTCTAGTTTACGACCTTATATTAGCCTAGTAAAAATCCGTTGTTTATCCCGAACGCGCACGAGCTCATAGGGCTATTGTCGGTTACGTACATAGATGGGGATAGCGCTAAATTAGACTAATTAATATGCTTTT *
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
24 20 16 utg000001l 21868 60 11S39M3I12M3D5M1I12M1I10M1I19M2D9M1D7M1D1M1D1M1D2M1I9M1D10M4I16M1I13M3D2M1D2M1I3M1D7M2D17M2I5M2I11M2I3M1D18M2I18M1I5M2I4M1I18M2D6M1D5M3D21M1I5M2I10M1I8M1D15M3D16M3D6M2I1M1I35M1D1M1D4M2D16M2D10M3D23M1I12M1D2M1D3M2D3M1I13M1D2M1D4M1I9M2D7M3D6M1I6M1D3M1I1M2D6M7D14M6D3M1D15M2I8M5I5M1I5M1D3M2I5M6I11M4I1M1I5M1D4M1D2M3I6M4I5M2D29M1D16M1D9M1I12M1I10M3I7M1I9M1I11M1I5M1I19M1D3M2D9M2D23M1D7M2I15M1I7M2D7M1I7M1D10M1D20M1D33M2I3M1D5M1I30M1D3M1I7M14I11M3I11M4I2M1I5M1D4M3I17M4I1M1I12M1D4M5I6M1I8M1I10M1I2M2I8M2I7M1I3M2I14M3I2M5I27M2D14M2D4M1D9M1I4M3I1M2I3M1I10M1I5M1I13M1D5M4I12M10I6M1I6M4I2M1I25M1I4M5I6M1D1M2I4M2I3M5I18M2I7M1D5M1I9M2I4M1D7M2D10M5I17M1D5M1I12M1D14M8I2M1I17M1D8M2I4M2I3M1D10M5D7M1D4M2D3M3I9M2I1M1D3M1D10M3D56M4I18M2I1M2I3M1I1M5I6M1D3M2D1M1D5M3D1M1D5M1D6M1I4M8I1M2I3M3I2M3I3M1I11M2I2M1D8M1I17M2I4M1D13M1I3M2D4M1I10M2I2M1I5M1D3M1D14M3D8M2I2M2I3M1I8M1D2M2D2M1D2M4I8M1I15M1I9M1I6M1D16M4I2M1I7M3D4M1I16M3I2M1D7M1I21M2I7M5I16M4I4M1I2M1I3M3I3M4I8M1D2M4D5M8I3M2I15M3I4M1I2M2D7M1D4M1I9M1I12M12I6M1I19M2I5M1D27M1I7M1I5M3I9M1D3M1D8M1I1M2I8M2I2M1D1M2I4M1I5M1I8M1D6M7I1M1I8M1I6M2I10M1I2M1I1M1I9M1D3M1D4M3I3M1I31M1I4M2I4M2D3M1I42M1I8M5I1M1D12M2I2M1I3M1D15M2I4M1D8M1I6M2I3M1I2M1I23M2D2M1D2M1I8M6I10M2I3M2D5M1I3M1D7M3I1M1I11M1D15M2I1M1I8M1I6M1I8M2I21M3I2M1I7M13I19M4I12M2D19M3D2M1I10M1I15M2I15M1I16M2I9M1D31M1I25M1I14M2I18M3I6M5I7M1D4M4D5M1I11M4I1M1I25M2I10M1I7M1I14M56S * 0 0 CGATTGCTTAGTGTTTCGTTTCGTTTAGTGCATTTGATCCTTTACTCCTCGCGCAACAGAACATGACCCAGCAAGGTACACAATACTTTATATTGGCCAACTTAAGAATGCTGCCAGCAATAGTTTAAAATCAGCGCGATCTCCATTAGAATTCGGCTTTCATCAGCATTTATTGGTTGTATGAGAGGTAGATAGAAAGACAACTGGCTTGAAGCTATCACCAAACTACAAGTAGTGATGAAAACTTTCAAATATGGGGAACGCCCATCAGCCTCATTTCTAACAATGAGCAGAGTTAAGACGTAATGAACCACAGATTCAAGTGGACGATGATAAATTCATTAAATTGTTTTGGTGACAATATCCAGAAATATGCTTCGAATGAGCTGGACATGCAATTGTTTTTATTTAATCACAAGATTAGTAGATGTCGTTGGCGAAAGTCATTAGTTTGTTCGATGAACCAGAGGTTCATCTGCATCCACCTTTGCTCTTCATTTTGATAGAACATTAAGCACTTACTCGATGCACGCAATGGGTGGGCAATAATTGCAACTCATTCCAGTAGTACTGCACTGCTACCCATTCAAATGGTTGCATGCTGTGGAAAGTCTCACGGGTCAAGAGAAGCAATAAATATTATCGTACTCGATCATTGAGAACATTCGGTGAGAACTTAGGGTTTTAACTCGTGAGGGCTGTTTTGGTGAAGTGACAAATTCTGGATACCACCACTATTATTATCGCAGTCGTTGATTCAGAGCTTTCTTATGGAAACCATTCGTGTAAAATTATACATGGTCAGATAGGATTAGTAAAGTACGAACCGTTTTAAAAGCATCCGATAATGAACAGAGATGAAGGTAAAGTACAATGAAAACTACCCTCTTCCAGCGAGAACTTATAGCGAAATGCTTAATAAATGCTCGGAAGGTATGATGCAGATAAATGTTAGAAATAATTTCATTACTCACTTCCCCACTTTTTGGGCAGAAAGAACAACAATATAGAATATTAAGCTCGACAGGTCAGTTTATTTACCCAAGGACAGGACACCCCTCTTGAGAGCCTACAACCTTAGTATTGGTAACCTGACAAAGGTAAATTAGAAAAGCTTTATTATGAAATAATCTCCGAGATAAAAACAACCCGCTAGAACATATTACGATGACATGCTTGGCTTCATCAGGGTGAAAATGTCATTTTGTGTGATAGGACAGACAAAATAGATCATTTTCTTCCTATCACATTATCCTGAATTTCGTGATGCCTATTAATTTGCCATTCCATCATGCCGCGACTGCAATATGGGAGAAAGGTCAAGTTTCTTCATTAGATGAGGTACACCAAGCGATTCATCCCTATATCGACAAGGACATTTTTCGTGAGCAATGGGCTATGCAAATTTCTACTTCCGGAACCCCGGGCTATCAGTTTTATGTTGCTTACGCCCGTGAACTGGAGGCAGGAAGACAACAGAGCTTCATCATTCTTCATCAAGCTATTAAATATTGCTAACAGGTATCGTTTGGAGGCAGGGAAGCACTTGAGTGAAGTCGATTACTCACGGAAGAACTCTTTCGTAAAAGTTATAAGGAAATATAGTCAAACCGCAACGTTTCAGCAGCTACAGTCAGAATTTATTGGAAGCAAATCTGAAACCTATTATAGATTTGAATGACTTCCCCAATTATTGGAAAAGAGTTATGTATCAGTGCCGCCTAGCAAACTCGGAAGATTTTTCAGAGGGATCTAGAATATGATGAAAGATAGAAATTACGACGCTTATCGGAAGTGAACGAATATCCTTTATGAGGAGGGCTGTTTTACAAATCCGGGTAGACTTGCCAACCAATTCCGGCAGGTCATTGGCAACAGTGGCATGCACCGAGAAGGACGTTGTAATGTCGTCCGGCACATAGCAGTCCTAGGGACAAAATCTGGCGTACAGTCATAGATGGTTCGTGAGCGTGGTACAAATTCTCGATGCAAAAAGCTGTAAAATCGGGCAACTGGAAATCATTCAACACCCGCGCACTATCGGAAGTCGCCAGCCACCCGCATGACGTTCCTGCATACGACGTGTCTGCGGCTCTACCAGTACTTCCTATGAGCAACGTGTTAGCGCAGAGCCACACTCACAACTCTAATTTAATACATAAGCATGATAAGTAATAATATTAAAATTTCCTGTGTAACTAGATCTACCATTTACCTCTCTGGTTTCTGATAAGAATCATTGCAAAGATCAAACAACTTGTATTACATTGACAGTCACAGCAGTCGACTTTATCACCTCTAAAATATATCAGCATCTAGCATGCAACCTATCAAAATGGGAGAGTTTATGACTAAAAACCATGCGGAAAGAAGACTTTAAAGATTTTATCGCACTTGCTCAAATGCTGCATTGATAAGGTTTGACCCTGAAATTATTTCGCTTGAATTTGAATCAATTCCTCCAACGCAAGGAACAGTAACATTTATTATTCAAAAACAAACCAGATTATAGGATATGACGGTTTATTGGTATAACATACAACCGTATTGAAAATGGAAAAGGTGATCATTAATGCGTTTGGGCTAAGAACTTCTCGCAATACGATAGAAAACAAGGCGATTTAGAAATGTATAGCGAGGCAAATGAGTACTCTTATTTCATCTTACATCATTGAAGAAATGACATTGAGTTTATTACAAACTGAAAGTATGTTAAACATTGGTATAAAAGTCGTCAGACTTGCACAAAAGAAATTACCTTTCATATTATTTAACTGGATCATCTATTATTGACGACATCAGAAAGAATGGGTCGCTAATACGCTAACGATTACGAATTGCCGACTTGCCTTAGCTATAATCTATGGCAGAATTGTATAACTGCTGTAACTCTCTTGGGACCAAATAAACATTCCAATGCTGACGATGTGATTTCGCCAACATCATTCGACTCTTTACTTTGATGAAGCCAGGAGAATAACTTATTTAAATTATAAAAGATTACTCCATAAGCAATTGTCCATTTAGCATGATACAATATGACAATAAAATAATTCCTGAAGATACTTTAAAGAGTCGTCGAACTGGTAGATAAGCCTAAAATATCGTCACCGCGGAATTGACGTTAGTTGACTATACAGCCAGGTTAACACCCAT * tp:A:P cm:i:34 s1:i:331 s2:i:0 NM:i:866 ms:i:1358 AS:i:1358 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
25 21 4 * 0 0 * * 0 0 TTCGATGGACGGAGTCTATTAGATTCAACTAAGGCGGAAGCGTACGTCGACTTATTATTCGTCACGGCTGCCAACGATTGTAACATTGATCGTCCACAGAGACATCCAACTTCTAACATGCATTACGCAGGACATCTAGACCGACGAGATGGTACTATGCGGCAATGTTTTGGCCCGAATCGATTAAGGGATGGACCCAATTGTTCTTTACGTCGGTTCAATGAACGGTTTGATATTTAAACGATTCGCTACTGTACTTCGAATCTTTCTGTACAGTCCGGTCTCGTGTACAGCCAACTGTTAATTTGACTTTAGACGCGATCACAGCACCCATTTGTTACCGCATGAATAAGCTTAGATGGAGCTCGGTCGCCTGTTACGACTCCAACTCGACAGGGACCCGGGATGCCAACGCGATTGGAGCCAAGCCACCCATGAAACTCCACGCAAGCACTTAACAATAGGGAGATTTGAATGAGTAAGTGCCGTTAGAAGCTCTTCGATCGGGTCCCAAGAGGGGAAGGAATTTCTAACTTGGATTGTTGGTCAGTACGGACCGTCACAACGTCTAAATCGTTATAACTCGGATAGAAAGCCTGTTAACGGATATTCGCAAGCCAACGAGTTGGTAGCCACGTAAAGATCAAATGTTACACTTCAGCCGAGCCCGGTGTACGAGACCTGTTTGACACCTGACTAATGCGATCGAAGTACGGGTTCCGGATCCCGGAAGTTATTGCCAAGCGAATTTTCGATGAGTACATGACGATCGCTGTGATAACGGTTTGACTAATTAAATCGGCTTCGGCCATGCAAGCCCGCCAACTCGTCCGCCCTAATCGACTTTCCGTTGCCTTCGGGACGATTCTGAATAAATGCGATACGCAATTGGCGACGACAATAAATGTGTTAAATTTCTAAATTCTCCAAGCCTCGGCCCGCGGAATTCTCACGATTTCCACTAGTCGCCGCCGTGACTTGGCCGGGAACCGATGACTGCTCCCGAGCCAGCTAGTCTAGCTGCTCGGACTATCCTACATCCTCCGATTCACGGATTTCAAGTTGCCGCTTTGTTTCACTTTTTCTACAGGCTTCTGCAGTGGTCTTTAAGGGACGGAAGCCCATGCACTTAGGCTACTCGCTACTGCCGGCCTCGGTAATCTGCCCGCTGTGGCTCCGGGTTGGGTTGCACAGCCATGAAGCGATTAGATCGCATACGAGAGGACGGGAACCGGGCCCATCATTTCTGACTTCGTTTCTGGGATTGTTGGCGCGGAAGGACTTCAGATTGCCTAGATTTGGCTCGAAGGGTCGACTAAGTCGCAGCGACTCTCAGCCTTCTGATCGCACTCCATTGCTCGGTTTGCGTGACGTCGCATTTAACTCCGGGCAATCCCGTTGTGTATTGCTCGCGCCTGCAATCGATTGCCGGGCCAACCTGAATGATAGTGAAGGTAGCCTGCTCTCGACCGTCTATTTATTCCGATTGTTGCGAACTCCTTAAGGCTCTACTCGGAGCGTCGCGTTTCCTACTTGCCAGTCGACGAAGTGCGGGCTGACCCTAAAGAAGCAATCGGTAGGTTTGCCCGATGGTATAAAGACTGCGTTGATCTTGAGCGCTAGCCGACGAGAAGCTCAACGCGAGCAACATTTCATAGTCCCTGGACGGCCGTTGCAATTATTTGCCAAACGCACCCCGGGGACATCCTCGGGCAAGTGCCGTGTCACGGTGATTGCGCGTTTAACGATTCAGTTCAACTCCCGTTGTCACAGCCAGATTGACATCGATTTATCGACGGTAACCCTTATACGCCTACACCCCTGACGCCGGCAGCCGGCCTGCATGGGCAAGGCGAGCCTGATCGCATGACCTGCTCGGACTCGGATCTACTTAGTTCCGCCTTCTTTGTGGATTCCGATCGCTAATTCTAAGCTGCTCCAAGCCCGGTACCCACGGCCAGACGCGACGGCGATGCAGCTCGCGACTGTGCTGCAACGGTTGGGTTCGTACTTTAGATCGCCTGGCCGGAATCGGATCGACAACAGCATACGGGCATCCTGCAATCAAGCGTCCTGACTTTCCACAGAAACTGTTCAACGTAAAGCACGCTCATAGTCAACGGTGAAACCAAAGCCAACGGAAGAGACGACCACGTCCAAGGTTTGGGTTTGAATTCATTTACGATGCCCATTTGAAGAGGTGGAAGCTGCAGTACGGACGCTAGATCCCGTCATAAACGACCTTTTGACTGTTCTGACGTTGCTTTAACTAAGTTTTAACAGGCCAGCAGATATACCAAGAATAGTCATTTGACGTACGTGACATTTCGCTGTTAACTAAGCGTCTAGACGAAGCGTTGATAAGGCAATCAATCGATCAAACCCCATTACCGATAACGCTCGTTGAGCGAAGGTTAAACGGGTCATGAACGATCCAGGTCCCCGAATGAACGGCTGACGACGCAACTCCCACGCCGCTTTTAAGTCGAAGAATGCAAACGATGTTTTGACGAAGCCCCAATCTGGTCGCCCCAAGGGTAGCCCGGTTAAATGACGAGAAGTCCACGAAGATCAAATCGTCCTTTACAGAATGGCGAGCCGGCAGGTCATGTTTCTCCATGTCAGTACCCCGAAGGCCAGGGATTTGGACGGCCTTTAGATCGTAAGAGACCCATTGAACATTGGACTACAGACGGATCCAGCAGCCATCATGTTAGATCGAGGTTGTTTATTATACGCGGATACTTAAGTCAAGCATAGACGACGAAGATTGTTAATCCCAAACGGTGAAGTTCACGCAAATCCTGTGGCTCCACAGCACAGTTCAATAACTATTATAAAACCATTCGATTGATAACGCCCCATAGTACCGCTCACGCTGATTTGGACTTGTCGTTGAAGGATACATAAGTGTGAAGCAACGCATTTACTGTACTGCACGTCCTTTAGGTCGTCACGCTGCTTCAGCTAAGTGGAAGCAAGAGCAACCCAACAGGCAACACAAATATTCAGAGATTACCAACCACAATGCTGTACCGATTTACAAACTAATCACGCGAAACCGTTGCTAGATAGACACATAAACATTACTGCCGAACTGTTTCGAGTTGGAAGTTTGCAAACGGATATACTGCCTGCAGTGGTTCGAATTCAGACATCGTCAGGGACTCACGACGAGAATCGGGCTAAGCTTCATCGAAACACAGGTAACGGTAAAGAATGCTGACACATGAACGTTTAAGTCAAGGTTACCCGATTTTACGTCAATAAGTTGAACGAACTGACCCTGCCGGGTTACTGTTACATCGTGAGTGAACATAGTTGACCCCATTCAGGTGGTCCGATTGACCTCCTTCCGTTGTGAAGTTACAGACGAAAGGACATGACGCACAGTGACCACGTGGATTGACGAACGATTCGGACATGTCAGCGGTTAGCAAGGACGTCCCACGATATTAATCGTGGGATACGTATTCGAAACTAACAGACTACGTTGTGAACTTCCCGCCAAACGTCCACGCTAACTCCATACGCCGGACTTTTCTGAACGGGTACTAACGACGGACTTGACGCTGGCGATCTCTGTAAATGTTACACGAAGCAGTTACTCCAGCGACGCCAAAGGCGAGACTAATGCCGCATAGAGTGTTACAGGAAGCCATTCCGTAACCTTTACAAACCAAATATTTCCTTTTCAACAACGTTGTAGATCTGTTCACGAAGCCCGTTGTTAAGAGTCGATCCCAATAGTTGAAGCCACGTTGTTGGTTAACCCAAACGATCCGTTATCCCCGATGCAGACGGAGTCAGAACGGTTAATCGTCGTTGTAAGCCGCATCACGCACCAGAACGATACCAGCCGTCAACGGAGACGAATCGAGAAACACAATTACCTCCATTATCCGTACATCACGTTGTATGAATGGATCGCGTCATAGCGTTTCCGATCTCATTGAACGGTTAACAGTGGACGATTATTACATGTTAGAACGTCCCCAGCCAACCACCGTATCGATATACGTCTTTGGCATATCGCTACTGTTAATAACGTGACCATCTGGCCGACCTGAGTAATTTGCCCCACGGTTGATTCTTTCACGATCCCGTTTGTACCGTGATTTGGTTCTAAGTTCCGACGATTAACGGTGGACTCCTATCATACGTCCAATAATGGTCGTCGACGATAATCGAACGATGCAAGACGAACACCACTTTTATCTTTACGCGTCAATCGACTGACGAAGTCAACCTTTGGCGACGGTTTAACGAGAGTTCATGTTGGACTTACGCGACGAAATCAGAAGCACAAGTTAGAACAGTACTTAACGTTTCCGCTGAACCTAGATAGATCAACGGTTAACATGGTCCGTGGCTATATAATTCCCAAGGAAGTGATCAATTCGAAGGTCAACGTCTCTGCCAACGGATCCTGCGGATCGCCCCCGACTAGCAAGTCTTTGTTTCGAATGCGCCGGGTATCCCGATTTGTCATCGATCCTTTATTGACGCATCGTGAAGGGTTCCCGCCAACGCCCGGATATTTCCTGGCTCCTTGCATGTGATGCAGCCATTTTCTGACTAGCATGACTTTCCTCCATCTCACGCCCAACCGTAAAGCGGACGGTCTCTTATCCTACATCGCGTGCTTTCCACCGTTGCTGACGTAGGTATTTTCTGTAATGCTCCGCAGCTCGCATTTGAGTCCGTGCCTTCTTTATAATTTCTATTGGTTCAACGAGCGGGTCTCCGAAGTTTACTGATCGAGTTCGAACGGACCTCACCTTCTGCACTTTCGCATGTTCAAATTTCTGTTCTGACTGCTTATCTAGATGTAAGCTTCGCACAGAGCTGCTAGATGAGTCGACTTCTGGTGATTCAAGATTCCTGTCTCTACTGCTTCCTTACCGCAATCGATGCGTCAGGCGAACGCCAGACCCGTTTCCGTTTGATTCGACGCCCGCGGTCGGTTGGCTCTGTGCGTTCCTTAGATCGACCGAATCCATTATGAATCGTCGAAGGGTTGTGTTTAAGTAAATTGTCCCTCGAGTCGCGCTCGAGACTTCTAGTTTAGAAACTTAGATCCTAGTCGCACGTCTCTTTCTGATGCAGGCGTTAAGGGTTGGGGGTTTGATCCGATCTGACTTAGGGCGTTGCCACGCGATTTTCCGAATGTTTAGATTTGGTCTGTTTTAACGGATTCGTCGTTCTTCTCATGTAAATCGTCCTCGGTTTGGATTTATTCTTTCCGCTGCCTATCTTGGTTTGCTTCGACTGGCGGACGCGCCACTGATTAGAATGTTCCGAAGGGCGGGACCATTCCGATCGGCACATTCCCGTTTTGTACTCATGGTTTGACGCTGATTTACGCTCCTGTCTTTTTAACGTGCCTCCGACATTTTCAGGTACGGCTGAGTCCGGACGGAATGCTCGCCGTGAGCATCTTCCGGACATGCCAGCGATCGTCGTACGCGTTACGGATTGAGCTCGACGGTTTCTGTTCCTGACTTCAGGTTCTTCATCTGCTCCTCGTCCAAATGCTTGGTACTCTACCTGACATCGTATTTCGTTCTACTGATACTAGCTGGGTGGCATGAGGCACGACTTCTTTACAGCATCCCCGGCTCCGTGTAGTTGAAGGGTTTCGGTTCGCTTCGTCCCATTGACATTGGACTTTATTTTAACTGCGTTTCTACGTTGGCAATCTATTTGCGGATTCGCATTAACTTGCTTAACGTCGTCTAATGTTACCGTTAGCCTTTCCTGCCGTGATGCACCGGATTTCTTCCGTTCTACACGAGGCGCGATCATCGATTCCGTAAAGGGTCTCTTCATTCGAAGCATTTGCTTCCTGTTACGCTTCGCCATCGCACTAGGACGCGCTCCCCCAGGACCCTGCACTTCCCTCAGAATGCGCGATTAGTCGCTAGCTGCCTCCAACTATTCCATGACTCCGACCGCTGACTGGATCTGTTCGGGTCGCGGTGCCTCCGCAGGGCGTACTGAATCGATTTTCTACGCTCCATTCCCATCCGTTTCAGCGCCTGTCGGTTCCTCGCTGTATAAGCGTACCGTCTCGTTTTCTTATCGAATGTCCACGTCACCCGGCCCGTGAATTAATACCCTGCGCTCTAAATGCGATCCTGACCCTGTTTGCGACCCATTCGAGTTTTGCGTTGGTATTTTGATGCAGACTGCGATCCCCAAGTTTAAATTATTTGCGGAGTGGCATCGAATTGCGTCACATGCGAGGGGATATTCCTTTCTAGTCTGGCCGTCAGGCCAACTCTGTCCGGGGTCCTCCGTCGCTCATTCACTCGTTTAGACACTCTGCAATCCGTGATCATTCACGACGAGATGGTTACAATTATTCTCAGGCAGTAGGGATTCCGTAATGGTCCGTGAACGCGCCCCTATCTGGGGTTGCCAATTTTATTTGATCCGACCCTAACCGTCAAAGCGGGACGCATTCACGTCCAAGTACCTTTCTTTAGCACCCGTACTCGAGTTGGCATTCCCACCCCAATCTATCGAGGCGTAGATCACGCCGTATTGGGTTGGGACGCTCCGAGAACTTCACGGACTGTCCTATCTAGACCCCAACTTTAATCCTGTTCCCGCTCGTATCCCTGAAATGGTACTGCATTTGTTACCTTACGGATTCTCCATTTGCTCTCGATTGCTCGCAGAGCGGATATGCGGTACGTCCTGCACGCATGAGCGCTTCCCTGCAACGCTGTCTCTAGAAACCGTCCGCTCCGAACGGGACAGTTCTCGCATTTGAATCGTTAACCCTGACCCCTGGTTGGCTTGCTCCAACATGATCTCATAGCCAACTATACGCGATATTCCGCGCATTAATCGTGTAAATCTAAAGCCAAGACCCGTCTAGACCGGGACGTACGAGACATAAACCTTGACGGTTAATCGTGCACTTAGATCGTACGTAGCCGCACTTCCCACTCGTCCGGCCAATGCGACCTGCGACTTCGACCTGTAGCACCGTGCCCGGATCGCCGACTTCCTGTTTGGTCTAAACCCGTCGTGCACTGAGCGGCGAATCGTGTAGCCGCGGTAGTTTGGTTGATGGAGTCCTGTACGTGCGTGAGACCGTTTAGTATGTGGTAAGAGAATGCTCGCATTTCTAAATTAATTTCTACTTTAACGCCAAAGCCACGCTCCGAACCGGGACGGTGATCCTCGATAGGTTAGGTTGGGTTGGCCGACCTAGACCCGTTTCATGGATAAACTGGCATCGGTCTAATGGCGAGTCGTCAACTTTTAATTTCACGTTCGTCTCGGCCAATATGCGGTAGCGCGTCCCCGCACTCTTAACCTTCGACCCGATAATGTCCACATTGCCGTCGGCCCAACCGTGCTTAAACTTGCTTCCAACTGTTAGGGATGATTTCGCAGCACGAAGCCAAAGTACTGCTCCGTCCCGACATGGCGCTCGGGTGCTATTTGCCACGTCCTACGGCTTGCTCGTTCGTAAAGTCCCAATGACAGTTGACTTTTGCGAATGTCAACGCCAGCCTGTTCCCATTGGTTCTTGAAGCAATTAGCCGCTGACGGAATTGTGTTTTACTAATAA *
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
26 22 0 utg000001l 24223 60 215S10M2I22M1I6M2D2M1D2M1I3M2I5M6I8M1I12M1I3M1D5M1I14M1I1M4I10M1I14M1I6M1I13M1I16M3I2M1I7M10I54M1D22M1I4M3I20M1I40M1I6M1I7M1I13M1I24M3I12M1I8M1I6M5I18M4D10M4I1M1I8M1I24M2I4M1D6M2D1M1D9M1D4M1I1M1I2M6I4M3I2M2D3M3D1M1I3M4D7M2I16M2I7M1D10M1D30M1I3M1I3M2I9M1D3M1D11M2I2M1I4M1D7M1I2M1I10M2I3M2I1M1D4M1I10M3I23M2D13M2I23M1I8M1I4M2I21M1D33M1I28M1I8M4I15M1D27M1I9M1I14M6I17M2I1M1I26M1D15M4D15M2I32M2I44M1I1M2D5M4I1M1I15M1I7M2I3M1I11M1D4M1D1M1D7M1I4M2I4M5I11M1I4M3I3M2D2M1I15M1I2M1I21M3I9M2I12M1D3M1I2M2I27M1D8M8I8M1I18M5I3M1I4M1D3M1D6M1I6M3D1M1D8M1I2M2I10M3D11M3I2M1D8M2I5M1I7M1D12M2I2M1I8M1I3M1I7M1D16M1I13M1I40M1D10M1D8M1I9M3I5M4I3M1D11M1I3M2D28M3D3M1I5M1D4M3I1M1I2M1I7M10I3M1I7M1D8M1D4M2D5M2I5M1I1M2I6M1D6M1I2M1I20M2I12M1I9M1I7M5I16M2I1M1D4M1D17M4I9M2D4M1I7M1I6M1I10M3D2M1I22M3D3M1D7M1D13M1D10M1I12M2I6M1D1M3I2M1D3M2I7M1D1M2I4M1I16M1I5M2D60M2I5M1D5M1I2M2I10M1D13M1D10M1I2M1D1M2D12M3I20M1D10M1D11M2D4M1I18M1I19M2D4M2D2M1I7M2D6M1I1M2I16M2D9M2I18M1I3M1I5M2I4M3I13M5I8M2I3M1I2M1I7M1D2M1I14M3I13M4I3M2I14M1I2M3D6M4I1M1D20M3D2M2D5M3I8M4I1M1I8M2I20M2D2M3I2M3I4M1I3M3I19M1I21M1D25M3I15M1I11M1I27M3D7M1D7M3D6M2I11M4I17M4I6M2I5M4I7M5I1M2I5M1I41M2I23M2I4M1I7M1I1M2D7M4I9M1I1M3I13M1D1M2I7M1D3M1D6M1D7M1I34M1I7M1I15M1I23M3D6M6I3M2I6M1D9M1I2M1I5M2I12M1D11M1I5M1I6M1I21M1I1M2D12M2D18M1D3M1D15M7D4M1I5M1I3M1D30M5I2M1D25M1I1M1I5M1I21M3I8M2D8M1D6M1I5M2I6M1I7M2D14M1D16M1I19M1D1M1D3M1D7M1I8M1I5M2D3M1D5M1I2M1D1M1D6M1D4M3I5M1D1M1D9M5D7M1D20M1I12M1D9M1D19M2I11M1I2M1I3M4I3M1I6M2I37M1I5M4I3M1I6M5I1M1D8M3D7M1D14M2D1M1D10M1I23M1I4M2D8M1D17M1I7M3D11M1D4M3I1M2D33M1D17M2D16M1D11M5I7M1D11M2D3M3D4M2I19M1D8M1I12M3D11M1D10M3I12M3D31M3D21M2I12M4D11M2I6M1I44M5I15M1I2M2D8M1D10M1I6M1D2M2I8M3I13M1I8M2D7M1I15M1D3M1I5M2I7M3I17M1D14M1D10M1D15M2D11M3D8M4I44M2I10M1D12M2D26M2I3M2D12M2I18M2D1M1D14M3I1M1D3M1I4M1D6M1I4M2D9M1I1M1I5M1I13M3I20M1I12M2I10M3I6M3I13M3D19M2I27M3D2M1I4M1I20M1D21M1I14M1I12M1D5M1I12M1I3M1D13M3I35M1I6M1D6M1D21M3I1M1I18M6I2M2I9M2I19M1D7M1I15M1I12M2D2M1I7M1D4M1I3M1I7M2D2M1D4M1I5M1I10M2D3M2I15M2I14M2D5M2D4M1I3M1I7M1I4M2D5M2D3M2I4M1I13M3D14M3I1M1I2M1I10M1D25M1I12M1D7M1I23M2I9M1I11M2D10M3I2M1I12M1D5M1I18M2D8M1I8M1I5M1I16M3D4M4I11M1I2M2I10M1I6M2D4M1I11M1D17M1I10M1I11M1I7M1D4M3I1M2I9M2I2M2D10M1I29M1D7M2D1M1D7M3I5M1I10M2I5M3I3M1D4M2D2M1D4M2D1M1D12M2D5M1I5M4I2M1D12M1I3M3D10M1D1M1D12M1D15M1D6M1D11M4D16M1I24M6D1M2D4M2I10M4I2M2D14M3D2M6I4M4D8M1I14M1D15M1D7M4I8M1I8M2D13M1I1M1I2M1D9M1I8M1D21M1D11M1I27M1I32M1I7M2D3M2D8M5I2M1I6M1I15M1I6M1D5M1D3M3I17M1I8M2I30M3D11M3I14M1D5M4I7M1D11M4I11M2D5M3I55M1D11M1D46M2I6M1D1M1D7M1I5M1I9M2D1M1D37M1I21M2I6M2D14M3D4M3D5M1I24M1I21M2D8M1D4M1D4M4I5M2D4M3I9M3D12M1D1M3I18M2I3M1I49M1I14M1I5M1D15M1I7M1D12M1I38M1I2M2I11M1I11M1D5M1I2M1I2M1I5M2D4M1I11M1D2M1D9M3D28M4I16M1I4M1I20M1D6M1I12M1D1M1D16M1D8M3I9M1I11M3I8M1I10M3I8M1I3M1I6M2I3M1I10M3I5M1I7M7I7M1I11M1I5M3D7M1I2M1D14M1D3M1I13M1I1M1I2M2I10M1I3M2D8M1D1M2I4M1D35M2D15M3I6M1I9M1I20M1I5M1I19M1I20M1D6M3I1M1I11M2D4M1D2M1D4M1D11M1D2M1I19M1D12M3D1M1D6M2D5M2I6M4D4M2D1M2D8M1I10M1I28M1D2M1D38M1I1M1I2M1I6M2D6M1I5M1I4M1I2M2I7M4I29M1I4M1D6M1D29M2I8M1I7M3D4M1D2M1I4M1D2M2I25M1I15M4I2M2I7M1D6M1D12M2I2M1D3M1I7M1D3M5I1M1D2M1I10M1D29M1I6M1I7M1I6M1I11M2D4M1D12M1D4M1D8M2D5M1D11M1I2M1D4M6I5M2D2M3D2M2D8M1I10M1I1M1I5M1I2M1I5M1D7M2I6M1I6M2I8M1I14M1I5M1I1M3D1M1D2M1D6M1D17M3D2M4D7M2D4M1D3M2D4M3I3M1I5M3I4M2I8M1D5M4I11M1I4M4I8M1D5M4I19M4D7M2D2M1I14M1I3M4D8M2I5M2D3M2D21M1D7M1D12M1D3M2D28M1D3M1I2M1I5M1I28M2D9M2I4M1D3M1D6M2I31M1D9M1I10M1I4M1D3M3D6M1D5M1D5M1I8M2D8M1D4M1I4M1I14M1I3M1D2M2D9M2D1M1D11M2I5M2I9M1D1M2I4M1I1M1I9M2I1M4D3M1D18M1I1M2D13M1D18M1I6M3D5M3I58M1I3M2I6M1D5M3I20M1I3M2I5M1D4M3I4M4D23M1D13M2D2M1D9M1D5M4I1M1I18M3D24M1I5M6I10M2D4M1D9M2D3M1D6M6I2M4I11M5D2M1D10M2D5M1I32M2I5M1D3M1I9M1I17M1D17M3I3M2D19M2I2M1I31M1D20M1I2M1D6M1D18M1D1M2I13M2D11M1I4M1I20M1D12M1I19M2I1M3I2M2I9M2I3M1D3M1I5M4I14M1D2M1D7M1I8M1D12M1I8M1I13M1D9M1I7M1D15M1D7M3I5M2D8M1I2M1I4M1I11M1I5M1I18M1D10M4I6M1D3M1I9M1I16M2D5M1D4M3I6M7I4M1I2M1I15M1I6M1I3M1I9M1I3M1I2M4I16M1D8M1I17M1D2M3I3M2D12M2D2M1I18M1I10M1I48M2D2M1D6M1I30M12S * 0 0 GCCTTAATCTCATCGCACTTGATTCCCAACTGCTGCACTTGATACAAGGATTTTGACTCTGAATTATTTCGGACTTGAATTTGGATCAATTCCTCCTAAACGCAAGAACCTAATAACAGTTTTATTGTGTATCCTTCAAAAACAAACCATAATAGGATGGACCTTCGTAGACAATCAATTCACTTGAAAAATCGAAAAACTGATTCGTACAGTTCAATGGCTTGGGCTAAAATTCTCGCAATACGATAGAAAAACAAGGCGATTTGTAGAATCGTATAGCGAGGCAAACAGGCTACTCTTATTTCATCTTACATTGAAGAAATGACATTATCATTGAGTTTAGTCAAATGAAAGTATGTTAAACATTGGTAAAAGTTAGTCAGACTTGCACAAAAGAAATTACCTGTCATATTTAACTGAATCATCTATTATTAAATCAGAAAGACGATGGGTCGCTAATACGCTAAAAGATTACGAATTATTACATGCCTTTAGCTACTAATCTATGGCAGAAGGGAGTAACTGCTGTAACTCTTGGCATACAAATAAACAATCCAATGGGTGACGGATGGCATTTCGCCAACATCATTTCGACTCTTTATTTGATGAAGCCAGGAGGAATAATGTACTTTAAATTAAAAGATTACTCCATAAGCAAATTGTCATTTAGCATGATACAATATGACAATAAGAATAATTCCTGAAGATATTAAAGAGCGTCTAAACTGGTAAGCCTAAAATATCACTTCGGACAGAAGAGTTAGTTGACTATACAGCCAAGCTTGCAGAAACGACTTTTTAAAGGACGGTTATCACATTCAAACATTAATTTATGATAACAATTCCATCCAATTGATTTAATCAATACAACATTTGAAGATCAAGCAGATAAACTACTTTTTGGCGTTATGCAGCTGACAGAGCCAAAATAACAAATGCCTATGGCTTCATTTTCGATCAGAGCTGGCTGACAGAAAGCAAGCATCTACTCAATAAACCAATACATACAATGCCAATTATAGATGAAAGACTTCAGGTAATTGGAATTGATTCAAATAATAATCAAAATGTATTTCATGGAAAATAGTTAGAGAAAACGAAGAGACAAACCGACTTTAGAAATATCAACAGCAGACTCAAACATGACGAAAAACCATATTTCATGCGTTCAGTCTTAAAAGGCCGCAATTGGCGGTGATGTAAACACATGAACAATTGAGTCATAGAACTTCCATTATTCTCCTGAAGATAATAATCGCCAAATAAACCAATACTCAGCTTTACAATATATCAACTAACCGCAGGACCGTTATTTCATACAACGTTTCTGCGGCATCAAGAAAGGCCCGATTACTCCATAACAGCGGACATCCAAGGCCACTCAATATCAGGTGCAGTTTACTGTATCAACACGACGGTTCAGCAACACCCGATACTTCTTCCAGGCTTCCAGCAACGGAGGTTTCTTCCTTCGTTGCAATTTCCCAATCTGCATCACATCCTGAAGCCGGCACCATATGCTCACTGGCTACCTGCATCAGGCTTTTGTTTCCTTCTTCCCCCTCCCGGATTAGAACAGTTTTTCTGCTTCCGTATCCTTCACCCAGGCTGTGCCGTTCCACTTCTGATATTCCCTCCCGGCGATAACCAGGTAAAATTTTCCCTGTAACGGACCGAGTTCAGAAAATAAATACGGACGCGTGCCCGCGAAGCCAATCACGACGGTTTTTACCCCGATGGTCTTCAACGAGATGCCACGATGCCTCATCACTGTTGAAACAGCCACAAAGCCAGCCGAATATCTGGCGGTGCAATATCGGTACTGTTGCAGGCAGACCGGTATGAGGCGAATATGCGTCATTCACCAATAAATTCATTAGTTTAAGCCAGCAGATTATAAATTTTATGGCTTTAGGTGGTTGTTCACTCATTCTGAATGCCATTATGCAAGCCTCACAATAGTTAAATGCAATGTTTGACGGTTTTATTCCGCGTTACCTCACGGGGTTAAACGGTGATGGTGTGTCCGTGTGAACCATCAACTGAAGAATCGGCATGAGCACAAGCGATAACAAATGGATGCTCGTATCCCACGTAATACCAACTGCTGCGCATGTGCAGCGGCACTCAACGGCTGTACCGGACAATGAGTGACTGTGGCTGCCCTGACTGTCCGTTTTCGATATTTAATCAATGAAGTACCTTTGTGCTGGTTCCTTTAACTGTGGATAACTTCCTGTAATGGTTGCTGTTCCATACTGACTCCAGCCAGAACTGTTCATCCTTAACTTAAGCCTGTGTAATCGAACGCCCCGCGGCCCCTGTTGAACCGCTCAGACTGTGAGCACTGAGCCCCCGTGTTGTTATTCGTCGATTTGGTGCGTAATCGAAACTGCCTGTTGTTCGTTATCCGTAATCAAACGACGATGGTTTTCGTCCCCAAATCGATCCATTGCACTGGCACTGTGGGTGTGCGACTTAATTCCATCCTGTTCCTGAGACAATACAGCACGACGCCGCTGGCGGGTTTCCCCTTGATTGTCCAGCCTCACGCATATCGAAGGAAGACCCACCCATCGAATACGCGACAGCAAGAAGTTTTGGGTGAGCGGGACGATTTGTTAAAAGCCCTGCCCCTGCATCAGGACGTAGCCAGACGGAACGATATGATGGCCACGGGATTCTCAACGCGCACCTGCCGGAAAGGCCGAATTCTCACCGGCCCAAGGTTTCAAGAAAGACATCTGCAACGGAATTTTGCCACGAATATCCCTGCCAACCGGCGTACTTCAGTCAGGCTGGCGGCGGAATCGATGTCCTCCGCAAAATACGGTAATTTATTTTCGCCGTGCGCAAACCCTGCCAGCGTCGGAGTGTCGCATTCTTCGGTTGTTGACGCCGCAAGCGCGTTAGTCATGGTGTAGCAAATCTGGATTACCCATTCCCGAGCTAGCTGCGGCCCATTTCATTCAGTGGTTCCAGTGCGTCAGGTGACGCGTCGATAACATCTGCAATCGCGCTCAGTCAAAAGCGGTGTTCGCAATCTGGGTATTTTGTTCCCTGAGCGCGGTTGGTGCTGTTGGCGGCGTTCCATTCAATCGACTGTCCAGTGGGCTTTTCTGTTCGTTTCATCCATTACCACTTAACCGCCTTTGGCGTTGCAGCAAGCGTTTCAGACGTGCTGTTGGTTGCACTGCTGAGCTGCACTATCCCTTTCTCGTGTGTCCCATCCTCAAGCGCGACACTATGAAGCTAGTAGTCGTGCACGTTTTGCCGAATTTTGCACGTATATTGCCGCTTCTGCCGCACTTTTGCTCTGCGATGCTGATACCGCACTTCCCCGCAAGCCTGGCTTTGCCTTCGTGGATGCCGTTGACGCACTCCCGCCGCTGTTTTGCGTCTGCCGCGGCAGAGGCGTAGGGTTCCGCTGCTGTTTCAGATGACCTGGCGGCATTCGTCGGGACGTTTTGCTCGCTGGCGCAGAATTTTCTGCTAGTCCCCGCCGAAGCTGCACGACCGGCACTTGATGATGCGTTCGTTTCTATCATTTGCTGCCTCTTTGAGGCAGGGGACTCGTGCTGGATGAATGGCGTGGGTGACGCTTTCGTGGGATGTGGAGGCAGACGTGGCGGCTGATTGTTGTGACGCTGCAGCATTCGTTTCTGACGTTTTCACACGGCGGCACTGGCCGCCGCGTTTGCTGAGGACTCTGCGCGGCTGCGGCACTTTTCGGTTTCAGTGGCCTTTGCTGATGCCCATTCGTGCCTACGGAGGACGCTTCCTGAGCTGACGATGCAGCCTGTCCCTGAAGGCGTGCCTGGCGGCGCGTGCTGAGTCAGTCTCCAAGTCACAAAGCCGCGACCTGAGCAGCCTGATGCACTGTAATCGCCGGCGGGTTTTCTTCGCGTTTGCCGTACTCTGTGCCACCACGACGCGTTACGCGCCACCTTCCACCATCAGTTCGGACGACGCCGAATGACCCCTCCATCGGGCATCATCCTCGTTACGTGGCACAGAGAAAATCATTCAGCGTCCCCGGTTGTGAATCTTCATACACGTGATGGTCCCGGCGTGCGATGGTGGAAAACCGTCAACCTGCAGGATCGTATTGTAACCGTACTCCACATCCATGCTTGGTAACGCCCGGCTTCATCCGCATTCTCTGAGCCCACCGTGTTCACCACCACCGTGGTGCTGTTACGTCTGGCTTTCATAGTAGCTGAATGGTGCAGTTCTGTACCGGTTTTCCTGTGCCGTCTTTCAGAGGACTCCTAATGAAATCTTTACTGCCATATTCACCCCACAAAAGCCCACGGTTCCGGCGGGCTGGTTCAACACTGTGTGTTACCTGGCTAATCGAATTTATAAATGACCCAACGATGAATCCGTCAGTACGCGTCGCCACTGCCGGAGCCTTCAGTCATAAGCAATATCAACAACGACGGACGCTGCCGGATTAATCTGTATACCTGCACTCCACGCCACTCATATGCCGCATTGCACTTTCGTCCCTGGCAGTGGTCGTCTCTTCATATACCGGGGAGTGATTTCCGTACGGTAATCCATGCATTACATGCCAAATACGCGACTGTGAGCCACTCCGGCCGCTGGCGTACGCACTAATGACCTGCTTACTGATTTGTAAAAACCGGTCGGCCATCACGCTCAAGGACGTCCCGGACGCAGCCTGTGAAACGTATCCTCCCCGGTTCATATCACTGTGCTGCTCTTTTCGACGCGGATCCCAGTGGAAGCCATCGGCCCCCACGGTCCGTCAGCTCATAACGGTACTTCACGTTAATCCCTTTCAGATGACTCCACCGCGTATCCCGCCAGCGACACGACGCAATGTATAGGATGTTTCACTTGAAAATAGCCACCGTAAACGTACTCATGTCCCTTTCCACGGGCTCGAGTGACTGTCTGTCACCGCAAGTGCGGCAAAGACCCTAAAAGAAGCCGGCAATACACACATTACGCATCGTTCACTCACTGTTTTATAATAAACGCCGCGTTCCCGGACGACTCTGTAACACACGCAAGCCCTGATGCCCAGCGCCTGTTTCTTAATCAGAGTAACCTGCACATCGCTGGCAAACGTATACGGCGGAATATGCCGGAACTGCGTTGTGACGTAAGCGTGAACGTCAGGATCACGTTTCCCCGAACCCGCTGGCAGTTGTCAACAATACGGGGAACACCTGTACCGCCTCGTTTCACGCGCCATCATAAATCACGCACCCGTTCATCAGTACTTTCAGATAACACATCGAATACGTTGTCCTGCCTGACAGTACGGTGCTGATTCCTCCTCGAACGTCAGCGGAGAAGCATAAGTATGGCGATCAAAAGCATGTATTATACGGTCACGGTGACAGTGACTCCAGACCTGACGGCCGGTCCACACTGCTTTGGACGCTGGCCTAGAAAAGCCGCCTCGCCGCCTTTACAATGTCCCCGACGATTTTTCCGCCCTCAGAGCGTACCGTTTATCGTACAGTTTTCATAGGTATCGTCTACATTACTGAGCGTTGAGGGGTCGCATTCACACTGCACTGATATCTACCGCATTTTAGCGGTCATTTCCGTCCTGTTAAGGAAAACAGGCCGGAGGATTGCTGCACGCTGGTAATGGTGGGGCCGTTACGGCGCTTCAGGAAACACGTCGTTCATGAATATGGTGGCTCCGCGCCAAACATCGGCGTTTCATTCCCGTTTGCCGGGTCAATAAATGCGATACGATTGGCGGCAACCAGAAACTGGGCTCAGTTGCCTTCCTCCGTGTCCTCCATGCTGGCGCCATCACGGCGACATAATGTTGCCGTCTTTGGTCTGCTCAAGGCTTTTGACAGCCCACATTGGCATTCACTTATCGATCTGCATCCTTCTCACTCTTTCGAAAACTCCTCCAGTCTGCTGGCGTTATCCTCCGTCAGCTCGACTTTTCCAGCAGCTCCTTGCCGAGATGGGATTCGGTTATCTTGCCTTTGAAAAATCCAGGACTTCCGCCGAGGATCCATCGCATCGCCCGACCGACGGCCTCCACGAATGCCGATTTGCCAACGGTGTTCACACTGCGGATAACGACAGTAATAATCATGGCCCGGTTTGATATTACTGGCGGCTATCCAGTACAGCGCCGTACCAATAAGGGTAACGCGTGCCCTGGTTTCATTCAACCTGTCTGATATCCGCAATCTGCTTTTCCGAGACCAGAACTCAAACTCGTACCGTCGGGTCATAAACGCAGATGCGGCGTGGCGGTTATCTGAAATAGCCAACCGTCAGCTCAATCCTCGACGGTGCTCTGCCGGTGCGGCAGATCTGCGGAACGATACCGACGCCGCACTGCCCTGCTGCCCCACGCATTTACCGCCCGGACTGTCAGCCTGTAGTTCCCCAGCGCCAGTTGCGTGAATGCGGTATCGTATTCCGTCGGGCTGCCGTGCTGACTCAGCCGCTCACTGCCGTCGTCTTAGATAGGTCAACGGTTTAAGCTGAACTGGAAACGCCCTTCACCTTCGGTGTGTCTCCATGGCGCCAGCACCTGATATTCCCCGCTGTCTGCAGTGACTTCTGCGGTCAGGTGCTGCACCGCCGCGGGCGGCGTGACACCATTCAAGCGTCCACTCTGTTCGCCGTTCAAAGTGCGCCCCGTTATCCACGATGGCCTCTTTTCCGGCACATGCTGCACGGCGGTGATGATGGCATACGTGCCGTCGTCGTTCGACGGTACTCACGCAGCGAACAGTCGCTGGCGCAGCGTCGGCAGCTTCAGCTCCCATACGCTGTATTCAGCATAACACCGTCAGGAACACGGACTCATTTTACCTTCACGCCGTCGGTGACGGACTGAACCTCCACGTAACGGATTGCCACTTCCGTCAACCGAGAGGCTTATCGGGGGCGGTACCGGAGGATGGCAGCGTGATTTCACCCCGCTGAACGGTCGAGCGTCATAGGCGTCGGGTCTCTAATGTTCACCGCCAGCAGCACACGAACCACCGGTGCTGATACCGGCATAGTCATCGAACACAGATTTCAATAACAACATCGCCCGGTACATGGCACTCGCTTTACTGCTCAACGCCGCTGGCTGAAATCCACGGTCTGCGTTTCCAGCAGTTCTGTTTAATCAGCCACAGCCCGCTCCCGCGGTGTGCGCCTGCCCCCGGCTGGTACAGCCAAAGGGCATCCATCTTCGTAACATTACGACCGTAACGGGCAATGGCCTGCGTATGGTCAACAGCTCTGTCGCCGTCTCCCAGCCGTTGTTCGGGTCACGTGGAGTTCACCTCAACGCATTATGGCGTTTTTCAGGGCGCTGAAGCGTTAGCGGAACGGCGCGCCATCGTATAGCGGCATCACCACATTACTGCGGTTATAGTCACGTCTTATCCGACGGTCGGTCCTGCACGAACGTCAGTCAGTGCCGCCCGTTCCATACGATGGCATACAGCGCATCGCCGAGCACGAAATCGCTGAGCACATCCACGCCTTAACTCGTGGTCCGTACGCATTACAGGTGATGCGCGCTGATCCAGTCCGCCAAAGCGTCCGGCACGTAACGGTCTCACAGTACTGGCCGATGACATACAGCGCCCATTTATCTTACCACATCCAGCGCACTAAGACGTTTCCCCATTCAGCGGGCTGGATGGGTCAGTGGCATATCCCACAGACACAGGCCATGTTGTTGCTGTATGCCGGTTTAAACGTTCCGTCCCAGATACCGCCTGTATGTCCCCGTCTGCGGGTTAGCGTTGAAGCACCTGCAGAAACGCCCGCTCACGAGATACTGACTATTACAGCTTGCTGGCTGCCGAACTGCTGCTCCAGTCCACCTGCGACGCCGACCAGTGCCGGTGTTCGGGTAGCACTGTTTCACATCGATGATTTCAGTGTATGACGACCATCGTTTTGTTCTGCATAAGCTGGTCCGTGGTGCTTCAGGCGTCATCCTTAGGATGGTTTGAAACTCTGCTTAGGGGGCGGCAGGTTACCAGAGGATACACCACCGAGGCCAGATACTGCGAGGTGGTTTGCCCTTAATGGTGATGTCTTTCCTATACCCAGCCACGTTACGTAGTTTGTATCTGAACCAGCAGGCGGACTTCCGACGGATTCCTGTCACTTTGAGGTGGTTTCCACCAGTGCCTGTACAGCGAAAGGTAAAGGGGACGGTCGATGTTTGCACTTCGTAATGGTGCGGAGGTAATCGCGTGTCATATTTCACTTCCGTACCCAGCACCGTCTCCATCGGAGGATCCCAAATCCCTCCGGCCAGTGCTCCGCTCACAGCCAGGGAACACACCGTGACACATGGTTTATGGTATTCCCCTGAGTGTCCAGCACCGGCGTACTGTTCAGCAGCACGCTGTTTAAGCCATCAAGCATCTCTTCAATCGTAGTCGCTGATGGCATCGATCACACTCAGCAACTGCGTGGACTTCAGGTTGTCCTTCGCTTCGCGCGGGGTATGCCGGTACTGCTTCCTTTACCCATTCCTCACGCTCCATAAATGACAAAACCGCAGCAGGCGGTTTCCACATAAACATTTTGCATCAGCGACCAATCACCACGTAACATACCGTTTGGTCTCGTCTGCCGTGCTGATCTCCTGGAAACCGCGTGATACGCGCGCATTTCGAATTGCCAAGAACAGGCAGAACATTGCTGGGCAACCATGTTATCCAGTGAGGAGAACAGGGCGTAGTTCTTAGTTACCGTTATCCAGTTTATACGGAATTCGTCATGGGCTTTCGGTGCGCCAGCATCTGCCACACCACCGAGCACCATACTGGCACCGAGAGAAAGCCAGGATGCCGGTCATACCACCGGCCCCAATCGCTGCCCCCATGCTGCAAGCGCTGAGCCGGCGGTAAAGAATGATCCGGCAATGGCGGCAGCCCCAGGACAATCTGAATACGCCACCTGACTTAGCCCCGGCGACTCTGGGAACAATATGAATTACAGCGCCTGCCAGGCAGAGTCTCATGTGACTGCGCCGTTATGATCGAGACGTGCCTGACGTCCCGCCGCGGCAATCCGTACCTGATACCAGCCGTCGCTCAGTTTCGAAACTAAACGAGCCTGTGATGCGCCAGTGCCCGCACTGGCTTCAGCCCCCGTTTCACACGAAGGTCGGTTCCGGCGACCAAATCGTTGTAATCCCCGTCAAAGGCACTGCGCGCCATGCCCGTGACTCCAGAGGGAGTGTGCGTCGCTGCCATTTGTCGGCTTATCCTCTCCGTTTGCTCAGTTGTTCAGGAAACTGGTGCCGGCAGCATCGCCCGTCGCCGCAGTAATTGCGGCGTACCGTGCGGCACTGATGAACCAAAACGAGGCACATGAAGCACATGCCCGGCCTGTGCTCGTCGACAACGATACATCACCTGGATACGCGTCGCCTCCAGATTATCCAGATAGAGATTCTGTCCGTTACGCTAAGTCATCCTCACATCGAAAGTCCGGCATCTCAATTCCCGCCCATCTACACGCATCCCGGAACAGTGTGTAACAGTCCGTCACACCGTGCTCGACGCACGCCGGTGAGATGCGGCACAGCGAACTTATGAATCGTCCCCCACGTT * tp:A:P cm:i:160 s1:i:1526 s2:i:0 NM:i:2342 ms:i:5422 AS:i:5422 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
27 23 16 utg000001l 33462 60 265S2039M1D8M1D1M2D1M1D7M1I4M2D7M1I7M3D10M1D14M5I9M1I17M1I4M1D4M1D1M1D2M1D10M1D4M2I5M2I3M1I10M2I16M1I2M1I4M1D5M2D2M2D12M1D6M1D10M1I16M1D4M3I20M1I5M4D6M4I6M1I11M1D2M1D6M2I5M2D4M1D2M1D6M4D5M4I6M1D5M1D8M1D6M3I18M1I16M1I17M2I11M1I5M1I10M1D3M1D9M1D2M2D7M1D4M1D15M1I10M2I12M2I58M1I2M1I5M1I4M1I9M1I3M1I13M2I3M1I41M1I7M1D11M1I8M1D3M1D11M1D6M1D12M2D20M1D16M2D35M1I5M3I11M2I6M1I9M3D9M2I31M3D7M2D5M2I1M2I4M1D7M1I6M2I5M1I13M1I15M1I6M1D21M1D10M1D6M1D2M3D3M1D18M1I2M2I2M2D15M2I31M3D11M1D9M1I3M1D2M1I16M1I10M1I28M3D4M1D4M1D11M1D14M4D8M2I40M1D15M5D9M1D9M1I9M2D3M2D6M2I4M1I12M1D10M1I11M1I1M1I20M2D16M1D6M1I17M2I3M1I28M1D4M1I26M1D2M1D6M1D1M2D1M2D10M3I1M1I2M3I4M1D2M2D8M1D3M1I38M2I7M4I9M1I1M1I12M3D5M1D10M4D30M2I18M3D3M1I11M2D7M1I5M1I9M5D11M1D1M2D22M4D53M3I2M4D5M2I3M2D9M1D7M1I1M2I7M1I3M5D1M1D28M3D2M1D7M2I5M2D2M1D16M3I4M2I1M1D17M1D14M2I10M1D12M1I9M1D4M2D5M1I14M2D24M2D7M3D9M1D19M3D30M1I5M1I4M2I1M1D23M2I8M5I13M1D9M4D15M1D2M1I2M1I2M2I10M3D4M1I1M1I1M1I10M2D3M1I1M2D5M1D49M2I16M1I1M2D4M3I29M1I19M1D23M1I6M2I9M5I16M2D17M1D7M1D15M1I6M1I8M1D12M1D18M1D2M2D4M1D22M4D1M1D1M2D11M3I11M1D6M2D9M5I3M4I5M3D20M1I6M1I9M2I2M1I9M2D3M1D3M3D16M1D1M1D2M1D1M1D8M1I10M1D15M1D4M1I3M1I17M2I6M4I4M2I14M1I11M1I7M2D15M4I31M2D1M1D20M1I5M1D25M1D4M1D16M1I8M1D3M1I11M1I7M1I20M1D3M1D4M5I11M5D26M3I1M1I1M3I5M2D12M2D3M3D4M3D3M5D7M2I3M7D8M1D6M3I12M1D6M2I11M1I6M2I1M1D5M1I4M2D3M3I1M3I3M3I2M1D2M1D12M1I2M2D3M1D11M2D7M5I14M1I3M1I15M1D4M3D5M1D2M3D4M2I5M1I15M1I1M2I2M1I3M6I5M2I4M1D6M2D2M1D6M3D4M4I17M1D8M1D10M2D36M2D5M1I3M3D1M1I3M1D4M5D10M2D4M1D4M2I4M1I8M6I4M1I2M2I1M5I6M1D21M1I2M2I4M1D3M3D10M4D3M1I2M8D3M3D4M1I2M4D9M2D6M1D5M3D8M1D3M1D4M1I3M3D5M1D38M3I5M3D15M1I1M2I11M6D5M2D2M1I5M1D6M2D2M1D12M2D11M1D1M1D3M1D5M1I3M1I6M1D2M1D15M1D7M1I20M1I5M3D3M1D4M1D7M1D5M1I6M2D3M1D9M1I7M2D4M1D13M3D29M2I5M1I3M2D1M1D11M5I2M1D4M1D3M2D14M1D5M1D5M5D1M2D2M1D16M1D1M3D3M2I6M1D8M1I10M1I2M4I8M4D3M2D6M2D2M3I1M6I7M2I2M2D1M1D18M1D9M3I11M1D1M2D12M1D7M1I2M5I5M1D5M4D11M1I4M1D5M1D5M4I6M2D4M2D2M1I3M4I2M1D3M1D3M1D3M1D13M3D4M1D3M1D9M3I4M1D4M4D16M1D5M3D1M2D1M1D8M1I6M2I7M2D6M1D9M1I6M2I2M1D6M2D1M1I5M1D1M2D4M2D6M3D9M3D7M1D3M1I4M1D3M1D2M2I6M2D1M1I8M1D21M2D9M1I7M1D1M1D7M2D1M1D6M1D7M2I7M1D13M1D25M1I3M3I5M2I4M4D7M5D12M1I3M2I1M1I11M1D11M2I7M4D7M1D19M1D11M1D5M1I12M1D2M3D8M1I5M1I7M1I15M3D4M1D3M4I1M1I11M1I14M2I4M7I2M1D2M2I8M2I1M1I3M1D3M1D12M2I14M3D8M2D1M1D10M1D4M3D4M2I8M5I2M5I11M2I8M2D2M3D5M2D5M1D4M1D20M1D15M2I29M5I19M1I9M2I9M4I13M2I3M1D3M1I12M1I7M2D27M1I34M1I8M1I19M3D7M1I2M1I1M2D2M2I8M1D2M1D8M1D4M3I4M1D14M3D13M1D8M3D5M2I1M1I9M2I11M1D7M1D10M2I2M1I6M3I5M1D12M1D4M1D41M2I8M1D4M1D9M1D6M2D9M2I1M1I5M1D27M1D4M4D9M2I19M1I3M5I8M1D11M1D4M1D3M3I7M2D39M1I7M1D14M1I9M1D13M2I37M1I7M1I17M1I11M1I18M1I25M3D5M1D10M3D4M1I4M1D8M2I5M1D6M1I4M2D7M3D4M1I6M1I6M1D16M1D28M1D7M1D34M1I11M2D13M1I1M1I28M1I9M3D16M1D23M1I13M1D45M1D20M1D14M1D10M1I1M2D52M1I1M2I23M2I30M1D4M2I2M1I4M3I15M1I33M1I16M1D6M2D7M1I8M2I6M1D1M1D11M2I11M3I5M1D6M1D3M1D44M2I1M1D42M1D1M1D12M1I13M1D2M1I3M4I9M1D10M3I3M1I3M2I5M1I11M2I8M2I4M1I7M5I10M1D17M1D10M1D5M2I1M2I19M1D9M1I15M1D14M2I32M1I14M1D16M1D13M2D15M1I56M1D2M1D9M2I4M1I18M1I11M1I33M3D7M1D4M8D3M2I4M2I3M1I1M2I2M1I5M1I6M1D1M1D12M2D3M2D6M2I10M1I13M1I22M1D6M2I2M1D4M2I9M1D19M1D1M2D21M1D4M1I5M1I4M4I2M1D16M3I8M1D29M1D2M1I19M2I16M1D3M1D7M4I12M1D28M1I2M2D34M1D9M1D22M2D4M1I9M1D23M2D8M2D2M1D4M1D3M1D24M1I11M2D3M1I5M1I5M1I11M1I3M1I2M2D33M1I5M1D25M2D15M1D5M3I10M3D9M3D6M2D6M7D8M4I6M1I2M2D18M3I4M2I1M1I28M2D10M1I11M1D2M2D12M80S * 0 0 ATAAGCAGGTCAATCCGAGAAAACAGGACTTACAAACACTCTTCCTCCTCACGCTCCACTCCGACCGAACCCCCTGAATCCTTACGCCTTGACTGAATGATAGTTGATCTGCTGCACTCATAGTTGATCTTCTAACATACGCTAAATACGCCTAGCCGTACCGTATTCACCCCGGGGAACTTTCCCCTCTCGCTCATTGATCGCCCCGCAACCGACTCCGCTGGCACATCGCCGGGCGGTGCGCCAGAATCTAGTGATTTGGTGTCTGTGTCATGGGATTTTACGGTTCGAAAGTTTGTTAATGGGAAGGAAGCCGCCAAATCATGCGACGTTATGCTAGAACTTAAACTGAGCAGGCATTCTATGCAGATTTATCCTTCGTATTAGGACTATCGTTGAGCTGGTCAATTCATCCGACAGCCGGACCGCTATAACTCATGATCTTCTACAGTGCGATAGAGAGGCTTAAGGAGGGCATAAGTTACCCGGAAAAACTAGCCACACGGCTAGTTTCGTCGAGTCGGCACGATAAAGGAGCTGAACGCACTAATGCTAGTCGCTGCACTGTGATAGTGCACCCCTCAGGCTGATCACCCCTGCTCCGATCGTGAGCGTAACTTTGTTTCTACCACGTAACCCAAGTTCACCGATCAGAAAACGGGCGTTAAACCTTGACCCCCAACACCGTTTCTTGGTTCAGACATACAATCTTGCATATCTTTAGATACCCCGGTAGACAACAGTCCAATTATAGAAACCGTAGACCGTGCGCTTCACTGCTGCCTTTGCCATTCAGTCGACCATCAAACTTCCGCGGTTCTCATAATGGGTCTGTTCCCCCTGCCCCTGACCTCGGCTCACCTTTTTCGGTTCATGCTCATTACAGAAATAACGTTGCTCCACCGACCTGTCGTCATCGATTTCCCAGCACAGACTGACTCGAGGGCGCACGCGCTGGATTCATTCAGTGTTTCCTTGCCGGATATCCTGCATCAGTTCACCTGTTCAACTCTGCTGAATCCAACACGCAGCATACTGACCCTAGACGACCATTTGCTACGTATACCTTTATCTGTTAGCCACTCATAAGGCTGAGTCACAGAAAGAGTTTCCAGCCCCGTGCTCTTCCAGAAACGATCGTATACCGGTGGCCTCCCTCACGGCGACAGAAAGCGTCACGCTGTACGTTCCACTTACGGCATTCAGCCCGTGGCAGGCGCTCGCTGAGAATCTAAGTACCAAAGCACCTTCTTGTCAGAAGGGACCGAAGCATCATAGGTTCGTATTCATTCCCAGCGGAAGGTCTTCATTATAGTCACCGCGCGATGAACAGGCCATACCACAGATCTGTGTCTGAATTTCATCACGGGGATCATGCCGGGCCATGTCATACACCGCGTCGCTAAGAGCAGCCGGACTATCTGCCCGTTCGTGCGTCGTTGGTTAATACATGGTCTTGCTCAAACGTCCGGACGCCTTCGCGAGGTGACGGCTGTCTGCCATGCTGCCCGGTGTACCGACTAAAGCCGGGTGGCATAGCCTAGCATCAGCGGACATTCCCCACGCCAATCCGGGGCTGGTTGCCCCCTTCGTGAAGACAAACTCACCGGTGAACAATCCCCGCTGGCTCATATTTACGCCGGTTTATCGCGTAATCCTCCGGTTGCAAAACCTAGAATTTGGCCCTAGAAGCGGCCTGAATGGCTGTACTTCGCCTGACGGGATTATGCTAGCCAACAGCCCCAATGGCGCTGCCGATACTCCCGACAATCCCCACCATTGCCTGCTTAAGCAGAATTTCTGTCATCATGGACAGCACGAGAACGGGTGAAGCTGCGCCATTTCTTAGCACCACTGCCGGTTCAGCATCTCCCGCTTACTGCGATGGCGCACAGTATCAAATTGGGGCTGCATTTACCTGCACATACTGTCCGTGGCGCTCTCTTCCCACTCACTCCAGCCGACTTCAGCTCGTCATCCAGTTCCCGCGAAGCTGGTCTTCAGCCCAGGTCTTTTCTGCTGACATGACGTTATTCAGCTAGCGGATTATCTCATACTGTTCCTTCAGGCGCTGTCGTAATTGTGGCTTCCCGTTCGCTGCCGGTCAGTTCAGCCCCGGCCTTTTCCATCAATAGCGGCCCGTTTTATCGCCCGTCGCTGCTATGTGCGAATTTTATCTATGCTTAGCCAGCACGCGTTCAGGCGCTCCGTCAGTACTTGTCGCACCTGCAGCCAGCTGGCGTTTGTACTCCGGGCGTCTCATCTTTATGCCTCAGCAGGAATTTCTCCTGTGCAGACAGCTGAAGGTTGCGCTCGGCCTCGATCCCACCGCGAACTGACTCGCCTTCCTCAATCCCGGCGCTGCCATGGCTGATTTTCTCATTTGGTCCGGCATGCAGTCTCAGCTCGTTTGCCGGAATCGTCAGCAGGATGCAGGGAAGAGAACTATGTCTTCCTGACGATCTTCACCGCAGACATTCACGCTGGACTGTTCGGCTTTTCAGCGTCGCTTCATAATCCTTTTTCCTAGCCATCAGCGTGTCGTAATGGTGCAGGCATTTCCCCGTCTTTTCAGTGCCTTGTTCAGTTCTTCTGCTGACGGGCTATTTCTCAGCGGCGTCTGCAGCCGTTCGTAAGCCTTCTGCGCCTCTTCGGTATTTCAGCCGTGACGGTCTGTATAAGTCGTGCTGCTGCGCATTTGTGCCCTGTTGAGTCTTGCTGCATCAGCCTTCTTCGGCGGCTTCAAGCAAGACGGCCTTCACGATCATCCCATGTAACGCGCCCGCGCTTCATCGTTAACAAAATAATCATCCTTAGCAGATTCCAGATGTCGTCTGCTTCTTACTCACGCAGCCTCTTGCCTTAATTAAGTAACCCCCTGCCTAGGGTATCAGGACGACCAATATCAGCACCGCATCCCACATGGATTTGAATGCCCGTGCAGTCTATGTCTGCCAGGTCTCCAGCGTCCATGTCTCTTTCAGGCGGGGGTCTGTACTCAAACCCTTCGTTGCGCTCGTTCGCCGCCGGCAATGCCCCGGCTTCATCGCCGGAACGCTGCAACTGAGCAACATACGCAATCTGTAGCCAGACACGTTATGGAACTGGGGCTCATCGTTCAGCCGTCAAAGCTGGGTATGTGGTCAGCTTCCAGGAATTCAGCGGTTGTGACTATACCCCACGCCGGGTTGCAGAGGAGAAACGCGCTCAGGTACTGGCTGATGGACGCGGATCTGGCCTCACCGCTTACCCCCGCCTAACCAGTGCCTGAGTACATGGTGTGCTTGGTTAAACGTCAGCCTGCCGCCTGCCCGGCTGCTGGACAGAGACAGCATACGATCTGCCGTCAGTCGCCTGATTGCCGGAAAGGACCAGGTCGTGTTGAAATCGGACATTGATGAGTTGCCCTGATACCAGGCATACGCCAGCAGGCAGTCGCCACCGCCAGCGAGGCCCTAAGATGAGCATGATTGCAAGGCTGCAAGCCCCCTGAACATGGGGATCATCCCGCCGAAGGAGTCTGTCGATGTGCGATGCAGGAGCCCAGCAAGCAATTTGCCCCTTGCAAGCTCTGCGTGTGGCCACGTCGTGAACTGTGCCAGGCAGCAGATCAGCATGGCGGCTTTATAATCGCAACGGAAATCCCCGCTTCTGTCGCAGCCAGCGCCTGTCGATGATAGAGCGACTGTTCAACGACTGCCGCTGTTTTTCTAATGACCTTCCGTACCAGAAAATGACCCGACTCTGATGCTCGTCCAGTGATATCAACTGGCTCGAATCAGACTCCAAATCAACGACCAGATCTCGACCCCGTTTCAGCCCCTCCCCGGGCTCTGACCTCCTGCGTACTTCCTCCTCGTACGTACCAGCATTACGTCCTCGGTGATGTCGCCACATCCGGGAAGCGGGGATAACTTCATTCCCGTTGCTCAAAGCGGACATCCGGCAGAACCCTTGCCGCCGCGCATTCAGCAACCTTCAGGCTCTTCCGTCAGCCTCGCGCCGGTTCAGCAGACTGAAATCCAGCGGATGCATATCCGGATCGCTGAAAGCTAATGAGCTAACGGTACGTCAGCGGAAAATGCTGTACGGAGGATAAACATCATGAAATAATGGGTACTGTAAAATCCAGTCGATCCATACGGGATGACATCCGGGCACGGAGCAGCTGCACGCCAGTCGGGTCGCCCATCTCACGCGCCAGTTTCAGGGCAAACTCAGTTAAGCCGTCGAACCTTTCTAAGAAACAGGCTGCGGGCCCGGCGTCCTCTGTCTGTTCAGGGATTATTCACAAACTCAGCATACCAGACAGCCGGTACACGTTTTCAGCATGAGAAATTGCCTCCGTAGGTCAGGGCTAGCAGCACTTCGTGCTCAATCTGTTTAGAAAGGAATGGAGGAATTCATGCACGGATATGCGTCGGGATGGTTATGCCAAGCGACATCGCCACCAGAAAGCCGAGATGTCTGATGGCGTTCGTACAGTAACTTCCGGTTGCTGTCTGACTCCGCCTGTTCTGCCTGCCGTTTCATCAGGGCGAGATGCTCAATGCGCTGCAGGGGGCTGACAGTTCAGAAAGCGTGACGGTCACCGTTATGTTCAAATGATTCGGTTTTCAGGAAAGCCGCTGACTCCCGGATCGGGACTGGCGGTGGAGTGACGGTAATTTCTGCGGGACCGCAGCACGCTACCATTACGGATACAACCGGAATTGTTGACCTCTTGCCGCTGCAGCAACGCGTTCACGGTGATGGTCAACCTGACGACGGTGGCTTTTGTTTATCCAAGGACGAAAGCTCTGTGTCCATTACGCCTCCCGGCTGGAAGGCCACGGTCGGGTCATGCGTGCTGTGCCTTTCACCAAGGGTGCTATGCAGGGCGATTCGAGTGCCATGAGTCGCGAGGGGCCAGTGCCGCGATCTTCTTTAAGTAGACGGACGTCCCACATTGGTGACTTCACCGTAGGGTAAGTACTTCCTTTCGCCGTCACGCCTTACCGATATTGCTGACTCAGGCCACGGAACATCACCGACTAGCGTTCGGGAAGCGGCGGATTTATAGCGACGAGTATCGCCTTCATTAACCCCCAGCAGCGCCTGCTGCCGCTGCTGGGGCATCGACTCAGGCGTGAAGCTGGTACCCGGGCAGATTTCTGCCCCTGCCCGTCAGCAGTCCAGTCTTGCATCTGTCATCATCGAGATAGCTGTCGTCATAGGACTCAGCTTCCGTCACCGGAGGCGTCAGGTCTTTAACTTTTGCCAGACGCGACCAGTCAACGTTGAAAGCGATTCGTGCTAAGGTACCGCTCCCCCTTATCCAACCCACAGGGTCCGGGCACCTTCACGGCATTGTAGGATTTGGTACAGGCATAGCGTCGGACATTTCATAGGTAATGACATAAAGTCAATCGGCTGAACTCCACAAGCCCGCAATCATCGTAGCGCCGGTGAGTCGCTCGTGGCCACCATACTGATCAAATCTGACCATAGTGCCGGGATATCGCTCATACCGGATAAATCCGGGACTCCATCGACGCATCACGAGCTCTGAAAATCCGTCACACTCATAAGGCAGGAAAACTTCGATATGCAGTAGGCCTGCCAGGTACTCGGTCCAGCTGCCTTCGAGTCTCTTCCTCGGTGAGACCTCGATATTCGGAAATCCGCCTCCATCAAAACTCCGTAGGGCGACCGTCATCAAAAACGTCGCCCCGGTGTCATGCTTCATAGCATTGCGGTAGATTAGGCTGCACGGAGTTCAGTATGTTTCATCGCTTTATTACCGGCCAGTTGATGCTGCAGCGCATAGCCAGCTCTTCGGAAGACGTTCACGGTATCCATCAATAGCTTTTGTTTAAACGCCGTGGTCGATTGGAGAGAACGCGGATTGAGCAGTAATGGGGACGTTTTCCCCAGCCACGCTGCAGTAAATCCAAGTGGTACATTTTCGTTGCTGAATAAACGGCCGGGAATACGACGAGTACCACGCACGCTTGCCGCCCTTCAGGATGAACGCTGCCCCTTTACTAAATGCTTGCGAAAGGACAACCCGCGCATTACCAGCTTGATTACGGGCAATCCCCCGGTTAACTTTGATTCTGGCTGCGGATTTGAAGGGGCCTTATTCATGGCCCTTCCTCCTTTACCAGTTCGGCGTACTTTGTCTCACGGGCAACCTGTGACGCCGACTGCCAATATCGCGTGGATGTGAAGCAACGCGGTTAATGGCCCATTGCTCGCGGGCGATCAGGCACCGCCGTTTTGCTGATACGGCTGAGGTTTTCAACGGCCTGCTCAAGACTTTTATGATACACTTGGTCCCCTTCAGCACGGCTAACGGCAGGCGGTACGCGAGGATTTCGAAGAGAGGAGCAAGACCTTCCTCATCATCCGGCGAAACCCGTACCCAGAAATTTTCCTCACCGATGGTCCGTGTCTCCACGCCGCAAGCTGCCGCACCGCATCAGTCCGGACAACAGGGACGGGCTGGAGCCTTCAACGCACGCCTTGTCCGGCATAGCTGTCCAGGGTCATCAAAACACCACGTATCACTAAGCCCTGACTGCTCATGGATGTAATGGTGGCTGACGTTCCCCATGTACCGAGCGTATCGTTTCATCGGCGGGCAATGGCAGCAGCATCGAACAGGTATCGAAATCAGCACTGTCCCCGTTATTGCAGTTCTGGGGCCAGGCCGCCCTGTCATTTCGGCTGCCCACACGGCAGAGACACGGAACGCGTCTCCCGGCAGCACAAATGCCACGGTCATGAGCGTGGCGTGAAGTGCATCAGTATGCAGCTTCACAGTGCCAAGGACCGTGACCAGTTCAGACGTATCCAGAAGTACGGTATCCCTCGTCCTAGCATCCCACCTCATTTCATGTCCATGTCCTACAGCACATTTTCCCGGCTGAGAGGCTGTCTATCACCGGCAGTTTCATCCGTGTCATCAAGCTCCTCTTTCAGCTATGCCACACGAGTGCCAGTTCTTCTCTTCGTCCCCGTCGGTCGAGGCTGACATCACGGGTTCAGTGTCTATCAGTGAGCGGAGACGGCAATCAGTCATCTTTCGTCAACCGACTCCTCGACAGAGAAACAATGGCCCCGAAGGGCCATGATTACGCCAGTTGTACCGACACGAACTCTCATCACCGATACAGCCAGCAGCATTGTAGGGTGGCTGACTGAATCAATGGTGAACTCACGGGGTGGATCGCCGGTGGTCACCCAGTTTTTCGGGTAACGGGCAGAGGCGTTAATGCCCTTCGCGCCTGTGCGTCGGCATCCTGAATGCAGCTCATGTAGCGCAGACAGGTTCGGCGTGTTCCCCAAGCAGATGGCTTGTTGTCCGGCAGGAAATTCTTTAACGCTTTCCTAATTATACGGTCCTCAGAATACACGACGATGGCCACATCGCCAGATACCTCCCCCTTTATAGACACCGCTTTGCCAGGTCTTTACCGCTGTCTCCAGCTCGGAATTAGAGCCAAGACGGATATCCAGCTTCTATTGACGGCTTGAAGGAACGGAACAGCGCCAGCCTTTCGATCGAACACGATGATATGTCACACATGGAGTTCAGCGCGTCCGTCTCGATATCGTCGGTCGGGGTCATACGTGACTTGTCACGGTGCTCACACTCGTGCTCAGGACTGCGTGATGTTATTCTCCTCACTGCGGCCCATATTCTACCTAACCGGATCGAAGGCGTTGGACGGTCATGGTGTATTTGCCCTTAAGCACGGCATCAGAAACTGCCTGCATCTCTTCAGACCTGATGATACAGCATGGTCTTCAGTCACGCATTTATCTGCATGATGATGCGACGGCGGCGGTAAGCCGCTATCGTCAGATTCTGCGATCTTCATCCGGCAGGCACGCATTAGTATTGCGATTCACTTCATGCTTCGGCTTATAAATACCCCGGCGTAAATATTCAGGGTAGGAGCCGCCACGGGAACGGATAACCTCACGGAAACATCGGCGAAACGTACAGGCCAGCGGTTTACCAGTCCCGGAATTTGTGCGATAGACTTTCTCGGTGGTGAAGGATAGCTCTCACGGAAAAGAGACGCAGAAACAGCGGATCAAACTTAATTTCTGCTCATTTGCCCTGAGTTAGTTGGGCGGTTGTGTACACGGACATAAAATCCCGTAAAAGCCGCACAGGCGGCCTTTTTAGATATGAAGGGTAAAGTTAAACGATGCTGATGCCGTTCAGCAAACGCGGTCCGTTTTCTCGTCTCGTCGCTGGCAGCCTCCGGCCAGAGCACATGCGTCTCAGACTAGAACGTGCCGGACTTGTAGAACGTCAGCGTGGTGCTGGTCTGGGTCAGCATGACGCGCACAGGAATGCCAACCGGCAGGCACCGTCGGTGGTGCCATCCACGCAACCAGCTGCCGGGCTGGAGGTCCAGCAGTACCGGGGTCATGCAGGCGTGCTGAGATCGATCCGCCGGCGGAGGCGGTTGCGCCGGTCTGAGCCGGTACTGTTGCCCTGCGGCTGGTACTGGGCAAGGTTTCTTTGCTCGTCATAACATCCCTTACACTGGTGTGTTCAGCAAATCGTTAACGGATAACAGATGCCGGGTTTACCTGCAGCCAGCGTGCCCTTCCCTGCATCGAACATCCAGCCTCGCGTGTCGCCGGCTGCGCCTGTGCACTCTGTGGTGGCCTGCGGGAGAGAATTAGATGCGGCGGCGTTTTCACGGTCATACCGGGGTTTCTGCCAGCTAACGCGCGTGCCTGTCTTCGCGTCGTGAGCCTCCCTCACAGTTGAGGATTCCCATAATGCGCTGTATTTCTGTACGCAACCGCTGCGGTGATCTGCGGGTCACGTCCGGCTTGCCGCGCTGGCTTCGCCTCCGTCGAGGGGCAGATCAGTAAAGGTTGAGCCTGCGAAGCAGTGGCTGAAACAGTTGTTGATTGAGTCTCTTTGGTCATTCGCTCCTGAGAGACGCGGATTTACGTGCATCCAGTGCAGTCACGCATGACGGGTGATCGCATCGGTGCTGTTAACAAGTTCATCAGCCAGTCGGCATGCTGCCTGACCTAGCCACTCACTGATCCTGCGCTCGGTATCCAGCAACCTGCACGCGGACAGGCCGGGTATATGCCGACGTTGTTCTGCTGCAACATCTGGCGGATGCGAGTCATCTAAGACTGCAGTGTCTCCCGGACGTCATCCGGATGGCTGTAGGGATGCCATCACTTATATGGCCTGCTTCACGCTGTAAATGGTTCATTTCCTCCACATGTTCTCCAGCGCAGCACCGTAATTACTGTGGCTCATCATGACGCCGATGGAGGCCCTGTCCCGGCGGTCTTGGAACAGACGTGGGCTCGGAGGCGGACTGGCAAGCAACTGACCTGCACTGCAGTTCATGTCGTTGGCAAGCGCCCATACCGCGTTTTAGTGACGCACACGGCGATGATGTCAGCGCAGTCAAATGCCCCCGCCATCCGCCGGCGTGTCCATATCGAGCAATGCCGTCAAGATGGATCGCTGGCAGCCTGTTGCAGACGGCGCGATAATGCCGTTGTAACCATGTCACTCCCCGAGTACGGCTGCAGCGCCCGCGTCCGGCTGACCAGCGTGCCGGACACCGGGCAGCACGGCGATGCCGTTCATGACCTTAACTGCCGGCTGTCGTGGTCTACGTCATCATACCGGATAATGCCAGCTCGTCGCTCCTGGGCCAACAGTCAGGCTGTCGCCGGACACCGCATCGCCGTCCTACCGTTGCTGATCCCACATCATGAGTGCAAGCACAAAGAATACCCGTGCATAGCGTTCAAGCATCAGCGGTTCATTAAAGCTTGATGGAGGGGAAGTCGCGACTAATGCATGCTTCAGCTGCCTCCTCTAGCTTACAACACCCAAC * tp:A:P cm:i:482 s1:i:3109 s2:i:0 NM:i:2061 ms:i:7752 AS:i:7752 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
28 24 0 utg000001l 35424 60 851S23M4I3M1I8M1I12M4D8M1D8M1I7M1D7M4D2M2D6M1I4M1D11M5D3M1I4M2I4M6D1M1D5M7D13M1I3M2D26M1I1M5I2M3I2M3I6M1D2M3D2M1I27M1D4M1D2M1D2M2D4M4D2M1D5M1D14M1I19M2I4M1I19M2D6M10D6M5D6M2I8M2D1M1D7M1I2M2I2M1D7M3D4M2I7M1D6M3I3M1I5M2D7M3D12M4I5M2I7M1D1M1D19M1D5M5D6M4D4M5D3M6I7M1D3M1D22M6D6M3D10M1D4M1D10M1I2M2D14M1D1M1D1M1D9M4D30M2D8M2I2M1D3M4D16M1D3M2D7M1I3M1I7M1I3M2D6M1D2M1D16M1D6M3D9M2I10M2D8M1I10M4D10M3D5M3D3M2D3M1D7M1I3M2D1M2D6M1I8M1D7M1D12M2I1M5I4M1I9M8I7M1I5M1I5M1D6M2D4M5I7M1D6M1D1M2D1M1I5M1I2M1I5M3I2M1D8M2D2M8D7M3D6M1D6M3D6M3I8M2D4M1D4M6D3M1D3M3D2M3D3M1D7M2I11M7D2M3D8M1D4M1D1M1D5M2D3M1D2M1D10M2D10M1I8M2I2M2D12M1D5M3D4M1I4M2D4M4D7M3D5M2I11M1D6M1D6M1D4M2D20M2D5M2D5M5D1M1D9M1D4M3D7M1D3M1I6M1I1M2D8M1D3M4D1M1D3M1D2M2D8M1D8M4D1M2D1M1D5M2D12M2D2M1D18M1D11M1D1M1D5M1D5M2D3M6D4M1D1M1D2M2D7M1D6M1I7M4D8M1D5M1D4M3I11M1D7M3I12M2I2M1D16M2D9M7D3M2D2M1D7M1I5M2D8M1I4M2I4M2D4M1I2M2I15M1I3M2D2M1D4M1D8M1D5M2D2M14D1M1D2M1D1M2D17M1D10M1D7M3D8M2D12M1D4M1D5M1D4M2I5M1I3M2I2M2D7M5D4M1D3M12D18M1D5M1I1M1I10M2I10M1D3M2I3M2I5M3I13M1I4M1I3M1I5M3D2M2D6M1D3M1D8M1I3M1D6M1D18M2D4M2D1M1D1M3D6M1D10M1D13M1D8M1D14M1D5M3D7M4D2M2D16M4D14M1D9M4D1M1D2M2D3M4D27M1I4M1I5M2D20M2D4M4D15M1D11M1I17M2I3M3D25M1D5M1I2M4D5M1I12M1D8M2D5M1I3M1I4M1I3M1D8M1I1M1I18M1I3M3I7M1D3M1D5M1D9M2D2M1I18M1I2M5D4M2D1M1D2M2D7M1D23M1D8M1D6M1D3M1D32M4D8M5I18M6D7M5D1M1D3M2D5M3D8M1D11M1D37M1D5M2D12M4I13M3D10M1D5M3D13M3D8M2I6M1I6M1D16M2D2M1D3M1D5M4I11M4D1M1D6M1I19M3D5M2D1M1D10M1D3M2I1M1D7M1I14M3I3M1D45M1I8M8D2M3D11M1D1M1D4M1D3M1D9M2D2M1D4M1D14M2I11M1I17M1D7M1D6M2I6M2I4M1D3M1I1M1I7M1D4M5D6M1D3M1D5M1D3M1I2M1I5M3D26M1169S * 0 0 AAGGTCGTTGATAGGGAAGGCCTTCTTACAAGTGAAGCAAGTACATATTTAACGTTTAAAGCAGCGATCATCACGTCCTCCCATGAAGAGCCGGCGCCATCACGCCGATATTGTACGCATTTTCATGACGGGCAGCCTGGTTAGTACAAGCCTTGGAAGCAGCTGACGTATTGCCCGTTCGTTCACGTTGTTAATCATAAGCTGGTTATTCTGTGCTCAATACGTCCCTAACGCCTGCGACCGGCTGTCCATGCTGCACCCGGTGTGGCAGGAATGAGACCCGCATCACCTAAGTAGCCGTCACCAATCACGGCCTGTGCTCATTCCGATAAGCCAACAGTGAACAATCCCCTGAGCCATATTTACGTTACCGACGGTGGAAGCCTTTGCTTTACAAATGGAATTTCTACCGCGAGCGTAAGCCGTAATCGACTCATGCCACAACAACGCGCCAATGGCTGCCGATACTCCCGACAATCCCACCATTCGATGGAAGGAATTCTACATGGACAGCAATGAACGAAGCTGCGCCGTCGTATGCTCACTGCCGTCAGCATCACGCCTTGCAATACCATCAAAGGTCTCGTGGCTCATTTACCTTGAGACATAAGGGATCCGCTCTTCCCACTCACTCGCGACTTCCTCCTGCCGTATGCCCGTCCCAGCCATTATTTCTTATGACATGACGTTATTCAGCGCCAGCCGTACCATTTCCCAGATGTTCATGTAGCTTCCCGTCTATCCGTCGGTCAGCCCCGGCTTTCGCATCATCGATACCGTTTTGCCCCGTTATGCTGTGCGAATTTATTCGCGACGAGCCACAGGGCCTTTCGATACGGTAATGTCTCAAGTGCAGCCAGCTGGCGTTTGTACTTATGACGCAGCGTCTCGATATTTACTCCTAGGCATTTACGTATTCGAGTAAGCGACTTTTACTGCTGCTATGCGCAGAAGCCCGCTCGTCGGGCCCTTACCCGGTAATTTCTCATTTAACTGGCATGCTTCTCCAGCGTCCCGTTCGTCGATTACTAACGAATGAGTCGTCACAGGCATGAGCACTGTCTTCCTGACGATCGCCGCAGCATTCACTAACTGTTCGGCTTTTTCACGCGTGCTTCATAATCCTTTTCACGCCGCCATCAGCGTGTTGTAATCGACGCATTTTCCCTTTCGGAAGTTTCTTTAACTCCGACGCTTATTTCTCCAGCGTTATGCAGCCGTTCGTAAGCCTTCCCTCTTCGGTATATTTCAGCCGTGACTACGTGCTCCGCCTGTATGCTGCTTAGGATTTGTCTATTTGCAGTCCTTGGGAGGAACCGGCTTCAAGGCAAGACGGGCCTTTCACGATCGTAACGCCGCTTCATGTTACAACAATCATCTCTGCAGATTCCAGGTGCTTTCTTTATACGCAACCTCTGCTTAATCAGCATCTCCTGCCGTATCAGACGATAAACCACCCGATTGGACCACATGAATTCAGCGTCGCAGTCTCTGTGCCCAGTGGCAGTTTGAGGTTCTCTTTCAGGCGGGTCTTGGGTAATTAAATCTTTCGTCTGCTGGCATTTCCCTGCAATCCGTCTCAGCCGAACGGTCGGATGCGATAGGACGCCTCGCGCGACCGTATGACAGCGTTGACCATCTCAGGCTCCGTGACGGTCGGTAGCCCCAGCTTCGTCGACTTGGTCATTCCGGATGAGGAAGGATCAGCATATGTCCAACGCGCCATTGCGCGAATCTAAGCTACTCTTCAAGGCTCAATATCCTCAGTACCGCTTACCCGCTTAGCGTGAACCTGGTCTGGTGCTCCTTCAGCGTCGGACAGACTGGACGGATAGTACATTGCCGTCAGTCCGCCTGATTACCACGGAAGGACCAGCGTTTGTTGAATCGAGAATTGAGACCTCCAGGCAGCCCGCTCAGGCACCGGTTCTCACCGCCAGGCGGCCCACCATCGGCAGGTCTAAGCATCTAAGCGACATGGGATCATCCCTAAGGAGTGCTCTTCTATGCAGCATTTGAGATTGACGACTTGCCGCCTGCATCCGTGTAAGTCGGTGTAGTCAGGCAGCATACGCATCGAGCTTTATACTGCCAACGAAATCCGGTGCGCAGCCTTTCTATGAGCCGACTGTCGACTGCCCTTATTTTCGCGCATCACTTTCCTATTATACACAAATGACGCCTGTAACCTAGGTACGTGCTGGTAAATCTCGCATCCATCAAATCAAAGGAAGATCGCCGTCAAACACGTAGCCTGCGGTACTGATTCCTCCTGTTGACCGCTGTACGTCATCTAAGTTTATTCCACATCCGGGAAGCGGGGACTTCATTCCGTCCGTAAAGCGGACCTCCGGCAAGCCTGCACTGTTCCGATGCACATCATCGTGCCTCTTTATTCGTCGCCGGTTCAGCAGACTGAATCCGATACAGATGCATGCAGCTGAATTGGGAGGAAAGTACGGCTAATAAGCACGGCTTACCGTCAAACACGCAAGTGCATATCTAAGAACATCTATGAATAATGGTACTGTAAAGCGGTGCGTTGAAGCCGATCCATCACGGCAGCATGGCACGCCGTCGGGTCTCCCATCTCACGCGTTTTCGCATACCCTCCGTCTAACCATTTACGAACATGCGCTGAGAACAGTCGTTTCTTCCCAATCTTCACAAACGACTCATACATAGGAAGTTCAGCGTACAGAAATTATGCCGCATGAAACTCCGTGGCCATGGTAAGCACTTCCTGGCTCAATCTGTTTAACGTCGCTTTCATGGACGGCATCTGCGTCTTCTTAATGAGTCCACAGGGTATAAGCCAGAACGCCCCTTCCGTATGTTCATGCTTTGCACAGTCATAACTTCCGGTTGCTGTCTCCACTGTTTAGCGTTTCGCCTGAGGTTCAGCCGTACATGCCGTACGCCGTTGTCAACAGCGACCGTGACGTCACGTTATGTTCAAATGATTCGGTTTTCAGAACATGGTACTCCGGATTAACTGGCGGTGACGGTAATTTCTGCAACCGTTGCCCAGCAAACTCACCATTACCAACCCGTACTTGCCTGCAGCAACCCGTTCACGGTATGGTCATACCACTGACCGACACTGCTTTTGTTTTATCGCAGACCGCACGAAGGCCTCCTTGTCGGTTACGCCTCCGGCCTGAAGGCATTAATTATGGTCCTTTCACCACCAGGTAGCTGGCAGGCGTCACGGTCATGTGACGCTTCAGGGCTGTTACCGTGCGACGCGGATCTTCTTACGAACGACGTTACATTTACTTTCAAGTCGTACTATTCGTCGCCGTCACGCCTTACCCGATATGCTGGCCGAGCCACTGAACACATCGACCGTGCCGTTCGGGAAGCGGATTTAAATACATTCATTAAACCGACTCATGCCTGCTGCTCTCCGGCATCCACGCCAGCCCGTGAAGCTGGTATATCTCCGGCAGATTTTATCCTGCCATTCCAGCCGTCCGCAGTTGCGATTCTTCGTAGCGGCTGTCGTCATAGACAAGCCGGTCAGTTCACGGGCGTCAGGTCTTTAACTTTGAGACGGGACCAGACAGTCGGAATCCTTTAACCAATTGGGCCGTAAGGTCACCGACTCGGTATAAACCACATTTACATTTCACCGGCATTAGAATTGGTACAGGCACCGTTTAGCATTTCATAGGTAGACATAAGTCAGTTATAAACCCCACAAGCCCGCATTCATGCCCCGGTATAGCCTGATGGCCCCATACTGGTGAATAGAAATTGACAGGCTTAGATATCACCGATATCGGTACAACCATCCACGCATCCAGCTGAATCCGGCACCTGAGCAGGCAGGAAAACTTCGGATATTAAGCTGCCAACTGCATGTCCTATTTAGAAGCTCTTCAGCGTTTCAAGCATTAGTCAAAGGCAAATCGCCTCATCAAAACAAGCGGGTAGACGTCACCAAAAGTCTTGCTGTCATTGCTCCAGTGCATCCAGTACTATCGACCGTTCAGTATGTTCATCGGTTATTACCCGATTGCACCATAGAGCTCTTCCGGAAGACGTTCCGCCGTATCCGCTCAATATTTGTTAACGGGTCACGGCACCGCCATCGGGAGTCCTACATCAATGGGTAACGATGTCTCCATGACACGCTGCATGATGCTACGGCCATTTTTCAGGTCGATAAACGGCCGTAGAATACGACGGTTACCACCAACGCCTGCCCGCCGCTTTCAGGGATGAACGCTGCCTTTGACGCCTTAGGCGAAGGACCCGCATTACCCAGCTTGATTACCGACTCCGTACCGCATTTACTTTGATTCTTAGCTTGGATAGGACCGTGCTTTATTTTTGTAATCTCCACTTTCGGACTCCACTGCATTTTAGTTGACGCCGTCCAGAAATGGTTATCATGAAGCAACGTATACATTGAATATCTAAACCAGGCAGGCTGTTCAACGTATGGCCACATTAGAGCATAAGCCGTTTTCATGAGTATAATCCGTTAACGGCCCGTAGCTGGCTATTTGGAGATAGACATCTCCGGTTTCACGAGCGACGGTTACTCCAAGCATGCCCGTCCAAGCCGGCTCCTGTCGAAGCCGCATGATGGCTCAAGCATGCCGATCACAATGTTCTACGGGAGGTCGGACCTGTCTCACGCGTGGTCGGACGGTTTAGAGCTACAACATTTCACTCATGTCAAGCATAGACTTTTCAGGCGTATAGTAGCG * tp:A:P cm:i:30 s1:i:250 s2:i:0 NM:i:1079 ms:i:328 AS:i:58 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
29 25 0 utg000001l 20209 60 297S6M1I4M1I19M1I2M1I7M4D16M2I15M4D5M2D4M1D9M1D3M6I18M2D5M2I4M1I7M2D3M1I4M1I15M1I21M1I9M4D3M1D12M3D11M9I1M2I5M3I23M2I18M5I11M1D2M1D5M3I7M3D12M3D8M1D1M2I4M1I6M1I4M3I10M1I7M2D24M6I3M2I25M5D7M6D2M8D17M6I12M1I13M2I3M1D23M2I32M1I16M1I2M2I4M3I4M1D2M3I3M1I15M5I4M1I8M1I1M1I2M1D1M2I9M2I6M4I14M1I4M3D30M1D12M5D3M2I13M2I2M1D5M3D17M1I2M1I5M1I4M1I14M1D1M1D4M3I3M1I20M4I11M2I6M3I2M3I46M2D18M5I8M3D11M2D10M1I6M1D5M1D6M3D12M1D5M2D3M1I10M2D1M1D8M5D5M5D6M1I3M2D6M2I64M1D30M1D19M1I2M2D4M1I5M3I9M1D2M1D10M2D11M2I7M1D9M1D11M3D7M3D2M1D33M4D1M1I2M2I11M2D2M1I11M2I6M2D21M1D56M2I24M2D9M2D4M1D19M3I6M4I9M2I1M1I9M1D10M1D29M1I8M3D6M2D8M1D5M1I14M2D3M1I8M3D5M1I13M1I6M1D14M3D4M2D11M1D1M3I2M2I10M1I3M1I12M1D5M3D2M2I3M1D6M1I7M1I7M1I10M4D2M2D9M3I12M1I9M2I10M2D18M2D6M1I28M3I2M3I1M2D5M1I2M1D13M1I13M3D2M4D1M2D42M2I6M2I9M2D11M3I21M1I18M2D8M2D1M1D13M1I11M1I2M2I13M4I3M1D5M1I5M1D11M1D4M1D19M1I23M1D13M1D1M2D2M1D17M2D3M1I4M1D1M2D15M1I9M2I3M1I11M2I3M1D3M2D3M1I19M4D3M22D29M1D9M1D14M2D3M1I2M1I2M1I8M1I2M2I5M1D8M4I1M1D1M1D13M4I13M4I8M1I3M1I2M1I21M3D19M1I13M1I2M1D28M1I7M1I20M1I10M3D9M1D7M2D27M2I4M1D16M1D4M2D5M1I2M1I7M1D2M1D7M1D6M1I14M1D35M2D5M1I24M1I6M1D9M5I3M1I10M4I2M4I5M2I5M1D4M1D2M4I2M1I1M1I8M4I7M1I7M1I8M2I4M3I6M2I8M1I10M1I2M2I10M2I6M1I8M1I2M1I7M8I8M3I6M3I28M1D17M1I4M2I4M1I10M1I3M1I2M1I11M1I8M8I1M1I3M2I6M4I1M2I7M1I4M2I2M5I2M1I16M1D13M3I1M1D4M1I5M2I4M7I12M3I2M7I1M3I4M2I20M2I10M2I31M1D5M2I8M1D3M1D11M1I2M2D5M1I22M2I6M5D5M4D4M1D5M3D1M3D1M3D4M4D5M1I18M3D12M1I2M1I35M3I13M6I4M1I4M1D2M1D8M3D13M1I2M1I3M1I5M3I5M3I3M3I2M3I3M1I18M1I3M2I18M2D3M1I9M1D11M1I4M1I7M2I20M1I3M1I3M3D10M3I1M1I14M2I1M1I8M6D9M1D3M1I11M4I3M1D1M1D12M1D12M3D30M1I7M1I14M1I1M1I6M5I12M3I3M1I4M4I2M1I4M4D10M1I3M2I1M1I8M9I20M2I10M1D13M1I2M1I5M1I9M3I2M1I19M2I5M1D6M1D5M1D10M1I3M1D2M1D4M1D10M1D11M2I26M2I8M1D3M3I4M2D12M5I5M2I5M1I2M1I1M1I12M2I21M1I5M1I18M2I2M1I8M1D38M1D4M1I13M1D25M2I18M4D6M1D13M1I6M2D2M1D2M1I10M3D2M2I2M1D9M2I3M1I2M4I5M1I30M4I3M1D5M1I6M1I21M1I1M4I2M8I3M1I7M3I2M1I14M1D18M1D2M2D4M1D5M1I2M2I7M1D2M2I3M1I2M1D6M6I2M1I10M1I17M2D11M1I16M1I13M2D1M1D2M1I1M1I2M2I2M1D1M2I35M1D3M2I6M1I18M5I8M3D7M4D10M4I1M1I9M3I19M1I8M1D8M1D12M2D10M2I4M1D2M4I5M2I2M1D7M1I32M3D16M1I8M4I7M1I3M1I3M2I9M1D3M1D11M2I2M1I4M1D19M2I3M2I1M1D6M1I5M2I6M2I2M1D3M2I11M3D1M1I9M2I2M1I2M1D6M3I3M4I6M1D4M2I3M1I8M3I3M3I5M1I6M3D6M2D24M2D2M1D20M1I9M1I4M1D10M3I2M1D4M2I38M2I4M1I31M1I1M1I2M2I4M1D2M2I17M1D6M2I5M3D9M2D13M2D24M2I2M1D2M1D7M1D14M3I22M1D4M1I17M3D2M3D9M2D4M1I3M2D6M2I3M2I20M3I3M2D2M1I2M1I32M1I4M2I2M4I2M1I11M2I6M3I10M2D25M1I3M1I4M1I8M1D12M4I6M1I4M1D3M2D5M1I11M1I9M1D3M1I7M3D10M3D3M1I6M1I5M1I3M1D14M3D2M1D4M1I3M2I13M2D6M2I1M3I6M2I14M1I4M1D16M1I5M1I11M1D16M3I4M3I6M7I1M1I9M1D11M1I3M1I1M2D37M1I3M2I6M1I9M2I6M1I1M2I15M2D5M2I5M1I1M2I9M1D25M5I4M1D6M3D12M4I10M1D20M1D15M2I9M1D4M1D14M2D2M1I6M2D10M6I1M6I2M1I2M3I15M3I4M2D6M3D1M1D4M1D4M2D4M1D1M1D11M3D7M2D9M1I14M1D4M2D4M1I3M1D10M2D21M4D22M1D2M1D2M1D4M1I7M1I14M1D10M1D5M2D11M1I7M2D2M1I15M1I4M3D16M1D16M1I18M1D4M2D4M2D5M1D4M1D6M2I13M2D9M2I18M1D7M1I3M2I10M2I2M1I13M1I3M1I1M2I16M2I2M1D8M2I3M1I6M2D8M5D7M1I6M1I5M3I16M3D3M1I7M3D2M2D14M2D13M2D2M3I1M4I5M1I23M2I3M1D12M1I32M1D8M1I1M3D25M2D4M1D6M3D6M1D4M4D2M1D6M3I10M2I1M1I17M5I1M1I5M2I12M1I1M4I36M4I9M1I1M1I22M1I1M3I4M1I7M1I1M2D7M5I6M1D2M1I11M1I2M2D8M1D3M2D6M1I4M1I4M1I1M1I6M1D25M2I7M1I8M1D6M1I23M3D6M3I3M6I8M1I10M3I2M1I3M2I1M1D2M1D11M2D4M2I13M1I12M3I4M3D10M1I7M2D1M1D10M1D5M1I2M2D16M7D18M5I8M1D12M3I5M8I10M1D5M1D8M4I4M3I4M1I8M1D3M4D3M7D8M2I13M3I22M1I11M1D5M2I1M1I11M2I20M1D11M1I2M1I7M2I4M1D4M5D12M1D5M2I3M3I13M1D32M1I12M1D9M1D10M1D4M2I4M1D14M2I20M2D15M2I1M2I8M2I18M1I10M1D1M2D3M1D7M1D9M5D28M1I32M1I8M3D8M1I4M2I1M1D24M1I2M1I12M4I1M3I10M1I8M1I5M1I1M2D19M3I4M2D2M2D4M1I6M2D4M2D12M1I4M1I23M2D4M3D13M2I9M5I10M5I28M2I5M1D6M1D13M1I1M1I5M1D11M4D11M2I6M1I32M2I5M6I7M3I15M1I12M1D8M1D7M2I4M1D19M1I8M2D1M1I13M1D3M1D3M1D7M1I1M2I5M2D4M2D11M2D7M1D4M1I7M1D1M1D2M1D8M1I6M1D13M3D3M2I35M3D10M1I9M1D1M3D11M1I27M2I3M2D21M1D2M2D6M3D3M1D17M2I1M1I7M2I4M2D9M1I2M3I1M1I3M1D11M2D8M3D14M1I6M2I10M3I12M1I10M3I15M1D26M1D8M1I11M1I8M3D5M2I20M5S * 0 0 AGTAGGCAACGAGTTGGTGATTTATGCGAAATGAAATGGTCTGACTTATGCTATCATATCTTTATGTCCAAAGAGCAAAACAAGCATCGGCAAATTGCCATCCCAACAGCATTGCATATTGATGCTCTCGGAATATCAATGAAGGAACCACTTGATAAATGCAAAGAGATTCTTGGCCAAGAAACCATAATGCATCTACTCGTCGGCGAACCGCTTTCTGCGGCACAGTATCAAGGTATTTATGCGCGCACGAAAAGCATCAGGTCTTTCCTTCGAACCAGGGATCTGGTGGTAGAGCTTTCACCGAGTTGCGCAGTTGTCTGCAAGACCTGCTAGGAGCAAATAAGCGATAATTTAACATAATATTCCCTGAGGTCGACAGATGGCATCACATCGATGGTATTGACATATCACAGGGGAGGGATGGGACAAATTGAATCAAATAATGATTTTATTTTACGTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTTATAATGCCAACTTAGATCAAAAGCTGAACGCGGCGAAACGTAAATGATATAAATATCAATATTAAATTAGATTTTGCATAAACAGACTACATAATACTGTCGTAAAACACATATGCAGTCACTATGAATCAACTACTTAGATGGTATTAATACTGTCCGTAACAGAGCATTAGCGACTGATTTTGTCGTCTTGCCTAAGCGTTGTCATCAAACCTGTCACACTCCAGAAGCACTCACCCAGTGCAAAGCTTTGTTGTGTGCGGCTAAGACGACCTGCATAACCAGTAGAAGATAGCAGTGATGTCAAACGACGCAGAGCTGACTTCTTTCTTTCACGACTTCCCCACACCCAGCATGCCGACCTTCCGCCATAACTGTAGTGAATGTCTGTTGGTCGACCAGGGAGCCCGGCGGAAATTAACAGCGTAACCAAATGGCTACCCGAAGTCCGCCGTGGCTATCTATCGGTATTACGTGAAACGCTTCTTCAGAAGCCTGAAGAGCTAATCGTTCTACCATCTATATGCATTAATAGACTGTGATGTTCTGTATAAACATGTCCCACCGCTGCAACATGAATAACAATCGTCTATCTTACAAAGGAAGCAGAAAGCTAAAGCAGAACGGAAAACTACAATACGGTTATTCCCCCGTTAAGTTCAATACTACTAATTTAGATGGAAAACGTATGTAATAGAGAGTAACTTAAAGAGAGATTAGATCCTGTGCCGCCAACTAGTGCGGTTATTTTAATAAATTAGAGATTATATGTTGGAGTTAGTGTGCATAGAGGCGGACTTCATGCGTAGAAAGGCAGGTCACGAGCAGATGGTCCGAATGACTATTCATTTGTTACAATGTTTTATCTTACTGTCTTTGATGAGCACATGGCTAAATGCGATATCGGAAATGTTAAAATTGGTTTGCCTGCAAAAGAAGAAGTAAGCACCTTATTGCTCATTAATAATAAATTCAGTCATTCCCTTAAAACTGTTTTTCCTTAGGTGAAAGCATTGACTATGTTAGTACCAAATGCTGCGATGGTTTGATAAAAGCTTCTGCCTCGGGTCAGGGTTTTACGTATGGCCAAATGTGGATTAGCCGACATGCAAATGAAAGCGTCCTTAACAGCTCATTACTTAGAGGGGTAACTCTTTCAGAAATTCATGGACAGTTCGCGCACGTGTTAAATGGTTTGCCAGGATTGTTGATTTCGCTTTCATTTAATAGAAAAATTAGTATGGCTCCCGGATTCAGTATTGATTTGACCCTTTGAGGTGACGGTTAATTCTATGCCCAGCACGAACACTTCATGCTTTATCGGGCCGAATGGTGTAGGTGAAACAACAATTTTAGAATGGAATGATCTTGAGGCAATCACCAACCCAGAAACAATGAATATTTCTGAGAATAATAGATAGGTACGTGGAGTCAAGAAATGCCCAAAGGGATATTTCGCGTACATTTTCAGTTTCGTTTGAATGCCTGTTATTCCTTTCTTAACCAACAAGCTGGATCACCAAACAGGTACCCAATACTTTTATATTGGACTCAAGAATGCTGCCAGCAAGCCGTTGTTAAATCACTAGGGGATCTCCGGGACTGCCTAATTCGATTTCAGCATTTATTGGTTGTATGAGAGGTAGAAGACGCCTCTGGCTTGAAGCTATCAAAACTAAGTAGTGATGAAAACTTTTGTCAAATATGGAACTCATCAGCTCCCTCATTTCTAAAGTAACCAGTTAAGACGTAATGAACCACAGATTCAATGACGATGATAAAATAATTCACTAAATTGTTTGAGTGACAATATCCGCGAGAATATCTGCTTGAATGAGCTCTGGACTGCAATTGTTTTATTTACTATCACAAGATTAGTAGATGTCGTTGTGAAAGTCATTAGTTTATTCGATGAACCAGAGATTGGGTCGCATCCCACCTGTCCTCCTCTGCTTTTCTACGGAACATTAAGCGAGACTTACTCGATGCACGCAATGGTGTAGCAATAATTGCAATCCATTCCCCAGTAGTACTGCAGAGGTTCCAAATCCTGCATGTGAAAGTCGCTCACGTTAAGAAGCAATAAAGTATGCGTCCCCTGTGAAGCTTCGGTAGAACTTAGGTGTTTATAATTGCGTGAGGTGTTTGACTATTGAAGTGACAAATTCTGGATACCACCACTTATTATCGCAAGTCCGTTGATTCAGACGTTCTTATGAAACCATTCTAAAGATTATAATGGTCAGATAGGATTAGAAGGTCGAACCCGTTTTAAAGCGATGTAAACTGAACAGAGATGAAGGTAAAGTACAATGAAAAACACTATCTTCCAGCGAGAACTTAGCGAAGTCGCTTAATAAATGCTGGAAGGTATGATTGCAGATAAATGTTAGAAATAATTTCATTACTCACTTCCCCACTTTTGCAGAAAGAACAACAATATAGAATATTAAGCTCGGACAGGTCAGTTATTTACCTACGACAGGACATAATCGCGGAGCCTACAAGGCGTAGGTAATTGACCTGACAAGGTTAAAAGGGTCGAAAGCTTTATGAAAATAATAATCTCCGATAAAAACAAACCCGCTAGAACATATTACGATGACATGCTTGTTTCCATCAGTGAAAATGTCCATTTTTGTAGTGACATCTAGACAAAAATATAGATCAACATTTTCTTCCTATTGCACATTATCCTGAATTTTCGGTGATGCCTATTAATTAGTTCCATCGTGCCGCGACGTGCAATATGGGAGAGAAAGGTCATAAGTTTTCGCAGTAGATGAGGTACATCTAAGCGATTCATCCTCCCTATATCGACAAGGACATTTTTCTTAGCAATGGGTATGCATTCGTTTTCCGGAACTCCGGGTGCTATCAGTTTTACTTTGCGCGTTATCAGTGAAACCGCCCGGCGACTGGAGGCAGGAAGACAAACACAGAGCTCTTCATCATTTCAAGCTATTAAATATTGTTAAACAGGTATCGTTGGAGGCAGGGAAGGCTTGAAGTGAATGATCTAAGAAACTATTTCGTAAATTGGGAAGCCTGTCAACCGCAACGTTTCCCTGAGTCGATTTATTGAAAATCTGAAACCGTAGCTAGAGATTTGAATGACTTCCCCAATTATTGGAAAGAGTTATGTATCAGTGCCTAGCAAACTCGAAGATTTTCCAGGGGCATTAGAATATGATAGTGAAGATAGAAAATTGCCGACGCTTATCGGAAGTGAACGCATCGTTATATGCACGAAAGGCTGTTTTACAAATCCGGTGACTTGCTAACGATTCTAGGCAAATCGCTTGGCATGAGTGAAATGAGGAAGAGGAGCGCCTGTTGTAATGTCCCTGGATACGCGCCGGCGTTAGGACAGTGGCGTACAGTCATAATGAGTCCTTGGCAACATGGTAAAATTCTGGCTGCAACGTAGATCGGGCACTGGAAATCATTCAACACCGGCACTATCGGAAGTTCACCAGCCAGCCGCAGCACGTTCCTGCATACGACGTGTCTTGCGGGGTCAGCACCATATCTCCTATGAGCAACGTGTTGAGCGAGCCAAGCCACAACTCTAATTTAATACATAATGAATGATAATAATAATATTAAATTTCCTGTGTTGACTCAATTACTATATGGGTTTCTGATAAGAATCATTGCGGAGATCGACCTATTGTATCCATTAACACGTTAGAGTCCTTTAACACTAATATATCAGCTTAGCATGCATGCTATCAAAAATCGAGAGTTTTATGACTAAACCATGGGAAGACACAATGGCACATTTATCACGCACTTGCTCAAATGCTGCATTGATACATATTTTGTATAGGCGTACTTTCGCCTTGAATTTGAATCATTCCTCCAAAACCGCAGAACAGTAACATTTATTATTCAAAACAAAACCAGATTACGAGTCTGACATTTGGTAACAAGCATGTTATTGAAAATGGAAAAGATGATCCATTAATGGCTTAAATTCCGCAATACGATAGAAAAACAAGGCGATTTAGAAAGGGTACTGAGGCAAAAGGCTACTCTTATTTCATCTTACATTGAAGAAAATGACATTGAGTTTATTATACAATGAAAGTATGTTAAACATTGGTAAAATTAGTCAGTATGTGCTAAGAAGAGTGCAACAACATTCATATTTAACTGAATCAACCGTATGTAATCAGAGATAGAGGTCTTAGTGACAAACGGAATCAGGGTAGCGATTAATCAGAAGACGATGGGTCGGCATAATCTATGGCAGAATGTAACTGCTGTACTCTCTTGGCATACAAATAAACAATCCGAATTACTGTATAAGTACTTTCGCCAACATCATTCGACTCTTTATTTGATGAAGCAGGAGAATAATCTACTTTAAATTAAAGATTATTCCATAGGCAGGTCATTTAGCATGATACAATATGACAATAAAGCGGCAATTCCTGAAGGACTTAGGAGCGTCTAAAGGGTATTAAGCCTGACAAAATATCATTCGACAGACAGAGTTAGTTGACTATACAGCCAGCTTGCAGAAACGACTTTTTACGGACGGTTGACATTCAAACATTAATTTTATGATAAACAACAATTCCATCCAATTGATTTAATCAATACAACATTTGAAGATCAAGCAGATAAATATATTTTGAGTTATGCAGCTGACAAGGCCAAATAACAAATCTGCTAGCTGGCTTCATTTACAATCAGAGCTATGAGCCAGAAAGACGCAAAAGAGCATCACTCTGCCTCAACCAATACATACAATGCCAATGAGGTACTCATAATTAAAGGCACTTGGAATTGATTCAAGGCATCAAATGTATTTCATGGAAAAATAGTTGAGAGAACGAAGAAAAACCGACTTTGTAGAAAATATCAACAGCATACTCAAACAGTACGAAAACAGCATATTTCATGCGTTCAGTCTTAAAGGATTGGCGGTATATGTAAACACTACGAACAATTGAGTCATAGAACTTCGTCATTATTCTCCCTGGATAACATTACTAAAACCAATACTCAGCTTTACAATAACTAACAACCGCAGAACGTTATTTCATACGACAACGTTTCTGCGGCATGACAAAACGATTACTCCATAACAGGGGCCACTCAATATGAGATGGAGTTGACTTAGCCCCACGGTTCAGGCACTACGATATTTCTTCCAGGGCTTCCAGCAACGAGGTTCTTCCTTCGTTGCAGTTTGGCACTCCGATCTGCAGCATCCTATGAAGCACGGCGCAATATGCACTGGCTACCTGCATCAGGCTTTTGTTTCTTCCGCCTCCGGATCGAACAGTTTTCTGCTTCCGTATCCTTCACGAGGCTGTGCCGTTCCATTTCTGAGTATTCCCCTCCCGGCGATAACCCAGCCTTTCCGGTAACGGACGAAATTAAGAGCCTCGCCCGATTCTACGGAAGCCCGGTCGACGGTCATAAGTTCCCGAATGATGGTCTTCATGAAGGTCCACGATGCCTCATCACCTGTTGAAAACAGCCACAAAGCCAGCCGGAATATGCTCTGAGTCCGTGCAATATCGGTACTGTTTGCAGGCAGACCGGTATGAGGGCGAATATGCGTCTACCTTCACCAATAATTCATTAGTTCCGGCCAGCAGATTATAATTTATGGTCCGTGGTTGTTCACTCATTTCTGAATGCCATTATGCAAGCCTCAATAGTTAAATGCAATGTTTGACGGTGTTGGAATTCCCGTTACCAGCGTTAACGGCTTATGGTGTTAGTTGAACCAATACTGAAAGAATGGCATGAGCACGATAGGCCAACCGGATGCTGTGAGCACCAATACACGGTATCTGCATGTGCAGCGGCACTCGAAGGCTGTACCGGACAATGGCGAGGTATGTGACATGCCCTTAACTTCGCCCTGCGTCGTTTCGATAGGCAGCTCCTGTGTGCTCATTCCTTTAACTTGCTGGCTGTCCGTAATGGTTAATTCCGACCTGACTCCAGCCATGTTCATCCTTAAACCGCTTGTGGATAGCACCCGCGCCATCGCTGTTGAACCGCTCAGACTGTGAGCATGATGCCCAGTCGTCGTTCCGCATTTGGTGCCGTAATGTGAATGCCTGTTGTTTTCGTCCCGTAATCAAACGACGATGTATTTCGTCCCCAGATCCGTGACACGGTAGGCACTGTGGCTGCGACTTAATTCCATCCTGTTCCTGAGACAATACAGCACGACCCTGGCTATTCCCCTTGATTGTCCCTCCGGGCATATCAGGAAGCGACGCAGTGGCTGGAGAAGCCGGAAGCAAGTTTGGTAGGCTGATTGTCTCAACGCCTGCGCCTGCGAAGCCATATTAGCCAGACGGAACGATATGGTGATAAGGATCGCACCGTAGAAGCCGAATTCTCACCGGCCCAAGGACTTCAAGAACATCTGCAACGGAATTTTTGCCAGAATATCCCTGCCTAACCTGAGTCAGTTCAGTCAGGCTGGCGGCATCATTTCCGCAAAATACGGTAATTATTTTCGCCGTGGAAGCCTGCCAGCGTCAGTGTCGCATTCTGTCAGTTGTTGAGCCGCAAGCGCGTTAGTCATGGTGGTAGCAAAATCTGGATCATTCCCGAGCGCTGCGGCCATTTCATTCAGCGTATTCAGTGCGTCAGGTTTTTGACGCGTCAGTAACATCTGCAATCGCGGCCAGTACAAAAAGCGGTGTTCGCAATCTGGGTTTGTTTAGACCTCCCATTTGGTCCATGTTGGCGTTCCATTCGGGTCGGACTGTCGATGTGGGCTTTCTGTTCGTTTCATCCATTACCATCTTAACAGCCTTTGGCGTGCAGCAAGCGTTTCAGACGTGCTGTTGGTTGCACTTGGCTGATGGCACTATCCCACTTTCTCGTTGTGTCCGCATCCTACCGCGACAGCTGAAGCTATATCTTCTGCACGTTTTGCCGAATTTAAATGTAAGTCCCACCGCCTTCTGCCCTATTTTACTTACGATTAATGATCTCGCACTTCCCCGCAGCCCTCTGTCTCCGCGGGTTCGTTGAGGAATGGACGCATCGCGCCCCGCCGCTGTTGTTTTGCGTTGCCCGGCAAGAGTAGGCGCGGTCGTTCCCCTGCTGTTCGACTCTACTCTGGGAAGGAGGCAGCCCTGCCTGGCAGAATTTCTGCCGCCGCTTCAGGAGGAAGCTGCTAATGGAAGGGCACTTGGATGATGCGTTCGTTTCTGATGATTTTGCTGCCTCCTTTGAGGCCAAGCGCATCTCGTGCTGAATGGCGGCCTCTGAAGGGGCTTTCGTGGCCCGGTGTCAAGAGGCAGACGTGGCGGCTGATTGTTGTGACGCTGCAGCATTCGTTTCTGACGTTTAGCGCACAGCACTGGCTAGAGTTTTGAGGAACTGCACCTGCGGGGTTTCCTTTTCAGTAAGTTGCTGATGCCTTCTGGCGCGCCTAGAAGGCCTTCCTAGCTGGACGATGCAGCTGTCCGGCGACGTGCTGGCGGCGCGTGCTGGATCAGTTTGCATCAGTTACAAGGGCCGCGACCTGAGCATACGAATGCACTGGCATGCCCTGACGCTGATTTCTTCGCGTCTGCCGTATCTACTGTGCCACGACCGTTGAATGAATCGGAGCAGCGCCACCTTCCTCAGCATCAGTTCAAGACGACGCATAAGCATCGCTGAAACATCCTCCAAGGTCATGTAACCATACAGAAATGGATTCAGCGTCCCGGTTGAATCTTCATACACGGGCTTATGGTCCAGCGGCGTCAGTTGAATACTTAGTGGGAAACCGTCAACCTGCAGGACGGTAATCTTAATGACGATCTCCACATCGCGCTGCTTAACGCCCGGCTTCATCCGGATTCTCTGAGCCCACCGTGTTCACCACCACCGTGGTAGTGTTAGGCTTCTTTATACCGTTTGCCCTACCTGAATGGTTAAGTTCTGTGTACTAGTTTTCCTGCCGTCTTTCCTCAGATTCCTGAAATCTTTACTGCCATATTCAGCCGCACAAAACGCGCGTCCGGCAGATCGATTCATAGTGTCCTGGCCTATCCATTTATACAGTACAACAAGTGAATCCGTCTAGTACGGAGTCGCCACTGCCGGCCAGCCTTCATAAGCAATATCAACAACGACGGACGGTAGATTAATCTGGTACCTGCATACGCTAAGTAGACTATGCCGCATTGCACTTTCGTCCCTGGCAGTGGTCGTGCTTTCATACCCGGGGTTTCCGTTACGTAATGCGATGTACTGCTTCATGATCACTAGGACTGTGAGCCACTCTGAGAGCCTGGCGTACGGAGACCTGCTTGATTTGTAAAACCGGTCCGGCCATCACGCTCACAGACGTCCACGCAGCGCTCTCATAGTGAAACGTATCCTCCGCGGTCATCACTGTGCTGCTCTTTTCTACCGGCGAATCCCAGGGAAGCCGACCGACGCACTGTTAGCGTCAGCTCATAACGGTATATTGG * tp:A:P cm:i:87 s1:i:826 s2:i:0 NM:i:2618 ms:i:2900 AS:i:2878 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
30 26 0 utg000001l 30793 60 7S16M1D4M2D10M3I1M1I9M3D28M3I4M1I13M4I6M1I23M5I1M1D14M2D4M1D2M1D4M1D11M1D2M1D4M3I23M5D10M2D10M2D9M1D1M1D8M1I3M2D14M1D3M1D7M1D6M1D2M1D17M1I23M2D4M3D13M1I1M1I3M2I6M1I3M2I42M1I1M3I14M1D3M1D14M2D2M3I7M3I3M1D26M2D4M1I3M2I4M1I6M4I4M5I2M1I4M1D4M2I1M1I2M1I8M2I14M3I7M2I20M1D26M1I6M1I18M2I3M5D9M2D13M5I13M2I12M5D7M1I12M3D5M1I17M2D2M1D9M2I13M2D2M4D2M3D2M3D10M3I2M1I3M1I2M2I8M3I18M4D4M1D5M2I4M1I2M1I3M2D2M4I18M1D6M2D13M1I7M1D10M2I9M1D6M1D4M4D5M2D2M1I12M4D4M2I4M3D2M1D2M1I3M1D1M2D16M1I1M2I1M1I4M1I9M1D12M1D3M1D6M1D3M1I3M1I4M1I12M1I17M2I10M1D9M3D13M1D26M1I20M3I6M1I6M1I4M1I7M1D9M1I9M1I13M1I6M2I25M1I3M1D2M2D8M1D4M1D10M2I4M1I1M1I7M6I2M1I2M1D3M1D9M5D3M1D10M2I8M1I1M2D13M1I4M1D4M3D7M1D4M4I4M2D4M1D14M1I39M3I4M1D2M2I5M1D5M4I18M1I17M2D5M2I34M1D3M1I15M2D5M4I6M2D6M2D21M1D2M1I7M2I9M1D2M1D19M1D12M1I1M1I7M1D21M1D18M5I9M1D9M1D3M2I9M1I17M1D12M1I8M2D19M2I16M3D15M1D6M1D12M1I2M2D5M1D33M2D11M1I4M1D7M1I4M1D7M1D3M1D3M1D4M1I2M3I4M1I4M1D8M11I4M1D4M3D3M1I8M5D3M1D9M1D7M1I10M1D19M1I12M1D22M3I3M2I2M3D5M3I14M2I3M2I2M1D7M1I1M1I8M1D23M1D13M2I3M1I13M1I2M3I3M1D6M3I8M1I2M2I1M3I6M2D32M2I3M1I5M2I1M2I8M1D5M1D7M1D8M2I8M4I4M5I2M1D6M2D2M2I1M2I10M1D26M2I23M2I17M2D17M2D2M2D18M1I18M4D3M1D4M1D2M2D2M1D5M2I1M1I11M2I4M3D21M2I3M1D14M1D1M1D3M1I7M2I3M10I2M1D36M2I7M5D1M1D1M2D6M1D34M2I28M1I13M1I6M32I2M2I3M2I15M4I3M2D6M1D26M1I1M2D2M1I8M2I3M2D7M1I2M1I3M1I10M3D5M1I13M1I2M1I5M4D5M1D7M1D7M2I14M2D1M1I3M1I4M2D6M1D2M2D8M1I5M1D6M4I7M2D5M3I2M1I8M2D8M2D1M2D8M1D8M1I3M1I7M6D5M1I6M1I2M1I9M1D3M2I2M1I5M1D6M1D19M1I5M3D6M3D2M1D4M1D7M2D12M1I2M1I14M2D6M1D5M5I4M1D7M3D1M2D5M3D2M1I28M1D3M1I8M2D12M1I2M2D3M2I4M1I1M2I3M5I6M1D14M6D5M2D4M1I16M1I1M4I3M8I11M1I6M2D4M1D4M1D5M1D4M1D2M3I13M3I1M1D5M1D5M1D8M1D4M2I9M1I5M1I2M1I8M5D6M1D2M1D1M3I22M2I2M1D26M1I6M2I10M2D16M1I1M2D8M1I5M1I6M1D11M2D20M1I10M1D29M2I9M1D7M1D6M2I4M1I9M1I8M1D12M2D12M2D4M1D15M2I3M2D1M1I13M1D4M1I15M2I3M1I4M2I2M3D2M1D4M1I8M1I4M1D6M3D6M1D5M1D14M1I3M1D7M1D3M1I5M1D14M2I4M1D22M3D11M2I3M1D15M2I8M1D6M4I6M4I2M1D11M1I10M2D4M4D8M1D1M1D8M1D9M2I4M1I3M1I13M3I4M2D7M1I3M1I2M1I9M1I8M2D19M2I2M1I13M1I3M3I15M2I18M3D8M2I8M1D7M2D9M1I3M3D15M5D6M1D6M1I4M2I7M1D9M4I29M1D10M1D36M2D25M2D6M2D4M2D5M4D7M1D2M1I2M1D2M2D1M1I7M1D5M4D2M1D3M3D2M3D6M2D2M3D2M1D5M6D3M1D9M1D4M1D6M1D15M3D3M2D5M2I3M1D8M1I20M1D17M1I18M3D1M1D2M10D9M1I6M1I7M1D4M1I18M2D3M1D14M2I4M1D4M2D3M3D3M2D3M1D8M1D6M1D1M1D10M1I6M2I5M4D5M3D2M1D1M1D7M3D19M2D3M4D3M2D3M2D4M1I16M1D1M2D3M2D1M1D8M3I14M1D24M1D14M3I1M1I8M1I11M7I16M1I5M1I3M1I7M1D4M2I33M1D6M1D4M1D2M2I27M2I3M2I4M1D7M2I3M1I5M2I10M1I1M1I13M1D1M1D30M1D14M2D4M1I4M1I10M1I5M2I6M1D11M2I2M1D4M1D20M1I3M1I18M4I4M1I3M1I16M2D23M1D3M1D13M2I1M1D17M1D9M2I12M2I10M1I7M1I29M2D1M1I11M1I14M1I18M5I8M1I3M1I26M2D5M1I21M3I12M1D24M1D3M1D13M5I7M1D3M1D16M2D13M1I6M1D3M1D6M1D4M1I8M2I8M2I6M2I3M1I2M1D3M3I10M1I26M1D12M2D1M2D3M1I8M2I8M1D6M2I4M1I6M1D17M2I14M1D3M2I6M2D17M1D6M1D2M5D4M3D1M1D16M1I23M1D23M1D12M1I4M1I12M1I17M2D7M11I1M1I9M1I5M3D5M2D11M1D4M1D3M2I7M4I16M1D4M1D1M1D12M2D19M1I11M1D3M1D10M2D5M1I8M4I14M1I10M2D1M2D6M1D8M1I7M1I24M1I14M1D1M1D21M2D11M1I17M1D21M3D15M1I8M2D2M1D23M1D11M4D33M1D20M3D21M1I5M3D4M2I8M1D23M1I9M2I4M1D20M1D19M3D2M1D3M1I5M3I7M1D6M1I17M1D9M4D11M1I16M6I17M6I5M1I7M1I22M1I7M2D2M2D22M1D15M1I12M1I9M1D19M1D3M2I39M1I2M2D25M1D6M3D8M3I7M2D10M1I6M1D10M1I1M2I12M1I23M1I28M1D4M1D1M4D3M1I8M1D5M2I9M1D9M2I7M1I12M1D8M2D1M1D14M1I3M1I2M2I7M1D14M2I16M1D69M1I2M2I3M4I11M3D4M1D12M2I11M2I2M1I15M1I13M2I8M2D12M1D13M2D11M2I13M2D1M1D7M2I11M2D13M1I5M1I5M1D4M1D2M1D4M1I5M1D9M2D7M1D14M2D7M18S * 0 0 CTTAGTCCGTTTCCAGCAGTTCTTTTAATCAGCCACATACGCCCCGGCGCGGTGCCTGCCCCGGCTGGTACAGCCAAAGGCAGCATCCATCTTCGTAGCAATAGTTACGACCGTAACGGGCAATGGCCTGCGTATCTTCAACAAGCTCTGTCGCCGTCTCCCAGCCGTTGTTCGGGTCAATCCGGCGTTAGCCTCAACGGCATTATGAGTCCTTCAGGGCGCTGAAGCTGTAGCCTAGAACGGCGCGCCATCATCCGGCATCACACTAACTGCGTTATAGTCACGTCTTATCCGACGGTTTAGTCCTGCACGAACGTCAGCGTGCCGTTCCATACCGGCGACTCAGCGCATCGCCGAGCAGAAATCGCTGAGCACATCCACGCCTTACGCTGTGGTCAGGTGACCGCGCATTACAGGTGAGCGGCTCGTCGCGTCCCCCAAAGCCGTTCTAGGGCACTGACTGGTCGCAGTACTGGCCCATCATACCACAGCACCGCTTTATTATGCGTATGCACATCCGCCGCATCAACAGAACCGTTTCCTCCCATGCCGTAGCGCCTGATGGGTCGGCATATCCCACAAGACACCAGCCATGTTGTTGCTGTATGCCGGTTTAAACGTTCCGTTCAGATACCGCTGTACTTGCCGTCTTGAGTTATAGTTCGACGAGCTAGCACCTGCAGAGAAGATACGCCCGCGCATCATTAGCGGCTCACCTGCTGGCTGCCGAACTGCTCCCCGTTGGACCCGCCGACCAGTGCCGTGTTCGGCTAATTGTTTCAAGCCGACCTTCAGTGTTGACGACCGACCAGCGTTTTGTCCTGCAGCTGGTCTGGTGGTAGCTGTCCGGCGTCATCCTGCGCATTAGAAGCTTAAACGGGCGCGGCGGCAGGTTACCCATCACCGCCCCAATAGATGATGCAGGTGGTTTACATTAATGGTGATGTCTTTTCCGTTCACCAACAGCGTTACGTTGTATCTGAACCATGTACAAGGCGGCGACTTCCGACGGCTTCCTGTCACCTTTGGCTAGGTATTCCTACCAGTGCCTGTACACCCGACTTAAAGCGCAGACGGTCGATGTTGCAGACCCAATGGTGCGGGTGATCGGCGTCATATTTCACTTCCGTACCCCAGCACCGTCTGGAGCCGCTCGAGGATGCCAAATCCCCTCCGGCGGAGTCTGCTCCGTGCTCACCATACGCGGAACATCACACCGTGACACTGGATATGTTGATATTCCCTCGAGTGTCCAGCACCGGCGTACCTGTTCAGCAGCACGTCGTTTAAGCCATCTAAATGTCGACTTCAATCGTCGCTGATGGCATACCGATCACACTCAGCAACTGCGTGACAACTCAGGTCCTTCGTCGCTTTCTAGGGGTCCCTTACTGCTTCCTTTTACCCATTCCTCACGCTCCATAAATGACAAAACCGCCCAAGCAGGTCCTACACATAAAACATTTTGCATCAGCGACCAATAGATACACCCTAAGCTCGCCGTTCGCGTCTGCCGTGCTGATCTCCTGAGAAACCACGCGTGGTACCGCACGCATTTCCACAGAATTGACAAGCAACATTGCCTGGGCAACCATGTTATGCGTATAGAGAAGCGTAGGTTCTGCTTACCCGTTATCCGTTGTCTGTACGGGGAGTCTGGCTGCTTTCGCTGCCAGCATCTGCGCCACCACCGAGCACCATACTGTACAAGCAGCCAGAAAACAGGATGCCCGGTCATACCACCGGCCCCAATGGGTGCCCCCATGCTGCAAGGGGCTCCGGCGGTAAAGAATGATTAAGCAATGAGGCAGCCCCCAGATCGGAATACGCCCTGTGACTTGGCGCGGCGACTCTGGCACGATATGAATTACAGCGCCATCAGGCAGAGTCTCATGTAACTGCGCCGTTAACCCGGAACGTGCTGACGTCTGCCCGGCAATCGAGCGTGACATATACCAGCCGTCGCTCAGTTTCTACGAGCCGGGAGCTGTGTGAGTCGCATGGATTGAGCCCCCGTTTTCCACGAAGGTCGATGCGGCATACAAATCGTTGTAATCCCCGTAAAGGCAGATGCGCCTCGCTTCACCGGTACCGCCAGAGGGAGTGTGCGTGGACGGTGCCATGTCGTCGGTCTCCTCTCGTTTGCTCAGTTGTTCAGGAATATGGTGCAGCGCAGCTCGCCGTCGCCGCAGGTAAATTGCGGCGTGATTCGGCACTGACCGTAAACCAAAACAGCACAGCAGCACATCGCCGGCTGTGCCCGGTGATCAACGGCACCTGATACAGCCCGTGCCTCCAGATTATCCGAGATAGAGAATGCTTCTGGCCCGTTGAATCAGCTACCGTCATCCTCACGATGAAAGTCCGGCATCTCAATCCCCGCCAGATGATAAGCATCCCGGAACATATTGTGTAACAGTCCGTCACCGTGCTCAAAGCGCCGGTGAGATGCGGCACAGGGCAACTTATGAATCGTTGGGGGCGAGCGCCCCGGCAGGACTTAAAGCTGCACCTGCAGCCGGTCGGCCTCACTCAGCCAGGGCAGACCACCGGGTATGGACTTGCATCAATCAAGCACCCCCTGTCCACCCTGCATTTCTGCCTGCAGCCAGTCTTCCGGCGACACTAGAAATACGCCTCCGGCTCACCGGAGATATTCACGCAGGGAAAATATCTTTCCCCCTCCGGCGTGCTTACTACGAAGCTCGCACGACTCCATGGCGCACATCGCCGGGCGTGCGCCAAGAATCGCGCATGATTCTGTCTGTCATGGGATTTTATAACCCGCGAAAGTTGTTAATGGAAAGGAAGCCGCCAAAGTTGCCGACGTTACTTGCGATCTTACAACCCGCTCCAGGCATTTGCTGCATTTATCCTTCGTGATATCGGACGTTGGCTGGTCATTCATCCGCGACAGCCGCACTGAGTAACCGCACTCGTCACCGCGATAGTCTAGGTGCAGGTGTTAGAGCATGATACCGTCCTAGAAAAGCGCCATCCGTTTCCGTCGGCCGTGACAGATCAAAGGAGGCACTCACCGCTCAGTTCGCTGCACGCGGCCTCAATGCGCCAGCGGCTGATCATAGCCGCTCCGGATCGGCGTAATGGTCTCGTTGTACGAAGTTCACCGCATCCAGAAAACGGGCGTAACCTTACGCCGTAGACCACCCGTTCCGCCGACCAGACCCTGCATATCTTCCGCCATCCCGGTACCATACCGTACAGGTCGAAACCGTCAGCGTGGGCGCGTCGTCATGAAGCTGGTGCTTTGCCATTCAGTTCAAAACCGACTGCTCCCTGAATGGGATACGGCTGATACTATCTTCGCCCTGCCAGGTGACCGGCCAGCTTTTCGTTCTGTAACTCATTACAGAAAAGCTACGTTCTCCACGACCTCTGTCAGGTCGATTTCCACAGCAGCACGGCCGACTGCGCACCGTAGAGCATTCATTCAGTGTTTCCTTGGATCGATATCCTGCATCAGTTCACCTGTTCAAACTCTGCGCTGAACTCAACGCAGCATACTGACCGCGACGACCATTTTGCGCAGGTACCCTTTATCTGCCCCACTCATAAGGCGGCGTCCACAGAAGGATTTCCAGCCCCGTGCTCTTCCAGAAACGAACTCCAGTACCGTGGCCTCCTCACCGGGGGAACAGAAGGCATTTACGCTCACGTTCAGGTTGGCATTCAGCCCGGCACCGAGCCCTGAGAATAGCCATCACCAAAGCACCTTTCGTACAGAAGGGACCGAAGCTCATCCATACCGGGTTTCACTTTCCAGCACGAAGTCTTCATCGTCCTCCGGATGAACTAGCCATCACCCTAATCTTGTCCTGAATTCATCACGGGCATCCCTTGCGGGCCATGTCATACACCGCCTTCAGAGCAGCCCACGATATCTGCCCGTTCTTCAGCGTCGTTGTTAATCACCACATGGTTATTCTGCTCAAACGTGGCGGACGCCTGCGACCGGCTGTTCCATGCTGCCGGTGTACCTCGACATAACCGCCGGTAGGCATCGAAGGCGCATCAGCCGGTACGATTCCCCACGGCCAATCCGGCTCGTTGCCTCCTTCGTCCGACAAACAAACTCACCACGTATAGAACAATCCCCGCTGTAGCTCATATTTGCGCCGGTTCCCGTAAATTCCTCCGGTCCAAAATGGAAGTCGCGCCGCAGCGGCCTGAATGAGATCGCTGACGCGGATGCGCCGCCACCAACAGCCCCCGCCAATGGCGCTGCCGATACTCCCGACAATCCCACCATTGCTGCTTAAGCAGAATTTCTGTCATCATGGACAGCACGAACGGGTGAAGCTGCCTCAGTTCTGCTCAAGCCGTCAGCCGCGCTTCTAGCATCATCAAAGTTCTAAGGTCCTAGAAGATTGGTGTGCTCCATCATTCCAGCGACTCCGCTGCCATGTGATTCCCGACCGTCTTACCTGCCAGCTCTGTTAGTGCTGGAAGGACCATATCATTCAGCGCCCTACCATCATACGATTCCTTCAGGTTCCATCCCGTTGCGCCGCATGGTCAGTCAGCCCCCGGTGCTTTCGACCAAGCGCCCGTTCAGGCGCTTGAGTGCTGATGGAATTACTCAGGTTGCCAGCCAGTGCGGCCGACGGCGTGCCAATATCGCAGCGTTGCTGGTCGTATTCCCAGCAGGGGATTTCTCCAGATTTATTCCTAGGCAGACATCGAGCGGACGTTGCGCACGCCTCCTCCAGTACGCGACTGACTCTCCGCTTTCCACAATCCCGGCGCTGCTGGCTTGATTTTCTCATTTGCTCCGTAAGCGTGCTTGCTTCTCCAGCGTTTAGAGTTCTGCCTGAAGCGTCAGCAGGGCAGCATGAGCACTGTCTTCCTGACGATGCCCGCAGACTCCGTTCACGCTCTTAACTGTTTCGGCTTTTCATAGGTCGGTCTTCATAAGATCGCTTTTCACGCCTCATCAGCTCGTGTTGTAATGCCTGCAGGATTTTCCGTTTCAGTGCCTTGTTCCAGTTCTTCCTGACGGGCGGTATATTTCTCCACAGCGGCGTCTGCAGCCGTTCGTAAACGTGCGCCTCTCTTCGGTATTTCAGCCGTGACGCTTCGGTATCGCTCTGCTGGGTCCTTGAGCATTTTGTCCTGTTGAGTCCTGCTCAGCCTTCTTTCGGGCGGTTCAAGCGCAAGACGGTAGGTTTCACGATCATCCCATAACGCGCCCGCGCTTCATCGTTAACAAAATAATCGTTCCTTGCGCAGATTCCAGATGTCGTCTGCTTTCTTATACGCAGCCTCTGCCTTAATCAGCATCTCCCTGCGCGGTATCAGGACGACCACAAGTGGAGGCACCCGCATCCCACATGGATTTGAATGCCCGCAGTTCCTGTCTGCCCAGATCTCCAGCGTGCCCATGTTCTCTTTCAGGCGGCGGGTCTGGTCGTAAATGCTTTCGTTGCGCGCTCCTCGTTCCCGCCTGCAATGCCCCGGCTTCATCGCCGGAATCTCGGCACTAGCTACCACGCAATCTGCTCCCGACACGTTATGGAACTGGCGAGCCATTGCCGCCGTCAAGCCCCGACGTCGGGTCTGTGGTCAGCTTCCCGAAGGCTTCCCATATGTCCACCTATCCACGCCGATGCACCAGAGAAACGCGCCCACTCTGGCTGATGGGTACGCAATGTGGGACCACTACGCTTACCCGCCTTAACCAGTGCCTGAGTACGGGTCTGGTTAAACGTCACGCGGCCGCCTGCCCGGCTGGGACAGACCAGCATACGATCTGCCGTCAGTCCCGCCTGATTGCCACGCGACAGGACTGAGTTTTGTTGAAATCGGACATTGAGTTAGATAGGCTCCGCCCTGATACCGATGCAGCCAGCGCACCGGTCGCCACCGCCACAGCGAGGTGAGCGCCCACCATCGGCAGGGTACGCACCGGCAAGCCCTGAACATGGGGATGATGCGCGCCGAAGGAGTCCTTCACCTGCCCTGCGTGCAGCACCATTGATCAGCCACGACTTTGCCCGCCTTAAGCTGCGTGGCCACCGTCGGTGGATCTTTACAGGCAGCATACGCATCGGCGGCTTTATACTGCCGACGGAAATCCCGGTTTTCTGCAGCCAGCGCCCTGTCGACTCAGCGACGTTCAACGACTGCCGCTTTTCGCATCATTTTGCGTACCCATAAAAACCCTGACTCTGGCCATCTGCTCGTCAAATCTGTCCGCATCCAGACCCAAATCAACGACCAGATCGCCTAAGCGTTCAGCCATGACGGACTCCTGCGATGCCTTCTGATACTGTCATCAGGACAGTACGTCATCCTCCGTCATGTTGCCACATGGCGGGAAGCGGGGATACTTCATTCCCGTTCGGGCCACGGCGACAACAGAGGCGACTCCGTACGCTTTCTTCTGCATCAGCACATCATCTTCAGGCTCTTCGTCAGCCTCGCGCCGGTTCAAGCAGACTGAAATCCAGGGTAGGCAGATGCATATCTGGATCAGGGTCGCTGGAAAAACAGGCTGAGCACGGTGTACGTCAGCCCGGAAAGTGCATATCCAGCAGAACATCATGAATAATGGGTACTGTAAAAGCGGTGCCAGGTCGGCATATCGATCCTGACATCCCGGCAGCGAACGACCCGCCAGTCGGGTCGCCCCATCGCACGCCAGTTTCCAGCAAAACTCAGCTCACCGTTGAACATTTCCCGAACAGGCTGGTGCGGGCCCGGCGTCCTGATTTATTTCCGGGGCAGTGGTCCTCACCACAACTCTCATACAGATAAGACAGCCGGTTCCACCACGTTTTCAGCATGATTAAACGATCCTAGGTATTAAGCATTCCTTAACTCCGTATTTTAACGGCGATCCATTCGTTGCACGGCATCGCGTCTTCCATGGTTATGCCACAGGGACATCGCCACCAGAACGCGCCGGTTCTTCGATGGCGTCTTCCGCAAGTAAACTTCCGGTTGCTGTTTGACTCCGCCTGTTCTGCCTGCCGTTTCATCAGGGCGATGCTCAATGCGCTGCATGAGTTTAGGTGGACAGAGAAGCGTGACGGTCACCCGTTATGTTCAATAACTGATTTCGGTTTTCAGGGAACATCGCTGACTCTCTAGATGCTGGCGGTGACGTAATTTCTGCATAAACGCAGCAAACACTCACCATTACCAACCATGGAAGAATGTTGACTTGCTTTAAGCAACGAGCTCACGTTCCGGTATGTCACTGACAGGACTCACGGGCGTTGTTTATCCGCAGACAGCACGAAGGCCTCTTATTTGATAGA * tp:A:P cm:i:80 s1:i:779 s2:i:0 NM:i:2029 ms:i:3386 AS:i:3398 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
31 27 16 utg000001l 30267 37 994S6M2I2M1D11M1I15M1I6M2I14M1I3M7D7M1I2M2I5M1I15M1D9M2I2M1D8M1D6M2D2M4I26M3I5M3D21M5I3M1D5M1I11M1D1M2I5M1D5M3D25M1D4M1I5M1I12M1I16M1I5M1D6M1I4M1D2M1D6M1D1M2D7M2I6M7I10M1D6M2D1M1D2M1D5M1I9M2D2M1D7M1I2M6I7M2D6M1I5M2D8M1I3M1D2M2D3M1D4M3I3M1D5M1I11M4D4M2I6M1D11M1D2M1I5M2I2M1I6M5D5M1I2M2D5M3I3M1D5M1D12M1I2M1I17M1I12M1I7M4I1M1I5M2I5M1D14M3D2M1D10M1I7M2I9M1D2M1I2M2D21M2I4M1D4M1I12M12D6M2D2M2D5M1I2M3D19M3I6M5D7M2D2M5D2M1I4M2D3M2D1M1D4M4D5M1D7M4D12M1I5M1D2M1D6M1I9M1D6M1D8M2I2M3I2M2I3M2I4M1I4M1I2M1D6M1D9M2D4M4I4M1I18M3D7M1I2M1D2M1D5M1D3M5I1M1I17M4D5M3I6M1I7M3D3M1I20M1595S * 0 0 ATAAACAGAACGTTTCAATCTCACTGATATCTCGCAGCAGGTCCGTCTAGTTTCGCCGTCCGTCAGCCAGAAAAGCCGGAGTGATTAGCCGCTGAGTGGGGTAAGCCGTTCGAAGCTTCGTCGTCAGGGCATCAAAAGTCGTTCATGAATATCTCATTCACCTGCGCTACAACACTCGGCGTTTCGATTCGCGTTTGCCGGTATAATAAAATGCATCCCCATTAACGGCGAGCAACCAAAACTGGCTCGTGCTTCATTTCCTCTAGTCCTCCATCCCTGAGGCGTACCCAGCATTAGACAGATGTTTGCCGTCTTTATTGTAACTAAAGATTTGCCTCGGCATGAATTCGCTACGTATCACTTAGCATCCTTCTGTCACTCTTTCGAAACTCCGACGCTTGCTGGCGTTATCGGCTCACGGTCGACTCGACTTTTCCTACCATCCTGCCGAGATGGGATTCGAGTCTTGCCTTTGAAAAATCCAGGTAACGTCGCATCACCCGGATTGACAGACGGCCTCCACGAATTGCGATTTGCTAACTTAGTGTTACCCACTGTGACCAAAGTAAAGATCAGGCCGTGACCCGTTTATTGGTGAGGGTACATATCCGTACCAAGATAACGCGTCGTCGGTACTGTACGAGGAGCGCAATCTGCTTTTCTACAACAGAACTCAAACTGGTACCGTCGGTATAAACATCGAAGATGCGGCTTGAAAGTGGCTTCTAGGTCTAATCCTCTCACCGGCGTCGCTCTCAAAATCTAATTGAGAACGTCAAGTGAACGGCAATCGCCCCGCGCCAATACCGCATTACCGCCCGTGGCAAAGGGAGTCCCCCATATTCATACTCGTAGACTTTTATACGAGCCAGTTGCGTAGGTTCAGGCTTATGACATTGATTTCAGTCGTCCGTGAGATAGACGTCCGTCACGTCAAGTTGAACGGTCAGCCCTGGAAGTAAGTTGGGTGACATTCATGTTACGATAGGCTCATATTCCCCGGCGTCTGCAGTGATCTTCTGCGGTCAGGTGGCTGCAAGCCTTAGGCGACTAGATGAGGCCGTGACCTAAGTTTAGTTCGCCGTCAAAGTGCGCCCCGTCCTACACGATGGCTCTTTCGTAAAGCGCCTGCTGCACGGCGGTGATGGCACTTTACGTTCGTCGTTCTCACGGTACAGCCCACGAGCGGAACAGTCGCTGGCGCAGCGTCCTGGCAGCTTCAGCTCCCATACGCTGTATTCACAACACGTCAGGGAACACGGCTCGGTTTACCTTCACGCCGTTTAGTGACGGACTGAACTCACGGTAGAATTGCTACACTTCCCGCCGTCCGTCAACCAGCGTATGGCGTACCGGGATGGCCCGATCCGCGTCAGCATTCCAGCGTCAGTCCGGAGCTTGGGCTGTTCACCGCATTACACGACTGTGTGATACCGGCATAGTCGGTCCATCGCAGATTGGGTCAACAATGCTCACATGGATAAGGCGAAAGCCTTTGGGAATCCGCTATGAAATCCACGGTCTTGCCGTTTCCAGCAGTTCTGTTTTGGGATCAGCTCACAGCCGTAGCTGGCGCCTCGTTGGGCTGCCACAGCCGCATCAAAGGCATCCATCTTCGGGTAACAATAGACCGACGGGCAATGGCCTGGTGAGTCCTCAACTTTAGTCGCGTCGCCGTGTTCGGTAATCCAGTCCTCAACGGAATTATGGCGGTTTTGGTCGAAGCGGAACGATGGCGCTAGGCGTATCACAGGCATACATTACTGCGGTTTATAGTCACGTCTTTATCAGACGTTGCTTTGCACGACGACGATGTCGCAGGTAGTCGTTCCACGGTTCGACTAAGCAGCCATCGCCAGCTACAGAAATCGCTGACCTAATCGCCTAATCGTGAGTCAGTAGAGATCTGCATTACAGGTGATGCGGGTAGCGCCGTGCCAAAGCGTCCGGCCAACTGACTGGTCGCAGTACGGGTCATACGGTGATAAGCCGGCTAGACCTGTTTAACCGTTGCCCGCGTCGACCGGAGTTCAATCATCCACAACACAGGCCAGCTGTTGTTGCTGTATGTGCCGGTTTAACGTTCGTAGAGGTCACAGCCCTGTATTGCTCGTTATCGAGCGTCATTGCTGGCCCGTTGGACGCCACTCGCAAGATGCATCCTAAGGATTACGTGTAGAGCTGCTGGCTGCCGAACGGCGTACCTAGTCCATGTTCGACTCACCCGTTTCCTATGACTAGATTTCAGATTATTAGCCATAGATTCGTTTATAAACTAATTATTATCCACTTTATCGTAGGCGTCGGTGCTCTGCTATCTCATACGTCGTAATTAAACGGCGGGCTTAGGCAGGTACCCATCACCGAGGCCATACTGCGTGAGGTTTTTGGGCCCTCCGTGATAGTACTGTAGTTACGTTAGTCCTCAACAGTTGTATTTTGACTCGTAGGACGGATTCCTTTAAGGCGTGCTGGTTTCTCACCAGTCCTACAGCTCGTCGTCCGACGATTAGTACAAAGTAGGCCAAGACGTCGATGTTGCAGACGTAATGGTGTGAGACTCGTGAGTTCGTCACTTCCGTACCAGCCGTTGACCTAGCCGGATTCAAATCCTTAGGCTCTCATGCGTATTACTTAAACAATACGCTACACGGATAGGGTCTCCTGTTGACTTTAGAGTCAACCGCCGGATACGTTTACCAAATGTCGGAGCCGATGATGATAAGGGACTTCAATCGCTTCGGTGATGTAGCACCTGTAATACAGTACTAGCCAGGACTGCGGTCAGACTTCGAGTCGTGCCGCGTGCGGGGTTCGCGTGGATCGTTCCCATTCGTACGCGTCCATAAAGGACCGCTTAAGGGATGCACCAAACATACCGCATTCAGACCAAATAGGCCAATCTAGAATACGTCGCGTCGCTTCGATCAATTCCTGAAACCACGTCGGGGGCGATCGTTGACGGATTCCCAATAACGGAACGATTGAAAGACGATTGCCTTAGAAGATAGGTCGTTAGAATTACCCCAGTCCGTTGTTTATGTACGCCGGGGAGTGCGGGTCGCATTGCGCGATACGAGTACCACCACGGCACTGAGAACAGGATGCTCGACAGAAGCGAGGAATCGCGTTGCGCCGCAACGGGCATCTAGGTCAAAGAATGCATGCAATGAGTACGATGGCGATTAGGATGAATTTCAATCGAACTCCAGGCACCGCGGTACTGGAGTAAGATGAAGCGGGCAGCTGGCATAAGTAGAGTGCCGTAACCTAGTCCGAAGAAGTCTAATTATGCTACCGGCAATCCGTAGTCAGGGGCCATTTAGAGTCCCCTGACGAACGCGTTCGTACCCGGCGGTTTGGGAGCCATCCCATTCAGGGTCGCATTCAACCATAGGAGCGTCACGAATCGGGCTTGTAAAGCGCGTAAATGCGGGCAGATCCGTCATGCCCGTGACGCAGTTGAGTCGGGGAAGTGCTGCCAGTTGGGTGCGTACCCTCTCATTCAGTTCAGGAACTATGGTGCAGCAGCCGCGAGTCATAAACACCAATGGAGACGATGGATG * tp:A:P cm:i:6 s1:i:64 s2:i:0 NM:i:349 ms:i:152 AS:i:110 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
32 28 0 utg000001l 22440 60 55S450M1D8M8D7M1D4M3I14M3I1M1D6M6I3M10I2M5I6M2I1M1I13M3I6M6I6M2D7M1D4M1I8M2D4M2D2M2D5M4I1M4I6M3I6M5I7M2I28M1I27M2I1M3I4M1I10M1I5M1I11M1I8M6I1M1I3M2I9M1I7M2I12M1I1M1I3M3D7M1D5M3I15M3I3M3I1M1I7M1D20M6D5M1D21M1I19M1D5M1I12M1D2M1I4M1D7M2I10M1I3M5I1M2I3M1D10M2I4M3I1M1I3M1D13M5D3M2I1M1I4M1I4M1I6M3D3M2D1M1D1M1D7M1I7M1D3M1D33M5I15M4I12M6I1M1I4M1I4M1D6M2D1M4D7M4D6M1D6M1I4M9I1M2I3M3I2M3I3M1I10M2I14M2D13M1I5M1I21M3I4M1D9M1D2M1I5M1D1M1D12M2D14M5I7M1D4M4D2M2I28M2I2M1D4M1D2M1D7M1D7M3I3M1I5M1D28M1D12M1D13M1I1M1I6M5I5M1D3M1I3M1I4M1I1M1I4M3I4M3I3M4I13M4D6M2I4M1I16M2I10M1D2M2I11M1I9M1I10M2I14M4I4M2I5M1D39M3I13M1D1M2D5M1I1M2I10M3I2M5I1M1I8M2I8M1D4M4I3M2I9M4D1M2I10M1I2M1I13M2I9M2I5M1D25M1I4M3I22M1I7M2I3M1I19M1I16M1D80M1I9M1I1M3I6M2D2M1D11M4I12M1I23M2I9M1I6M1I23M1I7M5I1M1I7M7I28M1I26M1D27M2I20M1I11M2I12M1I8M2D9M1D5M1D3M1I13M3I12M1I14M2I4M1D17M1I1M1I1M2I16M1I2M4D10M6I7M5I24M3I12M1I12M1I13M1I7M1I5M1I14M2D9M1I3M1D4M2D2M2D9M1D15M1I5M1I10M1I3M1I3M2I9M1D3M2D11M4I5M1D11M2I8M2I3M2I1M1D4M1D2M2I7M3I17M1D11M4D5M3I3M1I16M1I4M1I8M1I4M3I15M1D5M1D33M1I28M1I11M3I2M1D9M1D4M1D9M1D4M1I1M1I16M1I14M1D14M1I1M1I8M1D21M1I14M4D15M2I32M2I11M1D14M3I3M1I6M7D1M1D4M1D4M1I25M1I11M1D4M1D1M1D11M2I4M2I12M2D1M1D2M1D5M2D11M1I2M1D37M1I20M2D3M1I12M3I3M1I6M3I8M3D1M1D1M3D5M5I7M1I4M1D10M4D7M2I8M1I2M2I10M3D21M1I1M1I2M3I5M3I3M1I2M3I6M2D12M2I5M1I4M1D9M2D23M2I23M1I5M1I15M1D2M2I5M2D6M1I7M7I1M1I9M1D8M1I3M1I3M2D3M1D1M1D6M1D5M2D4M1D13M1I3M2I15M2I6M1I1M2I13M4D6M3I10M2I5M1I18M1I6M1I11M1D14M1I1M1I10M1D12M3I4M1I7M1D6M4I9M1I4M4I6M5D5M2D8M5D6M4D3M4D3M3D5M2I8M1D7M6I6M1D10M1I10M2I15M1I10M3I2M1I4M1I20M1D38M1D1M2D16M3I3M1D4M3I3M1I4M1D1M1D8M1I13M1D10M1I2M1D1M4D37M2I9M1I14M1D13M1D7M1I14M3I3M2I3M4I4M1I8M9D15M2D9M2I6M3D17M2I4M3I10M2I10M1D15M2I19M3I2M1I1M1I5M3D5M5D1M1D8M3I2M1D24M3D9M4I11M1I3M1I18M4D5M5I2M2I4M1I17M2I6M2I3M1D28M1I7M1I12M1D6M3D25M2D11M3D3M1D3M1D2M2I6M4D4M2I8M1D2M4D4M4I9M3I6M2I13M4I7M1D43M1I14M2I8M1D6M1I3M1I15M1D4M1I9M2D5M1D4M2D9M3I1M1D23M1D14M2I7M1I15M1I23M3D6M1I2M2I3M2I2M2I3M3I11M6I2M1I3M2I1M1I8M3D1M2D8M1D4M4D1M1D10M1D6M1I13M1I7M2D5M2I11M1I2M1I4M1D15M7D9M1I42M2D7M2I15M2I35M1D5M1D6M2I11M1I9M1I14M1D16M1I8M2I13M1D3M1D7M1I3M1I6M2I2M2D5M5D12M2I6M2I2M1I3M1D10M1D8M4D9M2D2M1D6M2I12M1D24M2I5M1D7M6I5M1I8M1D7M1I2M2I5M1I6M1D34M5I1M2I8M3D7M1D23M2D3M2D2M2I1M1D6M1I6M2I17M1D6M4D3M1I2M2I3M4I9M1D1M1D10M1D25M1I1M2D10M3D14M1I2M1I1M1I18M4D2M2D4M6D13M2D3M1I2M2D8M1I6M1D7M1D8M1I6M2D4M3D23M1I4M4I3M3I27M8D4M1I4M6D8M2D9M1I6M4D11M2I6M1I35M1D10M1I11M1D2M2I6M3D8M1I1M1I5M2D27M1I8M2D7M1I8M1I7M2D1M1D12M3I17M1I26M1D32M2D34M1I1M3D11M4I16M1I35M2I10M1I18M1D5M1I5M1D15M1D1M1D2M1D4M2D7M3D1M1D5M4I2M2I1M1I3M1I9M1D2M2D25M1I6M5I14M1I17M3I1M1I15M1D6M3D2M1D1M1D17M2D17M1D56M3D7M1D11M3D3M1D9M1I21M1I17M1D3M2D11M4D3M1D17M3I5M1I2M2D14M2I14M2I15M1I5M1D12M1D4M2I7M1I3M1D3M1I1M1I7M3D4M2I7M1I12M2I1M1I7M1I10M2I8M5D2M1D7M1D17M2D5M2D3M2I4M1I16M4D2M1D7M2I1M1I2M1I7M2D7M1D6M2D4M1D14M2I37M1I7M1I8M1I4M1D2M3D8M2D2M2I1M1I3M1D8M1I1M1I3M3D39M2I5M1I7M1I3M2D12M1I12M2D4M2D6M1D6M4I4M1D1M1D11M2I3M4D9M2I7M4D9M2I6M1D6M3I2M5I2M1I20M2I12M1D3M3D6M2D17M1I2M2I5M3I1M1I3M1I2M3I4M2I7M3I7M3D2M2D7M4I11M6D5M1D4M7D2M1D4M3D13M1I12M1D8M1D12M4D16M1I8M1I16M2I4M2D10M4I4M3D2M2D6M6D6M1D2M5D2M2D6M1I29M1D7M1I15M3D5M1I46M1D4M2D10M1I27M1I9M2I23M2I7M2D6M1I30M1I6M1D5M1D3M3I8M4D5M1I25M1D4M3I22M3I14M1D13M3D11M1I8M2D5M3I15M1D3M1D2M1I11M1I2M1D1M1D4M1D3M1D2M1I6M1D12M1I1M1I5M2D4M1I30M1D9M1D1M1D11M1D7M2I12M1I6M4D1M1D3M1D38M1D4M1I6M3I8M4D6M1D3M1D5M1I11M1I11M3D20M4D2M1I23M5D2M3D22M1I9M1D12M2D5M3D10M1D13M2D10M1I1M1I4M1I4M1D15M1D10M1D3M1I9M1I15M1D35M1I17M2I2M1I2M1I5M2D4M1I3M5I1M1D6M1D2M1D17M4D10M4D5M1I2M1I4M1D3M4D4M2I12M3D11M1D1M2D6M1D6M4I1M1I8M3I8M1D9M3D19M1D2M1D3M2I18M1I9M196S * 0 0 TGTTGCCTCCATGCGCAGCGACTTACTCGATGCCGCACGCAATGGTGGGCAGCATAATTGCAACTCATTCCCCAGTAGTACTGCAAGAGGTTCCAAAATCCTGCATGTGGCAAATCCTACGTCGCGAGATAAACTTATCCGTTAGATGCACGGTCGGTATTAGGTGTTTATACGTGAGGTTTTACCTTGAAGTGACAAATTCTGGATACTACCACCCCTTATTATCGCAGTCCGTTGATTCGAGCTTTCTTATGAAACCATTCTAAAAATTAGATGGTCGATAGGATTAGAAGGTCGAACCGTTTTAAAAGGGTGAAGTAATAATGAACAGAGAGATGAAGGTAAAGTACAATGAAAAACTATTCTTCCAGCGAGAAGTGTAGCGAGAAATGCTAATAAATTGATTAGAAGAGTATGATGCAGATAAATGTTCAGAAATAATTTCATTACTCACTTCCCCACTTTTGCCAAGCAAAAGAACAATATAGAATATTAAGCTCGACAGGTCAGTTAGCTTTACCGACAGGACACTATCCTCCATGGACAAAGGTAGTTGATAAAGTGAAAAGGTTAGGTGAGAAAAGCTGTTATGAAAATATAGATCTACGAGTCGACAAACCCGCTAGGCTATTGCCATCATGTGTTTCGTAAAAAGCTGAGGGTCATTTTGTGGTATATAGAAGACAAAATATAGATCATTTTCTTCCTATTGCACATTGATCCTGAAATTTTCGGTGATGCTATTATCATTCGATTCCATCGTGCCGCGACTGCAATATGGGAGAGAAAAGTCAAGTTTTCGCAGTAGATGAGGTACACCAAACCGATTCATCCCTATCATAAGTTCGTGATAGCGGGTGCAAATTTCGTTTCCGGAAACGGGTGCTATCAGTTTATGTTGAATGCCCGGCGGGCAGGAAAGACAGAGCTCTTCATCAGTTTCAAGCTATTAAATATTGCTAACAGGTATCGTTTGGAGGGCAGGAAGCACTATTGAGTGAAGTGATTACTCAACGAGAAACTCTTTCGTAAAAGGTCTACCAGGAAGTAGTTCAAACCGCAACGTTTCATAGGCTACCGTCGAATTTAGCATACAGAGCAATCTGAAACCTATTATAGATTTGAATGACTTCTGGTACGCAATTATTGGAAAAGAGTTATGTATCAGTATTCTAGCAAACTCGAAGATTTTCAGGGGATGTAGAATATGATGAAAGATAGAAAATTACGACGCTTATCGGAAGTGAACGAATACTTTTATATGAGGAGGGCTTTCCAAATCCGGTAGTAACTTGCTAACCAATGTCAGGCGAAAATCGTGGCATACCAGTGGCATCCGGAGGACGTTTGTAATGTCCTAACCGGCACAGCAGTTCTAGGACAGTGAGTCAAGAGTCATAGATCGTCGGTGGAGGACTTAGATTCTCATGCAAAAACATTAAAATCGGTAGCACTGGAAATCATTCAACACATAACCTAGGATATTCGAGCCAGCCGCAGCACGTTCCTGCATACGACTGTCCTTGCGGCTCTACCATATCTCCTATGAGCAACGTGTTAGCAGCCAAGCCAACTCTAATTTTAATACATAATGAATGATAATAATAATATCTTAAATTTCCTGTGTAACTAATTTACTATGGTTCTCTGATAAGAATCAGCGCCTGCAAAGATCAAACAACTTGTATTACATTGACAGTTAAGCAGTTAATTTATCACCTCTAAATATATCAGCATCTAGCATGCAGTAAGGGTCAAAAATAATGGAGAGTTTTATGACTAAACCATTAGGAAAGAAGACTGCCTTTATCGCACTTGCTCAATGCTGCATTGATACATATTTTGATCCTGAATTATTTCGCTTGAATTTGAATCAATTCCCTCCAACCCGCAAGAACAGTAACATTTTATTATGTTCAAAAACAAAACCAGATTATAGGATATGACATTTGGTAACAATAATGTTATTGAAAATGGAAAATGATCCATTAATGGCTTGGCTAAATTCTCGCAATACGATAGAAAACTTCAAGGCGATTTAGAAATGTATAGCGGCGAGCAAAGCTCTCTTATTTCCTGTACATTGGCGGAAAATGACATTGAGTTTATTACAAATGAAAGTATGTTAAACATTGGTAAAGTTAGTCAGACTTTGCACACAAAGGAAATTACCTTCATTTAACTGAATCATCTATTATTAAATCAGAAGCGACGATGGGTCGCTAATACGCTAAAAGATTACGAATTATTACATGCCTTAGCTATAATCTATGGCAGAATGTATAAACTGCTGTAACTCTCTTGGCATACGATAAACAATCCAATGGTACGCTTGATTTCGCCAACAACATGGTTCGACTCTTTACTTTGATGAAGCCGGGAGAATACTTATTTAAATTAAAGTACTCCCATAAGCAAATTGTCATGTTAGCATGATACAATATACGGACTCGACCAAATTAATTCCTGAAGATATTAAATATTAGTCTACGACTGGTAGATAAGCCTAAATATCACTTCGACAGAAGAGTTAGTTGACTACTCAGCCAGCCTTGCGGAACAAGCGTTAGGACGTTATCACATTCAAACATTAATTTTATAGTAAACAATTCCATCCAATTGATTTAATCAATGAACATTTGAAGATCTAAGCAGATAAATATATTTTTGGCGTTATGCAGCTGACAGCCCCAAAATAACAAATGCCTATGGCTTCATTTGGATATCATGGCTTACCAGAAAAGCAAGCATCTACTCCAATAAACCAATACATACAATTGCCAATTATAGATGAAGACTTCAGGTAATTGGAATTGATTCAAATAATAATCAAAATGTATTTCATGGAAAATAGTTAGAGAAAACGAAGAAAAACCGACTTTAGAAATATATCAGCATATCAAGACCCTGACGAAAACCATATTTCATGCGTTCAGTTAAAGCAATTGGCGTGATGTAAACACTGAACAATTGAGTCATAGAACTCTTCCATTATTCTCCTGAAGATAATAATCGCCAAATAAACCAATACTCAGCTTTACAATATACTAACTAACCGCAGAACGTTATTTCATGGGGCATACGTTTAAACAAAACGATTACTCCATAACAGGGACAGCAGGCCACTCAATATCAGGTGCAGTTGATGTATCAACACGGTTCAGCAACGCATCGTGCACGTCGAGCAACAGATTTCTTCCTTCGTTGCGTCCCAATCTGCAGCATCTAGCAACAGCGCAATATGCTTCCTCCAGCCTGCATCAAGCCATTTTGTTCTTTAAGCCAATCCCTGAGTTTTCTGCTTCTCGTATCCTTCGCCCCAGGCTGTTGCCGTTCCACTTCTGATATTCCCTCCCGGCAAAAACAGAACCCTTTTCTCAGTATAAACGAGTCCCGCAGCCTACTACGAATTCTCGAAGCTGGAGCCATGAACCCGGTCAGCTAGTTTACCGCGATGGTCTTCAACGGAGATGCCACGATGCCTCATCACCTGTTGAAAACAGCCACAAAACCGGAGCCGATATCTGGCGGTGCAATATCGGTACTGTTTGCAGGCAGACTCGGTATGAGGGATATGCGTCATTCGCAACGATTCATTAGTTCCGGCCAGCAATTATAATTTATGGTCCGTGGTTGTTCACTCGGTTGAATCCCGCTGCAAGCCTCACAATATAGTTAAATGCAATGTTTTGACGGTGTTTTCCGCGTTAACGCAGCGTGCTCGTGATGGTGTTAATTGAACCAATACTACCCAAAGGGATGGGAGCCGCCCTAAGGATAACACTCCAGATCAACTGCCGCGCATCGCAACTGCGCACCGATTGCACGGCGGCTAGGCTGTACCCGGACAATGAGTGACTGTGGCTGCCCTGACTGTCAGCGTTCGCTCATATACGAGCAATACTCGTGTGCTGTTGCTTCCTTTAACTGTGATAAACTTCCTGTAATGGTTGCTGTTTGCTACTGACTCCAGCCGCTGTTCATCCTTAAACTTGTACTGTCTTAATCTATGACCCTCGTCTCCCCTGTTGAACCGCTCAGACTGTGAGCTGAGCCCCCGTGTTATTCGTCGATTTGGTGCCGTAATGGGGACTCTTGTGCTGTTGTTTTCGTCCCGTAATCAAATAGGGTGGTTTTCGTCCCCAAATCCGTACCGGATGCACTGGCACTGTGCTCTGTGCGACTTAATTCCATCCTGTTCCTGAGACAAACCGCTAAGGCTGGCGGGTTTCCCCTTGATTGTCCATAGGGCATCTAGGAGCACATAGCATCCGGATACGCGACAGCAAGTTTTGGTGAGGCTGATTTGTGTCGACTACAAATCACGGGCTATCGCCAGACGGAACGATATCTGATGGCCAACGGGATCGGCAGGACGGTGCCGAAGGTCGAATTCAGCGGCCCCCAAGGTTCAAGAACATCTGCAACGGAATATTTTTGCCAGAATATCCGTGCCAACCTGAGTCAGTTCAGGTCAGGCGTGCATGAATCGATTCCCAAAATACGGTAATTATTTTCGCCGTGGAAAGCCTGCCAGCACGGTTAATGTCGATTCTTCAGTTGTTACCCCGGGGTTTAGTCATGGTAACAAAATCTGGATGCTTCCCAGCGCTGCGGCCGTTGATTCAGCGTATTCAGTGCGTCAGGTGACGCGTCGATAATGGTGAAATCGCAACCCGCGTACAGCGGTTCGCGGTGATGTTGTTTAGACTCCCGGTTTCTTGCTGTTGGCTTCCGGTCAGTGCCGGACTTCCAATCGGCTTTTCTGTTCGTTCATCCATTACCACCTTAACCGCCTTTGGCGTTGCAGCAAGCGTTTCAGACGTGCTGTTGGTTGCACTGCTGAGCTGCATGACCTCCCCTTTCTCGTTGTTGTGTCCGCATCCTCAAGCCGCGGGTAATGGTTCTTAGTTTGCCGAATTTGCACCGTATTGCCGCCGCCTTCTGCCGCACCTTTTTGCTCTGCACATTAGCTGATACCGCACTTCCCCGCAGCCTGTCTATAAGCTTCGTGGATGCCGTTGACGAGCCCGCCGCTGTTGCGTGCCCAGCGGCAGAGGCTCCGGCTTCGCTGCTGTTTCAGATGACCTGGCATTCGTCTCGGACGTTTTGCCGCCCTGGCAGAATTTTCTGCCGCCCGTTGCCGAGGAAGCTGCACGACCGGCACTTGATGATGCACGTTCGTTTCTGATGATTTGCTGCCTCTTTTGAGGCCACCGCATCTCGTGCTGAAGTGTGGCGGCCTGGATGGATTTCGTGGCCCGGTGGAGGCAGACGGTGCTTACGTGTTGTGACGGTGCAGCATTCGGTTTCTGACGATTTCGCGCACGGCACTGGTGGCCGCCCCGCGTTTGGATATGCGGACTGCGCGGCGGCTATTCGCTTCAGTGGCCTTTGCTGTGCCGCTTCTGCGCCGGAGGACGCTTCCTGAGCTGACGATGCAGCCTGTCCGGCGGGTCGGTGGGAACGCGCGTCGGTGGGCTTGAGTTGCATCAGTCACGGGGCCCCTAGAAGGCATAGTGGTGATGCAGCTCGCATCGCCGGCTGATTTCTTCGCGTCTGCCGTGACTGTGCCACCGACGCGTTACGCTCAGAGCGCTCTTCCACCATCAGTTCCGGCAGCGGCCATGAAACATCCTCGCGTCATGGCCACAGAGAAGCCATTCAGCGTCCCCGGTTGAATCTTCATACACGGTGATGGTCCCGGCGCGTCAGATACCCATGTAGGAAAACCGTCAACCTGCAGGGTACGTGACCCACATCCGGTATCACGACGCGGCTTCATCCGGATTCTCTGAGCCCACCGTGTTCACCACCACCGTGGTGCTGGTCAGTTGGCTTTCAGCCTGAATGGTGCGTTGCTCTGTGGCTTTTCGCATGTGCCGTTACACGACTCCTGAAATCTTTACTGCCATATTCACCCCACAAAAGCCAAGCGGTTCCGGGCTGTCATAACACTGTGTTACCTGGCTAATCTAGAATTTATAACCGACCCCAACGATGAATCCGTCAGTACGCCAGTCGCCACTGCCGCCAGCCTTCAGCAGCAATATCAACAACGACGGACGCATGGATTAATCTGTATATACCTGCACTCTGACGCCCACTGAGGTATGCCGCATTGCATTTTCGTCCCTGGCAGTGTGGTCGTTCCTTTCATACCCGGGAGGATTTCCGTCTTACCGTAATCCATTGATGCGTAAGCGACTTAGCCACCACTCCAGCGCCGCTGGCGTACTAGACCTGCTTACTGATTTGTAAAACCGGTCCGGCCATCACTACACATAACGTCCCACGCAGGCTCTCATAAGTGAAACGTATCCTCCCCGGTCATCGTCACTCTTTTCGACGAAGCATCCAGGGAAGCCATCACCCCACACTGTCCGTCAGCTCATAACGGTATTCACGTTAGTAAGTTCGGACGACTCGGGGTATCCCGCCCGACAACGAATGTACCCGGTTTCACTTGAAGGTAGCCCACCGTAAACGTACCCTGTCCGTCGCACGGGCCGGACGTCACCGCAAGTGCGGCAAGAAAGAGCAACGGCAATACACATAGTACGCATCGTTCACCTCTCACTGTTTATAATAAAACGCCGTTCCCGGACGAACCTCTGTAACACAGCCAGACCGCTGATCGCCCGACGCCTGTTTCTTAATCACCGGATAAACCTGCCACATCGCTGGCAAACGTATGAGAATATCCCCGAATGCCGTGGACGTAAGCGTGAACGTCAGGATCACGTTTCCCCGACCGCTGGCAGTGTCAACAATACGAGAACACTGTACCCTCGTTCGCCATGAACAGCTAAATCACCGCACCGTTCATCAGTACTTTCAGATAACGATGAAATACGTTGTCCATGCCCTAGTAAATCTAGTCATTCACGAGCGTCACGGAAGGCACCACTATCTGGCGATCAAAGGATGGTCATCGGTCAAACCGTAGACAGGACCTGTATATGACGGCCAGTCCACTGCTTTCGCTGGCCGGAAAGCCAATAGCGCCCCGCCTTTACAAGCTTGACGATGTTCCCTCGTTTCCTCACATACCGTACCGTTATCGTACAGTTTGCCTCATCGTCACATTACTGAGCGTCCCCGGAGTTCGCATCACTGCCACTGGTATCCGCATTTAGCGGTCAGCTTTCCGTCCATGTTAAGGAAAGGCCGGGATGCCGCTTATGGGTAATACTGTGGGGGCCGATTTGAGCGCGGGTCGGAACACGTCGTTCATGAATATCTGGTTGCCCTGCGCCGAACATCGGCGTTTCATTCCCGTTTGCCGGGTCAATAGAATGCGATACGATTGGGCATGAATAGAGACCGTGCTTAACAGTTGACTGGCCGGTGAGACAATACCCGCGACATAATGTTTGCCGTCTTTGGTCTGCTCAATTTTGACAGCCACATGGCATTCCACTTATCACTGGCATCCTTCCACTCTTTCTGGAAACTCCTCCAGTTGCTGAGTTATCCTCCGTCAGCTCGACTTTTCCAGCAGCTCCTTGCCGAGATGGGGGATTCGGTTATCTTGCCTTTGGAAAAATCCAGGTAACCTTCCGCATCATCGCTCGCCCGACCGACGGCCTCCACGAATGCCGATTTGCCAACGTCACACTGCGGATATAAAGTAATAATCATGGCCGGCCATTTGATATTGATACTGGCGGCTATCCAGTACAGCGCCGTACCAAGATAACGCGTGCTGGTTTCAAACCTGTCTGATATCCGCAATCTGCTTTTCCAGAACAGAACTCAAACTGTACCGTCCGTATAAACGGCAGATGCGGCGTGTGTGAGGTCCTGAAAATAGCCCGGCGTCAGCTCAATCCTCGACGTGCTGCCGGTGCGGCAATCCGGAACCATCTAAGCCGGATGCTCTCCCTGCTGCCCGCGCATTTACCGCCGGACTGTCAGCCTGTAGTTCCCCGCATAGAGTTGCTGCGTGAAGCGGTATGTGGTTTCCGTCGTCCGGGCCGTGCTGACCAGCTCACTGCCGTCGTCCGTTAGCCGTCATAACGATAAGGAAACTCATTCACGGTCGGTGTCCCAACCGCGCCCATAAGCTCTTCGCCATGTCCAGTGGGTGCGGTCAATCATGCGCCACTCCATGAGTTAGCAAGGATTTCACGTGCCTATATGTTCACGTCAAAGTGCGCCCCCGTTATCCACGATGGCCTCTTTCCGGCACATGCTGCACGGCGGTGATGGCATACGTGCCGTCGTCGTTCTCACGGATACTCACGCAGCGGACAGTCAACAGTGGGCGCAGCGTCGGCAGCTTCATAACCATACGGTGCAGCATACGCGTCGGAGCCTAACATTTTACTTCACGTCGGTAGACGGGACCTCACGCTCCACGAACCGGATTGCCGCCACTTCCGTCAACCATTATCAGCGCAGTACTGGAGGATGAAAGATTTCACGGTGAGCGTGCGGCGTCCGTGGCTGTTCGCCCGCGCCAGCCCATTGATACCGGCATAGTCATCATCGCATAGATTTTCAATAACATCTCGTAACACCCTATTAATGGAACGCTGATCCTGGGGCCTCCTGCAGCTTGGTAAGCTTCAAAGTGCATGTTCGGGTTTCTTTCCTTACGACCCCTAACGGCAGGCTAAGTTACGTAGAGACAATATCA * tp:A:P cm:i:170 s1:i:1381 s2:i:0 NM:i:2360 ms:i:3906 AS:i:3906 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
33 29 16 utg000001l 40813 60 5S6M2D9M3I1M1D5M1I4M2D18M1I3M1D12M2D3M2D16M4D2M1I6M1I25M1D2M2I4M1D15M1D3M2D11M2D3M1D2M1D2M1D12M1D10M1D13M1I2M1I12M3D10M1I3M1D3M1D7M1I5M2D2M1I2M1I3M3D30M2D14M2D3M2D5M8D1M2D6M2D13M1I4M1I1M2D3M2I7M1I4M2D11M1D15M2D10M3D6M1D7M1I10M2D6M1I6M2D6M1D9M2D4M2D2M1I21M4D23M2D11M2I10M3D37M1I1M2D13M1D3M1D18M3I5M6D8M4D5M1I12M1D4M1D9M2I3M1I5M3I2M1I14M1I8M3D3M1D4M2D3M2D1M2D3M1D1M1D7M1I5M2D16M2D3M1I10M1I10M2I8M1I3M1I6M1I3M1I11M1D5M1I7M3D8M1I25M1I3M1D2M5D5M5D6M2D12M2D5M1D3M1D41M1D25M1D5M1I4M10D7M3I18M1I3M1D1M1D5M1I1M2D3M3D13M1D6M1D2M1I7M3D12M1I3M5D6M4D13M1D8M3D15M1D12M3D10M1I11M1D11M3D5M2D2M1D16M1I1M1I1M1I4M2I1M1D31M2D10M2D5M1I13M1D6M1D9M1D23M3I23M3D11M1D2M1D10M1I3M1I64M5D2M3D6M1D5M1D7M1I13M3D4M1D3M1D1M1D39M1I1M2D6M1D7M5D7M1D1M2D12M1D2M3D14M5D4M1D3M2D8M5D6M2D4M1D10M2I15M1D7M2D26M1I37M2D3M1D10M4D1M2D7M4D15M2D17M2D3M2D13M4D19M6D2M1D10M3I38M2D2M1D8M1D22M1D12M2D18M2D4M1I3M1I2M2D3M1I9M2I6M2D3M2D6M1D3M2D1M1D8M1I4M1D9M1D15M1D3M1D6M2D7M1D14M7D7M1D4M2I16M1I2M2D8M2D8M1I15M1D9M1I1M2D9M7D12M3D14M3D10M3I2M1D2M3D7M4D7M2D1M1D14M1I12M2I6M2D3M1D26M4D6M1D3M2D5M1D6M1D7M1D1M4D8M1I16M2D25M1D7M1D15M1I1M1I1M1I8M2970S * 0 0 GTGGCTTGAAGGAACGGAACAGGCCCGCGCCTTCATCGAATACGATGATATTGTCACAAGGCGTCGGCTCAGTGGGCTTCGATATCGTCGGTACGTAGGACTTGTCACGCTTGCTCCACTGTCTAGTGCCAAATGCGTGATGTTATATTCACTGCGGGCTATCACTGACAGGATCGAAGGCTTCACGGTCATGGTGTATTTGCCTTTAAGCACGGCAGAAACTTCTTCGCACTCGAGACCTAGTGGAGGACCGAGCTCGTCACGCATGTTCTGCATGATGATGCGACGGCGGTAAGCCGGCCGAGATTGCTTCATACGGCAGGCGACGAGATTGATGCGGGGATTCACTTCATGCTTCGTGAGTCGACATATCCGGCGTAAATTTCAGAGGGAGTGCCACGAGGAATTCATATTCGCCGGGCAACTAGTAGAACGTACAGCGGTTTATACCAGTCCGGAATTTGTGAGAGACCTTCCGTGGTGAAGGATAGCTCACGGAAAAATGCACGCAGAAACAGCGGATCAAACTTAAATTTCTGCTCATTTGCCGCGCCAGTTGGGCGGTTGTGAGATAGACATAAAAACCCCGATTTCAACAGGCGGCTTTAGGTGATGAAGGGTAACATAAACGATGGCCCGCATGGCAAACGCATGCGGGCGAGGCGAGCGCGTCTCGTTCGTCTGACTCATCAGAGCAACATCCATAACGGAACGTGCCAATGTAGAACGTCAGGCGTGGTGCTGGGGTCTGGTGCCTCAGCATCGCGCAAGAATGCCAACGGCAGAGACCGTCGGTGCCATCCCACGCAACCAGCTGCCGGCTGTAGAGTAAGAGCCATTGCAGGCTTCGCACTCACGGCCGGCGCGGTTGCGGGTATGAGCCGGGTCACTGTTGCCCTGCGGCTGTAATGGTAAAGGTTTCTTTGCTCGTCAACGCTCCTGTATTCGGGAGCAAATCGTTAACGGATCCAGTCATTCTCGTTTGCAGCCATGCTGCCCTGCTCTAGACGATCCGCAGTACTGCAGCGGCACTGGCTGAGGCGGGAAGCGGAGGCTTTCACGGTCATACCGGGGTTTCTGCCCACGCGTGCCTGTTCTTCGCGTCGTGAGCCTCCGATTTGGGCTTCCATAATGCGCTGCGTCTTCTGCTCCGCAACCGCTGCGGTGATCTGCGTTCAAGTGGCTGCGCCGCTGGCGTTCTCGCCCCGTCCCGGCACACGTCAATAACGTCAGCCTGTGAAGCAGTGGAGTATGAAACAGTTGTTGATTGAGTCTTCGTCATTCGCTCCTGAGAGACGGGATTTACCTAGATCCAGTGCATCACGCATCTCGGCTTCCGCATCGGTGCTGTTAACAAGTTCATGATAGGGTTCAATCAAGGCCTCCTTGACCGCTGTACTGCCTGGTTCAGCACAACGTATGCACGGACAGGCCGGTATATGCCGACGAGTCGGCGCAACATGAGATGCTACGGGACTGCAGTGGCCGGACGTCATCCATGGGGTCGATGCCACTTACGTGCCCCCGTAAATCAGCGTGATTTCCACATGTTCTCCAGCAGCACCGTAATTACTGTGAGCCATCCATGACGCCGATGGAGCCTGTCCGGGCACGCTTCGATTAGCACCGGGAAGAGGCAAGCGACCTGCACTGCAGTTCAGTCGTTGGCAAGCGGATCGCCTTTTAATCGACACGGGCGATGATGTCAGCAGAATGCCCCGCCACCATCCCGCCGGCGTGTCCATATCGAGCAGAATGCCGTCACCATCGGATCGCTGGCAGCCTGTTGCAGACGGCGATAATGCCGTTGGATCAATGTACCCCGTACGGCTGCAGCGTGGCGCAGCCTAGAGTGAAGCGCCCTAATGCAGCACGGCTCCTGCGTTCATGACTGATAACTGCGGGCGTCGTAGTCCGTCATAAGCCGGATAATGCCAGCGTCGGGCTGGGCCTCCTGGGCAGTCAGGCTGTCGCCGCACCGCATCCGTCAGGCTGCTGATCCCAAGCTGAGTGCAAGCGCAACCCGCGGATAGGGTTCAAGCATCAGGCTCATTAAAGGCCACCTGCGACTGCGGAGTCGCTGCCATGTCGTATAGTTCTCCTCCTGTGTTGAGTCCCGCAGCACGGATTCAAATGCTGCTGCCAGGCGGCTTTAAAGCGGCTGCACGGGATGGCTTCGACAGGACCTGCTGGGCAAATTTCCTGATAGTCGTCACCGCGTTTTGCCGTACTTCTCGTAGTAGTACTCAGTCCGGATGCGGAGCATTAAGAGACTTATCCCGAACTGCCTACAGCTCGGAGCTTGATGACCGATCCGATGCTGGCTTCATATGCATATCTCCAGCATTTGGGGTTCCCCGGCTCGAAACAGCCGGCGCTGAATAGAATGCAGGAGAATTCTAGAAAGGTCGCCTCGTCGCCTTACCAAATTCAAGTCAGAAACATGGCTCGTCGACGTGAGATGCTCAGACGAACCTGAGCGCCAGCTACAGCGTAATCGACTGCCTACCGCAAGCCCCGTCGTACTCGTCGATGTCGTGAGCATTCTAAAATGCTTTGGAGTAGGATAGAGACCATGCAGGGATGCAGTTAACCTAAGCAGTAGGATCGAAACCGGCCAGTCCCGAGCCACTCCTGATGTCGCAGGAGTCAGGGCACAGCTGCGTATCTTCAGCTTAAACTCTATGGGCGGATACGGCACTTCAGCTTGAGATGCTTCAGTGCGTCTTCGGGCCACTTACCCTTGCCCTAGCTTTGCTCCGAACGGCCGTGGAATAAATTCATCGTGAATGAACCGCGAGCGATAACCCTGGTGCATCCTGTCACATTTCTGCTGCATCGAGCCGCATCGCGTCTCGCATGGTAGGTCTAATAGCCTTGCCCACGGTTCAACATTCGGCCCTGCACCGGCGTCCAGGTCGGTTGTCCTAATTGCTCTTAATTCGGACTCTAATCCCTATGTGCAGGCCGGAGACGAACTGGTACCATAGAGGAGTCGCGGATGGTCCACAGTCTCGACGGATATTCCCGAATTCAACGGTCGCGTTTAATTCCTGCACCGTAAACGTACGGCTCTTCAGCTGCTTTAGACCCGGAGCCCGGGCGGTCAACCCCGATGGCCGGAGGCACCATTGAGAACTCTGCGGCCGGAAAAGCCGGACGAACATCGTGATGCTGAGTTGGCTGAACAGCCACGTTATTAAGCCCGTCGTCGGATGCCACACCTTCTGAGGCTGCATCATTCAACGGTGGGTTCGGCCCAACGTCAATCATGCGTCAACTAATGCAGTTCCGGCGAATCGCTGCCCGTCGGCTCCACGCGCGGTGGAACGGCTTTCCGCTGGCCCCTCTATCCTGCGTTCCCCGGATGCCAGATAGCTGAGTCTGGCGTCAGCATGCTTTTCGTACACAGAGATCTCAAAGTGATATACGCGTTTAGATCGTCTTCTGTATTGTCGACCCAGTTCTAGTCATCAGACTGCGTCCGCGGCGGCAAGTCTTCAATTCAGTTAAATCATGTGTAACAGGCTCGACCCGTACGTCTTGCCCGGTGTTGTATTCTTGGACCGGACTGCCTCTTCAAATCCGTCGCATGCCCCTATGATAAGACTTACGGGTGTAATGGAGTGCCAGCGGCTTCAGTGATCGACTTAGTTATTTATTCACAAAATCTTTTTATGCATCGCTTTCCTGGTGCTGTCAGCGGTCTAACATGCTGCGCCGTCGGCAAGAGGCATCCTTGGAAGCAACGGAAGCTTCATCATTCAGGTTGAAAGGTTAAAACCTGTATGTCGCGGTCGCTCCAGATTCATGCCATACCGTTTGTTCATTAGGTGATGCTCAGTCACCTTCACGTCGCTTTAACGCTTACGCGCAACCATTTCGGAACATGGTGGGTACTGTACCTAGGATAAGGCGAATAGGGCAACCTTCGGTTAGATTTCCGGCGGGCCTTTTACTTGATCTCCGCAAGGTCTCAGGCAGCACTGAGATCGTCTTCATCGTAGTGGCGGCCAGAAATATTCATTCGTGCTCACGTCGCTCTCAGTGCAGAATTAAAGCAGTCGAGCTGGGAATCCATCGGGCTTCCTGCCCGGGAGCAAGTAGAGATACTTATTTCCTGGTTCATCTGGATTCAGCGGTCTAAGTCAAGTTTTTCGCTCGTCTCGCTAATTAATCCAAAAGTTGAAAGTTTCCTTCGTTCGGGGTTACTTAGAAGTGAACCTGAATCTAAATGTCCAGATGTGATCCTGTCAGGACCGGGTAAATCTTCGCCGGAGCAGGTACGAATGCGGTAAGGTCAAAGGGAGTGGCTTCGGCCGATAGGGCATGCTGTGCAGGCCTGCCTGATGACGGATGCTGCGCGACCTGGAGATTAAACGAAGCGTTAGAGTGGCGAGCCAATAGGTTCTGTTAATCAAGCCTTATACCTCAGTGCATGAGACGGGATATGACATATGCGGCATACCCGCGCCTGTAGATGAGTGTCTGATGATAATCTACTTAAGCCATTTGTAGGTGAGACGATCCGCTTTACACGAGCTACTACTCCTCAGCTTCATACGGATTACCCACAGATCGTGTCGCATACTTCTATGTTTATCTATGGGAGCAGCGAGATAGATTACAACCCACTAAACCTAGCTGACATAATTTGCTCCTGGTATTTTGTAGCCTTCCCTACTAGCCCACCTTAAAACGTTATCTCGGTCAATTTTGCCTCCACCTACACTACTAGGCTAAAGGATACCATGATTACTCTCGTATTCTATTCGGTTTGGACTAGTCTATTCAGTCCCGACAATCTGATAGTAGAACGGGCTATCTACCATACCATAACCCCATTAGAAATTTACAGGGTATAGCTCAACGTGACTAAGTTAACTACAATATTACCTTAAGACTCCAGTTAACTCTATACACCCTTATTTTCTTAAGAATCTGATCAAAGTCCATGTTCGTAGGCGACTGGTCTAATACCTAGTCTGTAAGAGATAAACACGCTGGTATGTATCATCTATACTTATTGACTGTCTCTTGTGTCCTGTTAACACTAATACTAATGTGCCGGTTATCCCTCCTGGTTGCACTCTTTACTGTAACATTTAACGCATAAAACCTGTTATTCGCTTCGGTGGGACTATCCAATCGACGCTCCCTTCACATAGGGAGCATTATAATGTACGTGGACTACTACCAAAACCAATCAAATTTGACGCAAGTCG * tp:A:P cm:i:35 s1:i:284 s2:i:0 NM:i:657 ms:i:1212 AS:i:1212 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
34 30 0 utg000001l 9015 60 166S12M1D1544M38I6M3D24M4D1M1I2M1I5M1I13M1D9M2I3M1D7M2I1M1D2M1I7M1D8M3D5M8D2M1D7M14D14M2I10M2I3M7D2M3D1M1D2M4D6M1D5M2I13M4D5M1I10M3I3M1I22M1D7M3D4M3D13M6D3M3D2M1D4M1I7M2D11M4I6M3I3M1I5M3D7M5D13M2I1M3I3M1I6M1D4M1I6M2I4M2D14M1I9M1I11M4I10M2D24M1I4M2I5M2I6M2I11M1D7M1I1M2I9M3I2M1D6M1D4M2D14M6I8M1I3M4I2M4I11M1I13M1D11M1D16M1D2M3I2M1D9M2D8M2D1M2D2M2D6M3I6M1D1M3I7M2I6M4D8M3D2M1I7M1I1M1I5M2I8M4I2M1D3M3I20M1I2M2D4M1I1M2D6M2I26M3I8M1D7M1I5M1D8M1D5M1D16M1I3M5I1M1D2M2I11M1D6M1D1M1D2M2I24M1D5M3D1M1D5M1I6M2D19M2I18M1I1M1I13M5I6M1D19M1D8M1D6M1I13M4D14M1D6M1I3M1I1M1I1M1I23M1I3M4D2M2D1M2D4M5D19M3I2M1I23M1D5M1I12M4D2M1D1M1D3M4D4M2I11M1I13M1I1M1I8M2D3M1I3M1I4M1I10M2I6M3D3M3I12M3D2M1D1M1D11M2D4M3I2M2D4M1D4M1I13M1I3M2I11M3D3M1D4M1D9M1I7M1I2M1I18M1D8M3D2M1D3M1I1M1I1M1I7M2I3M1D14M1I1M4I5M2D18M5D2M1I5M2D6M3I15M1I11M2D3M3D1M2D8M1D7M1I4M5I17M1I7M1I12M8I5M2D5M1D6M1D2M2I2M1D5M2I1M1D3M2I2M1I3M2D4M2I8M1I19M2I7M1D2M2D3M1D22M6I3M1I2M2I9M5I2M5I2M2I3M3D4M2D5M2D7M6I1M1I4M1D30M1I18M1D2M3D3M1D3M3D1M3D18M1I10M1D22M1D2M3D6M3D4M2D20M2I9M1D4M3D4M1I5M2D24M3I10M1D4M3I2M1I5M4D2M2D13M1I4M1D7M4D29M9I19M1D5M4D34M7D5M1D8M6D2M1D6M1D14M4D17M4D3M2D4M1D6M2I5M2D7M7D9M1I3M1I4M3D8M3D16M1I3M3I3M2I4M1I14M1I2M1D5M4D10M1I42M1I19M1D2M2D35M1D3M2I5M1D12M2D1M1I8M3D1M2D2M2D4M3D6M1I6M2D11M1D1M3D1M3D8M2I25M2D4M3I23M1D13M2D7M3D2M2I10M1I5M1D6M1D4M1D6M1D7M2D7M1I2M3D1M1I4M5D4M3D1M1I46M4D6M1I9M3D1M1D3M1D10M2I8M1I7M4D9M2I3M4D20M2D4M1D15M2D2M1I16M1I6M2D3M2D9M1I3M1I3M1I3M2D6M3D12M1D5M1D2M1D3M2D33M2I7M1D4M1I4M1I4M1I1M1I11M3I3M1D16M1I2M1I12M4D1M1D5M1D13M1I15M1D4M1D8M2D15M36D11M1D2M5I29M1I15M4D13M1I20M1D10M2D1M4D2M1D12M2D2M3D21M2D8M1I4M1D18M2I10M1D15M1I9M1I21M1I35M1D13M2I6M5D36M1D5M2D15M1I6M1D9M3D7M7D2M4D8M5D1M5D1M3D10M3D5M3D2M3D17M2D15M1D3M3D10M1D3M3D2M1D2M2I9M6D7M1D1M1D1M1D5M1I3M1I6M1D10M4D36M1D18M2I2M3D28M2I3M1D2M1I9M2D12M1I8M1D42M3D11M2D7M5I27M1I11M4I7M2D5M4D2M9D4M3D2M4D8M2I9M8D1M4D4M2D7M3D1M4D6M1D2M1D10M1I15M1D4M1I3M1D16M1D3M1D5M1I6M3D20M3D1M1D2M2D2M1D15M1I6M1D2M1I13M1D16M1D7M2I13M2D6M1D5M2D2M1D5M7D2M1D38M7D3M1D13M3D12M1I7M1I6M1I24M3D1M1D2M1D4M2D3M1I7M1D3M1D1M4D35M1D5M1D1M1D5M1I3M2D10M1D17M2I1M1I15M2I23M2I2M1I1M1I10M7D3M2D23M1D6M1I7M3D10M1D2M1D7M1I11M2D10M3D2M3D6M3D8M5D1M1D4M1I4M1D32M6D8M1I1M1I3M3D2M1I6M1I8M1D12M1D8M3D5M1I7M1D20M1D5M2D8M5D2M1D1M1D17M1I10M1D6M1I4M2D12M1D5M4D7M1I11M1D24M4D2M4D1M3D9M1D7M3D9M6D1M4D9M3D16M2D22M1I10M3D3M1D5M6D8M2D2M1D10M3D4M1D10M1D19M1I4M1I7M2D1M1D5M1I4M3D13M1D10M3I4M1D13M1D5M1D6M1D6M7D11M4I1M3I11M1I10M1D7M4D1M4D13M2D2M1D1M1D10M1D3M1D7M2I5M2I16M2D1M9D16M1D3M3I19M1D11M1D1M1D2M1D19M3D14M1I6M3D8M3I5M1D1M1D2M2D4M1D6M1D15M3D11M1D12M2I4M2D9M2D8M2D1M1D8M2D4M2D13M2D34M2D8M1D30M2D7M1D5M2D10M1D3M1D1M1D5M1D2M3I6M3I2M4D9M1D1M1D6M2D4M1I20M2D9M1D3M1I1M1I8M1D3M7D4M4D4M2D8M4D1M1D2M1D5M1D15M1D6M3I19M2D22M1D11M1I7M1D4M2D20M1I25M4D11M1D7M2I21M4D6M2D11M3D1M2D16M2D5M822S * 0 0 CCAGTCCTTGTTCGCTTGGCCTAATTCACGTTAAATACGATGTCGCTGCGATGAATATGGAGTAATGGAAGCGCGTAATGCTTCTATAGCAGAGGATTTGTTCAGTAAGCGAGCGCGCGCTTCAATAGATTGCCGGCTCAGAAGTATACCGCACAGAAGCTTTGTCCTGGCATGCCCATAGAACAGCACACATGTCGCGTATGCGTCACGTTCACGCATCAGGCGATATCGTTTAGCCCACCCATACAAATTCGGTTCTCTTATCGCTCTGCGCTCGGTCTTCGCTGTCGGCTCCGCTCTGCGGCGGTCAGTCTTCCTGTTTACCATTGCTTACATCGATCCGAAGCATCCGTTCAACCTCCGACGGAAGGTCGTTTTCTGGCTCGTGCCGCATTCGCCAGAATTCCTTAACGGGAATAAATCTTTCTTTTCTTTGTAATAGTGTCTCGTTGTGTCCGCAATGGGAGAAGGCCGCAGGTTTGAACCGCGGTTTTATCCTCGTCGGGATTTTCAGCGTTTGAGGGATGCACCCATTCTGGCGCTTTTTATTTGGTTACGACCCTGCCGCCTTGCTGCTTGATAATATTCATTCTGACGAGTTCTAACTTGTAGTCATTGCCGTTTGACAGGTAACTTTGTAATCTCGCTACAGTTGAGAATCGGTGATTCGTCCATTGGTTTATTCCCAGCTGTCACAGTAGCAAGCAGCACTACTTCCTTAAACTGTCGCTTGGTCAGATCTGCCCGAATAAGCCTCTACCACCAGCATATTTACTCAGTCTGAGTAACCATCGAGATCTGCCACATTACTCCTGTCCAACAGGTCTCTATGCCGAAGTTGAGTATTTTGCTTATTTGTCATAAGCCGAGACTCGAAGCGGGAGGGAACTCCATTCTCCGGTTCCGGCCGCTTGCCCGGGCGTTGATTAGTGAGAATCGCAGCAAATGTCGCGCGCCAATCGAGCCATGTCGTCGTCACGTACCGCATTCAAGAACAGCAAGCAGCATTGAGAACTTTGGAATCCAGTCCCTCTTCCACCCTGCTCAATGCGACTTATCAACGCCACAGCTTCCTGTCTTCCCCGTTCCAAGCATGCGATTTGTTAAGCAACGCACTCTGGATTCGTAGAGCCTCGTTGCGTTGTTGCACGAACCATATGTAATATTTCCAAAATAACAATTGATTGAATCTTACAAATAAATGCAGCCCAGGCTTGGTTTAATTTGATGCCCTTTCAGGCTGGAATCATAGGGGTTATTTATGCTGTTGTTTTGTAGAAGCGAGCGTCCGCCTCCGCATAAACGCTTCCATCAGCGTTTATAGTCAAAAATCTTTCGGCCTGCATGAATGGCCTTGTTTAATCGCCATTTGATACGCCGAGATCTTTAGCTGTCTTGGTTTGCTCCGATATTCTCGTATTTCCGGATGCGTTGTTCAGACAATACTGCTCCTGCGTACCGCCAGGTAAATAGTCAACACGCACGGTGTTAGATATTTATCCTTGCGGTGGAGTTACTGACTTGAGCACAAAGAAACCATTAACAACAGAGCAGCTTAATCGCACGTCGCCTTAAAGCAATTTATGAAAGAAAAGTGAAGTGGGCTTATCCAGGAATCTTCGCGCCGAGGGAGCAGTTCTGCTTTATTTAATGGCATCAATGCAGTTAATCAAATTAGCCCGCATCTTGCTTACAAATTCTCAAAGTTAGCGTTGACGAATTTAGCCTTCAATCGCCAGAGAAACCTACGAGATGTATGAAGCGGTTATGCAGCCGTCATGTAGAAATGAACTCTGAACCTTTTCTCATGTTCAGCAGGATGTTCTCACTAAGCTTAGGACCTTTACCACTGATTGGAGATACCGCTCAACAGTGCATTCTGGCTTGAGTTGAAGGTAATTCGATACTACAACGCACCAAACATTTCATGACGAATGTTAATTCTCGTTGACCCTTGAGCAGGGCTGTTGAGCCAGGTGAGTATCGGAGAAGGAGATCCTTCAGAGACCTGGGTGAGGAGCGGTCAGGTGGTGTTTACATCCGCTCGATCTCCCGGGTATTCTCCATGCAAGGTCGAGAGTTGTTCCGTTGTGGAAAGTCATCAGTCAGTGGCCTGAAGGAGACGTTTGGCTGATCCGGCAAGGTGTTCTGGTCGAGCATAGCTGATAACAATTGAGCAAGAATCTTCATCACGAATTAGAGGAACCGTCATCAACCGCATCAAACATGAACCCGTTACCGATCAACCGACGAATGGTTTGAACCGAACCGACTGTACCGAAGCACTAAGGAAAATAAACGGAACCAAGCATCAATAAACCTGTTGTCTTCCTTAATTCTCTTACGGTGATAATCATGCATGTTCCAATGGGAGCGGAGCCAACCGAGAAGGAGGTGGAAATTTCTGGTCAGAACAAATGACAAGAGTCTGGTTCAGAAGATAAATCGCTCTAAAGCTTCAGTTGAATATTAAGAAGCCCTCGCAGATGACGAATCATTGGGATTCCCATCTTTGTTGTTGAAGGCGACACCCATTGTCCTGCCGAACTTTCGCTCCTCCATCCAGTCTCCTTCGCCGTGTTTAATCGGGAAGGAATGTCATTAAGCAGTGGAGAGCGCGTTCAGTAAGGATAGGTGGAGGGGAACTCACCAAAGACGATGTTATGCATATGCATTTCATCGAGACTGAACAACGGTGAAGGTAGAGACAAGCTACCTGTATTTGGCGATATTAAAGTCTTAGGGGCAACAGATATTGAAGGCAGCTTTGCTCATTACGACTCATGTCATTAAGCCACTGTCAGAAGGAGATGGGAAGGATGTATACCGTCACCTCAATTTTCAGACATTAGCCTTGGGCAAAGATGGACAGAAAGTATTTTAGCCATGATGGTGATACAAAAGGCCATCTCTCAGCGCCTCTGAACAAGGTCACCAATGCTGAGACGGGCAAGAGATGAGCATATTGGCCGCAAGAATGAAAGTATACTGGAATGTTTAGGCAAAGTGAAAGTTAAGGATTAATTACTATCAGGAGTAATTATGCGGAACAGAATCATGCCTGTGTTAGACCACGGTAATAATTCCTTACGTTATCGGCTTCGACTCCGCCTTTTCCCTCATTCCTGTGTTTCGTCGCATTTCAATAGAGATGGTCTTGGGGACATTGTCATGCAGGGAGAGTGGAAGCAATCCGTGATTGCTTCCGACTTCGGAAGCGAACGCGCCGACCGTGGCAGTATGGGTATATGACATCGGTAGTTATTGTCTCTTAGGTCCGTTATTTGAGCTTGAGCTTTGTTCCGTATTGCTGTCTGTTCCAGAGGGACGATAATATAAGCTCCCATCGCCATCACCCATTGCCTCTGCATCGTTCATTCATATGCATCCTTGTTTTCAGACTATAATTTACCATAAGAACACAAGAATAACCGGCCTCACCGTCCTGTCCCTCTAGAGTCGCCCCCAAAACACATAACCAATTGTATTTATTGGAAAATAAATAGATACAATCAGAAGCTAACTCACGCCTACCAAACAATGCCCCCTTAAAAATAATTCATAAACATACAAGACCATCCGGTAATTATCTGGCGGTGTTATCCTATCACAACCATGATGGGCCATCAAGGACGCACTGACCACCATGAAGGTACTAACCCACTTCCATCGCTATCGCGCGACGCAGCATTCAAACGAGCGTTGGGGGTGTGATACGAAACGAAGCATTGGCCGTAAGTGCGATTCCGGATTAGCTGCCAATGTGCGTAGGGGGTTTTCGTTCAGGACTACAACTGCCACATAAGGACGACTGACGGAGAATGCCGTAAGCCGCCCGCGAACGTCGCGCAGAGAAGCTAGCACGATAATGGAAAGGGAAGGCAATCCGGCGAGAAGGGGCACCAGTTAACCGCCTATTCTCTCTAGCATTGAATGAGCGCAAACCGAAATCACGAGTAGAAAGCGCACTAAATCCGATAGTAGTCAGGGTGCTGGCTGAATACCACAAACAGATTGAAAGCAACCTGCAACGTATTGAGCAAGAATCAGCGCACATAGATCAGCAAGCCTGGCAACGGGCGGCATAACATGCAGTACCTCAGAAATTGAATAGAAAATGCCATTCCGTATCTAGGTCGGTGGCCTTAGGGCTTTATCTCAATATTATATGGATCTATAGCCCAGCGACTAATTCAGTCCCAGTAATATCCTCAATAGAAGCCTCCTTCCTTTCCCTTCCCATCGGAAAATTCTTTCTACTAATAAGCTCAATCAGAAGCTAAGGGAGCTTTTGATGTAACCACATACTTCCTGCCTTCAATCAAATCAGCCCGCCCCTGGCCGTGATATTTAGGTTTGAATTACCTTAATCGCACTTTATCGTTTGCATCTTGTAATGCGTTTTCTTAGCTTAAATCGCTTATATCCCGCTGGCAAGCCTGATAATCGATGCACGCTTAGTCTAGAAAATGCAGAGCAAAGCACGAACATGCCACATGAGGAAGCCGATCCATTAACATATTCAGGCCAGTTATCTGGCTTAAAGCAGAAGTCCAACCAGATAACGATCTACTCTCCATATTTAAACTCCCCGAGAATGTCATTACCTGGAACACTCGTCCGATAGCAGTGAGTCGATTTCCTCTACTCGTAGGTATGTAGGATTGTAACTTTATCCGATTTCTAGTTAAAAGAAGATACTACACAATCTTTACTACCGCAATCCACCGTGTTAAGGTGATATATGAAGAAAGAATTTGAAAGAGTTCGAAGAGCATCCTCAGGATGTGAGTACAGATCTATCCGTGACGCCTCTGCTCTAGATCGCTTCTTGATAGATTCAGCGATGCAATGGATGCAATAGCTGCAATCGAATGCATGGTTAAGCCTGAAGAAGCCTGTTTCCTGTAATGGAAGATGGGGAAATATGTCGATAAATGGGCAATACGAACGACGCAATGATTGCCAAGGCGTACAAACAGAACAACAAAGCTGCCTGATAGTGGCCTTTATTTTGGCATAAATAACAGAACTAAACATGCACTGTGTGATTCCGAACGATGGAGGCTGAAGAAGAAGACGTGATTGGAAATCTTCTTTGCTCGATTACAAAGGCGATTCTGTACCGACTGAGTGGCTCGACCGGCCTTGAATCTCGACTCCGAGTAGCATGATAGAAATTGAAATCGACCATGACTTAATGACAGAGGAAAAACGTGCCAGATTAATAATTTCTGGTCAGACTCTGAATACCGACTCAATAAACTCTAGGCCTGGTATTAAATGCTGTATTAATCGATGCTGGCTAACATGCTCTGCTTAGCAATTTCAAGCGACTTAAATGCATATGTTGTGTGAGTTCGACTCCTTCGGAATGGGCTGCAGTGATGTCGGTTCGAACCGGCCGTATCGCGGGGCTCCGGGATCGGAATCGCGCTCCATCGCAGGAACTAGAAGAATATCGCCCCGCTCGATTAAGTTTTACCGCATACAGACTACGCTTCAACTAAGCCCGTTTCGTCCTTATAATAAGGGAGCACCATGCAATATGCCATTGCATGAGTGTTCGCTGCCTTCCGCGATCTTTACCTTGAACGAATCACCGTAAATTACGTGACGATGGAAACCGCCTTATCGACATACTTAATTACACGGAGTTAGATGGATCAAACACTTATGGCTATCCAGACTAAATTCACACTTTATTGGCGATGGAACTTTCGTGAGAGCCGTCGGACGGTGTCAAAATGGATATTAATACTGAAACTGAGATCAAGCAAAGGATCATCCCTTTCCTGTTTCCTAATCAGCCCGGCATTTCGCGGAGAGTGGCAGGAGAATTCAGGAGTTCAGCCACGACCGGTGGTCTAATTCAGGATCGTCTTGTGAGGCTCAGAGCCTGGCGCGTCGTAGACGAGCAGCTCCCGTGAAGAGAAAGAGGCAGAACTGGCAGACGACATGGAAAGGCCTGCCCCAGCACCTGTTCGATCGCACTTCCGCTCCGTTGCGCTCCCCTCAATCGATCGCGTTGCGTTGCTCCTCGCCCGCTTGTTGAGTTTCAGGAGCGCATGGCAGAAACACAATCGGTACATGGTTGAACCATTGCTCATACCAGGTTAGTACTTTACGCCAGGTATAAAACGAATGAGTACTGCACCGCAACGGTGGAAGCTGGCTGAACGTCGCATGGATTCGTCTACTCCACAGGAACTGATCACGCGATGGCCAGAAGGCATTTAAAGTGATGCCAGCGATGCGCAGTTCACGAATCGTTTACATCAGTACCTTAATCCTGAAAGAAATTACGCCTTTCCTGATAAGCAGAATGGCATCGTTCCGGTGGGCGTTGATGAGTCCGAATAATGAAATACAGTTTGATGGCATGATTTTGAGCAGGTAAATGAATCCTGTACGGTGCGCCCACTTTACCTCGAAGGGTAATCGTATAGAATGCGTTACCCCGGAATCATCCAACCAATGCGCCGGATGGCTTCAAACGAAGGCAGAGGAGAAGGGAATGGGGCCGTGGCAGTCGCATCCAAACGATGTTACGTCATAACCTACTCAGAGTGCAGCTGGAATGGGGGATCCGTGCTGGTATCGCTATCGCCGCTCCCTCCATCGCGATGCGACTCCTGCATACACTGCAGAACGTCAGCCGACCGACATCACTCCGGTTAACGATGAAACCATGCAGGGAGATCACTCTGCTGGTGATCGCTGGATAAACATGGATGACGACTTATTGCCGCTCTGTTCCCAGATATTTCGTGCCGCGACATTCGTGCATCGTCCATGACAGACGAAACGAACCCAACTTGGATTCCTGAAACAGAAAGCCGCAGAGCAGAAGGGCAGCAGGTGACACCGGACATTATCCTGCAGCGTACCGATGGCTTGGAGCTGTCGAACAGGAGTGCGTGAGGGACAAATCCCTATCGGCGTCATCACGCCATTCAGAAGTTCACAACGTGATAGCAAAACCCCGCTCGAGGAAAGAAGGGCGGAAGGTACTTCCACATCCTTGCTTGGGTTTGCACCCCTTGGCTCCGGGGAAGTTAACGCTAAAGCATGGCCTGGGGAAAACAGTACGCGAACGACGCCAGAACCCTGTTGAATTCACTTCCGGCGTGAATGTTTACTGAATCCCCGATCATCTATCGAATAGAAAGTATGCGTACCGCGCCTGCTCTCCCGATGGTTGATGAATCGCAACGGCTTTAAATGAAATGCGCGTTCCTCCGCTTCGGCGTCGCCTCGACATTATTGGTTTTCGAGAGGCCATAAAGTCATTAGTAAGTAGCCAGGTGCAGTACAGCATGTGGGTATACGCGATAAACGCTGGTATTTGCCAACTATACAGTGGGCTCAGTGCAAGGCATTATGCAGTAGGCGGCTAAGAGAGGAGGAAACGGAGCAGTGTTGACGATCGTGCCGAGTCATTAACGAAGGTAGACAGGCAAAACGGGCGGTTAGTTTGTATTTTGGGGAGCCAATGGCGATACGATCTAATAATATCAGCCCCGGGTGGTACCACCTTTCGTCTATCTAGTTATTCAAAACTATAGAGGCTGGGTCCAGACCTTCTTTATCCGCAGAGTTACGGCGGACACGGAGCAAATAATAGTGAGGAGAGATAAATAAGAAATAGTAGAGGTATGCACACCATCTTCTTTGAGTTGATAGAACCAGATATCGATGGCTAATAGTGTAGTAAAATTGGAATGCCTGTTACATCTATGAGAGCAGAGTAGAAACAAAGAAGTTCGACTCGTCCTCGCGGGTACACGTCGAGAAGAAACCAGGAGAGAGAAGAGAATAAGATGAGAAGTTAGTAATAGAATCGTGGCATTTTCTTTAAGACGGGCTTTCATATTCTGTGTGGTCGGTGCCAACATGTAACACGTTTACATCACCTACAGGAAAGCCCTTCTGACCCAGCATGTGCCGTCAGGTAAGGGCACCAACTAAGAAGGAAGAAGTTCCCTAAGATAAAAACGTCAGTGACATTTGCCGTAGATTATATCGAAGCACCCAAACGGTAAAATATCCCATTCATAAAGTT * tp:A:P cm:i:345 s1:i:2153 s2:i:0 NM:i:1987 ms:i:4308 AS:i:4342 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
35 31 4 * 0 0 * * 0 0 AGGGTCGTTCTAATCTGTTAGATGACCAGATCTTAAGGATAGAGACTGTGGGTATTGCTGGCTAAGGGTGTAGATAGTTTGTAGGGCTGGGCGTCAGGCAGTCCCACCGTGCAACAGATGGTATGAGTGGAAATTTAACGCGGTTATTGAAGGACCGGTAAATAGAGCGGCCCATAGGCGTATCTGTACTGTGTGTTTAGTTCGCATTGACTTTTACCAAAGAGCCAGCGTACGTGGGGATTGTACCGGTAGCGGTAGCTAGAGGTTACTGTCGGTGCCACAATCAGATAAGCATAAGGGTAAGAAGGGTCGCAGGCCGTTGGCCAAGACAGAATATGTATGAACCACGACGAGCACGAACGCGTAGAATAAGTCCGTAGCCCTGAATTTACTCCACATGACCTAAGGGGTCGCATCCGGTTGAAGCCCAATACATTGTATCGTTTGGCCGGCGTGACCTGAAGACGGCCTGGAATCGAACCGGTACTGTATGCGTCCGTACTGGTGGCCCAATCGTGTGTATGGTACAGAGCCCCGTGCGGGCGGTAATGAACTACAACGGAATTAAAGGTGACGTCGTCCCCGGTAGGGGTAGAGTCCTAATCGTTCTTTCGCGGGACAGACTGAATCGTTGACTTGTGACGAGCTGTAGGCTGGTAAAGGCCAATGTAAAGGGAGCTTTAGATGTCATTATGTGGTAGGTAGCTACTATTTTGACTTTCCGACGATTTATAAGCGCAGTAACAATGAACTGAAGAGCACTGGATATAGGCATTAGGCTTCGGTAAAGTACTGGAATAAGCTGGCGTACGTCGGATTGTTGACTGAAAGCGGGCCCGTTAAGCGGGTAAGGCGTGACATAGATGTACCCATTCAGGGGCTTTTGACGACCGTAAAGTAAAGAGTCCACTAAGATTACGTCCTACGTGCACCGTCGTCTACACACGCGGCCATGGGTATTTAAAGTTAGATAGTCTGTTGAACGGCCGTGATAGCCCCGATTTGTATCGTGGGAATTGGTCAACGAACAGGATTAAGGATTAGAGGATATCCCGCTCTAGATCGATTTAAGGGACCTGCCCCATTAGTCCTACGGCCGTGACGATTTACGCGGAACGCCAGGCTGACTATTTTTACAACATCACTTACGATTGGTACGAGTGGGTAGCCGTACCGTGGCTTTTAGCGTTAGATTGAGTAACAGATGATAACCAGGCCACGTGCACCATCACAAAGCCTGCCGTAGCTCGTTACGTCCAAGACAAATTAAAATTAGGCATTTCGAGTACAAATTAAGGTCAAACCCATGAAACAGACAGAAAAGTTTTATGACTAAGGGGTAGATGTCGCTTATTTCGTAGGGCTTACACGACAGGGGCGGACTTTGCCCTGTGAACGATCGGCCGGCGTATTCGATGGTCCTAAAGAACTGAGCAGAAAGCAGGTGATGTGACTGTTCGAGGCCGAATTGGTGTAGCCCGGTACTTAATGGGCCAGCCGGCCAACTATGCGATCAGATATTTGGGTGTGACTTTACCATCAAGAGTCCACCGTCCACTGGTGTCCCCTGAATCGGACGTCCACAATCGCGTAATGTCCGCGAGGTTTCGATGATACCGTAATACGGATGGGCTCACTTCTAAACGTGATAATCGGGTATGTAACCGTATAACCAGCACCATCTTGAGGTGCTTCGACAAGCGGTGGGGTGGTCCTTTTTGGTCCTGGCCCATTTATGAAACCACGCGGATTTACTGACATGAGTCGAATGACAGTATCGGACGGGTCGATAAAACGAGAGTTAGAAGGACAAATGGATAGCCACGAACACACTCCGTACCGGCATCTAAGCCATCCTTCCGCCGGCTTGCACGATTTAGCCGGCAATCCACCTGCGGCTGAACGGGCTAAACCATCGGAATGGCACTTCCGGGGTAGACTTGGCAGTTAAAATGCGTCATGAGGGTCCGTGTATCGAGCCGATTGTGCCGGGGACTATCTATCATGACCGTTGAACGTTCACCGATCGCCCGGCCGCGTCGAGGTGTAAAGTTCGGAGAGATGTTACACCTCGGTTACGATGAGTCGTGTAGCGCAGCCAGTGCTAAGTTCGAAGGCTCGGAGCATTACTCGGTTGGGCCCGGCTGAACCGTTCTCGTCGGATCATGGTGCTCGTGGTTAGCGTAACTCCAAAGCCAGACCCCATGAGACAGACAACCGTACGGTAAGAACACCTTTCTACGGACAGGTGTTGCCCAAGCATGTTCTGCACCGTTCTGTCGGGGTAATGCTTACGCTTTTATAAGAATGATACGCCCGGGCACGGTATGTCCGTTGTGTATCCGTCCTGGTAAAGGTGTTCTGTGACGCCGGGCGTGCTTTATAGAATGGGGTAACTGAAGAGGGTACCGTAAGAAGCCGAAGGGACCGACAATCTACGATTTATAGCTTGGATGAGGCTAAAGCCGATCTAAATCGATCTGGTGCGAGGATTATCTATGAACCCGTCTTAACCCTAGACACCAAATATCCCAATGGCGTCTCCGGTTTCGCGTACTGTATACGCAGCCGCTTTACGTACCCCGGTGGGTAAATCCTGTACGCCGGACCCACAGGACTACGATACCCACCAGTCCGGCTTTAAACAGGACCGTCTTAGTCTAGATCGTGGCAACATAGTGACCGCGGCTAGAAGTACCGGTAATTGAATTAGGGTAACTGTCAGACCGAACCGGTCTGGCACGAAAAGACAAGAGTACCAAAACAGGCCATTACTGTAGCGTATGGTAATTACCACCGTCCTGGCGTAAGCCCGTACCGACGCCCGCATGAAGACACATAAGACAAAACGTCTGCTAGCTACAATCGAAGTCCGAGCGAACGTTAGATTCGAACTCACGACGCGTTCGGGCAGGGGTGACGCCACTTACCATACTGGCCGTAAGGTCTGCCGGCTTACGTCAGGGTACGTAGACCTAAGACTACAACAGGCGGGGTCTGGACCGGACGTCCTAACCGGTAATAAAAGACAGGGATGGGTGTCTGTGTAGCTGTGGACCCATCGATCTAACGCGGAATCTTCGCACTTATGGATAAATCTTGCTTAGGATTACAACCGATTGCGTTGACAGAGTAATGACGTGTAGGGACCGGAGCCTAATGGGTCGGTACCCGACATCCATTGATGTCCGCCATTTTATCTATGGAGAATGGTCCGGCCGACGTGACCGGGCACGCGGCGTCGTGCACCGACGACCGTCGGATAAGATCCTACTAGAATGATGATGGGTTAGCGATGAGCGTCCAGCGGTCTAGACAGGCCGACGCCGACGGCCGTTGCTGTAGGTGAATGGGATACGACAACGAGCTCTAACGGACACCATTGTTAGATACGATAGATTGCAGGGTACGTCTACTGTTTGAAGACTGCTTGGGTCGCACCCGGCCACGAACACGATGTGATATTGAGGCCGAACAGACCTGGAACGACGCCGAGGGTATAATTATGCTTTGCACCGGTGGGCTAGACGTGGGGTCGATCGATGTGAATGGTAACTGGTCCGGTGTAGGGTTGACGTTATGACATGCTGACCTGACGAACTGACGCGAATACTACTCCTCGGAAGGGGCCACTCGGTGAACCTAAATCCACTCTACAGTCTAGTAGTTACCTAATGACCGTGGGCAGTCAAACCGTCAGTTCGATCCCCGGACGGGTGCTGAATAACATGTTCGTAAGTCGGCACTTAAGCACCCTGATCACGCCCTGGCTGGGGAGAACCACGACGTTTAAACCGTATGGCCATTAAAGGACGGTACATCTAAAAGTCAGCTGTGCACGCGAGCCAATTGACCGTAAAGTTGAATGGGAGAAGCGTAATCCCGCCTTTGTCACTAGAACCACCACAGTACGATTAAAGGGGAAGGGGCGCGGCCGTAAACTGACAGATGTATTAAGCGTGGGTCGGGCGCGTCGACGTGACAGGCACGTAAGCGTACATGGTCGGATACCAGAATGACTCCACGACGCGGAACAAGTCACGCTGACTAAACGCAACGGCCGTGCGTCAAACTAATTACGAAGTTCGGGTAAAGGGTAGCGTTCGCGTACACCGGGCCACCCGTCGATACTGGTACCCCGTAAGCTGGTTCGACGACTACCGGGAGCTAAAATCCAAGGCGTTACCCAGCCGTGGCGTTGACTTTAACGTCCAACAGAGGGCTGGTCCCTAAATACCAGCCGATTGTAAATAAAAGAATTTATCGTCACGCTGATCACCACAGTCCGAGCCATAGAATCCGGGTATTATTAGTTATGGTACCCATTGACACCGTGTAAGCATTGGTTACAGCCGTCGGTCGGGCTTATCTAATATCGAGCGGATTGACGACGTCAGGGCAGCGATTAGAAAGGCCAATAACGTATAGAATCAATACACGGGGCTAGTGGAAAGAGGATTTTACGAGTAAGTGGATGAATGAGTTGGGTGCCAAATCGGCCCAACAAAGACGTCAAAATGTTAGGGTCCTTACCTGAGACTAGAAGCGAATAAACGCCCATTTCTGGTCCGCCAATGGATCTACCGTTGACCGTAAACGGGGGACTAGACGATGTTTTACGGGCAGCAGGTGCGCGACAGTTGAGGTATGACGAATCCCGGCTCGTAAAACCTGAGCCAGTAATTTTAAACCCCGGCCGGAAACTCACGGAGAATAATGAATGAATTACTGCCAAATAGGAGTAAGGGCGTAACTTAGGACCTGGACGTTAATGGCAGCCGTGACACTCTAAAGCCAAACGTACTAGTGTAAAAAGGCTCCAACATGGTTTAAGGCCCCACGACAGATCGAATTATCGATCCGTGATGGGATCCGTACCGTGACCGGGTGCTGACGTTGTACCGAGTATATGTGGTCTAATTTAAAGTAAGGATTAGTCATAGTAAGGCACGTATTGATGTGTTTGACACGGTTGACGCGTGAGTCTTTATTAGCTCTTATGGCTGAGGACCGTCTAAGTGTCCCGGTTCGGAGTGAACCCACCACTTGCCTGGGGAAAGCGTATCTGACGTCCGCATGCGTGCCGCAACCGTCACTCCATATTTCAGCCATTGGCCGTTGGATGTCAGGTTATGTGAGAACAGGCCTGGTAAGGTTAGGTGTGTCCCGAGGTCCACCGTTGACGCGGGGGTCAAAACAGTAGTTAGTGAACTACCTACTGATCTAATTTTATTGTGCCGACTTAAAGATCGATCGCTGAATACCGTCAGCACTTAATCGTTGACCGCGGTCCTTTGAGTGAACGCGTAAATTACGTGCGTCGTCAGCGGTCGTACTGAGTACGTACCGTACCGGTCTCTGAATGAACATTGGCTGGTCCCTGGGTTTACGATTACAGAACAGGGGTTGACTCGGCGGGTTTCAAGCTATCGTGGGTTCTCTTAACGGGTGGCCGGCCGTTGACCGATGAAGTAAGATCCATTCCTGCGCATCACATCACCGTGCTTGTGTGTTACAGTCCGATGCCATTACACATCGGATAGAATACCGGATCTAAAGCCCCGGGTCGAACCGGGTACCACGATTGGCTTACGATCAAGTGAGAAGCTTGGTCAGGTAAGTCCGTGATTCTTATTACCCTCGTGGGTATGTAAAGATTGAAGCGTTTAGTACGTTGCGTACTGTACGAGCCCATTTGGCCTCGCCCCGGTAACTGATGAGTTGTAAACAAGTGACAGGTCGCATTACCGACGCGCGAGCGTCAGGTACTGACAGTTTGAGGCCTGACACGGAAGAGGGAAGGGTACAGGAATCGCAGTCTGACCAGAATGAATAAGCGGGCGTGAATAGTGTAGGTACCCGGTCGAACCGGCGTACTGATGATCTACGTTTCCGCAGGGTACGGTAGCCCCATTGGATTACCGGACATAACTGTTGACGTTAATTAAAACCGGGGTACGAACCGGGAGGACTTATGATCACTTTATGGTCCGAGCCTTAACGCGTCCGTGGCGAGTCGAGGACGAGCCCGCGAAACAGAGGACGACGGAACCATCCTAATTCATTAAGTACCCCAGTCGATGCCCTGTGTATCATGACGTACCATAACTACCGCACATACGAGCCGGACAGCGTCTAAGCTGAGTAGGTTGGGCCCGGAGATTAAGCCAGTAAAGGCACTGAAGGCACGAGCTAAGGCCGATCTACAAACGGCCGATGCCCCGCGGTAAAACTATAGAACGAATTTGTCAAGTTGTCAAACAAGAGATCCAAGGATGGTGCTAACCGGGATGAAGGGTCTACTCACCGAACCCGGGTACGGCTAGCGTAAAGAGGTAGTACCAAAGAGAAACGAAGCAGAGAGATGAGCAGCGAGCGACCTCCGTAAATTCGTCGATTAAAAAGGGCCCATTGGTAAAACGAGCGTACGAAGCCGATGGAAGTCACTGACGCTACAGCGCCTCGACTTAGAATGAAAGGGCGGCGGGCTCGTACGTAAGCATACGAAGGACCCACCGTCGGGATGCGTCGAGCAGCATTGGGCATAAAGCTTAGATACGGTGAGATCGTAAAAGTCCAAAACGACGTCAGATATTGCCTGCTGTGGCTTAGGACACAAAGGAAGGGGACGTCATAACCACGATGCTGAACGAGCGCTAATTCCACCTTACCAGGCTTTTGAACTTAAACCCGACCGAACAAAACGATTAAGTAAACAGCCCACGCACGCGAACGCCAACAGAACGAGGGAACACCAGATCGACACCGGATTCTACGATTGCCATATGTTGTATCGACGAATCCGTAAATACGACTACTGACGAGCTCGGGACTGTACCATTTACCACAGATGTAACGCCTTAAACACGCAGCAGAAATCGGTGACATCGAACGTCTAAGGGGGCCTGCCCGGTCTAAATAAAGCTCCTCTATGACTTACGATCCCACGCTGATCTGACCGCACGATCCGTTGCCGTATTTCTCAATCGTCTAATCATGACCTCGATCTAGAATTAGTGGGTTCAGATTAGCGTCCGATCGGGAGGGAGGCGGAAGGAACTTAAGGTGACGCATTTTAGGACAAACCTACCCAAAATGTATCTTTACCATCCGCTCGTGTTAGTATCGAAGCACAACCAAGGGCCGAAAGCAGGGGCGGTCCTTGATGTCCACGACGAGCCGGCCGTACGGCCGCATTTAAGTCATCCGTGCACCGGTTTGGCGCTCACGAATAATTGGTTTCTTGCCATCGCACGAAACAGTTTTAGATTACGAATAAAGGCACGACACCGCGGCTCATCTACAGAATGCCGTTTGAAAGCTCTAATGTCGGACAGCGCTTAAGCATCTTTACATGACAGTTCTGTATACGTACCATTGACATAAAGAGACGAAGTGGGCACAGGATTTGACGAAATTTACGAGGCCGAAAACCGTACCGGGTACAGGCCCGATTAACAGATTTAAAGTCCGGTGCTCTTAGTTGAACCGGGTACTTATCTGTCACCCATCGCGTTGTATCGGTCGCTTACCATTGGTCGATGTGGTCCAATTAGCACCATACGCGTTAACGGTACGTAACACCTAAACAGGGTTAGAATTAGTCGTCTGATAATCGTACATAGACCGTCGAACAATGGACAGTAAAGGGGTTACCCTTGATGACTAAGGACTAGCGTGACTTAGATGGATATTCTGAGCTACCGTTTCTTAACCTACGATTACGATATCCCCGACTGTCGCGGAAATGGTTGTGTATTTCTAAGCTGACCACCACTGGGTAACGTGGGGGCTGAACTAGCCCCGTGACCGTGGTCGAACGGCCGTTGATTGGTTCGGCCGTTCGTTACAACAGATTGACGACATTTACCCCTAATGAGGGGGATGAATAAAACTTAGAGCCACCAGGGTTAGGAACAAATGCCGGCCGCAGGAGAGCTATCGATGTAGCCGATGATAGATTACCACTGTGAAAGTGAATGACAAGTGACAGAAACGCTTTGGGTAAAGCAATGGATTTACTCGTGTCTGACTAGCCAACTATCGTATGTTGGATGTCTGAGCTTAATTTTGTGTATCCCCGAACCTATTTGACGACGGTTCCTTTGAGTTGTTGTAATCTTAGGTAGTATCGTTGGTTTAGTATCTTGAGAGAAGACTGGATTTATGACCATTGTGCTTGTTTTAGTAAGAAGGTCAGAAGCGGGTAACGACGACTACTTTCGTGCTGTTCTAGTCTCGTCTGTTCTAAAGTCGGTTCTTGGGTTTTGACGTTGCCGACATCGCTTTTATTTGATCAAGTCCATTAAAGGTTCTACTTAAGTGTATGTAAGTTCTGAGCCTGGTTGGTTTGCTGGCCTATGGTACCAAAGCATATAAGGGTGAGCGGAGTCTTTGACTTTAATACGCCAACTATTTGGCTGTATCTTACAACTTTGCCGGCCTTAAAGTTTACGCCGAATGTAAATGTTCTATGTACTGTAACCGTTGTAATTCCGATCGTTTAGGTAACCGTCTAATGCTGAAGGTCGTCCCTGACTGTTGATACCATTTTTAGACTTTACTTGAGTACTTTTGGTTTATATCCGTATAGACCCATTATCTAGTACTTGCTTTACGATTGTAATATGCTGAGATAAGAGTCGACTGTTAGGGATACCCGAGCTGCCCGCGTATGTTCTTTACAGAGTACATGAGTCACATTTAAGGTACACCGGCTATCACCTTAAGTT *
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
36 32 16 utg000001l 20505 60 98S19M3D8M1D1M2I4M1I6M1I6M5I5M3D7M2D2M2D1M1I6M3I12M1I3M5I25M1D1M2D6M3D7M1D4M2I1M1D8M3I3M1I13M5I7M1I11M1I6M2I41M3I7M1D5M1D16M4I6M2I13M1I4M1I10M1D10M1I2M1I5M3I27M3I6M2I6M1D12M1D3M2I2M2D7M1I1M2D2M4I4M2I8M2D7M1D3M2I2M1D15M4D17M1I12M1I43M2I9M2I46M1D15M1D29M2I19M1D9M1I2M3I2M1I2M1D6M6I4M3D24M4D6M1D22M2I53M1D4M1D36M1D5M1D1M2I12M1I2M1D22M1D11M1D2M1D21M1D3M1D13M2D6M1D22M1I15M1I26M1I14M2D21M1D18M1D20M1I13M3I2M1I5M4I2M4I17M1D1M3D7M1D22M1D17M1I13M1D4M1I4M2I11M2I9M1D24M1D6M3D4M2D7M1I9M2D3M1I8M3D4M1D10M1I1M2D1M2D8M1D19M2D4M1D4M1D4M1I2M1I12M1D30M3I20M1I20M3I1M1D19M2I19M1I11M2D9M1D7M1D2M2D1M1I11M1D9M1I3M2I4M5I12M2I2M1D4M1I6M3D2M1I11M2D10M3I3M3D17M2I3M1D17M3D17M2I8M1I9M2I4M2D3M2D6M1D9M1D20M1D7M4I1M2D5M4I7M1I18M2I16M5I6M2D27M1I12M1D4M1D17M2D10M3D24M1D3M1D2M2D2M2I11M1I3M1D11M1D1M2D6M18D2M4D5M1D59M1I8M5I5M1I4M4I4M4I2M6I5M3I2M1I3M2D8M2D31M1D9M3D5M3D24M1I23M1D7M1I7M1I14M1I12M2D6M3D1M1D13M1D8M1I30M1I10M1I4M2D7M4I8M1I10M1D18M1D2M1D15M1D1M1D4M2I11M2D2M1D1M1D29M2D4M1D8M10I6M2I3M1I6M2I7M2I5M1D4M4I7M2I10M2I5M1I9M1I5M10I1M1I9M2D13M2I8M1I20M3I3M3I3M3I7M2I57M5I3M1I2M1I3M2I16M1I13M6I1M1I3M2I8M5I6M1I4M4I1M1I29M7I14M2I5M7I7M1D8M2I14M1I9M2I11M3I3M1D25M2D5M1I12M3D22M1I2M3I2M1I13M2I8M1D7M2I10M2D2M1I2M1I6M1D3M4I14M4I5M3D22M1D28M2I9M5I4M2I10M6I4M1I11M2D3M2D7M3D1M1D5M1D6M1I4M11I1M2I3M3I2M3I3M1I13M1D8M1I5M1D8M1I3M2I5M1I6M1D7M4I1M1I9M1D2M2I2M1I4M2I2M1I8M1D14M3D8M3I2M2I3M1I8M1D3M2I4M2D3M1I5M1D24M1I2M1I4M1I7M1D8M3I5M3I6M1D5M1I6M1I7M2I12M1I6M2I5M1I10M1I1M1I6M5I12M1I4M1I1M1I4M3I4M4D10M1I4M2I8M7I23M1I7M1D4M1I8M1D3M1I6M3I9M1D18M2I5M1D20M1I1M1I2M1I15M3I10M1D3M1D1M2D5M1I1M2I8M2I13M1I12M4I4M2I14M3I1M1I9M1I2M1I1M1I9M1I12M1I5M1D10M1I9M2I2M2I1M1I8M1I3M2D8M1D4M2I13M1I1M1I4M1D13M1I16M1D1M1D24M2I19M3I1M1I7M2I20M2D2M1D10M6I8M1I8M3D1M1I3M1D5M1I30M2I1M1I3M1I5M1I6M1I13M5I16M3I2M1I5M1D9M8I2M1I3M1D5M4I12M2D7M2I14M1D26M1D46M2I2M1D5M1D6M1D10M1I27M1I12M2I18M1I5M6I13M4D5M1I11M4I1M1I6M1D24M1D1M1D10M4I2M5I3M1I4M1I1M2I7M2D13M2D6M2D3M4D23M4D6M1D16M2I8M1I7M1I3M1I3M2I9M1D3M1D11M2I2M1I4M1D9M2I10M2I3M2I1M1D4M1I10M3I32M1D5M1D35M7I8M2D10M1D18M3I15M1I14M1I5M1I9M1I8M2I15M1D23M1I8M5I13M1D14M3I2M1D5M1I3M1I2M3I2M2D18M1D15M4D16M1I5M1D8M1I2M3I4M1I9M2I6M3I7M1D27M2I8M1I6M1I6M1D18M1I11M2D3M1D1M1D5M3I3M1D2M2I5M2D4M2I2M2I2M4I2M1I2M2I3M2D2M1I8M1D8M1I3M4I18M4I5M3I15M1D36M1I5M2I16M4I1M1I8M4I5M1I15M1I6M3D1M1D8M1I5M1I7M2D12M3I11M2I6M3I6M1D5M1D14M4I8M1I1M2I8M2D7M2D8M2I3M1I3M1I9M2I15M1I3M1D8M1D3M1D28M3I5M4I3M1D8M1D5M2D4M1I7M4I17M1I3M1I3M2I4M1I3M1I6M1I7M2I2M1I6M4I5M2I4M1I2M1I3M1I9M2I2M4D7M3I2M2D3M2I1M1I13M1I6M1I6M1I5M1D15M4I2M2I6M2D14M1D9M1D6M21S * 0 0 AATCAACCTCTATAAAGCTGAACGAGAAACGTAAAACGATATAAATATCAATATATTAAAATTGCGACCTTGGCGCGCATAAAAAGAAGCATAAGTTCAAACACAACATATGCAGTCACTATGAATCAACTACTTAGATGGTATTAGTGACCTGTAACAGAGCATGCCCTAGGCATGATTTGTCTTCTGTGCTAATTTGTCATCAAACCTGTCGCACTCCAGGTCAGAAGCACAAAGCCTGCAATCCAGTGCGACAACAATGTTGTGTCGTGCCCCACTACGACCTGCATAACCAGGTAAGAAGATAGCAGTGATGTCAAACGACGCAGCTGACTTCTTTCTTTCTGGACGACTTCCCACCCAGCATGCGACCCTTTCTGCCATAACTTAGTGAATGTCTGTTATGAGCGAGGGAGCGAATTAACACTTATGAAAAACCGGGGTACGAAGTCGTGGCTATCTATCGGCTTATTAGATTACTTGAACGCTTCTTCATTCTTCCAAGGCGCGTTCGGTGGTTCCTGGCGCTCCTCTCTGCTTAATAGACTATATCGTTGGTATAAACAGTGCACCATGCAACATGAATAACATGTGGGTTATCCAAAAGGAAGCAGAAAGCTAAATCTGGAAAACTACAATACGATGCCCCGTTAAGTTCAATACTACTAATTTAGATGGAAAACGTATGTAATACCAGAGTAACTTAAAAGAGATCCTGTGTTGCCGCCAAATAAATTGCGCGGTCCTTTAATAAAATTACCGAATACAGAGCCTAGTGGGGAGTGGCGGGTGAGCTGAAAGAGGCGGGTATATTCCTGCAGTAGAAAATAAGGCATTCCTACGAGCAGATGGTTGGAATGACTATTCCTTTGTTACAATGTTTTATCTTACTGTCTTTGATGAGCATGGTGAAAATGCGATATCGGAAATGTTAAAATTGGTTTGTAGGTCAAAAGAAGAAGTAAGGCACTTATTCATTAATAGATAAATTCAGTCAACCCCTGAAATGGTTTTTCCTTAGTGAAAGCATTGACTACTGTTAATCTCAGCAAATTAAGCGATGGTTTTAACATAACCTTCATTAAAGCTATTCAGGATTTAATAGTAGTGGCCAAATCGATTAGCCGACATTGAAATGAAAGCGTCCTTAACACCTCATTAGTCCAGGGGTAACTCTTCCGCGCACTTCCTGGGCCCTGGTTTCGCGGGGACTCCTTTCTTTAATGGTTTGCCGCTTGTCCGCTTTCCATTTTCATTTAATAGAAAAGTGCTCCGGATTCTAGTGATTTGACTATATGTAGGTCCAAACGGTTAATTCTCTATGCCAGCACGAACATTCATGCTTTATCCTGGCGACATCGGTGGTAACAACAACAATTTTGGAATCGAATGATTGGTGCAATCTAATAGAACACAGGCACCTTGCCCCTGAAAATAAGGACTATCGGAGGTAAGGAATCCCAACGGATATTTTCTAATCGCTTGTTTCAGTTCGTCGTTTAGTGCATTTGATCCTTTTACTCCTCCTAACGAACAACCTGATCAGCAAAAGGTACACAATACTTTTATATTCTTGACACGCAGAATGCTGCCAGCAATAGTTTAAAATAAGGGCGATCTTCGTTAGCGTTCGACCGTTTCATCGGTGCGTTTAATGTTCGGTTGAGTCGAGTAGATAGAAAAGACAACTGGCTTGAAGTGGCTAAAACTAAGTAGTGATGAAAACTTTCAAATATGTGGAACTCAGCCTCATTTCTAAATTATGAAGAGTTAAGACGTAGCATGACACAGATTCAAGTGGACGTGATGATAAATTCACTAAATTGTTTTATGTGCTATGACAGGGAAATATCTGCTTCGAATGAGCCTTGGTGGACATGCAATTGTTTTATTAAGTCTATCACAAGATTAGTAGATGTCGTTGGCGAAAAGTCATCGTGTTTGGTTCGATGAACCAGAGGTTCATATGCATCCACCTTTGCTCTCTGCCTTTACAGCTTGCCTGGCTCCTGCCTCCATCCCGCAATCCTTCGCATACCAATTGGACTCATTCCCCAGTAGTACTGCAAGAGGTTCCAAATGCCTGCATGTGGAAAGTGTCACGGTCAAGAGAAGCAATAAATATTATCATTCCGGCTCTTGAGTGCAGATGAGACATCGGAGAACTTGGCCTACACGGGCGAGTGGCCCGTGGAATGACAATTCTGGATACCACTTATTATCGCAGTCCGTTGATTCAGAGCTTTCTTATGAAACCATTCTAAAATTATAATGGTCAGATAGGATTAGAAGAGTAGAACCGTTTAAAGCGATGATAATGAACAGGAGATGAAGGGTAAAGTACAATGAAAAGCCCTCTTTCCATGCGAGAACTGCTACCGAAATGCTGCTTAATAAATCTGCTCGGAAGGTATGATGCAGATAAATGTCGAAATAATTTCATTATACTTCGCCCCACTTTGGAACGAACAACAATATAGAATATTAAGCTCGACAGTCATTATTACCTACGACAGGACACACCTCTTGAGCCTACGCACCTTAGTTGGTAACCTTAACAAAGGTTTAAATTAGAAAAGCTTTATAGAAATAATATCTCCCTACGAGATAAACAAACACGAGGAACATATTACGTGACATGCTTGTTTCATCATGAAAATGTCATTTTGTGGTGATATGACAGACAAAATATAGATCATTTTCTTCCTATTGGACATTATCCTGGAATTTCCCTTCGCGGCTCCCAGTCTCCCTTCCATTCGCCTGCGGAAATGCAAGTCGGGAGAGAAGGTCAAGTTTTCGCAGTAGATGAGGTACACCAAGCGATTCATCCTATACCTGACAAGGACATTTTTCGTGAGCAATGGGTATATGCAAATTTCGTTTCGAGAACTCCGGGTGCTATCAGTTTATGTTGCGAATGCCCGGCGAACTGGAGGCAGGAAGACAAACACAGAGGCTTTCATCATTTCAAGCTATTAAATATGCCAACAGGTATCGTTTGGGCAGGGAAGCACTTGAGTGAAGTGATTACTCAAAGAAACTCTTCGTAAAATTATAAGGAAATATAGTTCAACAACCGCAACGTTTATCCGGGCAGCTGCAGGCTACAGTCAGAAATTTATTGAAGCAAATCTGAAACTATTATAGATTTGAATGACTTCCCCAATCTTATTGGAAAAGAGATTACCAGTATCAGTGCCTAGCAAACTCGGAAGATTTTCAGAGGAGATCTAGAATATGATGAAAGATAGAAATTATTACGACGCTTATCGGAAGTGAACGAATACTTTATGAGGAGGGCTGTTTACAAAGTACGGGTAGTAACTTGCCACGAATTCCGCGCGAGGCAGTATACGGCGCAACGGCGGCAGCGCACCGAGAAGGACGTTGTAATGTCGCTCCGGCACATAGCAGTCCTAGGACCTAGTACCGTCACAGTCATAGATGGTCGGTGTGGAGGTGGTACAAATTCTCATGCAAAATATGTAAAATCTCGGCTGCCATCGCGACTCCCTTCCACCTCGCCATACTATCGGAAGTCCCACCATGCCAGCCGCAGCACGTTCCTGCATACGACGTGTATTGCGGCTCTACCATATCTCCTATGAGCAACGTGTAGCAGAGCCAAGCCAACTCTAATTTAATACATAATGAAGCTAATAATAATATTAAAATTTCCTGTCAACTAACATTTACTATGGTCTGATAAGAATCATTGCAAAGATCAAACAACTTGTATTACATTGTACCACGTTAAGCAGTTAATTTTATACCTCTAAAATATCAGCATCTAGCATGCAACCTATCAAATGGAGAGTTTATGACTCAAAACCATGGGAAAGAAGACTTAAAGATTTATTATCGCACTTGCTCAAATGCTGCATCATACATATTTGACCCTGAATTACTTCGGTTTGAAGTGCTGAAGTAGCATCCCGCAACGCAAGAAAGAGCAACATTTATTATTCGACAAACAAACCAGATTATAGGATATGACATTTGGTAACATAATGTTATTGAAAATGGAAAAGCTGATCCATTAATGGCTTGGGGCTAAAAATTCTATCGCAATACGATAGAAAGTAAGGCGTTTAGAAATGTATAGCGAGGCAAAGAGCCTCTTATTTCATCTTACATTGAAGAAAATGACATTGAGTTTATTACAAAGATGAAAGTATGTTAAACATTGGTATAACACAGTTAGTCAGACTTGCACAAAAGAAATTACTTCTTTATGGGGTTGCCACTCTTCCTTGCGCGTATCCGCACTAATCCTTCTTTCTAATACGCTAAAAGATTACGAATTATTACATGCCTTAGTAATCTATGGCAGAATGTATAACTGCTGTAACTCTTGGCATACAAACCAACAATTCAATGGGTAGACTTGATTTCTACAACATCATTCGACTCTTTATTGGGATGAAGCCAGGAGAATAACTTATTTAAATTAAAAGATTACTCTCATAAGCAAATTGTCCATTTAGCATGATACAATATGACAATAAATAATTCCTGAAGATATTAAAGGCTAGACGCGTCATCAGGCGCAAAAGAGCCATGCGACAGAAGAGGAGTCAATTATACTCCATAAGCTTGCAGAAACGACTTTACGGACGGGTTACATTCAAACATTAATTTTTATGATAAACAATTCCATCCAATTGATTTAATCAATACAACATTTGAAGATCAAGCAGATAAATATGTTTTTGGCGTTATGCAGCTGACAGAGCCAAAATAACAAATGCCTATGGCTTCATTTGGGATATCATAGTGGCTAGAAAGCAAGCATCTATTCAATAACCACAAATACCATACAATGCCAATTAGATGAAAGACTTCAGGTAATTGGAATTGAGCATTCAAATAATAATCAAAATGTATTTCATGAGAAAAGTAGGTACAGAAAACGACGCTAAACCGACTTTAGAAATATCAACAGCAGACTCAAACATGGATGTACACCCTTCCCTCTTCCTGCGTCGGTCTGCCTCAATTCATGCGGTGATGTAACACTATGAACAATTGAGTCATAGAACTTCCATTATTCTCCTGAAGATAATAATCTCAAATAACCAATATCTATCCAGCTTTTACAATAGCCCGACTAACAACCGCAGAACGTTATTTCATACAACGTTTCTGCCGGGCATATCTACAAACGATTACTGATAACAGGGACAGCAGGCCAGCCAATATCAGTGCAGTTACCCATCATCAACAGCAGCCGAATGCAGAAGCCGGAGCTTCTTCCAGGCTTCAGCAACGAGGTTCATCTCTTCCTTCGTTGCAATTGTTCCAGTGATCTGCAGCATCCTGAAGGCGCAATATGCTCACTGGCTACCTGCATCAGGCTTTGTTCTTCCTCCGCTTCCGCACAGATCTCATCAGTTTTTCTGCTTCGTGTACTCTTCACCCAGGCTGTGCCGTTCCACTTCTACTTCCCCTCCCGGGCGATAACCAGGTAAAATTTTTGCGGGTAACGATAACCGAGTTCAGAAATAAATAACGCGTCGCTGCCGGAATGACCCACGTCAACGGTTTACCCGATGATGGCTTTCAACGAGATGCCACACGATGCCTCATCACCTGTTGAACAGCACAAAGCCAGCCGGAATCTGTGCAATGCAATATCGGTACTGTTGCAGGCAGACGTATGAGGCGGAATATGCCGTCACCTTTCACCAATAAATTCGATGCCACTAGTTCCGTCAGCAGATTATAAATTTATGGTCCGTGGTTGTTCCTCCCTTCTGATGCCCCTTACTGCCAAGCCTCGCCCATGCTCGTAAATGCAATGTTTTGACGGTGTTTTCCGCCGTTACCGCAGCGTTAACGGGTGATGGTGTGTCCGTGAACCAATACTGAAGAATGGGATGAGCGGAAGACTTAAGGTTAAACGA * tp:A:P cm:i:84 s1:i:763 s2:i:0 NM:i:1643 ms:i:2342 AS:i:2342 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
37 33 16 utg000001l 40362 60 1927S17M2I4M1I1M2I2M1D10M2D4M2D5M1D5M1D4M5I8M2I6M1I6M1I11M3I3M5I4M1D8M1I21M1D3M1D16M1D2M1D5M1D11M3D8M3I7M2I11M1D10M1D10M3D8M2I4M1I2M2D6M1I12M1D3M1I4M2I4M1D3M1D7M3D29M1I22M2I12M1I2M1I3M2D2M1D8M2I2M1D17M1D23M1D10M1I2M1D3M1I9M1D11M2D3M2I5M2D9M2I1M1I6M2I9M2I4M1I9M1D9M1D8M1D3M2I20M4I1M2I5M1D18M7I14M2I10M1D10M1D5M1D6M6I24M2I6M1I7M1I8M2D5M1I2M1I9M1D2M1I6M2D3M1D5M1D4M1I13M3I11M2I23M3I2M2I5M3I5M2I8M2I22M2I13M1I27M1I4M2D7M3D11M2I6M2D16M1I28M1I24M1I4M2I25M2I14M1D15M2D12M4I9M3D5M1I14M1D16M1D16M1D5M1I16M3I8M6D7M3D7M1I14M2D13M1I3M1D17M2I8M2D9M1I8M1D35M1I6M1I1M1I9M1D1M2I10M1D3M1I5M4I1M1I3M2I7M2I1M1I8M1D13M2I4M1D6M5I21M2D6M1D6M3I4M5D9M1I12M1I10M1D8M1D2M1D35M1I21M2I5M2I32M1I8M3D7M1I4M1D3M1I9M4I10M2I18M1I9M1I2M1D8M2I12M2D4M1I14M2I4M1I14M4D9M1D3M3I21M1I3M1D5M1D9M2D6M5I10M1D4M1D14M4I9M2I15M1I7M1I15M1D7M2D10M3D4M1I22M1D13M1I20M1I7M2D10M2I16M1I11M1I10M1D2M1D4M2I7M3I4M1I2M1I11M7D3M2D5M2D1M1D4M1I7M2I2M2I3M1I2M1I18M1I1M2I1M1I7M1D7M1D8M4I1M1I14M1D2M1I20M4I3M4I1M1D9M2D15M1D21M1D4M1I2M1I5M2D7M3D2M1D20M2I3M4I10M3D5M1D8M1I2M2D3M3I1M1I3M1I10M1D10M1I2M2I6M1I3M1D8M1I5M2I35M2D16M1D6M2I21M1D15M1I7M2D7M6I8M2I5M5I1M1I8M1D18M2D10M1D22M1D12M2D3M1I10M1D3M3I7M1I3M3I30M1D5M1D4M2D36M1D5M1D5M7I9M4D17M5D2M3D11M1D8M1I2M2D23M1I3M1I8M1I7M1I6M1I5M1D3M1D1M3I10M1I4M2I2M1D15M2D18M1D4M1D18M1I4M2D16M4I3M1I4M1I8M4I1M1D11M1D2M2I21M1D17M1D3M1I5M1I4M2I5M11I5M3D30M2I4M1I1M1I16M3I5M1I3M1D9M1D3M2I17M1D15M3I3M1D4M1D4M2D1M1I5M1I16M6I16M6I15M3I5M3I8M1D9M3I9M3I7M2I29M2I15M5I25M6I4M3I9M2I5M1I4M1I3M2D14M1I5M1D2M3D4M1I7M1I20M1I2M4I4M1D5M5I3M1I41M1D8M2D21M1D6M1I1M2I1M1I13M1D15M5I8M2I2M1I4M1I4M2D3M1I4M3I1M1I4M2I8M1D2M1I10M1I10M1I4M2I16M1I6M4I5M2D12M2I17M7I4M1D2M1D8M3D4M1D6M1I8M1I2M2I5M1I6M1D12M2D3M4D4M3D9M1I24M2I5M1D3M1I8M4I5M2D8M4I13M1D5M1I7M2I3M2D5M4I4M1D12M1D9M1I16M2D28M1D16M2I4M1I4M1D11M2I31M2I1M1I6M1I7M1D10M3D19M1I38M1D1M2I12M2I3M1D6M1D10M5I1M1D8M1I19M2I15M2D13M1I9M1D21M2I16M1D19M3D1M2D8M1I3M2I23M2I6M2D6M1I11M3D20M2I34M1D4M1I2M1I6M1D9M1I11M2D8M1I12M2I4M1D2M1D7M6I3M2I9M1D8M3D6M6I13M1D4M1I3M3D17M1D19M4D2M2I12M1I9M4D3M2I13M9I8M2D3M2D1M2D17M1D7M2D10M1I6M3I1M2I10M1I22M1D4M1I4M1I6M1I12M1I6M2I28M1D8M6I5M1D5M2D6M1I4M1I1M2I5M1I7M3I14M1D6M1I4M1D9M1I10M5I5M1I7M2D2M1I10M2I69M2D31M3I11M2I9M2D8M1I17M1I6M2I30M1I7M1D11M1I2M4D3M1D9M1I6M3I8M1D31M1D6M1D15M1D9M2I5M1D6M3D9M1D6M1D7M2D12M1I8M1D3M2D4M2D4M2D4M3I6M1D4M4I7M2I4M1D8M1D2M1I1M2D5M3I10M1I5M2D9M3D2M1D13M1I1M2I15M2I16M1D21M4D24M1I5M1D8M6I8M1I9M1D1M1D14M3D2M1I6M1D1M1D14M1D3M1D5M1I7M1D2M1D7M1D2M6D7M2I8M1I9M1I2M1I23M1D8M1D3M2D2M2D4M1D3M1D4M2D12M1D5M1D5M1D7M3I5M1D12M5I15M2I1M2I9M2I3M1D4M1D3M1D1M2I3M1I12M1D16M1D1M1D5M1D4M1D9M1D20M2I5M1I2M1I15M1D3M1D15M5D7M2D19M1I11M8I7M1I16M1I6M3I1M1I5M3I10M1D20M1D4M1D7M1I1M1I8M1D7M1D7M1D3M1D9M2D9M2I5M2D5M1I3M1D1M1D6M1D2M3D3M1I1M1I12M5I8M2D19M3I10M1D12M1I3M1I4M4I11M2I9M1D20M2I8M2I9M1D11M2D3M1I2M2D2M1D9M1D5M2D1M2D8M2D2M1D10M2I6M5I8M4I11M3D2M1I15M1I10M2I13M2D1M1I2M3I14M4I19M2I1M1D4M3I14M2D3M3I2M1I9M2I16M3I1M1I37M1I15M2I14M1D11M2D7M1D2M1D5M2D6M1I1M1I4M1D13M1D9M1I6M1D17M1D14M1D11M2D10M3I3M1D13M1D6M1D4M1I19M1I1M1I6M3D4M3I7M1I10M3D2M2I3M1I12M1D8M1D4M774S * 0 0 AAACATAAAAGAACAGCGACCTTCAGACGTCTGAGACCAGTCAACGTCCGAATCCGACGCTCTACACATCTACCGCTCTTATAAACCCACAGCGGTCCCGGCACCTTCTTCACGCGGCATTGTAGGATTTGACCATGAAGGCGGCGTTGGCACCACCGCCAGTAGCGTAAGCACAGCACCATGATCAGATCGGCTGAACTCCACAAGCCCGGGAATCATCGTCTGCGCCGGTAGTCATAGCCGCGGGCACCATACTGGTGATCAAATCTGTAACAGTGCCGGGATACCCTACCAATGGATAAAGTGGGGCTGACCTCATCCCACGCATCCAGGCGCGCACGTGGAGCACCTGATGCAGCCTGAAGGAAGACCTTCGAGCTCTGCCAGCGCCTGCGGGTCTCCCTGTCCGGCTCTTCGCCTAGTCCTTTCTGTCCCTACCCCGCCGGTGAGATAAACGGCAACTGCCGGAAAAGTGGGCTCCAACATAAAAGAACCTCTAGCTAAGATATAAAAACGTCGCCCATTGTCTCATGCTTCTCCAGTGCATCCAGTACGGCTGCACGGAGTTCAGTATGTTTCATCGCTGTTACTCTACCCGATTGATGCTGCCATCCACGCTATACGCTGGCTCTTCGACAGACGTTCACGCCGTTTATCAAGCTTTGTGTTTAAACGCCGTGGTCAGCGGACGCCATCGGGATTTACCACAATAATGGGGTAACGGTTTTCCCATACACGCTGCATGACATGCCTAAGCGGCCATTTTCAGTTGCTGAACCAACGCGCCGGGAATACGACGGTTACCTACACAGCACGGTGCCGCCATTTGGTAGCGGATGAAAACGCTGCCTTTTACGTAAATGCTCCGCGAGGGGGAAGGACACCCCGCGCATTACCCAGCTTGATTACGGCAAAGTCGCCGGTTAACTTTGATTCATGCGGATTTGACGTGGCCCTTTCATAGGCCCCCTTCCTTACCAGTTCGGCGTACCTTTGTCGCACGGGCGGACCTGTGACGCACTGCGATATCGCGGATGAAAGCAGAACGCGGTTAATAGGGTTGCGCGGACGATACAGAGCAGGCACCGCCGTTTTGGTGAGCCACTCGTCGGGCGCTTTTCTCAATCCTGCTCATACTTTTGGGCTAAGCCATTTCCCTCAGCGACGGTTAACGGCAGGCGTAATCAGCCCCGTCCAATGCCAGAGATGACAACTTCCATACCTGTAAACACGATCCCAGGTTACCAGAAATTTTCCTCACGATGGTCAGCGTGTCTCACGCCGCAGCTGCCGCACCTCATGAGTCAGCCGGACAAACACAGGGACGGGCTTGGAGCTTCAACGCACGCCCATATGTCCGCGGCATAGCTCACCTGCGTTGTCATCAAACAGATTACCACCGTACCTGAAGCCTACCGGCCCCGGATTATGGTGGCTGACTCCATGACGTCCGCGGTACCGCGCGGTATCGTTTCATCGGCGCGGCAATGGCGGCAGCAGATAAGATACAGCAGAAATTATCGAAATGAGCCACAGCGCCTCCCGTTATTGCATTTCTCTCTACAGGCCGCGCTCTGTCAGTCGGCTGCCACACCGGCAGAGACGAAACCGTTACTCCCGGCAGCACAATGCCAAGGTTCATCCCGCGTGGCGTGAATGCATCCAGGTATGCAGCTGTTATTCACCAGTGCCACGACCGTGACCAGTCAGACGTATCAGAATAGAATCATCCGGCTCCTATTACGGGGTTGGGACCTTCATGTCCGGTCCATTTAACATGCCTGTGAGGCCGATGTCTTATGACGGCGGGTCATCTACGCGTGTCATCAAGCTCCTCTTTCAGGGCCCCTCACACGGGAGCGGGGCTTTCTTCCTTTCTTTTACGTCGGCACGGATGCTCCCCGTTCAGTTGTTTCCCGGCGGCACGGGCAATCAGTTCATCTTTCTCGTACTTAGACTCCTGCACAGAACATGGCCTGAAGGCCATGATTACGCCAGCGTTGTACCAGGACAGAACTCATCAGATACCATACTTACTACAGCATCAGGCGGTGCTGACTGAATCATGGGCAACTCACGCGCCGGATCCCTTGGTACCATATTTTCCAACTGTCATGAGAGGCGGTTTAATGCCTTCCTATGTGCGTCGCATCCTGAATGCAGCCTAAGCTCCAAGACCGCCGTGCCTGAGTGTTCTGAGCATACTACGGTGTTGTCCGGCAGGAAATTCTTTTGACGACGCGTTCTTACGTACTGTCTAGAATACACGTTGACGATGGCCCATCACTCGGTACCGCTTAGCTAGACACCGCTTTGCCCAGGTCTTCACCGCTGTCTCGAGCTCCAAATCGAGCACAGACGGTATCCAGCTTCTCCTTGACCTTTATGAAGGAACGGAACAGCGCCCGCGCTCTTCGGATCTTGAACAACCATCATATTCACCACACGCTGGCGTCAGCGCGTGGGCTTCGATATCGTGTGGTCGGGTCATCGTGGACTTGTCACCATTAATAATAGCCGTATCGGCCTCAGGCTGGACTGCTGATGTTATTTCCTCCTGCCGATTTCACCCAGCTGTACCTCAACCGGATCGGCAAGAACGTTAACGGCTTCCTCTTCTTGCTCTGCCAGCACGGAGAAGTAAAGTCGCATCCTTCAGACCTGAGCAAGGGGAGCCAGCTCTTCGTGTAACGCATGTTCTGCATGATGAGCGTGCACGGCGCGACGGCGGTGTAAGCCGCTGGTCCGCCAGAGCATTCTGCGGTAATCTTCATCATCCAGCAGGCGACGAGTTCAGTGCGGATTCACTTCATGCTTCGGCTTGACATATCCCCGGCGTAAATTTCAGGGTACGAGGGCCGCCACGGGAACGGATAACCTCACTAAGAAACAATCGGCGAAACGTACATGCGCCATGTCATTTACCAGTCCGGAATTTGTGAGAGAGATAGACTTTCGTGGTGAAGGATAGCTCACGGAAAAGAAGAGAAGCAGAAACAGCAAGATCAAACTTAAATTCTGCTCATTTGCCGCAGCAGTTGGGCGGTTGTGTAGGATAGACATAAAAATCTAGCTAAAAAGAGGCAACCTTTAGTCCATGAAGGATAAAGTAAACGATGCTTACATGCGTTCCGGCAAACGAGGCTTCCGTTTTCGTCTCGTCTCCTGGCAGCTCCGGCCAGAGCACATCCTCATAACGGAACGTGCTCAAAGTGTGTGAACGTTACTAGTGGTGCTGGCTGTGTACTTGACAGGCAGGACCGCAGGAATATGCCAACGGCAGCACCGTCGCTGTCGGCCGGCGGGAACACTTAACCAGGCCAGGGCCGGGTCCAGCATCAGGGGTCATTGCAGGCGATTTCGCACTCAAGTGCGCCGGGCGCGGTTGCGTATGAGCTTCATAATATTTTCGATGCGGCTGGTAATGGGTAAAGGTTTCTTTGCTCGTCATAAACAAATCCCTTACACTGGTGTGTTCAGCAAATCGTTAAAAGGATCTAGATGCTCTAGTACTATGCAGCCAGCGGTGCTGCCCCTGCGCATCAGACGATCCAGCGCCAGTATTGCTGCTCTGTGCACTCTGTGGTGCTGCTCAGAAATGCGGCTGAGGTCGCTTCGACCCAGATTCTAAGTATGCCTCGACGAATCGTGCCTGTCTTCGCGTCCGTCCAGCTCCTACAGTTGAGGATCCCCGGGTGTCATACGCTGTTCTGCCGCAACCGCTGCGGTCGGTGATCTGCGCGTTCACGTCCCTCATGCGCCGAGCGCGTTCTCGCGCTCGTCGCTCTACACGTCAGACGTTAAGCCTGCGAAGCAGTGGCTGAACAGTTGTTGATCCGAGTCTCTTTGGTCATTCGCCCTCCCTGAGACGGATTTGACGTGCATCCAGTGCAGTCACGCATGACTGGTGATCTCACGGGCTTATTTAACAGCCAGTTGTATTAATGTGGCAGCAGCGCTGCCCTGAAGTGCTGGATAATATGCCATGGCTCCCCATCGAGCACACATCGAGACAGTAGGACAGGCTGTATATTAACGAACGACATGTTATGCGCAAACATCTGGCGGGTTGCGTCGTGGCCTAAGGCGACTTCACATCTCCAGGACGTCATCAGAAGATGGCTGTAGCGATGCATCACACCCTTACCTTCGGGTACGCTGTGGGTTCCACTCGTACTTCCTGTTCCAGCACAGCGTAATCCTGTGACGCTCAGAGTAGACGGTAGATGGAGCTGTCCTAGCTGGCTTCTGCGTGACCAGACGCCGGGGAGCAGAGGCACTGGCAAGCAACTGACCTGCACTGCATTCATGTCGTTGGCAAGCGCCATACAATGGGTTTTTAGTGTCCCACACGGCGATGATGTCAGCAGAGGTCAAATGCCCTGAGAACACCAGCCGGTGCCGTGAGAGTCGTGTCCAATCAACTAGAGTGCCGTTAAGTATCGGATCGCTGGCAGCCTGTTGCAGACGGCGATAATGCCGTTGTAACCGGTTACGCTTACCAATACGGCTGCGCAGCGCGCCCGCGTCCGGCTAACCAGCTTGCTAACCGGCAGCACGGCGATGCCGTTCATGACCTGATAACTGCGGCTGTCGTGGTCTACCACCGTCATCATCTAGATAATGCCGTCAGGTGGCCGCCTCCTGGCAGTCAGGCTGTCGCTGGACAATGCATCGTCAGGGCGTGCCGATCGTACGAGCGCGTCGTGGCAAGGCAAGGGAATAAACCCGCGGCATCTAGCGTTTTCAAGCATCATGGCTCATTAAAGGCCAGGTGGGCAATATGCGGTACTTACCGCATATGCTGTCACTCTTCTCCTCTCTCTGTCGGCTTGTCCCGATTATGGCCCGGATCGGACATGCTGCATAGGGCCAGGCGGCGGTTTAAGACCGGCTGCAACGGCGGCTCAACATCGTGATGGATCATTTTCAGACCTGCTGGGCAAAAATTTCCTGATAGTCGTGTCAGCGCGCGTTTTAGGTACTCTAGCCTCTCCGTCCATACGGTCGGTACTTCTATCAGCATCACCCTTCCTGAACTTCTTTGGTCAATACTCATCGATAAGAACCGGAGCCTATCCAGGTGTTTTAAGAGTTCCCCCATGAGATAAGACTGCGGCTTCATGCGAAAAACCAGCGAAGCGCTTTTGAAGGTAAACGTCACACCAGGGCGAACAGGTTGGCCTCTTCCAGCCAGCACAGAAACATCTGGCTCGCCTGACGCTCTGGATGCGACGAATTTTCGCCGCCCCATACTGACAAATCACGGCCCACGATCCTCATGTCGCAACTCATTTGCCGTGGAGTAAGGTATAGCGATAATTCCGGGGAAAGCTGCTCATACGAGAACATAGAGCCGCCCGTACAAGGCGATACCAGATATGGCAGCAGTGACTGCTCAAACACGGAGTAGCGTTATCCATCCTCGGCCGTCTGCAGGTTACGTGAGTACCATGGCATCAGCTGCTTACTTTGTGCCTCCCCATGAGCGTAACATCGTGCCCTTGCGGCGATCATCGCACCGGCATAATTTCTCCAGGTCCATAGGGTTCAGCCTTTCAGCGCTGCTGCTCCTGACTGTTCTGCGCCCAACGAGAATAATTCATCGCTGACACTGCGTATCCAGCTCATCGCTCCCTCTCTCCAGCGACCCTCCCTTCATATCTCGCTCCTGCGCGGCTTCCGTGTTCTGCCCGTAGGCTATCTTCATCTGCTGAGATCACGCTGTAAAACATTTGCAAGCGGCGGTCTTATACGTCGGCACTCTAAGTTTCAAAAACACGTGAATGAACGAGGAGCGCCCGCCGGGTAATAACACGGTCACGGGTATCCATGTCACTTCTGCGGCATCCAGCCAGGATACGTCCTCGCTGACGTAATATCCCCAGCGCTAACTGATGTCATTAATATCTGGCACCGGCACGGCAGTTTTGGGGCTGTCGCCGGTATTGTTCCTTAGGCCATCGATGCGCTTCGGGCTGACCATCCGGAACTGTGTCCGGAAAAGCTTAGAGACGAACTGGTATCCCAGGCCTGAACGAACAGTTAGGATGTTAAAGGCGCATGCGGGCCAAGTCGCCGAAGGAGCTACCCTACTCAAACGTGCGTTTTGGGGCTAACAACGTCAATGCAGCAGCAGTCATCCTCATGCAAACTCTTCCATGCCGCTTCAACGCGGGAAAAGCACGGGCTTCTTCTACCGCGCCCAGATAGCGGGCTTGGGCGATGACACTGAGCCGGAACAGACCCGACGATATGATCGGTGCAGGCTGGATGGCGTTGGCGGCATCGTTATTGCGTACCAGATCGTGTCCGCGGGCATTGCCACGGGTAAATTGGCTCTATAACAGGCTGCATCACACTTTCACCCTTGATTCCAACGCAAACAACTTGGACCCCAATCCGCGTAAATTGCTTCATGCTGGGGGATCGGGTTTATCGCGCCGGCTTTACTGCCGTCGGCGACCGGTGGGAATGGTGGGCGTTTCATACATAAATCCTGCCTTGCCGGGCGTCGCTCTTGTCGTTCGTCGATGCAATTCCAGCTCTAATCATGCTGCAATATTTAATCTCAGAAGTGGCCGTAACTCCATTCGTGCGTCTTTCTATCACATCCTGTTACCTCACCCGTTTACCTGTCATCATATCGGCACCCGCTAGCACGCTGAAGCGGCAAGTTGTTCCTATGTCGCGTCATTCATCCTCTCCGGATAAGCACGGGGCAGAACAAATCTGCCAGCTTTCTTGTGTCTGTTGGTCCGCACGAGACCCCCTGCCGGCAGGAGGCCAGGCAGGGATCGAGATTAGAGCTGCCCGGCAATCGGAAAATACTCTCGATGCGCAGCGAGCCGCCAGCGCATAAACGAAGCAGTCGAGTGCCTCATTGGGTCGCTTTGCTGTCACACAGGTCCTTCCTCATCCACCCATTTTTCGACCTGCCTTTCAGCCAAGCAGTCAGCTGCTCTGCGCTTCGTCAGATCAAAAATATCCGGGTTATTGCGGAAGAATGAACGGCACCGGGAAGCGGTTAGTACCCTGTCGGGTGGAGTGTGAAGCGCGTATAATCTGCTCTGTTCGCCGGGGTATCTGATCGATTTCGGTAAGGTAAACCCCGTTTTGTTTTCGCTAATCGTGGATGCTGTCCACCGGCCTTTTCCGTAGACGGATGCTTCTAGCATGGGATCACGGAACAGCCCATGTTTTTCCAGCGTTCACACTGCTGCCCCTGGTAGTCCGTTAATCCCGCCCCAGGTCGCCTGGCTAATACGCGCGGATATCGACATTTCTTACACCATTCCGGCATATCTATTTATGGCTTGATGGCCTCATCTACACGCAGCAGCGTCTGTCATGGTTTAGTGGCGGCCGATAATAATCTGCCGGTCAATCAGCCGGAGCTTTCCTCGAGCCGAGCCATCCCCAGGTTGATCCTCGCATTTCGAGCTGAGTATGCGATGATAAGTGGGTTCAATAAGCCACACGGTCAGGAACGGGCCTGAATAATCCTCTTCCGCTCTGCCCATCTATCTTCAGCATGTAGACGTTCGCTAAGTTCGCCTCCATAGGTCACGGCTTTGTTTACGAAGGTTTACGTTTTCCCTTATCTGCCCTTCGTTTCGGCCGGACCGTTGTTTGACAATCTTAGCACCCAGGTGGTGCTAACTGATTACCAATTTATCAGATGTGAAAATCACACTGTCAGGGCTCAATCGTACCGGATGACGAAACCAGAGAATGCCATCACAATTGTCAGAGATCCCGGCTTTTCACCATCAACGGGCATCAGTAAAGTCCAGCTCCTGCTGGCGGATGACGGCAGGCATTATGCTCGCGCGCTCGCATGATAAAAACACGCTGGCTGGAGAGAGTATCATCCGGCGTCATTTGAGCCAAACGGCGTCTCTTTGTCGCCAAATTTACACCATCCTTCCTCGCCCTAATGCGGCAGGCAACATGAACGCAGCACTTCTGCGCATTCTTATCCTGCATCCTGTATCCTGTACCTCTCTTCGTACCGTGGCGGAGCCACGGATGGACTTTGGGATATAACGAGCTTCAATACGGTGTGTCTACCAGAGGAGGAACGTTGTAGAGAGCCTTCGGTTCAATATTACTACCAAACAAACAGCAGGAAATCATCACACCCCACAGCCCGACTTCTCACGCTTATTTTGGTTACCGCCTGAGCCCAGGAGCACCACGCCTAAGCCATTGGTGAACGAACGCTCTATCCAGTGTTATCCGCTGCTCTTTGCCATACCACACGGGGCCAGCGATGCGATAGAGACGGTATAACTGGTACGAATAGTGGAGCCAACGGCTGGTTGGCTTCATAAAGTTCTCTATAAGCAGCCATCCGTCAGGGCAACCAGATAAGGGGCTTCTTTGCTATGCTTATGCTCTATAAAGCTGAGACCAACACCCCAGCAGCATTTGGCTTTGAATAACCGACAGGCGGTATTCAAGATTCACTATGGATCGTACTCATGCTCCATCGCATTCATATGGCCCGCGGTGAAAGCAGTGTTTCCCATGCGCGTTCCTGGTATGCGATTCTTTCGGGAGATAGCAACCCTTACACTCGCCCATTCAACGGCTTTCTTGTGAGAACGGCCTGAACATGAGCGGGACCGGCACCCCGGACAAAATGCCGCATGGTTTATACCTGACTGTTCGATATATTTGACCACCACCATACCATTATCGATAGTTTCAATCCAGCGCGTCAGTGAGTCCTTTGTTCGGCGCGCGTGTAGCCTCGCGCCTATCGCTGTTCCAGGAAATCAACATGTCCTGGTTTTCCAGTTCCGCCCAAACGCCGGCGCCTCAGGAGGCTCGAGAATACATGAGTTCTGGTATAGTCCAGGATCAGAGCTCCGCAATCTGCCACTGCCATTTTGGTAAAGTTAACGAACAGTACCAATTCGGTCTTCCACGTACCGGTCGTCATCCGGCATTCGCGCCATTCCCCTGTCGGCTCGTTCAATTGGGTCCTGATGGGGTTCTGATTAACCCATTCTTAGCTCCACTCTGCCCCTTTCTGTTCCACTCTCAATGAGGGCGGCCTAAGCTTCGTTCTCAATTTCAGATCCCCTTCTAAGCATACCATTTATGCTGACCGCGCAGAGTCATAAGCACCTCATTACCCTTGCTACACTAGATCGGCATTAACCTGTTTAATCCCCCGTTTTCTGATATCTGACTAGCCACGGCTCGCACCGAAATGTCACTCATTGCCTTTGTTGACTTCCATTGTTCATTCATTGTGACGGACAAAACAGAGAAAGGAACCAACTACCAGTCAAAAGCTCGGTTTCAGCCACCTGTCGTTTGCCCTTTCTGTCTCAGAGGGTATTTTAAATAAAAGGCTGCAGTCTGACGAAGAAGAACCTAAACGCCTTAAACCGGAAAATCTTCATAAATAGCGAAATAGCGCGTATGCCGCCAGTAAACACCCAACC * tp:A:P cm:i:76 s1:i:694 s2:i:0 NM:i:1930 ms:i:2654 AS:i:2654 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
38 34 0 utg000001l 11088 60 406S19M1I14M1D1M1D5M2D7M1I5M1D4M1I17M1I1M3I3M2D4M2D9M1D1M2D18M2I5M2I2M1D7M1D14M1I23M1I1M1I5M2I4M1I4M1D5M3I5M6D8M2I14M3D32M4D2M1D4M1D19M1D5M2D1M1D9M3I1M1I1M1I2M1I21M1D2M2I9M4I8M1D5M1I2M1D9M2D1M2D13M2D5M11D5M4D3M1I5M2I1M1I12M1D3M2I4M1I10M1I2M2I4M1D9M2D4M1I7M2D7M6D5M1I10M1I3M2I14M2D27M3D4M1I5M1I1M2D3M2D17M1D3M2D8M4D3M1D15M1D10M5I2M2I3M2I1M2I8M1D6M2D2M3D6M4D2M6D2M1D3M3I5M1D3M1D1M1D2M2D14M3D2M1D1M1D9M2D1M1D4M6D6M1D1M1D4M2D5M1D1M1D11M3D11M2D2M1D3M3I6M2D18M1I8M4D5M2I1M1I13M1I7M1I3M1I7M3I8M1D1M1D2M1D9M5D8M2I2M1I7M2I2M1D2M1I27M2I8M1I6M1I3M1I9M1I6M1I4M7I4M1I5M1I7M3I3M1I10M1D8M1D3M1D5M2I2M1I2M4D5M4I3M1I1M2I6M2D5M3D3M4D20M1D6M2I19M5D7M1I2M2I4M1I6M3I21M1I2M1I5M2I8M1I10M2D3M1I12M4I9M1D7M3D2M1D1M1D3M1D3M2D5M1D3M2I5M7D3M5D6M2I10M2D8M4D8M1I5M1I4M2D13M2D7M1I25M3I4M4D6M6D5M2D5M2D5M3I3M1I2M2I12M4D7M2D3M2I6M1D2M1D14M2D6M3I3M3I1M1I5M1I7M1I2M1D5M1D4M1D9M1D18M3D10M1D21M2I1M2I2M1D5M6D2M1D5M9D20M6D1M3D7M1D11M1I2M2D2M1D8M1D8M2I5M2D7M2D6M2D1M3D22M1D9M1D1M2D6M1I6M2D28M3I6M1I19M2D2M1D2M1D2M1D4M4D5M2D15M1D9M1D6M1D2M1I15M11D1M1D7M1D2M1I2M2D5M2D10M1D4M3D3M2D8M3D3M1I4M2D4M2D1M2D9M1D1M3I8M1D9M2D2M1D5M5D5M1D10M1I10M1D8M1D7M3D9M1D8M7D3M1D9M4D7M3D6M1I8M8D7M2I5M3I18M4I2M3D24M3D3M4D11M3D2M1I6M1I8M3D2M1D2M1D9M1I5M1D8M1D5M5D6M1I4M2I2M1I4M7I4M2D4M3D11M3D21M5D5M1D11M1I6M1D4M1I6M2I7M1D3M1D4M1I10M3D9M1D3M2D3M1D1M1D6M2D6M2D1M2D12M1I4M1I23M1D26M2D5M5D3M2D3M1D16M1D2M10D1M1D4M1D5M3D11M1D5M4D2M2D2M1D2M6D2M2D12M1D6M1D5M1D3M1D5M1D1M1D12M2D6M1D3M3D2M2D1M2D9M1D4M2I3M2D9M1I19M1D11M2D2M2D1M3D7M3I8M3D6M1D10M2D26M2D4M1D2M5D1M1D6M2D29M1D4M3D9M2D4M2D59M2D2M1I3M1D1M2D3M1D15M3D4M2D5M2I22M1I6M2D6M1I13M2D20M2D12M1I7M1D4M1D12M2D4M11D6M2D1M1D4M1I3M1D7M6D5M2D2M1D6M3D1M2D3M1D7M1I1M1I2M1D3M3D4M1I1M2D2M1D2M1D8M3D1M1D36M1D14M1D16M3617S * 0 0 CTTCTATGCGGTCTGGCATGTAATTGAATGAGAGACAATTTCCACGGTATCTAAGCACTAGGATAACCGAATAGAGGGTTTCCTATCGCGCATGTTAATTATAGTTGCCGGCATATGTTGACAGACTATTTGTATTAAAGCCATATTGGCTGGGTTGACTATTCCATGAAGGCAAATATCCAATCAAGAGCTCCGACGAGGTTAAAGTAATTCTGGCTAGCCGGCCCCATCTAAGATAATGCCATGAGATAGCAAGAATTTTAATGGTTTGTAGGAAAGTGCTCCAATCCATCCAGCAAGGTTGGCTCTTAGCGGGTTTTTGACGTCACCCTAAGGTACGGCCAACACATTGAGCAAGAATCTTCATCGATTTGGGGAAGTCACTCCGAGTAAAGCCGCTCACTCCATTGAATTATGAAGAATGGTTTTATGCGACTTACCGCATAAAAGGAAGACATAAGCTCAATAAACCTGTCTGTTTATGGGTCTATCCCTGACTCGTAGCCTGCACGTGAGCTCCAACTTATTTGGTTATTCATAAATCGATGGAAAAGACTTTTCTCTTTACCAAACAAATGACAAGAGTCTGGTCCCAGACAATCGCTCTAAAGTCGATGCCATATCAGGACAGCCCAAGACGAATCATTGGGATTCCCATCTTTGTTGGGACACATTGGTTTAATCAGAACTTTCGGGCCACCGCTCCCGTAGCACAGATTTAATCGGGAAAGGAAGTGTCATTAAGCATTATTGGGAGAGAGGGTCATGAGGTGACAACGGAGGAGTCGGCCGCTAAGTCTGCCATCCGGTCATGAAACAACGGTGAGGACCAGAAGCCAAGCTACGTATTGCGGCGATATTAAAGATTAGGGGCAACATATCCAGGAGCTTTTGAGTCATCAGGCTATAATCATGAAGCCAATTTAAAAGCAGTAAAGGTTGCCAAGAGTACTTTATGAGTCCTCAATTTTCATTAGCCGTGAAAGATGAGGATATTTTAACAGAACATTAACCAAAGGCGCTCTCGGACAACAATAAGTATATCTTAGCACTTAGTACAGGCTATATAAGAGCGACTTGCCCAAGAATGAAAGTATACTGGAAGTTTAGGCAAATAGCAAATTAAGGCATTATTATGAGACATCCAGGCTGCCTTAGTGTTGATAGTAATAATTCCTTACTAGTTGGCCCATTTGCTATCTCCTTTCCCCTCATTCCTGGTGTTTTCTTTGCATAACGCGATATGTCTTGGGGACATGTCATGTAGTGCAGGACCATGATTGCAATCCTGATTGCTGCCTTGACGTTTCTAATCGAAGAGCAGAGCCGACGCCTCCCGCCATTAGAGAGAGGTGGGCTGACATCGGTAATTATTGTCCTCTCCTTAGTTTGTTGCTATGCCTTTGTTAGTATGCTTCTTCCCATAGCATAAAGCGGGGCCTGATACGCACTCCTAACCAATCCCTCTGCATCGTCCTTCATATGCATCCTTGTTTCCAACTAGCTTTACCGAGACAGACCTGAAGCCGACGCCTCGCCATTCTTCACCATCCGCGACACCATAACCAATTATGTTATTATGAGGACAACAATAGATACACTCGCTCACATTAAATCTCACTAATCTAAACCTAATCATAGTCATAAACATACAGATAAGTAACGGTGATAATCTATCGCTGTGTAGACATACACTGGCTAGTACTGACTATGAGCACGATAGAACGCTGACATGAAGCTCTAACTTGCCCTGTCGAACGACCAGGGCAGCATTCAGCAGCACTTTGGCTGTGGACCGAAACGAAGCATGCCGTAAGTGCGATTGCATTAGACTTACAAGTGCTTGGCAGCGGGGTTTTCTGGTTCACTACAACTGCCCACCACGCTACACTGACACGAGAAGCCAGATACGTAGAGCACACGCGACTGCGCAGAGAAACAGGCTCAATGAAAGCATAAATCCCTGTCTGTTGGGGGACGGCAAAACCGTAGTTACACCGCCTTCTCGGATGCGCAATGGAAATCACGATAGAAAGCGCAGCTAAATCCGATAGCTTACAGTGCTGGCTGAATACCACAAACATGAGATTGAAAGCAACCTGCAACGTATTAGGCCGATCAAGATGACAGCAAGGCTGGCGACACAGCAAGCCTTGAGATGCACCCGGCAAATCAGGAAAATGAGGTACTTAAAATTACTTAATATCCTGCTTTATCAGACTTATGGATCGCTGGCAACAGGCATTCAATTCTTTAAATAATAATAGAAGCTCTGCTTTCCACTTCCATCGGGAAAGTTGTTTGGACATAAGCTCTCATCCACCTTATGGCATTGTTTGTAACCTATGTCAATCACTTCCTGCACAATCAAAATACCCAGCTATTGCTCTTCTGACACTATTTTGAATTACTGATCGCATTTATGTTCATCTTAATGCCGATTTTCTGTACCTTAAACCTTATCTGGCGCCTGGCATAGCTGACATCGCATTAAGCTGCTTTAGGCGACTGCGCCAAATAAGCACGAAAACATGCCACATGAGGAATACCGATCCATCGCTATTCAGGCCAGGTTATCGGCTGTAAAGCAGAAGTCCAACCATAACGATCATAGACGTTCTCTCCGAGTCTATGCTGAGCTCGTTAGAATAACGAGTACAATGCCATTTCTATAGCCATCAAAACTTAGCGGTTGTAATAGGTTGACCGATTTAATCAAGAGCCGATAAAGAGACTTATTGAGCACATCTTTACCGCAATGCCTATTGTTAATAGAGAATTTACCGATTCGAACGCATCTAACGCTTATGGAACAGACCCACTATCGTACCCTACTGACTAATCGGACTTGTAAACAATTTCGGACGATGCAATGGATCAAGCTGCAATGAGGATTAAGTGCCTGAAGAACTTTCCGTAATGGAAGGGGAAATATGTTAATAAATGGGCAGTGAACACTATTGCCAGAAGTGGGCAAACAGAACAACAAAGCTGCTGATGGCCTTTATTTGGCATAAATAACAGAATAAACACTGCACTGTGTATTCATTCCAACGAGTGAATACACGTTAAGTGTGCTCTATCTAAACAGGGGCCTGTTGATTGGTTTGGAAATCTTCTTTGCCCTCTGAGTGTGGTAAGAATTTATCTTAGAGTCTGAACAGATGTCGACCGTAAATACATCATTGATGTAAGGTGGAAGCATCAATAGAGTGCAATGATATGATCAGGGAAAAACAGATCTATTTCTGGTCCTGACTATCACGCTCAAACTAGCCTTATGTAATCGTATTAATCATGCTGACGCAACATGCTCTGCTTAGCATTTCAAGCGACTTAATGCATATGGTGTTGAATTCTGTGAATGATGGAAATGGTCAGGACAGTATCTAGCCATCCTTAGCGAAGGAATAAGGGGTTACCGATACATCTCACTAGGAGGCTCTTGGTCGTAAAATAAGTATGATACCAGCACGCTATTAAATTTCTCCGCTGGGGCCTCGCTTCACTCGAGGCCCGAATTTCGTCCTTATAAATAGGATGAAGCCTAAATTAGATGTCTGCTGGCTGCTTTTATTCCAAATTTACTGTAGCCGATACGTAATCATGATGCCTATTAGCTTATGAAATAAGGTCTGGCTAAATGGTAAAGCGGAATTACAAGATGGATCTATACTAAACCTCATTCTCCCACTCTAGGTTAGCTCCACTTTGCCTGTATCCAGCTCCGATGTTCTGCCTCGTCCTACCTGCCCTGACAGAACTTAAACTGAGACTGGCAGAACCCTCAGCATTGTCTAACCGCCTTTCATCTAATGTTTTAAAATGGACGGGGCAATTGTTCTAGTATGAGCACGAGGTATTTGCCCTAAGGTCGAATTTGCTATAAGTAGGCTTATTACATTGCCAGTGGTTACAAAACCGACTGCACGTGCTCGCTAAAGCCCGTGCAGAGAAGGGAGCCAGAACGAGCATAGGCAGGACGGACAGATCGCATAGACTTTCGATCGCTATGCCACTAGTACCTTTAAGGACGAACACAGCGCCTATAAGTGCACTTACCGCATTCGTTCTGGCGGCTCGGATGTTGCGTGCTCGAAGCAACCATACGATACAGATCAGTCCATGAAATTAGCTAAGTGGGTCCATAAGCCGACTCCGATGAGTGGTAATAGGACTCAATGGATAGGCAGCTCATGATCGGCTGGTTAAACGTCATGTCACTCCACAGGAATATGCCCCTGGTCACCAAGGCGATTTACAGACTTAGAGCGTAAGCAAGTTCACTCCCATTAAATGGTTTACATCAGAATCGCTCATGCTATCCAGTCTGGCGCGCGTTACTAGGTTTGTAATAACCAGAGTGGCATCGTTTAGTGAATTTATGAGTCATTGCCGAATATAGGGCAAACCGACAGTTGGAGTAATTGTCAGCAAAATGAGTCTATCCTTACAGGTTGATTATGGTCCACGCGGGCCAACATCGTAATACGATTAGTTGGCCGGTGCTGCTGAGTGCGCATACATTCGACCCGGGGCGAAGGGAAGATCATTACCAAATTATGGCATCCGAAAACAAATGTCAGGTCATAATAGGACCGTCACATTACAGTGTCTCGTCGAGTTGTAGTATCTATGACAGGGTGGAGCCGAAGTAGCGGTTGGGCAAGGTACAGCTGCGGGTCAGCCCATGAGACATCTAAATTACCATGAATAATCGAGGGATGTAACACTTAATCTTACAGCCTGAAATAGCTATCTTGCCCACTGGCGGGATCGGCGACTGTTCGCACTGCGGCGTGCTAACCGTCAAACTTAGCACCAAGCGGCCCTCTTGGGTTGAAGATAAGCAGGCCAAACCAATGAGAGCGCTGGCTAGCACTTATCCTTAGATTATAGAGCTTAATGCCTCTTCCAACGCTGAAGCATATTAATTATGGGCTACGAAAATTAAAGCTGGGCTTGCTGGCGCTTCCATGTCGCTATTGAAAACCGATAAAGGCAGAAATTAATCTATGAGAGTGTCGCGTCGGGGCATGTGCTCAATGTTGCCGGCTGTGGCTGGAGCGTGGCTACTAAGCGCTCATGGAGAGCTAATCACAGAGCTAGAGCGTAAATGTTTTCAAGATCCTCACCTTTAATAGTGGATGTCACTATGAGTATTATGAGTTAAACTACAGCGGGCTAGTATGTAATTATAAGGTGCTCGATATGTTATTAAACGAGCTACGTTACATGGCAATGCGCGTTGTATAGGGGTCAACCGAGTCAAGCCGTATTTCAAGAGAGCGGGGATAGTCGGCTCGGTATAAAGTAGGGGTATGGCGGCGGCGTAAAGCATGTGATGACAGCAGGGGCGACGGTATTAAATATTTAAAATAGTAGGGTGGCAACAATTAAGGCCGGTAAATGGTCGGTCATTGGGACAAGAGCGCGTGCAAAGTCCTAACCAGAGTTAGGGATGGTTAAAGAATTGAAGATGAGAGCTGGCGCCCGACTCCCTGAGCAATTAAAGTTTGTGGTCGGGGCACCAATACAGTGGCGATAACATATAGTATGCATAAGGTAACGCGCATACCTTTCGTCTACCGTGCCATAGCGGCTGGAAAGCCTTTAGTATTTGGCAGTGGCGCACCACAGCGGCTGAATAGGAAGCCTCCGGACCGACCCGCGCTGTAGAGCGTATTCTGTTTAATTAAATGAGATATGCGAGAGCAAAGCTTTAATAGGTTGAAGTCAATTCGACCGTGAACCGCAACCGAGCAGCCAGGGGTTCTAACGTTAGCCCTTAAGGTTCTAGAAAAGGCGAGTCAACCGAAAGCGAGCAAGATGAGGCAACCAAATACTATAGAGTGCGTCTGGCTCGCATGAGCTTCATGTCATGTGTATGGTTACATAGTAGATGTTTAATATAGGCGATAACATAGGTCCGGATAAAGTCACCGTCCACCCACGTGGCGTACCGACATAGCATAAAAGTTCTCAGCCTCTAGCTCTTTAATATAGCTGTTGCTAGTGGGTTGGCGCAACATAGAGTATGAACTGACACAATGGATTCAGCGGTGATAGGCTTTAGGCTGGCATGATCACATGTTAGCCGTTATTGTAAGGGGTAAACATAGGCTAAGCGAGGACTTAAGCCGCATAGGCATGGGACTGAATGTTATTGACATTGCCCATTACTAAGCTATCTGCTCAAGCCGTCAAGGATACTGCAAGGGCATACAGCTTAACTTATTAAACCGTAACCAATAGAGGATCGACAGATAGCACGACGCTAGGTTAGGTAAATGGCCAGGGTAACTTATTAGATAAAATTGTAGGTGTGAAAGTTAGACCAAAAGTGAACGCAAGCTACATGGTCGTTTAAAGAGTGTGTCCTATTGTTAAGTGTAGGGAGAATGGCTGTAAAGTAACCGATTTGGCAAGTAAAACGCATATCCTGGAGGTGATTCCGGGCTCAGCAGCGGGGTTGGGCACTATGGGGATTTGACAGAGACCTTTCCATGAGTATTAGCCTAAGCCAGTTATTGGGCTGTAGTAGATAGTAGGGAGAGGTGGCCATCAGGTAGGCCGCTACCGGAGTACCAGGGTTGCTATAGGTAATGAGAAATGTTTTAATGTGGCATCGAGCGGGCGCTCAGCAGCGAGGTCGGGCTAGAGTAGGAAGGTTGTAACAGGTCGAGGCCTAGCGTTATTGTGAGTAGGCGGCAACGCAGTTAATATTGCCAAGGGGTACGTACCGTTATTGTTGTTTAGTAAAGTACTGGAGCTCCTGTTGACAGCTAGGTCCATGGGGGCGCGCGTCTGCCAGTGCCTATCCATACATAATAGCGTTAATATAGTAGACTATGTACGCAACTATGCTAAGGATGCGTGATAGTGATGATAACATTCGATGGCATGGTGACAACTTATTAGAGACGTAATGTCTACTACTATAAATGAGGCTTTGTGTGTCAACAGGTAAT * tp:A:P cm:i:18 s1:i:141 s2:i:0 NM:i:1150 ms:i:374 AS:i:198 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
39 35 16 utg000001l 24388 60 12S15M3I4M2I14M1I2M1D3M2I10M1D4M1D26M1D23M1I8M1I10M1D9M1I8M1I6M1D6M1I4M1D4M2I7M3I7M1I2M1D13M2I10M2I8M2I6M5I7M2D6M2D4M2D4M1D1M3D3M1D7M2I7M3I6M1I6M1I1M2I4M1D7M1I9M1I7M1I2M1I7M1I8M2D2M2D4M2I10M2D12M1I7M1D8M1D1M2D35M1D13M2I10M1D9M1D2M2I11M1D3M3I4M2D3M1I3M3I2M1I29M3D5M2I8M1I18M7I9M2D1M1D6M2D4M2D1M1D11M1D35M1D18M3D7M1I15M1D34M2I5M2I9M5I1M3I2M5I3M2I8M1I5M2I1M1I4M3I2M2D5M1D12M1D11M3D7M1D1M1D10M2I21M1D6M2I15M1D8M1D32M1I36M2D3M1D1M1D11M2I4M2I11M1I4M3I3M2D2M1I8M1D8M1I17M1D3M2I4M2I15M2D5M2D7M7I4M2D1M1I9M2I7M2D11M3I3M2I10M4I10M5D1M1D6M1I6M3D1M1D8M1I2M2I10M3D11M3I2M1D7M2I6M2I7M2D2M1D3M2I14M1I17M1I11M2I13M1I15M2I5M1I1M2I2M1D4M4D2M1I21M3I4M4I3M2I3M2I4M1D7M1D15M1D4M1I10M4I2M5I4M2I9M1D6M1I2M3D5M1D7M2I2M1I7M2I10M1D4M2D5M2I5M1I1M2I5M2I5M1I27M1D8M2I3M2I7M4I4M1I1M1I6M1D5M1I5M3D4M1D17M1I14M1D24M1I2M2D6M1I6M4D2M1I10M1D5M2D11M1D2M1D10M1I6M1I6M2I6M1D3M1D6M2D24M1I5M2D21M1D6M2D2M1D11M2I10M1D10M2D2M1D8M1D4M1D13M1D10M1D5M2D4M1D36M1D13M3I9M2D9M1I7M5I6M1D9M1D2M2I13M1D6M1I1M3I6M1D9M2D9M2I6M4D6M2I2M2I1M1I2M1I5M2I4M1I9M2I3M1D11M1I2M2D23M2I4M2I3M1I5M3D9M4D12M1D5M1D3M3I6M3I9M3I8M1D6M2D3M2I4M4D15M5I4M2I4M1D4M1I6M2D6M1D5M4I6M1D11M2I13M2D13M1D4M1D7M3D13M1I3M1I6M1D4M2D13M1D10M1D4M1D8M2I11M4D3M1I1M2I9M5I6M2I12M1I1M4I27M1I17M3I1M1I1M2I18M4I9M2D5M2I1M2I4M1D2M2I4M3D5M7I11M1D6M1D6M1D3M3I7M1D4M1I4M3D2M1I25M2I2M2I20M1I8M1D14M1I8M2I1M3I3M2I6M3D2M1D6M1I7M1I3M3I17M3I13M1I9M1D24M3I11M2I6M1D4M2I4M5D11M7D3M1I10M8D4M1I14M2I9M4I4M1I3M4I7M1D3M1I32M1D7M2D15M2I16M3D9M2D4M2I5M2D5M1D7M2I7M1I16M2I7M1I7M1I3M1I15M1I2M2I2M1I8M4D2M1D4M4D6M1I14M1D14M5I3M1I10M3I12M1D12M4I3M4I16M3I3M5I4M1I12M1D3M4I7M1D19M1I6M3I6M2I2M5I3M1D6M3D7M1D17M5D7M1I5M2D20M2I16M4I5M1I14M2D2M1D8M1D7M1I8M3D17M2I20M2D21M1D14M1D5M1D7M2D3M3D15M1D7M1D21M4D9M1D2M1D5M2I7M1I3M1I5M2D12M1I17M1D37M4D5M1D5M2I11M2D11M1I12M4I15M1D1M2I6M1I18M1D10M1I4M2I2M1D3M2D6M2I1M1I5M2D4M3I1M1I9M4D6M10I22M1D2M1D3M6D10M3D5M2I2M1I23M1I10M1D8M1D5M1I3M4D3M2D3M1D5M1D30M1I10M1D6M2I6M1D16M1D10M2I3M2D15M1I15M2D1M1D2M2D2M1D3M1I8M1D1M2D1M1D4M1D12M1D8M1I6M2I8M9I11M1D3M1D9M5I12M1I3M1I1M2I5M1D14M1I6M2I9M1D2M1D4M1D6M2D15M1I19M1D1M2D20M5I2M2I1M1I7M1I5M1I9M1I15M2I24M1I11M1I5M1I5M1D6M1D10M4I15M2I8M1I1M1I21M1I6M9I9M1I51M346S * 0 0 CGTCTCATATTTAACTGAATCATCTATTACTATTACAAACCAGAAAGACGTATCGTACCGCTAATACGTAAAAGATTACGAATTATTACATGCCTTAGTAATCTATGGCAGAATGTATAACTTGCTGTAACCTCTTGGCATCACAACTAACAATCCAATGGGTGACATGTAAGTTCGCAACATATCATTCTTAGGTAATTCTATCGATGAAGCCAGGAGAATAACTTATGTTAAAATTAAAAAGATTACTCCATAAGCACTATCTTTAAGCAGAGGAAGAGAAGCCAATTCCGAGCGAAGAGTAGGAAGAGCGAATTAAAACTGGTAGATAAGCCCTAAAATATCACTTCGACAGAAGAGTGTTATGATTATACAGCAGTGCAGAAACGACTTTTAAAGGACGGTTACCATTCAAACATTAATTTATGATAACATTCCAGCCACTTGGATTTAATAATACAACATTTGATCAGCCAGTACGCCTCTCTTTGGGTTTGGGCGAAAGTAGCGGACATAACAAAATGCCTATGGCTTCATTTGGGATAGAGCTATGGCTGAGAAAAGCAAGCATCTACTCAACCAAACATAACCAATGCCATTATAAGTAAAAGATTTCAGTAATTGGAATTGATTCAAATAATAATCAAATGTATTCATGGAAAATAGTTAGAACGAAGAAAAGCGACTTTAGAAATATCAACAGCAGACTCAAACATGACGAAAAACAAGTGTTCGGTTGCGTTCATGGCGGTCTTGATTTCGGACCTGCATTTGAGCGGTGATGTAAACACTATGAACATTGAGTCATAGAACTTCCATTATTCTCCCGACATAATAATCGCCAAATAAACCAATACTCAGCTTACAATGTATTAACTAACCGCAGAACGTTATTCATACAACGTTTCTGCGGCATATCACAAACGATTACTCCAACACTAGGACAGCAGGCCATCAATATCAGTGCAGTTGATGTATCAACACGGTTCAGCAACACCCGATACTTCTTCCAGGCTTCAGCAACGAGGTTTCTTCCTTCGTTGCATTTCCAGACCCTGCAGCAGGCGGAAGCGGAAGGCGCAAGAGGGGATGGAGGCTGCAGGAATGTCGTTTCTTCCCCTCCCAGGGATCCGGGACCAGTTCTGCTTCATCCTTCACCCAGGCTGTGCCGTTCCACTTCTGATATTCCCTCCCGGCGATAACCAGGTAAAATTTTCTACAAAACATAACCGAGTCGAAATAATAAATAACGCGTCGCCGGAAGCCACGTCAGTGACGGTTTGTACCCCCGATGGTCTTCAACGAGATGCCACGTTTCCCCTCTAGCTCCTGTGCGACCCTCCCATCCCTGCCGGAATCTTCTCTGAGTGCATGGTACGTGATGTTTGCAGGCAGACGGTATGGAGGCGGAATATGCGTCCTCTTCACCAATAAATTCATTAGTGGGGTTTAAGTAAGCATTATAAATTTATGGTCGTGGTTGTTCACTCATTCTGAATGCCATTATGCAAGCCTCACAATAGAGTTAAATGCAATGTTTGACGGTATTTCTCGTTACCGCCGATCAGAATTTAACAACGTGATGGTGTCGTCTCGAACCACTGAAGAATGGGCATGAGCACCGATAACAACCGGATGCTGGTGCGCACCAATACCAACTGTATGCGCAGTGTGCATAGGGCACTCACGGCTTAAGGGACAATGATGACTGTGGCTGCCCTGACATGTCCGTTTTCGATAAATAAGCAACCCTGTGCTGGTCCTTTAACTGTGGATAACTTCCTGTAATGGTTGCTGTTCATACTCTCAGCCAGAACTTCATTCATCCTTAACCACTTGTGCTGAGCACCCGGCCCCTGTTGAACCGCTCAGACTGTGAGCATGAGCCCCGTGTTATTCGTGGATTTGGTGCCGTAATCGAAACTGCCTGTTGTTCGGTGCGAGCCCAATAGAAACGACGATGGCCCCATTGCGTGCGAAATTAGAGCAGGGGATGAGATCGGCACTGTGGGCTGTGCATGTAATTCCATCCTGTTCCTGAGACAACCACAGCAACGACCGCTGGCGGGTTTCCTTGATTGTCCCTACGCATATCAGGAAGCACCCGATGGATACGCGACAGCAATATTTGGGTAGGCTGATTTGTCCAACGCCTGCGCTGCATCCACGCTGGTAGACGCACGAGCGCGGCTGGTATCGGATTCGGGGAGCATGCCGGAAGGCCCGAATTCTACGGCCCCAAGGAGCCTTCAAGAACATGCAACGAATTAGGGTTTCAGAATATCCCTGCCTCAACCTGAGTCAGCGTTAAGGCTGGCGCATCATTTGCGCAAATACGGTAATTTATTTTTCGCGTGGAAGCCCTGCCATAGCGTTCAGTATTCATGCATTCTTCGGTTGTTTACCCCTGATTTAGTCATGGTGGTAGCAAATCTGGATCATTCCCGAGCGCTGCGGCCAGTTCATTCAGCGTATTCGGTTGGGTCAGTAGACGCGTTAGCTGATAACATCTGCAATACCGGCGTATCACAAAAGCGGTCGCAATCGTATTGTTTGTTCCCTAGGGAGCGCGGTTGGTGCTTGTTGGGGTCACCTTCCGTAGCGGACTGTCCAGTCTCATTCTGTTCGTTTCATCCATTACCACCTTAACACCGCTTTGGCGTTGCAGCAAGCGTTTCGACGTGCTGTTGGTGCTATGCACGGTGAGCTGCACTATCCCTTCGTTGTCCCGGTACTCTAAGCGCGACAGCTCTGAAGCCTATATCTTCTGCACGTTTTGCCGAATTTGCACGTATTGCCGCCGCTTCTTACGAATGGCACCTGGAGGCGCGCGATGGAGCACCGCACTGCCCCGTCTGCCTTCTGGAGGCATCCCAGTGACGCAGCCGCCCTGTTGCCGTCTGCCGCTCCGGTGCCGCGCATATAGCCCCGTTGGCTGCTGTTTCAGATGACCTGCATTCGTCTGGACGTAGTTGCCGCCCTGGCAGGGTTCCTTCCGTTGCCGGAATCCCCTGCGACCCCTCCCATCTGATGCGTTTCTTTCCTTCCTCCTGCTTCGCTGCCTCTTTGCGGCTAGCCCGCATCTCGCCTTCGAGTGGCTAACGTCTAGCGTCGTGACGCCCCCTATCGTGAGCAGAACTTGAGGCCCTGATGATTGTTGTGACGCATGAGGCAGCATTCGTTTCTGACGTTCCGCTTAACCGGCACCACGACTGGCCCTCGCCGCGTTTTTGAGGACTCTGCGGCTCGGTGCTCACTTTTCCCTTCAATGGCCTTTGCTGATGCCGCCCTTCTTAGCCGGAGGACGGTTCCTGAGCTGACGATGCAGCCTGTCCGGCGACGTGCTTGGCGGCGTGCTGAGTCAGTTGCATACCAGTTATAAGATACACGTTGGGCCTGGAGCAGCTGATGCAACGGCATCGCCGGCTGATTTTCTTCGCTGCCGTACTCTGTGCCAGACTACAGACGCGTTACGCGCCCTCTTCCACCATCAGTTCTAACGACGCAGCAGCTCGGCCGGCATCATCCTCGTCATGGCACAGAGAAATCATTCAGCGTCCCGGTTGTGAATTTCATACACGTATAGTTGGCGGTGCGGGTCGATGGGAAAACCGTCAACCCTGCAGGATGACATTGATTGACCGTACTCCACATCCATGCTGTAACGCCCGGCTTCATCGGATTCTCTGAGCCACCGTTCACCACCACCCGTGGTAGTGTCCTATAATTCTGGCTTTCACTATGAATGTATTAAGTTTCTGTACCGGTTTTCCTGTGCCGTCGGTTACAATTCCTAGGCAAATCTACTCGGTAGAGAGCGTTCACAAAAGAATCTCCGGCGCATTGATCCCCCTCGCTGTATTCGCTGGCTAATCATTTAACTATAACGACCCAGACGATGAACTGCGTTAAGTACGCCGCCGGTACGCCTTACGGTTCAAGGACATGACAACGACGGACGCTGCCGGATTAATCTGTTACCTGCACTCCACGCCACACTGAGTATGCCGCATTGCACTTCGTGCCTGGCAGTGGTCGTCTCTTCATATACCGGGAGTGATTTCCGTGGAATCCCAATCCATCGACCCCGAATGCATGACGGTAGGCTCATGGCCGGTACGGACCCGACCTCATGACCTGCTTATGATTGACAAACTCAGTCGGTAGATGTACGGCTACATAACGTCACGCAGGCCGCCAGTGAAACGTGTATCCTCCAGGTCACTCTGTTGCTCTTTCTAACGCGGGCGACCCCAGGGAAGCCACCCCCACACTGTTAGGGAGCTTCAAGCAACTAAACGGTACTTCACGGTCAATCCCTTTCAGATGACTCACACCCCAGTATCCCCGCAGGACAACGACGGCAATGTACCCGGTTTCTACTTGAAATAGCCACGTAAACGGTAGTACCATGTCACCCCCTTCGGACGGAGAGCGGAGTGACTGTCAACGCAAGGTGCGGCGGTGGAGCCAAAGACAGCAACGGCAATACACATTACGCATCGTTCACCTGGATGTTTATAATCAACGCCACCGTCGCTCGAACTGACTGTAAGCCCAACACTCACCAATCCTTACGGTAGCTGGGCATATTAGGCCTCCAGCGCCTGGGCTCCAAGAGAGACCCGCACATCGCTCAGGGAAACTTAGTACGGCCGAACTTCCGTTTCTCCTCGATTCGGCTTCGGCATCGTCGGGAGCCTTTCCCCTACCGCTTCTGGCATGTCAACATCGGAGAACACCTGTACATGCGTTCGCCGCTCAGCCATAATAAGCAGCACCGTTCATACCATCAGTACTTTCAGATAACACAGCCATCGTGCCTTGACATAGTAAATTACGCTTACTTCCGCGAAACGTCAGCGGAAGCAGGTTAAC * tp:A:P cm:i:37 s1:i:399 s2:i:0 NM:i:1388 ms:i:1358 AS:i:1358 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
40 36 4 * 0 0 * * 0 0 CGTCGAAAACCTTCGAGACCCAACACATGTAGTTTCGAGCAGCCTCGGTTCTACGAGACTAGACTATTTTACTGTCAAAGCGTCCTTATAGCTGGAAGTACAACGCCGCGAAATGACAGGTGTTAAAGTCCGTCGACCCGCGGTGGCTCCCATGCCTGGGTCGAGGGGCGGAATGAAAGATCATTCGACGGTCAAAGCGTCAAACATTCCATTATGGCTTGACATTTTCGCCCCAGCGGAGCCCATTGCTGATACCGGCATAAATCGTAAACGCAGGAAAAGAGTTTGACGCTGCTCGCCCGTATGGGTGGCGGCCACGTACAGGCCCTAGCTGGGCATGCAGCGCCGTCATATGTAAAATCGTTTCAGAAAGGGATGTTCTTTTAATCAAAAATGAGAACGAAAGTGTTGCCGGTGCCGCGGCTGATGAACTAAAAGGAATGGGATGGTCAGTCGTATAGTCACACTCCTGACGTACCATGAAAACCGTAATCTTATTCAACAGGTAAACGGTACTGTCACGGTTCTTGGCGCAACGGTTTCAAAACTTACGTGAAGTTAACATAAAACGGCGAAGTTAACCGGCCTCAGAGATTCCTTCAGGCACGGGCGTATAGGAAACGCACTCATCGGCGTATCGCGTAGGGTGTGATGCGGTCAATCCACCGTCAAACCCCTACGTCATTCTATGCGCCGAACGTCGACCGTCCCGTTCCCCCTGGGGCAACGCGCCCCATCGCCAAGGGCTTCGAAGTGGACTCGGACAAACCCACATTAGCTGTTGATCTTCCTGAACGCGATCAGGTGATGCTAAGCGATGAAACGTCCACAAATAGACCGTCCGGCTATGGTCACCCGTAACGGCCGATACATGGGGCCGCTTTATTACGACAATGACAAAGAGCGACGTTTCAAAACAGTCCCTATCTACGGAATACGTATGCGGCGCATATCCCGCCTCTAGGCCTGTTGTTTGCTGTAATCGTTGCTATCGTTCCGTCCCGACTCAATCTTGCCGGTCCACAGAATGCCGTTGAAGCGGCTTATGCAGGATGACGCCTAGAAATAGCCGTACCCCTCCTGCTGAAATCGAAGTGCTCCGCAGTCATGACGGGCCCCGCGACCCCGTGCCCGTGTTCAGCCCTAACTGCGTTTAGGACCCAATGATTTGCCGTGTAACCTAGGCACGTTCTTTCATGCAGCTGGTTATTCTGTGAAATGCTCGTCGGGGCTTCATTATCCCGTATCAGGATAGTACGACGGCAGCAAAAGCGGCTCGGTTGCGAACCGGATGGTGATGCCCCAAACAGCGCTGAAACAGGACTATTATCAGACTGGTTCTAGATCACTCCGTCTCTTGCTTTTCCGTCGCATAGGCGTCGTGAGGTTTATCTACAAACATCAAGCGGAGCAATTCCAGCGTCATGTCAGCTGTTGAATATGGTTCCTACGATTTAGTGTGGTCTGGCCCCCGGGGCGGAGCTTCAAATGTTGCAACGTAATGAAAGTCGTGAGTATTAGCGGGTCGATGAACTTTCATGCCTTTACGTACCCGAACGAGCACGTCTTATCTGCGAAGTCTCCGCGGAACAAGGCGTCAGCTTACACGGCCGGCCGGCCAAAGTCCACTCCGTAGCCCAACGCCAAAGCTCACTAGGGTTGACGCCATGTTGGTTCATAGAATCTTCCCTCAAGCCGCGTACTGTTCGGCAGCGCTTCCAACTCTCACGGATCGGGGGTATGTCACCGTATTAACCTTCGTGACAAATAACTCCAGGTCGGCGCCAAATCGCACGGACGACGCTGTAAGATCCTGGTTCAGGTCTTCTGCGAGCATGCCTTCACCCGCCAGCACCTACTCACGACGGTGGGTTCATTTACCCGGTTCTATAGACCCGCGAAAGACTCCACGGACCACGCGATGGCATTTCGCGCCATATGCGTCCATCGGGACCCACGATTACGCCAACCTGACAGTTAGATTCATTCTGCCGTTAATCTAGTGGAAACCGCACTGATTACCGCCACCATGCGTTCAGATTAGCCAAAGACTGAACGAACGGATTACATGGGAAACAGGTTTATCCAAACAGTGCGGAGAAACACCAACTTTTATCCTGTGAGACGCGGTTCCGTTTGTTAACGGGGAGTTCGTCGACGTCATCCGGTTTCGCTTGACATAGGATGATGCATCATAGGAACAGCATACTGGCACCAGGGAAACTCAGTGCCATTCGACCGCTCTAGGGTCTAGTCGCCGCATGCTTAGATGGCTCCAAGGATTCCCAGGTGGAATCCATCGAATGCGCGGCTGGGGCGGATGCGGTCTGGAGGTATAGAACATGACTTGGCCCCATGAAAGCCCGGGCAGTACGCTCTGGAGTGCGCCACGACGATGAAAGAACGTGGCCTTACTCTTGCGCCTAGGTTTATGACCCAATAACAGCTTTGCCTGACGTCCCCGGCATTGAAAGTGCTGATACCCGGCTACGTCGCTCGGATTTCACTGGCTCTGACGGATACTAAGGAGCTGTGTATGAACGGGTCTGAAACAACTTAGCTTTGCGAGCCCGCGATTTCGCCGAGATGTTACGGACTGCGGCAACGCTGCGTTGTAGTCACGATCGAAAATGCCGGGGCCAGCATGCCACGGTACCCCAAAAAGAACGGGAGTGTTGTGCATTTGAAAGCTGCGGATTCATGTGATACGTTTTGTGAACAGTTTACAGAGATGAAATGGTTATTCGATTGAATCGCTTCCGCGACCGTGGTCAGTCCAACAATGCTTCCGGCACTGATGGGTAGGGTTCCAGCGACGACCAGCCACATCAGCTCAATCGAATTACGCTTGAACCTAGCCTCACGCATCAGACGCGGTAGCTAACAGATTATCCAGATAGAGATTTAAAAGTTCGCTAGTCATCTCACCGAAAACCAGGTTCTAGCAACCAATCCCACAAAACAGCGACATCCCAATAGCGTTGATTGGCGTCGGACCGCCGTTAGCCGCCCGTCGCGCCCCGGGCGCTGCGCATCAGGGAGGGTCTCCTTAGCGATCGTCCCACGGCGCCAGGGGTTGCTGGCGCTCAGCCACCGACGAGGATGGTGGACCAAACCAACACTGCGACGATTACTCTACTTCGAGGGCTAGCCGGAGAGGCGATAGAGCACTGACGGGTCAACAGCGACGACAAATCTAGCCGCTGCCATGTTCTGCCTGCAACAGTCTGCAGCTAACCTAGAAATGACAGCTCAAACGGGGCAAATATTCACAGAAAGGAACTGTCGTAAAATGAATGAGTTTAGTCGACGACGAAGCCATACGGGGTGGCGCCCTGAAAAAGAGCCCTGCATTCAGTCGGAAGGAGTGGGACTTTAACTTCTTGTCAACATGACGCATGTTAACCTGCAGATGTTGATTTATGGAGGGAAACGCCACAGATGCCACTGTCTCTTGCGCTCGAACTGCCATCTAAACAGGCATTTGACGGTGCGTATCCTTCGTGAATATGCTGGTTATCAATTGTAGGCATGATTTGGGTACGCACCTGGCTGGAATAGCCAGACCGTCTGAACCCGTGGGATGCACTCTTTGGCCCGCCCAAGTGGCCTTTTAGAAAGGCCGCCATCCGTTTCCGTCTGGACGATCTCTAGTACGGAAGAGAATAACGGCCCTCCCGCCCAAACGCGTTTACCTGCACTGACGACCATATTGTCGCTAGAGAGCGGCTCCTTATAGGCTTAACTCCAAGTCGGCTGGCTCTTTCCGTTGATCGAAATTCTATAGAAAACCAAGAAGAAGCCATGCGTAAACCTGCCTAGAGCTAACCGTCCACATGAACACTACTGCGTCGACCGCTGCTCGCATCTAACTAGTCGAAAATTAGAATACCGTCAGCAGTTGATTCGCACGTCAACAAACGGTGCTTTGCCATGTCAAATTCCATCCATCTAGCAAACCGGTGAACGGGCTGATGGTTGAGGCTTCAGATAGATCGGCTCGCTTTTCGTTCGGCCTTTCTTACAGGACAACAGTTCTCCACCCGACCTCTGTTCGAATGTACGCAATTTCGAAAGACCATCCGCTGACAGCGAACTGCTCCGCGCCGTGTGCAGATTAATTCGACATGCCGTGCAGCTGTTCGGTTAAGAGTATCCTTGAATAGAAATTCACGCCCTGTTCATAATACCTGCCCTCAACTCAACGGAGGACCTCAATACCCGTATACCCCGGGCCCCTTTCAGCCATTGACTATTTAATCGTAGGGTAGAACAGCGCATGGATTGCGAGGCGGTTCAAATGCCCCGTTGGACTGTCCAGGTCGCTATCAGTATTAAAGATGCTCATGAGCTAGGCGCTCGAAGGCTTCGACATGTGATTTCGATCTCGCATTCAACACGCATGAAGGCGCTCGCTGCATATAGCCACCCTAGCACCTATCGTTGCTTGGCCAGATGAGGTCCGAGCTGGCCAATGAACGGGTTTTACGTCAGGCATAGTCTTCAATACCGTTCTCTATAGCGCGAACAGTCAGGAGCTAAGGGGAATGACGGCTCCACGATCTGTCTAACAAATTTCGCCGGGCACTACGCCGCTTGCATGAGGTCGTGGGCTAGCGCAAAGGTCAGCATGATAGGGTATCGCCTGACTGCCCGTTCGAATTTGCCGGTCAACGCGTTGTTAATCGAGGGGACGTGTTATTCTGCTCATCGTCCCACTACATGCTGGGGCTGTCATGCAGATGCTGCCCGGTTGGCTAGCTCCGCCGGTAGGCAGCTCCCCGCGATGAATAGATGCCCAGTTGAGGCTAATCCAACAACTTCAAAAGCCTGTTACGTGCGGACAAACGAGCGCTTAGGGCGTACACCATGGCTCGCTGTCTGAAATTGCGCCGTGCCAATGCTTGATAGCGGTCCATAATGGGATTCTTTGTCTTGTTGTGCCTAGAAGGCTATGAATACCCTGTACCCTGACAGATGCGCCGACGAGCTAGCCCGCCAAATGGCGCTTGCCAGTACTCCCATAAATGCCCGCCATTGCCTGCTTAGGTGGAACTTTCAACTTCTGGATAGGTTATCCTGAGCGCCAGTGGGGTCTGATGAGTAGCCTTAAAAGAAGTTCATTAAACTAGCGATGCTAGTGTCAGCAATAGCACGACGTGGTCCATCGCTAAAGTCTGTGAAATTAGTCTGCAAAACTTTTATAACCAAGACGTTAGTTGACAAAACTCTTCAGCAGAGCTGGCGAACGACTTCGATGGGTCCCCGTCCGCATGGTCGTTGGAAGCGCCCATTATTTCTGCGCTATGGACTCCACGTGACGTGCGTTGCCAAAGCAACAGTGATTATCCCAACGTTCAACTTCAGGCACTGTTCGGTAATTGCCTTCCAACCAGTCCTGCCGTCAGTTCACGAGGCGTTCACGAGCTTAGATGGCGGCCGTTGCCTGAAGTTTGCTGCTGTGCGAGTTCCCTGTGCGGCCTGCTGCAGCCAGCCCGGGACGCGTTCAAAGGCACGGTAAATACGTAATGATGTCACCTCGATCCAGACAAAACGATTTGTGGAGCCCGTCTCGCCCCATCTTTGACTGCCCATGAGGGATTCCCTGTGCGACAGCTGGCATAGTTATTCCTTAGAGCCGCCGACTAACAGTACGCATGTACTCTAAGGTCCAGGTCACCGAAACGCACTGCCTGGCTGATGGTTTGTTGTCAACCCCGCTTTGGACGCGGCTTAGTCGCACCGTTAGAGTTGCGTACCAACTGTTACAACGGCATCGTTCGGCAGGCAGCACTGGGACACTGTCTCATTTGATCTAGGGTTTGGCGGACGTGACGGCACTCTGTTCATATGGAATTTTCAGCGTCGGTCAGCCTGTCTCGTCGACAGCGCTAAGACCCTCGTGTTGTAGTGCCTGCACAGGTTTTCCGATTCTTTTCGTGTTGTTCAAATTTAAAATGTTCAGTTCTTCTATCGCCAACGAACCATTAACTTTCTCTGCACCGTCTTGCAGTACCATGCTGCCGCCGGCCGTTCTTAACTCCTTCGTCCTATAGTCCCTGGTCAATAATTAACCCTTCATCTGACATGATCTCACTTGCTGGCCAGGTTTGTCCTGTTACAGTCTAATTAACGGTGGCCTTCTTTCGGTGAAACAGCCTTTGAATCACGGCGCAGCACCGTTTACGGTTACATCTAAGTAGCACATTCATCGTTGACTAGATAATCATCCTTGCAGGTCCAAATGTCGTCCTTTCTTATACGCAACCTCTTACGCTTAATCGACGCAATCTCACCATCTATCGCGGTATCAAGCTGGGACCATTGAGCGTAGCGCATCCCTAGATACATTTACAGTGCCGCGCGTCTCACCGTTGCAGTGCCCACATGTACCGAGCGTTAGCCATGTCTACTTTCAGACGCGATGAACTTGTGATCAACATGAGGACTTAACGGTTTCGTTGCACTCACCGTTTCGCTAGATGCAATCCACCCCAGCTTCAACCCCGGGCGGCTCACGACAGCCCCGATCTGCTCCGCCACCGTTATCGAATGACCAACAGGTAAGCGATCAACAACCGAGCTTCGACGCTTATGTACCACTTCAATTCGCAAGGCTTCAAAGGCTACTTGTCTAGCCGCCGACGTGCCAGGAGGACGCCAGGCTAAAACTGCCGCTGATGGCGCACCCGACGTGAACGGCCCCTACATTACACCGCGCATCTGAAGTTGCGCTCAATGGACCATGGTCTGGTTAATAGCTTCAGCCAATCCACAAATCGGGTAGAGGTGAGCCAAACAGCAACGCGTGACGAATTCACGTCTAACGGGCCTGATTGCAGAAAGACCATCGCGTTTGTTGAAATCTGAACGGATGCTTGGATCCCTGATACCCCATCGCAGCCAGCACCACAGCGAGTGCCGCACAAGGCGCATGACCAACAAGTCGCGTAGCAAGCCTGATGCAGCGGCGAGCAGCCACAGCGCTGGCTCCAAGCTGACGTAACCCGCCAAGTGGGATGCCGTTAACGATTTGCTGAACACAGTCGATTGATGTTTATGACGAGCAAAGAATCAACAGCTAGATATTTGCCGCTTAAGCTGACAGTGATTAGGGCTTGGATCAGTATTTGAAGGCAGCGGCCCCAACCGGCTGTTAACGAGTGCGCGACGAAATCCCCATTTCTTGCAAGGCACCCCGCTGTCGATGCTGAGCAAATATTTCGCTCAGCCGTACATGTTTGGGGATCCCTTCCATTACCCAAGGTAAATGAACCTGGCCTTATGCTATCGTCAATCTCGCGTGGCACTCCATGCTGCTCAACGACCATGATCACGGCGTCGACCAGCCAATAGCGTAACACTGCGTACCGTCGTGATCTCTGTCGTCCTAGCGGCTTGGCTTGCTCCTCCGTCATGTCAGAAACCGTGAGAAGCAAAACGAACTTCGGGTCGCGTTTACAAACGCAGGGCAAGAGCGCATAGCCGAGCGACCTGCGCTTTCGATGAGCACATCATGTTAAAGGGTTCGTCGGCGCGCGCCGTCGGCGTACGCGACTGTGGCGCTGATGAGCAACAAATGCCATAACCGCGTGGGTGGCAAATGAGCAGTATGAACATGTACGTCGACCGCCGGAGGGCTTCGCGCTGCCTCCCCTGAGCGAGAGCTCGGTGGCGATAATTGGGTCAAAGCAAGTCGAGTTCGGCAACTCCGTCAACGGTAAACCAAGCGAGCGGCGCTGACCCATCGCTTGATTAGATCTCTAGAGTGCTCCTAGGCTGGTTTCCGGCAAAACAAAACCTACGCTTCGGATATGCTTTTAAGAAGCCGACATGATCGAATTAACGCATGCGGTTTAATACGTGTCTGTTCCACGCATTATGCCTGCCGCGGGATGAACACCGCATACCGCGGCACCCGGCCCTTACCGCCGCTTTCAGCATCCGAGTTAAGCCATGGCCAAACTCGTGCTGACGAAGGTCGTTTGCTCAGTTGAATTCATACTCGGCATCTGCAGTCTTCTGCGATGGTTATGCAGGGACAAATACAGAGCGAAGGGGACCGCGCTCGCATTTCATCGTCGTCACTGATGGATGATGTCAGAATAAAGAACCCAACTTCACGGTCCTTTAACCCTAGTTTTAGGTCTAGACCGTTCATGACAAGGCAGATGATAATTAGATCAGACAGTGAAGTTCAACGTCATCGGACCGGACGCGTGACATTCTGTCATAGGCGTTATGTTCAACCTTCGGTTTTCAGGAGTACGCTGGTACTGAAAGGTCCTGGCGCTGTAGCCCAAGTGAGTTTTATTTCGGTGCAACCGCCGGCTAATAGGACAGTGCCGGATACATCAGAATGTTGACCTGTCATGCATCCCGGCTTTCGATGTAAACCTTGAACAGACCTGGCTAAATGGCTTTTGATTTTATTAGCCCGACGCCCGCACCGAAGGCGACCTCATCATTGTCATTCAATCCTGAACTAAGCACGTGGAAAACGCCAAAAGAACTTCCCCTCGTATTAAACACGATGCCTTGTTCGCGCCCGAACATCCTGGCACGGCGTCGCCTTCAGTGCGGATTTAAGTCCGTTATGCATTGGTCCATCGGACGTCTAAGCACTTTGGTGACTTTCACGTTTAAATCGCGTGCCTTCACCGTTACTGAAAAAGACTGCGTCACAGTACTTAGTACAATCCTAGCGATACCGATACATAGTTCAGTTCCAGGAGAAGCAATGCTGTTTAGCGCCGCTATCACGGAGAGGGTTCGGTGTAAACCGCGGACAAGGCGCCCTCTGCTGCCATTGGCTCTCCGTGGGAGGATGGCTGACGAACAGTTGAAAGCTGGTACTGCCAGGCAATTCTGCCCTGCTGCCCAAACACGTCGCGAACCGTTTGTCCATGTCTTGAAACTTCGTAAACGAATAACTAACTGTCGTCTAGGCTCAGCATTCCGTTTAGAACAGGTCCGACTTGGATTTGACTTTGCCTGAAGACGAACGCAGTCCAACGACTTCTCCAGCGGGTCATGACAGTGCCCTATCCCTGGCCGTCCCAAAACCGCCGCTGTTAACGGACATGAAAGCTCGTTTAGCATCCCAAGTCCCACATGTTGGTACAGCAGCGTCCACATTTCTAGATAAGCTGACGGGACGGTTCAGGTTACTGAGCATACCACGGCCGCATCGGTGACGTCGCATAAGTACTGTCACTCATCAAACCGCCCACGTACTGGCCATTAACCTGTGGTACGGTTGTGCCTATGCCGGGAACGCTCATCGCCTCCTGTCGATGGGGGTCGCCGCTGTGTGGATACCGTTGAACCAACGAGACAGTAGGCCGGGGAGCATATTCAAACCTGCAATAACGCCCCTGCCAGGTGGCTTAGGCTGATTTCGATAACCTTCACCGCGTTTGCTGCGTATTCACTAGCGCCATTGAAACGATCGCGGGTATACATGGGAACGAGGTTGCCGCAGGTCACACGCTACATGCTCCACTCATAGAGCGACCATCAGCTCGTCACTACAGTCGTGGTCGTCGGATCGTCACCGTGAAACCAGGCCTCGTCCGACAGGCGTGCTTCCGTTGAATGTTTCATCATTTAATCACATGTAGCGGTTACTTAGTCCGGACGCCCATAGCCGCGACCTTTCGAGGCGTTCTACAAATCGCTATGAACGGTTTGTTGCTTAAACACGTGGTTCTTCTAGAGCACTGCGCCATCGGATTTCAGACGATGGACTATCTATCCCTTTTCCCAGCCGCTGCAAACTCTATGCAGCGTACCGCTTTGCCGTTACAACGGCCTCCCGCTGAAATGGCGACATTGTTGTATACATAAAAGCTTAGGCTAATGTTCAGGATGAAAATAGCCGCTTTACGTTTGAACGGCGCTGCCTGGCGCTGGCCGCAATCCTCAGCAGCTTGATCCCTGAAGTCGCCGCGGTTGCTGTTTGTTGACGTTGGTGGGGTACAGATGTTCG *
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
41 37 16 utg000001l 17216 60 2958S4M1D8M2D6M1D26M5D9M2D12M2D11M5D4M5D10M1D9M1I3M1D9M2I8M1D8M4D5M2D5M1I4M1I8M1D2M3I19M1D2M2D4M2D12M4D2M1D7M3D1M2D4M6D10M2I8M5I11M3D5M1I8M3D6M1D1M1D6M2D2M2D11M3D29M4D7M1I1M2I5M3I14M2D12M2I6M1D2M2D4M1I11M4D1M1D2M2D6M2I3M1D22M3D4M3D5M1D1M2D1M1D3M3D10M9D14M1D5M6D7M1D2M1D15M4I10M1I15M12D8M5D11M4D3M1I1M1I3M1I6M3D2M1I9M1I6M1D8M1I2M1D2M4D2M2D4M2D4M1I16M1D5M1I4M1D19M1I5M1D4M1I6M1D5M1I4M3D4M2I3M1I3M3I5M1I7M1D2M2D4M1I7M6D7M1D10M3D2M1I15M2D7M3D3M3D2M1I3M2D12M2I12M2D7M1I6M1D5M1D4M3D8M1D3M3D1M1D11M1D5M1D12M3D8M2I3M1I2M3D4M1D10M2D4M2I6M8D2M1D10M2I1M1I1M1I7M1D12M1D6M3D1M1D5M1I2M1I3M1I5M5I8M2D15M1D4M3I11M1I1M1I6M1D12M1I5M4D8M6D3M2D3M1D2M1D3M3I15M1D2M8D1M1D2M4D2M1D3M5D2M2I17M2D23M4D7M1D2M1I13M1I8M1D3M2D20M2I1M1I7M1D6M1D1M3I14M1D6M1D18M2I8M1I4M4D8M1D7M1D14M2D3M3I10M3D20M1I3M8I8M7I7M2I16M1I2M1I7M1D2M1I3M1D9M5D7M2D3M3D8M6I14M1I1M3D12M1I7M4D4M1D3M1I6M1I13M2I3M1D6M1I5M1D26M3I6M1I6M1D3M2I4M1D6M4I4M4D29M1I14M2I8M5D17M2D4M2I10M1I2M5I2M2D13M2D9M4I3M1I2M1D1M1D7M2D7M1I5M1D7M1I6M1I5M1D12M3I3M1I7M2D8M1I4M2D4M1I29M7D19M1D9M1I6M1I4M2D8M3D7M2I3M1D4M1D9M5D5M1I5M1I2M4D6M1D8M2D8M2D4M1D1M1D4M1D13M4D5M1D6M4D11M1D2M2I6M2D5M1D5M2I9M5D12M2D9M2D2M1D4M2D8M1D3M3I1M1D3M1I4M2D5M2D9M2I3M3D2M1D22M2I17M2D1M1D16M1I1M1I10M1I1M2D6M1D14M1D11M3D8M2D16M1D8M1I6M2I30M2D1M1I5M1D4M2I21M1D5M1I3M1I6M5D1M1D2M1D8M2I4M1I2M1I3M1D4M1I3M1D6M3D2M5D9M2D3M3D2M2I11M2I6M1I4M1D13M1I18M1I14M1I2M1D3M3D9M3D8M1I10M2D14M2D15M1I11M3D11M1D14M1I2M1D7M1D1M1D8M7I4M4D14M2D4M1I4M1I29M1D4M2D5M1D11M1I15M3D5M1I6M2D5M3D9M3D2M2D1M1I10M1D7M1I7M1I2M1D4M1D6M4I1M1D5M1D10M2D4M1I9M1I3M1I10M1D2M1D5M1I15M2D7M1D2M6D2M1I5M2I4M1D8M1I10M6D12M1D3M1D9M1D2M1I7M1I4M1I4M1D7M4I6M1D11M4D5M3D3M1D5M3I2M2I14M2D16M2D2M1I3M1D6M3I2M4I7M1I8M4D3M2D4M2I2M1I2M4I2M1D4M1D1M1D12M4D7M1D4M2I5M4I5M4I5M6D17M1D1M1D3M1D3M1I6M1I5M4I4M2I1M3I5M2I2M2I1M4I13M1D3M1D22M2I8M2D3M3D4M1D6M2D1M3D16M3D4M1D4M1I7M2D1M1D9M4D7M1D6M1D2M2D12M1I10M1D6M1D10M1I6M1I1M1I7M2D2M1I3M4D2M4D14M2D4M1I8M2D1M1D20M3I8M1D3M1D4M3D4M1D1M1D7M1I1M3D2M2D20M1I8M2D5M3I12M5D14M2D6M2I3M1I3M1D1M3I5M3I9M3I3M2D4M2D2M1I3M1I18M2I5M2D8M1D8M1I10M2D1M1D1M2D2M1D2M1D22M2I6M7D2M6D8M2D13M2D7M2D10M3D16M1D4M1D8M1I1M4D7M3D17M2I16M1I24M2D2M1D6M2I6M2D2M2D29M3I3M12D7M2D2M3D8M1D6M1I2M1D8M1I5M1I6M2D8M4D5M1D3M1D11M2D8M1D14M2D6M1I7M1D3M1I3M1I3M2D3M2D3M4D3M1D6M1D13M2D7M3I14M1D5M3D7M4D12M3D1M1D3M1I22M2I10M2I1M2I9M2D5M1D2M1D4M2I4M1D15M3D1M1D7M1I4M2D6M3I7M3D4M1I8M1I2M2I31M6D27M3D6M3I1M1D4M2D4M2D11M1D11M4D1M2D9M7D3M2D6M5I4M1D9M1D6M8D3M2I2M1D7M5D9M1I6M2I2M2D9M1I2M1D11M1D7M1D22M3D16M2D9M1D11M2D8M3D7M3I5M1D7M6D1M1D5M1I3M1I8M4D2M1D9M3D5M1D27M1D9M4D9M2D4M1D8M3I1M1D23M5D6M3D3M2D2M2D17M1D4M6I10M1D7M1I3M1I6M1D1M2I6M1D17M1D4M2D8M4D18M3D11M2D6M1I4M2I5M2D3M1D5M2D7M5I10M1D10M7D3M11D4M1I10M1I2M1D1M4D5M1I5M17D6M4D4M2D4M1D5M1D5M1D5M2D15M3I1M1D12M1I13M3I4M4I2M1I3M2D2M2I9M1I5M1I5M1D2M3I12M1D8M3D20M5D3M8D1M3D5M1D3M1D18M1D7M1D6M1I12M2I2M3D10M1I5M1I5M2D10M1D2M1D20M1D9M1I8M1D8M1D9M1I9M3D8M5D8M1D9M1D7M2I5M1I2M1I26M6D25M3D7M1I4M1I2M4I7M1I2M1I4M1D5M1D5M1D1M1D9M1I10M2I11M1I6M1I3M1I5M2I4M3D10M1I4M3I6M1I9M1I1M1I14M3I2M4I5M2I8M2D16M1D1M2I8M1D9M2I8M3I14M1I1M2D6M1I8M6I4M11I5M2I6M1D5M4D3M1D7M1I30M4I11M2I4M1D8M3I9M3I13M1I9M1D5M1I25M3D7M1D5M2D3M1I6M2D2M1D16M2I3M1D5M1I13M2I4M1I18M1D3M2D6M1I4M3D1M1D2M4D3M2D1M1D4M4D21M2D10M1D11M1D15M554S * 0 0 GACCTGATTTCCTTCCTCCGGTAAAACTGCCCCCGGTCTATACGTGTTGTGGTACTACGGTGACCATAGAGGAACACCCAAAATACATCATTGATAGACTGAACGAAATTTACAAGCATAGAAAGTAGCTGATTATGAAATCGAAGGTTGACGGATTTGAACAGAGAACGGTACTAAGGATTGCTTCGAGTGCTCCCGACCATACGTATGACTCGACTTAACACGGCTTCGAGAGCAAGAATGGAGCGATCATGCTCGAGGACATGCTGCTAGCAATCGAACCTGGTTAGGTAATGAGACGCATGTTCTATGTACCGACGCGGAAGGAGCGGCTGGTTGCTGACTATGAAAATACGCCGCTCGGACTATCATTAGGCTGTAACGAATAAATTAAATAATTACGTACTTTATTTTGATAATGACAGAAGCACTCATCAGGTAATGACTTATCTTCTTGATCGCTTCTACTCAATAATAACGGCTTCACTCGAGGGGCTTCTATTAGTATAAAGCATCCCTGTCTGTATCCGCAATCTTCACTCATGTCGCTTTTATCCTTGGCTCCTTATTCGACCGGCCCGAAAAGAAATAAACGAAGGAGGCGGTAGACAAAGTGCTTACGTGACGTAGTACCCGGAACTCTTCTAGAGTGACAGTAATTTAACTGTCAGGTACTGATAAACCGGATAACACTTATGCCTGTGGTAGTGATGAGACCCTTCCTGCTTCCCAGTCGGCGGGTAGTGAAATATTGTGATTCGGGCTATAGAATGATGGAACCATTACGGAGGACGGTACTAATACTGAACTGACCAAGGAGCAAAGGGATTCACTAATCGCTCCCTTCCGCATTGACGGCAGAATGCGGTGACATACATACCTCGGACTCACAGGCGTTGTTCGTATCCTCAGGAGAGCCCTGCCATTTCCATTCACGTGGCGGTGTCGGCGAGGCGTAGTGTAGTATGGAGAGAGCCGCGCTTAGCTACTATTAAGCTTCAGCGGAGTAAAGAGAAATAGTCTAAACTGATTAACGACTAGTTACTCAGTTGATGAAAAGCTGTTCACTCGTCATGGGTCGAATCGCCCTCGCTTAATGATTACAGGAGGCGCGACGAATTTCCGTCTTCTCGGGTTTACGGGCAAACCGTTCACCTGGTACGTGATGACGACGGAGCTTATCCTTCAGTGTTACAGGCTAGGCGTCGCCCGGCGTCAAGAACAAGAAGCATGAGCACTGATGAAAAACCATTGCTCCCCCGGCTGTCCATCGGTGAGCGTACGGTGATTCCAGTAAAAACGGAATCGGTACTTGCAATCCTCCCCATCCGTTCGGGAAGCTGGCGGAACGGTGGGACTGATTCGGGGCTTACAGGATTAAAAGCCCGATCATTGGTCAGGAAGCCACGGAAGGAGGATGCCATGATGGTGCTGATACGATGCTTTCGCATCAGGGTGACTCTATCTGTCAACCACGCTCGATTCCTGATGCGATGAATCATTCATCGCCGGGTGCCCTCTTTAGATACAGTACTAAATGCTTAATCCGCGGAGCTTTAGCCGTGGGCTAGAGTGGCTCGTTCATCCATTGATGGTTGACCGATGAAAAACCGAGCAGCGTTGATGGCAGCGACTTTGACTAAAATGAATCCTGTACGTGCCGGATTCCCCGCGCTTCTAATCATCGATCTGCGGAGCCAGGAAGGGGAATCGAAGCCGCCGCTTAGAACCATTCAAACTCAGAAGGCAGAGAAATCACGGGCTTTACATCCAACGGTTTACGTCATAAATGATTGAGTGTGCCCGTCTGGCCTTCGTCACGCTTCTATCTATGACATGAAGCTACCTAATCTAGTCGAAAATACTGCAGGACTGCAGAACGTACTGAACGCGACATGACCCCTTCCGGGCTTCGATGCAGGAGATTAACACCTCTGCTGATCCTGGATAAAACATGGGATGACGCTAATGCCGCCGCTCTGTTCCCCACTTCGCCGCCAGAGACATTCGTGCATCGTAGAACTGACAACCGAAGCATCAACATGTCGGATTCCTGAACGACGGCCTCACACCCGCTGACCCAACCGGACATCTTGCAGTACCCCACGGAGCCGCGGAGGTGGAAGGAGGGATGATGCGGCAAATTACGGCTCATGCGTCAGTACCGCTTCGACAGTTGGACTGATAGCATACAAAGCCGGAGAGTGGCCTCCCTTCCCATTCCTTCCTACACCCTGCTTGCTGAGGATTGCGACCGGTGTGGCTCGGAAGTTAACGCTAAAGGACTGATGGGGAACAGTACGAGAACGACGCCAGAACCCCTGTTTGAATTCACTCGGCGTGAATTACTGAATGCGTAATCATCTATCGCGACGAAATGATGCGTGTAATGCTCCCCCATGGATTTATGCATGAAGCAACGGCTGAACTGAAATCCAAGGGAGCTCCCGCGATCGCCCGAAATACGCGGCTTCCCTGATGGTTTCGAGGTAAAGTCAGCTTACATGGAGGTGCAGATTAAGCGGGTGACTGGCTACGAAAATGCTCCTTCTGTTGCCAATACTATACCCGGTGAATCATGGACAGTGAGGTAGGTGTCACGTGAGTGGATGAAAGTACGGCGAGGCTTTGACGAGATCGTGCCGGAGTTCATCGAAATGGACGAGGCACTGGCTGAAATTGGTTTGTATTTGGGGGTGAGCAATCGGTGTATAGGTAATGACGCATCCTATTCTTCTATAGGATCGAAGGAGTTTCTAGATCGTTCAGTTACAAAGGCTGTACTCCCTACCCTCTCATGAAATGATCGAATAACTGTAGCCGGCTGTATCAAATAACCAAACGTGTTGGCTTTAACTACATCTTACCTATCAAAAACGTATTGGATGTAACTTTGGTAAAATCGACGGTTTTGGTACAGGAAGACGAAGAATTTCATACTACGTTAGCTTACCCCTTCAAAGCTGGAAATGATGGGCGAAAAGCAGAAGCAGATGAGAAACTATGACAACCGGAATGCATTTTGGCTCTCGGCAGTCCCTTCTGCTTCCCTCATGGAGACTGTTCAAGGAAATACCTCAGCAGGAAATCGGTGCAGCGATTGCCCGTCAGGTAGGCATTCTGAAATCAAAAGCCAACAGCATTTCCGGATAAACGTGACATTCAGCGTACTGATCAACGGCACCGCGAGAGTAAACGGTAACGGGAAGCGGATTCACGGATTCATTAAGCCTGGCAATCGGCATGTTAAACGGGGTCTTTAAGGAACGATGAGAACAGCGACGAAAACGGAATCAGGGAGCAGCTTCTTATTATTCGCACATTCACTAGCGACCGTATTAACCGTCGGATTACGATGAAGATGGCAGACATCATTGATTCATCAATAGAGATTGCCGCTCCTCACAGCAATAAAAATGCCTCTAACATACAGCTATATCTGTATTGATGTTTGAGTGGCGTACTAGTTACATGAACGAAGACGCTTGGTCGTAGGGTTGTCGACTTGTGCACTGCCGGAGGATCTGGAACTTATCAACGAGAGGAATGGAAGGAGCGAATTAACTCTCAGGCACTGCGTGAAGCCCGCAGCAGGCAATGCATGACGACTGGGGATTGACGAGACCTTTCCATGAATTGGTAACCATCGATTCTTATGGAACTGCTGGATGAACGGGAAGAAACCAGGACCATCAACGGTAGCCAATGACGGAGACGAGGATATTGCCTGGCTTCTGGAACTTCCGTGTTGGGTGAGAACAGCAAATCCAAACTCAACGAGTACCGTATTACGAATGTTATCGGATGGGAGTAAGGGCTTAAACTGAGAAAGCAACGAAGTCGTGAAGACGGAACCAGTTGTTCAGGTCTCACCCTGGGAAGACTCCTGTCACGCGACTGGAGAGCAGCGGAAGTTCTTAGTGCGGGGTTAATCGAACAAGATCGTTAGTAACTATCGACATCATTACGATCGCTGTTACGCGTTGGGGTAATGGGTTCAGGATGCAGGCTATCTGCTTCTGCTTCCTGGCTTCGGCCAGTGAGATCGGTTTGTAAAAGATAACGCTTGTGAAATGCTGAATTCGGTCCGTCTTCACAGCGCTTCAGAGTCTGCTGTCAGATGATGACGTACTGACAAACATCGGGTTGAGTATTATCTTACTGTTTCCTACATAACATTGCTGATACCGTTTGTAGCTGAATACGATGCAAGGATTATAAAGGGTATCAATGATTGAGTCTGTAAAAGATTAGGATATAAGAAGGAAGCGCATTCTTGTCTAGCTGCGACTAGACATCACGAATGTTTTATGTAGATGAAGCTCATGATATAGATCTGATCAAATATTCGGCTTCTCTCCTGCCTCCAGGGTGCCATTCTGCAATGTAGAAATGACTGATACCGTGCAAATTATCACGAGTACGGTGGAAACGATACTGTTGCTCTGTGACAAAACAGCTCATCAAACCCAATATCATAAATCGGCACCGGGGATTTATTGTTATCGACTCTGTACCTCATTGTTTATGGAGATGATAAATGCACTTCGAGTACAGGAATGGAAGATGGAGCCGCGGTACGGAACAGGAGGCATGGAGAACCAACGACTGTCAGACCACTGGATGAACTCCCTGCTCGGGCTCTCTATCTCACATAATATTCGAATTGAAGAACTGAAAGAACACCATCGCCTGATGATTTGTATCTCTGCGTAATCGGAGACTTTGCCGTACTTGACGCTTCAGGCTTGAACGGACGCCAGCGACGAGGAAGCCTTGAAAGTTCGTCGATGGGTTCGGGAATGCATGAGTTCCCACCTCCGGTTAAGGATGGAAATATCTTATTCACGAATCAGGTAAAGGTTGACTTAAAGCAATAACAGGTGGCCTTTGAAGGAGGAAATGGAAGGCGAAGTATCCGGGTGCGGAATACCGAGGCTCCGTAACAGGGAACTTCTTCCTGCCTGCCAAGGACGGGTAAAGAGTTTGTACGGGCATAAACCGAATCGCAATCACTGAAGCTATAAGCCAACATTGAGTTATTTTCAACACAACACGGTAAACCGAGAATCAACATGATGATAATTCGTCAGTTACATTCATGGCTTGATCGCTACGAAAATGGCCAGCAGGAATCAAGCAGAAGACACTCATAAATTACATGAGCAAATTAAAGGACCATTGATGCCTGATGCTCCTGATTGAAGACATCACAAAGAAATTGCGGACCGCTCAATGCAGAGGAAGCTTCCTTCCTCGGCTTCGATCGTATGATGCCGCGTAGAGGCAATAGCTGAAGCATAACACAAACCATGTCGCTGCCACTCGGAGCAAATCAGGTAAGGAGATTCAAGACTTACGGCTGACGAATACCTGAAATTATCAAGCAGAATCATACCAGCTTATCCACATGCAATGGAACTGGCTGTTGTTACCGGCAACGAGTGGTTTATGCGAATGAAGTGGTCTGATACGTATAGGGTAGATGTACTTTGGCTGTCAAAGCAAAACGGCAAATCGGTACGGCGAAGCATCGCAGAGCGATGCTGCGGAACCGTCTGATTGAAGGAAACATTTGATAAATGGAAGGTCTCGTGGCGGGGATACCATGCGCTCCCTCCGTCCCGACGCTTCATCCGGCACAGTATCAAGGGTCTCTTAGGCACGACGATCGTCTTTCCTTCGAAGCCAGTCACGCCTTTCACGCTCGCAGTTTGTCTGCAAGACTCTGAGAATCACCGATAAGTTTGCCAAACATCTCCGGGCAGATGGACGATGGCATCACATATCGTGATGACAGAGGCATGGAGTGGGACAAAGTGAAATCAAATAATAATGATTTGACTGATGACTGTTCAGCGCATGGAACAACCCTACCCAATGCAATGCTTTTTGATTCCCTTCCCCATATGCCTGAACGACGAGACGGAGTAAATACGGACTACGGCTGACTTGTAAAAACAGACTTACATACGTAAACAACACTTAGATCATTTTAAAGCAACTACTTAGTACTGTTACGGCTACATGTAAACTACTGCATTAGCGTAGACTATTAGAACCTTATCTCCGGGCCCCACGCTTTGTGTCATTAAATTTGTTGCATTCAGCTGGGAAGGAAGCACAACGGCGCAATCGAAGGCTTTGTAGATACGACCTGCATACGTAAGAAGATGATGTCAACGACTATGACTTCTTTCTCTTCACGGATTCCTACAGAGCATGCATCACCCTCTGCCTTCTCGGAGTCTGTTAGGAGCGGAATTAACTATGAAAATGGAGAAGTGGGGGCTATCTATCGGCTTATTAGTATTGAACGCTTCGACGCTGACAGCATCGTTTGGCGATACTATATGCTGCATTACAATAGACTATCGTTGGTATAACGATGCACCATGCATGAACCGAAGGAGGAACCGGCCAGAGGTAAAACGATAAAGGAAATAGAATGCTTTAAAAGTTACAAGATACGCCCTATTTACATGGATTAATCTTAGATGGAAACGTATCACAGAGTGACTTAAAGAGAGACTTCCTATCCATTCCTGTTTTAATAAAATTACGCTTACTATGTTGGAGCGGGCTTGAAAGAGGCGGTACTTCCTGCAGGTAGAAAAACGCATTCCTACGAGCAGATGGTTGGAATGACTACTTCCTTTGTTACAATGTTTTATCTGTTCTTTGGTAAGGGGACTGAAAATGCGATATCGGAAATGTTAAATTACCTGGAGGAAGAACCACTAATTATTCATCAGTAAAAATCAATTCATAACTCCGAAATGTTCCTTAGTGAAAGCATTGACTCATGTTAATCTCAGCAAATCATGATGGTTTTAACAAACACTTCCTTAGCTTCCTTCTGGTAGGCCAAATCGATTAGCTAACATTATTGAAATGAAAGCGTCGTGACCTCATTAGAGGGGTAATTCGAGAAATTCATGGACAGTTCGCACGTGTGTTAAATGACGCATTTGCCAGAATTGTCAGATTTCCACCTTCATTTAATAGAAATTATCGGATTTCAGGCGCAGCGACCCGATGCTATGACGGTTAGATTCTCTATGCCCAGCACGAACATTCATGCTTTATCGGCGGAATGGGTGTGGTAAAACAACAATTTGATCTAGGAATTCACTGTGCAATCAGACCGAGAAAAGCATTTTCCCATACCCCTTCTGCAATCGGTGGAGAATCTACAGTCGCTCACGCTTGTTTCGTTTCGCCGGATTAATGCCTTTATTCTCTCTAAAGAACCTGACCAGCAAAGCTACAATACTTTTATATTGACTCAAGAATGCTGCCAGCAATAGTTTAAAATCACCGAGATCTCTTAGAATGCTTCATTTCAGGAACGCATCGAGCCGGAGATAGAAAGACAACTGATTGAGTAAATAGAACTAAGTAGTGATGAACTTTCAAATAGAACTCCTCTCTCCTTCTAAATATGGAAGAGTAAGACGTAATGAACCAATTCAAGGAACCGATAAATTCACTAAATTGTCATTTTATGACAATACGGAAATATGCGGTTTCGAAGCCAGCTCTGGACATGCAATCGTTTATTTATCACAAGATCGATGTCGTTGGCGAAAATGATGCTTAGTTGGGTCTAACGTCACCGATTACTTGCATGTCAGGCCCCCTTTAAACTTGATTTGACGAGCCATGTAACGCAATGGCTGAATAATCTGCAGAATCGCGATTCCAGAGCACGCAAGGATTCAAATCCTGCATGTGGATTCCTTCCTCCTTCGCCGAAGCAATATTATCGTCCGGATATTGAGACATTCGGTGAGAACTTAGGCTGTTTTAACTCGTGAGGCTTTACTTGAAGTAAATTCTGGATACTGAGAGCTTACGATTCAGCTTCTTATGAAACCATTCTAAAATTAATGGTCAGATAGGATTAGATCAGGAAGCGTTTTAAAAAGCGCTGATGATACGGAAAGGAGATGAAGGTAAAGTACAAGGCAAACTACCCCTTCCACGAGAACTTATCTAGAAGGGGCGCAGACGCTCGGAATGATGCAATAAATGTTAGAAATAAGATTTCGGTGTACTCACTTCCCCACTTTTCCGGAGCTCAATATAGAATATTAAGCTGGACATAGATTACCTACGACAGAGACACCTTGGCTGGTAATCGTTGGTAACTGACGATTAAATTAGAAAAGCTTTATGAAATACATTCTCTAGATAAACAATCTAGAACATATTACGATGACGGTGCTTGTTTCAACAGGCTAAAATGTCATTTTGTGTCATTAAAAGACACGAAAAGGATTACTCCTCCCGTCGCAAGGTGATCCTGAATTTTCTGCTTGATGCCTTAATTTAGTTCCATCGTAGGGAATGCAATATGGGAGAGAAATAAGTTTTCTTCTTCCCTTAGCTCCGGCTCGGGCGTCATCCACTGACATTAACATTTTTCGTGAGGACTTGTTATGCAATTTCGTTTCTAGAACCCCTGCGTGCCGTTATCTTGCGTGACGCCCGGTGAACTGGAGGCAGGACAACACAGAGCTCTTCATCATTTCAAGCTAAATATTGCTAACTATTCGTTTGAGCAGGGAAGCACTTGAGCATGATTACTCAACGGAACTCTTCGTAAAGAGTAGGAACGAGGAAGGTCTCAAAGGGACGTTTCACCGTCAGAATTTATTGAAGCAAATCTGAACTATTATAGATTGAATGACTTCCTAATTATTGGAAAAGGTTCCTTCTCCATTCGGGAAGGCGGTTGAGGGATCTAGAATAGGTGATAAAAGATAGAAATTACGACGATTATCGGAAGGAACGAAGTAGCTTTATAGAGGCTTTTACAAATCCGGTGACTTGCCTAACCAATTCCTAGCAGAGTAGGTACCTTGGGGTGAACAGGCGCACCGGATTTGACGGTTAACGGTAAGCTGAGCTCCACGTCTACGGGGGACAGTGTACAGTCACGAGGAGCGGCTCCGCGGAGGAGACCTCGGCAAATATGAGTAAATCGCTAACGCGTAAAACCCATTCAACGCACTCCCTTCTTCCGCTCAGCCAAGCACGTTCTGCCACCGTCGTGTCTGCGGGGCCCCACTTCCGAGGGACTTAGCAGAGCCCAACCGACTCTAATTTAGCTCACCACATAATGAATGATAATAATAATATTAAACTTCCTCTGTAATTTACACTGGTTGTTATGACCCCATCGGAGACGATGGACCAAAATCTGTATTACATTGACAGTTAAGCAGTACTTTACTCAGCTTTGGGAAGAGGAGCAAAGTT * tp:A:P cm:i:28 s1:i:194 s2:i:0 NM:i:2292 ms:i:328 AS:i:-106 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
42 38 16 utg000001l 1 60 63S12M2I6M4D7M3D1M1I2M1D15M2I22M1I35M5I13M2D1M1D23M2D2M2I2M1I10M1D24M2D2M2I5M1D18M1I3M2I4M2D4M1I29M1I15M1I9M2I23M1I1M1I25M2D48M1D11M3I18M1D8M2I10M2D1M2D2M1D10M2I12M1I10M1D15M3D4M1D51M1I36M1I4M2I2M1I17M1D11M1D6M2I37M1D32M1I8M5D15M2I8M1D9M1I3M4D5M5I24M1I3M1I6M1D36M2I12M4D2M3D9M2D2M1D2M1I12M2I3M1D16M1D3M2I25M5I13M1I5M1I5M1D6M1D3M1I13M1D10M4I15M2D5M1I2M1I7M4I5M2D9M3D11M2I10M1D9M1D1M3I10M1D3M1D8M1I19M2I6M2I2M1D7M1D2M4I14M1I4M1D15M4I9M1D1M1D9M1I4M1D6M2D3M1D26M1I10M2I4M1D17M1I3M1I7M2I13M1I11M1I4M2D6M2I8M2D7M1D15M1I10M1I51M3D6M3D3M1D9M3I2M2D9M5D1M1D3M1D2M2D28M1D10M3D23M2D29M1D10M2I3M1I12M1D6M1D17M4I2M1D5M1D1M2I6M1I2M1D18M5I7M1D17M2D19M2D21M1D13M2I11M1D9M1I5M2I6M3I11M3I9M2I26M2I15M1I11M1D1M1D9M4D12M1I7M1D1M1D7M1D1M2I3M1D2M1D24M1D8M1I8M1I9M2D3M1I3M2I6M1D34M2I10M2D20M3D7M3I1M1D3M2I2M2I20M1I4M1I9M1D29M3I1M2I3M1D3M1D4M3D9M1I10M2I5M1D6M1D16M3I6M2I4M1I7M5I9M5I4M2D12M1I4M1I2M3D2M1D1M1D3M2I6M2I3M1I5M2I11M1D10M1D11M2I8M1I10M4D12M3D3M4D4M1D8M2D4M6I1M2I29M2I16M4I5M1I3M1I1M2D7M3D5M4I2M1I8M3D4M1D3M1I10M2I20M2D2M5D4M1I3M2D26M3D14M5I8M2D4M1I10M1I10M1D6M3I26M1I12M2I4M1I23M1I12M1I11M3I5M1D1M1D1M1D3M1D13M1I2M3I3M1I8M1D9M1D6M1I11M1D11M2I4M2I4M1D6M2I3M1D10M1D9M1I10M2I11M1I5M3D16M4I2M1D17M1I7M4D1M1D9M1D4M4I20M1D5M1D3M1I17M3I7M1I1M1I2M1I13M1I1M1I1M1I5M2I12M2I3M1I13M1D14M2D2M2I6M1D3M1D12M1D13M5I1M1I7M1D6M1D34M1I26M1I1M1I4M2D5M1I10M3D5M1I7M1D4M3D4M4I4M1D11M5D24M1I34M3I8M6I23M5D2M4D6M1I4M1D3M1D2M2D11M1D17M1I31M1I8M2I9M1I3M2D8M1I3M2D9M1I14M2I5M1D8M2I2M1I9M3I4M1I6M1D8M3I3M1D3M1D6M1I7M1I7M1D9M2D4M8I4M1D2M4I1M2I5M2D5M1D2M3I4M1I2M1I11M1D8M1I13M2I24M1I8M1I12M1I22M2D3M2I1M1D4M2D11M3D21M1I22M1D11M1I4M1I3M1I21M2I13M2I19M1I13M1I9M2D7M1D39M2D14M1D5M1I5M3I10M1D2M3D25M1I38M1D47M3I9M1I5M1I4M2I1M1I16M1I5M5I15M1I8M1D1M2I7M1I4M1I4M1I6M1I10M1D7M1I4M2I4M1D10M1I14M1I19M2D6M1I12M6I4M1I3M1D6M1D28M1I22M1D13M1I2M2I14M3D43M1I2M2D11M3I10M1I7M1I8M1D16M1I17M1I3M2D10M2D10M1I4M1I3M1D2M5I1M1D4M2I22M1I3M2D9M2D2M1I3M1D8M1I7M3I39M1D2M4D2M1D6M3D16M1D5M3D16M1I6M1I13M2I7M1I11M1D8M1I4M2I2M1D7M1I35M1D43M1D1M2D7M3D6M5I4M3D24M7D7M4I2M1I15M1D3M2I5M1I26M1I10M3I17M1D5M3D1M1I35M2D8M1D12M1I9M2D5M5I14M2I1M1I18M1I57M4I11M1D7M2I17M1D2M1D5M1I1M1I9M11I1M1I19M2I16M2D10M1I22M5D6M4I1M1I5M1I2M4I5M1D21M1I8M1I29M2D5M1D4M3D14M1I6M1D5M3I7M3I5M3D9M1I12M2I6M1I3M1D9M1D2M1D8M2I6M3I4M3I5M1D2M5I8M3I2M1I7M1I4M1I2M3D8M2I2M9I32M3I5M2D25M2D14M1D8M1I17M3D5M3I4M2I7M1D12M4D19M1I18M2D8M1D2M1D14M1I7M3I25M1D7M2I2M1I1M2I4M1I3M1I12M3I2M1I17M1D4M1D8M3D6M2D8M1D6M1D1M1D9M2I4M1D4M2D4M1D21M1I3M2D18M2D17M1I6M3D4M1I9M3D5M3D4M2D5M1D3M1D18M3D9M1I3M1I14M1D4M3I9M1I14M1I6M1D7M1D16M3I4M1D4M1D5M2I15M2D3M1D26M1D26M1D2M2I4M1I4M2D9M1I4M3I5M1I8M1I16M1I12M3I11M3I1M2D22M1D9M1I8M2I5M2I21M1D11M1D2M3I9M3D5M1I9M2D3M2D1M1I12M4I11M3I2M2I12M3I4M1D12M6I5M1I18M1I2M1I9M3I1M1D1M1D20M2I1M4I3M4I4M2D4M1D2M2D11M2D8M1D11M1I22M4I4M1D55M1I4M1D1M1D1M1D11M3D29M1I1M1I27M1I12M1I8M1D1M1D21M1I17M1I2M3D13M4I5M3D13M1I23M1D1M2D11M1I7M1I17M3D3M1D24M1D7M2I38M1D4M1I35M1I4M1D5M3I6M2I1M1D17M2D8M2D8M1D2M2D2M2I5M2I2M1I4M2D13M1I8M1D1M1D3M1D2M1I2M1I3M3I3M1I3M2I51M2I8M1D5M2D9M1I4M2I27M2I3M3I1M1I6M1D3M1D16M1I23M1I6M1I7M3D3M1D10M2D3M1I1M1I6M1D3M2D2M3D1M2D7M3D3M1D13M2I22M2I2M1D10M2I4M2I12M1D44M3I6M1D1M3D19M2I12M1I14M1I2M2I4M1I10M1D11M3D2M2I11M2I22M1I5M1I17M4D25M1D1M2I7M1D6M1D16M1I2M3D22M1I4M1I18M3I3M1D11M3D18M2I1M2I9M1I5M1I12M1I6M1D6M1I16M2I4M1D15M1I3M1I4M1I1M1I23M1I66M1I17M1D10M1I22M1I11M5I5M1I4M2D3M1I6M2D4M2D8M3I7M1D23M1D4M1I6M3D6M1I5M1I6M8I2M1I2M2D3M4I13M1I9M1I4M2I2M1I2M2D8M1D13M1I4M2I2M1D6M1D4M3I3M4I19M1I5M1I8M2D5M1I15M3D6M2D10M1I3M1I3M7D8M2I10M1D11M2I5M1I14M316S * 0 0 GACCGAACATAACAGAACTTATAGTCCCCGCCCCAATCGTCGAGATCACGGAAAGAGACCCGTAAAGTGATAATGGCCTTATGTCATCTAAGTCACAACGTGCGTGGAGGTGCCATTCAACCACGTCAAATAATTCAATTATGACGCAGGTATCGTATTAATTGATCTGCTGAACATCAACTTAACGTAAAACAACTTCAGACAATACAAATCATAGAGACTGAATACGGGCAACCTCATGTCAACGAAGAACAGTCAGCACGGCAGAACAACAACCCGCAACATCCGCTTCCTAACCAAATGATTGAACAAATTAACATCCCTTGAGCAAAAAGGGTCGGGGAATTCTCGCTGCCTCCGTCATTGAAGCCTGCGTCGGAGACTAACGTCAGAAAAGTACGCATACATCAATTAAAATGATGAAGAATGAACATCCCGCGTTCTTCCCTCCGAACAGGACGATATTATGTAAATTCACTTAATTACGAGGGATTGCTGCAGTAATTGGGTTGCAGTTTTACCACTTTCCGTGACAGTGACAGACTGCGTGTTGGCTGTCCGGACTAAATAGTTTGAATGATTAGCAGTTATGGTGATCAGTCAACCACCAGGGAATAATCCTTCATATTATTATCGCTTTTCATAAATCCCTGCTCTCAATTGCTCGAATGCTTCCAGAGACATTATGTTCTATACATGCAATTACAACATCAGGGTAACTCATAGAAATGGTGCTATTAAGCATATTTACACGCACGAGATCCACGGAGGATCAGCAGATTATTCGTTTTATTCATTTGTCGCTCCATGCTTGTCAGTCTCTTCATCTAGCGGTTAAAATATGTACTTTCAAAATCTTTCTGTATGAAGATTTGAGCACGTTGGCCTTACCATACATCTGTCGAGTCTGTTTCCCCGACATCCCAGCATAAACCGCACTTTGTTTGGCAAGCATACCCTATTAAGTGAAAACATTCCTAATATGGTCTTGACATAAATAAGCCAACAAAACAAGGAGTAGACCAGATTGAACGATAAAACGATAAAGCTTGCAAACTACGCGCCCCGTATCACATGGAAGGTTTTACCAATGGAGCCGTATGCCATTTACGACGAAATATTCAAGTACGTCTTAGAAAGATTTAACTTGAATTGTGTTTCATCGTGAACTAAACGGTTCACAACTCGTCTCATTTAGTCCTTTACTATCTAGCCACAGATAATATTCACATCGTGTTAGAAACGATAACCGCGTGTTAATAAAAGCGACTTAAAAGGTTGTAAATGTTAAATCTCAAGGAAACACGCATCTTATAGAAACGTCCTATGATAGGATGTGAAATCTGCAGAGAAATCACACCTTCAGCAATACAGGGAAATCTGCCAAAGCAGGTTTTCCATCGGTTACAAATATCCCATGAACATAAAAGATATTACTATACCTTTGATAATTCATTACTATTTACTGAGAGCATTCATACTAAGACTTTCCACGCGCAATCATAACGTCCATTTGCGCGTGTCAGCACCGGGGCGTTGGCATAGTGCAATACGTACGCGCTAAACCCTGTCCGGGTTGGCCCTTAATTGTTATCCCGGGACACTCCCGCAGAGAATATTCCCCGTCAGGGCTAGGGCACGTTAATCCGGGAATACAAGTGACGATTCATCGCACCTGACATACATTAATAAATATTACTACAAATATGAATTTCAACTCATTGTTTAGGTTTTGTTCACTTTCTACATACCATTCTGCGAACTTCAAAAGCATCGGGAAGATAACACCATGAAAATGCCTACTCGCTACTGCGCTGGCCCTGCTTATTACAGGATGTGCTGCCAACAGACGTTTACTGTTCAAACAAACCGGCAGCAGTAGCACCAAAGGAAACCATACATCATTTCTTCGTTTCTGGAGAACCCGCGATAAATCGCAACGGAGCAGCCAAATTTGTGGCGGCGCAGAAATGTTGTTCAAACAGCAACCCCAGCACAGCTCGTAAATGGATTGCTCGGTTTTATTACTTTAGCATTTATACTCCGCTGGAAGCGCGTGTATTGCTCAATAATTGCCATGAATCGCTCAGCTTCATCGATATGGGCAACTCTATCTGGCACTTGCTCATTAATACTTCTGGGTTCCTTCCAGTTGTTTTGTGCCATAGTACGTCAGCTCTCTGAGCGGTGAAATAATGTACCGTCCAGCGGGTCTGCCAGTCGGGAATAGATGCGTTGCATTTATTCACGCGCCGGAGGCGGCCGCATGGTCTCCATTCACGCTAGTATCGCCTGAGTCTAGCAACGGTGAAGAACCAGACCAGCGGCGTCAACATCATACGCAGAGCATCACCTTCAGCTTTAGCATCAGCTAACTCCTTCGCTTATTTTGGCTTCCCGATCCAGGCAGCAGACATCACGCTGACGCATCTGCAATGTCATAGTAATTGCCGCGTTCGCCGCCAGCATTCAGTTCTATGGCATTTGTCTTCGTCGCGTTTTGTGACTATGGCGTTATCACACGGTAATGATTAACAGCCTGGCAGCTCGGATGATGCAGATAACCAGAGCGGAGATAATCGCGGTGACTCTGCCGCTCATACAATCGCCTGACCGTTCCGCCCGCTTCCGAATTTGCTGCAATCAGGCTGTCAGCCTTATGCTCGAACTGACCATAACCAGGCGCCCGGCAGTGAAGCCCCAGATATTGCTGCAACCGTAAGTCTGCCTAAAAGCGGGTTACACGATCAATCATAGGCTACGCAAGAAGCCACGCTCCTTAATCTGCTGCAATGCCACAGCGCTGACTTTCGGTTCGCGTTGAGTATTTCAGGGCCTCCTGCATGCGGTAGGCATCCCCACCAACGGAGAAATAACCCGTGATGAGGCGCCTGTTGATTTGTTTCAGTTTGGGTTTAGCGTGACAAGTTTGCGAGGTGATCTGGAGTAATCAGTAAATAGCTCTCCCCAGCATGACGTGCCATAACCATGATTTCTCTCATTTTCTGACGTCCGTTATCAGTTCCTCATGCCGACTACACGCCAGCATATCTCGCCGGAACGGTTACGTGATTATTGATTGCCCGGCTCTTCGCTCGGCTTTGTGACCCAGCGAAGCGTTGTCCGTCGATAAGCAACCAATCGAGTCAGTACCGATGTAGCCGATAAACACGCTGGGTTATACACCGAGATTGCTACTTAGTACGGCCGAAGTCCGAGAAGTACCGAATAGAACTAGGGAGATGGCCTCCGCGGCACATCGTTGCGTCGATTACTGTTTTGTAAACCCGACCGCCATTATATCTGCCGCGAAGGTACGCCATTGCCGCAAACGCAACCGGATTGCCCCGATGCCTTGTTCCTGTTCGAGAATGCGGTAAAGCCTGTTTTTCTGGCATCTTCATGTCTTACCCCCAATAAGGGGATTTGCTCTATTTAATTAGGGAATAAGTATGATTACTGAACGAAACAAATGCTACTGTGTTTAGTAATCAGATTTGTTTCCGTGACGATATGCCAACGGGGCAAAACGCTGGCGCAGGAGTGAGGGGCTAGACCTCCTGCCAGCTTTCACGACAGAGAATCCGATCAAAAGCCTATCGCAGCGTAACTGTTGTTTACTAATGAACCATTCAGAGGACAGACAGTGGCTCAGCTGAGAGCTGGTTGGTGCTGAGTTGCTGGGCGGCGATGACGCCTGTACGCATTTGGTGATCCGGTTCGTGCTTCTAGATGCGTTCACGATTTCCTAACAACGGAAAGAGCACTGGCTAACCAGGCTCGACTCTTTCACGATTATCGACTCAATGCTCTTACCTGTTGTGCAGTCAGATATAGAATCCCCGAAATGCAGGTTCATGCAGGCTCTAACCATTACCTGCGAACTGTGTTTCGGGATTGCATTTTGCAGACCTCTGCCTGCGATGGTTGGAGTTCCAGACGATACGTCGAAGTGACCCTAGCCAGAATCGGAGTAATGTCCCGCTCCGCCCTTCACTTCACAACGAGCGAATTAACCCATCGTTTGAGTCAAATTTACCCAATTTATTCAATAAGTCACTACTTGCCGTTAATATGTTGCCATCCGTGGCAATCATGCTGCTAACGTGCTAACCGCACTCAAAATGTTGTCTTGCGATTGACTCTTCCTTGTGGCGGCGCACCCTCGCCAGAGCGTCGATACAGCGGCTTAACAGGTGCGTGACCAGGGTGGGTTTGGGTAAGGTTTGGGATTAGCATCGTCGATCCACCGCAGACCTGATGCTGCGCTTGCTGGCATCCTTGAATAGCCGACTGCCTTTGCATCTTGGCTCTCCGCACTCTTTCTCGACAACTCTCCCCCACAGCTCTGTTTGTGCAATATCAACCGCACGGCCTGACCATGGCAATCTCTGCACATCTTGCCCCCGGCGTCGCGGCACTACGGCAATAATCCGCATAAGCGAATGTTGCGAGCACTTGCAGTACTATTTTGCCTGCGCTCTTCCTGTCAAGCGGTGCCACCACGGTATTTCCCCGTACCTTGTGCAAATTGCCAGATAGTTGATAGCCTTTGTTTGTCCGTTCTGGGGCTGAGATTTCGTGCTTACCGCAGAATGCAGGCCACCGAATCCGCGTTGTGATTGCGCCATCCCCCAGATAGCAGCCATCACATCAGTACCGGAAAGAGTCAGAATCCGACTAGTGAGTCGCTCATCATCGCGGCTTTAGAATGAAATTTATAAGCCACGCTTTTCGAGTCTCATGCGCCTTCTCCCCTGTACCTGAATCAATGTTGCCGGTTTCCGCAGAAACACTGCGCCCGGGCCGCGTTACATTTGGTTGGCAACTTGAGTGGTTTCACTGCTGGCGAGCGACCAAAGATGAACGGCCTTGATATTCTTCCGGATCACCCCGTTTTGTGAGTTGCTGATTCGGTTCGCGGTTCCAGATCTACCTGCTGATGATGTAATAACTGGCTTTCCAAACTCGTATTCGTCAAAGGGATAATCGGCGTGGCAGATAACATATTTACTTTGAGCCAGTTCGATGATTAACGGAAGTTCATCTGCTTTAGGCAAGAGTTTAGCCAGAATCTTCTTTGTCAATCCGGCCAGATTAAAGAACCAGGCCACCGCCATTAAGCAGCCAGTTGATTAACGTTTCCACGCTCTGATAAGCCGGTAATCATCATTTGCTCATGGGTTTCCACGTACGTACAGCTCGAACCAGGCGGAATGTGATTAATTCCGGATTCATAGGGTTCCGCATTCCAACGATCCTCACGATCAACCAAATCGCCAGACGAGATAAGCAGGTCTTTGTTGTCGAAATCCAATCGTATCCAGTTTTGTTCATCAGCTCTATTCGTGTAGCATCGTGCAGATCGCCAACTACCAAATATTTTCGGTATTTTGCTGCCATCAATTTTCGTAATAGCGCATCTCTTCACTCCATCCGCGATGAACCATGGAAACGGTGTCGTTGTGAACGATGTGCATTTTCCCCGTCTTTATCATATCAACGGTATTTTCTGACGTACCGCGACTAAGATGTCGCCAGTCTGCGTGCTACTTTCTGTCTGTAGCTCGATTTCCGTATGTTCGACAACGAGCATGTCTGGAATGGTTTTACTGAGAACGTCATGCGGCCTCACTTCTTGCTATTTTCGCAGCTTTGAGTTTCTGTTGGTACTGCCTTGATCGCCTTGCATTCGATAGTTGTAGATATGGCTATCGCCATTGTCCAATTCGATTTCGTCTACTGCTTCCTGCCCGATGCGGCTAAATCAGTTCGACGCGATACGGAACGAGATTCCGCTTTGTGCTCGGTTGCACACCACGCATTGCTTGTGAATATTGCGTTCATTAAATTCAGTCGAGTCTGAGGCCGCAGCAGTTGTCATCACCGGTAATGTCGGCATCCACGAGCAGACGTGAGCCGTGGGACCCATACTCTAAGTCGCCATTCTTTCTCTGATGAAGGCGTTTACGGCTTGTTGGGCTGTTTAATCCAGTAACTGCGGGGCTTTAAGGCGAGTTTTTCGAATCTTTAAGTTTATCTGTTTCTGCTCCTCTCGTCGTCGTTTCTTCTTGCTGCTTTTCTCGCTTTTCGCGTTCTTTACTTCGTTGTGGTTCGAGTGCTATCTTGGTTCTAACTCTCAGAGCACAGGTTCGATTAGCGACCGATGCGAGGGCAACCACATTCCCGGCATTCATCGTTTACATCGTCTTCGCGCTGGTTTAGCCATCATCTTCTTCCTCGTGCATCGAGCTATTTCTAATCGCTCATCAGTTTCTTGGGCGCATGCAGTGCTACACACGTGAACTTCCAGCACATGCAGCTTCGCTCCACCGCAGTTTAGCACGTTAAAGCTCGCTCGACGCTTCTTGTTCGGTAACTTCATGATTTTGTGGTCAATCACCTTGTTTTCCCGCACGACGGTGCTCACCGGATATCCAGCTCGTGCTGGGTTTGGCATTTTACGTCAGATGCATTCTTTTGGGATTGGCTTGGGTTTATTTCTGGTGCGTTCGTTGGAAGGGCTCATTTTGCAGTTTTCGCAGATTATGTCGGTGATACTTCGTCGCTGTCTCACACGTCCTCCTTTCCCTTGCGGTAGTGGTAACACTGTCAGTTGGTTCTTTCACGGAGACCATCGATTCCAGTAAGGTCCGATTTGGATGTAAATGGAGGCGTCCTGGTCCTTGCATTAACGCACCGATAACATCGCATCATGCAGCTTTCCTCCCGAAGTCGAATCAAGCTGCCCTCCAAATATTTCGCATGACTGAGAACACAGGAGCCGGTATCGAATCTTTTAGCTCGTGACCATGTCCTGATACAGGGCTTGATAATGCCCTTCTGAATACATTTTCGCGATACCGTCCATGCGACATTCTTCCTCGCTGGTACATAATCTCCTTTGGCCGTTTCCCGATGTCCGTCACGCAAGCATCCCGTGATGACCTCACTTTAAAACACGCTGCAAATCCCTCCACTTTGCAGGCAAGTCGCATTTTCCGATTTGATTTTTAATGCAGAATATGCAGTTACCGAGATGTTCGGTATTTGCAAATCCGAATGGTTGTTGCTTCCACCATGCGAGGATATGTTGCTCCTTCGGTAAAGTCTGACAGTTCAGCAAGGATATGATTCCAGCAGTCTTGGCGTTTAGCCGGTTTCGGTTCATCAGCTCTGATGCCAATGTACGTGGTAATTCCCTGCCCGAAATGGTCATCACAGTATTTGGTGAAGGGAACGAGTTTTAATCTGTCACCTTGCAGAACGCGCTCGACGTATGGAGTGCCATATTTCTGTCACCATATCGATAAATGGCGTTGCCGAGAACAGGCATTCGCGTCTGAATATCCCTTTGGTTCCCATACCGTATAACCCATTTGGGATGTCCAAGCTCCGGGTTGATGACCTGCAATACGTCAGTGGTATCTCAGAACTTCACAACTCTTCCCTGACAAACCGATATGTCCCATTTGGATGTTCCCACATGGCTGTATCCATGAAACGTAATGCACGTCTTTACCTGCCCGTCGCCCTTTGCTCCATCCATACCCAAATATGCTGACGTCCTGCCACCGGAGAAACTAACGACATTTACCATGCATGCAGCCTGTTCTCCCCATCCGCTTTCCACTCCAGAGCCAGTCTCGCTTCGTCCGACCACTTAACGCCACGTAGCTGTACCGAATGCCTGTATAAGCTCTAATAGCTCCGCAAATTCGCCTACACGGCATCCTGCTGGTTGACTCGAGGTACCTACAAAGCCATTCCCGGCAAGGTATAGGAAACAACATCTTGCTGGGTGGCTGAGACCCGCGGTAACATTTCCAGCTTTCTGCCAAGCTCCAGCTAGAAGACCATGCCATTCAACCTTGACGCCAGACGATCACCTAAGCAGGCCCATAGCTTCCTGTTTTGGTCTACAGCTTGCGTGTTTGCGTTCCTGAATGGTTACTACGAGTACTGGTTTGGTTGGGTCTGGAAGGATTTAGTGTACTGCGTGAATAGCGTTTTGCTGATGTGCTGGAGATCGAATTTCAAAGGTTAGTTTTTCCATGACTTCCCTCTCCCCAAATCAAAGGCCTGCGGCGATTACCAGGCAGGCTGTTATTAGGCTGTAATGTATAGATGGTCACTTTTAACTCCATAAGCCCCCAACCCGTTTCATCGTACTCGAGGAGAACATTCTATGGGAACAGCTATGGGGTTCGTGCTCATCTTCGCTTTCCCGTTCTTCCCTCAGCAAACCGGTAATACACCGTTCACGAACTTACCTTCGTCAGATAACCAGAAGACCTGCCCGTGCCATTTTAGCCGCGGCCCTGATTTATGCCCTGGTTACTGTTTGCCTGTTAGCGGCAACGTTCGTAGGGGCACAGAAGCTATTATGCGTCCCCAGGTAAGCGGCATCAATTGCCTCTTTGCACGCCCGTCATCATGCTCCTTCAGTCCGAACGGCTTTGATTTCTGCTGCGATCTTCGCCAGAGCCCTGTGCACGATTTAGATACCGCCCATGACAGGAAGTTGTTTGATAACTGGTTCAGGGCAATTCGCCGAGACACGGCCGATCCCATTAGAGTCATGGACAAGCTCTCATCATCATCTTCGCGGCGCCTATTACGGCCTAATTCTTGATCAGTAAGCTCCAATCAGCCCGCATGTTCTGATACGGTTGGTAACCAGCCAGTTAGTGAGGTTAACACCCAAGCAGACGCCGCAATATCATGAGCACCCAACACC * tp:A:P cm:i:169 s1:i:1550 s2:i:0 NM:i:2053 ms:i:5250 AS:i:5250 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
43 39 4 * 0 0 * * 0 0 ATTAATTTAATTCTCAACCTTAATATTGTAACATTGCTGCAGGCTGTATCCATATCCTGCAGGCGACGGTTGCGTCCGAGCATTGCGGCTGTTGTGCTTCGTCGACTCGAATGCGACGCTGATTGATAATCTGTAGCCCAGAAAGGATCATGTAAGAGATCGCAGACGGGCTCGAACTGTCACAGGTCGCCCACTCCGGCCGACATTGGGTGAAGCTATGACTTAATGTTGTGTTTTACGATGACTTAATTGTTGCCTAATCTAGGTCAATATGCTGTCTATGCTTTTACGTTATCTCGTTTAAGTTAACACAATTGAAATGACGCCCATGCATCCGTCAGAATTTGTTGAGCTCCATACGTACTATCAATTCATATACCTATCATATTATTCTTCGTTGTCCCGACTCCTATTACTGGTCCTCAGCTGTGTATTACCACTGTAGTTTAAAATACTGCCGAAAGTGTTGGACCGACTGACCCTTATGCTTCTACGGAGTTATGTCCAGACAGGCCGTCCTCGATAGGATTGCATAATCCAGCAAATGCGTCGTGGAGGAAGATAGTGGATCGCATTTTCTGCCCGCGCCTCTCGGACGGTACTGTGCGCTCTCGCAGGCCGTCCAAAGGGTAATGAATTAACTGTTTACCTAAAGCCGATCTATGTTGGCGTAAATTATCGCTATCGTTGACGAATCCTTAATGATTTAAGAGCGGCCTCCGTGAAGATTAATGTTGCAATGAGATTCATGGAAATGTTTGCTTCAACAGACATAAGATAAATCATACCAACTCAACGGTGAAGTTCGCAGCGTAGCATTAATTCTAATAACATAGAATGTTTAAGAATTAAATTAAGCTATCCTAACATATCTGATTTACTGCTTACTTACCTATTTCCACGACTTGGTGTCAGCCTTAAATTATTAATGTAGCTCGTGTTATTAGTGGCCGCTCCGGCGCTAAGGTATTCATTGCCTGTTGTCTCTGGAATCCACCACTTGCCCTTAACAGGATGCATCTAACCAACTGTTGATCTGACTAACGCGAGCGCGAAGAGAAATGAGGAGTGGCTAAGCTGAGTCATAAGTTGAAAGTTTATTTCTTGGTGTCCTTCAGATGGTAGGCTGAGGCAAACTATAAGTGTAAGTTAATTTATAGTGTAATTATGGAGTGTCTTTAGTACTATTTAATACTTAGTAAGAGTTTACAAACCATCCAACAGGGAGTAAATCAACGGAGTATATCGGAAGTCTATCACTCTTTCGTCCTTCGCTGTCAGTAAGTGTTTGTTAGCGACGGCCTATGTTGGTCGCTGTACACGTTGTCAAACCTTGCGTACCTGTCTCTGCCGCGTGAGATAGTTGGCCGTTTAAATCCTTGTAATGGCTGTAAATATCTACAATGTGTTTTACTGTAACATTAGAGAGCTGTGGCGGCTGGGTAAAGTCGTCCGCTTTTACTTACGTTATTCAAGGCCTATTTTGGACTTGCTTTAGGTCAGGTCGCGCTGGTTGGTCCAATAATATGACTGTCCATCCGTAAGCCAAAGTAGGAAGCTGTGAGTGGCATGTCCACAGATACAACCATAAGTGTTTCAAGCAGTCTTACTGGTTACCTGGCGTGCGTTCGACATACAAGCAATGTCGACCCCCGTTCGCAGATGTAGAAAGTGCCCGCAAAGAAAGCCCAAGCGAGCTTAGTGTTGGTCAAAGTCGTCGTAGTTGAGTATTGATCCTTTGTACATGTGCTATGGGCGCTACTATACTGAGTGGTTATGAGTCGGTCATGTTCTCCGTGGCACTCTACTGTTGAGTATTCCATACCGGTTCGCTTTGCTGTGTATAGAGATCCATTGCTGACTCCCTAGCCAGCTGACAGAGATACGAGTTCGGACCTAATAGTGGCCCGCCGAGTACAAGGAGTGTGTTAATACTATTAATTAAATGAATGACTATAATGTTGTACCGGAGGTAGTATGGGCTTTCTTAAACAATCCCACTATTAGCTATGATATTTGCTAATGGATCCTTTCCGCGCACTTGCAGCAACTGGAAGTCGTCTTGCTATCAAAACGTCATGGAGGGCTCTGTTGACCCTATATGGACGGTGTCATACCACGGCCGTGATGCTTGCGGGCAGCGCTCAAATGAGTTGGTAAGGCCTTAACACCAATATTGTTAACGGGTAAAACAAGTCATGGCCTCTACATTTATCTAACACTTGCCAATATTCGTTTTCCTCGACTCGGTGGCATCGTCTCTCTCGGCATGGCGTGCCAGCTCTAGCAACGATGTTGCACTGCTAGTCGTCTATCTGAGCCAAGCTCTGGCGACCCTGTGCAGCGCTAGCAGCGATTTGAGCGGTTTCGCCAGACAATTTATGTGTTTACCAAAACCACAATCGTCCTATATGAGGTGTTATCCTGCCATGCCGACCAGGGTTGTCGATAGGTAGATGCGAGACTGGTAAGTAAGTGGGAAGCGTATGAGCATTGTAACTAGAGCCGATGACAGGGTGAGTGATGATGTCAGCCTGGATCTAACATATTGTCAGGTCTACTGCCACAAGAGACTTAATTTAAATCACAATTAGGATGTAATCATAGCTAGAGAATCTTTGGCAGAGTATGAGGCTATAGAAGAGATATATGTTAGTTAACAAAATTGAGTTGTAATGTTCACAGGTTGAATGACAAGTCACATCGAGACTACGTCTATGACACCACGTGCTCATTTCAATGTTATTTTGCTGTGTCCCTAACAACGCAGTTCCACTGTTAGCGACTGTACTGAGGTGACATTGCTCAACAGTTGATGATGTGAATAGTTCATTTCTTGGCCGTTCCTTAAGAGCGTCAGCGATAGTGAGTAGTACCGAGTGGCAAGGGAAAGCTCGAGTTGAGGCCGAGATCTGGTTGCTGCGACTTGCCACTGTGTAATCATTCACCAGTGCTAACAGAGTTAATGTTGCTCGTCAGATGAATATGTTGGATAATAAGGTCCGAGTTAACTATCGAGTGCACAAGTCAGGACAGGCTCCCAGCATTCTTCGTTCGCTCTGCGCTTACCTAGGCTATAGACCAGTACGAGCCTGATGGTTCGGGAGCGCATTTTATTAATGTTACATGTAGATTTATTTAGTTTTATTACTGCTGGATCGGACTATGTTCTGCCAACTTTCAGTTGATCGGACTTTCTTGCTCCCTTGCTAGCTGGATTAAGCTCGAGCTATCATCAATGATTTGTAGTTTGGACTGTCCGTCATCGTTGATACAAGCGTTTAACGGTGGCGTGGCACGTAATGCAGTCATTGAATCCCACATCAGCGTTGGCTGTTTGTCGTAACAGCAATTAGTCGTCAATACACATATAGGCGAGGCCAGTGTCATCTAGGTTTAGTGGGGATATGCTGTCTCGTTGTACTCTTTCCGATGCTGGCCCATCCGTGGAAGATCAGTGCAAGAGTTTAGTGGCCAAGCGGACTTGCTTACATACATTGGCGACCCAGCGACAACAAGATATGAGGCCCGGGCCGAGTGCAGTGCTTCTGGTTGTCACACCTGATTTTCGCCTTATGAATTGCTTTTACGACAGGTTAGTTCGGTGTTTCTTAAGAGATACGACAACGTATGAAGTGTTATTGAATTTATGTTTTATAGTGGAATGCATAAACTCTACTTCCATTTACGACAGCGACAGGTCTTCATGGGGCCGTAGGTTAATAGCTGGACGCAAGTGCTTTGTGCATACGACACATAATTCTTATTTATGACATCAGCCAGCCAAACTTGCTTTCAGTACTAGTGCCACCCAGCGGAGATGGCGCTCGCTTGTATACAAGAGAGCTCATAGGCGCAAACCTTGCACCGAGAAGTATGAATGCATCCGTGCGTTCGGCCCCTGTGTGCGCCAGATGGCGCTCCCGCTTTCGGGGTCCTCGTCCCTTCCAACCGTAACAGCGCCATCCTGTCAGGCTATAGGGGCTATCTTATGTCTGATAGTACCGGATACACATAAAATATCCAACGGTTGAATGTCAGACAGAATTAAATTGGCGATAGTGGGAGGAGTCGTTGTTACGGATGTTAGCCAGAACAACTTATTCAGGCTGTAAGCTGACGTGTTATATTAGACGAAGCGGATGACTAGCCGTAAAGCGAGCCAGAGTGTCAGGCGATCTAGGAGATAAACATTGGATAGGAGTCTTCAGTGTTTAGGCGTTGTTAAAGGTCTAAGTCGGAGCCATAAGCATACGGGAGAGCAGCAGTCACAGAGCTGTTAGTCGCAGGTAATACGTAGGCGATTTAAACATAGTCGACAGGAGTGAATTCAGCGGCGACTGTCATCAGGTCGTCCGTTCGTCGTCAATTGATAAATGTTTGTTAAGATAGATTAAGTTAGCGTTGGGTCAGAGAGCCACCGGTTACAAACTGAGGACCAGAAGCAGAAGTATTAGGAGTCGAGAGGGCTTTCGCTTTATAGGTCAAGTCTTCCCATAGATGTTGTAAAGCCCTGATTGTACATATTGGGAGACGAACAAGTGATAGAGACGGTATTTGTCGGCCCATTAGTCATCCTAAGTGTTCATAAACTGGATGAATTAGAGTCACTTGAGAGCTATGTTAAGTGTCAATGATCACGGTCTATATCAACATGTTTATGTTTCAGGAATCCATTTGATGCTTATGAGTATGTCGGTTTCGTAGGGTGCGCATCCTTCGCGGCGCGAACCAATGTAGTAGGAGGGAGGGGGAGCGAGTGATGATCAACGCGATGTTGCGTACGCGAGGAAACAAGATGTTAATACATGCTATGGTTCGTAGTTATGAGAGTGATATTGCGAGTTTAAGCTATCGTTCTGCAGTCTTATGCAAACTGGTTTTCAGGGTGCACGGCCTTTGATCATGTTAACAACTAGGCTCTTAGAGCCAGACATGAAAGGCGTAAATGGCATTGACTATGGAGCTACGTAAAATTTTAGGATGCGCACTGCACAACGTGATTTCTCTGCAGCTGTCACGATTTAGCATCGTCGCGGGGCATTGCTCCCATCCGGTCAAACGCAGATCCAACCTTAATGTCCTTGCGTAATTAAGTAAGTACCGCGGTCATGTCCTTAACAAAGTCAGTGCCATCAACTGCTGGTTTCATTACTCCTGCCTAGCTGAGACCTAACGCCACCAGAGCATGCCATTTATTAGTATCAGGAAAGGCGTAGATGTCTTTCGTTAGAACGTAGGCTGATCCTGGTTAATGAGGCATGATCAGGCCTTACGAGATGAGATGGCTAACCTGGGAGCGATAGCTTTAAGTATTGAATTCTGGCGGTGATATTACAATTCCGTATGCTGTAGGCGTTAAAATCAAAGAGTGGGCTAAAGTTTCAGCCAGAGCTTCCCATAGAGCGTTGCGGGTCGAGTAGCCACTTCGTCGTTTATATGGCTACCAATGCTGGTATAATATCTTAGGGGTGCTGGTTTTAACCATTAGCGTATGTTCTGTGCCGGGCATCTAGCAACATCTGGGGTCATGGAGACCGAAGCTAAGCTGGCATTTTAGGCCCGTGGCGTCGTCGAAGACCATCCATCCGAGGCGATTTAAAACAGGTGGGGGCCTTTTTGCCATGTCGTCTGTGAGTTCATGTGCTCTTTCCTTCGCGCTGGCGACCGTAGTAGTGGCTAAGGGAGGAGCTGGATAACAAGCCAATTAGGCATCAACAGCTAC *
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
44 40 16 utg000001l 20436 60 9485S14M1I14M2I7M2I10M3I1M1I11M1D2M1D7M1D19M3D8M1D1M2I5M3I3M1D7M5I5M3D7M2D26M6I9M2D15M8D1M3D7M1D6M2I13M3D6M1D8M1I11M1I6M2I5M1I44M3I1M1I10M2D4M2D3M2D10M1D10M1I1M4D10M1I8M1I5M1I12M1I15M3I3M1I2M1D2M1D27M1D20M2D11M2I2M1D2M2D7M1D4M1D1M2D6M1D20M1D23M1D4M2D22M2I22M2I23M2D15M1D40M4I7M2D2M2I3M2D14M2D6M1D12M5D6M4D14M1D6M2D6M2I59M3D16M2I9M1D25M1I4M2D32M2D13M6D7M3D19M2D10M4D4M2I33M1D26M2D21M1D5M1I21M2I35M2I20M2D5M3D28M1I3M2I3M1D4M1D2M2D8M2D3M2D3M1D19M1D18M2D6M5D9M8D1M1D6M2D11M3D4M4D3M2D6M1D7M5D1M7D8M3D9M4D18M1D20M1D6M2D9M2D3M2D4M2D7M1I2M2I26M4D4M3D21M2D5M6D6M1D1M1D1M1D3M1D1M1D5M1D6M3D6M2D1M2D6M1I4M1D5M4D4M1D1M2I12M2D33M2I3M1D11M2D8M1D1M1D13M1I8M1I11M2I7M2D8M2D2M3D21M1I2M1I20M1D18M1D12M1I5M1D6M1I14M1D23M1D2M2I2M1I2M1D11M2D3M1D8M1D5M3D1M1D33M1D5M2D6M3I13M1D1M28D14M2D6M1I17M1D15M85S * 0 0 ACATCTCAACGCATCAGCTCAACGGTATTGACTTTGACCTTCCAAAACCGGCCTCAAATGCAGCAGCATCGAATCCCCGCCAGGATGGTTGAATCTACCCCTCATTAGTACGCGTGAAACTGGCGGGTCCAGACTGTCCACGCTGACGTTAATGCCAGTAAGTCCCGCATCGCGCCAGCTCGCTACATCGCGTTCCAGACGGTAACCATTGGTTGTGACGCAATCTGGCTTATACGTCGTTTTCCCGCACAGCGGCGATGATATCGGGCAAAGTCGCGCGATAAAGACGGCTCCCTCTCATCTGTACCGCCTCATATTCGGCGAAGGCGCGGATTCAACTGCCCGTGACCCCAAGAAGCCGGTCTCCGGCATTTCTCCTCCTAGCCTGCCCCCTACTTTATTGACTTTAACGAAATACACATCGGTAATCGCAGGCAAGTAAACTACGCGGCAAATGCATCAGTCATAGTTGTGAAGCCAGCATCATCTCCATACGGAGGCGAAGTCATTTCTTCCGCCCTGGCGCAATCTTACGAGCATTGTCCACGGACGATCGTATCACGTATGCAGAGGAGGATGTTTAGCGTCTCATTAGTAAATGGTACTACCATTTGATCCACACCTTCGCTCTGTAATCATGTATAGCTACGTACGGCGGTCGTAAGACTAGAAATGGCGTTTTACTTTGATACATCATCAGGGAGGCAGAGCGTGCATCGTCCTTTAGATAGAAGAAATAGTTTGTATCCTCAATATTGGCAGGTAATTGCTTCCCCGCAATTTGGGCGATGTAGGCGGATAATTACTCCAGGAATCTATATTTAAATCGTACGCTGGCTGATCTTGATCGTCGTCCGGCGGAGGCAGGGAAGGGAATCCCTTCCCTTCTCGCGAGGCTCTGCGGGTCGAATTCGAGGAGCGCCACCGATAATGCGAGCGCACGGGGCGTATTCGCCGTTCAGAAGGCGCATTGCCTGGGAGCTCTTAACTGCCTCAAACCAAGCTGATAACGCAACGAGCGTCGCCTCCGCGATGTTTGAAGCCCGTTTTTGGTGGCAATGGCGAAGCTTCCCGGTCATAATCTCGGAAACTTGATGTTAAAGCGCTGGGGATCACCTTAGCGTGCTGTAGCCTCTGGAAGCCATCAATTTAATTCGTAATCTGTAGCTGAAAGTGGATACGCATTTGATTCCAATGTTAAGAGCATCCTGTTGATCTGATGGCGATTGACGTACTAGCAGTGAAGTTTACGGGGAGATAGCAGTTAACTACGCCGATTCAAGAGTTATTGTTAACGCCCTAGTGTATACCCGCAACGCGTATCGAGATTTCACGCTATCAATGAAGCATCTCATCATCTGTTCTGAGCAGTTTTTATACAGCCTGATGCCAATCTGCTGCTGAATTACGAACCGCCCATGGATCGATCGGGACGCACTTGGATGGTTGAGTCTCCATGCGCGTGCCTTCGGCTAATTGAAGCTGGAAAGCAAGCTGGCAATTATGGAGCAGTATGTTGGTAAAAGGTTTGATGCGAGTCGTCGGCCAAAAGTGGATGTCTGGGTGAAAGAGCATTGTGATCCAGTGTACCGCCACTATATCGGAGCGATGACGGTTGTTACATACGCGCTGGAAAAGGCGTTACAGGCTTTAGGTTACGGAAATCCGAAGGAAATTCCGTTTCCGAAGACAAAGGCGGAGGCTTATGCCGGATGCGCGAACTGCAGTGGAGCGCTACAACGCGCAAACCTCAGAGTGATATGCGGAGAAATGTAGGCTGGACCGTAGCAGAGCGTCGAGTTTTCCGTTTGTCATCAGTCTTCTTTCGCTCCGCTGTTACGATGCCGCGATAAACAGCTCACGCAGTGATGCAACTGGTCACGTAAGAATTTGCTGCCGCTTCTTCGAACTCCAGTTCTGCCCGTTGCATCATCAACCCTTCCAGCTCATGCTTCTGCTGCGATACGCTTCTGCGGGAGCGTCTCATACGGCACATTATCCGGGGCTCAAATCGGTGGATTTTCCTCTGCCGTGCCTTTGGTTTGGCAATGTTCTGCCCAGCGCCAGGATATCGACCACTTTCTTGTTCAAGCCTTGCGGCGTAATCCCCTATTCCTCGTTGTACTTCTGCTGTTTCCACGGCGACGTTTCATCGCCAATCGCTTTCGCCAGGAGCGTGATCGATATCGCCGTAGAGAATCCCTTTACCGTTAACGTCAGCTACGTGCCGCACGACCAATGGTTGGACGAACCATGGAACGCAGTTCGACGCTCCCTACCGTCGAGGATTCACTAACCTCTACGAGATCCGCGCAGTAAGTTGATCCCTACCAGCACGTCGAACTCACCAGACGCAAGTCGCGGATAATCCCATAAGTTCGACGTGTCGATATCTGAGCAAGATAACGCACGCGCTCGCCATGTTCTTCGAGATATTCGGTAAGATTTCCACTCATCCGCTTGGTCCTGACCAGAGATCTCATGCCTCTTCCACTCATTCCACGAGTTTTCATCACCGCTGCAGGCCGCACTTCTACGGGTCAAGCAATCCGGTTGGACGCACCTGAAGGCGAATCGAAGCATCCCCGGATTTGCGAGCGGTACGAGTGCGTCGCGAAACTAGATGGTTGCGGCGCTAATGCTTCGAACTCTTCAACTTAAGGGACGGTTATCCAGCTGATGGCAGGCGAAGGGCCATTCTACCAGTGTCTCTTACGCCTAGCCCGTACCGCGATACATGCCGCCAATTGTGGAATGGTGACGTGAGATTCATTGACGACCAGCAGCCATTCAAGCAGGCGATCAACATCAGGCGTCGGTGGCGCCGAGTCAGCAGACGGAGAGGAAGGGGTAGTTTTCAATCCCCCGAACAGTAGCCGCCAGCCAGAGTCTCCAAACTGCGTACGCTGGGATACTCACGCTGCTCTTCAGCAGTTTTGTTGTTTTCCAACAGCACTTCGTCTGGCGGCCAGCTCTTCTTTGACCCTCCATCGCCTGAGATCCTCGCGGTTTGCGTTCCTTCGGCTGGGTAAAACGGAATAGTGGAACAATCTGCCCGGTCAGCGGGTCAAATAACGACAATCGTTCCACTTCCTCGTCAAACAGTTCCACGCGAAGTGCATCGATTTGATCGTTGGGACATATCTATACCTGGCCACGAACGCTGAAATCACGCTGGAATGAGCATCATTACGAGCGTATTGCAGCTCTCAGTCGGGAATCGCGCTGATCGATAATCATACCGACCGTGAGATGGAGCATCAGTCTTGATATAATCAGGACTGCCAGACCATAAATCGCGGAAAGACGCCACCAAATACGCCGCTCCAGCAATGCCGCTTTAAAACGCATTGCTCAATATGTTCCGTTAACCGAGGCATCTTTCTCAATGAAAGCTGGAACTTGGGGAGTAAGGCTTCCAGGCGAGCGGGAGGAACGAAAGATGCACCGCGAATTTCCCAAGGAGAACTTCCCTTCCCCCTCGGGGCCGCCAGCGTTTTGTTGGGCGCAAGTACCATGGTTGGGCGCTGAATAAGCAATGACATTGGCAATGGTGAAGGTTTTCCCGGTGAGCCAGTCACGCCACAGTAACGTCTGCTAGGGGCCGTATCTTCCAGCCCCTTCGAGACGTCGAATTCCCGGAGCGATCGCCAGAAGGTTTAAACCGGAATTCAGTTTGAACGGTTGTTCATGAGGTCTGACGTTGGTGGTAAGCTCAATTATCGTCGTATTTAAGCGTCGCCAACACGCTACTCAAAAGTTCTGATACCATAATTGCAGCGGTAACTCCGTCAATCATGAGCACGTACTTAGGGTTAAACTCCACCGGTCCCCAACGGACGGGCTTTTTAACATTTGTCACGATGAGTGATGACAGTTTTATGAGGCAAGAGATGCCTGTCAGTGACTGCCATTGCATTTATCTAACCAGTTAAAATAAAAGATATTCTTTGAGCCGTCTTTAACGCCAATTCGCGTGCAAGCCGCGGTACTCGTCGCTTGCCGCGGCTTTCTATACTCTAATACACCGGGTTATCCACAGGAATAGTGGATAACTGTCTCCAGCCTATTCCCCCGCCGCCTGGGCAATTCCCACATTCGCTTAACTGTCTGACGAATTTATTGATTATCTAGTGAATTTGGCACGGTTAAATGCAGTCAATCGTCGAAGACGCATCTCGCTGCAGTGTAACCAAATACAGAATGGCTACAACAAGGCAAGGTTTATGTACTTTCCTTCATGCCGCATTTTCTGGATTTTCCTGCACTGTTACGAGGACTGAATCTCCCAGCAGGCGCGGAGAATCTGGCGAGCGCGAGTCATCCAGGGCTAATCTCCCGCTTAGAAGATTCGTTCGCCCACGACCCGCCAGTATCAGTCACCCGGCGTGTTGTATTACCTGTGCAGTCAACATCGCGTGATTAATACAGCCGAGTTTCACAGACCACCCAGTATCACCGGCAGTTCCTCTTGTTACCAATCTGCAAAGGTGAAATGTCAGAAAGCGGCGTGCTCAACAGCCGCCAGCACCTTCCACTAACACCCAGTCAGCCTGTTACAGTGCGTAATCGGCTTGCCCTGGCTTCCTCCTTCCTGGTGCGCTGATGATGTGCGGCGAAGTGGGTTCTGCGGAATGTAAGGATTTACTGTTGCGTAATCCAGCTTGCAGGCTTCAGCATCGTGCTGTAACGCCAGCGTCGCTTGCGTAAACCTTCCGGGGTCTTCGCTGCCAGAGGGAACCGGTTTATAACCTGGTCCCCCGCTCGTTGCGGTTGTAAAAGGCACAACGGTGACAGTTTTCCTAATTTGCGGAGCGCTTGTAGACAAAATAAAGGAGGCTCACGTTAATCGCCAAAAGATGATACCATAGATACCTGCCTTGCTTCCTCAGGCCACAGTTGCAATCGCTGCAACTGTGAACGCGTTAATATTTCTAGGTCGCGCCCTTCATGAAGATGCGGCACCGATGCCTTTCAGCGAACGCATCGCACTGAGCGCATCATCAACAAGGGTCGCTGAATATGATGTTGATAATGCACGCCATCCAGTGACGGCTCGATTGCCAGCGGTAAAAGGGCACCGTGCATGTGGACGCTGGATGCCCCCTCTGTACTCCATGCAGTTCGGGTAACGATCCCTGCACCGATCAGCGTGGTAACGGGACCACGCGTCTCGGCGCACCAGGGAGCTCGCGCGACCCCGTAAGAAAGAGCCCGCACCACATGCACTGCGGATGCGCCTCATGCAGATCGAACGTCGCAGTCGCTAACGGCAGGATTCACCATCTCCCGCCAGATAATGGTCTTGCGGCATCCTCTAGCGTTGAACAGCATTGGGGCGGCGAGAGATCTAAGGCCGTCACCTGCGTGTTGACGTTCCCGCCAGTGGCGGCTCATCCAGCCGTCCCAACCCCGTCAGTACGTGCTGTATATTACGCTGTGGAAGCATTGCCAGTAAGGGTCAGCAGATAATATGGCGCTTAGATCTGCATGTTGCTCATAGTGTCGGCTGCCCGACCAATGCCGCTCGCAATGGCCTCGTTTATTAACCTCATTTGCCATGCAGCACCTCCAGCAACGGGTCGATATCCTGCAATTCGTTTGTGCAGCGTCCTGTTAAGTGCAGTCGCGCAGTACCAGGGGTACGGTTGGCGGGCGAATCGCCGTGACCCAGCAGCCTTGCTGACGCAGTTTTTCTGCCAGTTTGTAACGCACGGCTGTTATCAACACGGCTCGATCGGCGCTGCATGAATTAAAGCGGTAAACGGCAAATCCTGTACTGTAACGAACGGGGGATAGCCTCGCGTGCCATATCTAGTGCCCACTTCGAAGGACCGCCAGCGACGGACTAATTGCGCCTGAGCGGCGGCATACTGATAAGTGCTGTAACGCAGATAATCCGCCACCGTACTGGAGCAAAGCAAGCGCTGCCCCGCTGACGCCAAATCCCTTTGCAGCCGAGAAAGTCCATTACCAATTGGGAGGCCGCAGGAGTAAGGCCCCGCCGCGCCCCCTGCCTCCCCGATAACGCCCGTCCGTTCCATCGACCATCAACCAGCCATTGTGCTGTTGCGTTACCTGCTGGGATTTCCGCTTCATTTTAATCAGCCGCCGCCTGAAACACGCCTTCTGTCACCATTTGCTGCCTAGACAGGGGAAGCAAGCAATCGCTAAAGCTATGGCCATACTTCTGCGCCAATTCCTGCAAGCTGCGACGGGCTTAAACGGCAGCTTCCAGCACATGAGGACTGGCTAAGCCGGTCGGCAGCAAGTCACGGTCCCCCTTCGCTTCATCATCGCGGACTGAGACTCTGCCTGATTAGCGGCGAACCAGAGATAAACAGCAGTGCCCGGAATAGCCATCCATCCGGCTCTTCTTCCAGTGCCTGATGACCACGCTATAACCGCTGACTTATGGAGCCGCCCCCACCCTCTAATGCCAAATTGCTCCGCCCCCTGCTGCCAGGCACGGATAATTTGCGGATGATGGCTTAAAGCAAATAATCGTCATGGAAAAGTTCAGATACGGTGATAGCCACCATAGCTCGTTCCGGTGCACCGTAAGATAACGGCCGACGCAGGCATCGGCAACGCCTAGCGCATCGAGCGCCGCGTTGTTCTCCCTGCCAGCTCGTCATGCTGCTCTGATCACTGTCGGTGTTGTTCGTATACCATGCCGCTAACGAGATGTTAAGAGATTCCCTGGTTCCTTATCTTCCTTCCAGATGTCGGGAACAGTCACGAACGTTAGGCTTTGCTGGGATTCGGCGAGAGATACGAGTTTGCACGTGAAATTCAGCCTGCCATAAAGCACATCGCCTGAGTCTGTTCGTTCATCTGCATCGCGTCCGGCAGAAAGGCGACGTAAGAGGATTGGATACGATGATTTGTGGGAAGCGCAATGGTGCGGTCAAATCAAAGGCATTGACGATGGTAGTCGGCCAACCCGCTCGTGCCTTTCATCTCACTAATGTTTAGCACGCTCCTGTCTGATTATCTCAGTTGCAGCAATAATCCGGCGCGATCTTTACCGTTTCAGCAGCCCACAATGCCGCTAAGAACATAACCGATCCGCATCGCGCACCCTTTCCAAGCGTATCGAGGCGTTCCTGATAAGTGCGTGGGCGATGATGTCGCCGTAAAACTCCGGCTAAGAGATGTCACGGTGTTGGTTGTAAACGTACCACCGGCGTTCGCGCCTTCTATTTCCTTCAACGGAGGGTCACGCCTCCAGCCGTCACGCTTTACCCTGCACCATTTGTTCCAGGTACGGCATATCGCGTTCGTGGGATTCTTCCACGCCTAGGCCCATAAAGGCGCTGATTCATTTGCCGCGTTTTCGCCCCTGACTCTAATCAGCACCTGTTCAACTTCCATCAACCGCTTCTATTCCAGCCTACCGGTTTTGTTGGGCAGTATTTGCAATCTTCCCGGACACTCGAGCGCACTGACAGGACTAGCCGATTTGTAATACAGCTCAACGTTAATCTGAATGCTAGTGGGCGATGCAGCATGCTGGCTTCAACAGCACTCAGCAACGGTTTTTCAAATAATTCTGTGACTTGCAAGGTGTCCAGCGGTGAGCCGGGCTTCTCCAAACGTGTTTGTTGTTAATTCGGGTGACTTGTAACCTAAATCTTTCAAGTTTTGGTTTACAAGTGATTATGACAACGGACGATCTTGCGTTTGACCAACTCATATCTGATACCCATACATCCATGACCTCCCTCTGCCGGTTTATCCTTGGTGAGCGCTGAAGGTTGCGAGCTGATTTTTGACGGCACGCCTCAGTTGACGGTATGTCGTCCTGGTGGGCGGCGATTACACGGCTAATCACCGCACAAGCTTAATGCGGCGATGAAGTCGCAAACAATGATATCCAAGTCTGCAAGTCGTTTGGCGGTATCAGCCCGGGCGCCAGCCGGTATTGAGCTGTGCCGCAAACTGTTGAAAGCCCCGCAACCGCTCGTTTTGGCTTGGGGCCACGGTTCCGTAGCGTGGAAGTGGCGATGAAATGGCGTTGCAATACGGCAAGCCAAAGCGAAGCGCGCCAGCGTTTTCTGACCCTTCCGCAATGGTTATTCTAGATATTACAACGGTTGGCGGGATAGGGATAACGCATGCACAGTCTGTGGAAAGGCTATGTGCCAGAAAACCTGTTCTAAATGCATGGATGGCGAATGGGATGAGCGCGATATGGTGGGCTTCGCCCGCCTGATGGCGGCGCATCGTCATGAAATCGCGGCGATTGATCGATTACCGGATGCGCTTACATGGAATCGGGAGCAACGAAGTGCACCTGTACTGAAGTATCGATTGCCGACGAGATCTCACTGTAACATGAGTGGATTTAGAACTCTGCCTAGTTGAACACCCTGCAGAAATTGGTGCACAGTCGCCTCGGTAAAGCCTAAAGGGGGCAAGTACTTGCCTTACACTCAGAAACGCGGTGATGGTCGTAGCCGGGAAACCACCCAACTGTTTAAATGTTGGTTGGGTGAGCGCAGCGACTTATGGGCAATTGCTTTTGTTGGTAGCGCCTAAAATTCAGCCTGTGATCGGCGAATTGGGGATCGGCAGCAACAGGGGTGACCCGAAGGCAGAATGCGGAGACCCTGCGCTGTACCGTGAGTCTCGTTGAACGGTTGCCTGATGCGGCCTCTTTATGGGCGATCGGGGCCAGGGGCGGCTGAACTAAGTGCTGAATTTTCTAGCTTATGCAAATGCGTGAACAGGGGCTGCATCTGTTGGCAAACCCCACAGCTTAGATATGCCCCGCCGTGAGGTCGTACTCTCCCGGCAACAGTTGCAGCGTCTGACCGCAGCGGTTAACACCGCGGTACAGGATGAAACATTTGCCAATAACGAGAAGTCCGCGTGCGAGGGTCTGGCTACACTTTTGGCAACAAGAAAGGAGGGTTCATGAAACTAGATAGTAACGATTTGCGCGATGGCGGCTATTACGACGCGTCGTCCGTCTTTAACGGCATCTCATACGATGTGATAATATCCACTGCATCTGTGCTACGTACTTCCTGCGAGGAACGAAAGTTTTGTTGTCCACCTGCATACGACCGGGACGCGCCAACGCGGCTCGGCTGGGGCACTGGGTGTTGAGTAGACTATTACCCCGATATGCGTATACCGCAAGGTTTGGCTCTGGTCTGTAGCAATGCGACGGCGTTGCCGGACGCGTATCGACTTTGGTAAACCGGGTACGATGGCGCATCCGCGCCGAAAGGCGATGACGGACGCATACGCCATTTTACCGTTTAATTCCCGGATATAGAACGTAGGTGATGTCGATGAATAGGTGCCAGGCGCGATGGCTCGGGATTAACCAGCCATGCGTTCCGGCAGCGCCTGATTACTGGGAGGAGGCGATAATCATCTCTGCCACGATGGCGTGCAATGCCATCTCACTTAACGTATTAAACAACTTTATTTGTCTTTACTTTCCCGTTTGGCTCATACGTCATAAAAGCTGAACGAGAAACGTAAAATGATATAAATATCAATATATTAAATTAGATTTGCATAAAAAGACTACATAATACTGTAAACACAACATATGCAGTCACTATGAATCAACTATGCGGATGGTATTAGTGACCTGTAACAGAGCATTAGCAATGATTTTTGTCTTCTTGCCTAATTTGTCATCAACTGTCGCACTCCAGAAGCACAAAGCCTCGCAATCTAGTGCAATGTGCCACCACTACGACCTGCATAACCAGGTAAGAAGATAGCAAGTGATGTCAAACGACGCAGCTGACTTCTTTCTTTCACGACTTCTATCTCGCCTCCAGCGCTTCTTATATTCGAAGTCTGTTGATGAGGGAGCGGAAGTTAACACTATGAAAAGCGGCTACGAAGTCCGTGGCTATCTATCGGCTTATCTATATTGAAACGCTTCTTCAGAAGCCTGAAGAGCTAATCGTTTGGCGATACTATATGCATTAATAGACTATCGTTGTATAAAAGAGGCACCATGGACAGCAAGTACGTGGGTTATCCAAAAGGAAGCAGAAGCAATATGGAAAACTAATACGATGCCCCGTTAAGTTCAATACTACTAATTTTTAGATGGAAAACGTATGTAATAGAGAGTAACTTAAAAGAGATCCTGTGTTGCCGCCAAATAAATTGCGGTTATTTAGGCGGCAGAATAGCAGGAGGTGGAGGCTGGAGGCGCGAGGAAAGAGGCGGTTCCTGCAGTAGAAAAATAAGCATTCACGAGCAGATGGTTGGAATGACTATTCCTTTGTTACAATGTTTTATCTTACTGTCTTTGATGAGCATGTGAAAATGCGATATCCTAGAAATGTTAAATTGGTTTTGTAGTCAAAAGAAGAAATAAGCACTTATTCATTAATAGATAAAATTCAGTCACTCCCTGAAATGCCTTCCGAAAGCATTGACTACTATGTCATCTCAGCAAAGCATGATGGTTTAACATAACCTTCTTAAAGCTATTCAGCTTTAGTAGTATGGCCAAATCGATTAGCCGACATTGAAATGAAAGCGTCGTGTAACACCTCATTACTTAGAGGCTGGTAACTCTTTCAGAAATTCATGGACAGTTCGCACGTGTGTTAAATGGTTTGCCAGAATTGTCCATTCCACTTTCATTTAATAGAAAGTGCTGTACGCCGATTAACTATACCTTTTGCTGACGGTTAATTCTATGCCAGCACGAACATTCATGCTTTTATCGTAAATGGGTAAACAATTTTGAATGGAATGATTTCTAACTAATAGAAAGGCCCTGAAATAGTAAGCCGAGTCAAGAATCCCAAAGGATATCTTCGGATCGCTTGTTCCGTGCTTCCTGCCTGCCTTCTCTTCCATACGAACAACCTGACCCAGCAAAAGGTACACTTTTTATTGACTCAAGAATGCTGCCAGCATTAAAATCAGGGTTTGCCTTTGACGGTTTGTTTAATGAGCGATGAGTATAGATAGAAAAAGACAACTGGCTTGAAGCTATCAAAACTAAGTAGTGATGAAAACTTTCAAATATGGAACCCATATTTCATTTCTAAATATGAAGAGTTAAGACGTAATGAGAACCACAGATTCAATGGACGATGATAAATTCACTAAATTGTTTTATGACACTCCCAGAAATCTGCTTCGAATGAGCTCTGGACATGCAATTGGTTTATTTACTATCACAAGATTAGTAATGTCGTTGGCGAAAGTCATTATCTAGTTCGTGTCGATGAACCAGGATCCACCTCACGTACTTTGCTCTCTGCTTTTACGAACATTAAGCGACTTATCCATGCACGCCGCAATGGTGAAGGACCTGCAACTCATTCCAGTATATACTGCAAGAGGTTCCAAATCCTGCATGTGGAAAGTGTAACGGTCGGAGCAGCACTCCTCTTACGTCGCCTTGCGACATTCGTGAGAACTAGGCGAGCGATGGACGACCCGCATCT * tp:A:P cm:i:42 s1:i:347 s2:i:0 NM:i:537 ms:i:1130 AS:i:1138 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
45 41 16 utg000001l 27001 60 387S10M2D4M2I7M1D5M1I13M1D6M2I16M2D4M2D12M1D5M1D9M1D7M5D9M1I12M1D6M2D16M4I2M1I3M3I9M1D2M3D5M1I3M3I2M1I2M2I27M1D1M1D6M1D7M1I11M1I14M1D3M2D6M1I6M2D23M1I8M2I8M1D1M5D2M1D4M1D10M1D14M5I2M5I5M1I1M3D14M4D20M1I12M1D3M1I7M2I1M1D4M2D2M2D5M1D11M6I5M2I4M1I4M1I1M2D15M2I9M1I12M1I6M1I3M3I5M1D3M1I6M3D7M1D9M2I10M1D1M1D29M1I4M1I3M2I6M8D2M2I16M3D11M1D11M1D1M1D2M1D1M1D3M2D40M2D4M2I16M1I4M2D1M1D13M2D3M3D23M1D20M3D10M2I11M2I14M2D13M1I10M2D9M3D2M2I20M1D1M1D5M4D7M1D3M3I4M1D2M1I7M3D1M2D10M1D2M1D4M2I20M1D4M3I2M1I2M4D6M1D10M1I5M2D31M1I3M3D3M3D5M1D10M2I7M1I3M4I7M2D9M1D1M1D8M4I2M1I14M1D4M2I10M1D13M3D5M1D47M2D5M1D12M3D11M9I4M2I5M1D6M2I2M2I2M1D2M1D2M2I5M2I8M1D19M1D7M1D4M4D6M2D17M6D6M2D2M1D8M1D3M3D6M3D4M1D4M1D4M1I1M1I2M1I1M2I5M2D5M1D8M1D4M1D8M1D5M1D16M1I1M3I7M7D8M2D7M1I10M1D10M2D4M2D1M1I13M4I5M1I12M2I2M3D18M1I7M1I1M2I16M4I1M1D5M4D11M1I1M2I7M1I1M1I5M3D2M3D2M2D5M2D6M2I5M2D7M3I29M1I8M3D17M2I5M1D8M1I1M1I3M1I5M1D8M4D5M1I5M1I12M1D9M1D3M1D4M1I3M1D9M2D25M1D8M3D4M1I14M1I7M6D3M1I1M1I2M1D28M3D2M1I3M2I11M1D3M2I7M2D2M1I19M1I5M1D2M2D4M2D5M2I2M1D2M1I2M1D5M1I15M2D26M1I8M6D4M1D1M1D2M1D3M1I5M1I6M5I1M1I9M2D6M1D7M4D5M1D5M1I2M1I5M1D4M3D2M1I4M5D10M2D1M1D2M1D6M1I4M2I2M2I3M2D13M1D3M4D4M1D2M3I2M1D11M1D5M2D1M1D5M2D10M1I7M1I2M2I5M1D1M4D7M2I6M5D12M2D9M3I1M2I2M1D7M1I9M2D10M3D13M1I12M1D10M1I12M2D17M1I7M1I11M1I6M4D1M1D7M2I8M1D12M2D2M2D6M2I3M1I1M1I6M2D2M2D3M2D18M4D2M1D3M1I7M7D3M6D15M1D18M1D2M1D21M1D3M3D2M1I5M1D21M1I5M1D22M1D10M2D7M2I3M1I14M3D9M1I6M1D25M1D9M2I35M1D4M5I4M3I9M1D16M1D6M1I2M2D8M3D3M5D13M4I6M1D2M2I11M1I2M1D1M1D3M1I5M1I3M1I10M1I5M1D2M1D37M1D3M2I12M4D5M4I4M1D9M3I1M1I6M2D4M1D2M3D2M1I4M1I9M1D8M1I19M7I6M1D15M5D4M1D3M1D5M1I11M1I31M1D4M1D2M3D1M2D24M1I16M1D1M2I18M2I3M1I9M1I12M1I3M3D5M1I11M1D6M1D2M2D8M1I8M2I21M2D11M1I1M2D2M1I19M3I13M1I2M1I12M2D5M1D12M1I3M1D7M2D1M1D10M2I4M1I42M1D1M2I8M2D7M1I16M1D6M1I7M2I5M3I6M1I7M2D4M1D28M3I8M1I5M1I1M3I5M1I8M1I5M2I3M3D2M2I12M3D1M2I3M1D4M1D4M5I1M2I1M1I2M1D5M1I10M1I5M3D13M2D1M1D6M1D6M3I4M6D5M2D8M1I5M1D1M1D10M1D11M2I2M2D5M1I4M2D4M2I20M3D1M2D13M1D1M1D8M1I4M1D15M3I3M1I22M1D8M5D14M1D4M2I6M2D4M3D24M3D5M1I15M2I4M4D4M1I2M5D1M2D2M1D13M2D6M1D19M1D16M3D12M2I16M3D4M2D3M1I4M2D10M2I10M1I5M1D8M2D8M1I1M1I18M5D5M4D10M4I4M4D5M1I9M3I28M1D9M1I5M1I4M1I6M1I4M1D9M1I2M1D13M1D3M2I1M1D2M1I10M1D3M1I12M1D15M6D3M5D2M1D3M1I11M1D8M2D1M1D5M1I12M2D13M1I17M2D8M3D5M1I6M1D4M5D15M2I12M2I24M7D5M3I5M1I22M2I3M1I4M2I2M1I10M1D4M2D3M5D5M1I6M1I5M6I15M3I3M1D5M2D6M1D21M1D11M1D1M4I6M2I14M1I1M1I4M2D2M4D4M2D6M1D4M1D11M1D6M2D9M1I3M1D3M1I8M1D21M1I3M1I1M1I14M1D5M1I3M1I1M1I7M1D4M3I5M2D6M3D2M1I10M2D22M1I3M2I2M2D3M1D20M1D9M1D19M2D8M1D1M3I12M3I6M3D3M5D5M2I3M1D4M1I11M1D8M4I8M1D20M1D5M1I3M4I4M2I5M1D1M2D13M1D28M1D19M1D27M2D7M1I5M1I2M1I7M1D5M4I9M2D10M1D16M2I14M4I24M2D4M4I6M1D5M2D7M1D2M2I10M1D27M1I7M1I8M1D2M2I5M2D3M3D26M4D18M2I1M1D4M1I10M1I1M3D3M1D10M1I5M1D3M2I8M3D15M1D2M1D8M1I2M2I7M2D11M1I8M4I2M1I7M1I4M1D3M1D7M1I7M2I16M1D7M3D3M1D2M2I4M1I2M2I4M1I2M2D3M1D5M1D7M1D3M1D3M5D4M3D1M4D3M1D6M1D5M5I6M3I2M1I2M1I2M2I2M1D5M3I9M6I2M1I6M2D5M1I17M2D7M1D20M2I19M1D4M1I17M1I8M2D6M1I26M1I4M1I4M1I34M1D16M1I5M117S * 0 0 GTATCTAGAGTGTGCCACCCTCGGTACTCAGTCGATCAGTCACGGCAATGAGGCGAGTCGGTGGTAGCAAAATCTGGATTGGTTTCCCGTGGAGGGCGCTGCGCCAGTTCATTCATTTGTTACCAAGCGCCGTTAGTGCGTCAGGTGACGCGTCGATAACATCTGCAATTCAGTTACAAAGCGGTTGCAATCTGGGTTTGTTTGTTCCCCTGAGCGCGGTTGGTGCTGTGGCCGGTTCCGTCATGCAGTTAGGACGTAGAGCGCGTAGCGCGTACTGGTTTCACCGTATTACCAGCAATGCCCTGGCCGCAGCACCGGTTGGGCACGTCGAGAGGCGGTTTAGACGTGAGCTGCACTATCCCCTTTCTCGTTGTAGGGACTCCGCATGCGACAGCTGAAGCTATATCTGCGCACGTTTTGCCGAATTTTTACGTATCTTGCCGCCGCTTCTGCCGCAATTGCTCTGCGATGCTTACACCGCACTCCTTATTCACCCTTCGTGCTGCCTTCGTGTTCCCTGACGCCATCCCTGCTTCCCTTCTGCCCTCCTTCCCGCGCAGCTCGCGTCGGTCAGCCTTGCTGTTTCAGATGACCTGGCATTCGTTGGGACGTTTTGCCGCCTGGCAGAATCTTCTGCCGCCGTTGCGAACCGTTCGTTCAATGATTTGATGATGCGTTCGGGCCGGGGTTGATACTTTGCTGCCGCGGCCTACCGCATCTGGGCGGAAGTGGCGGCCGCCTAAAGCCGTCGCGTCGTGGTCCGCGTGGAAGCAGACGTGGCGGCTGATTGTTGTGACGCTGCAGGCATTCGACGTTCTCGCTAGCCCGGCACTAACTGTTCGCCGCGTTTTGAGGACTGCCGGCTGCTGCAATTTTGTCGCCTTCAGGTGGCCTTTGCTGATGCCGCTTCGATCAACGGACATTCCTGAGCTGACGATGCAGCCTATGTCCGGCGTCGACGGGCGGCCGGCGCGCGCGCAGTCAGTATGCAGTCAATGTTGTAGATTACTGAGCAGCTGATGCACTGGCATCGCCGGCTGATTTCTGCTTGCTCATTGGCGCCACCACGGACGCGTTACGCGCTACCTCTTCACATACCATGGCAAGACGATTCAAGGATGGGCCGGGCATCATCCTCGTCATGGCACAGAGAAAATCATTCAGCACCCCGGTTGTGAATCTTCATACAATTGGTGATGGTCATCCGTGCGATGGTGGGAAAACCGTCAACTATGCAGGATGACTGTACTGGTTCACTCCACATCCATGCTGTAAGCCGGCTTCATCCGATTCCTCTGGCTCACCGCGAGCCACCGTGGGCGTGAGTCGTCTGGCTTTCAGCTGAATGTGCTTAAGTTCTACCGGTTTTCCTGTGCCGTCTTCAGGACTCCTGAAATCTTTACTGCCGCCTCGATACACGCCTACGCTGCCTGCGGGGCTGTCAATACTCTATGTGCTCTGGCTAGTACATTTACACTCTACGCTACCCCAACGATGAATCGTCGTCAGTACGGGGTCGCCACTGCCGGAGCTTCATAAGCAATATCAACAACGACGGACGCTGCCGGATTAATTGGTCTGCATTCCACGGTACTGTATGCTGCATCGACCCGCGCGCAGGCTGTCTCGCTGCCAGGATTGGCGATTGCCTGATCCAAGCCAGCGCGATTCATTAAATACGTAATCCTTATCAGGTCCCTACCGGGGAAGCAATTGACTTGCTTGACCTGTCAACGTGTACCGGTGGTTACAGCCTACATAACGTACGCAGCTCTCATGAACCATCCTCCAGGGTACTACCGTGCTGCTCTATGGGTTCTTTGTGACGTGACCGTCAGTCGGTACGGTGCCGTCAGCCCAACGACCTCACGTTAATCCTAGGCTCCATAATGATTCACACATCGTCCTCCCGGTTCAACGACGGCAATGTCAGGTCGGTTTCATTTGAAATCTTAAGGCCAAACGTACCATAGTATCTGGACTGTCCCACCCGTCGGCCCGCAAGGATGGGGAAGACAGCCAAACGGCAATACACATTACGCATCGTTCACTCTCACTGTTAATCAACGCCCGTTCCCGCGGACGAACCTCTGACACTCAGACCACGCTGATGCCAGCGCCTGTTTCTTAATTACCAGACCTGCAAGCCTTACAACCATACGGCGGAATATATGCCGAATGCCGTGGACGTACGCGAACGTCAGGATCACGATGCCTACAGAGCTGGCATGTCAAATACGGGGAAATACCTGTACCGCCTCTCAGCCTAGCCATCATAGACACGACGCACAGGAGCCAGTATTTTCAGATAACACTGGCACGGTCCCTGCTTAGAAGATAACCTTGTACTTCTAGAAACGTCAGCAAAGCACCACTATCTGGCGATCAAAAGGATGAGTCCGTACACGTACGTCACGATAAAACCTTAAAGCCAGGATTGCCTCACGCCCCGGAAAGCTTGTTGCTCCAGCAAGCGCTGACGGTTTCCGCTGAGCGTACACGTTTATCGTACAGTTTTCAGCTAGGTTTACGAGTCTACCCGGAGTTCGACGCATTGCCACTGATATCCGCCATTTAGCGGTCAGCTTCGGCTGTCCAGGGAAAGGCCGGAGGATTGCCGCCCCTCAAGCATGGTGGGGGCCGTCAGGCGGTTTCAGGAACACGTCGTTCATGAATATCTGGTTGCCCTGCGCCACAAACATCGGCGTTATTCATTCCCGTTTGCCGGGTCAATAAAATGCGATACGGATTGGCCGGGGCAACCAGAAACTCAGGTTTAGCTTTCTCGTGTCCTCCATGCTGAGGCCATCGACATAATGTTTGCCGTCGTTTGACTAAACTCACGCATTCGATTATCACGGCATCCTTCGACTCTTTCGAAACTCCTCCAGTCTGCTGAGGTTCTGTGTTACTCGACTTTTCCAGCAGCTCCTTGCCGGATGGGATTCGGTTATCTTGCCTTGAAAATCCAGGACCTTCTTCTCGCATCATCGCTGGGACCGACGGCCTCCACGAATGCCCGTGCCAACGGTGTTCACTGCGGATATAAAAAGTAATAATCATGGCCCGGTTCCATATTGATACGGCGGAGTAGCTCCAGAGTACAGCGCGAGACGCAGTCAATGCGGGTGCCTCTTCACCCCTGGCATCTGGTAATTCGCCCCCAGAACCAGAACTCAAACTGTACCGTCCGTATACATAAACGGCAAGAGTCCGGGTGGCGGTTATCGAAAATAGCCCGGCGTCAGCTCAATCCGGACCCTATGCTGCCGCTGGCAATTGAGCCAGAACGATACCGACGCTGGATCGCCTAGTGCTGCCCCCACGCATTACTTCACGGACTGTCAGCTCGTAGTTCGTTCCACCAGCGCCCAGTTGCGTGAATGGTATGTGGTTTCCGTCGTCCGGGCCGTGCTGACCAGCCGCTCACTGCCGTCGTCCATGTCATGACGGAGCAGGAAACTCACGGTGTCTCATCACCTTCGGTGTGTCCCATCGCGCCAGCACCTGATATTCCCCGCTGTCTTGCAGTGACTTCTTGCCATGTCGCTGCAGCGCTGTGGCGATCACCATTCTACCGTGTCGGCCGCTACTCGCTATAGAATTAGCCCCGTTATCTAATCGGCCTCTTTGCGGACAAGTGCCGCTGCACGGCGGTGATGTGGCATACGTGCCGTCGTCCGACGTACGACTCACTTAAACCCGCCTGCTAGCAGCGTGATGGCGCAGCTTCAGCTGCGATAAGCTCCATTCAGCACATGTATTTAAACACGTGTTGGAGCCTTCACGCCGTCGGTGACGGACTGAACCTCACCACGATTATGACCGGGATTGCCTTCCGTCAACCAGGCTTATCAGCGCGGTACCGGAGGATGGCAGCGTAAGTCGGTTCACGGTCGAGCGTTTAGCTAGTCGCTTAGTCTGGCTGTTGATTCACTAACACGACCACGACTAGCGATACATGCATGATAGATGATGCATACACTTCAATAACATCGCCGGTACTTAGCCAACCCCCTTTGCCTGACGCGAAATCCACGGCTTCATGCCTAAGGCTTCTGTTTTAATCAGCGCCACAGCCCGGCGCGGCTGCCCCCGGCTGGTACGCGAATGCATTCATTTCGTAACATTACGAAAGGGTAAACGGGCAATGGCCTGCGTCCTCAACATCTGTCGCCGTCTCCAGCCGTCATAGTCGGTACGAGTTCACCTCAACGGCATTATGGCGGTCTATTCAGGGCGCTCAATTATGTAGGCTCTAGCGCCGTAATAGTCGATCACCGATTACTGCGGTTATAAATCACGTCTTATCCGACGAGCCCTGCACGACGACGTCAGCGTCTGCCCGTCCCCACCGCAGGCATCGCGAGCAGAAATCGCTCGAGCAAGCAATGCTAGGATGTCGCGGGAGCCACGCAGAGCAGCCGCGTAGCGTGCCGCCAAACCGTCGGCGGACTGACTGTACCTCGCAGTACTGGCCGATGACATACAGCCCATTTATCACACATCCGCCGCACTCACAGACGCTTCCCCAGTGCGTAGCGGATGGGTCAGCATATCCCACAGACACAGAGCGATGTTGTCGGGTATGCCCCATTAAACCCCCAGATAAGCCGGGTCTGCTGCGGTCCGTTCCGACGGCACCTGCAGAATACGCCCGTAGCAGATGATAATTACGGCTCATGCTGGCTGCCGAACGGTCTATCATGCACGCCGACCAGTGCCGTGTTCGGGTAGCACGGTTCGCATCGATGATTTCATGTATGACGACCAGAGCGTTTTGTTCTGCAGCTGGTCTGTGGTGGGCGTTCTAAGCGTGGTACCTTAGGGTACAGTAGGAACGGTCCCTGGGGCGCGGCGGCATGCAGTACCATACCACGCCGGAGGCTTCGGCGCGGCTCTGCGCGCTGGTTTGGGGGTCCTGGCTCTTGTCTTTCCGTCACCCAGACCTCACGTTGGTTTGACCAGCAGGCGGACTTCTACGGATTCACTGTCAGCCCTTTGAGTGGTTTCCACCAGTGCCTGTACACTACCGAAAGTAAAGGCAGGACGTATGATGTTGCAGACATTATCCAATGGCGGATTCTTTCATATTCCCATTTCCGTACCCAGCACCGTCGCCGTTAGGGAGCTTCAAATCCTCCGGCGGAGTCTGCTCCGCTCACCAGCCCGGAACACACCGTGACACCGGATATGTTGGGAGCCTCCCCTTGTTGCTCAACGGCGTACTGTTCATCAGCACGCTTTACGGTATCAACTAGACCTTCAATCGGCCCTTCGCTGATCGGCTCTAATTGTAACCACTCAGCAACTTCGTGGACTTCAGGTTGTCCTTCATTCGCGCGGGGGATGCCTTACTGCTTCCTTACCCATTCCTCACGCTCCATAAATGAAGACCGCCCGCAGGCGGTTTCACATAAAACATTTTGCATCAGACCAATCACCAACCTGACACCGTCCGGTCTTCGTCTGCCGTGATGGCTGATCTCCTGAGAAACCACGCGTGACCCCACGCGCGGTTCCTACATAAAGTCGAAGAACATTGCCCTGGGCAACCATGTTATCCAGTGAGGAGAAATCATGGTTTACGTATGTGCTTAGTCGTCTGAGATCGGTGGTCTCGGCTGGTGCCAGGAATTGGGGCGTAATACGAGAGTACGATGAGCAAGCGAGAAAGAAGGATGCCGAGTCATACCGCTCGAATGGCTGCCCCATGCTGCACCGCTGGCTCCGGCGGTAAAGAACCGGTACGGTGCAATGGCGGCAGCCCGCCTAAATCGCATATCGGCCCTCTACATCCTGTATCTCGCGACATCGAAAGGATATGGAGCATGACCAGTCTCAGGGGACTCTAGAGCAGAGTGGACTCCCTGCGTTAAAGCCCCGCCGGTTCGTGCAATAGGCTACCTTTCGATACCAGCCCTCAGTTCCGGACGACGCCGGGAGCTGTGCGCGTTGCCCGGATGGCTTCAGCCCCGTTTTCTCAATCGACGGTCGAGGCGACCACTGTCGGTTGTAAATCCCCGTAACAGGCAGATGCGCCATTGCCCGGTGACTCAGAGGGAGTGTGCTATGCTGCCATTTGTTGTAGTCTCTCTCGTTTGCTCAGTTGTTCAGGAATATGGTGCAGCAGCTCGCGTCCGCCGCAGTAAATTGTGGATTCGGCACTGATGAACCAAACAGCACACACAGCAGCACATTTCCCCGGCTGTGCCTCAACAACGGGGGACCCTCCATTAAGCTACAAACAGGGAC * tp:A:P cm:i:47 s1:i:548 s2:i:0 NM:i:1934 ms:i:1116 AS:i:1108 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
46 42 4 * 0 0 * * 0 0 GTTGGTATTGCAGCGTCTGCTTGGGTTTATGGCATTGTGACATGAATAGCAATACGCTTCAGGAGTCCTCAAAGCAGGAAGCCAAGTCAGAACTCCCAACCATTCAGCTGGCGCACTCCCACCGCCGCAGTGCCGAATGGCTAGAATGCGACGCGACGCTCCGGCGTACATGATCGTACCGATGACGGTTTAATCTAATCTGCACCTTGACGGAACGTGGTACTCCCACTGTTTGCACGCCCGGAATACGCCTAGACGGGACTAGGAATGGCTAGAAGTGGAGATCCGCTCTCATGAACTTATTTTACTGTTACAATCCCACGGGGGCTGCGTGACCGCTTACTGCGTCTTGAACTTAGAGGGGTGGCACGCCGTGACCGTCCGTTAATCGAACGCCCGTAAGGATCCTCGGAAGGAGGACGATGCGATGCAGCCAGTCCGATAGCTGCGCATGCCGCATCTCACGCACTCTGCTGGTAACTGGACCATTGCAACTCAACGCCTCGCCAGCGGCATCAACGCGCCACGACGGATTTAACCGCCAAAGCTCCACACGGAATGCATCATTCTAAACGCCGGGAGCTCCGGTTCTAAAATAGAACGAAACCCGACGCTCCCACTGAAAATCCCAGCCAATGCTCCCAACCGCGGCACTCACGAGTTGCCGGTGCCTCGAGAATGGAAAGCCCGTACGGTGCGGCTTAAAAGCTATCAAGTTAAACACCCGATAAACGAAAGCGTCCAAGCCGGGTTTAGAGCGCGGGTGCATTATCCCTGAAAGGGAGCAAGAAAAGTCTCCACTTAGAAACGATGAAGGAAATGCCTGAACGTGACGGTTTATTCATTCCTCACGAAGCGGCAAAATTCATCCCTAGCACCGGGGACCGTCCCAACGCACGAGGACATAGAGTGCCATGTGGTACGCATCGCATTCTCCAGGCAGATGCCGCATCCAAACCTCGAAAGCCACCAGGCTCCCAGTGCGTCACTGAATTATAAAAAGAAGGCAGCTGAAGGACAATGAAGCTGGAAATGCACTGCTCCAAACGCCAACGCGATTAGATCCAACGGAAGAGAAACTGCATCTACGTGCACTAAATTCGAACGTGCACGCAGGACTTAGCTTCAGCTGTCTAAACCCACGTGCCAACGCGAAGGGATGGTGCAGCTCCACCATGAAGGCCCGTCTGACGGACTCAAAGTCCTGCCGGCCCGCTTCTATTCCGAAACTTTAAGTATGATGGAGCGAACGCTGAGAAAGCCAACCACGTTAGAAACGACCCCAACATCGACGGGCTCACGGGAAGCTCCTAACGACAGGTACCCCAAAATGATTGCAGGGACCTCAAATCATTTGACCCGATTGCCTTTGACGATCCTGTAGCGCACTTCAGAATCTCTACGCTGAGATGAACTGGCCGCAGCGACTCCAGGAGCAGCCCCGGGCAGTTTTGCCTGACCTCGCTCCTCACTCCCGACATTCATCCTCCCCAGGGATCCACGGCGACGATGTAGCTCCATGAAAGCGTTCTAAGCGACTCAATCTAATCTTTGCCCGCATCGAATGCTAAAGCCCGTAAGGCGCGAAGCACAAAATTGACTGCGGGATCCAACTGAAGGACGAATTCACGTTGCAATGTTCTTACGCACATCTCATTGGGGTCGCATTCACGGCTCATGGACGTTTCATTCGAGCAACGATGCCCGTGCCCGCGTGGCCGCATCACGGACTCCAATTACGCGATGTAAAGGCAACGGTTTAATCGATGCAGGATCGTTTGGCTTACAGCCCGGATATTGTCCATGTCCTACGTATCCACTCATCCACTCTTACTTCTAACGTAACGTATCGATCCGGGTAAATCTAAAGGAAATCTCAAGCACTAAGTCGTTTCATGTATTCTTAAGGAAGAAACGCATTAGATCTAAAGCCCACGATCTAAAGCGTGGAATTGACGCATATCCCGCATTTGGGGTCGCCAAATACCGCACGCCATCGCCCGTCGTTTGATCTAAGGCCGCAAGCTAAGCCAATACGGGATTTCGATTACGGCTGAGAAGCGAATCGAGAATCCTATAGAGCCATCCTGACGCCGTGACTCAACGGTTCATGGGACGTTACAAACCCTAAATGGTTATGCCCTGCCGCATGGAACGGTTCTTGGCATGGGCGTACGTAACGAATGCCGGATGCACGCGTCTCACTCCCAGGTTACGCCCACTAAAAAGGGATCTCAGCACGACTTGCCTTATTTAACGCCGAAGGACGGTTGCTGAATGCAGCCAAATCCACGGCTTGTTTGCCGGTGCGGCTTAGATCGATGGCGATGCAAGAAAGCACGTTGTAATGCCCGCTACTAGGAGCGTACGGTTATTACTAGCTTAGCCGCCTTGCCGCTTCTTTCAGTGACCTTGACAGCCCGCTCCGTTGTACTCACGCATGCCTGACGAACGCATTAAAGGCCTTGCGGTCTATCCGGTGCTATATCCTGGCACGTCGATGGCTCCCTGGCTGGACTAAGGCTCCACTAAATTTACGTATCTGACGGACTCCTACATCGAATTTATTGGGCTCGAAAGCGGCTGGTTTCTACGCCCGCCTCATGGCCATTCAGACATGCACGGCCGTACCCGGGTGCTCGTATTGCAAAGCCCAAATATTTACCGGACAGCCTGACCTGTTGTAACGTGTTCAGACGATCTGAGGCAACGTGAGAAACTAACAGCCGTTTCCAAAGCCTGCTTAGATACACGATCTCCATTTTGTCCTCTGACGTGACATTCCATGAGGACGAGTTTATTTATTTCAACGGTACGTCCGTTGTACCCACGCGACTTTGACACTGGTCTCCCATGCAAGGAAGCCGAAATGGAGAAATGGAGCCGCAGCCGGTCGCGACCTGTTTAAGAGTTATCAAGAGGATGCAGAGAAGCACGCATCTAATGCGGATCGGCTCTACAGCACGTGGCCCTGGTCTCCGTAGATGCGCATTAGTGCATGTGGGGAGTGCATTGGAAGTATGACAGTTTTGGAAGCTGGAGAAATGACGGGTCTTGCCTCCACTTAATTAAACTAAGCCTCTTAATGCAATCCTTAGTTTTGCCTGTTACTCCCAAACTTAATCGTTTGACTGATATGCCCGATAACAGCTTTTAGGAGAACGTTCTGTAATGCGGTCCTGCTGGTCTAACGGTACTTATTGGTTGTATTTGCTCCAACGATTGCCCAACGTATTCAGGGATGATAATGGAGAAGTTCTGACCTGTTCCACTGTTGTATAAACCTCCCGAACCCCGTTAAGCCTATCTAAGCAACTGACTTTTCACGTCACTAATTGTTTACGGATCGTATCCTGTTGGACAGTAACTGTCACGGGACGAGCATTTTATGTCGTTTCTCCCTCCTTTTTCCAACCGTACCCCTTACCGGCTTGGATCCATTCCATTGTCTACTGAAGTCTTTCATCTGAACACTTGGCTTGTAAATTGGTTATGCGTGCTTGACGTGCTTTCCATCTCATCTAATGATATGATCTAAAATGGGATCCCTAAATAGGCAGCCGGGAATGGTGACCGCTGGTTTGTAACATGACTTCCTGGTAATGGTGCGACTCGCCTAACTTCTCTGCGTATTAGACTTCCAAATGTTGTATTGGTTAATCGATTTGGCCCACTGCGATTCTTATCTAAATTCGATGTTTGGATCTAAGGATTCGTCTCACACGGGTTCTGCACGGACTTATCTCGTACGCCTGGACTTCGAACTTTTGTGCTCCATCTCACGGAAAAATTTTATCGACTTTATATTCCGACAGCAGGAATTATTTCCTCTCCCTTCCCAACGTATCTAGTTAATCACCTGTCATTATGAACGTATTTTAATTTAACAGAGTCCTGTCTCCGCCTGGCTTCATCGACTGCACCAACTCACAGTGCAGCCGGGTACGCGAAGTGCCCACTCCACCTGTTGCAAACCCCATTACAATTCTTTGATGCACGCGAATTGACTCCCAGTCTCATTCAACTTCAATTAACGGACGCATGTACCGTTAATTAACGTAGCAGGCAGTGACACGACCCGGGTTCTTTCTATTTGTAACGCTGACGTCGGTCGATTAAACTACTTAGCAGCTTTCTTTGTGCCGGTCTACTGGTTTACCAATGTTTACTTTCGTCACCGACTTGTCACGTCTGTCAATGTAATGACGAGCCGACCTTTAGCCCTCGTCACGGTACGCTTGTTTCTATCTGTGCCGAATTTTAACTAACGGAAAGAGATGCATCCTTGACTATTTTCTCATTTCCACTCGTATTCTAAGTGTTCATATCCTCTATCCGTTGTTCCGTAACGGGTCTGGATTTGCCACGGTTCAGGAATTGACGGGCACGCAGTTCGACGCAACGGAATTCAGATTGAGACGTAGATGCATTTACCAAATGCAAGCGTAACAAATCTTTAAGTCGCATTCAACTTTCTAAGATAGTTTGACGTACGCCTCCATTTTGACCTACGTGCCATTAATGGACTCCTGGTTCCTGGGATGCGCAGTCTGACTGCTTAAGGTATTCAATGTAACCTAGATTGTTCTGTGCAATGATTTATCGAAACCCTCATGATTAAATTCTAAGGCAGTTCTAACTTGACTGCTTCATGCACTAGGTTAAGAAATTGCCCGTTATCGTATCGACAGTTTGCCTCACCAAATAATGAGGACGGAGCATCGACGCCACGTCTGATCCCAGGAACTGGTTCCTGCCAAAGAGGACCCGGCTGGTGCTGCTTCCGACCTTGCGATTCAGTATGGGTTCCGAAGCACGCTTTAACGCCAATTCTACTTTTATCAAATCCGCATTTGACTAACCTCCAGCACGACTAGATGGTATGCTCCTGTTTACGCAACTGCTTACGAACTAAACCGAATCTGATTTAACGATGCCGTAAGCTCCTGACTTCCGGATACTACTTAGGGCATTGATCGGTTAGGATGCCTCCCACCTTTGTAGCTAACCTCCTACACGCTCCTACAGCCAACTTCGTTTAGAAGGATTAAGCTTCCAACTGTCACCTCTTAATTAACGCAACGGAGCCGCAGCGAGGAAGCAACTCGACTTTTGCGTAAATTAACAGGAAATCGACTTCAAAGGCTTGACACTCGACTTTTAGAATTGCTTCACGCAACCATCTGTAATCATGACGTGCCTTTGGATTAACGTCCTTATTTACCGCAATTTTCTTTTCGACCTGACGGTCGACTAGGTCTATTTAACCGTACCGCTCCATCTCACGTATAGAAGTGATCTCACCTTACGAAATACTGCCGAGACTGTTGTATTTTAATCGACCCGATTCCCCGGGCGGTTCAACTAAGCACACCTCCCACCCGCGTGCTCCACGCAACGCAACAGTTAAGAACTAGAATAGAAAATGTCTGGTTGCAAGGTACCCCGGTAACGGATCCTATTATCCCCCGCTCCTTAGAACTTAACTCTTTTAACCAGCGACTGTGCAGTCTAGAGCACGATCCGATCTACTAGAAGCACGCGCATCTCTAAGGTTTCAGGACCTATGCGATAGGAAGGCGAACTCGTACTTTTGTCTTTACTATCGCCTCCTTTTAGACTGCATCCGCTCCAGGTTCTATGATCGAAGTGTTTAAAGGATTATGTTTCCTTTTGCTTCTTAAACTACTTTGTCCGTGACGCTCCAACTACGGTTAGATGCCAAATCTTTTGGATACTTTATAACTCTTCCGACATTAACTTCTAAGTATTTGTTTAAATTATCGCAGGGTGACTAATGAAGAATTATTTCTATTTAACTGCATCGCTCTCTGATTCCGAGCGGTCTCATTAGGGCCCGGTCGACTAGTCTCACTGGGGGACCATGTAGTTATTTGATAACATTCCTTTCATTAACCTTTTACACGGATAAGTTTGACGCAACATAACATTTAAAATGCTATCTAATCGTTTGTAGGCCATCGTCATAAGGGGACGATCATACGACTGCAGATGGTACGATTCCGTCAAACTAACTACGATCCCTCTAGTTCTCACGAGTGCTCCAGGTACATACCTCACCTGGGTAACTTTATTGTAATTATGTAGTATAGACGTACGTGAATCTCCGAAAAGGCATTTTAGAGTAGTTAGAGTGCTCTGGGGAATGAACGGGC *
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
47 43 4 * 0 0 * * 0 0 CTACCGCGGACGTCATCTGCCTTATGCCATGGACGCGCCGGCGCAGCATGGCAGATCGAGCCAGCGTTGAGAGTCTATGCCAACAGGTGCGGAGAAGTGCAGAGGGATAGGGGTACGATCAGCATTAAGTCAGTACAGGGCAGCTCTAATCGCTGCTAATGGCATGGTAGCAAGCTATCCCCTGTGCTGACCTGGTGGCATGCGCGCAAGAAGTCAATGGCATAATTGACCATTAAGTCGCGTCTAATCCATGAAAATACCGCAATATACTTGAATAAATTAGTTACAACTAAACTATTGGGTTGGCACTCTCAGGCTAAATACCGTGCTCACGATTATTCGTGATCCACTCTTAAATCCAACAGCGCTCTAAGAGAGTGCCAACTGCAATCGAACAGAGTCGCAGGTAATTAGGTGCCTGGAAGCTTGCAGTCTAAACATAGAGCTAAGTCAGTAATGGTGAAGAGTGTGGGCACCTTGATTAGCGCGTACTTTTAGTCTTGGATGTAAGCGAATACGAAAGCAGAACTAAGTAACAGGGCTGCCGGCATTGACAAGAGCACGGAGCGAGCTACGCTCAGTGTATTTAGCGTGATACTATTAATCGTGCGTGAATCGCTCTACTATAGCTATCGTAGCACTCCTTGCTCTTAAGAGCGAGCAGGAACAAAGGCCTATGTAAATTTTGCTTGGATAGGTTGGCTACAATCGCCTCGCTTGTTTCTACAGTAACTTATTCCAAATCGCTCGATGGCGTATTAGAAGCCAACAGTACAGCTCTATGGTCCCGCTTCTGAAGGAATAAGAACGGGTACGGGCCTTTGCAAGCGTAGGTCGGGACTATAATCGTTGGGCTACAACTATCGAAGCACTTGAGCCATCTCTAGATTGCTCACGGTATCTTCTCGTACAAGCCGATAGGATAGCACTTAGGTGACTCGAATGGTCTATGGCCTCGATCTAGATGGCGCTAGAAACCGCGACCCAGCGAAGCCTATAGACAGCGTTAGAAAGGCAACGTAATAGCGTATTAGGAATCAACGTACGAGTGAATACATATTAAATTACTTATCGAAGGTTGGGTGACCCTGATTATCTCCTATAAGTGTGCCCTCCTAACCCAATGTAAAAAGGCACAACTAAATTGTCACGCCTTCTCGATGAGCGCAGCAGGTCCCTGAAAGTCTCTCGAAAAGTCACTAATGGCGTGGTGCAGCATTAGAAGGTAAGTTGATAGCGTATGTAACCGTTAGGCGATACGTTGCGATAGTCTAACATGAAGCACTAATATCTGGTGCTCATTGTCTAGGGACCACGATGATAATGCGGTCGAAAGAGGCGCGCTTGCGCATGTAATGGATCGCCGAACGTATAGCTAATATGTATGAGCTGGTTGCTCATGGGCTCGATGTCGGTACCATCACCGTACTGATCAGCTAAAGCCAAAATCAGAAACGAAGGACCGGGCATGATGAAGCTCATCGTCAGCGTATGTTGCTCCATGCAAAACACGAAGTTAGCTTACGACAGCGAGCTGCTATCATGGATCGGCTGTCGTCGGTTGAACCAAAGCAATTATTGCTTACATTCTGCCGACGGACATGCCTGCAGCCCCGACCAAGGGCTAAGGCTAGGGGTCGCGGCCAGATACTATCAGGGACACTGGAAGAAGCGATAGTCTGACGATACAGCCATCCCCTCCATGAAGGCAGTGTAATGTAAGGAGGCTACACACGCTTCCAGCGATAAATGCTAATAAACTGAAGCGAGATCGCATGTTTGGGTCTGTCTAGTTGGCGCGGTTGTAAACATTTGCCCGCTGCCAAGGCAGACTTTAAAGTTGCTCCTGCCAATTTCAGAACACTTTATGTAGAGCCTCCACAGCGAGCCGAGGCCTAACAGATTTAATCTTTAAGAGCATGAGGCATCGTGCAGTTAGAGTACCCAGTGCCTGGTAGAGCCAGCCATCCGTCCCTTAAGTTCAATGTCTATCTATGTAACTTAAACTCGAACATGGTTTGCTTACTTGCTATGGATGACATTACGGCCATCCGAGGGCTTACTATCGACGGGCAACCGTCTCAGGAGCTGCGGATAACCACCGAACCAATTAGATACATCTGATCGATGGGCCTCGCCAATCCGCGGAACCGACGTACGGCTTGGCTTAGAAAAGAGACATTATGTCTCAATCGCCCAATAGTAAAGCTAACGATAGGCCTCAACTTTATTTAGTACCGCTACGAAAATTCCTTAAGTTTTCTTCTAGTATGCTAGGACTTTATCCTTCCTCTACATCAAGGGCACTTTCTAGATAATCTTTCTTAGAAATTAACATGTCTAAGCTTTGTGTACGTGTAGTCTCTAATAATCGTCTAAATGGAGCTCTGTAGATAGATAATGGCTAATTACTTTGGGTCCAAATAAACATTCACAGTCTAATGGTCCGGCACTATCCAACTGTCTTCGTACAAAGCGGACAATCGCTCTGTCAGTGGGTACTCTCCAATGGGTTGTCTGCATGAGGCTCAATGGTTTTACCTTCCTAGTGTATAGTGTTTACTTTACTTGCTATGGCAGTGTCTATACTTATTGGGCAACAATCCTGGCTCTCTTAAGGCGAAGTTAGGAGCCAACTAAATAAGCGCTATTGAATATTAAAGTTAGCAACGTCGGTACAGGACAGCAAGCGCAGGCACAAAACGAATAAAGAACAATCTAGCTCCACCGTGACGGTATTCGTGACATATGATCTAAGTCATAGCGTCTCTAGCTTGTAATCAAACCACATAGTGTCTCTGGAAGCAATCCAGGATGAGGCGGATTTGTGGAAGCGACAGATAGGCAGTACTTCCGGATATGACTACATATCAAGCCTTCAAGCCTTGGCGTGACAGACAGCGCAGTTATCCTATTGATAGAAATAGGTAACCCACTCAATTACTGCGGTAGGTAATAAGTGAGTAAGTCCTATCGTGCTGTCCTAGAAGACGGAGGTTAGTCTGCCTACTTTATGCTCTTTGACATTAGTCGCGCAGTGCTACAAAGAGCCGAGTACAACTACTTTGAGCCGGCTAGTACGTGTTCCATCAGTCGTATAGGAAGGCTGAACGTAGTGCCGGGTCGATTGTTTGCTGTCATTCTCGTACATCCGCGTATCCTATTAGCTTGTATGTCTGAATGTTAGCTCTTAGTGGATAGATATCAGCATACATCAATTAATACTTATCGTGTAATATTATTTGAACTAGCCCAATTATACGTATACGGTTGTAATGGTTTAAGTGCCATCCCTCCGTTGGTATCGTATTGACTTG *
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
48 44 0 utg000001l 32981 60 568S18M1I8M1I5M1I2M1I7M2I1M2I5M1I1M5I1M1I7M1D7M1D8M1I17M2D2M1D14M1D3M1I23M2I17M2D21M2D14M3I24M3I1M1D15M4D5M3I2M1I25M6I10M4D19M2I3M1D12M1D5M3D6M2I23M2I4M1D16M4D6M1I3M2D6M1D24M1D9M2I12M1I9M1D18M4I2M1I5M1D1M29I2M1D9M2I1M1D5M2D4M2D42M2I2M2I3M1I2M1I2M3D3M1D18M4D1M1D7M3I8M4D5M1D17M1D16M1I2M2I14M1D14M1D3M2I2M3I6M1I3M6I1M1I5M1I7M3I6M4D2M1D3M1I7M1D10M1D13M1I2M1I7M3D1M1D2M1I10M1D1M1D3M3D9M3I9M2D8M1D3M1D2M1D8M1I2M2I1M1D10M6D9M1I16M1D8M1D3M1I1M4I6M1I7M3D1M2D4M1I5M2D2M1D23M4D5M1I3M1I15M1I2M2D3M3I6M5I15M2D6M6D5M2D5M3D6M1I6M9I4M1D10M1I6M2D8M2D5M1D9M1D10M2I7M1D5M1D9M1I1M2D9M3D1M1I5M1I2M1D3M1D11M1I6M3I13M3I5M1D23M1I8M1I16M2D16M1I3M1D7M1I15M1D7M1D23M1I8M1D29M1I2M2I5M2D8M1D5M2I5M2I6M4D2M1I14M3D2M1I13M2D7M1I2M3D7M2D3M2D4M7I7M1I5M1D15M3I1M3I3M1I4M2I2M3D2M1D4M1I13M3D3M3D6M1D5M1D2M1D10M1I16M1D13M1D27M3I2M1D5M4D10M1I7M1D6M1D1M3D5M1D6M4I6M4I2M1D21M2D4M4D9M1I10M1I8M1I4M2I5M1I4M1D6M2D4M2D29M2D19M1I14M2I11M1D7M2I10M1I8M3D6M1I9M1I3M2D4M2D3M1I9M3D22M2D12M2I4M3I4M1D9M2I20M1D47M1D9M1D16M1D8M2D2M1D10M1D17M4I3M3D2M5D2M1D6M6I2M1I2M1I1M1I4M1D2M4I2M1I1M1I2M1I4M1D16M2D21M2I8M2I2M2I23M1D16M1D23M1D2M5I1M1I4M2I7M1I8M2I9M2D5M2I3M2I6M2D4M1I18M1D10M4D3M3I20M3D1M1D10M2D5M2D1M1D6M2I13M2D12M2D6M1D3M2I1M2I5M1I19M1D9M1D46M2D8M4D6M4I11M3D10M1I8M1D17M2I7M1I7M1I15M1I13M1D3M1I10M1D4M2I17M1D10M1I7M1D10M2D2M2D12M1D6M1D10M1I11M1I8M2D12M3I5M1D3M1D14M1I1M1I4M1I11M1D2M1D3M1D9M2I1M1D4M1D19M1I1M1I1M2I8M3I3M1D8M3D13M2D4M3D11M2I18M1I37M5I11M2D3M3D6M1I52M2I25M2D3M1I9M1I18M1I8M4D5M1I2M4I5M3I2M6I25M1D3M1D25M1I12M1D3M2I9M3I9M4D16M1D11M1D8M1D1M2I4M1I2M2D3M1I2M2D28M1I4M1I1M1I2M2I10M3I5M1D4M2I9M1D4M2D24M1D9M1I3M2I16M1D3M3I8M1I7M1I12M1D10M3I19M3I6M1D17M1I4M1D6M3D3M1D18M1I2M3I2M2D14M2D12M1I2M1I16M1D13M1D7M1I2M1I5M1I6M1I19M1I2M1I11M2I2M1D4M3D3M1D8M1D9M2D9M1I2M3I11M2D10M1I14M1I8M3D3M1D8M3I3M1D3M1D6M2D28M1I2M1I9M3D10M1D4M1I5M1I27M3I12M1D14M1D3M1D5M1D48M1D5M1D4M1I14M2I4M2I12M1D20M2D3M4D2M4D25M4I8M1D12M1D7M2D4M3D7M2I7M1I13M1D7M1D24M1I1M1I6M1D26M1I9M4I9M5D1M2D2M1D11M1D6M1I14M1D2M1D9M4D33M1D3M2I4M1D3M1D3M1I7M1I24M3I6M2D6M1D6M1I12M1I33M1D3M5I1M1D5M1D2M4I4M1D16M2I4M3I8M3I9M1D1M5D23M1D20M1I8M4I1M1I11M1D5M1D16M1D7M2D14M1D6M1D6M1I9M2I31M1D1M1D28M2D9M1D22M1I7M1I10M1I2M2I7M1D9M2D2M1I4M1I14M2I20M1D32M2I16M1I7M3I4M3I6M3I6M1I15M1I19M1I1M2D6M1I15M3I32M1I3M3D1M1D6M1D6M2I7M1D7M1I9M1I3M2D6M1D8M1I33M2I8M1I9M4D17M2I13M1D6M2D10M3I5M1D23M1I3M3D4M1D7M1I7M1I7M1D13M2I4M1D2M1I2M1D1M1D2M1D20M1D12M1D8M2D5M1I10M1I4M5I4M2I4M2I10M1I6M2I5M3D7M2D2M2D6M2I6M2D4M2I1M1I3M1D32M1D8M1I5M1D28M1D21M1I18M3I1M6I31M1D7M1I13M3D6M1I7M1D17M719S * 0 0 TGTTGCGCCGCTAGGGCGGCGGATACCTCTGAGCGGCGGAGAGCCGGTGAGGTTTAATAGCGCGCTCCCCAAGTAACTGAGTACACCAGTAGTCCATCGGGCAAGCGGTAGAAACATTAAGCAGGTCAACCGGCGGCCCCAATCTGGAATCGCGCTATCTGCACCCGGCGACTCTGGGGGTCAAACTGACGATTATAAAGGGCCATCGGGGTTAACAATGTAAATACGGGTTTGACTGAGGGGTAATTCGACAATACGTTAGAAGCAATCCGTGGGTACAGCCGTCTAATAAGAGTTCATCACCGAGACTAGGGCACCTTACGCACGTGCCGATGGCTTCAGCCCCCGTTGGACACGAAATCCGGGTTGAGGCGGCCTGCGTTGGCTTACCGATCAGGCAATGACAGGCCGGGCGTGACACAAAAGAATGTGCGTCATTGGTAATCCGGATTTACCGGTTCATGTACCGTATAGCTTTTGCTCGAGTTAGTGTTCGGAGGCTCTGAGTCCAGCAAACAGCGTGCAGCAGCCGCAGTAAATGCGGCGTACTTCGGCACTGTATGAACCAAACAGCACAGCAGCACATCGCCCGGCTGGTGCCGGTGGACAACGGCACCTGATAGCGAGAGATGCCCCGTGCCTCCAGATTGTCCAGATAGAGATTCTGGCTGTCAAGAGTCATCCTCACGACTGAAAGTCCGGCATCTCAATCCCCGCCAGATGATAAGCATCCGAACAGTGTGTAACAGTTAGTCACCGTGCTCAAAGCGCCGCCACGGGGTTACATGCGGCACAGGGTGAACTTATGAATCGTCCCCGATTCCAAGACCAGCCACCACGGCAAATCACTGGCCACCTGCATACAGCGGTCGGCCTCATGCAGCCAGGGCAGACCACCGGGGTCGGGGGACCAGCCAATCTCACCCTGCATTTCTGCCTGTGCATCAGTCTTCCGGCGACATACGGAAATACGCCTCCGGCTCACCGGAGATATTCACGCAGGGAAATATCTTTCTCCCTCCGTGCGTGCTTACACGAAGCCGCACGACTCTCCGCTCAGCACATGCCGGGCGTGCGGATAGAATCAATTCTTCTTGTCATGGGGCATTTACTGCGACTTTGTTAATGGAAAGGAAGCCACAAAGTCCCACGACGTTAGTTGTCCCACGATACAACGCTCAGGCATTGCCTGCATTCCTTCGTGATATCCGGACGTTGGCTGGTCACTTCATCCGCAGCTATACCTGAATAGACGGCCAAAACCGTCTACGAGCCGTACAAATGTGAATAGTTACAGAGCAATACCAACCACGTTACTCCGGAAAGGCCACTAGACGCTCCGTTTAGCGTGACATCAGTAAAAGGAGGAGTAATAGCACTACAGTTCGCTGCACTTAAACATCCCACAGCCGGCTGATCAGCTGCTCCAACTGGGGTGACTGTTCCGTTGTAGCACGAAGTTCACCGGACCGGAAAACGGGCGTAGACCTTACCGCTGAGCTAACAGACGTTCCGCCGACCAGACTCTGCATATCTTCCGCCATCCCGGTAATAGATCCGGATTATAGAAACCGTCAGCGTGGGGCGCGTACTGGCTCTGGTGCTGTTGCTTGAGTTCAAAACCGCTCCCCTGAATGGGACCGGCTGATCTGTCGCCCTGCCAGGTGACCGGCTCACTTTTCGTTCTTACTAGTACAGAAAAGCAACGTTCTCCACGACCTGTCAGGTCGATTTCGTCAGAGCACCACCGCCGGCCGACTGCTCCGACCGTATCATTCGATGCGATTTCCTGCCGGATATCCTGCATCAGTTCGCCCTGTTCAAACTCTGCTGAACTCAACGCAGCATACTGACCGCGAACGACCATTTTGCAGCGTATAGCTTATCTGCCGCCACTCATCAGGCAGCGTCATCAGAAGGATTTCCAGCCCCGTGCTCTTTGCGAAACCACTCCAGTATAATTGGCCTCCTCACCCGGAGTAACAGAATCTACGATTTACGTTGCTAGTGGCATTCAGCCCGGCAGGCAGCCTGAGAATAAACCATCAGATGAGGCACCTTTCTTACAGAAGGGACCCAACCCGCCACATCCATACCGGGTTTCACTTTCCATAGAAAGTTCATCGTCCTCCGGAGAACAGGCCACCATCACGCATCTGTGTTGAATTTCATCACGGCACCCTTGCGGGCCATGTCAGACGCCCACGGTTGCAGCAGCTACATCTATCTGCCGTTCTTCGTTGTTAATCACCACATGGTTATTCTGCTCAAACGTCCCGACGCCTGCGACCGGCTGTCGTAAGATGCTGCCCCGGTGTGATAGGCACTAACCGCCGGTGGCAGGCGCATCAGCCGTCAATTCCCACGCCAATCCGGCTGGTTGCCTCCTTCGTGGAAGACAAACTCACCACGGTGAACAATCCCGCTGTAGCTCATATTTGCCGCCGGTTCCCGTAAATCCTCCGTCTTAAAATGGAAACTTCGCCGCAGCGGCCTGAATGGCTGTACCGCCTGACGGGACGAGATGCCGCCACCAACAGCCGGCCAATGGCGCTGCTGATACTCCGACAATCCCCACCATTGCCTGCTTAAGCAGAATTTCTGTCATCATGACAGCACGGAACGGGTGAAGCTGCCCCGTTCTGCTCACTGCCGGTCAGCATCGCCCGCCTATATTCTGTGCATATCAACCGCTCGTCTGCGTGGCTCAAGTGTTGTGACACTGCTATACTGTCCGTGGCGCTCTTCCCGCTCACTCCAGCCCGGACTTCAGGCCTGCCGTAAGCGAGTTCCCCCGAAGCTGTCTTCAGCCCAGGTCTTTCTTATGACATGACGTTATTCGCCCACATCAGCGCTAATTATCGCCATACTGATTTCCTTCAGGCTGTTCCGTGGCCTCGTCTACTCCGTTGCCTGCCGGTCAGTCAGCCCCGGTTCGGGCATCAATGGCGGCCCGTTTTGCCGTTGCTGCTGTGCATTTATCCGCCTGCTGCGCCAGCGCGTTCAGGCGCCTTGATACCGTGATGTCGCCAAGTGCAGCCAGCTGGCGTTGTACTCCAGCGTCTCATCTTTATGCCAGAGCAGGGATTTCTCCTGTCAAGACATGGCAGCTACGTTGCGCCCCGCCTCCTCCACCGTGACGGAACTCTCCGCTTCCACAAATCCCGGCCTGCTGGCTCTATTTTCTCATTTGCTCCGGCATGGCTTCTCCAGCGTAGAGTTCTGCTGAAGCGTCAGCAGGGCAGCATGAGCATGTCTTCCTGTACGTACGCCGCAAGACATTCACGCTGGACTGTTCGGCTTTTCAGCGTCGCTTCAGGATCGCTTTTCGCCATCAGCGTGTTGTGGTAATCGCTGCAGGATTTTCCCGTCTTTCAGTGCCTTGTTCAGTTCTCCTGACCTGACGCGTTACTCGCGCTAGGGCGTGCGACGCTCCCGTTCGTAAGCCTTCTGCCTCTTCGGTATTTCAATTATAGGTGACCCTGGCTGCTGCTTGGCATTTTTGGCTGTTGAGTCTTATGCTCAGCCTTCTTTCGGGCGCCCGACGTGTTAGGCGCATCGATTTCACCGATCATCCCAGTAACGCGCCCGCTTCATCGTAACAAATAATCATCCTTGCCCAAGATTCCAGATGTCGTCTGCCTGTTCTTACGCAGCCTCTTACATCATCAGCATCTCCGGGCTAAGTGAACTGAATGTGGTCAATATGCTGATTAACCGCATCCCACATGGATTTGAATGCCGGCAGTCCTGTCTGCCCAGGTCTCCAGCGTGCCGGTTCTCTTCATCAGGCGGCCTTGGTTGTAGTAAACCGCTTTCGTTGCCTCGTTCGCCGCCTGCAGTCAAGCCGAGCTTCTATCCGGAACGCTGCAACTGAGCAACATACGCAATCATCGCCGCCGACACGTTATCCAAACTGGCCATGATAGCCGTCAGCGACGTCGGGTCTGTGGTCACCTTCCCGAAGGCATTCATAGCATACTTGTCCGCCCAACGCCGCCGGATCGCACGCGAGAAACGCGCCACCTGGCTGATGGACGACGCAATCTGAGCCTCACTCACGCTTATCCCGCCTTAACCAGTGCCGCTCGTAACCTGGTCGGTCTGGTTAAACGTCAGCCCTGCCGCCTGCCCGGCTCCCTAAAACAGCAATCACGATCTGCCGTCAGTCCCGCCTGATTGCCGGGGACAGACCAGCGTTTTGTTGGAAATCGGACAGGGTTAGTCAGCCCTGATACCAGCCGCTAGGGCAGGATCCGTGCCCACTAGAGCCAAGCCTCCGCGCGCCATCGGCAGGTGACCGCACCCGGCAAGCCGCCTCTAACATGGAGACCCGCCGAGACAGGAGTCCTTCATGCGCCCTGTTGCAGCAGGATCAGCCACGGATATTGCCCGCCTGCAAGCTGCGTGATCCGCTGTTAGTGAAATGTGCAGGCAGCATACGCATCATGGCGGCTGTTACCTGCCCGACGGAATCCCGCTTCTGTGCAGCCAGCGCCTGTCGGCTCAGCGACTGTTAAACGACTGCCCTGTTTTTCGCATCACTTTCCGTACCCCAGCAAAAATGACGCGTACTCTGGCCATCTGCTCGTCAATCCGCATGCAGACCCAAATCAACGACCATTCCGATCGCCTACCGGTTCAGCCATACTGACATCCGATTCCGGTTCTGATAATGTCATCATCAGGTCACGTCATCCTCCGTCATGTTGCCACATCGCTGGGAAGGCATATATTCATTCCCGTCCGGGCCACACGGCGACAACATCCTCCGGCATCGGGCTTTCTGCATCAGCACATCATCTTCAGACTTTCGTCAGCCTCGCGCCGGTTCAGCAGACTGAAATCCAGCGGATCATGCATGCGATGCTGGAAAAACAGGCTGAGCACGGTGTACGTCAGCCCCGGGCAAATGCGGACTCTCAGCAGAACATCATGAAAATAATGGGTACTGTAAAGCGGTGCCAGTCGGATATGAGTCCATGGTGAGCAACATCCGGCAAGCATGGCACCGGTTATTTGTTAGCTCCTTACCGCATCTAGTTTCAGGGCAAAACTCAGCTCACGTCGAACATTTTCCCCAAGAAACAGGCTGGTGCGCGGGCCATTAGGTTCTTTTCTACTCAGGGGCATGTTCACCAAACTCATACATACAGACATCGGTACCACCACGTTCACGCAGCATGAGAAATTGCCTCCGTGTAGAGGTAAGCACTTCCTGCTCAATCTGTTTAACGTTCATTCATGACGGCAAGTGCGTCTTCTGCGCATGGTTATTGCCACAGGACATCGCCACCAGAACGCGCCGTCATGATACCCGTCTTCCACACCAAGTAAACTTCCGGTTGCTGTTGACTCCGCCTGTTCTGCCTGCCGTTTCATCAGGGCGGGTTGCTCAATGCGCTGCGCACAGGGCTAAATACAGTTCGTCAGAACCGCGTGACGGTCACGCGTTGGTTCAACTGATTCGGAGTTCAGGAAACATCTAGTACTCTCCAGGACGGACTGGCGGTGACGGTAATTTCTGCATCGCAGAGCAAAACACCAAGTCACATGTACAACCTAGAATGTTGTACTTGCTTGTGCAGCAACCCCCGTTCAAAGTGATGGTCATACCACTGACCGACACGGTGGCTTTTGTTTGACAGACAAGGCACCGAAGCTCTTGTCGGTTACGCCTCCCGGCTCGAAGGCACGGTCAGCGTGGTGCTCTTCCTTTCACGGCAGGTGGCAGGCGTCTACGGTCAGCGCCGGTTGCCTAGCTGTTACTCCGTCTAGCGATCGTGCTCACATCGACGGACGTCCCACATTGGTACTTTCACCCGTTAGATCATTCCTAGTCACCGCCGTCACCTTACCGATACTGCTGACCCCAGCCGCCCGGACATCGAATAGTTCGGTGGAAGCTTTACCTGAGGAAGGGTATCGCCTTCATTAAACCACGCCAGCACGCCTGATCGCGCTCGCCGGGCATCCACGCCAGCGTGAAGCTGGTATCTCCGGCAGATTTCTGCCCCTGCCCATTCGAGGTCTCTCAATATGAGTCTGCATCTTCATCATCGAGATAGCTGTCGTCTATAGGACTCAGCGTCAGTTCGCCGGGCGTCAGTCTTTGACTTTTCAGACGCGACCAGTCGGGACGTCTGAAAGCGGATTCGCGTAGCGATTACGCTGACGCTCCTAACCGCACAGGGTGGTCCCGGCAGCTGATTCTAATGTGTAGGATTTGGTACACAGGCATAGCGTCCTCACATTCATAATAATGACATAAGTCAGATCGGCTGAACTCCACAAGCCGCATCATCGTTGCGCCGTAGTCAGCTCGCTGGCACACCATACTGGTGATCAATCTGACAGTCGGGATATCGCTCATCACGATAAATCCGGACTCATCAAACCGCATCCAGCTCTGAATCCGGCACTGAGCAGGCAGGAAAACTTCGATATGCAGCTCCGCCTAGAGGTACCCGCTGTCCACTCTTCGCCCGTGTATTCAGCGCCCGGTAGGAGATAAACATCGCAACTGCCGCAAATCCGCCTCATACAACAGCGGGTACCAAAAACCTTTAGCGGTGTTAGGTGCTTCTGAGTGCATGCGAGTTACGGCTGAACGGAGTTCAGTATGTTTCATCGCTTTACCATCCTCGAGTTGATGCTGCACCTACCCAGCCTCTTTCGGAAGACGTTCACGCCGTATCCCTTAATATTTTGTTAAACGCCGTGTTACCTACCAGCGCCATCTCCAGCAGTTCACATCAATGGGGTAACGCTTTTCCCAGCCACACGTGCAGGTGACATGCCACCGGCCATTTTCAGTTAGTAACAAACACACGTTTGGTTATGT * tp:A:P cm:i:62 s1:i:631 s2:i:0 NM:i:1572 ms:i:2448 AS:i:2457 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
49 45 0 utg000001l 24882 60 41S7M1D16M2D2M1I23M1I8M1I4M4D4M2D2M1I2M1I6M2D4M2D5M1D14M1D21M1D6M1I5M1D14M1I4M1I2M1D5M1D14M3D1M2D1M2D30M1D10M2I1M1I6M1D15M2D2M1D13M7D8M1D5M2I2M5D4M3D4M2I14M1I7M2D17M2D4M3I5M5D1M1D3M1D18M4D3M2I5M2I2M1D8M2D3M1D1M1D11M2I4M2I7M4D4M5I3M2D10M2D7M1I15M1D5M1I4M1I17M1I21M2D13M1I17M4I1M1D2M2D5M2I2M1D4M1I3M1I2M3D7M1I6M3D1M1D3M2D5M2I4M3D3M3D6M1D2M2I5M3D13M1D6M1D5M1I4M3D10M2D7M1D1M1D4M3D4M1I4M1D1M1D18M2I16M1D12M1D19M1I5M1D3M9I8M3I12M1I3M2D1M1D4M2I6M1D10M1I5M3D3M1I4M1I11M1I2M2I5M2I6M1I1M2I18M1I4M1I7M4D5M1I2M1D23M2D1M1D5M2I16M2I43M2D5M1I4M3D1M1D1M1D20M1I2M2D15M2D1M2D7M2D3M2I5M1I12M2D8M2I20M1D3M1D5M1D2M1D4M1D12M2D9M3D13M2D1M4D3M1D5M4I2M4D6M1D3M1I4M2D1M1I7M1I3M6D1M1D23M5D13M1D12M1I18M3I13M2D4M1D26M1D3M1I3M1D7M1D11M1I5M1D7M2D6M1I5M1D1M2I10M1D10M2I6M4I6M2I7M5I10M1I2M5D6M3D9M1I2M2D10M1D11M1D7M2D9M1D1M1D14M1I4M1D2M1D12M1D6M3D6M2D1M3I16M1D6M1D19M2I4M1I9M2D2M2D11M1D9M2D7M4D2M1D5M5D1M7D2M3D5M2I3M2D9M3I4M1D4M1D4M2D5M1D6M3D4M1D1M1D8M3D6M2I8M1D19M2D2M2I4M1I14M3I8M1I9M3D6M1I5M2D9M2I24M3I4M1I6M2D8M3I10M1I1M3I4M2I10M1I9M2I3M1D7M1I15M1D16M1D10M1I5M1I7M1D11M1D4M1D4M2D1M1I6M3D4M2I2M3I4M2I3M1I11M1I3M1I2M1I3M2I11M2D22M1D6M1D9M3D2M3D8M5D3M7D10M5D13M5D2M2D7M1D2M1D3M2D8M1D17M9I1M1D5M2D7M2I9M1I8M1I3M2D2M2I6M1D2M1D4M2I2M1D9M1D1M1D3M1D5M2D7M1I7M1I5M1I4M2I10M1D15M2D6M1I14M1D3M1D7M1I7M3D7M4D2M1I17M1I4M1D4M1I1M3I4M1D1M2D1M4D5M2I1M1D19M1D4M1D4M1D2M1D10M2D36M1I8M1D34M5D5M6D6M2D2M3D1M3D5M1D6M1I1M1I5M6I7M1D2M3D11M2D2M2I2M1D6M2D2M1D4M1D7M3D3M1D8M3I1M2D4M2D10M1D1M1D17M1I26M1D30M1D18M1D4M2I4M5D3M2D14M3D7M1D8M1I6M2D4M3D7M2D8M1I12M1I6M1I5M6D3M1D9M1I33M1D11M4D11M2I6M1I22M1D2M1D10M1D10M3I5M1I9M2D7M2D8M1I8M1D3M1D6M3D3M2I1M1I8M1D4M6D10M2D7M1D3M1I5M1D1M1D25M1D9M1I2M1I10M1D29M2D7M6D7M1D7M1I13M3D2M1D4M3D5M2I1M1D8M2I4M3D2M1D2M2D3M2I13M5I4M1D4M2D1M1I10M3I6M2I11M2I15M2D3M1D1M2D3M3D6M2D5M5D1M1D2M2D2M3D12M5D4M2I1M1D6M2D12M3I4M5I1M1I2M1I85M2I2M1D9M1D7M4D11M1I14M1I14M4D4M1I6M1D11M1D3M1D5M1I6M1D3M2D9M1I11M3D5M1I4M1I8M1D22M4D2M2I4M1D7M2D15M1D3M1D4M1D2M2D4M1I2M1I2M1D4M1D8M1I4M1D4M2I7M1D3M2I7M1D4M3D36M3I2M2D10M2D1M2D16M1D7M1D4M1I3M3D7M2I6M2D1M1I19M3D9M2D2M1D17M1D17M2D1M1I29M2I9M1I12M2I11M1D6M1I4M1I9M2D6M3D9M1I18M1D9M1D12M1D4M3D1M1D8M4D5M2I4M6D1M4D3M1D7M1I8M3I6M1I20M1D5M1I1M3D7M3D7M1I17M3D3M2D2M3I3M1D9M3D6M2D12M1I7M2I7M2D8M1D6M2I4M5D8M2D6M1I9M2D1M1D6M3I2M1D2M1D2M2D3M3I4M3D12M1I8M2D2M1D10M1I10M1D7M3D5M1D27M5I5M4D1M1D3M1D2M2D5M3I1M1D5M1D18M1D1M3D3M1D24M1I10M1D17M1I5M2D1M2D3M1I29M1D2M2D7M1D6M1D2M1D11M1I15M1I17M1I2M1D1M1D6M1D8M19D9M1D3M2I2M1D2M1I3M1D7M1I4M2D8M1D1M1D3M3I4M1I4M2D8M2D22M1D4M1D21M1D3M1I4M2I6M1D4M2D3M3D16M2D5M2D5M3I5M1I6M3D5M1D2M2I11M1I2M1D1M1D4M1D3M1D2M1I18M3D2M1I2M1I1M2I1M1I10M2D8M1D13M1D9M1I2M4D7M3D7M2D1M1D6M1D2M4D1M1D4M2I4M2I21M1I5M3D2M1I5M1I6M2D4M1D9M6D3M1D3M1D19M2D3M2D9M2I1M2I2M1D4M1D8M1D15M6D4M1D2M2D4M1I4M2D2M2D4M2D2M2D12M2I1M1D12M1D4M1D2M1D3M1D16M3I11M1D7M1D5M2I26M4D1M1D9M1I14M2D2M2D4M1I14M1I8M1I6M2D13M1I3M1I2M1I5M1D4M1D5M1I1M2I5M1D4M4D3M5D5M2I2M1I7M3D9M1D7M1D5M6D19M1I5M1I3M4D4M1I24M1D15M2I4M1I7M2I10M1I3M1D5M1D1M5D5M1D5M1I3M2I10M1D10M1D1M1D5M1I4M2D6M2I14M4D3M1I7M1D9M2D4M1I4M1I11M3D3M1D6M2D9M2D17M4D5M1D4M2I6M3D4M6D1M1D29M3I8M2D8M1D19M2D10M2I5M3I5M5D26M1D2M1D4M3I2M1I5M3D16M2D16M2D2M9D1M1D3M1D1M1D4M1I3M2D1M3D11M1D6M5I5M1D3M1D4M1D4M1I14M1D18M2D4M1I7M2D6M1D11M3D3M6D16M1D5M5I8M1D2M1D4M1D9M1D2M3I6M1D3M4D4M2I3M1I7M3D4M1I3M1I4M4D19M2D20M1I4M1I2M1I6M1D1M2D9M1D14M1D2M1D8M1I4M3D6M1D6M2D1M3D2M1D7M1I6M1I13M1I5M1I6M1I6M1D4M10D6M4D1M1D23M1D6M6D3M1I7M6D3M2D9M2D4M2I7M2I15M2D4M3I13M2D5M7D7M1D6M1D6M1I8M1I4M1D5M2D8M3D1M1D3M1D5M3D7M1D7M3D8M1D1M1D27M1D9M4D3M2D4M1I2M1I3M2D13M3D8M2D4M1D1M2D5M2D15M2D19M2D19M1D2M1D4M1D2M1D2M1D12M2I4M2I18M1D3M2D15M1D1M2D5M2I27M1I6M3D3M1D4M3I7M4D3M1D3M2D1M1D3M2D3M1I11M1D1M2I5M3D5M1I19M1D4M5D12M1I8M1D3M1D7M1I12M5I4M1D5M1I1M4D3M1D10M2I7M1D15M2D6M2I2M1I10M1I2M3D4M1I25M1D10M2D13M1D11M1I2M1I11M1I23M1D1M1D6M1I6M1D15M2D6M1I6M1D7M4D14M3I5M1D19M3D3M2I19M1D1M1D4M1D5M1I1M2I6M7D9M1D1M1D6M4I7M2I7M2D42M4D4M1D9M1I1M2D8M3D3M1I4M1I3M1I5M1D3M1I4M1I4M5D3M1D6M2D7M1I1M2D5M1I12M4D17M5D1M1D12M1I36M1D7M1I2M1I3M2D2M1D2M1D3M4D5M1D6M2D3M2D2M1D4M2D3M1I16M1I7M4I1M2I11M2D4M6I1M2D5M1I4M1D26M1D8M1I19M1D3M1D8M1D6M3D8M2I2M1D5M1I7M1D9M1I1M3I7M1D1M2D2M1D3M3I1M1D20M2D15M1D11M2D4M4I1M1I8M1I3M1D3M1D1M2D8M1I10M2I6M1I10M4D1M4D18M1D2M8D10M3I9M5I4M3D16M1D10M1D15M1D1M1D14M2D10M2D9M2D19M1I1M1I4M3I8M2I5M1D3M1D2M1D10M4D10M1D3M3D7M1D5M1D4M1I12M1D14M2D3M1I13M2I8M1D15M2D14M1D19M4D6M1I3M2D6M1D14M2D8M1D4M1D5M1I10M1I11M127S * 0 0 GTCGTCTAGTTATGCAGCTGACAGACCAAAGACAAATCCAGGGCTTCATTTGGATATCAGAGCTATACGAAAAGCAAGCATCTACTCAATAAACCAATACATACAATTGGATTAGATGAATTCATACGTGAATTGATTCAATAATAATCAAATGTATTTCATGGAAATAGATGAGAAAACGAAGAAAAATGAATTCTATTGCTTCCGCGGTATCCTCCGGAAGAAGAGATGGGAGCGTTCAGTCTAAAGGATTGGCGGTGATGTAAACACTGAACAAGTCAGTCAGAACTTCCATTATTCTGAAGATATAATCGCCAACCACTCAGAGCTTTACAATATACTACTAACCGCATACGTTATTTCATGACGCTCTTTTTAAGCCAACGATTACTCCATAACACATTAAACGATCATCAATATCAGTGCAGTTACTGTATCAACACGGTTCAGCCCGAATGATTTCTTCAGGCTTCCCAACGAGGTTTCTTCCTTCGTTCGATTCCAGATCTGCAGCATCCTGAAGCGGCGCAATATGCTCACTGGCTATGCATCAGGCTTTGTTTCTTCCGCTCCGGATCCCCTGAAGTTTGCTTCCGTATCCGTGCCCCAGGCTGTGCCGTTCCATTGGTATTCCCCGGCGATACGATAAATTTTCCGTAACGACCCGGTTAGAAAGATAATCGCTTCCCGCGGCTCGCGCACTTCGCAGGCAGCTCGAGAAGAGACGGGAAGGGTTGCGCCATCACTGTTGAATAGCCACAAAGCCAGCCGGAATATCTGGCGGTCGAATATTAGATCTGTTTGCAATGAGGCAGACCGGTATGAGTGAAGATATGCGTCACCTTCAGATAAATTCATTAGTTCCTTAAGATTGTACCAAATTTATGGTCCGTGGTTGTTCACTCATTTGAATGCCATGCAATGGACAATACAGTTAAATCAATGTTTGACGGTGTTCCGTTACCCCCGCAGCGTTGACGGTATGGTGTCCGTGTGAACCAATACTGAAAGAATGGGCAGCCGCACCAACACTCCATCGGTGCGCACCAATACCAACTGTATGCGCATGTGCAGGCACCGGCACGCTTGTACCATAGGACAATGAGTACTGTAGCCTTGAATGACTGTCATTTCGATAAATAAGCATCGCTTCCTCTTCTATTCTGTGATAATTCCTGTAATGGTCCCAACCGAGAAGCTCCAGAAGGTCTCATTGTGACCCAGCTTACAGCACCGCGGCCCCCTGTTGAATGAGACCCTGGTCACATGAGCCCCCGGAGTTATTCGTCGATTTGATCGGGTCGTAATCGAACTGCTGTTGTTTCATTTAGCGTAATCAACGACGATTATTTCGTCCCAAAACCCGTACCGGATGCACTGGCACTGTGGGTCTAGACTTAATTCACATCCTGTTCCTGAGACAATACATAAAGTAAATGAGGGCGTCGCCGTGATTGTCCCTCTACAGATCAGGAAGCACCCGATCGTACGCGACAGCAGTTTTATAGTAGATTTAAACGCCTGCCTGCATCAGGACGGTAGCCAGACGAACGATATCTGGCCCCCGTGATTAGCACTGCTAGAAAGCCGAATTCGCCGGCCCCAATATTCAAGAACATCTTAGAATTTGCCAGAATATCCTTAAACCTGAGTCAGTTTCTTCCGGAAGGAATACGGAAGAGATTATTTCACGTCGAAGCCTGCCAGCGCCGTTAGTCGCATTCTTCGGTTGTTACCCGGCATTTTAGTCATGTAGCACTGTGATCATTCCCCGGCTTAGTCGGTTTAGATTCAGCGTCATTGCCGTCATGACGCGTCATAAATATCTTGGATCGCGGCCAGTCAAAAAGCGGTGTTCGCATCTGGGTTGTTGTTCCCTGAGCCCGGTCCTGTTGTTGGCGTTTGCGGTCATGCATTCAGGGACGTCAGTGAGTGGGCTTTCTGTTCGTTTCATCATTACCATTAAACCGCCTTTGGCTTGCAGCAGCGTTCAACGTTAGTTTATTGCATCCTGAGCTGCATTATCCCCCTTTCTCGTTTGTCCGCATCCTCAAGCGCGACCTATGAAGCTATCTTCTGCACGTTGCCGATTTTGCACTTGCCACTTCCGCCTCTTCCAGAAGGCAGAAGTTCCAGGAAGCCTCTTCGGTCGTGGAGCCGTTGACGCACTCCCCGCCGCCCGTATTTTGCTTGCCCGGCGGAAGGAGGCTCCGTTCCGCCTTAGTTTCAATACCTTAGGATTCGTCTCGACGTTTTGCCTGGCATGAATTTCTTGCCGCCCGTCATGCCGAGGAAGCTGCACGACCGGCAGGTGATCGCGTTCGTTTCTGATGATTTGCTGCCTCTTTGAGGCCACCGATCTCGTGCTGAAGTGGCGGCGCTCGGTACGCTTTCTATTGGCTTGGAGGCAGACGTCCAAGCTGTCTTTGACCTGCAGCATTCGTTCTGACGTTTCGCCAGCGGCACTGAGCCCGTTTTACAACTCTGCGATGCGGCAATTTTTCTATTCATTAGCCTTTGCTGATCCGCTTCCGCCCGGGTCGACCTCGCTCCGGGTTGAACGTGCAGCGTGGAGGGGAATTGGAAGCGGCTGTCGCTAGAGAGCCTCCGAGCTCCTTTCGGCTCCTGGCATCGCCGATGATTTCTTCGCGTCGTCCCGTACTCTGTTACGCCCCCGACGGTCACGGGGCGCCTATTCCACCATCAGTTCAGACGACGCAGCACCTCCATCGATGGCATCCTCCGTCATGGCACAGAAATCATTCAGCGTCCCCCGTTGAATCTTCATACGATCATCTTTGCAGTTCGAGTGGTGGAGCGTACGATTTCATCATCCACATCGTACTGACCGTACTCCACATCCATGCTTAACGCCCGGCTTCATCCGGATTCTCTGAGCCCACCGTGTTCACCACCACGGTGTATGTTACGTCGGCTTTCATCATATGAATCGGTGCATTCTGTACCGTTTTCCTGTTACGTCTTTCAGACTCCAATGGCGGTTACTGCTAATCCACAAAGGCCGGTTCCGGCGGGCTGCTAACTTGTTACCTGGCTAATCAGAATTATAACCGAACTCCCAACGATGAATCCGTCAGTACGCCGGGAGCCGGAGCCGGGAGGCAGGAAGAAGACGACGGTCGGATCCTTCCTTATCTCCTGCGTATAGAGCGCATCACTCTTGGCAGGTCGAGCTTTCGTCTATATCCCGGTTATACTTCCTTTTACGGTAACCGCTAGAGTAATTTCAGGTCAATACGTGAATCGTGAGCCCCAGCGTATGTACGCACGTAAGCGCTGATTACCATAGTCGTAACCTTGTGAAGGGCTCCGATTTACATCTAACGACGTCGCAGGCTCGGGTGAAACGTATCCTCCCCGGGTCATCACTGTGCTGCTCTTTTCGACGCGGCGAACCGAGGGAAGCCCAATAGCCCCACATGTCCGTTCATAACGGTACTTCACGTTAATCCCTTTCAGATGACTCACGTATCCCCCGCCGACAACGACGGATTACCCATTTTCATTGAATAGCCCACCGTAAACGTACGTTAGCTTCGTCGCACGGGCTGCTTCTCCGTCGCCGCAAATCAAGAAGAAGGAAGGATACAGAAGCCCTATGTTTCGTACTCTAGTAGATAACGCCGTTCCCGGGACGACCCTCTGTAACACATGCCAATACGGTTGCCCGCCCTGTTCTTAATCACCATAACCTGCACATCATGGCAAACGTATACCCGAATATCTGCCGAATCCGTGTAACTTAAGGGTACGTCAAGGATCACGTTCCCCATGACCCGTGCAGTAACAATACGAAATAGCTGTACCGCCTCGTTCAGCGCCATCATAATCACCGCACCGTTCATCAGTACTTTCAGATAACACATCGAATACGTTGTCCTGCCGTGCTGACATGACACGTTAGCCTCATAGAAACGTCAGCGAAGCACTATCTTATCGATCAAAGGATGGTATGGGTCACGTGACAGTACGGGTATAGGTCGAACCGTTCATACCCCAAGCGCTCTCACCCGCCTTCCATTCCCTGTCCCCGACGATTTTCCGGAAGGAATAGCGAAGGAAGTATGGCAGCTATGGTCACGTAACTAGCGTTAGAGTCGCATTCACTGCCACTGATATCCGCATTTTAGCGTCAGGTTCCGTCGGTGTTAGAAAGGCCTAGAGAGATTGCCGCCGGCTGGTAATGGCGTCACATAGGAGCCAGTTAGAATACGTCGTTCATGAATATCTGGTCCCTGCGCCACAAACATCGGCGTTCATTCCCCGTTGCCGTATAATAAATGCGATACGATTGGCGGCGATGAAGCAAGACTGGCTCAGTTTGCTTCCTCCGTCTCCATGCCGGCTGATACCGAGACATAATGTTTGCCTTTATTTGGTCTGCTCAATTTGACAGCCAAGATGAATTCCACTTATCACTGGCATCCTTCCACTCTTTCGAACTCCTCAGTCTATGGCGTTATCCTCCGTCAGCTCGACTTTCCCCTTCCTCTCCTTCCGCAGTGAATTCGTTATCTTTAATTTTCGATCCAATGCTTCGCCGAATGAATGGAGAAGGAAGCCGATTTGCCAAACGGTTCACTTAGATATAAAGTAATAATCATGGCCGGTTGATATTGATACTGGCGGCTGGTGAGAGGTCGCCGTACCAATACCGCGTGCTGGTTTCACTGTCTGATATCCGCAATCTGCTTTCTAGAACCAGAACTCAAACTGTACCGTCCGTATAAACGGCATAATCCGGCGTCGTGTATGAAGTCCGATATAGAGCCGTCACTCAATCCTCGACGTGCTGCCGTCGGGCAATCGAACGATGACTAAGCGTGAGCTGCTGCGTACCACGCATTTACCGCCGTAACTGTCATGATCGTTCCCAGCGCCAGTCCGTGAATGTATGTGGTTTCGTCGTCCATCCGTTGAACCCGCTAAGCCTATGCTTCTTCGCTGTTGGCTTCCTCCGGAGTCTCCGCTTCGATCATTGTGTCCCAAGCCAGCACCGATATTCCCGCTGTCGCAGGATTCCCGGGGAGAAGAGGGAGAGGAGCTGCAGGCCGTGACACATTCGTACCGTGCCACTCTGTTCGCCGTCAAACCCCCGTTATCCACGATGGCCTCTTCCTACATTGATGCACGGCGGTGAATGGCATCACGTGCCGTCGTTCTCACGATACTCACGCAGCGGAAGTCGCTGACGGCGCCGTCGCATTCAGGCCTCCCCATACGTATTCAGCACCGTCAGAACAATTTTACGTCACGCCGTCGTGACGACCTGACCTCCCACGCTGACCGGATTGCCACTTCCGTCAACCAGGCTTAGCTAAGTCGGGGTAAGGAGGATGGCAGCGTACTTCCGCTTCGCTTCGCGGCTTCCAGTTGGCGTTCAAGGCACGACCACCGGTTGGTACCGGGCATAGTCATCATCGCAAGATTTCATCAATAAAGCCCATGTACATGGGCGTTGACTGCTCCGCACTATGAAATCACGGTCTGCGTTCCCGTTCTTTTAATGTATCAACAGGAGAAGCGCCTGGAGGGAAGGGTACAGCCAACGAATGCATCCATCGTGAAGTAGTACGTAACGGGCAAACCTGCCGTATCTTCAACACGCTCTGTCGCCGTCTCCCATCCGTTGTTCGGGTCAATCCAGCAGTTCAAAACGGCATTGAGGCGAGTGCTTCAGGCGCTGAAGCTGTAACGAGCGCCGATCCGGGATACTACAATGCGTTACTTGGTATAGTCCTAAGTCTTATCCGACGTCATTTATGCACGACCGAACGTTATGCCCGTTCTAACAGGCATAAGCGCATGCCTAAGCAGTTCCCTCCTAATTCTCCGCCGTATAGATCTAACTACAGTCCCTATCCGGCTCCGTCCGCCAAAGCGTCCGGCGGACTTTACCGCAGTACTCGATCATGACACAGCGCCATTTATGCACATCCGCCGCAGCACGAGCTTTCCCCATCCGCTCCCAATGGGTCAGCATGCTCAAGACAGGCCTGTTGTCATCCGGTTTAAACGTTCCGTCCCAATACCGCCTGTATTGCCGCTGAGGTCTGCGTGACGGTCCGAGAAGAAAGAAGCCCTTAAGTGATTATCCATGCTGATGAAGCTCCGAGTCGCCCTGCACCCCATGGATTGCCGTGTTCGGCTACTGTTCAAGTAAGTATTTCAGTGGACCAAGAGCGTTTGTTCCTGCAGGTATATTCTGCTTCCGCTTCATCCGCGTAGGATATTAAACGGGGCGGCGGCTTACCCAGGCCGATCGATCAGATACTGCAGGTGGTTTGGCTATTAATGGTGGTCTTTTCGTCACCCAGCCACCGTTACGTTGTATGAACCAGCAGGCGACTTCAGGACGGATTCCTTTACCCTTTGAGGTGGTTTCACAGTCCGTACCCGAAGGTAAAGGCGCATACGTTAGATGTTTGCAGACGTAATGGTGCTGGTATACCGTGTCATATTTCACTTCCGTACCCAGCACCGTCGTCCATCAGGGTCACGGAATCCCTAGAGTCCCCTTGAGCCAGCCCGGAAAGGAGAAGAACAAGGATATGTTGGTATTCCCTCATGTGTTTAAAGCCGGCGTACTGTTCGCACGCTTTCAAGCCATCCGGACTTTGCCTTAACCGTGTCGCTGATGGCATCACGATCACTCCTCGATATTCCGTGACTTCCTCGCCTTGTCCTTCGATCTAGCGGGGGTCCCCTTACTGCTTCCTTTACCATTCCTCACTCCATAAATGACAAATCGACGCAGGCGGTTGCATAAAACATTTTACATCAGCGACCAATCACCACATGATCACCGTCGCTTCGTCTGCCGTTGATCTCCCTGAGAACCACGTGACTCCACGCATTTCCCCCGTCAGAACAGGCAGAACATTGCTGCTGGCAACCATGTTATCCAGTAAGAATAGGTCTGCTTACCGTTATCCGTTTGTATACGACGCGAGAGTTATGGGGTTTCGGTGCCATCTTGAGCGCCACCAAGCTACCAGCATACAGGCAGAGAACAGGATCAGGTCATACCGCCTCCAAGTGGCCTGCCCCGCATGCGTCCATCCGAGAAGAAGAAAGCAGGGATGGAGGCAGCCCCAAATTAGAATACGCCTTATTGGCCCGGCGACTCTGGAACTCCAATATGAATTACAGCGCCATCAGGCAAGTCTCATGACTTTCTCGGTTCCAGATTCACTCCTTCCCACAATCCCGTACGTGATACCAGCCGTCTGAGTTTCTTGAAACGAACGATGTGTATTATGAGGGCGCTTCGATGAGCTTCAGCCCCGTTGGATTACCAGGTCAATTGCTACGATAAATCGTTGTAATCCCGTAAAGCAGATCCCCCTGCAGCCGTGACGGCTAGGATGTGTGCGTCGATCCGCCATTTGTTACTATCCTCGTTTGCTCAGTTGTTCAGAATATGGTGCAGCATAGCCGTCGCCGCATAAACCTTGCGGCGTCACTCGTCGCACTGAACCAAAACAGCAAGGCACATCGCCGAGCTGTTAGGAAGAAGCGGCCAAGTGCTTATCTCAGACCCCAGATTCTGGCCGTTACGCCACCAGTCATCCTCACGATGAAAGTCGGCATCTCAATCCCCGATGATAAGCATCCGAACAGTGTGACAGTCCGTCACCGTGCTCAAAGCGCCATCAGCCGGTCTCGGCTTCCAGGCGCCAGGCTGTGAATCGTCCCCGGCAGACAGCCACGGCAATCATCGGCCCTGCAGCCGCCGTGAGGCTCACTCATGAGGGGGACCACCGGGTAGGTCGTGAAGCACCACAATCTCACTGCATTTCTGCCTTAATCAGTCTTCCGGCGACATACGGAAATACGCCTCCGGCTCACCGGAGATTCACGCAGGGAATATCTTTCGCCTCCGGGCGTGCTTACACCGAAGCCCCTCAACTAAAACGCGCTGACACGCCGTGCAGGAGAAGGGTCGATTCGTCTGTCATGGGATTTACTGGAAATATAGAGAAGGAAGGAAACGTTCCAACTTTAAGTTTAGTTATAGTCT * tp:A:P cm:i:35 s1:i:301 s2:i:0 NM:i:2893 ms:i:740 AS:i:684 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
50 46 16 utg000001l 17739 60 604S522M25D12M3I15M1D5M9I4M1D7M2I4M2D18M1I3M6I15M1D4M1D3M1D3M2D2M1I7M1I2M6D10M1I2M1I8M1I6M3I17M2I7M3I5M1I3M2D1M1I16M1I8M2I11M1I1M2D7M4D7M1I3M3I4M2I7M1D7M3I2M1D7M4D8M1I7M2I6M1I5M1I2M1D7M1I37M2D19M2I11M3I6M2I2M2I1M1I13M1I3M3I3M1I1M1I5M3I9M2D7M3I1M1D4M1D2M2I8M3I4M3D8M1D12M1I2M1I14M1I4M3I1M1I4M2I5M4I1M2I3M1D12M1I7M1D4M1I12M1I4M1D11M1D8M2D23M3D1M1D2M1I17M1I2M1I4M6I1M1I4M1I19M1D5M2I17M3D7M1I4M6I4M2I8M3D4M6I18M1D2M1I3M3I8M7D3M2D6M3I12M2D14M1D3M1I1M2I20M1D7M1I4M2D2M2I4M2I10M2I4M5I8M5D5M1I21M1I16M1D11M1D25M1I6M1I4M2D7M2D9M1I9M11D2M1D10M5D19M3D7M1D1M1D8M3D1M4D2M1I2M1D3M3D3M1D1M1D18M2D1M1D6M3I3M6I6M3D9M1D7M4D9M1D2M6D1M1D13M9D2M1D5M2D6M2D5M2D3M3D2M1D6M1I20M1I1M1I3M2I6M1D3M1I3M1D3M1I1M2D8M3I11M1D1M3D6M4D1M1D10M1D3M1I2M2D24M1I7M1D8M1I6M2I4M2I20M1I1M1I16M6I6M2I11M1D8M1I3M5I9M1D2M2I6M1I3M2D6M3I10M1I4M1D7M1I2M1D5M3I4M1D8M1I2M1D4M2D10M2I5M3D10M2I7M1D6M1D3M4D5M3D11M1D28M1D11M1D1M1D4M1D4M3D7M1D17M1I5M1D15M2I13M6D15M2I4M1I2M2D14M1D6M1I32M2D4M8D18M1D4M1D4M2I6M2I2M2I6M7I14M1I1M2I2M2D5M2I11M2D5M2I1M2I6M4I2M1I3M1I4M1D2M1D2M2D3M2D24M3I11M1D9M2I7M5D2M2D9M1D2M2D6M1I2M1D3M1D4M3D11M1D7M1I6M2I12M2I2M1I3M1D4M1D4M1I7M1D6M4I2M2I5M1D3M2D2M1D3M1D2M1D6M7D3M1I7M3I9M4I1M1D2M1D5M1D3M1I5M4I3M1D9M4I7M3I10M1I18M5D3M1D2M1I6M1I3M4I3M1I5M4I10M3D4M1D13M2D2M2I4M1D1M2I4M4I11M1D9M1I2M2I2M1D3M1D2M2I1M1I3M2I5M4I1M1I14M7I9M1D4M4D13M1D12M1D3M2D1M2D3M2D5M1I7M1I2M1I4M2D1M1D2M1I10M3D3M3D6M1I7M5I6M1I5M1I9M3I8M1I2M1D9M1I6M2I4M3D2M2D3M2D5M1I2M1D6M2I8M1I18M1D6M2D11M3D9M2I1M1I4M1I12M3D4M1I15M1I4M1I5M1D4M2D2M2D6M1I11M1I5M4D5M2D2M1I9M1D18M1D5M1D12M2D6M2D21M2I1M1D21M1D11M1I5M4D2M1D19M1D26M1D5M1I10M2D1M4D1M8D3M1D20M9D9M1D8M2D8M1D7M1D3M1D3M3I7M2I15M2D10M2D3M1I3M1I8M2D5M4D7M1D7M3D3M2I3M1I12M2I4M1I4M3I8M3D30M2D3M1D9M1D1M2I6M2I6M4D15M1D13M2I24M1I1M2D13M2I1M1D9M2D4M1D8M1I8M2I4M1I5M1I10M1D15M1I1M1I8M10D1M1D3M1I3M1I5M3I24M6I4M6D1M1D5M4D6M3I2M2I18M1D3M1I14M1I8M3D1M1D4M3I4M1I9M1D32M2D1M2D6M3D7M4D5M2D12M3D4M1D11M1D7M1D15M2D7M2D14M1I3M1D1M3D11M1I9M1D11M1I3M1D3M3D7M1D11M4D12M1D5M1I7M2D12M1I4M1I2M1I7M1D6M1I4M2D12M2D13M5D12M2I3M2D1M2D4M2I6M2D14M1D2M3I3M1D7M2D14M1I9M3D7M2I15M2D1M1D4M2D8M3D2M2I4M1D4M1D16M2D9M1D5M3D22M1D6M2I2M1D4M4I22M2D14M1I2M1D3M1D4M2D27M6D10M1I6M1I12M2D9M2D6M3I18M1D12M5892S * 0 0 AGATATCCGCTTAGCTCGTCCAAATGGAAGGAGCGAGCATCTTAGATATAGAAAGACGACAGAATTTCATACGTTTGAGGCATGGGTGGTTCCAACAGCTGGAAAGTTGGGCTTAGAAATAAGAATCAGATGTACAAACCAGGCTACTTAACTGAACTTCACCTTCTGACCGGCTTCGAGGCTATCGCTGGCTTATTTGGCTAGAATCAATTTAGACGGTCGAAGCAATTTTGTTGGCAGCAAAACTCCGCTCGCACCGACTCGCAAGAGCGATCAGGCTTAATTCGAATAAAGCCAAGTACTTCTGTTACAGAAAATGTGGAGCACATGCTATCGAGGCGGAGATCGAAGAGAAGCACAGCATCGTGGTTAAGAACGGTAAAGGGGCCGCGACTCGACTAGATTCTACGATTGACGCTCGTCGGAATCGGCAGGCTAACGGGGCAGGCGCATAACGATGAACAGCGAAGAAACCGATGACAAACTCAGGGAGTATCATGTCTGCGCTTGTTCCACTCAGCAGGAGGGATAACACGTGTCCGTACGCATGAAATTTAGTAATGCAAGGTTTGACTGATCAGAAAGTGACAATAAAGTCATTTAGTAACACAGCAATAAAATTCGCCTCCCTGTTTGACATACCAGGCTTGATGGGTCCTGTTGGCTAGCGACCCGGCTCATGAACCAAATAAACAAAGAAGACGCGCGAGCTGTTATTATGTCTAGTTTGACTGTGCAAGTCTCAGGCTAATTGGGACGTTATCAACAGTAGCTCCGACGCTGGCAAAGGCCGGCCGCACTCGCCGCGATCTCGGGCAAGCCGACAGCAGCCACTGATGACAGACTGTGATTAAACTAATCTGCGGTCCCAACGGCCAACATACGCAGCGCCGGACGCTTGTTAAGTCAGAACGGGAAAGAAACCAGCAAGATATCAACGGTAATCAGGAGAACGGTCCAGATATCGGGAAGTAATATCTAGCTAGAAAACTGCGTGCGTAGGCTAGAACAGGCAAAGTAAATTGAACTATACGGAGGTTTGACAGCTTTGGGCATTGTATAAGCGATGGGACCTGGAAAGGCAAATGACTAGAAGACCGACCATGCCTCGTAGCTGGAGTTCTTAAAGATTCCTGGTGAGGACCCAAGGTACTGGACCGGCGATCTTACGAAGGTTGCTGACCAGTACGGAATAAGCGGTGTTAGACTGGAGGCAAGTAATACTACGCAAGCTCTAGATGCGGAGCGGAGATTTCTGCAGTGTAGAACAGGCTACTCTCCATCGTACGCGGCCTCAATTAGCCCGTGCGCGATCGCATATCAACAGGAGTGAGATCGTTTGTATAAAAAGGAGATAACGCTTAGAAATGCTGAATTCGCCGTCTCCTTCGGTTCACAGGCTGCCAGAGGTCTGTAGTGATGATGACCGTACTCCAAACATCGGATATCTGTTTATATGTACTGTTTCTTTACATAAACCTTGCTGATACCGTTTATGAAACCACCATTGCAAGGGAATTTATAAATGGTCAGTAACCTGAGTTAGAGTCTGAGCAAATACGCGTATTACATCTGTAGCAGTCCTGTTTGTCGCTCGGTATGCACGGTACGAAGGGCTTTATCATGAAGGCTAGATAGAGTCGGCATACAAATATTCGATGAAAGAGTTATTATACAAGTCTAATGAAGACAAATCCCCATTCGCGCAATGGCGAGAAATGACTCATACCGTGCAAATTATCACGAGTGTACGGAAACGATACTTGCTTGGGGACCTAGGCTCATTAGACCCAATATTACATAAATGCTCGCACTCGCGGGATTCCGTTTATCTGAACCCTAAGCGGGTTTGTTTATGGAGCTAGCTGTCAGACGGATTTCCGAGTACAGGAGAATGACGCGGGAGCCATTCAACAGTATTATCGAAGCGGAGAAACCAACGACTAGACCACTGGATGATAGCGCCGATACTACAGCACAGGGACGTAAGATATTCGAATCAAGAACTGAAAGACAGGAGCTCCGCCTGATGGCTTTTTCTGGATTTGCGTAAGAGACTTTGCGATGTACTGACACTTCAGGAGTGGAACGCACGACGCCAGCGACGTCACGAAGCCTTGAAACACTTGTCGATGCCACCGGGAATGCAGGATATTCCCACTCCGGTTTACGAATATCTGTTCTAACGACAGGTAAAGTGATTGACGTACCAATAACATTTATGTACGAGGAATGGGAAGAAGGCGAAGAGAGCTCGTACGGGCACTAGAAACAAGCCACTCACTTTAAGCCAAGGACGGGTAAAGAGTTTGGATTAGGCAGAGACAGGATCGCACTGAAGCTCACAGGCCAACATTGAGTATTTGCTCAGACACAACAAGCGCTCAACTATAATCAACAGGAGTAATAATTCCGTTACGAGGATGCCTGCTCATGCCGTACTGATGAAAATGGGTACTAACGCAGAAGACACTCATAAATTACATGAGCCGAAATTAAAGCAATAAGGAGGCGAATTCTGCCTGATGGATGGACGACGCACAAGGAACAAAGAAATGCGGCAAGTGCTGACTCATACAGAGACGAGGGCAATTGCCTATACTCAAGTTAATCAGATCAACACTGAGCGTGATGCATTCCGAGCAATAGCTGCACCGCTACTAACAACCATGTCCCTGCGATGCTTACAAATAGTAAGGGATGACTAAGGAAGAAGCTTTGAAAAATTATCAAGCAGCAGAATAGAGTTGTTGGCTAATGGCACGGACTGTCTTTGGTGATGTGACGAGTATGTGATTATGCGAAATGAAGGCTGGTTGGTATGGTCACTTATGTCTGTTAACAGCACAAAAACAGGCGTAAATTCAGCCAACAGCATTGCATATTACTTGTGCCACTAATGAATTAAAACATTGATAAATGCAAAGAGATTCTTGGCGGAGGACATCATAATTGCATCAGCCTTACTCGTCGCGCGAAGCGTTTGACCAGTACGAGCGGCACGAACGTATTTATACTATCAGGAGCTGGCCGCGCGCCGCCTCGAACGACGGCAAGTGCCTACTTTCACGAGTCCCATTTGTTGCTGCAAGATGACTCCTGAAGCAGATGATGGTAACATGGGCATAAGTCGGACACCGATGGCATCAATACGGTATCGGAGGAATACAGAGCAGCGACTAGACAAATTGAAAGGTTAAATAATAGCATGTGACTGTTTATACCGTTGCTTAACAAATTGATAATCGCAATGCGTTGGTAATGCCAACTTAGGTATAAAAAGCAGTGAACGGCGAGAAACGTAAAATGATAAATATCAATATTAATCGTCATGCAGCAAAACACAGACTAAGATAATACTGTAAACAAATATGCAGTCATTTAGCTGAATCAACTATGGCTTAGATGTGATCTGTAAATACTATCCACGGTTCGATGCCCGCAGGGACATCATTTGTCTTCTTGCGCTAATTTGTCATCAAACTGTCTTAAGTGAAGCACAACGGCGCCAAGCCGCTAGCAAATGTCTTGTACTACATAAGATCTGCATAACCAAGACCAGTGGATGTCACTATCAACGACTGAAGCATGACTTCTTCGCGCCTCCTCAGATTCCCCACACCCAGCATCTGCACTGTTCCGCCAGACTGTAGTAGGGGCCCAGGGAGCGGAATAAAGTGTAAAAATGTAGAAAGTCGTTATCTATCGGCTGCTTAGGTACTTGAAACGCTTCGAGACGCCTGAAGAAGTCTAATTCATTGGCGACTATATGCCATTAATGACTGTTATCGTATGTAGAACGATGCATACGGACATGAATAACAGGCCGTTGTCAAAGGAAGGAAAGCAACCCGGAAAACTAATACGATTAGAGTTAAGTTCAATACTACTAATTAGATGGAACGTATCTATCACCCAGTAACTTAAAGAGCATTCTGTGTTGCCGCCAAATAAATTCTATTGCTTTAATAAATGATGTAGCGGTTGGCTATAGAAAGTAGTGCTTCTGCAGTAGAAATAATGATTTCGATAGATGGTTGTTGGAAGCTGACTATTCCTTTGTCAAGACTTTATTACCTGTTCTTTGATGATTAGAAAATGGGTATCGATGGACTATAAATTAGATGTGGCTCTTACAAAGACAGAAGGATGTCACTGTCTGTTTAAGGTGTAGACGCGAGAGATCCCTGAAAGCCTTATTCTTCCTTAGAAAGCATTGACTATTTACTTCATCCAAGGACCGATTGACCTCTATATGAACACAGATTGCGGAAGCTATCGTAGGATCTAGCTATGTCAAATCTAATTGGAGGTCTAACCATTGAAAATGAAAGCGTCCTTAACACCTCAGTGTACTTAGATTCGAGAACAGCCAGCTTAAACAGTTCGCACGTGTTAAATGTACCTCGTTTAATTGTCATTGATTTCCATTTTCATTTAATAGAAAAATGTCCCCGGATTCAGTGATTTTAACTATACGTCCCTGACGGGTCGATTCCTGCCACCAAAGAACATTCATGCTTTAGTCTCCTTAAATCCTGGTAAACAAATTTGAATGGAATGATTGGTGCAATCACACCCAGAAACAATGAATATTTTCTGAAAATAATAGACTTATCGGAGCAATCCCAAAGGCCATATTTTCGATCGCTTGTTCTCATGCCCGTGCATTGATCCTTTATTCTAACAAACAGCATACGGCTAAATAGGTAATATTTGCTGTCTACTCGATTCAGACTGCCTGCCAGCAATAGTTTAAAGTACTCAGCGCGGTTTGCCTTCTAATCCCATTGCTAATATTATGAGCGCTTATAGATATAGAAAGACAACTGGCTTGAAGCTAGCCAAAATTACGTGATGAAAACTTTTCAAATATGGAAGCCAGCCTCACTGGGAAGGAAGTTAAGACGTAATGGACTCAAGATTCAAGTGGACGATGATAAATTCACTAAATTGTCTGTAACATATTAGCGAGAAATAGTGCTTCGAATGAGCTGGGACATGCAATCTGTTACCTATCACAAGATTAGTAGATGTCGTTGGCGAACAGGTTTTACTATTCAGTCCAACAGGAGCTTCATCTGCATGTCAGGACCTTTGCTCTCTGCTTTACGAACATTAAGGCAGCCTGTTTAACGCACACGGGCTGACCACGCACTCATTCCAGTACTGCAAGGTTCAAAAGACGCCCGGAACCTGATTAAGAGAAGCAAGCTTATGTGCGTATTGGATCCTGTCAAGAAACTGGCCTTATCCGTGATAATTCCGGTGAGCTGTGCTATTGAAAGTGACAAATTCTGGATACCACTATCATCGCAGGTCGTTGATCGTTACCTTCTTATGAACCGCGAAATTTACGGTCACTAGATCTAACAGTAGGACCGTTCAAAGCGATGATAATGACAGAGAAGGTAAAGTACAATGAACACGCTCTCCTCAGCGACGTGTCGAAATGCTCTAATAAATGCTCGAAGGGTATGATGCAGATAAATGTTAGAAATAATTTCAGTAGGTACTTCCCCACTTTTGCAGAACAAAGAGGAACTAAGCTGACGACAGAGTAGCTACAGACAGTATAATTAACACTTCTACGGCAACTTAGTAGTTGGTACTGAAAGGTTAAATTAGAAGAAAAGTGTCGAAATAATCTCCGAGATAAAACAACCTGAACATACCATAGACTGCTTGTTTCATCATCAAAAGGGTTGGCGGTTTTAACCAACAAAAATATTATACGTTTTCTTCTATTGCAAGTGTAACCTGCGGAGTTTCCTTAATTTAGTTCCTCATCGTGCTTTGTCACGCCTCGCAAGTGGGAGAGAAAGTACATTTTCGCAGAGCCATGGCGATACACCAAGCGATCGTTCCCTATAAGTGACACGGGACATTTTTCGTGAGCAGCAATGGCTATGCAAATTGCCCCTAGAATCGGCCTGCTATCTAGTATGTTGAATGCCCGGCGAACTGGAGGCAGGAAGACAACACAGCTCTTCATCTCAATGTTAAACAGTGCTAACAGGTATCGGCTTGTTTGGAGGCAGGGAAGCACTTGAGTGAAGTGATTACTGTAAAGAATATTTCTTTCGTAACAGTAAGGACGTTCGGTTCAAATGCACCAGCCCAATGTCAGAACTTATTGAAGCAAATCTGAATCTATTATACGTGGCATGACTTCCCAAGCTTATTGGACGAGTGTATTTGCCTAGGCAAACTCGGAAGATTTCCAGTCGATCTAGAATCATGAAAGATAGAAAATTACGACGCTGTCTATCGGAAGTAAGAACGAAGTCTATGCGCGAGCTTACTTACAAAGTGCTAGTAACTTGCCTAACCAATTCCTAGCAGTAATCATTGGCAACAGGCATGCAGCGAGAAGGACGTTTGTAATGTTCACGATCGGCACAGCGGTAATAAGTCAGCAGGCCTGTGGCGTAGAGGGCCAAATCGTGTGGCTCATGTGCACAAAATAGGTAAAATCGCTAATCGGAAATCATTCAACAGCACTATCGGAAGTTCATGCCGCCAGCTAGCAGCACGTCTCTGCATCATCAGACAGCTGTCTGGGTCTCTATAAATTTATGATATGATACACGAGACTGGCATCGACTAATAATAATATTAAAAATTTCCTGTGACTAATCTATATGTTTCGATAAGAATGATGCACAAAGATCAAACAACTTGTATAGAAAGTGACATTACTAAATTGATAGACTTAGTCCATCTTAAACCATATTTGTACTGATGGCAATTATTTCAAAATGGAGTCGTTAACTAAACCAGCGGAAAGAAGACCTGACCACCCTTTATCTGCACTAGACCAGGACGGAACGTTTGGTCCATCTACCTGAATGTTGCCTTGACCTGAAGTACACTCCGGGAAGCAAGAACAGTACCAACATTATTATCAACAAAACCAGATTAGATAGCGACACTTGGTAACACCGAGGCTAGAAAAACAGCGAAATGATCCAGGAGGAGCTAATGGCTTGTTATGTTAAAATCCTGCAAGATAGAACATGTCAGCGAAAGGAGGCGTAAAGCTATCGCCTCATTGAAGAAAGGATTTATTACAAATGAAAGCTGTTAAACATTGGTATAAAAATCGTAGACTTGCACAAAGAAATTACCTTCGGTTATTAACTGAATCATTAGCTTATTAAATGAGAAAGACGATGGGATCCGCTAATACCTAATAAAAGATTACGAATTATTACATGCCTTAGCTATAATCTATGGCAGAATGTATAACTGCTGTAACTGCTCGAAATACAAAATAAACTCAAGTGCGACGATGTGATTTCAACATCATTCGACTCTTGGTGAAGCCAGGAGAAGATAATTAAAATTAAAGATAATTACTCACTAAGCAAATTGTTGCTTTAGCGGTTTGATGATACAATATGACAATAAAATAATTCGAAGTATTAAAGAGGGTCTAAACTCGGTAGATAAGCCTAAAATATACTCGGACAGAAGAGTAGTGACTATACGAGACCTAAGAACGATTGCGGAATAACGAGTAATGCAAACATCTGATTGGCTAATTCATCAATTGATTAAGGATAAGATTTGAAGATTAAGATAAATATATTTTGGCGTTGCTCGCATGACACCAGCCAAATAACAAATGCCTATGGCTTCATTTGATAGAGTGGCTCAGAAAAGGACTCATTACTCCAATAAACCAATACATACAATGCCAATTATAGATGAAAGACGACTTCAGGTAATCGACCTGATTCAAATAATAATCAAATGTATTTCATGGAACAACGTAGAGAACGAAGAAAATGACCTAGAAATATACTCAACAGGACTCAAAACATGACGAAAAACCATATTTCGTTCGGCTAGTCTCAAAGCAATCGCGGTGATGTAAACACTATGAACATTGAGTCATAGAACTTCCATTATTCCCTGAAGATAATCGCCAACAGACATAATACCAGCTGACCAGCTTTACACATACTATAACACTAACCGCAGAACGTTATTTCAACCCAACGTTTCTTACAGAGCATACAAACGATAGCCGCCAACAGGGACAGCAGGCTCGATTACTTACAGCTTGAGAGTATCAACTAAGCTTCAAACATAGCGATACTTCTTCCAGCGCTTCCAGCACGCGAGGATTTCTTCCTTCGTTGCAATTCCCATCTGCACTCCGAAGGGCGCAAATAGCCCTCACTGGCTATGCATCAGCTTTGTTTCTTCGCCTCCTAGACCCCTACATCCAAAGAGCTTTTCTGCTGCTTCGGCTTCATCCTCGTCCCAGGCTGTCGCGTTCCACTTCTACTCCCCCGGCGCGGTGACCAGGCACGCTTTCGGCGACGTAAATGGTTCAGAAAATAAATAACGCGTCGGACCACAGTTATAGACCGCGATGTGCCCCTTACTGTTGCAAACGAGCCCCTAATCACGATGCGCCGTCAGTACTGAGTGAAATATCTACAACGTATTTGCCGGAAGAGTCTGGCGCACAATATCGTACCCTGTTTCACGTAAATGAGCCCTGACCTCGTTTGATAATTCCATCGGTGCCATAAGATTATAAATTTATTGGTTGTTCACTCATTCTGAATGCCATTATGCACAGCCTCACAATAGTTAAATGCATGCAATGGCTTTGACCGGGCTTCTGTCCGCACCGTAACGGTGATGTGGTGTGTCCCTGTTGAACCAATACTGAAAGAATGGGCATGCTACAAGGGCCGATAACAACTGATTCAGGCTTAATAACGGTGCCCGGGGTACTGATGACTCGGCGCCTGTACCGGACGTGACGCCTGCTCCGACTGTCGTTTCGATAAATAAGCAAGTTGTGTCCTGGTTGTTCATTCTAACTGTGGATAAACTTCCTCCTGTAATGGTTCGATTGGAGTACTGTTCACGCCGGAGAACTGTTCATCCTTAACCACCGGCAGCTCACGCGCTCGCCTGTTGAACGCTGACTGGGCTAAGCTCGAGTTGCGTTGGGGCGATTTGTTCGTCCGTAATCGGCAAAATCGCCTGTCTATTCGGTGGTAAGCCAACGACGTCCCTGATGCGGCGCCTGAATCGAGACTTGTAATGTTGCACTGTAATTCACGATCGGCTGTCCATGGCTAAGCGCACCGCCCGCTTCCTTGTCTGAGACACAAGCAGCAAGAAGTTGGTGCTTCCCTCCGCGCTTCCTCCCTTACGGTGCTGCACTACTAAAGCACAGTAGCCCCGGATACGCGAGACAGCAAGTCTGGGCCGCAGGGAACGAACTCGCCTCTTTAAGGAGGACTATAACGGACGAGCACCTTCGGCTGAGCTCTCAGAATTCAGAATCTCTACTTAGATCGACGAAATGAATTCGTAAGGTCGGATTTATTTCCTAAACATTTGCAACGGATTATCGCCAGAAGTTCCTTCCCTCAAGTCCTGGTATGGCTACTGTTGGCGGTGCATCATCTTCGGCAAAGATTCAGGATTAGTCGGTCGTGAACGGTTTCATTCATGCGTCATAGCATCCTGCGAGTCGTTGTTACCCAGCCGAGGCCCTAACATGCTTATCATCTGTGTCCGTCGTAACAATTGGGATTAATTCCCGTCTCGCGGTTTCTGATACGGCTGTTTACTCTTCATGTCCTTACGGTGACCTAGCTTAACAGAACGTTGCAAGTGCGTTACAAAGACTTCTGAATGTGTTCGCAATTGCTATTGGGCTAGCTTCCCCGTTGGTGCCCTTATCGGGGCCGCGGATGGCAAGCCTATCTATCTTCTTAGTTGCCGGTTCATTAATTAACTGCATCCTGAGCCCTCGCTGGTTCACCGCTAGACTTAGCCTTTAATCGCTGCTCAGCATTACTCCCCGCCTGTTTGCATTCAATGTGACAGCTGAAGGCTGCACGTCCGCCCTCAACCTGGACGATGCCCCGCTCGAGTCTGCCGCACCCCCGCGGAGCCTGATAAGCACTCCCACTTGCGTGCCTTTCTTTCGCTCATCCCGTTATTCCATTCCGAGCGCCGCACTCGCTTAGCTCTGCTCGCTTCGAGGCAGTATCTCGCTTCGCTCTTGTTCCTACCGATTGTGCATTCTATCGGACGGGATAGCCCCGCGTTTTGCTGGCAGGTAACGGGGCTGCGAGGCATTGCACGAAGGCACTGTTTACTCGGTTCGCGAATCTCGGCTTTGGACTTGCTTGCGCTTCGTGCTACTCACCTCCTGTCGCAGAAGCATCGTGCTGACGCTTGCGGCTGCGGTGAGGCAGAACGTGCGCTGTCCACGGTCCAGGGGAGACTGAGCGCAGCACTGGAGCCTGGCGAAGCCTTCGCTGCCCCGTACTGTGCCTCCACCACTGTCCAGCCTCGGCCGGGGTACATCCTCGTTCGGGGATCTGCGCCGCTTGGCCTTCGCGTCCCCTTGCTGCCTTCTTGGTCGAGGAACCGCTTCCGAGTGAATGATGGACTGTATCGTAGCGGACGCTGCGGCGCGCTCTTTAGCGCGCGGCGGCGTTACTTGTCAACGGTTATTGATAAGGACCTATCGCGACTTTAAGCCTATTCTCTCTCCACGATATTCTGATTTCGCCGGCTCCGGGCCTCTCTCTTGTTACTGGCGCCTGTACCAATTAACCGACCGGGAGGTACGGTCAGTGCCCCCACAGTAGGGTAAGAAGCTTCGACGACCGATTACCTCGGCTTAGACTATCTGTATACGCTCCGATATGCACAGAGAAAGGATGCCTTCCGTTCAACCCTCCAGACTTGGTGGTCCTTACCTTTACCCTATACCGGGAACAGGTGTCCAAGTTCGCAGGTTACATGACAATCGAGTATTAAATGTATCTCAAGCCATGCCTGAATCCCACTGTGATGCCCTGTAATAAGTGCGGGTCGGTACGGCCCACCACTGTCCTAGCGGCTACCTGGCTCTCAGCGAACCCTACTTGGTACGGTTGGCTTCCTGAGGCTCTCCAGAGATCTCGAAATCTATTCACGCTCTAGACTGACTACCGGCTGAAGACACTCTAGCTGGCTAATAT * tp:A:P cm:i:108 s1:i:685 s2:i:0 zd:i:1 NM:i:1551 ms:i:1050 AS:i:915 nn:i:0 SA:Z:utg000001l,24335,-,7073S1572M60I2310S,27,566;
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
51 46 2064 utg000001l 24335 27 7073H15M1I8M2I10M1D10M2I2M1I7M10I11M1D2M2I24M1I1M1I9M1D3M2I30M2I33M1I10M1D10M1D19M2D17M5D36M7I3M1I12M3D9M6I6M4I1M1I16M2D4M1D9M2I4M1D5M2I16M1I9M1I15M4D3M1I3M1D4M2D3M1D5M2D2M3D6M2D4M3I2M1D10M1I5M2D4M3D10M3D5M1D17M1D16M1I11M3I4M2I9M2I23M2D3M3D4M1D8M1I11M1D4M1I4M1I8M1I4M2I21M2I10M1D42M1D8M1D15M1D4M1I6M1I7M2D5M1I10M1I11M2D1M1D5M4I3M1I7M1D9M2I1M1I4M3I2M2D5M1D12M1D12M5D14M1D6M5I4M1I4M1I2M1I2M1D10M3I1M1I3M1I12M1D13M1D1M2I9M1I3M1I1M1I4M3D10M2I4M2D15M2D12M5D3M1I4M1I4M2I3M2I2M1I4M2D3M2I5M3I3M2D2M1I3M1I10M1I5M2I24M1I5M1D1M1D3M1D8M1I5M1D1M2I11M2D7M1D5M1I13M1I3M3I3M5I13M1I1M1I1M1I3M2I2M1D9M3D5M5I4M1I15M2D3M1D25M2D5M1I3M2I23M2D4M2D4M6D1M2D3M1I4M1I7M1I1M8I4M1I1M2I5M6I2M2D6M2I3M1I9M1I13M1D4M1D2M3I9M1I3M2D5M1D2M5I4M3I2M3I1M1D6M5D3M2D4M2I1M1D4M1D5M1I5M1D7M1D4M5D5M2D6M1I12M1D8M1D4M2D5M2I5M1I1M3I6M1D6M1I3M5I8M2I16M3D1M2D8M1D8M7I9M1I27M2310H * 0 0 CAAATGAAAGCTGTTAAACATTGGTATAAAAATCGTAGACTTGCACAAAGAAATTACCTTCGGTTATTAACTGAATCATTAGCTTATTAAATGAGAAAGACGATGGGATCCGCTAATACCTAATAAAAGATTACGAATTATTACATGCCTTAGCTATAATCTATGGCAGAATGTATAACTGCTGTAACTGCTCGAAATACAAAATAAACTCAAGTGCGACGATGTGATTTCAACATCATTCGACTCTTGGTGAAGCCAGGAGAAGATAATTAAAATTAAAGATAATTACTCACTAAGCAAATTGTTGCTTTAGCGGTTTGATGATACAATATGACAATAAAATAATTCGAAGTATTAAAGAGGGTCTAAACTCGGTAGATAAGCCTAAAATATACTCGGACAGAAGAGTAGTGACTATACGAGACCTAAGAACGATTGCGGAATAACGAGTAATGCAAACATCTGATTGGCTAATTCATCAATTGATTAAGGATAAGATTTGAAGATTAAGATAAATATATTTTGGCGTTGCTCGCATGACACCAGCCAAATAACAAATGCCTATGGCTTCATTTGATAGAGTGGCTCAGAAAAGGACTCATTACTCCAATAAACCAATACATACAATGCCAATTATAGATGAAAGACGACTTCAGGTAATCGACCTGATTCAAATAATAATCAAATGTATTTCATGGAACAACGTAGAGAACGAAGAAAATGACCTAGAAATATACTCAACAGGACTCAAAACATGACGAAAAACCATATTTCGTTCGGCTAGTCTCAAAGCAATCGCGGTGATGTAAACACTATGAACATTGAGTCATAGAACTTCCATTATTCCCTGAAGATAATCGCCAACAGACATAATACCAGCTGACCAGCTTTACACATACTATAACACTAACCGCAGAACGTTATTTCAACCCAACGTTTCTTACAGAGCATACAAACGATAGCCGCCAACAGGGACAGCAGGCTCGATTACTTACAGCTTGAGAGTATCAACTAAGCTTCAAACATAGCGATACTTCTTCCAGCGCTTCCAGCACGCGAGGATTTCTTCCTTCGTTGCAATTCCCATCTGCACTCCGAAGGGCGCAAATAGCCCTCACTGGCTATGCATCAGCTTTGTTTCTTCGCCTCCTAGACCCCTACATCCAAAGAGCTTTTCTGCTGCTTCGGCTTCATCCTCGTCCCAGGCTGTCGCGTTCCACTTCTACTCCCCCGGCGCGGTGACCAGGCACGCTTTCGGCGACGTAAATGGTTCAGAAAATAAATAACGCGTCGGACCACAGTTATAGACCGCGATGTGCCCCTTACTGTTGCAAACGAGCCCCTAATCACGATGCGCCGTCAGTACTGAGTGAAATATCTACAACGTATTTGCCGGAAGAGTCTGGCGCACAATATCGTACCCTGTTTCACGTAAATGAGCCCTGACCTCGTTTGATAATTCCATCGGTGCCATAAGATTATAAATTTATTGGTTGTTCACTCATTCTGAATGCCATTATGCACAGCCTCACAATAGTTAAATGCATGCAATGGCTTTGACCGGGCTTCTGTCCGCACCGTAACGGTGATGTGGTGTGTCCCTGTTGAACCAATACTGAAAGAATGGGCATG * tp:A:P cm:i:9 s1:i:57 s2:i:0 zd:i:2 NM:i:566 ms:i:368 AS:i:156 nn:i:0 SA:Z:utg000001l,17739,-,604S4519M121D5892S,60,1551;
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
52 47 16 utg000001l 25544 60 96S4M1I12M1D5M1D15M1I16M1I10M1D14M1I9M1I7M1I1M1I2M1I10M1I9M3D17M1D7M6I2M2I21M1I3M2D4M1I2M2I6M1D8M1I3M4I4M1I13M2I6M1I5M1I4M2I7M2I7M1I2M3D3M3D4M2I5M2I1M2I2M1I10M1D2M2I5M1D7M2I11M1D5M1D5M1I10M6I26M2I1M1I17M3D10M4I3M1I11M4I10M1I2M2D12M2D1M2D11M1D3M6D5M2I1M2I6M1D10M1I12M2I6M1D3M1D10M1D5M2I16M1I6M1D17M1I36M2I7M2D3M1D11M1I1M1I19M1D10M1D5M2D4M2D12M2I23M1D6M2I12M2D15M1I2M1I3M1I6M1D6M1D4M1I13M1I11M3I14M2D5M3I4M2I26M2I4M3I4M3I6M3I3M2I11M1I7M4I8M1D1M1D13M3I3M1I5M3D16M3D6M4I1M1D20M3D9M3I17M5I18M1I2M2D2M6I2M1I4M1I14M1D8M1I3M1D5M1I18M2I7M1I2M1I12M1D5M3D15M1I14M2D11M3D6M1D3M2D5M2D5M3I8M4I1M1D3M2I15M5I6M2I17M2I2M1I2M2I16M5I5M1I13M1I4M2I22M1I3M4I1M1D7M2I1M5I4M1D2M2I8M3I2M1I7M1D16M1D12M3I1M1D4M1I32M1I13M1D10M1I12M1I11M3D6M6I3M2I9M3D6M3I2M1I3M2I12M1D9M2I5M1I1M1I7M1I9M1D18M1I8M2D5M1D12M1D3M1D15M2D4M1D4M6D19M2I14M9I2M1D10M1I9M2I7M2I1M1I2M1D3M1D3M2D13M1D7M4I3M1D6M1D6M2I11M1D4M2I35M2I21M2I12M1I6M4I5M1D12M1D5M2D3M1D5M2I2M2I13M2D4M1D6M1D6M3D11M4I22M1D8M1I5M2I5M1I9M1I1M2I6M4I18M1D10M2I10M1D5M1I2M1I11M3I5M2I8M3D7M1D18M4D5M8I6M1I23M3I9M1I7M2I17M2D13M1D57M1I7M2D1M1I11M3D12M1D13M2D3M2D2M1I25M3I9M3D6M3D22M3I12M3D42M1D17M2I7M4D11M2I37M1I5M1D3M2I19M1I8M1D3M1D10M1I5M1I5M2D18M1I8M2D1M1D9M1I9M1D5M1I12M3I4M1I2M2D35M1D28M3D60M3I2M1D35M1D4M2I3M2D29M1I5M1D15M1D9M1D7M2D43M2D9M2I2M3I6M3I1M1I5M1D4M1I8M1D8M1D16M1D18M1I5M1I6M2I5M1I21M2D15M2D7M2I17M2D28M3D3M1I11M1I14M3D4M1I10M2D2M1D4M4I3M1D36M1D7M1I16M4I13M2I16M1I17M1D4M2I5M2I3M1I3M1I6M1I5M2D2M1D4M1I5M1I8M1D8M3I13M2I5M1D8M2D3M3I15M2I7M2D5M2D3M2I4M1I16M4D10M1I1M1I31M1I1M1I4M6I34M2I22M1D3M1D17M2D7M1I10M2D4M1I15M2I7M1I6M1I21M1I6M2I14M1I2M1I16M1I7M1I26M1D18M4I10M1I3M1I4M1D3M4D25M3I3M2D16M2D5M1D14M2I5M1I2M2I7M2D2M1I13M3D3M1D3M1D6M2D15M2I6M2I7M3D11M2D4M1I9M1I10M2I2M1I10M1D11M4D11M2I3M2D3M3I2M2I12M1D9M3D3M2D1M1D3M1D5M1I1M1I18M3D2M2I3M1I1M1I7M1D5M1I13M1I13M2D4M3I1M1I15M1I4M3D5M1I29M1D21M1D12M2I11M1I28M3I6M1I4M1D8M1I7M2D6M1I7M1I13M1I10M1I9M3I3M1D3M3I7M2I7M4I3M1I12M1D6M2I1M1I15M3I17M3I14M1D13M3D19M2D5M3I21M2D3M1D2M1I4M1I5M9I11M1I7M2I11M1D12M1I13M1I13M1D4M1I1M2I8M1D13M1D8M5D4M2I6M2D6M2I42M3I4M2D13M1I5M1D3M1I3M1D1M1D5M4I4M1I6M2I1M1I9M2I20M1D10M1D4M1I20M1D14M4I1M1I4M1D3M1D2M1D13M4I4M2D9M1D17M2I9M2I6M1D25M2D42M1I9M1I2M1I29M2D7M3I1M1D7M6I12M2I3M2I3M4I6M1D2M1D8M1I5M2D7M4I4M5I14M2I20M2I6M1I15M1D5M1I27M1I4M1D3M1D7M2D10M1I5M3I5M1I6M2I8M1I5M2D5M2I22M4I7M4I18M1I5M3D9M1D7M1D6M2D1M1D13M3D12M7I8M1I9M1D13M3I1M2I8M1I9M1I4M2D10M3D7M1I5M1I30M1I19M1I23M8D3M1D2M4I2M1I24M2D3M1D6M1I8M1I14M3D17M2D5M5D3M3D1M1D18M1I26M1I2M2D1M1D22M1D4M1I1M4I19M2D6M1I3M1I6M1I8M1I3M2I10M2I8M1I33M3I1M2D9M2D3M1D8M4I1M1I5M1D22M1I19M1I6M1I15M1I3M1D11M2D10M2I9M1D3M2I1M1D2M1I2M4I8M1I30M1I6M1I7M1I6M6I11M2D3M1D5M3D8M1I11M2D13M1D26M3D5M1I12M1D6M2D1M1I9M2I12M2I8M1I14M1I12M1D4M2D22M2I3M1I41M1D7M3D5M1D4M8I8M1I7M1I24M3D1M1D5M2D2M1I3M1D7M2D2M1D9M1D2M1D6M2D25M1D7M1D18M2I5M1I3M1I4M1I9M2I7M1D5M1I14M1I4M2D1M1I8M1I30M2I10M1D4M1D31M1I5M2I4M2D30M4D6M1D1M3I6M3I8M1I5M1D1M1D5M2D9M2D1M1D11M2I5M1I6M1I4M1I1M1I1M1I14M1D6M1D9M1I9M1D15M1D8M2D8M1I6M3D5M2I2M3I40M3I4M1D6M1I5M2I2M1I8M1I4M1I21M1I12M1I44M2D3M2I11M2I8M4I16M1D27M2I17M1I1M1I3M1D10M2D10M3I4M1I10M1D11M2I10M2D17M1I3M1D5M2I10M1D4M2I6M2D30M5D6M9I10M1I13M1I3M2D12M1I19M1D11M1D8M1D13M1D2M1D17M2D5M2I4M1I6M1D9M1I1M2I9M3D6M1D13M1I4M6I1M1I19M1I5M2I12M2D7M2I16M2D19M1I36M4D14M1I3M1I3M2I3M2I6M1I2M1I4M1I12M2I11M2I1M1D8M3D10M4I5M1I6M1I7M1I2M3I3M1D6M3I6M4I2M2D9M5I15M1I3M1I10M1I3M1I9M2I1M4I22M1D8M1I13M5I4M3D16M1D10M1D15M4I24M2D10M1D7M1D14M2I23M3I13M3D6M2I4M1D10M2I3M1D15M2I15M2D2M1I8M1I2M1D1M1D13M23S * 0 0 GAATATTACATACTTCTGTTTCCGTATCCTTCACCCAGGCTGTGCCGTTCCACTTCTCTCATATTCCCTCCATGCACGCTGACCAGGTAAAAGCTTTTCCGGTAACGACCGAGTTCAGAAATAAATAACGCGTCGCTCAAAGCCACGTCATAGACGGTTTTACCCGATGGTCTTCAACGAGATGCTTAAGATGACGCTCCATCACTGTTGAAAACAGCCAAAGCCAGCCGGAATATGGCGGTGCAATATCGGTACTGTTTGCAGGGCAGACCGGTATGAGGCGGAATATATGCTTCACCTTCCACAGAATAAATTCATGCACGGTCCGGCCAGCAGATTATAAATTTATGGTCGTGGTTATTCACCTTCCAAATGCCATTACTGCAAGCCCTCCAATAGTTAGAATGCATGTTTTTGACGGTGTTTTCCGTTACCGCACGCGTTAACGGAGGTGATGGTGTCCGTGATAACCAATACTGAAGGACGAATGGGCATGAGCAGGACGAGCTGAGCTGATGCATGGTGCACGCCGCCTGATACCAACTGTATGCGCATGTGCACCGGCATCCACGGCTGTACCGACAATGAGTGACTGTGGCTGCCCTGACTGTCCGTTTTCGATAAATAAGCAATACCTGTGCCTGGTTCCTTTAACTGTGGATAAACTTCCTGTAATGGTTGCTTGTTCCATACTGACTCCAGCCAGAACTGTTCATCCTGCTTAACCATGTGGCATGAGCACGCAGAGGGGCCCTGTTGAACCGCTCAGACTGTGAGCATGAGCCCGTGTTATTCGTGTCGATTTGGTGCCGTAATCGAAACTGCCTGTGTTGTTTTCGTCCGTAATCAAACGACGATGTGGTTTTCGTCCCAAATCCGTACCGGAATGCACTGAAGATCACTGTGGGGTGCGACTTAATTCCATCCTGATGTTCCTGAGACAATACAGCACGACCGCTGGCGGGTTTCCCCTTGATTATTGTCCATTAGCTCGCATATCAGGAAGCACACTACGCAGATGGAAGCGACAGCAAGTTTTGGTAGGCTGATTTGTTAGACGCCTGCCCCTGCATCAGGACGTAGCCAGACGGAACGATACCTGATGGCCACGGGATCGGCGCACCTGCCGGAAGAAAGGCCGAATTCTCTACCGGCCCCACAGCTTCAAGAACATCTGCAACGAATTTTTGCAGAATATCCCCTGCCAACCTGAGTCAGCGTGGCGTCCACGGCTGGCGGCATCATTTAGGCAAATACGGTAATTTATTTTCGCCGTGGAAAGCCTGCCAGCGTCAGTGTCGCAATTCTGTCGGTTGTTACCCGCAAGCGGCGCGTTAGTCATGGTGGTAGCAAATCTGGATCATTCCCGAGCGCTGCGTAGGGTTCATTCAGCGTATTCAATCCAGTGCCGTTAGGTGACGCGGTCGATAACATCTGCAATCGCGGCCAGTACAAAACCGGTGTTCGTAACCCGGGTATTGTTTGTTCCCCTGAGCATTTGGTTGTGCTTTGTTGGCGTTCCGGGTCAGTGCCGGACTGTCCAGTGGGCTTTTCTGTTCGTTTCATCCATTACACCTTAACCGGTCTCCGTTGCAGCAAGCGTTTCAGACGGTGCTGTTGGTTGCACTGCTGAGCTGCACTATCCCCTTCGTTGTGTCCGCATCCTCAAGCGCGACACTATGAAGCTATATCTGTCCTGCACGTTTTGCCGAATCCGCACGTATTGCCGCCGGATTCTGCCGCACTTTGCTCTGCGATGCTGATACCGCACTTCCCGGACCGCCTGTCGCCTTCGTGGATGCCGCGTTGACGCACTCCCCGCCGCCGCTGTTTTCCGTGATGCCGCGGCAGAGGCGCTGACGCGTCGGGCTTTCAGATGACCTGCATTCGCTATTCTTGGACGTTTTGCCGCCCTGGCAGAATTCTGCGCCGCCGTTGCCGAGGAATCCTGCACGACCGGCACTGTGATGATGCGTTCGTTTCTCATCCTGATTTTGCTGCCTCTTTTGTAGAGCACCCGCATCTCGTGCATGGAATGGCGGCCTGGTAACGGGCTTCGTACCCGCGGTGGAGGCAGTGGCGGCTGATAATTGTTGTGACGCTGCAAGCATTCGTTTCTGACCGTTTCGCCGCACCGGGCACTGTAGGCCGCCGCGTTTTGGGACTCTGCGGCTGCGCAATTTTTCTGGTTTCAGTGGCTTTGCCTGATGCCGCTTCTGCGCCGCGACGCTTCCTGAGCTGACGATGCAGCCTGTCCGGCGGACGTGCTCTGAAGCTGGCGGGGGCGTGCTGAGTCAGTTGCATCACCAGTCACAAGGGGCCGCGAGACCTGAGCAGCTGATGCGACTGGCATCGCCGGCTGATTTCTTCGCGTCTGCCGTACTCTGTGCCACCACGGACGCGTTACGCGCCACCCTCTTCACCATCAGTTCAAGACGCAGCACCTCATCCGGGCATCATCCTCTAGTCATGGCACAGAGAAAATCATTCATATAGCGTCCCCGTGAATCTTCATACACGGTGATGGTCCCGGCGTGCGATGGTGGAAAACCGTCAACCTGCAGGATGACACTGTACTGACCGTACTCACATCCATGCTGTAACGTGCCCGGCTTCATCCGGATTCTCTGAGCCACCGTGTTCACCACCACCGTGTAGCTGTTAACGTCAACAAATTCAGCTGAATGGTGCAGTTCTGTGTACGGTTTTCCTGTGCCGTCTGTTACAATTCCTGAAATCTTTACTGCCATATTCACCCACAACGACGGACGGTTCAGGCGGGCTGTCATAACACTGTGTCTATGGCTAATCAGAATTTATAACCGACCCCAACGATGAATCCGTTGGTACGCCAGTCGCCACTGCCGGAGCCTTCATAAGCAATATCAACAACGACGGACGCTGCCGGATTAATCTGTACCTGCATTGCTCCACGCCACTGAGGTATGCTGCATTGCACTTTCGTGCTGGCAGTGGTCGTCCCTTCATATACGGGAGTGATTTCCGTCTTACGGTAATCCATTGACTGCCGGACACCGACTGTGAGCCATCGGCCATGGCATCCGCACTGACCTGCTTACTGATCCTAAACCGGGTCGGTTACAGCGCTCACGCTAACGTTACACGCAGCTCTCATGAACGTATCCTCCCAGGTCATCACTGTGCTGCTCTTTTTCTAACGCGGCGCAAACCCCAGCGGAGCCATGATAGCCACTGTCCGTCAGCTCAACGGTATCTTCACGTTAATCCCTTCATGACTCACACCGGTATCCCCGCAGCACGACGGCAATGTACCCGGTTTCACTTGAACACCCACCGTAAACGTAATTTAGTACCTTCCGCACGGGCCGGAGTGACTGTCACCGCAAGTGCGGCACGACAGCAACGGCAATACACATTACGGACGCATCGTTCACCTCTCACTGTTTATAATAGAACGCCCGTTCCCGGACGAACCTCTGTAACACTCAGACCCAAAGAATGATGCCCAGCGCCTGTTTCTTAATACCATAACCTGCTGCACATCGCTGGCAAACGGTACGGCGGAATATTATCTGCCGAATGCCGTGTGGACGTAAGCGTGAACGTCAGGATCACGTTTCCCCGACCCGCTGGCATGTCAACATACGGGAGAACACCTGTACCGCCTCGACGTTCTCTCGAGCGGCCATCATAAATCACCGCACCGTTCATCAGTAGACCTTCAGATAACATCTAAACGTGTCTGCCGCTGACAGTACGCTTACTTCCGCGAAACGTCAGCGGAAGCACCACTATCTGAGGCGATCAAAAGCAGTGGTCATCGGTCACGGTGACAGGTACGGGTAATACCTGACGGCCAGTCACACTGCCTTCACGCTGTGCGGCGCGGAAAGCCGCGCTCGCCGCCTTTACATGTCCCGACGATTTTCTGCCCTCACTAGATCGTTTATCGTACAGTTTTCAGCTATCGTCACATTACTGAGCGTAGGGGAGTTCGCATTCAACTGCCACTTGATATCCGCATTTTTAGCGGTCAGCTTTCGTCCGGTGTCAGGAAAAGCCGGAGGATTGCCGCCGCTGGTAATGGTGGGGCTAGTCAGGCGCTTCAGGAATCACGTTCGTTCATGAATATCTGGTTGCTCGCCCTGCGCCAAACATCGGCGTTTCATTCCCGTTGCCGGGTCGCTAAGATAAATGCGGGAGATTGGCTGCAACCAGAACTGAGCAGTTTTGCCTTCCTCGGTGTCCTCCATGCTGAGGCCAATACCCGCGACATAATGATTTGCCGTCTTTGCTTGGTCCGTCAATTTGACAGCCAGCATGGCATTCCACTTATCACTGGCATCCTTCCACTCTTTCGAAAACTCCTCCAGTCTGCTGGCGTTATCCTCCGTTCAGCTCGACTTTTTCCAGCAGCTCCTGCTTAGATGGGATTCTTCGGTCTATCTGCCTTTGAAAAATCCAGGTAACCTTCCACGATGATCGCCTGCCAGGAAGGACGGCCTCCACGAAATCATGCCGATTTGCCAACGGGGTGTTCGTCTACACTGCGGATATAAATAATAAGCTGCTAGGCCCGGTTTGATATTATTGATACTGGCGGCTATCCAGTACAGCGCCGTATCAAGATAACGCGTGCTGGTTTCAACCTGTCTGATATCCGCAATCTGCTTTTCCAAAAGAAACCAGAACTGTAACACCGCTGTACCGTCGGGTCATAAACGGCAAGAGATGCGGCGTGGCGGTTATCTGAAAATAGCCCGGCGTTCAGCTCAATCCTGACGCGCCTGCTTAAGGATGCGGCAATCCGGAACGATGGAAACGCCGGATCGCCCTGCTGCCCCACGCATTTACGCCCGGACTGTCAGCCTGTAATTCCCCAAGCGCCAGTTGCGTGAAGCGGCGGGTGACTTGGTTTCCGCCGTCAGTCCGGCCGCCGTGCTGACCTCAGCCGCTCACTGCCGTAGTCGCTGTACAGGTCAGGACGGAGCAGGAAACTCACGCCTTCACCACCTTCCTTTGATTGTGCCTCCGTAAGCACCTGAACTGTTGCCTGTCTGCATGACTTCTGCGGTCGGGCCTGCTGCACCATGAGGGCGCGCGTGACACCATTCACCGTGCCACTGTTCGCCGTACACGTCTAGCCCCGTTATCACGATGGCCTCTTTTCCCTGCGACGATGCTGCACGGCGGTGATGGCATACGTGCCGTCGTTGGACCACGTACTGAACGCAGCGGAAAGGAGGCGTGCCTCCGCTGGGCGCAGCGTCGGCAGGGTGCCAGCTCCGTATAATACTTGTCGTCGTATTCAGCAACACCGTCAGGAACACGGCTCAGCTTTACCGGTCGATCCGTCGGTAACGGACTGAACCTCCACGCTGACCGGATTGCCACCTTCCGTAACCAGGGAGTAGCGCGCGTACCGGAGGATGAGCACGTGCGATTTCACGGTCCAGTCAGTTCATCGGGTCCTGGTGGCTGTTCACCACCGCCAGCACACGACTACCGCTGCTGATACCGGCATAGTGATCATCGCAGATTCAATAACATCGCCCGGTACATGGCGAAAGCCCTTCTGTGCTCACGCCCGACGCTGAAATCCACGGTCTTGCGTCCGTTTCCATGCAGTTCTGTTTTAATCAGCCACACGGCACGCTGTGTCGCCTGCCCCGGCTGGTACAGCCAAAGGCATCCATCTTCGTAACATTACGACCGTAACGGGCAATGGCCTGCGTATCTTCAACAGCTGTCGCCGTCTCCCATACGTTATTCAGTCAATCCAGTTCACCTCCAACGGCATTATGGCGGTCCTTCAGGCGCTGAATGTAGCAGAACGGCGAGATGGACATGGCGGCATCACCACATTACTGCGGTTATTATCACGTCTTATCCGACGGTCGGTCTGCGACGCCCGAACGTCAGCGTCTGCCCGTTCCATACCGCTGCATACAGCATCGCCGAGCAGAAATCGCTGAGAGCACATCCCACGCCTTACGCTGTGGTCAGGTACGCATTACCCTATGATGCGCGGCTCCGTGCCGCCAAAGCCGTCGTCGAACATGGACTGGTCGCAGTTACTGGCCGATGACATACAGCGCCCATTTTATCACAATGGCCGCACCAAGACGGTTTCCATGCCGTAGCGCGGATGGGTCAGCATATCCACAGCCAAGACACCCAGGCCATGTTGTTGCTGTATGCCGGTTTAAACGTTCCGTCCCAGATACCGCCGGGTCTGTATGCCGCCGTATGCGTATAGTTTCGACGGCACCTGCAGAATACGCCCGGCAGATGATAATTACGGCTCACCTGCTGGCTGCCGAACTGCTCCAGTCACCTGCACGCCGACCAGTGCCGTGTTCGGGTAGCACTGTTTCACATCGATGATTTCAGTGGCTGACGACCAGAGCGTTTTGTTCTGCAGCTGGTCTGTGGTGCTTTCCGGCGTCGTGATTCCTGCGCATCCGGATATTAAACGGGGCGGCGCATGAGGAGTAGTACCCATCACTACGAGGCGCAGATACTGCGAGGTGGTTTTGCCTTAATGGTGTTTCTTTTTCCGTACCAGGATAGGGTTACGTTGTATCTGAACCAGCAGGCGGACTTCCGACGGATTCCTATTTAACGGATTTGTAGGCTAGTATTCCTACAGTATGCCTGTACGCGAAGGGTAAAGGCACGAGCCGGCTTTGCAGACTGATTCAATGGTGGCGGTAGATCGGCGTGTCATATTTCACTTCGTACCAGCACCGTCTCGAACGAGGGGATTCAAATCCCCTCTAGGCGGGTCTGCTCCTGCTTACCAGCCCGGAACACCGTGACACCGGATATGGCTTTGGTATTCCCCTCAGTGTCAGCACCGGCGTACTGTTCAGCAGCACGCGTTTAAGCCATGCTCACGGACTTTCAATCGGCCTTCGCTGATGGCATTAGATCACAGCCAGCAACTCCGTGGACTTCAGTGTCCTTCGCTTCGCGCGGGGCTCTTAGCCTTACTGCTTCCTTTACCCATTCCTCACGCTCCATAAAACCTAACAAACCGCCCGCAAGGCGGTTTCACATAAAACATTTGCATCAGCGACCAATCACCACAACCTGACCACCGTCCCCTTCGTCTGCCGTGCTGATCTCCTGAGAAACCACGCGTGACCCCACGCGCATTTCCCCGTACAGAAGGAACAGGCAGAACATTGCCCTGGGCAACCATGTTATCCAGTGAGGGAGAAATAGGTGTTCTCTGCTTACCGTTATCCGGTCTTACCCCAATGGGGAGTTCTGGCTTTCGGTGCCAGCATATCTGCGCCACACCGAGCACCATACTGATCACGAGAAGGAAACAGGATGCCGCTTCATACCGGCCCCAATGGCTGCCGGGGTCGCTGCAACCGGCGGCATTAGAACGGTAACGAAGCGATCCGGAAGCGTTCACGGAGGACAATCTGGAATACGCCCACCTGACTTGGAGCGGCGACTCCGGGAACATATGAATTACGCTCATCAGGCAGAGTCTCATGTATGACTGCCCCGTTAACCCGGACGTGCTGACGGACGTCTCAGGGCAATCGTATATCGATAGCGTCGCTCAGTTTCTGACGAAACGCCGGGAGCTGTGTGGCCAGTGCCCGGATGGCTGCTTCAGCCCCGTTTTCACGAAGGTCGATGCGGCGACCAAATCGTTGTAAATCCCCGTAAAGGCAGATGCGATGCCCGGTGACGCGAGGAGAGCTTGTCAGCGCGTCGCTGCCATTTGTCGGTGTACCTCTCTCGTTTGCCGTTGTTGTTCGAATATGGTGGTCACAGCAGCTCGCCGGTCGCCGCAGTTAAATTGCGGCGTGATTCTGGGGACACGGGTCATGAACCAAACAGCACAGCAGCAGCATCGCCCGGCTGTGGCCGCTGACAACGGCACCTGTGATACAGCCCCGTCGCCTCCAGATTATCCAGATAGAGATTCTGGCCGTTACGCCACCAGTCATCCTCACGATGAAGGTCGGCATCTCAATCCCCGCGCCAGATGATAAGCATCCCGGAACAGTGTAACAGTCGTCACACGTGCTCAAAGCGCCGCCCGCGGTGAGATGCGGCACACAGCGGAACTTATGAATCGTCCCCAGCGGCGACCGACGACTACACGCAAATCACTCTGCACCTGCAGCCGCCGGTCGCTCCACTCAGCGCGCAGACCACCGGGGCCTGTGGACCAGCGCCAAGGGTCG * tp:A:P cm:i:102 s1:i:1059 s2:i:0 NM:i:2073 ms:i:4506 AS:i:4506 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
53 48 0 utg000001l 22017 60 15S13M4I10M5D3M1D2M1I24M1I5M1I17M2I13M3D25M1I8M1I18M2D6M1D4M4D14M2D6M1D5M4I8M1I9M1I17M1D26M1D20M1D13M1D1M1D3M1D17M2D11M3D6M1D31M1D3M2D3M1I17M2D11M2D11M26D8M1D9M1D21M1I10M1I2M2I6M2I8M5I2M2I2M1D1M1D10M5I1M1I5M1D6M5I6M1I7M2D19M3D32M1D3M6I22M3I5M1D6M1I27M2D7M2D3M2I3M3I8M1I31M1I22M2D7M1I7M1D9M4I2M1D19M1D2M1I10M1I16M1D13M1I30M1D10M8I2M3I2M1I4M4I3M1I11M4I2M2I8M3I1M1D7M1I9M1I7M1I7M1D4M3I6M2I2M1D5M1I7M1I3M1I2M2I8M1I10M3I6M1I4M3I4M1I2M4I7M2I34M1D17M1I3M3I5M1I10M1I5M1I13M1D5M6I1M1I3M2I8M5I6M1I8M3I26M7I15M2I4M7I21M1D12M1D4M2I10M2I19M1I12M3D3M1I8M1D3M1D10M2I2M1I12M1I2M3I16M2I4M1I3M1D4M2I3M1I7M2I1M1D5M4D2M1I4M2D2M3D3M2I1M1D3M1D13M3D19M2D32M3I13M7I2M2I5M3D6M1D8M2I5M2I3M1I7M1I11M2I3M4I2M3I3M1I5M3I8M1D5M1I3M2I11M1I6M1I3M1D14M1I9M1I4M2I7M3D2M1I8M1I12M3D9M3I2M2D12M2I1M1I8M1I3M5D4M3D7M3I2M1D7M1I3M1D7M1D7M1I1M1I2M1I5M1D4M1I11M3I9M3I2M2I4M4D7M1I14M1I1M1I6M5I16M1I1M1I4M3I4M4D10M1I3M1I9M9I4M1I11M2I5M2I10M1D13M1I23M2I11M1I3M1I5M1D40M4I8M1D3M1D8M1I1M2I10M3I2M2I9M1I8M1D3M4I4M1I14M1I9M4I3M1I13M2I14M1D10M1D14M1I4M2I12M1D13M1I25M1I17M1I13M1D14M1I17M1I22M1I21M5D2M3I10M5I4M1I8M1I34M1I5M1I6M1I13M1I16M2I2M1I6M5I1M3I14M1I8M1I3M1D2M4I1M2I1M1I3M1D5M2D3M1I2M3D26M1D6M2I4M1I1M2D24M2I14M1I6M2D6M1I6M1I19M1I4M3I6M1I17M2I10M1I14M5I4M2I14M4D10M4I1M1I21M3D8M1I4M1I17M3I5M1I4M2I1M1D4M3I2M2D3M2I1M1D3M1D8M4D16M2I7M1D7M3D16M1I8M1I7M1I3M1I3M2I9M1D3M1D11M2I2M5I4M1D11M2I8M2I3M1I2M1I5M3I9M3I17M1D15M2I2M1I2M1D19M1I4M1I8M1I4M2I9M2D10M1D61M1I8M2I15M1D27M5I9M1I8M1I6M1I17M1I5M2I3M3I1M2I19M1I15M4D36M1D8M1I2M1D10M1D24M2D10M1D4M1I8M2I6M1D10M1I11M1D4M1D1M1D11M2I4M2I8M2D5M3I3M2D2M1I38M2I4M1I4M3I13M1I33M1D6M2I4M1I6M1I3M1I21M1D1M1D4M5I5M1I9M2I7M3D1M1D13M4D6M4D4M5I4M1I5M1I7M1D21M1I12M1I3M2D23M2I30M1I11M1D19M1I7M7I1M1I9M1D11M1I4M1D4M1I14M1D11M2I8M6I3M2I6M1I2M5I3M1I3M1I1M1I6M1I1M2I18M2D7M1I1M2I10M1I25M3D7M1I1M1I13M1D3M7I9M1D9M1I3M1D21M1D34M1I7M1I10M1D1M2D1M1I6M3D1M1D3M1I8M1I10M1D8M1I2M1I6M1D11M1D3M1D17M2I1M2I20M2D61M1I3M1D10M1I7M1D13M1D10M1D5M2D12M1I17M1D11M1D4M1D30M1I5M6I14M3I3M2I17M5D7M1D9M1D10M2I21M1I5M3I1M1I3M2I9M4I2M2D12M2I2M3D25M3I3M1I16M5D12M4I1M1D20M3D2M2D5M3I2M1D7M1D6M2I13M2I7M2D2M4I2M3I26M1I4M1D76M1D5M1D6M1I6M3D7M1I3M2I5M3D6M2I11M3I8M1D8M5I1M1I5M2I12M1I1M4I13M1I5M1I28M2I19M1D2M2I1M1I4M1D6M1I1M2D9M6I16M1D4M1D4M4I6M2D12M1I4M1I3M1D3M1D18M5I7M2I7M1I2M1I6M1D6M1I9M1I14M3D4M5I2M3I6M4I3M1D11M3I2M1I3M2I16M2D4M2I13M1I16M1I23M2I3M1D13M1D3M1D13M9D24M1I17M5I4M2D4M2D12M1I7M1I5M1I19M2D12M1D5M1D6M2I11M1I9M2I3M4D7M1D15M2I4M2I11M1D10M1D7M1I3M1I6M2I2M2D5M1D11M2I6M1I1M1I4M1D8M3I4M1I12M2I1M1D14M1I5M1I25M1D15M2I2M4I6M5I5M1D7M8I3M2I7M1D14M1D15M6I3M1D6M1I4M1I14M3D15M1D7M2D13M1D11M1I1M1I20M1I10M3I1M1D15M3D11M1D41M1I14M7I8M2D2M3I18M1D7M1I9M2I3M1D5M3D14M1D18M1I7M2I5M3D21M2I13M1I11M4I3M1I5M1D4M2D14M1I3M3I23M1I4M4D11M2I6M1I9M2I27M1D22M3I2M2D19M1I9M3I21M1I8M2D3M1I3M1D10M1I5M1D8M1I7M1D42M1D29M5D7M2I8M5D27M1I30M2I23M1D1M1D2M1D12M4I16M1I3M1D15M2D9M1I9M3D11M1I9M1D1M1D30M1I6M2I5M1I9M1D11M1I3M1I18M1D9M1D38M1I7M2D14M1D9M1I14M1I15M1D12M1D10M1I11M1I6M1I15M1I12M1D3M1I2M1I3M2D22M1D6M6I2M1I13M1I10M3I3M1D36M2I9M3I6M3I3M1D6M1I5M1D8M2D2M1D4M1I5M1I8M1I4M1D16M1I15M2D15M2I6M1I3M2I8M2D3M2I4M1I29M2D2M1I29M1D3M2I13M1I4M2I14M2I2M1D12M2I9M1I4M2I7M2I13M1D11M6I7M1I5M1D22M1I29M1I4M1D4M2I11M1I16M3D11M2D21M3I3M1I3M1D6M10D5M2D13M1I1M1I3M5I22M1I20M1I1M3D2M1D12M1I5M1I2M2I7M1D12M3I4M5D15M1I3M2D4M4I14M1I4M3D10M3D13M1I12M1D4M1I16M5D16M1I6M4I5M2I13M6D1M2D4M2I7M2D4M2I15M28S * 0 0 TCATCGTCTCTCACTTTCAGCATTTGATGGTCGTTGTATGAGATAGATAGAAAAGACAACTCTGGCTTGAAGCCTATCAAAAACTAAGTAGTGATGAAAACTTTCCAAATATGAACTCATCAGCCTCATTTCCAAATATGAAGAGTTAAGACGTAATGAACCACAGATTCAAGTGACGATGATAAATTCTAAATTGTTTGGTGGACAATATCCAGAAATATCTGCTTCGAATGAGCTCTGGACATGCAATTGTTTTATTTACTATCAAGATTAGTAGATGTCGTTGTGAAAGTCATTAGTTTTATTCGATGAACCAGAGATTCATCTGCATCCACCTTGCTCTCTGCTTTTACGAACATTAAGCGACTTACTCGATGCACGCAATGGTGTAGCATAATTGCAACTCATTCCCCAGTACTGCAGAGGTTCCAAATCCTGCATGTGGAAAGTCTCTACGTCAAGAAGCAATAAACTATTATCCGTCCGGATATTGAGACATTCGGTACAACTTGTAGGTTTTATATGACTCGTGGGTGTTTTACTGAAGTGACAAATTCTGGATACCACCACTTATTATCGCAGTCCGTTGATTCAGCATAACATTTCTTATGAAACCATTCTAAAGGCTATTAATGGTCAGATAGGATGCGAAGGTCGAACCGTTTTAAGGGCGGTATGATACCGGCGAACAGTAGAGATGAAAGTAAAGTACAATGAAAAACTACCTCTTCCAGAAGGGCGAGTAGCGAAATGCTTAATAAATGCTCGGAAAGCTGATATGATGCAGATAAATGTTAGAAAATAATTTCGCTTACTCACTTCCCCATTTTGCCCGGAAAGAACAACAATATAGAATATTAAGCTCGACAGGTCAGTTATTTACCTACGACAGGACACCGCCCCTCTTGAGCCTACAACCTTAGTAGTTGGTAAGTGGACAAAGGTTAAATTAGAAAGCTTTATGAAAATAATCTCCAGATAAAACAAACCGCTAGAACATATATCCGATGACATGCTTGTTTCATCAGGTGAAAAATGTCCATTTTGTGGTGATGGACAGACAAAATATAGATCATTTTCTTCCTATTGCACATTATCCTGAATTTTCGGTGATGCCTATTAATTAGATTCCATCGTGCCGCGACTGCAATATGGGAGAAAAGTCAAGTTTTCGCAGTAGATGAGGTACACCAAGCGATTCATCCATATCGACAAGGACATTTTTCGTGAGCAATGGGTATATGCAAATTTCGTTTCCGGAACTCCGGGTGCTATCAGTTTTATGTTGAATGCCGGCGACTCGAGCAGGAAGACAAACACAGAGCTCTTCATCATTTCAAGCCTATTAAATATTTAACAGGTATCGTTGGAGGCAGGGAAGACGCACTTGAGTGAAGTGATTATCAAAGAAACTCTTTCGTAAAGTTATAAGGAGAATATAGTTCAACCGCAACGTTTCAGCAGCTACAGTCAGAATTTATTGAAACCAAATCTGAAACCTATTACATTTGAATGACTTCCCCAATTATTGGAAAGAGTTATGTATCAGTGCCCAGCAAACTGCCGAATTTTTCAGGGATGTAGAATATGACCGATGAAAGATAGAGAAAAGTACGACGCCTTATCGGAAGTGAACGATGAATATTTTATGAGGGAGCGGCTGTTTTACAAAATCCGGTATACTTGCTAACCAATTCCTAGGCAGGTCACCTTGGCAACAGTGGCAGCAGGCGAAGGACGTTGTGCTGTTCGGGCACAGCAGTCCCTAGGACAGTGGCGTACAGAGTCGATGGTCCTTGGAGGTGGTCACAAATTCTCATGCAAATATGTAAAATCGGTAGGCACTGGAAATGAGCCTTCAACACCCGCATTACAGGAAGTTCACCAGCCAGCCGCAGCACGTTCCTGCATACGACGTGTCTGCGGCTCTACCATATCTCCTATGAGCAACGTCTGCAGAGCCAAGCCACAACTCTAATTTTAATACATAATATGAATGATAATAATAATATTAAATTTCCTGTGTAACCAATTTATATGGTTCTGACATAAGAATCATGTGCAAGATCAAACAACTTGTATTACATTGACAGTTAAGCAGTTAATTTATCACCCTCTAAAATATATCAGCATCTAGCATGCAGTAAGGGTCAAAATGGAGAGTTTATGACTAAAACCATGGAAAGAAGACTTAAAGATTTATCGCACTTGCTGATAAATGCTGCATTGATACATATTTGACCTGAATTATTTCATTGAATTTGAATCGATTCCTCCAAACCGCAAGACAGTAACATTTACTTATTCAAAACAAAACCAGATTATAGGATATGACATTTGGTATAACAATAATGTTATTGAAATGGAAAATGAATCCATTAATGGCTTGGCTAAAATTCTCGCAATACGATAGAAAAACAAGGCAGATTTTAGAAGGTATATAGAGGCAAGGCGGAGCTCTTATTCATCTTACATTGAAGAAAATGACATTGAGTTTATTACGATGAAAGTATGTTAAACATTGGTAAAAGTTAGTCAGACTTGCACAAAGAAATTACTTCATCTTTAACTGAATCATCTACTTATTAAATTCAAATTGTATTGTATGTGGGTCTACATCTAAAAAGATTACGAATTATTACATGCTTAGCTATAATGCTGGCAGAAATTATAACTGCTGTAACTCTCTTGGCATACAATAAACAATCCAATGGGTGACGGATGTGATTCGCCAACATCGATTCGATGATCGTCTTATTTGATGAAGCCAGGAGAATAACTTACTTTAAATTAAAGATTACTCCATAGCAGCAAATTGTCATTTAGCATGATACAATATGACAATAAAGCGATTCCTGAAAGTACCCATGTTTAAAAACTGTAGATAATCCCAAAAACAGGTTCGACAGAAGAGTTAGTTGACTATACTGCCAAGCTTGCAGAAACGACTTTTTAAAGGACGGTTGACATTCAAACATTAATTTTATGATAAACAATTCCATCCAATTGATTTAATCAATACAACATTTGAAGATCAGCCAAGCAGATAAATATATTTTTGGCGTTATGCATAGTGACGAGCAGCCAAAATAACAAATGCCTATGGCTTCATTTGGATATCAGAGCTATGAGCCAGAAAGCAAGCATCTACTCCAATAAACCAATACATACAATGCCAATTAGATGAAAGACTTCAGGTAATTGGAATTGATTCAAATAATAATCAAATGTATTTCCAGGCAAATAGTTAGAGAAAACGAAGAAAAAGCGACTTTAGAAATATCAACAGCAGACTCAAACATGACGGAGCAAAAACCATATTTCATGCGTTTCAGTCTTAAAGCAATTGGCGGTGATGTATGTAGACACTATGAACAATTGAGTCATATAGAACTTCCATTATTCTCCTGAAGATAATAATCTAAATAAACCAATACTCAGCTTACAATACTAACTAACCGCAGAACGTTATTTCATACAACGTTTCCGGCATACCAAAACGATTACTCCATATAACAGGACAGCAGGCCACTCAATATCAGGTGCAGTTGATGTATCAACACGGTTCAGCAACCGATACTTCTTCCAGGCTTCCAGCAACGAGTTTCTTCCTTCGTTGCGATTCCCAGATCTGCATAAGCATCCTGAAGCGGCGCAATATGCTCACTGGCTACCTGCATCAGGCTTTTGTTCTTCCGCCTCCCGGATCTCGAACACGTTTTCTGCTTCCGTATCCTTCACCAGGCTGTGCCGTTCCACTTCCATATTCCCTCCCGAGATAACCAGGGACATTTTCCGGTAACGGACCGAGTTCAGAAAATAAATAACGCGTCGCCGGAAGCCACGGTCGACGGTTTTACCCCGATGGTCTTTGAATGAGATGCCACGATGCCTCATCATTGTTGAAAACAGCCACAAAGCCAGCCGGAATATCTGGCGGTGCAATATCGGTACTGTTTGCAGGCAGACCGGTATGGAGGCAGAATATGCAGTCGTCTCAGAAGAGCAAATGCCAAGTGGGGTTCCGGCCAGCAGATTTCCGTTTCAATGTATGGTCCGTGGTTGTTCACTCATTCGAATGCCATTATGCAAGCCTCAATATAGTTAAATGCAATGTTTTGACGGGTCGCGGGAGCTCCGCAGCGTTAACATGAATCTATGTGTCCGTGCAACCAATACCTGAAGAATGGGCATGAGCAGCATACATACAATGTATCGGTGCGCACCAATACCAACTGTATGCGCAGCATGTGCAGCACCTCAAGGGCTGTACCGGGTAACAATGAGTGACTGTGGCATGCCCTGACGTGCTTTCCATAAAGCAGCAATACCCTGTGTGCTCGTTTCCTTTAACTGTGATAAATTCCTGTAATGGTTGCTGTTCCATACTGACTCCAGCCAGAACTGTTCATCCTTAAACCACTGTGTGGCATGAGCACCCGCGGCCCCTGTTGAACCGCTCAGACTGTGAGCATGAGCCCCCGTGTTTATTCGTCGATTTGATCCGTAATCGAAACTGCTGTTGTTTTCCTTTCCGTAATCAAACGACGAATGGTCTGCTTTTCGTCCCCAAATCCGTACCGGATGCACTGGCACTGTGGGTGTGCACTTAATTCACATCCTGTTCCTGAGACAATACAGCAAGAACCGCTGGCGGGACTTTCCCTTGATTGTGTCCCTCGCATATCAGGAAGGCCCCGATGGATACGCGACAGCAAGTTTTGGTAGGCCGATAAGTTGTCAACGCCTGCCCTGCATCAGGACGTAGCCATACGGAACGATATGATGGCCACGGGATCGGCACCTGCCGGAAAGGCCGAAGCTTCTCACCGGCCCCAAGGCTTCAGAACATCTGCAACGGAATTTTGCCAGAATATCCCTGCCAACCTGAGTCAGTTCAGTCAGGCTGGCGGCATCCATTTCCGAACAAAATACGGTAATTATTTTCACGTGTGCATCGACTGCCAGCGCCGTCGTCAGTGTCGCATTCTTCGGTTGTTTACCCGCAAGCGCGTAGTCATGGTGGTAGCAAAATCTGGATCATTCCCGAGCGCTGCGGCCAGTTCACTTCAGCCGTATTCAGTGCGTCAGGTGACGCGTCGATAACATCTGCAATCGCGGCCGTTACAAAGCGGTTCGCAATCTGGGTTTGTTTGTTTCCCTGAGCGCGGTCTGTTTGGCAGTCGTTCCGGTCAGTGCCGACTGTCGAGTGGCTTTCTGTTCGTTTCATCCCATTAATTACCACCTTAACCGCCTGTTGGCGTGCAGCAAGCGTTTCACGACGTGCTGTTGGTTGCAACCTGCTGAGCTGCAACTGCTCCCTTTCTCGTTGTGTCCGCATCCTCAAGCGCGACAGCTGAAGCTATATCTTCTGCACGTTTTGCCGAATTTTGCACCGTATTGCCTCAGCTTCTGCAGCCAGCATTTTGCTCTGCGATGCTGATACCGCACTTCCGCAGCCTCCTGTCTCCTTCGTGTCATGCCGTTGACGCACTCCCGCCCCTGTTTGCGTGCCGCGGCAAGGAGGTGCGGTTCCCCTGCTGTTTCAGATGACGGCATTCGTCTCGGACGTTTTGCCGCCCTGGCAGAATTTTCTGCCGTCCCGCTAGGAAGCTGCACGACCGGCACTCTGATGTGATGCGTTCGTTCTGATTGATTTGCTGCCTCTTTTGAGGCCACCGCACGCATCTCGTGCTCTGAAGATCTGCGGCCTCTGACGCTTTCGGTGGCCGCGGTGCTGGAGAGGCAGACGTGTGGAGCATACTGTTGTGACGACTGCAGCATTCGTTTCTGACGTTGCAAGGCCCCTACGAGCGGGATAGTGAGCGCGTTGCACAGGGGAGTAACTCTGCGATGAGGCACTTTTCGGTTCAGTGGCCTTTAGTGATGCCGGCCGTGTCCGGAGGACGCTTCCTGAGCTGAACGATGCAGCTGTTAGATGGGGACGTGCTGAGGCGCGTCCGTACAGTCAGTTGCATCAGTCACAAAGGGCCGCGGGTACTGAGCAGCTGATGCACTGGCATCGCCGGCTGATTTCAGCGCGTCTGCCGTACTCTGTGCCACCACGTAACGCGTTACGCGCGAGAGGGCGCCTCTTTACACCATGAGTTCAAGACGACGACTAAGTGCCGGCAGGGGTAATAGCTCAGCGTCATGGCACAAGAAAGTGGATTCAGCGTCCCCAGTTGAGTGAATCTTCATACACGGTGATGAGCGGCCGTGCGGTGGTGTGATGGAAATAGCATTTAGTAAGTGAGGAACACTGTACTGACCTATAGATCTCCACATCCATGCTGTAACGCCGCGGCTTCATCCGGATTCTCTGAGCCCGCCGTGTTCTCATCACCACCGTGGTGCTGTTACGTCGGCTTTCAGCTGAATGGTGCAGTTTTCTGTACCAGTTTTTCCTGTGCCGTCTTTTCTTGAGGACTCCTGAAATCTTTACTGCCATATTCACCACCAAAAGCCCACCGGTTCCGGCGTCAGTTCAACACTGTTACCTGGCTAATCAGAATTTATAACCGACCCCAACGATGAATCCGTCAGTACTCCAGTCGCCACTGCCAGCCTTCAGATAAGCAAACAACGACGGACGGTGCCGGATTAATCGTATACCTGCACTCCACCGCCACTGAGGTATCCGCCGCATTGCACTTTCGTCCCTGGCAGTGGTCCTTTCAGCGCTACCCGGGAGTGATTTCCGTTGTACGGTAATCCATTACTGCCGGAACAAGCGACGTGAGCCATCGAGCCATGGCGATCACCAACCTGCTTACTGATTTGGTAAACCGGTCCGGCCATCACGGCCCAACGTCACGCAGGCTCGACAGTGAAACGTATCCTCCCCGGTCATCACTTGCTGCTCTTTTCGACGCGGCGACTCCCAGGAAGCCATGTACCCCCACTGTCCGTCATATAGACCGGTACTTCACGTTAATCCCTTTCAGATGACTCACACGGTATCCCCGCCGACAACGACGGCAATGTACCCGGTTTCATATTGAAAATAGCCCACCGTAAACGTACCCGTCCACCGTCGCACGGGCCGGAGTGACTGTCACGCAACATACCGTGGCGGCAAAGACAGCAACGGCAATAAGGCGCGTACGCATCGTTCCTCTCACTGTTTATATAAAACACCACCGTTCCCGGCTGACGTAGTGACCGCCACTCAGACCACGCTGATGCCCAGCGCCTGTTTCTTAATACACCAGACCTGCACATCGCTGGCAACGTATACGGCGGAATATCTGCCGAATGCGCCGTGTAACGTGCCTAAGCGTGAACGTCAGGATCACGTTTCCCGCGACCGCTGGCAGGTCAACAATACGGGAGAACACCTGTACCGCCTCGTTCGCGCCGCCAGCACATAAGTACACCGCACCGTTCATGCCATCCTTTCAGATAACACATCGAATACGATAGGTCCTGCCACGCTGACAGTACGCTTTACTTCAACGGCGCGAAACGTCAGCCGGAAGCAGCACTATCTGGCGATCAAAAGGATGGTCATCGGTCACGGTGACAGTCACGGGTATGAATGACGGCCGTCACACTGCTTTCACGCTGGCGCTAAAGCCGCTCGCCGCCTTTACAATGTCCCCGACTACATTTTCCCTCAGCGTACCGTTTATCGTGAGTTCAACTATCGTCACATTACTGAGCGTCCCGGAGTTCGCATTCACCTCATTAGTGATATCCGCATTTTAGCGGTCAGCTTTCCGTCCGTGTCCATAGGAAAGGCCGGAGGATTGCGCCGGGCTGGTAATGGGTGGGGCCGTCAAGGCGCTTCAGGAACACGTCGTTCATGAATATCTGGTTGCCCTGCCGCCAAAACATCGGCGTTCATTCCCGTTTGCCGGGTCAACCGCTAGGTTGGCGATACGATTGGCGGCAACCAGAAACGCGGCCGTTGCCTTCCTCCGTGTCCTCCATGCTGCTGACGTTCTGGTTC * tp:A:P cm:i:96 s1:i:939 s2:i:0 NM:i:2099 ms:i:4104 AS:i:4100 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
54 49 16 utg000001l 46993 60 1182S18M2I2M1I21M5I3M1I23M2I26M2I17M2I7M1I3M1I2M2I3M3I1M1D23M1D6M2D6M1D12M1D5M3D18M1I20M1I14M1I5M2I13M1D4M2I28M1I5M1I8M1D6M1I4M1I14M1I15M1I2M2I3M1D10M1I17M1D10M1D18M1I11M1I6M1I36M1D14M1I9M3I1M1D8M1D4M1D1M1D18M3D18M1I15M2I14M32S * 0 0 GGATGACGAAAATAGAATGCCAGGACTGTCAGTACATCCCGTATCTGCATACGAACTGGTAAGAGTGACCCAAATAGATTACTCCTCGGCTCCGAGATAGTAAATCGTCCCTAATATTAGCGGTGCTGGATACGTTAACCAAAACACGGTGCGTCGTAGAGCATTAGTCCATTTAGCAAACGCTGGGGCTTTGTAAATCTACAGATCACGTACCGCCTTCCCCGGGAGCAATTCTATACATGTCAAAATACGAACGCATTAAACCCTTCTAGGTCCGTCATTCGAATAACCCCTGTTTGGTCTGACCCGAGCCCAATCCGACAGCTGGGTGCATGCGGGGGTGAGATCCACTGACATCCGGGGAAAAGCTATGTTGCAAGCTCAGAGCAAACGATGGAGGCGCTCCTCTTAGTCCAAACCAGTATTTGTTCAAAAATGGCAGCTGGATCTCAGAGATCCGGATGAGACTGAAGCCTGCAATCTAGGAGAGGATGGTGCTAGACCCTCGCCCGACTCATGCAGATTACACGTTAAATGGTCAAGAGCCCATCTATGAAAGCCGCCCGGAGGGTATTGCCTTAGCGTGCCACGGGGCCATGCATGACTCGTGACGCAACAGCATCAATATGGAGGGCTGAATCCCGCAGCCACCTCCAGGACAATACCCGTGTAATAATTACAGTTTATCTTAACCATAAGCCTCTTGCAGCTGGAGGTGCCTCAGCAATGAGGCATAACAGAGGAGCTGCAGGATTTTATCTGAATAACCGACGACACGGTCTAAACCACTTCCACCACTGGAGCTGTAAAACGGTACGCGCTCTGCTGCCATTGCATCCCAAGCATCCGGATTTATGAAAGGCAGGTCCGAGCGGTCATCTTCCATGGGCTCCGCGAATGATCCCGGGTATTAATGTGCAGCCCTGTTACCGAACGACCTGGTCGCGTGTGAATGCCGCGGACAGGCTTATGACGCGACTACCGGCGTGGGACAAATTTCAGCCCGTAGCCAATACGTGCAACCGGGATTGGGTCGTCATATCCGTCCATCGAGCAAGCCGTGATGACGCCGGCTGGCCTGGGTGGGCATCGCTCGAGGGGAAGGAGCCCCGTTAGTTTCAGGAATCCAACAGGCGCTGGATGGAAAGAGTTGCCTAGAACTGCTTGCTGCACGTGACAGGGGAGCCGTCGAGAATACTGGCAATTTCAGCTGCGATCCGCGACAGCTTAACCACCGAAAGTACGAATGCGGTTTCCACTCCACTTCAGGGGTCTCTGGCATTCTTCCCACCGTCCTGTTAGTTGATAAATGGCAACGCCGTAAGTCGATGATGGCGTTCGTACTCAATAGTTCCTGGCTGGAGATCTTCATCGCTGGCCTGGTCGCAGTTCTTCAACCTCCCCGGCGCAGCTTTTCGTTCTCAATTTCAGCATCCTGTTCGGCATACCATTTTGGTAAGCAGGGCAGAGTCATAAAGCACCTCATTACCCTTGCCACCCGCCTCGATAAACGGGCATTCCGTGTTCCTGCCGCAGTTCTGAGTGACGTGTGGTACGGATACTCACGACGCAAAATGTCCAGCCGAGCTGCTTTTGTTGACTTCCATTGTTCGGTTCCACGGACAAAACAGAGAAAGGAACGACAGAGGCCAAAAGCTCGCTTTCAGCACCCTGTCGTTTCCTTTCTGTGCGTCCAGGGTATTTTAAATAAAACATTAAGTTATGACGAAGAACGGAAACGCCTTAAACCGGAAAATTTTCATAAATAGCGAAAACCTGTAGTCGCCCCCAGGTCTATGAGAGCATAAG * tp:A:P cm:i:13 s1:i:125 s2:i:0 NM:i:118 ms:i:474 AS:i:474 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
55 50 4 * 0 0 * * 0 0 ACTATTTAAGCACTGGCATTAAAGCAGCAGGATGCTACTCGATCGGGCGGCCGGGACGCTCGGTGTACGTCGATATAAGAAAGTCAGATCGAGCACTCGGCGCTAGCGTAACCTCGTATATATGTCATAAGCATTCGTACACAGTCGGCGGCCGTTAATAGTAGAAGGAAGGAGAAGACGGCCGGTTAAATCGTCGGGTACTCGCATCATAAAGGCTAGTTTCTAGCGGCGCAGGACCCACTCACGTTGAGCCCTTTCAGCAGGGAGCAACGTGAACGGGACCGTCAACGTGCCCATTATTGCCCGGATACATGAGCCATAAACAGTACGACAGTTCACTACATGGAAGTTGTAGACAGTTCTAATAAGGTGCCTTAACGCTTATTCTGTTTATGAGTCGCCTTTGGTCGGGTGAGCATCTGTGGATTTGTGCGGATGGTTATGCTAGAGGTGACAGCGCCAGGCATCGAGGCTTCCGTATGGGTGGGGTCAAGGGTACGCTCTTCGATTTACTTCTCCGAAAGTTAACGGAACCGAAGTCCGTAGGAAGGCCGTAGTGCCTGCGGCTCTCCGCCCGTTGAAGGAAATCGAAGTCAACAAAAGGAGCCCCGTTAACTTTCGCTGGCGTTACGGTTCAGAAGCCCTGAAACTAAATCCATCATGGCTGAGGACGGTACGCTTAGCTGATTCTGCATCGCCGATACAAACAGCGGTCTCAGATCAAACGGAGTTTGAAATTGAAATGAAAGCTCGCGTTCTACTAAAAATGCGCATCTGGTCATGGCTCCCATAAACCGTTGTACGAACGCCAGCAGGACGCTCTTTAACGGTCGACGGCTCTAACAGAACTAACCGAGTAGAGATTGTTGAATAGCGTGAAACTTGGATCGGTTTCTAGCGCGGATTGGACCGAGGAATCGCCAGTGGGATTCGAAGGGGCTCCTTTGATCCGTCCTGCGTGACGTCGGACGGACCTACTTCCGACGATTGGTACGTAAATGTTTAACACGGTGCGCTGGTTAACGGGTTCTATTCGCTAGGTCCTCGACTTATCGCGGACCTTAGTCTGGCGCTGAATAGCCGCGGGATCAGGGCTCGTCCCGTTCGGAGCATTCTACTCACCCAGGCCGCTGATAACCTCAGGTCCTTAACCCCCGACGCCACCTATTAGTCGCCTTAACCGGGCATCACTAAGCGTTGGGAACACTGGTGGCCCGGCGAGTTTAAGGGCAATTCGCGGTCCGTCAATGGATTATGCATCTAGGCGAAGGGGCACGATGCCCGTATCCTCACAAAGCCGCTTCAGCTCGTCCTACCGTAAGCATTTAACATTATTCTCTTTGCCGAACGCATGGATTGGGTAAAAGCGTCTGAAATGAGTTGACGAGTGTAGACTAATCGGCCGCCTTGCTCGCTGCCCCTTATCGACGACGCACTCTTTAAGACTGTTTACCACGGCGATGCCCGATTTGGTGGGGCCTCGTCTGGCCCTTTCTATAGGTAACGGCAAAAACATTACGTGGACGACCCGCGGAGCCCTAGAGTAGGTTTACGACATGCTGCCTATGAGTGATGAACAGGTAACCTGCCTGACGATCGGGAGACAAGCCAGGAAGGCCGCATTGTAAAGCTCAGGCGTGGCTAGAACTCAAAATGATCTAAGCAGACGAGCGCAGGAGGTGTCAATCCCTTAATAGCTCGGCTGCCATGATCCCCGGTTCGACTTCTATATCACAGTTTGACCTGTCATAAGGCGGTGATTCCCTTCGACGCGACGCTCCGCATAATCCAGGTCGCCGGGGATGCCTGGGTACTGAGCACCTATACTGAGCAAGGCGACTAGACCTTCACCGGTCTTGTGTCCGCGTGAAATGGGTCACGATCCATCCGCATCCTCACTGCTAAGCCCCGTCACGTATATGTTCATCATTTATTGACAGGTGATTGACTAGCGGAATTTGATTAGTCCAGCCAGATAGCCTACACCCAAAGACTTTCAGGACGAAAGCGTGATTCAGAAACGAGAAGCGCGGATATGTTTCTTAGTACTAGTCGTCAACGCTAAACAGCGATCGACAGGTTTTCACGATGAAAATATCACGTACTGGCTTGTTTTCGAAGCGCTTGAAGCCCCATTGACTCCATAGAACCGGAATTTTCGTGCTCCGTACGGGTAGAGCACGGGGAGTGAAAAGCTGTTACCCCTAAGCACGTGCTACAGCTGTTCTAAAGGATGAACGGTGCCCCTTTACGCTAGATGGATAAGACAGCTCGAGCGAATTGTCTACGAACCTACTCTGCTCTCTCTTTCGCCCACGTAAGCAAAGTCAGCCCGAACTTTAACTTTAGTTCTGTATCTCGGTTTAAATTTTGACCGTTGATTTCAAAGCCTGACCTACTTTCATTTGGGATTACGAAAGAAACCGCGGTTTGTTGGACATGAAACTCGTGACTACAGGTGGTGAAATATCAGCATAATGAGGCAACCGCTTCACATGACGCTTGCACGGCTAATGAATGCTCCCCGGAGCGATTCGAGCCACATTTCGATTGATTGAATGAATGAAAGCTGAGATTTCAAGCTCAAGCCTTAACAGATAGTTTTTAAACCGCCTACGGACTAAAACACGGTTCTTTAAAGCAAAAGCAATGGACCCGTCTACGCGAGGCATGCCGCCCGTTGCGGCCGCGCTCCTGTCTACCTCGCGGATCACTACGGGTCGGGCACCTGACCCCATTACCCCCGGCTGTTTTATCGCAGTGACAGTTACGCGAGAAGCAACGAAGAAACACGGTCGCGCAATAAGCCCGCGCTGGACTGAATGGAGACAGGTCGACCCGCCCTTCATCGGCGCTCGGACTGGACTGATTTTACGACAGTAAACGGGGCACTCAAGAATGACGGACGAAGTGAGCTCACCATCAGATTAGTATCTCGTGACGTTCGAAAAGTACCCGCAGTCTGACGTTCATCTAAAGTGGCAGTGAAGACCCAACCGTACCGTAGACCTAAGGCAGCGCTCCGTTGAAATCCCATTCTATCGCGACGCTAAACTGTCACCTTTCAATCGCTCGCGGCACGGAGTACGCGCGTTCTAAGCGGCAGCGGCTAAGAGCTGCGCCAAGGGTTCTAATGGATACGCATGGAGCTCGGAAGGGGCTATGCAATGCCCGTGCAACAGCCACGGACGTGGCTTTCACGGACGGGTCTCGAGTCTCTAAGTACGTAAGGTCACGGCTTTCATGTCCTGTCATAGAGCTTTCACTCCAAGCTGGCGCTTTAGCATCGGGGAGGAAGCCCGTGCTTTTCCTTGAGGTTGACTCAATGAAATATTTCGAGTAACTGCCTAGGCTTCTTTCACGTCCGACCGTTGAGCTCCAAACGGACCCATTTCCATTGATTTCGGAGCGATAGAGACCCGGTTTCTGGATTTCGACTCTTTCATTTACCTGGATACTGGCTCGCGCCGGAGACAATACGCGGGTAATCCATTTACGGACGCATCAGGCAACGAAGAAGAAGGCACGCGAAACTCTACTGGCTTAAGGATATCAATGACCGTAGGGGCCGGGTTAACTACATGCGTGACGCGGTTTTCAGGTATGGATGGCAGAACCCGACGCCACCCGTCTATTGGATCCGGGGCCTTGCTTCCGCGATCGATGCAACGAGCTGACAACCCGAGGAACCGTTAACCTGTTCCAAATCGTGTTGAGCAGGAGGTTTGGTTTTACAGTTCGATCTCTTCCGCATGACGCCTCGCGACGAAATCCAAGCCGCATCAGTGGGATCGACATTTAGGATGTATGTTCACAGTCCCAGCTCGAATGCAGATAGCGCAGAGTACTTATAACGCTTTACATAGGATCCTCGGCGCGGCTAAACAGTTCAGGTTACAATAGGGCGTAAACTGTTGACACATGGCGTTCGACCCTGCTAGCTGAACAAACTCGTCATTCCTTAGCCGTTGGACTCATTCACCTTGCTCACCGGCTCGCGTTATCGACAAAGTATTAAGTCTGATCGTCTGTCACTGCAAGCCGACCTCACAACCGTACGAGACGATCGATTAACTGTATGTCTGCTGTAGAGCATCACGCTGCGAGTAGTTTCTTCCTCCTGAGCATCTCCCTGAACTACTGTCACGGAGGTCCTGAAGGGCAGACGGGCACCCGGGCTGACGGTTGGCCCCGGTGGTTTATGCGGTGTGCTGACGCGTCGCAGGCGGGGCACCGTATTATCCTTGGCGCTCTATCGTGAAGGTCGTCATCGTTTAGATGCTTCGGCGTGACTAGTATCCCAAACCGTAATTCAGAGGTCGCCCGTAACGGATGCCGCGGGAACTGGTGACGGGGATAGTTACTGAGAGGACCTTACAGCGCGGTTTAGGCTTTGACGAATTTACCAAAGCGCTATTCTAATTCTTGGAAGGGAGCTCACGAGAAAGAGGCAAACAGCGGTGACGACTGTTACTGAAAGTTGCTCAGCAGTACCCGAACGTTTGGGATTTGCCGGCCCACCGCCGCTTGAATCGCCCGCTCGTAGCCCCACAGGCGAATAGGGCTTCATGACAATGAGACATAGTAAAGTCGACTAATATCGCGATTAATTGCCGTTCGCATATAGAGTTCTCATTTCATTTAATCGTCGCTGGCATAGCCGGCCGGGGCCCCGCAATCGGCTCATGGTTTCCTAGCCTGCCAGCCTTCAAGCGTTACGTGGACGGGACTCTCGTATTCTCTCATTCAGCGAGCGATCGGAGACGGATTGTTGGCTACTGAAGCAAGACCACCGTCACTTACAGTCATAGATGAACGCATCGCGACTTAGCCGCCGGGGTGTCCGACGCTCTCACGGATCGTGGTGGTGCACCCATTTCTAAGAGAATGGAGAGAAAGGCGAATTCATTATGAGGTAGCCAATCATGTTGCCATGCGACTAGGACTCGTAGGAAGCACTTTCTTTGCTCGTCACTCAACTCATGTGGCTAACTGTTCGGCGGATCGTCGACCGGCATCACGATTTCCCGATCCTTCGCAGCCGGACGCTGCCGCCTGCCAACGAAGGGACTGCGATCTACACGTTACAGAGCGCGATCCTGATGCCTCATTCCCCTCTCCTTGATTGCTGCGGCCAAGAGAACGGACTTCACCGAACCGTCCCATTCATGGCCGGCTCACAGGATTTTAGGGCCCGCCGTCCCTTAGAAAAGTTTCGTTGAAATTCACCGTCCTACGTGGACCTACCGGTTAAGGGATCCGCATAATCCTAAGCGTATTTCCGAGATAGAAATGGGAGACTCTGCACGTTCACGGACCTTCCATCCCCCTCTCCCGTTCTGGACGACCGTCGTACTCTGGACGAGCTTCGACTGAGCTTCAC *
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
56 51 16 utg000001l 10572 60 222S2008M7I11M1I6M1D6M4D11M3D19M1I2M2D2M1D27M1I2M1I13M4D27M6D2M2D13M1I8M1D3M2D1M1D6M4D8M3D13M1I5M2D2M1D4M1I22M4D10M1I12M1D16M2D11M1I19M1D8M1I7M1D12M1I8M2D10M1D19M8D3M5D25M2D2M1I2M1D11M3D11M1D8M2D6M1D21M1D8M3D20M4D5M1I7M1D16M2D8M2D7M1D14M1I14M2I8M1I3M2D33M2D2M1I14M2I1M3D16M2I9M3D17M5D21M1I33M2D6M1D8M1D7M2I3M1I6M2D6M3D37M1D3M2I4M1I5M1I10M1D3M1I3M1D4M4I4M1I5M1D3M1D4M1I10M3I4M2D20M2D7M2I4M1D5M1D6M2D6M4D6M1D1M2I17M1D5M4D5M2I5M3D15M2D1M1D3M1D5M8D3M1I3M1D3M2D6M1D12M1I1M2D2M2D6M3D3M1D12M1D12M1D20M1I12M1D4M1I12M6D10M2D31M4I25M1I8M1D40M1I24M1D52M1D5M2D32M1D35M2D19M1D34M6D3M7D11M1D11M2I5M1D6M1D6M2D6M1I2M1I11M1I15M4D6M1D5M3D10M5I21M2I4M1D4M1I2M3D45M6D45M1D40M6D7M5D20M1I36M6D8M1D2M6D7M3D7M5D1M1D4M1D12M2I1M2I1M1D7M1D1M1D9M1D5M1D8M1I9M1D4M1D11M3D8M1D13M1I6M5I12M1I12M2D38M1I12M3D8M1D10M4D1M1D12M3D23M1D6M3D8M2D10M1D25M1I5M3I9M1D8M1D5M3D1M3D5M2D22M3D6M1I4M1D1M2I15M2D5M1D1M2D21M1D18M3I9M1I4M1D10M5D11M1D6M5D4M1D4M3D2M1D3M1I16M1D6M1I1M1I6M3D5M1D9M2D1M1D3M5I3M1I1M1I8M3I18M2D4M2D5M3D8M1D16M6D8M2I10M7D3M1D3M6D28M3D11M3D16M2D12M1D6M1I1M2D7M2D24M4I16M1D4M2D5M1D10M1I2M3D10M1I17M3I3M1D6M1I40M3I1M1D10M1D3M3D11M3D6M1D9M2D16M2D4M1I5M2I16M1D4M3D2M1D4M3D5M1D6M3D15M1D24M1I6M4D4M2D4M1D11M1D16M1I3M1I2M1I4M1I18M1I9M1D3M3I10M1I7M2D6M1D17M7D19M3D19M2D3M1D1M2D4M1D7M3D5M1I13M3D10M1I11M1I9M1D6M1I2M2D2M4I24M3D29M1D6M1D4M2D19M2I3M3D4M1I12M1D16M2D9M2D2M1I2M1I1M1I3M1I5M1D2M2I6M1D2M1I9M3D4M2D8M2I2M1I24M2D2M1D1M1D21M1I25M1I3M2D22M1D1M2D1M1D15M3D2M1D2M3D22M2D1M1D7M1D29M4D10M3I7M4D3M2D9M2D8M2D6M1D4M1D5M4I2M2D4M1I4M1D14M1D17M1I7M1D4M2D5M1D2M3D22M3D1M1I2M1D13M1D6M1D26M7D3M2D3M1I10M3D1M1D26M3D16M3D1M1D5M1D8M10D15M6D2M3D7M2I13M4D10M1D9M3D2M1D20M3D1M1D3M1D4M1D4M3D1M5D15M6D15M6D6M2D9M1D13M7D24M2I5M2D4M1D1M1D2M1D5M1D5M4D4M2D8M3D3M4I5M3D3M2D3M2I8M5D1M1D3M2D1M1D3M1D1M1D4M2D9M5D3M1D13M3D13M1D9M1D7M1I2M1D4M1D2M1I6M1I7M2D4M2D11M1I4M5I5M6D4M1D8M2D10M1D8M1D3M1D1M1D22M1D13M1D14M1D4M1D5M2D4M6D14M2D28M3D7M1I7M3D20M1D6M2D4M1D7M1D15M4D5M1I8M2I4M1I34M1D13M3D12M1I9M2D16M3D3M2D3M1D7M2D1M1I28M6D18M5I6M1D3M5D9M2D10M1D7M3D2M2D11M3D43M5D9M2I3M1D7M2I18M3D16M1D2M2D43M2D3M1I2M1D7M2D7M11D13M1I9M1D2M2I6M1I4M2I9M1D7M1D3M3D4M6D2M2D2M2D9M3D8M1D3M5D2M1I10M1D5M1I20M1I6M1D5M4I5M1D2M1I8M1D2M1I2M1I3M7D11M1D5M1I4M1D6M2I13M1I5M2I8M2I1M1I8M1I4M3D4M2I1M2I24M1I2M1I7M6D7M1D5M3I18M2I1M1I4M1D2M2D7M4D12M1D5M1D2M2D6M1D12M2I4M1I4M1D5M1D12M3D3M1D5M2D6M5I6M1I6M3D7M3D4M1I7M1D8M1D10M2D4M2I2M1I9M2I2M3D5M2D3M3D7M1D14M5I1M1D6M1I9M1D12M2I6M1D18M2I4M1D2M1D3M1I1M1I11M2D6M9D4M1I10M5D3M1D2M1D3M4I18M3D6M1D2M4D5M5I2M1D4M2I18M2D15M1I8M1D2M2D4M2D21M2I4M1D5M1I3M1I1M2D6M2D2M4D9M1I1M2D8M1I6M1D10M1D31M2I6M1D6M1I4M1I22M1I2M2I8M1I12M1I3M4I9M4I3M1I4M1I2M1I1M1I7M2I15M1D14M1I10M1I2M2I11M1I2M4D3M1D17M1I1M2I6M1I6M1I2M1D1M1D8M5D3M1D3M1I6M1I17M5I10M1I12M1D6M5I9M4I1M1I4M1I1M1I6M1D4M2I13M2I30M1D4M1I2M1I17M1I10M3I4M3D7M1D5M1D10M1D2M1D4M1D9M4I14M3D1M2D3M1D2M2I9M1I5M1D7M1I4M2I18M3I12M2D18M1I11M1I15M9D21M1I9M1I2M1D3M1I4M2D7M2D4M1D7M1D4M1D3M3I9M3D10M2D15M1D4M1I21M1D3M1D8M2D28M1D6M2D6M4D5M3D4M1I4M1I8M1I3M3I2M4I3M5I5M1D4M2D2M1D4M2D7M3D5M4I1M2I6M2D5M1I10M2I4M2D2M1D21M1I9M3I21M3I19M1D3M1I5M1D9M1I11M1D17M1I18M2I8M1I6M2I4M1I23M3I3M3I7M1D10M1I3M2I15M1I4M1I3M1I1M3I7M3D2M2D9M2I2M1D9M1I4M3I2M1I9M1D3M1D9M1D1M3D3M1D3M3I2M1I5M2D2M2I6M1I4M1D5M1I2M1I6M1I1M1I11M1D5M1I17M3D1M1D24M2I1M2I6M2I8M1D9M1D14M1I5M1I2M1I6M5I19M1D7M1I6M1D2M3D5M1I3M1D8M1I15M3I1M1I11M1D3M3I12M1I1M1I4M1D1M7D8M1D13M1I2M9I12M3D1M1D12M1D25M1D8M3D8M1I2M1D2M2I2M2D4M1D3M1D10M2I2M2I5M1I6M2D11M6I20M2D18M1D16M2I3M1I5M1I6M1D6M1I7M4D9M3I14M1D2M1I11M1I4M1D3M2I4M1I5M1I11M2I6M1D22M1I8M1I3M1I8M1D2M2D8M1D12M6I13M1I4M1I10M1I5M1D11M3I1M1I11M1D2M1D56M1I1M1I9M6I2M1D5M5D2M2D17M10I4M1I27M1D2M1D8M3D5M1I4M1I15M5I4M1I2M1D5M1I4M2D11M2I38M1I1M2I14M3D9M1D2M2I4M1I11M4I6M1D16M1I9M1I2M1I4M2I28M3I5M1I7M1D8M2D15M1D4M1I14M2I18M2D11M4D17M1I10M1D3M1D36M2I3M1D16M1I6M3D17M2D3M2D2M1D13M1D5M1D40M3I9M3D6M2D15M4D12M1I11M4D2M1D26M2I10M1I13M1I2M2D5M1D14M1I12M3D3M1D21M1D5M1D9M2D8M2D2M2D11M1I1M1I5M5D10M2D24M1D3M1D22M1D76M2D19M1I1M1I9M2D15M1D10M1D25M2I21M3D6M2D26M1I23M2D9M1D16M1I4M1I18M2D4M3D11M2D10M1D5M1I10M2D1M2D17M2D22M2D11M4D1M1D4M3D2M1D7M1D5M1D5M2D3M1D11M2I1M1D6M1D16M1D3M1D15M1I4M2I3M1I4M4I6M1D3M3D5M1D4M1D16M2D2M1I7M1D8M1I27M2D13M2I13M3D2M1D2M2D2M3D3M3D5M1D13M1I5M1D8M2I3M1D11M2D14M1I8M2I4M1D12M1D10M2D6M1D4M4D32M3I12M1D9M1D3M3D8M1I11M6D15M1D7M1I1M3D6M1D5M1I1M2D8M1D2M2I3M2D4M2D11M4D8M1D5M1I6M1D16M1D5M2D20M1D10M30S * 0 0 TAAGTAACGAACGACGCATACCCTCGAATCAAGGAGCGTCACCTTAACCCAGGTTGAAAGAAAAACCATATGTACCCTTAACCGGAAATGGTTACCCTCATGGGATTCGCATTCAGGCGTTAATGCTTTATTTACCCTGAAGTAAATGCATCCTTGACTACCCTGAATTGCAATCAAATTCTAATCGTTGCATTTACGCTTCCTTACGAGAATCTAGAGTGAAGCGGTTAGTATGCAGCCGTCACTTAGAAGTGAGGGTAGCGTACCTTTCTACTGTTCAGGCAGGATGTTCATCTAAGCTGTGACTTTACCAAAGGCTTGCGAGAGATGGGTAAGCACACGACCAAAAGGCCGATCGGGTCAATGCTTTCTGGCGAGTTGAAGGATTGCAGGACCGGCCAGTAACAGCTTCAAGCGTACACCCTTTCCTGACGCTAGAATGTAATTCTCGTCACTGAGCAGGGCTGTTGAGCCAGGCTTCGCATAGCCAGACTTGGGGGTGATGGTTTTTACCCAGTCAAGAAACTGATCAGGATAGCGGTCCTGTTTTACAACTAACCTAAACCCACGTACCCAATGATCCATGCAATGAGTGTTCCAGGCGGGAAAGAGGAATGGGAGTGGCCTGAAGAGACGTTTGCTGATCGGACTGTTCTGGTCTGGCGCATAGTTGATAACAATTGAGCACAATTCATCGAATTAGGAATTTTCACTCCTCCGAGAACATAAAGTAAATGGATTGAATTATGAAGAATGGTTTATGCGACTTACGCAGCAAAATAAAGGAAAGATACAGCTGATAAACCTGTCTGTTTTCCTGCATTCTGCTGGCTCATCATCACCTGCGAGTTGGCTGCATTATTGTATATTCATAAAATCGATGGAAAAACTTTTCTCTTTACCAAACAAATAAAGAGTGGTTTAGTATAATTCTAACTATTCAGTTGAAGATAGCAGAACAGCCTCGCATGACGAATCATTGGGATTCCCATCTTTGTTGAAGGGCGACACCATTGGTTTTGCCAGAACTGTTCGGCCGACCATCGATCTGACCATTTAATCGGGAAAGGAAGTGGTTTAAGCAGTGGAGAGCGCGTTCAGATAGCGTCCACTAGATGAGGCGTCAACCGTCCAAAGACGATGTTGGATATGCATTTCATCGGCCGAACAACGGTGAGCGACTAAGCTAGCTTGGTTTGGCGTATATTAAAGGTCTTAGCGTAACAGATATTAAATGAAGGGAGCTTTGACTCATTGGATAGTCATTAAGCCAAAATTTAAAGGGATAAAAGGTTGCCAAGGATATTATTTATACCGTCAGCTCGATCGACATTAGCCTGCGGCAAAGATGAGGCTGGAGTCTTTTAACAGAACAGTCTATCAAAGCTGACCTAAGGGGACCCTTAGCCCATCGCCTAGTGCGAACCATGGGAGCGCTGAAGAGGCGCATCTCATTAGCAAGAATGAAACCAGCTCATACTGGAATGGCTTTAAAGCAGGGCAAAGTAAGGATTAATTATATGGAGTAATTATGCCGCGAGAACGAGAATCATGCGGTGTTTACATAGTAATAATTCCTCATCGTTATCGTAAGCATTCATGGCCTTTCCTCCATTCCTCTGTTTCTTTTCAGGCTAGTCATGGTCTTGGGGCGAGTACTTATCATATGCAGGAATAGATGCAATTCTGATTGCTGCCTTGACGTTTAATGGGAAGCAGAACGCGCGACCAGAATTAGGATATAACCCTGTAGTCTTGTCTATTAATTTGTCAGCTTGGCGCTTCTGCCAATCTTTAGTCTTCAGCTAGCGGGTAGCATGGCTCTAGTCTCGGGCGGCTTGCCTCTTGCTCCTGCGTTCATTCAAGTGCATCGTTGGACCTTTTACGATATCTACGGTACCCTCAAACTGTTGCCGGACCATCGCACCCCAAAACACATAACCAATTGTATTTATTGAAAGTAAATAGATACAACTCACTAAACAGCAATTCAGATCTCTCACCTACCAAACATGCCCCCTTGCAAAATAATTCATAAACATACACAGATAACCATCTTGCGGTACAATTATCTGGCGGTGTTGACATAAATACCGGTGATACTGAGCAAGAGCAGGACGGACTGACTACCATGAAGGTGACGCTCTTAAAATTAAGCCCTGAAGAAGGGCAGCATTCAAAAAGCAGAAGGCGTCCTGTGTGATACGAAACGAAGCATTGGCCGTACCTGCATTCCAATTAGCTGCCACCTTACGGGATTCGGTTTTCAGGGACTACAACTGCCACACACCGACTAGACTGACAGGAGAATCCAGATGGATGCTACGACAAACACGCCTCGAACGTCGCGCAGAGAAACAGGCTCAATGGAAAGCAGCAAATCCCCTGTTGGTTGGTAAGCAACCAGTTGACCGCCTATTCTCCGCTGAATCGCAAACCGAAATCACGGTTAGAAAGCGCACTAAATCCGATGGGACTTAAGTGCTGGCTGAATACCAAACAGATTGAAAGCAACCTGCAACGTATTGAGCGCAAGGAATTAGGCACATGGTACAGGCAAGCCTTGAACGCGGCATAACATGCAGTGGACGCAAATTAAGGGAAAATCGATTCCTCTTATCGTGTATGCCATATTGGTGGCTTTATCTAATATTATGGATCATAGCTGGCAACTAATTCAGGTCAGTAAATCTTAAGTGGGAATAATATGCTTCCATTTCCATCGGAAAAGTTTTGTTCAACACCAAGCTCAATCAACTCAGGATGTATGGGGAATTGTTTGGAGCTACAACCACCATTTCCTGCCTTCATTAAGGGCTGCGCACAAAACCAGCATTGCTCTTCTGTATCATTTGAATTACTGATCGCACATTTATCGTTTTGCATCTTAATGCGTTTCTTAGCTTAAATCCCGGTAATATCTGGCGCTGGCAAGGCCTGATAATCGATGCATTAATGCTCGCGAAATGCAAGAGCAAAGACGAACATGCTACATGAGGAATACCGATTCGTATCTTAACATATTCGGCCTCAGTCTATCTGGGCTTAAAGCAGTCTAACCCACGTCATAACGATCAGTAATGGTTTCTCTCCTGCCCAGGTTCATTACTGAACACTCGTCCGAGAATACCCCGATCGCTCATTTCTACTCAGACTGTGCCCCATTGTAATAGTTTATTGATTCTCGCTGTGTAGAACACGAGAACCATCGTCTGTTAACACTAATTGTTACCGCATGTACTATTTACATGATATGGAAGAAGAATTTGAAGGTTCGAAGAGCAGCGGCCGGATGTGATGGAACAATACTAGAAGTACGGTCATGACTAAGCCTTAAATCAATGGTGGACAATTCAAGCGATGCAATGGATGCAAGCTCGCTGCAATCGGATTGCAGCGTTAAGCCTGAAGAAATGTTTCCTGTAATGGAAGATGGGAAATATGTTGATAAATCTGGCAATACGAACGACGGCAATGATGCCAGAGAACTTGGTAAACAGAACAACAAAGCTGCCTGATAGTGGCCTTTATTTTGGCATAAATAACAGAACAGACACTGCACTGTGTTTCATTCCAACGAGTGAATACACGGAGCAATGTCGCTCGTAACTAAACAGGAGCACTTGTTCTGACTATTGGAAATTGCCTTTAGCCTTGATTTATCTGCGAGATATGAACAGTCATGTCAACATCAAATACCCTTACGGTGATGACTGGAAAGGCATCAATAGAAAGTGAAATCAGCATTAAATGTAAGCCGACAGGAAAAACTTCATACGGTCACGGTAATTCTGTCAGACTCTGAAGCCCGACTCAATAAAAATCTATCTGTATTAAATGCTTAATCTCGCTGGCGCAACATGCTCTGCTTAGCAATTTCAAGCGATTAAATGCATATGGTGTTGTGTGTGAGTTCGACTGGAATGATGGAAATGGTTAGGAAGGATGGCCTCACGATGGCTGTAGCGAAGGAATAAGAATTACCGATGTATCAGGAATATTGATTCATGATATTAAGGCTACATGAGTGCCTGCCGTTTACGCTCCAATAACGCTTCATCGCGTCGTTTTTCGTTAGTATAATAAGGAGCACCATGCGACTGCCATTGCAGGCGTCGCTTCGTGCGTTGCTGGCTGCCCTTCCGGATCTTACTTGAACGAATCACCCGTTAATTACGTGACGGAGGGAAACGCCTTATCGACTACTTAATGTCAGCCATCCAAAGAAGCATTCAAACACTTATGGCCGACTTGATAAATTTATCGGTATTTATTGGCGTGAAAGATGTTTCGTGAAGCCGACGCACGGTCGCTAGTAACGGTATTAATATGAAACTAGATCAGCAAAGCATTCACTAACCCCTCCGGTCTTCCACGATCAGCCCGGCATTTCGGGCACTTTCACAGCTATTTCAGGAGTTCAGCCATGAACGGTCCTTACATTCAGGATTCGTGTGAGGGTTAGGGCGCTACAGAGCAGCTTCACGTGAGGAAGAAAGGCAGAACTGGCAGACGACATGGAAAAGGCCTGCCCAGACTATTTGAGCGCAATCGCCTATGCATGTACGGTCCGGTGCAACGCCACGCCAGCAAATCCATTACCGTGCGTTTGATGACGATGTTGATGGCTTCAGGAGGCAGGCAACATCTTACATGGTTGAAACCATTGCTCACCAGGTTGATATTGATTCAGAGGTAAAACGAATGAGTACTGCACTCGCAACGCTGGCTGGGAAGCTGGCTGAACGTGTCGGCATGGATTCTGTCGACTACAGGAATTATGATCACTCATTCGCCAGACGGCATTTAAAGCTTACACGAACAGGTTGCGTCGGTTCATCCTCGCATTACTGATCGTTGCCAACCAGTACGCTCGCTTAATCCGTAGGACGAAAGAAATTACGCCTTCCTGATAAGCAGAATGGCATCGTCATTGGGCGTCCTGATGACTAGGACGGCTGAGCAGCAAAGCAGTTGATGGCATGGACTTTGAGCAGGACAATGAATGCTGTACATGCCTAGATTTACCGACGAAGTGATCATCCGATCTTCGTTACCGAACCGGTATCGGTACTGAATGCCGCCGCGAACCGGTTTCAAACCCCTAACCCTAAGTAACGACTAGTCGCAGTCATTCGCATCCCAAACGGATGTTACGTCATAAAGCCATTCAGTGTGCCGGTTCGGTTCATGCTTTAGAGCGTCAACCTACGAAGCCGAGCGCATTGTCGAAAAATACTGCAGTACACTGCAGAACGTCCACTCAGGGAACGCGACATCACTCCGGTTAACGATGAAACCATGCAGGAGATTAACACTCTATGATCGCCTGCATAAAACATGGGATGACGTGACTTGCTTGCCGCTCTGTTCCCAGATATTTCGCCGCGACATTCGTGCTGCATCGTCAGAACTGACACAGGCCGAAGCAGTGAATCCTTGGATTCCTATGCGAACAGAAAGCCGCAGAGCAGAAGGGACCGCATGACACCGGACATTATCCCTGCAGCGTACCGGGATCGATGTGCGAGCTGTCGAACAGGGATGATGCGTGCAATTACGGCTCGGGGCTCACCGCTTCAAAGTTCACAACGTGAGCGCAAACACGATCCCGGAAGAAATGGCCTGACATGAACTTTTACCCATTTCTACATGCTTGCTGAGGTTGCACCGGTGGCTGGAATCAACGGAGGCAAGCAAACTGGCCTGGGGAAATATACGAGGAACGACGCCAGAACCCTGTTGAATTCATTGCGTGAATGTTACTGAATCCCCCGATTAGCTTCGCGACGAAAGTATGCGTACCGCCTGCTCTCCCGATGGTTGCGACTGCAACGGCCTTGAACTGAAATGCCCGTTTACCTCCCGGGATTTCATGAAGTTCCGGCTCGTGGTTTCGAGGCTAAATCAGCTTACATGGCCGTCATATGCAGTACAGCATGTGGGTGACGCGAAAATGCCTGGTACTTTGCCAACTATACGGGGTCGAACCGTGAAGGCTTGCACTGTCGTGATTGAGCGGGGATGAAAGTACATGGCGTTTTGACGAGATCGTGCCGGAGTTCATCGAAAATGACGGAGGCTGGCTGAAATGGTTTATTGGGGAGCAATGGCGTACGCATCAACGATAATATCGGGAGGGACTACTTTCGTCTACTCCGTTACAAAGCGTCGCGTATTCCCCGTCCTTCTGTTATCGAAATCACATGAACAGCAAACCGGCTGGCTGAGGAGATAAATAATAAAACGAGGGGCTGTATGCACAAAGCATTCTGTTGAGTAAGAACGCTACTCCAGATGGCACTTTGTCGCTCAATTGGAATCAGGTTGTGCCAAACCAGTAGAAACAGACGAAGAATTTCATACGTTAGCCGCATCCCTTCACAAAAGCTGGAATGATGGTGGCGAAAGGAAGCAGATGAGAAACCAGGTATGACTCTCGAATGCAGTTCTGGCAGCGGGCTATTCATGTGTGCTGGTGTGCCTTGCTAACATGGGACTTGTTCAATGACACCTCAGCAGGAAACGCCTTTCACAGCATTGCCCGTCAGGCATTCTGAAAGTAAAAGGACAGCAGTTTCCATTAAAACGTCGATGACATTTGCCGTAGCGTACTGAAGAATCACCGCGTTACTAAACGGATCGATGGGATTCACATGACTCATTTAAGCTGGCAATCGGCATGTTAAACGGCGTATTTACGAAACGATGAACATGAAAAGCAAACAGGAATCAGGGCTAATTTATCCTGTTCGCATTCACCTCAAGCGTATTAACCAACAGTCGGATTAATGAAAGATGGCAGACATCATTGATTCAGCATCAGAAAGTGACGAATTACAGGCAACACAGCAATAAAATGCCGCCTCCCGTCCCCGGCACTATCTTGGGCCTGATGTTGCTGTGGGCGATCGATAGATGAACGAAGACGCCGATAGTTCAGGGTTGTCGACTTGTGCAAGTGCCAGGAGGATCTGGAACTTATCAGTAAACAGAGATTTCGAAGTGAGCGAAATTAACTCTCAGGCACTGCGTGAAACCGGCAGAGCAGGCAATGCATGACGTTGACTGGGGCATTTTGACGAGACCTTTCCAGCTGAATTGGTAACAGATGCCATGCTGGAACTGCTGGATGAACGGGAAGAAACCACCAGCAATACATCAACGCCGCGAATAGGAACGCTATTGCGGACAGTGGCTCAGAGGAAATTCGTGTTGAGGTCCTTGAAACAGCAAATCAAATCAACGAGCAGATTGAGTATTACGAAGGGCTTATCTCTAGATGGGAGTAAGCGGTTTAGACTGGAAAGCGACGAAGTCGTGAAGACGGGAAACCAGTTTCTTGATTCATCCTGGGAAGACTCCTGTTATCAAGCTTAATCGGACTGGGATGGGAATGTTTCTGCGGCAGTAATCGAACAAGACCCGTCCTGACCTGACATCATTACGCATCGATTACGCGTACGCGGTCACTTCAGGATGCAGGGCTATCTGCATATGATGTCTGACGCTGGCATTCGGCCCAAAAGGAGAGTGAGATCGGTTTGTAAAAGATAACGCTTGTGAAAATGCTGAATTTCGTCGTCTTCACAGGGCTGCCAGAGTATGTAGATGTGCATGATGGTAACATTCCTCAGGCTTATCTTTACTGTTCTTCACATAACATTGCTGATACCGTTTAGCTGAAACGACATCATTGCACCATTATCTACAATGAGTATCAATGAGTTAGAGTGAGCAAAAGATTGGGGCGTTATCAATGTTGTGCAGATCCGCTTGTCTCCATGCAGACATCACGAAGGCTTTATGTAGATGAAGGATAGATAGAGTGGCATACAAATATTCCATGATTAAGTCTATGAAGACAAATCCCCATTCTGCAAGTCGGTGCGAGAAATGATCTACCGTGCAATTATCACGAGTACGGTGGAAACGATACTTGCCCTCTCTCTGTACAACATATAGATGATTAACCCAATATTACATAACAATTCCGCACTCGCGGGGATTTATTTATCTCTGAATCGCTAATCTAGTTTGTTTATGGAGATGATAAATGCATTCCGGTCACAGGAATGGAAGCGAGCCCATTCAACAGAGTTATCGAAGCGAACATCAACGACTGCACATACGGATGATATGGGCGGCGCAGATAGCACCGACTAACCAATATTCGAATTGAAGAACTGAAAGAACACCAAGCCGCCTGATGGCGTTTTTCTTGCGTAATCGGAGACTTGCGATGTACTTGACATTTCAGGAGTGGAACGCACGCCCGACTAAGAAGCCTTGAAACAGTTCGTCGATGCTTCGGGAATGCAGGATATTCCACTCGGTTAAGGAGCATGGAAGAGTATCTGTTCCACGAATCAGCGGTAAAGGAGTGACTTAAATCGACCAGTAACAGGGCCCTTTGACCAGGATCGAAATGGGAAGAAGGCGAATCATGAGCCGGGATTTACCTAGACCTGTTAAGAAACAATGGATAAGTCGTACTGCTACAGGGACCCAAGGACGGGTAAAGGCTTTGGATTAGGCAGAGACATGAGAATCGCAATCACCTGAAGCTACAGGCCAACATTGAGTTATTTCCAGGACACAACACAGCCTCTGACAGCGAGAAATCAACAGTGATAATTCGTTACGTTACATTCATGGCGTCGATCTCTCAGAAAATCCTGGCCAGCAGGAGGAATCAAGCAGAATCAGACACTCATAAATTACATGAGCAAAATTAAAGCAATAAGGAGGGGTGAGTCTGCCTGATGCTCACTGCACATCACCAAAAAGAAATTGCGGCATGTGCTCAATGAATAAGAGAAGCGTCGACCGTGGTCGGTACTAAGATCAACACTGAGCTGCATTCGAGGGGAGGCAAACTATGAAGGCCATAACAAACCATGTCGCTGCCACTCGCGCAGCAAATCAGGGTAAGGAGATCAAGACTTACGGCTGACGAATCTGAAAATTATCAAGCAGCAGAAGATAGTCATCATGTTGGGGCTGGACTGCAATGGAAACTGGCTGTTGTTACCGGGCAACGGAGTCAGTTGGTGATTTATGCGAAATGAATGGTCTGATATCGTGATGCATGACGCTGTTATGTTAAAGCAAACAGGCGGATTAAAATCTCATCCCAACAGCATTGCATATTGATGCTCTCGAATATCAATGAAGGAAACATGTGGGACCGCAAATAGATGCACCATTCCGGAGAAACCTAATTGCAGCCTCGTCGCGAACCGCTTCATCCGGCAAGGTATCAAGGCTTTATGCCGGCACGAAAGCATTAGCGTCTTCCTTCGAAGGGGATCCGCCCCGCACCTTCACGAGTGCGCAGTTGTGCACTGCGCTCTGAGAAGCAGATAAGCGATAAGTTTGCTCAACATCTTCTCGGCATACAGTCGGACATGGCAGCAGATACAGTATCGTGCTGACAGAGGCAGGAGTGGGACAAAGAGTGTGAAATCAAATAATGATTTATTTTGTCTGATAGTGACCTGTTCGTTGCAACAAATTGTACGACCCAATGCGTTGTCACTGCCAACTTAGTATAAAAGGGAACGAGAAACGTAAAATAGGTATAAATATAATATTAATTAGATTTGCATAAACAGACTACATAATACTGTAAAACACAACATATGCAGTCATTAGAATCAATTACTTAGATGGGTATTAGCATGTAACTATCCCTCAAGGCGCACATGATTTGTGTTCTTGCGCTTACGATTTGTCATTCAAACCTGTCGCACTCCAGAGAAGCACAACGCTGGACTTAGTCTCCAATTGCAAAGCTTTGTGTGCCCTCACTACAGGACCTGCAACCAGTAAGAAGATAGCAGTGATGTCAAACGACGCAGCTGACTTCCTTCTGTCGCCACGACTTCCCCACAGCATGCAACCTCTTCTCATAACTGTAGGTGAATGTCTGTTGGCTGAGGAGCGGAAAGTTACACTTATGAAAACATGGCTACGAAGTCGTGGCTATCTATCGGCTTATTAGGTACTTGAACGCTTCCAGAACGCGGAGGGCCTAATTAGTTCGGCGATACTATATATATGCATTAATGACTATCGTTGGTATAAACAGTGCACCATGCAACATGAATAAAGTCCTTATCCAAAAGGAAGCAGAAAGCTAAATATGGAACTATCAATACGATGCCGTTAAGGTTCAATACTAATTTAGATGGAAAACGTATCTACTCAGTAATTAAAAGAGATCCTGTGTTGCCGCCAAATAAATTGCGGTTATTTAGGCATAAAATTACATTACTATGTCGGAGTTTAGTGAAAGAGGCGGTATATATTCCTGCATAGAAAAATAAGGCATTCCTACGAGCAGATGGTTGGAACTAACTATTCCTTTAGTCAATGTTTATTGGCCTGTCTTTTGATGAGCATGTGAAATGCGATATCGGAAATGTTAAATTGTATCGTGAGAAAGAAGTAAGCACTTATTCGACTTAATAAATTCAGTCACTCCCTGAAATGGTTTTTCCTTAGTGAAAGCATTGACTATGTTAGTACTCTCAGCAAATTAAGCGATGGTTTAACATAACCTTCTTAAAGCTATTCAGGATTTAGTAGTATGGCCAAATCGATTAGCCGACATTGAAATGAAATGTCAGTCCTTAACCTCATTACTTAGAGGGTAACTCTTCAGAAATTCATGAAAAGTTCGCACGTGTGTTAAATGGTTTGCCAGAATGTGGATTTCTCATTTCATTTAAGCGAAAATGCTGCTCCGGATTCAGTGATTTAACGTTTTAGCTGACGGTTAATTCTATGCCCAGAGCACGAACATTCATGCTTTTATCGGCGGAATCGGTGGTAAAACACAGTGCATTCGAATGATTGGTGCGTCGCAATCAACCCAGAAAACAATGAATATTTTCTGAAAATATGCGTAAGGGAGGATCCAAAGGATATTCGATCGCTTGTTCGTAGTTCGTTAGTGCATTTGATTCTTATTCTCCTAAAGAACACTTGACCCAGAGCAAAATGAAGCTAATATTTATTGGTAACCGCAGAATGCTGCCAGGCAATAGTTTAAATGATACAGGGAGATCTCCGCTTAGAATTCATTCAGCATTTATTTGGTTGTATGAGAGGTAGAACACACTGGCTGAACCTATCAAACAGGAATAGTGATGAAAACTTTCAAATATGGAACTCATCAGCCTCCATTTCTACTAAATATGGATCAGACGGATGAACCACAGATTCAAGTGACGATGATAAATTCACTAAAATTGTTTTATAAAGATATCAGAAATATGCTTCGAAGGGTGGGACATGGCAATTGTTTATTTATAAGATTAGTAATGTCGTCTGAAAATTACTTAGTTGGATTCATGGGAAGGAGCTTCATCTGCATCAGCTCTCTCGCTTGCTTTACGAACATTAAGCGACTTATCCATGCACGCAATGGTGTAGCAATAATTGCAACATTATAAACACCCAAGCACGCATCGGAA * tp:A:P cm:i:507 s1:i:3132 s2:i:0 NM:i:2759 ms:i:8300 AS:i:8300 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
57 52 16 utg000001l 11385 60 4S6M2I3M1I8M1D2M4I17M1D1M1D2M2I30M1D5M1D7M1D1M2D4M1D14M2I33M2I1M1I3M2I21M1I9M1D4M2D1M1I16M1D1M2D6M1I10M3I3M2I22M7I6M1I1M1I6M4I1M1I17M1D2M2I12M3I2M1I13M1I5M3I9M2I5M1I5M3I10M1D1M1D6M3D13M1I14M1I11M2I1M1I19M4I5M4I14M2I11M1D11M2D2M3I4M2I3M3I17M1I5M1I5M1I9M1D11M1D5M1I3M2I17M2I9M1D16M2I1M1D8M5I1M1I10M2I7M1D6M1I22M4I1M2I3M1D14M4I2M1D2M1I27M2I19M1I3M4I9M7I2M1I14M1I10M4I1M3I6M1I8M2I3M1I7M3D3M5I3M2I1M2I4M2I2M7I2M1I1M1I8M1D4M4I6M1D23M2I1M1I3M3I14M1I8M6I1M4I2M3I2M2I3M4I8M2I15M9I3M2I4M2I2M3I8M2D11M3D4M3I6M10I5M1I29M2I11M2D15M1I8M2I8M6I6M2I23M1D6M1I1M1I6M2I23M5I15M4I2M1I9M1I2M2I14M1D18M1I23M2D12M1I3M6I14M3I17M9I3M3I13M2I4M1D7M2D4M2D6M1D3M2I20M1I3M1I13M1D10M5I4M2I7M2D8M3I2M1D3M1I3M3I2M4I8M1D11M6D2M2D13M2I8M1D3M1D16M3I11M2D5M2I8M2D2M1D4M1I5M1I9M1I2M1D3M3D1M2D22M1D3M2I11M3D14M2I4M2D11M1D14M2D7M3I6M1D14M1D7M2I2M1I13M2I5M8D3M2D2M1D9M5I13M2I46M2I2M1D19M1D31M3D11M3I23M6I11M1I11M1I21M5I2M2I3M1I2M2I25M1D10M1D9M1I5M1I12M1D18M4I7M3D37M1D10M2I43M1D9M2I3M1I6M1D7M3D25M2D17M1I6M1I11M1I5M1I6M1I4M1I15M2I13M2D11M1I9M4D4M1I3M1I2M1I2M1I4M1I16M1I1M2D25M1D6M3D12M1I4M1I1M2D4M4I2M1I23M2I37M2D6M3D3M1D29M1D17M1I4M2D25M1I1M2I16M1D4M1I6M1I40M2D2M2I2M1I5M1D38M3I18M2I7M1I46M1I8M1D5M2D21M1D4M5I10M1I21M1I3M1D7M2D18M1I7M1I37M2I7M1D29M3I12M1I37M4D28M1D9M1D9M1I7M2I2M3D8M1I10M3I27M1I17M1D3M2D7M1I5M4I42M2D2M1I11M6D7M5D6M1I10M1D11M1I42M1D2M5D8M1D23M1D16M1I30M1I5M1I22M1I2M1I20M1D19M1I13M1D4M1I1M2I24M5I1M3I2M1D5M1I7M2I8M2D2M1D3M1D4M2D17M3D58M1D35M1I19M3D1M1D2M1D9M1I1M1I32M1I6M1D17M1I2M2D5M1D9M2I5M1D4M1D1M2I8M3I17M1D6M1D1M1D15M3I6M1I11M5D1M2D23M1D6M1I1M4I6M3D5M1D4M1D2M1D5M2I6M1I1M1I14M2I13M1I5M2D6M2D14M1I11M6D18M6D8M1I4M3D1M1D5M1I1M1I21M1D6M1I5M3D9M2D6M1D12M1D6M1I1M2D6M1I1M2I7M1I13M1I27M2D6M1I5M2I54M3D30M2D2M3I8M2D2M3D6M2I1M1I5M2D4M1D5M3I6M2D19M3I7M1I21M2D17M1D5M2D1M1I16M1D11M3I23M1D16M1D1M1D2M1D21M1D18M1I15M3D18M3I5M1I6M1I5M1I7M3D2M1D11M1I5M1I8M2I2M1I17M1I4M1I12M3D22M3D25M1D4M1D10M2I19M1D6M3D20M3I5M1D2M1I8M1D3M1D22M3I7M3D15M1D2M1D9M2D9M2D8M1I5M1D5M3I3M1D2M1I6M1I4M2D43M3D48M4D10M1I17M4I19M1D1M1D3M1D8M1I20M2D9M1D2M1I8M1I1M1I12M1D3M1D2M3I6M1D10M1D4M2D9M1D11M1I6M1D10M1D8M4I3M2I4M3I16M1D5M1D5M4I8M1I7M1I1M2I5M3I3M1D9M2I6M6I4M1I5M1I9M3D7M1D6M1D4M1I12M1D9M4D7M5I4M3I5M1I4M1I9M2D11M1I3M1I7M1D38M3D5M4D7M4I5M6D2M2D5M2D14M4D7M1D2M1D5M2I4M3D2M1D20M3D15M8D11M2D29M5D2M1D7M1I17M7D6M1D7M2I6M2D10M1I1M1I7M1D5M1D3M1D10M1D7M1I2M2I1M1I2M1I13M2D3M4I4M1D3M5D5M1D13M2D10M2D2M2D10M1D9M1D10M1D24M2D5M1D9M2D3M2D15M1I3M3I7M4I5M1D5M1I17M3I11M1I3M3D10M3I1M1D7M2I12M1I1M1I7M1D9M1I4M1D5M2D4M6D14M2D9M2I20M2D7M1I6M1D23M1D20M1I21M1I6M1D22M1I10M1I22M1I3M3D5M1I1M1I6M4I11M2I6M1D11M1D3M2D3M1D6M1I5M1D17M5I9M6D18M1I11M2D16M1D15M2D2M2D8M1I40M1D5M1D45M1D1M2D6M2I61M1D12M1D15M10D7M1I2M1I4M5D23M1I2M1I3M1I4M1I4M3D4M4D5M1D4M1I17M3D15M1D5M1I9M3I1M1I10M1I6M1D5M4I5M1I11M1D2M4D1M1D4M1I13M1D5M1I4M1D6M1I13M1I5M1D4M1I4M1I5M2D6M2I6M2I3M1I3M2I7M1D2M4I4M1D6M1I3M3I4M1D3M3D26M5I4M2I1M2I4M1D9M1I1M4D9M2D6M1D4M3D11M2D4M1I3M2I6M1D16M12I2M1I13M4D6M1D6M1I6M1I4M2I10M1D4M2I5M2I1M1D9M2D1M8D3M3D4M6D12M1D4M1I17M2I4M1D3M4I7M2D11M1I3M2I25M3I11M1I1M1I19M3D8M5I6M3D4M1D7M1D1M1D21M3D10M1I6M1D3M2D4M1I7M1I4M2I3M2I2M1I3M6D9M1I8M1D2M2D12M1I3M4I14M1D12M1I8M1I7M1I7M1D6M1D1M3I21M1D16M1I15M3I11M1I28M3I2M2I20M1I3M4I3M8I3M2I1M1I2M1I3M1I4M1I2M1I1M1I5M2I2M1I29M1D14M1I11M7I4M2I3M1D4M1D6M1D11M1I1M1I11M1I5M1D10M1D3M1I6M1I7M3I10M2I8M1I21M5I9M5I1M1I4M1I3M2I4M1D11M2I7M3I4M1I25M1D4M2I2M1I2M1I12M4I13M3I14M1D5M1D15M1I13M1I5M4I8M1D12M2I9M1I5M1D7M1I4M2I18M4I8M1I2M1I2M2I10M1I10M1I11M1I13M4D2M1D8M1D12M3I4M1I9M1I6M1I4M2D7M2D1M1I8M2I3M1D3M2D12M3D10M2D8M1D6M1D25M1D13M4D4M1D1M2I5M1I30M5D15M2I7M143S * 0 0 CCGTGCCGACTACATCCGATCTGACAGATTTTTAATCGGGAAAGGAATGTCATTAAGCAGTGGAGAGCGCGTCCAGATAGAGCCACTGATGAGGGAACCACCAAAGACGATGTTATGCATATGCATTTCATCGATAGAACAACGGTGAAGGTAGAAGCCAAGCTACCTGTATTTGGCGATATATTAAAGTCTGCCCCAACAGATATTGAAGGGGAGCTTTTGACTCATTGCTGGATATAGTCATTAAGCCAAAATTAAACATCGTAAGAGAGTAAAAAGGCTGCTGTGCCAAGGATATTATTTTAACCCGTCACCTCGATTTTCAGACATTAGCCTGCGGGCAAAAGAGATGAGGCGATGGAGATATTTCTGTAACAGAACATTATCTATTACGAAAGGCCATCTCTCAGCGCCTCGAACAAGTACTAATGCTGATGAGATAGCTGAAGAGGTTTTGGCATATTGCTGCTACGCAAGAAGGTGAAAAGTGATATACTGGAATGTTCCGTAAAAGGCAGGTGGGCAAAGTCAGGATTAGATTATCACGGAGGTAATTATGCGGAACAAAGAAATCATTGCCTGGTGTTGATAAGGTAATAGAATTCCTTACGTTATCGTAAGCATTTGCTCTCCTTTTCCGCCACTACATTCCTGGGTGTTTCTTTCAGCCCCAGAGATGGTCTTGGGGCGACATTGTCTACCATCATATGCAGGAAGCCATGATTGCAATCCTGATTGCTTCATTGACGTTTCTAATCGGAAGCAGAACGCGCCGACTGGCCAAGATTAGAGTATGGGTATATGACATCGTAGTTATTGTCTATGCCCTGCGCGTTTGTTGAGCTTGGAGCGTCTTTTGCTCTGCGGGTTATTGCTTCTTTCCATGAACGGGCATAAGCGGCTACATGATACCCACTATCGCCATCGGCCACGTTCTTGCTGCCTCTGCATCGTTCATTCATATGCCATCCTTGTTTTCCGTCCAACTAGCTAATTTGACCACCAGAACAATAACGAAGCCTCATAGGGTTTATTCTGTATTGCCTCGCCTCACGATCGCCCCAAAACACACCAAGGACTGGACCCGGAGTGGTTTATGCGAAAATAAATAGATACAACTCACTAAACATAGCAATTCAGATCTCACCTACCAAACAATGCCGCCGGCTGCAAAAACCACGTGCTTCATATAAACATACACAGATAACCATCTGCGGTGATAAATTATCTCTGGCGGTGTTGACATAAATACCCTGGCGGTGATACTGAGCACATCAGCAGCAGGACGCGACTCTGACCACCATGAAGTGACGCTCTTAAAATTACAGCCCTGAAGAAGGGCAGCATTCAAAGCAGAAGGCAGGCTTTGGGGTGTGTGATACGAAACCACGAAGCATTGGCCGTAATGTGAATTCCGTTCGATTAGCTGCCAATCTTTCAGTACGCGGCGTCCGTTCAAGGACTACAACTGCCACACACCATTAACTGCGACTGACAGGGAATGGAGATGGTAGGGATTCGCACAAACACGCCGCGTTCTTGACCCGTTCTCTAGGGAGCAGAGAACAGGCTCAATGGAAAGCAGCAAATCCCCCTGTTGGTTGGGGTAAGCGCAAAACCGGCAGTTGACCGCCCTATTCTCTCGCTGAATCGCAAACCGAAAATCACGAGTAGAAGCGCACTAAATCGATAGACCTTAAGTTAGTGGGCTGAATACAAACAGATTGAAAGGCAATGCAACGTATTGAGCGCAAGAATCAGCACATGGGCGTACAGAAGCCTGGCGAACGATTAAGAAGACGATGCAGTGGACGCTAAGAAATTACAGGAAAATCGTAAGAATTCCTCTTATCTAGAGTTACTTAGATATTGGCCTTGGCTTTATCTCAATATTATATGGATCATATAGCTGGCAACTAATTCAGTCCAGTAAATATCCTCAATAGGGAATAATATGCTTTCCATTCCATCATCGGGAAAAAGTTTGTTCTACGCTCCAACACCAAGCTCGTCAATAACCCTCACTAATGTATGGGAATTGTTTACTTATGATATGATAAGACTACATATTTCCTGCCTTCATTAAGGCTGCGCACAAACCATAGAATTTCATCTTCTGTAAGGTTTGAATTACTGATCTCAGGATTTTATCGTTTTGCATCTTAATTAATGCGTTTTCTTAGCTTAAATCCCTTATATCTTTGGCGCTGGCAATAGCTGATAATCGATGCACATTAATTGCTAGAAAAATGCAAGAGCAAAGACGAAACATGCCACATGAGGAATACCGATTCTCATTAACATATTCAGGCCAGTTTATCTGGGCTTAAAGCAGAATTACAACCCAGATAACGATCATATACATCGTCATCTCTCCAGAGGTTCATTACTGAACCACTCGTCCGAATCAACGGAGGTCAGATCCCATTTCGTCACTCATCAAACTGTAGGGGTTGTAATAGTTTATCGATTTCTCGCTGTAGGGATAACTAAGAACCACCGAAGCCTGATGTGGTTAAAAGACAGGAGCACAATCTTTACTACCGCAATCCACTATTTAAGGTGATATGGAAGAAGAATTTGAAGAGTTCGAAGAGCATCCTCAGGATGTGATGGAACAGTAGCGACTATCCGTATGACTACGACTATTGATGATAAAATTAATGGTGTGACACGTGCAAGGCGATGCAATGGATGCAAGCTGCAATCGGAATGCATGGTTGCCGTGAAAGAAATGTTTCCTGTAATGGAAGATGGGAAATATGTCGATAAATTATGGGCAATACGAACGACGGGGCAATGAATTGCCAGAGAACTTGGTAAACAGAACAACAAAGCTGCCTGATAGTGGGCCTTTATTTTGGCATAAATAACAGAATAAACATGCACATCTCTTTGTATTCGATTCCAACGAGTGAATACACGCACGAATGTCGCTCGTAACTAAACAGGAGCCGACTTGTTTCTGATTATTGGAAATCTTCTTTGCCCTCCAGTGTGTAAGCGGAGTTTATCTGTGAGGATATGAACAGATGTCAAACAACATCAAAATACCATCATTGATTACGACTGGAAGGCATCAATAGAAATTGAAATCGACCATGACGTAATGACAGAGGAAAACTTCACAGATTAATCAATTTCTGGTCAGACTCTGAAATACCGACTCAACAATAAACACGGCTCTGTATTAAATGCTGTCGTATTAATCATGCTGAGACATGCTGCTCTGCTTATAGGATCGTTAAGCGACTTAAATGCATATGGTGTTGTGTGCGTTCCGACTGGAATGATGGAAATGGTCACGGAAGGATGGCTCGAATGGATGGTAGCGAAGGAATAAGAATTACCGATATCGATACATCAGGAATATTTGATTCAGATGATATGATTATCAAGGCCGCCTGAGTGCGGTTTTACCGCATACCAATAACGGATTCACTCGAGGCGTTTTTCATTTATGTATAAATAAGGAGCACGACACCATGCAATATGCCATTGCAGGTGGCCTGTTGCTGGCTGCCCTTCCGAATCTTTACTGTACGAACGAATCACCCGTAAATTACGTAAATGGTCTACGATGGAAACGCCTTATATCGACATATTAATCAGCCAGGAGTCCCAAAGAATGGATCAAACACTTATGGCTATCCAGACTAAATTCACTATCGCCACTTTTATTGGAGTGAAAGATGTTTCGTGAAGCCGTCGACGCTTATAACATGGATATTAATACTGAAACTGAGATTATAAGCAAAAGCATTCACTAACCCCCTTTCCTGTTTCCTGAATCAGCCGGCATTTCGCGGGCGTATTTTCAAGGGAGTTCGGAGGAGTTCACTACATGAACGCTTATTACATTCAGGATCGTTTGAGGTAGAGCTGGGCGCGTCACTACCAGCAAGCTCGCGTTCGAAGAGAAAGAGGCAGAACTGGCAGACGACATGGCCGAAAAGGCCTGCCGAGCACCTGTTTTGAATCGCCTCTGCATCGATCACCTTTGCAACGCCACGGGGCCAGCAAAATCCATTACCCGTGCCGTTTGATGACGATGTTGAGTTTCAGGAGCGCATGGCAGAACAATCCAGTACATGGTTGAAACCATTGCTCACACCAGAGTTGATATTGATCCAGGTATAAACGAATGAGTACTGCACTCGCAACAGCCCCCTGGCTTCGGAAGCTGGCTGGAACGTGCATGGATTCTGTCGACCCACAGGAACTTTACCCTATGATCACTCTTCGCCAGACGCATTTAAAGGTGATGCCAGCGATGCGCAGTTCATCGCATTACTGATCGTTGCCAACCAGTACGCTCGGTAATCCGTGGACGAAATTGCAAATTTACGCTTTCCCTCTGATAAGCAGAATGGCATCGTTCCGGTGGTGGCGTTTGATGGCTGGTCCCGCATCATCAATGAAAACCAGCAGTTGATATGGCATGGACTTTGAGCAGGACAATGAATCCTCCTGTACATGCCGGATTTGAGCCCGCAAGGACGGTAATACCGATCTGCGTTACCGAATGGATGGATGAATGCCGCCGCGAGAACCATTCAAACTCGCGAAGGCAGGGAAATCACGGGGCCGTGGCAGTCGGAATCAGAAAACGGATGTTGAGCCGTCCATAACAGCCATTAAGTTCCATTGTCCCCGTCTGGCGCTTCGGATTTGCTGGTACTATGACAAGGATGAAGCCGAGCGCATTGTCGAAAATACTGCATACATGCAGAACGTCAGCCGCCGAACGCGACATCACTCCGTTAACGATGAAACCATGCAGGAGATGCATAACATCGTCCTGATCGCCCTGGATAAAACATGGGATGAAGCTAACTTATTGCCGCTCTGTTCCCCCAATTTCGCCGCGACATTCGTGCATCGTCAGAACTGACACAGGGCCGAAGCAGTCTAAAGCCTCTTGGATTCCTGAAACAGAAAGCCGCAGAGCAGAAGGTGGCAGCATGACAAGGGACATTATCCTGCAGCGTACCGGGATCGATGCGGTTGTCGAACAGGGGATGATGCGTGGCACAAGAAAATTACGGCTCGGCGTCATCACCGTGCTTCAGAAGTTCACAACGTATTAGCAAAACCCCGCTCCGGAAAGAGAGGTGGCCTGACATGAAAATGTCCCTCACTTCCACACCCTGCTTGCTGAGGTTTGCACCGGTGGCGGCTGGAAGTTAACCTGGAGCAAGGCACTGGCATCGGGCGGGGAAAACAGTACGAGTACACGCCTCAGAACCCCTGTTTTGGCGCAGTTTAACTGATTCAGCGTGAATCCATCACTTTGAACGAATCCCCCAGATCATCTATCGCGACGAAAGTATGCGTTACCGCCTGCTCGCCGATGGTTTATGCAAGGTCTAACGCAGCAACGGGCCTTGAACGGGAGAAATGCCCGTCGGAGCCTCCCGCGGGATTTCATGAAGTTCCGTTCGATTAGGTCGTTTCGAGGCCATAAAGTCCACCAGCTTACACGGCCAGGTGCAGTACAGCATGTGGTGACGCATGAAAATGCCTGGTACTTTGCCAACTATGACCCGCGTATGAAGCGTGAAGGCCCCTGCATTATGTCGTGATTGAGCGGGAGCCGAAAAGTACCATGGCGGTTTTGACGAGATCGTCCGGAGTCGTCATCGAAGTGGACGGAGCACTGGGCTGAAATGGTTTTGTATTTGGGGAGCAATGGCGGAGTAAAGCATCCTGAACGATAATATCCGGGTAGGCGCAATCCACTTTCGTCTACTCCGTTATACAAAGCCGGCTGGGTTTTCCCGGCCTTCTGTTATCCGAAATCCACTGAAAGTAACAGGGGCTCAGGAGATAATTAATAAACGGCTTAGGAGAGCTGAAGTATGCACAAAGGCATCTTCTGTTGAGTTATCAAGAACGAGTATTCGAGATGGCACATAGCCTTGCTCATAAATTGGAATTATGAGTTGGCGCCAATACCAGTAGAAACAGACGAAGAATTTCATACGTTAGCCGCATCCCCGTCGCCAAAAGCTGGAAATGATGGTGGCGAAAGCAGAAGCAGATGAGAAACCAGGTATGACAACCACGGAATGCATTTTTCTGGCAGCGGGCTTCATAATTCTGGTGCTTATGCTTGCCGACATGGAGACTTGTTCACGTGACACCTCAGGCAGGAAAACGCCTTGCACGACCCCTTGCTGCCCGTCAGGCTAAGATTCTGAATCAAAAGCCGACAGCAGTTTCTCGGATAAACGTCGATGACATTTGCCTCGCCGTAGCGTACTGAAGAAGCACCGCGTGAACGGTAACGCTGATGGGATTCACACCGACTCATTTTAAGCCTGGCAATCGTACAGCATGTTAAACGGCGTCTTTAAGGAACGATGAACATGAAAGCAAATCATCAGGGAGCAGCTCCTTTTATTATTCGCATTCACCTCAACCGTATTACAACCAACAGTTCAGGGATTAATGAAAGATGGCAGACATCATTGATTCAGCATCAGAAATAGAAGGAATTACAGCGCAACACAGCAATAAAAATTCTGCACGCCTGAACCACCAGGCTATATCTGCCACTCATTAGTCTGAGTGTGGCGATCCGATAGATGAACGAAGACGCCTGTGTCGTTCAGGGTTGTCGACTTGTGCAAGTTGCCACCAGGAGGATCTGGAACTTATCAGTAAACAGAGAGATTCGAAGTGAGCCGAAATTAACTCTCAGGCACTGCGTGAAGCGGCAGAGCAGGCAATGCATGACGACTGGGGATTTATAAAGCAGACCTTTCCATGAATTGGTAACACCATCGATTACTGCTCGAACTGCTGGATGATAGTAACGGGAAAGAAACCAGCAATACATCAGCCAAACGCCGCATAATAGGAGAACGAGGATATTGCGCTAACAGTAGGGAAACTGCGTGTTGAGCTTGAGAACAGCAAATCAAACTCAACGAGCAGCGTCCGTATTACGAAGGTGTTATCTCGGATGGGAGTAAGCGTATTGCTAAACTGGAAAGCAACGAAGTCCGTGAAGACGGAAACCAGTTTCTTGTTGTTCGCATCTCTGGGGAAGACTCCTGTTATCACCAAGCACTGCACTGATCTGGAAGAGTTTCTGCGGCAGTTAATCGAACAAGACCCGTTAGTAACTATCGACATCATTACGCATCGCTATTACGGGGTCCCGGGTTATAATGGGTTCAGGATGCATACGTATCTGCATATGATGTCTGACGCTGGCATTCGCATCAAAGGAAATGAGACTGTGATTTTGAATCACCAACGCTTGTGAAAATGCTGAATTTCGCGTCGTGCTTCTCCCACAGCGATGCCAGAGTGTAGTGTCATAATGATGACCGTACTCAAACATCGGGTTGAGTATTATCTTACTGTTTCTTTACATAACATTGCTGATACCGTTTTACCTGAAACGACATACATTGCACGGAGTTTATAAATGAGTATCAATGAGTTAGAGTCTGAGCAAAAGATTGGGCGTTATCAATGTTGTGCAGATCCTGCTTGTCTTGTCTCTCCATGCAGACATCACGAAGGTGTTTATGTAGATGAAGGTATAGATAGAGTCGTGGATAAATTCCATGAAGGTTTATAAGTCTAATGTCGAAGACAAATCCCATTTGCAATGTGCCTAGAAATGACTCATCACGTGCAAATTATTATCACGAGTACGGTGGAAACAGCGATACTTGCCTCTCTGTACAAAACATAGATGATTAAACCCAATATTACATAACAATCCTCGCACTCGCGGGAGATTTATTTATCTGAACCTGGATCAGGCGGGTTTTGTTTATGGAGATGATAAATGCATTCCGAGTCACTAGGAATGGAATGGAGAGAGCGATTCAACAGAGTTATCGAAGCGGAGAACATGAACGACTGCTACGACCACTGGATGATATGGGCGCAGTGAGATAGGATTGGCAGACGTAACCAATATTCGAATTGAAGAACTGAAAGAACACCAAGCCGCCTGATGGCGGTTTTTCTTGCAGTCAAGTTTTCAGAGACTTTGCGATGTACTTGACACTTCAGGAGTGGAACGCACGGAGCAACGTCACGAAGCCTTGAGCAAACATTTCGTCGATGGGTTCGGGAATGCAGGATAATTCCCACCTCCGGTTAGGATGGAAGAGTATCTGTTCCACGAATCACGGTAAAGGTTGACTTAAATCGACCAGTAACAGGTGGCCTTTGAAGGATCAGAAATGGGGAAGAAGGCGAAGTCATGAGCGCCGGGATTGTCCCCTAACCTTTATAAGAAACAATGGATATTACTGGGATGATGTAATTACAAGGGACCCAAAGGCGTTTGGATTAGGCAGAGACAGGCGAATCGCAATCACTGAAGGCCATTACAACATTGAGTTATCTTTCCATAAACACAAACATCACGTGCGAAGGTTAT * tp:A:P cm:i:174 s1:i:1531 s2:i:0 NM:i:2150 ms:i:4832 AS:i:4832 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
58 53 0 utg000001l 42161 60 20S20M1D13M1I2M1I4M1D1M1D1M1D10M2D1M1D3M1D9M5I3M1I11M1I5M1I1M1I13M1D2M1D1M1D6M1D6M1I14M3D12M4D24M1I10M1D12M3D11M2I4M2D13M3D1M1D3M1D2M1I17M2I16M1D2M1I8M5I9M1D10M1D10M2D2M1I11M3D10M2I1M1I13M3I18M1I13M1D23M2I2M1I12M2D2M1I3M1D24M1D6M1D9M1I5M1I2M2D24M1D7M1I9M1D4M1I4M4D1M1D1M2D9M4I20M1I32M1D9M1I10M1D13M1I11M2D5M2I9M2D8M1I3M1I2M2D5M2D9M6I17M1D3M2D4M3D5M1I10M1I12M1I8M1I6M1I9M2D14M7D12M1D15M1I2M2D18M1I15M1D10M1D9M1I36M2D4M1I5M1I5M2D5M2D5M1I2M1I11M2D14M3I7M1I12M1D1M1D4M1I1M2D48M1D17M1D5M1D3M1D5M1D3M1D26M2D5M1I14M1I28M1D8M2D2M1I18M4D9M2I33M1I20M1D2M2D7M2I6M1I4M1I36M1I3M1D8M1I33M2I36M1I8M4D12M1D13M1I14M1D4M1D6M1D1M1D23M1D2M1D38M3I17M1I1M1I13M1I22M2D9M1I7M5I6M2D4M1I16M2D28M1D30M4I3M1D17M2D1M6D2M1D9M1I4M1I12M1I6M4D2M1D6M3D12M1D1M1D2M1I7M2I11M1D25M2I2M2I6M2I1M1D6M4D9M2I6M3D29M4I16M1D9M1I9M1I3M1D14M1I19M1I15M1D18M3I3M2D4M1D12M1D10M3D5M1D3M1D6M1I3M1I9M4D7M1I1M1I46M3I4M1I12M1D10M3D6M1D13M2D16M1D10M1D3M2D9M2I3M1I18M1I7M1I5M1D7M3D5M1I3M1I14M1I12M2I8M1D12M2I6M3I5M4D12M2I10M2D1M1D8M2D18M2D16M1I8M1D22M1D5M1D16M2I4M1D12M4I21M2D10M1I7M2D26M2D9M1D11M2D5M1I5M1D10M1I7M1D3M4I4M1D1M1D7M2I2M1I10M1D3M1I12M1I34M1I7M1I16M3I9M1I17M2I5M2D16M1I8M1I9M1D5M1D2M1D7M1I6M3I2M1I11M1D9M2D5M1I24M1D1M1D8M1D1M1D5M1D41M1I8M1D23M1D3M1D8M1I12M1D6M2D6M1D12M1I30M1D5M1D7M2D6M1I21M1D4M2D9M2D6M1I25M2D4M1D10M1D5M2D2M4D22M1D9M6D8M2D2M1D7M1D4M1D8M1I11M1D1M1D3M1I4M1D11M5D2M1D3M1D10M1D9M2D15M1I7M2I9M1I4M2D7M4D5M2I4M3D25M2D2M1I14M2D2M7D10M1D5M2I5M1D18M3D9M1I9M1I2M2D24M1I8M1I1M1I1M1I5M2D5M1D2M2D4M2D3M6D9M2I34M2D20M2D2M2D1M1D4M2I25M2D3M1D7M1I29M3I11M4D25M1D70M1I9M1I5M1I3M2D16M5D8M5D5M3D30M1I7M2I4M1D6M3I3M2I3M3I30M1D4M1D9M2I27M1D9M2D8M1I5M1D6M3I1M1I3M1I8M1D4M2D4M4D9M1I17M1D3M1D7M7I18M1I21M1D16M1I12M1D26M4I6M1D2M2D10M2D17M2D13M2I6M1I2M1I11M1I12M3I2M1I36M1I4M3I10M1D5M1D1M1D37M1D13M2I21M1D3M1D24M1I7M1I15M2D17M1D1M1D2M2I26M1D5M2D19M3D6M1I11M1D4M2D17M1I5M1D10M3D13M1I1M2D5M1D7M1I33M6D21M3D2M1I11M2D6M1I1M1I3M3D38M1I4M3D17M2D5M1I11M2I25M2I5M1I15M1I5M2D8M2I6M1D5M1I2M2D6M1D12M1I17M1I5M1D5M2I13M3I1M1D12M2D2M3I3M1I7M2I1M1I2M1I2M1D9M3I2M3I1M2D15M2D6M3D10M3D4M3D37M1I19M2I7M5D4M1I30M1I14M1D5M1I10M1I4M1I6M1D8M3D4M1I3M3D3M1D4M1D17M2I2M1D7M2D10M1D12M1D3M1I6M2D4M1I11M1D18M1I2M4D4M1D4M4I3M1I7M1D8M1D2M4D20M2I14M1I6M1I14M35S * 0 0 GAGTGCTGTTATACCGAGTAACGTCAGCCTGCGAAGCAGTGCTGAAACAGTTGATTGGATTATTCTTTAGTCACCCTCCTGAGAGACACGTCGGTATTACGTGCATGCGATTAGACATCACGCATGACGTACGCATCATGCTGTTTAACAAGTTCATCAGCCAGTCCGGCATCAATGGCCTCCTGACCGCTGTACCTGCAGCCTCGTATCCAGCACACCTGCACGGACATAGGCTTATATGCCGACATTGCGCAAACATCTGGCGGGTTGCTAGGCCTTGAGACTGCAGTGTTATGCAGGGGCCTACGTCATCCGGAGATGGCTTAGCATTGCCCGTAGCTGCTGGCTGCCTGTGCATGCCTCGTGATTTCCACACCCTGTTTCTCCAGCGCAGCACCCGTAATTACTGTAGCCATCATGACGCCGATGGAGCTGTTAGTCCGGGCGGTCCGTGACCAGACGCCGGGAGGCGGCACTGGCAGCAACGTACTGCACTTGCAGTTCATGTCGTTGGCAAGCGCCCATACCGGTTTTATGTCACCGCAAGGGAGCGAGCCGTATTAAGAGATGAATGCCCCAGGAGCCCGCCGGGCGTGTCCATATCGAGCAGAATGCCCGTCCACCATCGGATCTCGCTGGCAGCTTTAGCAGACGGTGCGATAATGCCGTTTGTAACCGGTCATCCGAGTACGGCTGCAGCGCCCGTCCGGCTCTAATGGGTAAGCGTGCCGGACAGGCAGCACGATGCCCGTTCATGATACTGATAACTGCGGGCCTGTCTCGTGGTCCGTCATCATCACGGGATAATGCCAGCGTCGCGGGTCCTCCTGGGCAGTCAGGCTGTCGCCGGACACCGCATCCGTCAGGCTGCTGATCCCAAGCTGGGTGCAATCGACAAAAGAAAACCCGCGCAAGGGCGGGTTCAGGCATCAGGGCCTCATCAAAGCCATGCTGGCACCTCCTGCGGGGAGTGCCGCTCTGCCTTCCTTCCTCTTCTCTACTGTTGATTTAGCAGCCCCGGATTCAAATGCTGCAGCCGCCCAGGCGGGCAGTCCAAGACCGGCTGCACGGCGCTCCATCGTTCACGGACTGCTGGCAAAATTTCCTGATAGTCGTCACCGCGTTTGCGCACTCTTTCTCGTAGGTACTCAGTCCGGCTTCTATCAGCATCACGCTTCCTACGTTCTTTCAGACCATCGATGACGACCGGCCAGCCTATCCAGTCGCAGTTCCCGCAGGCACTGCGGGCTTCCTGAAAACTGAAGCCGTTGAAGGTAACGTCACCACGAGCGAACGATGGCCTCTTCCAGCCAGCACAGAAACATCGGCCGCCTGACGGGATGCTACGAATTTTCGCCGCCCCATAAAGTACGCCCACGACTCGTTCGCACTGGCCCGTGCCGTGGAGGTAGCTCATCCTTAATTCCGGGAAGCTGCTCATACGGAGACACCCAGCCCGGCAGCGATAACGCAGCAGTGACTGCTCAAACACGATAGCCGTTATCCGTATCCTGAGCCGTCTGCAGGTTCAGTGAGTCATCGAGCATCACGTAGTCTCTATTTTGCGCTATCGAGCCGGACCGGCGCTGCGGCGTAATACAGGCAATTCGAGATCCCGCTACATTCCTCTCGTCCTTTCCCCTGCTCCTGACTGTTCGCCTACAGAATAAATCCATCAGTGACTGCGTATCCAGCTCACGCGCTCACTGGGGGCGGCATAGAGATGCGCAGGGCAAGCTGGCAGGGTTCTGCAGCGTGGAGGCATCTTCATCTGCTCCACCGTCCGTAAAACACATTTGCACCCGCGTCTGCCCGTCCTCCACGGGTTCCTCCAAAACGTACGATGAACGAGGCGCGCCGCCGGGTACTCACGGGGTATCCATGTCCATTTCTGCGGCAGCATCCAGCCAGGATAGCGTCGTTGACGGCCGTAACTATCCCAGCGCCGCACCTAATGTCATTAATCTGCACACCGGCACGGCAGTTCCGCTGTCGCCGGTATTGTTCGGCCTTGCTCTGCCTTCGGGCTGACCATCCGGAACTTGTCGGAAAGCGCACGAAGGCGAGTATCCCGATGGCCTGAACGAACAGTTCACCGTTAAAGGCGTGCAGGGCCACCCTTTCGCCCGAAATCATCATGGTAACGTGCGTTTTGCTCACGTCAATGCAGCAGCAGTCATCCTCGGCGACTCTTTCCTGCCTTCATCGCGGGGATAGGCACGGGCTTCTTCCTCCCCGATGCCCAGACGCGCCAGCTTGAGGCGATGACTGAGCCGCATAAAGACCCGACGATATGATGCTCTGCAGCTGGATGAGGCGTTGGCATTGGAGCGTTATTGCGTACCAGATCGTCCCGGGCATTCACGGGTAAAGTTGGGCAACAGGGCTGCATCCACATTTCACTCGTGGGTTCCACGACCGCAACTGCCTCCAATCCGCTGCCGCCTCTAGGATAACCGGCATATTCGCGCAGCGATGTCATGCCGTCCGGCCGAAGGGGGTGAATGGTGAGTTTTCATACATAAATCCGGCAGGTCCCTGCGTGCTGTGTCATGCCGGTCCGGCATTCCAGCTCTGGCAATATTTTGAGGTCAGACACGGAATGGTGGGCCGTAAACCCACCCTTCGTCCGTCTTTCTGTACTGTTGCCACCCCGTTTACCTGTCAGCAAGGTCATGGCAGTGCCGCACGGGCAGGAGCGGCAAGTTCTTCCTGTCGCGTCATGCTCATCCTCTGGATAAGGCATGAATGTAATCGTGGCCAGTGTTTCTTGTTGGTTGCCTGCACCATCCTCTTCCTGCAGGACGCCAGCAGCACTGGCGATCCAGCTGCCAGGGGAACTATGCTGATGCCGCGCCCCAGCGCATAGACGAAGCAGTTGAGTGCCTCATTGCGTCGCTTTTGCTGTCCACAGTATTTTCCTGCCATCCACCATTTTCGACTCTGCTCTTCAGCAAGTCATGCTGCCTTCGCTTCAGATTAAAAATATCCGGGTTATTCGGGAATGAACGCACCGGAAGCGTCATCCATCTTCCGGCGTCAGTGTGAAGCGGTTATAAATCTTATTTCTGGGGTATCCGTACCGATTTCGGTAATAAACCCGTTTTATTTTCGTACGATTAATTAGTAAGGGGCTTTCAGTAGACGACCCTTTAATGGGATGACAGGACAGCCCATGTTTTTCTAAGGGTTGGATAACAATGGTCCTGTAATCCGACAGTATCTCGGAGCAATACGGGTAAGTGACATTTCTGCAACGCACCATTCCGGCGGTATAGTTTATCCTTATCTCATGCACGCAGCAGCGTCTGTTCGGCCGTCGTGGAGCCCCACTCTGGCTGGCGTGAGATGCGAGTCTTCCGCCGCAGGCCCCATCCCCATACCGCATTTCGATGGTCCAGCTGGGAGTCGATACCGGCTGTTAAGGTGAGCGCGCCACGTCAGGACGGGCTGAATAATGCTGTTCCGCTCTGCCATCACTTCAGCATCCGGACGTTCCAATTTTCGCCTCCCACGTCTCACGAACCCGTGGTGTTTACGAAGGTTTTACGTTTCCCGTATCCCCTTTCGTTTCATCCAGTCTTTGACAATGCACCCAGGTGGTGACGGGCTGTACGCTGTCCAGATGTGAAGGTCACTATGTCAGGTGGCTCAATCTCTTCACCGATGACGAAAACCAGAGAATGCCATCACGGGTCTAGATCCCGGTCTTTTCGACAGATAACGGGCATCAGTAAAGTCCAGCTGCTGGATGACGCAGGCATTATGCTCGCAGAGATAAAACACGGCCAGGGGTTATCAGTGAGTTCCGAGGAGATTTGAGGCCAAACGGCGTCTCTTTGTCGCCAAATTTAAGATATACTGCTCCCTCCCGCAATGCGGGCAGGCAACATGAACGCATACAAATGCGGGATGCCTCGCACCGGGCGGCCTCACCGATGCGCCCCATTTTTGGCGTGGAGCCACGATGATTTGACCACGGCCAGACCGAGCCTTCGACATCGCTTGTCACCCAGGAACGTCGAGAGCCTTCCTGTTCTAATATCATCATCAAAGCAGCAAGTTCATCATAACCCGCGCCACATCCACGACTTTTCACGTAGTTTTTGCTCGTTACCCCAGGCATAAGAGTGAAGCCGACGGTTAAGTAGTGAAACGCTTCATGGTGAGCTCGTGTTATCCGGTGCTTTTGCCATACCACGGGGCCATGCGCCGACATAAGGGACGAATACCGAATAGTCGGCTCAACGTGGGTTTTCATAAAGTTCTGGCATCACCATCCCTGTCGGCAACCAGATAAGGGTGTGCCTGCTTATGCTCTATAAAGTAGGCAATAAACACCCCAGCAGCATTTTGGAATAACCGACACGGTAATTAGCTCAAGATTCACCTCACGGATGTAGTGCTGCCCATCGCATGCCTGATGGCCCTGAAGGGGCAGTGTTTCCCAGCCCTTCCTGGTATGCGTGCTTCCTCGGGGTAGGCTATTAGCATCCAGGATGCGACGGGGCGATCTGGAGCAGCGGAGGCAACAGGAGCGAAGCCGGACAAATGCCGCAGCCTGTCCATGACTGTTCCGATATTCATAGCCTCAGCAACCCCGGTATCAGTTCATCCAGCGCGGCTGCTGTTGTTCATGGCTTTGATGATATCCCGAGTTCAGGAAATGATAACATGTCCGTTTTCCAGTTCCGGAAAACGCTTGCACCGACAGGGAGCCCGTCGAATACTGGCATTTCACTGCGTACGCGACAGCACGAAAGTACAGAATGCGGTTTCCACCACCTTCATGGAGTCTCTGGCATTCTTCGCTAGTTCCTGTGCGTGCTTGCGGCGCACGCGTAAGGTCTAATGGCGTTCCGGGTTGGACAATAGTTTCCTGGCTGGAGATGCCTCGCTGCTGCCCGCAGTTCTTCACTCTCCCGGCGCAGCTTTTCGTTCTTAATTTCAGCATCCTTTCGGCATACCGTTGACGGCAGCAGAGTCATAAAGCAGGCCATTACCCTTGCCACCGCCTCGCAGAACGGGCATTCCTGTTTCCTTGCCGATTCTGAATGGTATACGCACCGCAGGAAAGTAGGGAGCCATACAGTGCTTTGTTGACTTCCATGTTCATTCCACGACAAAACAGAAGGAAACGACAGAGGTAAAAGCTCGCTTTCAGCATAGTCGTTCCGTGATTCGTCCCAGAGGGTATTTTAACAAACATTAAGTTATGACGGAAAGAAGAACGGAAATCGCCTTAAACCGGAAAATTTTTACACCTATAGCAAACAGGAGGTCGCCACCGTTTA * tp:A:P cm:i:88 s1:i:857 s2:i:0 NM:i:1221 ms:i:3794 AS:i:3794 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
59 54 4 * 0 0 * * 0 0 ACATTTTTCCGATAGACCGGTATACGGTAATTTGGCACGCTACACTTACCATGATACAATGTGAAAGAGCCTTCCATGTAAACGCTGACAGGTCATTTGACAGCACGATAGTCGTTTAAGACAATGAAGAGCGTAGTGATGCTAGGTAAACCACGTTAGGTCGGGCCGGTCGATTTACGTCAGGTCCTTACCTTAGACGTCCCGCTTGACTTTACGTGATGCGAGATCGTTCAAGGCTTTACTCTGAGGTATCAGGTCTTATCATCACGCCACGACATGAATGGCCTGAAGGTATAGGTGAAAGGTATCGGCCTGTTAATCAGATGAGTGCGCGGTGCATGTCATCACGAGTGACTGTCGTCCTAAGATCTAGCGTCCGTTCCTGCGTCATGTACTGTCAGCCGGCGTCAGTATTTAGAACCAAGATTTAAATTATAATTAGATTTGGTAATCCGTAATTTTACTACCGTCACCATTTGTACATAAGTTAGCATTTCATAAGACATAAGTCAGATCTATGAACTCCACAAGCCCATCATGTCGCCCGGTATGCCTATCATACTTATAAATTGACATATTAGATATTATAACTGATAAATCCATCGATCACTAAGCCTATGAATCCTACTGAGCAGGCAGACACGTATGCAGCTCGCCTGCCATCGTGCTCTTCGGTGTATTCAGCGCCGTCAGACTAACGCAACCCAAAGTGGATAAATAGAGCTCAGCATCATAGACGTCGCACGGTTAGTCGTGCCGTGAGTACCATCGAGAGCTCTTTCAGCATGTCACTTACTATTTGTTAGTACGTGTCTGAAGGCCATCCAAGTTAGCACGCCCTATCAGCTACTTCCACCCTGCATATCACCGGCCAGTCGTTGAATAACCCAGGGAGAATACGGTTACCACCAAGCACGGTTCAGGGTACTGCTGTTACGACGGCTAAAGACAATCTAATATCCAGGCTTACTAAGTGTAATGCTTAAGTAATTTTGACCGTGGCTCGTCATAACCGTCCTTTGGGGTCCTATTATTTGACGGCATGTACTCAGACTGCGATACCCTAGATGAAGCAACCATTTACATTTAGGCATAAGGCCGTTGTCGATGAGCTGATTTTTAATATGGCCACTGTCTCACCCCTTACGTTACGGCATAGATCCAAGCAGTGACATTCCAGCCGCTCTGTTAAAAATAGCGATGGATCTCCCCATGTTTAGCCATCTTCCACTTTAAGCGCCCAGTAAAAAGACGTCCAGCTCACCGACGGGCTTAAGTCCTATAGTTCATATAATTTCCACTTATAGACGAGAGCCATGTACCGTATCGTTCTCACCCCTGCGTAAGGATATCGAACAGTTGAATCAGCCACAGCGCTCCAGTTATTGCATTCTAGCCTATAGTCATTTCTAGCGGCAGGGATACGAACCGAGCAGCACAATGCCAAGTTACTCATCCGTGAAGTGCATCAGTATGCATATGCAGCATTGCCACGACGGTACGTTCAGACGTATCAGAATCACGTAGTATCTGAGCTGATCCCAGCGTTGCCGTGCTGTCTAAGTCCCTATGAGGTGTCCAACTTAGTAAGTTCATCCGTCATCTAGCTCTTTCAAGCCCTTTCAGTTCTTTGGTCTCGTCCATGACATCACGTTCAGTCCAGAGCGGACGGCAATCAGTTCTGTTACTTAACTCCACAGAAACAAGCCCACCATGATTCCACGAATTAACCATACAGGTCAGCCAGCAGCATCAGGTCTACTTCCACGTGATATAGCTAGTACATGGTCCAGTTTGGACCGCTGAAGCCGTTATGTAAGACCGGTGCGTTCTAAGGTTAGCTTAAGGACATCCTACCGACGGTCGGGATCGAGATTTAGAGTGACAGTACGATAGCCATCATCCCTTAGACATGTTAGGGTCTTTCAATGTCTCCACCGATCGACGGGTATGCTATTCTCTGACTGAGTTGAAGGAACGGTGAAAGAGCTGTCGATCCAACACGGTATTCACAAGCTAGTTCGCCGTAGGCTTCGATACCGTAGTCGTATACGTAATGTCACGGTGCTCATCCGTGCCGACTCGTGATTATTCTACTTAGGCCATCCTCATGAAGGTCTCAAGGTATGGTATTTAGTAAGCACGCCCAACTGCCTGCATCTGTCACCTTAAGTATTAGTCACGCATGTTGCATCATTAAGGCGAACGTAGATGCCGGTTGCCATTCTTAAGGCAGGCATTCCAATATCCGTCAACGGTATATCGATCACACGGAACTAGATAAGGCCAATAGAAACAATCCAAACTGTAAGCTAAGTTGCCGTAGAATTTGTAGAGCGACGTTACCTTGCATAGAAAACCACGCAGAATAGCAAACTAAGTCGATATGCTGCCGAGAGTGAATAAAACCCTAAAGCTCATTAGTGATGAAGGTAAAGTTAAACTATTAATTGGTCCTAAACGCGTCCGTTTTCTTCTCGTCCTTAAGCGCCTGAGACTCTATAACGAACTTCATAGTACTTTATAAATTATGTCTGTCAGCATCGCAGAATCAACGAGCACCTTTATTAGTCAGGGATGGATCATAGCAGGTGTCCAGCAGCAGCGTATGCAGGCGTGCACTCAATCGCCGGGCCGTCGTATGAGCTTATTGAGCTGGGTAATTTTATACTTCTATAGTAAAATGTGTTTCCGGCTTCCCATAGGTAGGATCATTAGCCCGATCCTGCTCATGATACGACGGATCGGGCGCCGTGGCACTTATGTGAGACAGGCGGCTTAGTTGCATTATAAGCGTGTTCTGCCAGCACGTGCCTGTTCTTCAGCGTCCTTGCTCCACATTAGTCTAGACTGATACTGTCCGCGGCAGTCAAATGCTAGTTCCCGTCAAGCTGCGCTCCGTTTCTCCCGTCCTACATACCAGCGTGAACGGTCGAGAAGTTAGATAGAGCGTTGGGCCACGTTGATTAATCCATCACGCATGACGTACGGACGGTGTTAAAGTTGAGCCGTTAGCATCAAGCTCTGACGTACTTAAGGGCTGCTACAATATGACTAACAGATATGCCGACCTTCTGAGGACATCTAGTCGTCCATCCGGGACTTGGCCCTTCCGATCACTTAGTTAAATAGCTATGACCGGTGCCCTTATGGTAAATCATTCCACGCTGTTTACAAGAAGCCGTAGTGTGACTAATAACCATCTACGTGCATGCGTTGATCAAGGGAGGCAGGCAACCGGGTATGGCTTTATTTACATAAAGCGTTGATCCCCCAGCAGAATGGTGTCAAGGTCGACTGCTAAGGCTCACGCTGTTAATCACGCTTACGGTCTCATCATGTAGACCATGTCTGTGAGACATGAAGTGATCAGTCTCAGTACCCAATGGGGCTAGCGGTCAGTAAGGGTTAAGCCCGTAGGCGATGCGGTCATATAGTCGAGATCATCGATAGCCGTAAGCCAATAGTCATGGCAATTAAATAACTGAGGCGGCCACTAGGGTTCAATAAGCTCTTCCATAAAGCTGGCGATATGCGGGAGATTACGCATATTATTCTCTTCTCTGTTGATCTCATCTAAGTAAATGCATCATAGAGACCGTGCACTACTGCTGAGCATCGATCGTTCTAAAACCTCCAGGTCAATGTGTTAGCATTCCACGACCTTTCTGTTACTTAAGCCTTAATTTGTTCCTAACGAACCCTATAGGACTATACGTACCGGTGAACTAAGGGCCTGCGTTCAGGCATACAGCTGTCGACGTCACGACCAACGCTTGGTAATTGGCACCACCACGGCCTGACGGCCCGGCCCAGTCAGCCCAACCCCTATCGTCAATAGATTGCTTAAGCTGGATATTCAAGGAAGGTCAACCAGCCCATAGAGCGGCCCCAGCAGATGGTATAGGCCCATAGTCGAGATAGCTGCGATGACTGAGTAATCCAATTTCACCAATCAGCCGTCTACCTTTGCCCTGCTCTGACGTTGGCCAGAATAATCCATCGACCCTATCCAGCCTCAATGTAAGCCTACAATCTAAGCCTCTGCACTACTGCCTGTTCCAGCTTCAAACTTTAAAATACCGACCTGTAGCCCTCGCATTTAAAAGTGAACCACGTTAGCTTACTATAATCACGTCATGGAGGCCCTCCGGGCATGTCCATTCCATGATCTTAAGGCACGATACCCGTCGCCGTATGTATTCCACATGTGCTCGGTAGTAAGTTGCTTAAAGTCTTTAAATTATTAGGAACCAACTATCCATGTTAGAGGACGAAATATCGACTATAAAGTGAGCCGTCACGTCCCTGAATCATCATAGCTTCCAGTAAACGTGCTGTCTAACGTCAAGCAGCAGCAGTATCCTCTAAACTCTTTCCATTCATTCAACGGGAAAGCACGGCTTGCTCCCCTTACATCAGCCAGGTGGGCGAGATTTGAGGCACCCACGTTGATCCGATCGTTAGCAGGCTTTAATAGAGCGTACCAGCCCTAGGACTCACGTCAATATTAATTTAAGCCAATATAGCACTGTCAGCACGTACCCACTTCAAACGATGCTGCTTCCGTCCAATGGCATTGGCATAGTTGAGCGCCTATCCAATCGTGAATGTCCTAGTCGTACATACTGCCTCTTGTCATGCCCATGCTTAATAGGTCACGATTTTCTCTTCCCGTTGGGTTCAGGCATTGAGCAATCTAAGCTAAGTTCTTCCTGTCGCTTGCTGCTCTATAAGCACGGTATTATGGTCGCGTTGTTCTCACATCTCTTCTGCAGCTGGCCCTACTGAGATGGCTATCATAGAAGTGATGCGCGCCGCCGGCATAAACGAAGTCATATTAGCTGTCATTGCTGTTAGTGTCCAATATTTCCTTACATCCACCATTTTCGACCTTATGCTAAGTCATGCTGCTTCGTCAGATCAAATCCGTATTCGAAGTACTGAGCGAGATTTAGATGATCGTTGCTTAAAGTAATGGCCGTTCTTAGTCATCCACCATTTAGTAAGTAATCAGGATGGCCGACCTAATGTTCCCGTCGATAAGCTTTGGTACGTAAGTGAGCAGGTACGATGACAGCCCGTCTGCCGTCAGACAATAGTTCTATAAGCCCAGCCACGTTAGACATTTGGCATCATGCCTTTATGAGCTATTTAGCATCACGCATTCCCCAGCCGGATTCATCCGGTCTATGGAGTCAAGGCGTCATACTACACGTCAGAACGGTAGAATACGTAGGGTCGATATTAAGCAGTACCATGGTCAATTTTTAATACTAAGTCCACAGACCGTCTGTTACATGTTGAGTTCTCATTACAGTTAATAGTCGACCCAGACTGAGTACTATGTCAGATACGTATAGTCAATGGTCACGATACGAAAACAGAGATGCTCACGTATCAGATCCCGGTTTACCAAAGCCCATACAGCTGCTTAAGCTGACTCAGTACAGGCATACGAGATACTTTAGTTGATACTTATGGTAAAAGCGTCCCAACCAATATAAGCTGCGGATTCCTGCGCCTCCTTCCCTATCACGTTTACGTAAGGCTCTGTTGGCCACCCAGCTTCATCGTACCCAGTACTAGAGCTGCGTCAATAAGTAAAGCATAAGTCATACTCACATCCACCGACTTTCACTGTTATAGTCGCCGCTAAGCCATTGAAGCCACGTTATAACGTGCTTAGCCGGTGTTGCTATCACTACGCTAGCGCCGACGACAGTAGAAGGTCGGACGTCGTCATAAAGTTCTCTAAGTACCATCCTTTAAGATAATAGTCCCGTATGCTATAAAGTAAGACCCCAGCAGGCATTTTAGAATAACCACGGCAGACTTCACATGCCTCACCATTATGCTGCCCATCGCAATCATTATCATGAAAGCGATGTTTCCCGCCTCTGGTGCTTCTTTGGAGAGATATTAGCATCCGCCTTCAACGGCGTTGGTAGCGTATGAACAGTGAGCGAAGCCGGCTAAAGTCGACATGTAAGTACTGTTCGAGATATGGTTGTTCAACCTTTATCATCAGTTCGGGGAGCCTTCCTTTCCCTTCCAGCGTAAAAGCCGCATACCGTTCAGAATACTGGCAGGTTCGTACCGACACCCAATACAATTAGTTCCACCACTTCGCCGTATGACGGCATTCTTGAGTTCTATGCTTGAGCACGTAAGTCTAGTTCTATTAATAGTTCCTGGGCTGTAAGCTGGCCGGTTGCTCGCAGCCCACTTTCGTCAATTTCAGCATCCCTTTGGCATACAGTTATGACGGGATATAAGGCCTATCCTTGCCACCGCTCGGCGATTAATTCCCGTTCTGAGTGTAATGTACGACTCGCACCAAAGTGTCACAGCTGCTTTTGGTACGGTTCATTCACGACAAAACAGAATAGAAAGACATAGTAAAGCTTATGCAGTCTGTCCAGTATTTTAACAACATTAAGTTGGAAGAAGACAGACGAAACCTTATAAATAGAAAATTTATAAATAGAAGACCGATGGCTAGTTCTTGTATTTT *
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
60 55 16 utg000001l 30 60 79S5M2I10M3I5806M1D3M1D6M1I15M2I10M1D15M1D28M1I4M2D13M2I7M2D6M2D5M1I19M2D10M3I20M1D33M3D4M3D3M1I35M1I10M1D5M3I1M1I6M2I9M1D29M1D5M1D6M1D34M6I14M1I15M3D15M1D8M2I7M8I2M4I9M2I6M2I10M1D1M1D4M1I2M1I9M1I2M1I9M4I1M1D7M2I5M2I1M1D9M4I3M1I9M5D7M1I16M1I11M1I6M1D15M2D22M1I14M2I7M1D9M1I4M1D4M1D1M1D13M3D10M1D35M1D17M1D12M1D1M1D21M1I16M6D13M1I3M1D21M7I4M1I2M2I9M2D2M1D2M1D11M1I6M2D1M4D13M2D4M3I3M2D6M1D3M2D2M3I3M3D10M2D30M1D6M1I11M1D11M1I12M1D4M4I2M2I3M2D1M1D7M1D7M1D6M1I6M1D5M1I10M1I5M2D4M1I2M2I1M1I8M1I8M1I8M2I8M1I9M1I3M3I27M1D8M1D20M1I1M1I7M2D9M1I4M2I8M1D18M1I3M2I7M1D3M1D36M2I2M2D2M1D9M1D5M1D6M1I9M2I1M1I6M1D3M1D12M7D23M3I6M2D7M1I1M1I15M1D3M1I3M1I7M2D8M2I4M3I5M4D10M6D2M1D2M2D9M1D3M1D16M2I11M1I34M2D6M3D2M2I11M2I11M1D15M1I4M3I10M3D2M1I8M4D5M1D1M1D5M3D15M3D4M1D6M1D19M2I14M1I6M2D16M2D8M2D20M3I13M1I15M1I2M1I10M1I2M1I9M2D8M1I3M1D8M1I14M1I12M2D1M1D48M3I3M1D16M1I17M1D18M1D3M1D9M3184S * 0 0 AGATCAAAGAACGTGTAGCCTGTCCGTAATCTAGCGCATTTCACACGAGACCCGCGTAATGGGCTCCGGCTTAGCGCTCCATATTACTACAACGTGCGTCGTGGAGGCCATCAAACCACGTCAAATAATCAATTATGACGCAGGTATCGTATTAATTGATCTGCATCAACTTAACGGTTCAAAACAACTTCAGACAATACAAAGGTCAGCACTGAATACGGGGCAACCTCATGTCAACGAAGAAACCAAAGAACCCGCAGAACAACAACCCGGACCCGCTTTTCCAACCAAATGATTGAACAAATTAACATCGCTGAGCAAAGGGAGTCGGGAATTCTCAGCCTGGGTCATTGAAGCCTGCTGGAGACTAACGTCAGAAAAGAGAGCATATACATCAATTAAAGTGATGAAGAATGAACATCCCGCGTTCTTCCCTCGAGAACAGGACGGTATGTAACCCCACTTAAGTCCCGAAGTCGCAGGAGTGAAGCATCTGAGTTGCAGTTACCACTTTCCTGACAGTGACTTGCGTGTGTGTTGGCTGGTGTCACAGACTAAATAGTTTGAATGATTAGCAGTTATGGTGATCAGTCAACCACTAGGAATAATCCTTCATATTATTATCGTGCTTCACCAACGCTTCCACTTCCTCGCATCCTTCCCCTACACCTTGCTGTTCTACATGCAATTACAACATCAGGGTAACTCATAGAAATGGGTGCTATTAAGCATATTTACACGAATCAGATCACGGAGGAGTAAATCAGCAGATTGTTCTTTATTCATTTTGTCGCTCATGCGCGCTTGCTCTTCATCTAGCGGTTAAAATATTACTTCAAATCTCTTTCTGTATGAAGATTTGAGCACGTTGGCCTTAAGCCATCTGTCGGTTTAGCGTTGTATTTCCCTCCAGAATGCCAGCAGGACGCAATTTTGTTACGCAACCAATACTATTAAGTGAAAACATTCCTAATATTGACATAAATCATCAACAAACACAGGAATAAGACAGATTGAACGATAAAAACGATAATGCAAACTACGTGCCTGCAGTACAGGGGAAGTACCAGCATGGAGCCGAGAGATGCCATTTAAAGAAATATTCCAATCAAGTGCGAAGGATTTAGACTGTGAATTGTTTTTATTCTGAACTAAACGTCACAACGTTCACATTATATTTGTTATCTAGCCCAGACTACTGTCGCCTTCGTGCCACGCTACAGCCGCGTGTTATAACCCGCCAATCTTAAAAAGGTTGTAAATGTTAATTCTCAAGAAACACGCATTATAAGAAACGTCCTATGATAGATTGAAATCAAGAGAAATCACATTTCAGCAATAAGGGAAAAATCTTAAAGCAGGAGTTTTCCGATCGGTTACAAATATCCATGAACATAAAGATATTACTATACCTTTGATAATTCATTACTATTTACTGAGAGCATTCAGAACACTACACAAATCTTTCCACGAAGCTCATAACGTTGCTACGCTTCTTCCGTGCGTGTCAGCACCGGGGCGTTGGCATCAATGCAATACCGTGTACGCGCTAAACCCTGTGTGTGCATCGGTCCTCAATTATTTACGCCGGACACTCCCCGCAGAGAATTCCCGTCAGGGCTGTGGACATAGTTAATCCGGGATCACGACCGATTGCCGCACCGAGAATACAGCAGTAAATATTAAATATGAAATTTCAACTCATTGTTTATAGGGTTTATTAATTTTCTACACATACGATTCTGCGAACTTCAAAAAGCATCGGGAATAACACCATGAAAAATGCCTCGGGCCTCCGCCCCTGCTTATTGGATGTGCTCAACAGACGTTTACTGTTCAAACAAAAGCAGCAGTAGCACCAAGGAAACCATCACCATCATTTCTTCTTTCGTTTCTGGAATTGGGCAGAAGAAAACTGTCGTGATGCAGCCAAATTTGTGGCGGCGCAGAAAATGTTGTCAAACAGAAACCCAGCAAACATTCAAATGGAATTGCTCGGTTTTATTACTTTAGCATTTATACTCATGGAAGCGCGTGTGTATTGCTCAATAATTGCATTCATGCATTACAGTCCGATATGGGCAACTCTATCTGCACTGCTCAGGATATATTTCTGGGTTCCTTCCAGTTGTTTAGCAGTGATGATCAGCCTCTCTCTGAGGGTGAAATAATCCCGTTTAAGCTCCGTCTGCCAGTCGGGGGAGGCTGCATTATCCACGGAGGCGGTGGTGGCTGCATTCACGCAGCACGACCCCGTGGAGTGGCAAATGAGCACGACGAGAAGAGCTTAACATCATCACGCAGAGCATCCTTCAGCTTAGCATCAGCCTACTAACTAATTCGTGCCTTTCCCATTTCGGGCTGCCGGCGATAATACAGCCCGCTGACGCATCTGCAGTGTCAGTAATTGCCGCGTTCTCAGCTTCGTTTTCTCTGAGAGCATTTTGTCGCGCTCCGTTGTAGGCATGGCGTTATCACGGTAATGATTAACAGCCCATGAATAAGCAGACGATGAGGATGCAGATAACCAGAGCGGAGATACTAATCGCGGTGACTGCTCATACGTAATCTCTGACCGTTCTCACGCTTCTTGAATTTGCAATCAGGCTGTCAGCCTTATGCTGAACTGACCAGACAGGGGACGGCAGTGAAGCCCCAGATATGCTGCAACGGTCGATTGCCTGACGGATATCACCACAGATCAATCATAGGTAAAGCGCCACGCGGGCTTAATCTTGCTGCATGCCACAGCGTCTGACTTTCGGAGAGAAGTCTTTTCAGCCAAGCTGCTTGCGGGTAGGCATCCCACCAACGGAAAGAAGCTGGCTCAGTCGGCGCCTGTTGATTTGAGTTTTGGGTTTAGCGTGACATTTTGCTCCTGCAGGGAAGCTCCCAGCAGCGCACACCGCCTCCGAGACACAATAGTCCATAACCATGATTTCTGGTTGGTAGTCGTTATCAGTTCCCTCCGACCACGTCAGCATATCGAGGAACGCCTACGTTGATTATTGATTTCTACCATCTTCTACTCCGGCTTTACAACGGCAGCGAAGCGTTTGATAAGCGAACCAATTCGAGTCAGTACCGATGTAGCCGATAAACACGCTCGTTATAAGCCGAGATTGCTACTTAGAGTCCGTGAAGTCGAGAAGTACAGGAGAATGAACTAGCGGCGATAATGGCGCGCGCACATCGTTGCGGTTCGTCGATTACTGTTTTGTAAACGCACCGGGTTTATATCTGCCTCGAAGGTACGCCATTGCAAACGCATTAAAGCAATGCCTTGTTCCGGCTCCTTTGCCGCGAGAAGCGGCCAACAGGTCATGTTTTTCTCGGCATCTTCATGTCTTACCCCAATAAAGGGATTTGCTCTATTTAATTAGGAATAAGTGATTACTGACGCTAAACAAATCCAGGCTGTGTTTATAATCAGATTTGTTCGTGACCGATATGCACGGGCAAAACGGAGATTTGTCCCCTGGCTCCTGCCTCGCCCGCTTCACGAAGGTCATCCCGAGGGAAGGAGCCCGTACACGTCCCAGCATGAATCCCAGAGAAGACAGTGGCTACGGCTCAGTTTGGGTTGTGCTGTTGCCTGGCGGCGATGACGCCTGATGGATTTGTGATCCGGTTCTGCTTCGGTATTCACTCACGGTGATTCACACAACGCGGAAAGAGCAGATCTGGCTAACCAGGCTCGACTCTTCACGATTATCGACTCAATGCTTATTACCTGTTTGTACCACTACAAAAACCCCGAAATCCATTCATGCAGGCTCACTATTACCTGCGAACTGTTTTCGGGATTGCATTTGCAGACCTCTCTGCCATGCGATGGTTGGAGTTCCAGACGATACGTCGAAGTGACCAACTAGGCGGAATCGGTAGTAAGGCCCCCTCTTTTCATCTCACCCACAACGAGCGAATTAACCCATCGTTGAGTCAAATTTACCCAATTTATTCAATAAGTCAATATCATGCCGTTAATATGTTGCCATCCGTGGCAATCATGCTGCTAACGTGACCGCATTCAACTGTGTCGGCTTCTCTCTTCGTTGGGATGCCTCGCCAGAGCTTCATACAGCGAGGGACATGGGGTAACAGGTGGGTTGGGTAAGGTTTTGGGATCGCGGGCGGAACCACGGCGATCCGTCCCCGCGAAGCCTGAATGCATGAAGAGTGCTGACGCCTTTGCATCTTCCGACTCCCTTCTACGACAACTCTCCCCCACAGCTCTGTTTGGCAATATCAACCGCACGGCCTGTACCATGGCAATCTTGCATCTTGCCCCCGGCGTCGTCGCGGCACTACGGCAATAATCCGCATAAGCGAATGTTGCGGCTAATTTGCAGTACTTTGCCTTAGTATTCCTTCAAGCGGTTGCCACCACGGTATTTCCCATCCATTGTGCAAATGCATCAGATAGTTGATATAGCCTTTGTCGTCGTATCCATGAGTTCGTGCTTACCGCAGAATGCAGCCATACCGAATCCATGCTTGATCATTGCGTATCCCCATAGCAGCCATCACATCAGTACCGGAAAGAGTCAGAAGCACGTGGCCCGTGGTGAGTGGTCGCTCATCATCGGGAGCTTTTGGCGAATGAAATTTATTACCACGCTTTCGAGTCGCCTGCCTTCTCCCTGTACCTGCGATCGATGTGCCTTCCCCGCAGAACACTGCGCCGGTATCGATATACATTTGGTTGGCAAACTTGAGTGGTTTCACTGCTGGCGTATGACCAAAGATGAACGTGTCCCTAGCTTTGATTCTTTCACGATCCCGTTTTGTGAGTTGCTGATTCGCATTAGAGTTCGCGCAACCCCACAGCTGAGGCAGGATAACCGCTTTCCAAACTCGTATTCGTCAAAGGATAATCGGGGCAGATAACATATTTATCTTTGCTCACCAGTTCGATGATTAACGGAAGTTCATCTGCTTTATGGGCAAGAGCTTTAGCCAGAATTTCTTTGTCGTAATTCGATTAAAGAACCAGCCCGCCATTAAGCAGCCAGTGATTAACGTTTCCACGCTCTGATAAGCCATCAATCATCATTTGCTCATGCACTTCCACGTACAGCTCTGAACCAGGGAATGTGATTAATTCCAGGCATTCAACGTTCTGCACCACGATCAACCAAATCGCCACGAGATAAGCAGGTCTTTTTGTTGTCGAATCCAATCGTATCGCGTGTCGGCGCCTTCATCCATTCGGTTCGTGCCAGTACGCCAACTACCAAATATTTCGGTATTTGCTGCCATCAATTTTCGTAATAGCGCCAATCTCTTTCACTCCTCCATCCGCGATGACGATGAGGAACGTCGTTGACGATGGCGTGCATTTTCCCGTCTTTATCATCAACGTATTTTTCTGACGGTCACCGCGACCCATTTCAGTCGGGCGTATGCCTTTACGCTTGCGTGGTTGAGCGCAACGAGCGTTTTTACTGAGAACGTCATGCGGCCTCACTTCTTATTTACTCGGTTATTTGAGTTTCTGTTTATACTCTGCCTTGATCGCCTTTGCACTCTTCGGAGTGGCGATGGCGGTTATGGTTTTGATTCGATTTTCGTCTACTGCTGCCTTCCTGCCCGATGCGGCTAATCAGTTCGACGCGATACGCGGAACGAGGATTTCCGCTTTGTGCTGGTTGCACACGCATTGCTTGTGAATATTGCGTCTCATTAATCGGAGTTGAGCTGCAGCAGTTATTCCGGTAATGTCGGCATCCCACTGAGCAGACGTAGTGAGCTTCAGGGCACGAGATACATGGTAAGTCGCTTCTCTTCTGCCTGACTCGGCGCGTGTACGGCTTGTTGGCTGTGTTTAATCCAGTAACTGATCGGGGCTTTAAGGCGAGTTTTCGAGTAATCTTAAGTTTATCTTCTGTTTATTCTTAGCTCCTCTCGTAGTCCGTTTCTTCTCTCTCTGCTGCTTTTCCCTTTCGCGTTCTTTACTTCGTCGTTCAGTGCTATCTTGGTTCCAACTCGAGAGCACCACTAGCCTGATTAGAATGCATGTGAAAACCATTCCCGGCATTCATCGTTTTACATCGTCGTCTTCGCGCTGGTTTAGCCATCATCTTCTTCCTCGTGCATCGAGAGGGTCCGGGATCGAATTGGGCGGCGCAGTGCTCACACGTGAACTTCCAGCACATGCAGCTTCTTCGAACCGCAGTTAGCGCACGTTAAGCTCGCTCGACGCTTTCTTGTTCGTAATTCGATTTGGTAATCACCTTGTTTTCCTCGCACGACGTCGGCTTATCACCGGATATCCCACAGGTAGAGCCGTGTAGTCCATTTTACGTCAGATTCTTTGGGGGATTGGCTTACGGGATTTATTCTCTTCTGCGTTCCTCGTTGATGGCGGTTTGCAGTCGCCAGGATTATGTCGGTGATACTTCGTCGCCTGTCTCGCCACACGTCCTCCTTTTCCTGCGGTGGTAACACCCCCTGTTGGTGTCCTTCACACGGAGACACCATCGATTCCAGTAAGGTTGATTTGGTCGGAAGCGGTTATCTTCTTTGCATTCACCGGACCGATAACATTGCGAAGCAGCAGCTTCCTCCCGAAGTCGAAATCAAGCTGCCCTCCAAATATTCGCATGACTCAGAACAAGAGCCGGTATCGAATCTTTAGCTGGTACCATGTCTATACAGGGCTTGATAATCATTTTCTGAATACATTTTCGCGATACCGTCCGACATTCTTCCTCGGTACAGTCACGCTCCCGTGGCTTTAGAGTGATCCCGGAGCTGATTGTTACAATGCAACCTCTAATGCCCTCTACGCCCTGCAATCCCTCCAGCTCCTTTGCGGCTTCCCCGATTTGCGTTGATTTAATGCAGAATATGCAGTTACCGAGATGTCCGGTATTTGCAAATCGAATGGTTGTTGCCTTCGACCATGCGGAGCTGTTAAGTCTCGCTCGGATCTGACATTCAGCGCCAGAGTATCTGGTTTCCAGGCGTGAGTCCTTAGCCTTAGCCGCTTCGGGTTCATCAGCTCTGATGCCAATCCGACTTAGTAATTCCCTCGCCCGAAATGGTCATCACAGTATTTGGTGAGGGAACGAGTTTAATCTGTCAGTGCAGCAGAACGCGCTCGACGTATGGAGTGCCATATTTCTTTACCATATCGATAAATGGGTGCCAGAACAGGCATTCGCGTCTGAATATCCTTTGGTTCCCATACCGTAACTACAGTGGGGGTCCCCAAGCTCCGCGGTTGATATCAACCTGCAATACGGTGAGCGTATATCCCCAGAACTTCACAACTTCCCAGGCGACAACGTAATGCTGTACCTGTCACGTTCAATCTAGTCATCCATGAACGTAATGGGAACCGAGGATTTGCCCGTCGCCTCAAGCGAGAGCACAGTCGTGAAAGTGCGCACCGAGAAACTAACGACATTTATCATGCAGCCCTGTCTCCCCATCTCGCTCCACTCCAGAGCCAGTCTCGCTTCGCTTGACCATTAACGCCACGCTCTGTACCGAGGAATGCCTGTAGCCTCGCTCTCCTCCCAATTCCCCCATCGTTCCTGCCTTGCTGGCCTATTACCACAAAGCCATTCAGCCGGCAAGGTTAGGAAACAACCCTGCTGCTTTAATGCTGCGGTAAACACTTCCAGCTTCTTGCATGAGCCAGCGAGCGACCATGCCATTCAACCTGACCGCCAGGAAGGTCTACACACATGAGGAAGTTTACTCCGTTTGGTCTCAAGCTGCGGTTGCGTTTCGTGAATGGTCATACGATTGGTTTGGTTGGTTCTGGAAGGATTTGCTGTACTGCGTGAATCGTAGTTTTTGCTGATGTGCTGGAGATCGAATTTCAAAGGTTAGTTTTTCATGACTTCCTTCCCCAAATCAAATGCTTGTGATTACTACGGTCCTATTCTAGCTACCCCATCCAAATAATTCACCGCCAATCATTCATTCACGCGACATTCCTAAACCATGGCGCTCATCTCCTTCTTATTCTCCTGCTTAACGGTAATACAACCGTTGCAGCTGTTCTTCGATAACCGACAGACCCGCCCGCTCGCTCTCCCCTCGGTTCTCCCGGCGGCCGCCTGTTAGGCGGCAAAGGATATGGTGGCATGCACAGACCCAGGTTCGTAGCGTTAGTAAGCATCTTTCCCCCTTTCAGGGTACCGCTGCTTGGTCGAACTAGCTCGAATTTCTGCGATCTGCCAGCCGGCGCACGATTTACCGGTTGACATGAACTATTACGGGTCGTTAGACCCCGCAGACTGGTTAATTCATTTATATGGACATTGATAATTTGCCTGATTAGTAATCCTGTACGTTAATGCATTTTACCGCATAGTCCTAAGCTTCCAGCCAGAGGCGCTATTAACTGCGTCACGATAAGACTGGCAATGGATAATTAGCCTGCTCCGGCACTCAACGAGAGTAACCAGCTCGCGTTGAATGATCTTAAGTCCTAGGTAGACTGTATCCTTCTTATGCGTGATTCATGCAATCAAACTTTCCGGCATCTTTGTCCGATGGCAGAAATGTATGCTCCGCCGACGCGTACTGTTTCCTTATATCGCTTCATGCGGCGGCTTCTGTTTTCCCCGAAATTGTAGACGATTGTGTTAAATCCCACTTTCGTTCATCTGTGTTTGTCACGAGTCGAGTTATTTGCTCTTAGAAATGTTTCATTCACACGGTGAACAAGTGATTTGCGCTTGTTGTGCCTTTGGGCATTTCAGGGACCCGTTGTGATTAACGCATTATGGCGACCTAAGAATTGATAACCATCTTAGGGCTTTTCATAGACCCGTTGTAAAGGCCGCGAGAGTGTCAGGTCGTATATCTGGATGCCGGCTCAAGGCCCCGCCTGTCCCCGGTAATCGTTTAATTTCGAGCCGTCACTATCGCGGCCAGGCCGCGAGCTTAACGTTACTAAGAAGTCCTGGACTTCAGTTGGACAGCACAAGCTCTTGGCGGTATATTATACAGTCTTCACGGACCATGTCACTCTACTAAATTCGATATGCGGCGATGCTTGGTTTTCAGGTGGATTCTTCGGTTAGTCGCTGTCCCCACTTGCTGCCGCTCTGAATTGCAGCATCTCATTCACCACAGAAAGGTGGTCTCTCAGTCCAGGATTCGCCAGAATTCGGACGAATAATCTTTCTTTCTTTGTAATAGTCTTTGTCCCCTGTTTTGAGGGATAGCAATCCCCGATTTGGCGGAGTGTATCCATCTACCCCTAGTTTGGGGAATTTCCTCGTTTGAGGGATGCATTCACTCTGAGATGTTTTATTTGGGTCCAAACATGCCGCCTTGCTTAATCGGCTCTTCATTCTGACGAGTTCTAACTTGGCTTCATTGCACCGGTTGACATAACTTTGATCTCAGCAGTTGAGAATCGGTGATTCTGTCATTGGTTTATTCCACCCATAGGTTTACGCAGAACCGTCAAGCAGCATTTGAACTGTCGCTTGGTCAGATCTGCGCCCGAATAAGCCTCAAGCAGCATATTTGATAGCTATTGGCGTGACCATCATCGAGATCTGCCGGTCGCTCCTCTTCCTGGGATAGGTTCTCCTGCCGACAAGTTTGAGTATTTGCTGTATTTGTCAGTAATGACTCCTGTTGATAGATCCAGTAATGACCCGGAACTCCATCTGGATTTGTTCAGGACGAACGGTTGCCGCCGGGCGTGTCTTGTCTGTAGGATCGCTAGACGGACTTGTCGCGCCAATCGAGCCATGTCGTCAACGTCACGCCCCATTCAAGAACAGCAAGCAGCATTTGAGAACTTTAGAATCCAGTCCCTCTTCCACCTGCTGATCTGCCGACTTATCAACGCCCACAGCTTCCGCTCTTCTCAGTTCCAAGCATTGCGATTTTGTTGATTCAACGGTCGCATCTCACGCGGTCCGGCCGGAGCGCGTTTGAGTATTGTGAAGAAAGATATGTAAGTATTTCCTTAGATAACAATTGATTGAATGTATGCAAATAAATGCATACACCATAGTGTGGTTTAATTTGATGCCTCAGCGTTTAAGGGGGAGTAAGAGCGGGTTATTTATGCTGTTTTTGTTACTCGGAGAAGGGCTATCTTCCCTCCTCCAAGTCGTAACGGGGCTCCATCAGCGTTTATAGTTAAAACGTGCGGTTCATTCACTTCTGCGTGGCTTCTTGGATAGTGTTTCGTCTCGCGTGATACTATAGATCTTTAGCTGTCTTGGTTTTACGCCAAAGCGCATTGCATAATCTTTCAGGGTCTGCGTTGTTCCATAACAACCTCCTTAGTACATGCAAGCATTATCACCGCCATGAGGTAAATAGTCAACACGCACGGTGTTAGATACCTTTATCCCTTGCGGTGATAGATTTAACGTATGAGCACAAAAGAAACCATTAACAAGAGCAGCTTGAGGACGCACGTCGCCTTAACAAGCAATTTATGAAGGAAAAACCCGACTTGGCTTATCCCAGGAATTGTCGCAGACAAGATGGGGATGGGGCATTCAGGCGTTGGTGCTTTATTTAATGATCGGCATGAATGCACTGATAAAGCCGCCGAGGAATTATCGCATCTACAAATTCTCAAATCAGTGTTGAAGAATTTAGCCCTTCAATCGCCAGAGAAATCTACGAGATGTATGAAGCGGTTAGTATGCAGCCGTCACTTAGAACAGGTGAGTATTAATACGCTGTTTTTCTCATGTTCAGCAGGATGTCTCACCTAAGCTTAGAACCTTTACGACCACGCTCTTCGGCTGCGGAGAGATGATAAGCACTACAGACAACGCGTCGCTTCTGCATTCTGGGCTTGAGGTTGAAGGTAATTCCATCATCGCACCAACAGGCTCCAAGCCAAGCTTTCCTGACGGAATGTTAACTCTGTAGTTGACCCTGAGCAGGCTGTTGAGCCCAGGACCTTCTGCATAGCCAGACTTGGGGGTGATGAGTTTACCTTCAAGAAATGATCAGGATAGCGGTTCAAAACGTTTTATTACAACCACTAAACCCACAGTACCCAATGATTGCATGCAATGAGAGGTTAACACCCAAGCAGACGCCGCACA * tp:A:P cm:i:1139 s1:i:6169 s2:i:0 zd:i:1 NM:i:533 ms:i:12626 AS:i:12626 nn:i:0 SA:Z:utg000001l,10329,-,10317S614M95I28S,32,231;
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
61 55 2064 utg000001l 10329 32 10317H16M2I5M1I10M3I6M3D2M1I1M1I7M1I16M2D12M2I15M2I20M4I1M3D11M1I14M1I3M2I2M2I4M4I3M7I3M1I14M4I12M2I1M1I6M5I1M2I5M2D7M5D14M1D16M39I29M3I5M4I4M1I2M1I2M2D14M1D9M1I15M2I8M1I6M7I3M1I7M1D9M1I2M1I3M3D4M1D2M1D7M2D8M1I3M2I2M1I8M2I12M2D8M1I9M3D15M3D5M1I6M2I4M3I9M1D10M1I5M2I4M1I24M1I1M2D6M2D9M1D16M6I6M1I9M2D10M1I11M1I13M28H * 0 0 CGCACGGTGTTAGATACCTTTATCCCTTGCGGTGATAGATTTAACGTATGAGCACAAAAGAAACCATTAACAAGAGCAGCTTGAGGACGCACGTCGCCTTAACAAGCAATTTATGAAGGAAAAACCCGACTTGGCTTATCCCAGGAATTGTCGCAGACAAGATGGGGATGGGGCATTCAGGCGTTGGTGCTTTATTTAATGATCGGCATGAATGCACTGATAAAGCCGCCGAGGAATTATCGCATCTACAAATTCTCAAATCAGTGTTGAAGAATTTAGCCCTTCAATCGCCAGAGAAATCTACGAGATGTATGAAGCGGTTAGTATGCAGCCGTCACTTAGAACAGGTGAGTATTAATACGCTGTTTTTCTCATGTTCAGCAGGATGTCTCACCTAAGCTTAGAACCTTTACGACCACGCTCTTCGGCTGCGGAGAGATGATAAGCACTACAGACAACGCGTCGCTTCTGCATTCTGGGCTTGAGGTTGAAGGTAATTCCATCATCGCACCAACAGGCTCCAAGCCAAGCTTTCCTGACGGAATGTTAACTCTGTAGTTGACCCTGAGCAGGCTGTTGAGCCCAGGACCTTCTGCATAGCCAGACTTGGGGGTGATGAGTTTACCTTCAAGAAATGATCAGGATAGCGGTTCAAAACGTTTTATTACAACCACTAAACCCACAGTACCCAATGATTGCATGCAATGAG * tp:A:P cm:i:11 s1:i:60 s2:i:0 zd:i:2 NM:i:231 ms:i:200 AS:i:219 nn:i:0 SA:Z:utg000001l,30,-,79S7791M1D3184S,60,533;
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
62 56 16 utg000001l 36327 60 364S11M2I6M5I15M3D15M2I2M3I5M1D3M1I9M2I10M1D12M2D5M1I2M3D8M1I2M3D10M1D2M1D6M3D7M2D4M1I9M1I1M2D4M2I9M1D7M1I2M3D21M1I8M4D4M1D2M1I5M2D5M1I14M3D11M3I6M1I15M2D4M1D3M2I5M5D27M5D1M3D10M2I5M1I10M2I1M1D15M2D12M3I13M1D1M1D5M2D3M1I3M1I6M4D11M1D5M1D2M1D6M1I1M1I4M1D3M1D16M2D13M1I6M1I6M1I10M2I5M1D2M1D15M3I19M1I8M3D11M1I22M2D6M1D3M2D4M2D8M2D1M2D8M1D3M1D11M1I10M1I2M2D6M2D8M4I4M2I1M1D19M1I5M3D12M1D3M1I15M1I7M1I7M2I18M1D10M1D5M2I4M4I6M2I5M3D8M1I5M1D6M1I12M2D12M3D7M2D6M2D14M1D12M1I3M2D7M1I1M1I6M1D1M1D3M2D8M4I8M2D14M1D1M1D7M2D16M1I21M1D5M3I27M2I10M3I4M1I5M1D1M3D10M1I13M1D1M1D6M4I2M1D9M2D3M2D1M1D11M1I6M2D7M1I7M2D1M1D7M4D12M1D13M3D9M1I1M2D3M1D7M1D2M1D8M1D30M1I4M2I17M1I1M1I1M3I3M4D1M1D11M1I8M1I6M4I1M1I4M1D9M2I4M1D13M1I7M1D6M1I14M3D6M1I30M1D4M1D7M1I11M1I13M1D2M2I6M1D7M1I1M1I6M1D15M1D1M1D3M1D2M1I15M6I5M2I2M1I6M4D16M3I18M2D20M3D9M1D10M1I11M3I1M1I13M3D19M1D10M6I2M1I7M1I7M1I16M2I1M1D7M4I5M1D9M1I3M2D4M1D1M2I5M2D2M1I6M1I11M1D4M4D19M1D1M1D9M3I10M2D10M1D24M1D4M1I4M7I4M2I15M1D12M1I5M1I1M1I16M2D3M7I1M1D14M3I7M4I15M2I9M1I8M2I3M1I3M1D3M1I3M2D10M1D7M1I9M2I3M1D18M1D9M3D20M1D3M1D16M3D13M1D13M1914S * 0 0 CCTGGATTAAGAACTTTTAAGATCTTCACGAACTGTATGGCTGCGTATCCAGCAGAAATAATCCAGCTGAGGTGTACCTCTTTAGCAGATCCTCCGCAGTTAGTCTGCTCGTACCCTGCGTAAGAGGTTTCCGGCGGGGGTATCAGGACGACGGATCAGATCTAATGGATTTAAATGCCACTCATTTAGCTGGAGGCCTTCAGCGTTTGCCTAGTGTGCCGCGGTACTAGATGCAACATTTATGCAGCGCTTGTGAGCCTCTGTTGGACCGCCTGTTTCACATGCTTAAACGAGGCATTCCAAAGTTACGGACTGTTCTGGTGACAAGTAGCAACGGGTACCCCGTCAGCCGCGACGTCGCCACCTGTGGTCAGCTATTCCCCGACGGGAAGGCTTCACGGACGTCAAGCTACCCGCCAAGGCTTACGCAGAGAAACGCGCCCAGTACTGTGAGTATGGACGCAATCAGCCTGTACTTACCCCTCGTAACCAGTGCCTATAGACCTGTGCTCTTGAGTTAAACGTCAGCCCTGCTCCTGCCCGCTCTAACCAACAGCATACGATCTGCCGTCATGTCCCCACTTGCCGCAAAACCAGCGTTTTGTTGAAATCGGGTGTGAATTACTATCTCTTAGCCAGGCATACGCCAGCGCAAGGCTTCACCGCCAGCGAGGCCCCCACTAATGGCAGGTACCGGCAAGCGAACCCTAAAACATGGGGGATGACCCCGCCAAATTATACTTTAGCTTGAGTGCCCCTGTTGCAGAGATCACACGGACTTTGCCCGCTGCAAGCTGCGTGGCAGTCCGTAGCAACTTGCGGCAGCATACGCATGGGGGCTTTATTCACTAAGACGAGAAATCTCCCGCTTTCTTGGTTCACCTCGCCTAGCTGTTGATAGGCGACTGTTCAACGACTGCTGGCTTTTCACATCACTTTCGGGTACCAAAAGGTGACGCCTGACTGGCCGCTTAGTAAATTTAGTGGCATGAGACTAAATCAACGACTGAGTACGCCTACAGCGTCACTATACAGCGTAACTCTACCCTGCGATCCCTTCTGATACTGTCATCAGCATTACGTCATCCCTGCGTCATGTCCCACACATCCGGGGAAGCGGGGATAACTTCATTCCCGTTGAGCCAACGGGACACCCCTCTAAGCGGCAAACGCCCTGCCGCTTTCCTGCATCAGCACATCATCTTCAGGCTTGCGTCAGCCCCCACGCGTTGAGGACTGAAATCCAGCGATGCATATTCGAGATCTGAAAATAGAGGCCGGACGGTACGTCATACTACTAGAAAGTGCGCATATCCCAAAACATGAAAATAATGGGTACTGTAAAAGCGGTGCCAGTCGGCATATCGAGTCCAACTAGACCCCGGCAAGCATGGCACGCGTCAGCCGGGTCTCTACCCGCATCTAGGGTTTCAGGCCCAAAACTCAGCTACGTCGAAATGACCTTTCCCGCAACGTGCGGGCGGCCAGGCGTCCTGTCTGTTTTAAGGATGGTCACAACTCATACATACAGACAGCCGGTACACGTTTGCTAATGGAAATTGCTCGTGGCCAGCGTAAGCACTTCCTGCTCAATCTGTTTAACCGTCATTTCATTCATGGACGGCAGTACAATTGCTTGCGATGGTTACCGCCACAGCGACATCGCCGAGCCAGAACGCGCCGTCGTACCCCGGTGTCCGCTCCCACAGTAACTTCTAAGTTGGTGTCTCACGCCTGTTTATCCTTGCCGTTTCATGAGCGAGATGCTAATGCGGTGCAGGGCTGACAGTTCCAGAAAGCGTGACGTCACACCGTTGTTCAACAGTGATTCGGTTTTCAGAGACCTGTGATCGCGGATTAACTGGCGGGCCTGTTGACGTAGTCAATTTCTGCAACCGCAGCAAACTAGTCACCATGACCTGAGCCACGGAATGTTGACCTTTGCCTGCAGCAACGCGTTCACCGTATATTGTCATACATACGATTAAAGGACCCTTTTGTTTTATCCCAAGACAAGCACGAAAGGGGCCTCTGTGTCGGTCTACGCCCTCCCCGGCCTTGGAAGGCCGTCACGTGGTCATCGTGGCGGCCTTTGCGCAGGTCTATGGCAGCAGTCACGAGTCATGCCGGTTGCCTGTTACCGTGCTGCGAGATCTTCTGGTATTAGTGACGGACGTCCACATTGGTATTTTAGATTTAGGTACTACTTCCTTCACGTCACCGACGCTTACCGATACTGCTGACCCAGTACGGAACACATACGACCTGTTGAGGTTCGGGAAGCGTCACGGCGGCTGACACTGTCAATGCTTGCTTCATTAATCAAACCACGCCAGCAGGCCGCCTGCTGCCCCTGCTCTAATGAGGACTAGAGCGCGTGAAGCTGGTATCTGGCGGCAGATTCTTCGCCGTGCCCGGTCGAAGTCAGTCTGCATGGTCATCGAGATAGCTGTCGTCATAGGACCACCGTCAGTTCGCCGGCGTCAGTCTTTAACTTTTGCCACAACGAGACCAGTCAACGTCTGAAAGCGGATTTCGGCTACAACTTACGGATACGCTCCGTAAAGTCACCACAGGGTGTCCCGGCACCTTTCACGGGCGAAGTCGGCGAGGATTTGGTACAGGCAGCGTCCTCACATTTCACTCATAGGTACCATAATCCGTACAACCCTCTCCACGGCCCGCATCATCGTCTGTCGCGCCTTAGTCCATAGCCGCTGGCCACCATACTGGTACTGAATCTGACAGTGCCGGGATACGCTCATACGGATAAATCCGGGCAAACCGCATCGACTCACGTGTAGCGACAAACTCGGCTAAGTGGAGCAGCAGGAAAACTTCGATATGCAGAGCCTAGGTGCCATATCGCTAGTCCGCTCTTCGCCGTGTATTCAGGGTCGAGGCGAGATAAACGCGACTGTAGGAAAATCGCGCCATACAACAGGGCAATAAGTCAAACGTCGCCCCGGTGTTAAGGTGCTTCTTCTAATTAAGTGGAGTACGGCTGCACGCGTCCGTATGTTTCATCGCTATTTATTACCATCCTCAGTTGTAATGGTGCAGCATAGCCCAGCTCTGTTCGGAAGACGTTCACTAGATCTTAGATAATATTTTGTTTAAACGCCGTGGTCACAGCACCGCCATCGGATTTTCACCACGACTCGGGTCAACGGTTTTCTCAGCAACGAGGACCAATGGCCCGGCCATTTTCAGTTGCTGAATAAACGCGCCGGGGAATACGACGGTTACCCACCACAGCACATGCCGCCACCTTTCAGCGAGTAATGAACGCTGCGCTCGTAAGGCCGCACGCGCTCCCGCGGCGAAAGTGGACCCGGCAATCCCCGTCTACTTTGATTACGGGAGACTCGTGCCTGTTTTGACCTGATCTTATCGTCAACCTGACCTTTCGTGCTTCCTTTACAGTTCCGGCGTACCTTTGTCTCACGGCAGTAATCTGTGACGGATCTTGCGTTTGCGATAGCAAGTGAAGCAACGCGGTTAATGGCCATTGCGGCCCAGCACCGGGAGCGCGTTTTAGTGATACGGCTGAGGTTTTCGGAACTATCGTAAGACCTTTTGGCCATACATGCGTCGGTCGACGGACGGTTACGGCAGCGATCGCCCCGTCCAACTCAGAGATGACAACTTCCCCATCATCTAGCGAACCCGATCCCAGAAATTTCCTCACCCATCTTGCCCACTTCGACGCATTGACGCACTAAGCCAGTCCGGACAACAGGGACGGGAGGGTATGCAACGCCCGCACGCTGTCCGGCATAGCTGGTATTTTCAGGTATAGTAAAAGATACGCCCACTACGTAACTGCTCACGGATGTAATGGTGGCTGACGTTCCTACGTACCCGCGTATCGTTTCATCGGCGCGGGCAATGGCAGCATCGAACAGGTCTGAAGAAATCAGCCACCTCCCGTTATTGCATTCTGGCCAGCGCTCTGTCATTTCGGCTGCCACACGGCAGAGACGAAACGCCGTTCCCGTAAGCACAAAGTTCGATACGATTAATGCGGTGGTGAATGCATCAGTATGCAGCTTCGCTACAGTGCCACGACCGTGACCGTTACATATCCAGAATCACGGTATCCGGCTGCGGTAGGTCCCACCTCATTTTCCATGTCCGTCAGCACATTTTCCCGTAGGGCCAGGTCTTTGAACCGGCAGTTTCATCCGTGTCACTAAGCCTCCGCCTTTCGATAATCGGAGCGCCAGTTCTTCTGTCTTTCGTTACCGTCGACATCACGGACCTACGTCCGTTGTTAGAGCGGAGACGGGCATAAGTGAATCACGTTGTCATCTTTCGTCACTTAATCCTCTACACAGAAATACACGGCCCGACGAGTCTAATTGACGCCGTAAATACGACGCCAGGTACTACAGAGACCAGAATCGTGAA * tp:A:P cm:i:8 s1:i:101 s2:i:0 NM:i:656 ms:i:670 AS:i:670 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
63 57 0 utg000001l 43578 60 80S9M1D11M1D12M1I1M1I9M2D6M1D4M1D2M3D4M4I6M1D7M1I16M1I1M1I22M2I3M1I3M2D3M1D18M1D8M2D4M1I6M1D6M4D3M1I1M3D6M2I12M1D10M1D4M1I4M3D3M1D58M1I3M1D24M2I8M2D10M3D7M1I5M3I2M2I2M1I2M1D7M3D15M1I21M1D1M1D2M1D2M1D8M2I3M1D6M1I14M3D10M2I6M3D16M1I13M1I11M1D2M1D6M1I5M1D7M2D5M1I3M1D6M1D20M1I21M3D5M2I6M2D19M1D8M5D8M1D11M1D15M1I4M1I34M4I8M1D1M2D13M1D2M1D5M2I5M2D3M1I18M2D4M3D22M2D16M1I16M1D19M3D8M1I17M1D1M2D7M1D14M3I8M3D8M2I12M3I27M1D14M2D13M2I11M1D22M2D8M2D9M1I19M2I4M1D1M2I3M3I1M1I6M1I10M1I5M1I14M2D16M25S * 0 0 GGTAGTGTTATGATAGCGCCTGCAGCGTTTAATGCGCCGCGACGCATGGCCCACAACCGTTCACGGACTGAATTCGATTTAGCTCATCTGGCGTAATTCCGGAAAGCTGCTCTAGTACGAGACACAGCCCGGCAGCATACTGGACGCAGCGATACTGACTAATATAGAGACTGGACACGTTATCCGTATCCTGAGCCGTCCCTGTCAGTGAGTCACCCGGCATCAGGTGGGTACTTTGCCTCCCAGCCAAGCGGGCGTAGTAATACGCGGCAATTTCACCAATCCAGCCGTCATGGGTCCGCTGCTCCTATCTGTTCCCACCGAGAATAAAATGCATCGCTGACTGCGTATCCAGCTCACCTCAATGGTGGCGGCATACATCGCCTTCACAATGGCGCTGCAGCTGCTTTCTGCAGCGTGTCCGTCAGGACTAGCATCTTCATCTGCTCCATCACCGATCAAACACATTTGCACCGGGTTGCCGTCCTCTACACGGGTTCAAAACGTGAATGAACGGAGGCGCGCCGCCGGGTACTAATGGGGTATCCAGTGTCATTTTCTGCGGCATCCAGCCAGAGCCCGTCCCTAGTGACGTAATCCCATAGGCCGGACGCTGTCATTAATCTGCACACCGGCACGGCAGTTCCGGCTGTCGGTATGTTGTTCAATTGTGATGCCTTCGGGCTGACCATCGAACTTTGCCCGCAGGGCCGCGACGAACTGGTATCCCCATAGCCTGAACGAACAGTTCACCGTTAAAGGCGTGCCCGTAAGGCTTCCCCCGAATCATCATCTAACGTGCGCGTTTTCGGCTCAACGTCAATGCAGCAGCAATCCTCGGCAAACTATTTTAATCATTGCTCGCGGGAAAGGCACGGGCTTCTTCCTCCGATGCCAGATAGCGCCAGCTTGGGCGATGACTGAGCCGGAAAAACGAGGGTATATTAGTGCAGCTCTAGGATGGCGTTGGCATCCGAGCGTTATTGCGATACCAGATCGTCTGCGCGGGCATTGCCACGATAAAGTTGGGCAACAGGGCTGCATCCACACTTTCACTCGTGGGTTCCACGACCGCAACTGCTGGAAATGCTGCCACCGCCGTGATAACCGGCATATTCGCAGCACTTGTAGACGGTGCGGTTCCAGCCCCAGAAGGGTGGGAATGGTGGGCGTTCATACAGATATCCTTGCCTTGGCTGCGTGATCCGTTGTC * tp:A:P cm:i:20 s1:i:159 s2:i:0 NM:i:275 ms:i:700 AS:i:700 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
64 58 16 utg000001l 44385 60 2513S13M2I2M1I7M1I15M1I13M2D4M3D8M1I21M2D8M2D6M1D8M5I4M1I7M5D6M1I9M2D2M1I4M1I2M1I12M1D8M1I4M1D2M6D11M1D4M1D5M1D4M1D2M1D2M2I13M1D6M3I12M2D9M6D1M2D2M3I6M4I9M3D7M1D5M3D6M1D13M3D4M1D2M1D21M2D13M1D16M2I3M1I10M2D4M2D5M3D6M6D18M1I1M3D10M3D24M2D8M2D2M1D8M1I10M10D6M1I9M1D5M1D2M2D4M1D2M1D13M3I2M1I5M1D7M2D3M1I3M2D20M1I6M3I4M4D4M2D3M2D7M2D19M1I25M2D6M1D4M5D6M1D3M1D5M1D6M1D5M2D13M2D11M1D2M1D9M5D11M2D14M1D6M2D9M6D11M4D11M2D1M1D1M1D6M1I3M3D2M1D3M3D3M1I10M3D2M1D14M4D5M1I12M5D2M1D2M3D4M1D7M2D8M1D8M1D1M2D3M1I10M2D6M5D2M2D6M2D6M10D3M8D3M1D3M3I9M1D6M4D1M1D11M2D3M5D2M1D19M1I7M1D5M1D8M2D8M6D8M2D1M1D13M7D1M1D5M1D15M4D1M1D2M1D7M2I2M1D19M4D10M1D3M2D5M3D10M5D4M3D1M2D8M1I4M2D5M2D9M2D3M3D16M2D2M4D6M2D1M2D10M2D4M1D6M2D6M2I1M1D2M1D5M1D12M4D4M1D10M4D5M1D8M1I2M2I19M3D3M2D2M5D12M1I15M2D7M3D3M1D3M2D14M1D1M1D8M1D10M5D7M1D2M2D3M1D2M1D15M2D4M1I3M1D6M5D4M2I8M1I3M1D1M1D2M2I8M4D1M1D16M4D9M1I2M2I3M1D4M3D16M1D25M2D3M1D6M2D5M4I2M1D9M1D14M3D23M2I3M1D4M1D10M1D4M1I4M2D3M2D17M10D16M1D2M1D7M3D3M2I8M3D1M1D7M1D10M4D11M2D2M2D19M1D13M2D1M1D1M1D3M1D3M5D7M4D9M5D5M1D10M1D5M1I1M2D5M1D9M1D12M1D9M1D3M2D11M5D1M2D4M2D5M1D7M10D1M6D17M2D5M1I6M1D10M3D20M1D2M2D1M1D26M2D5M3D10M3D3M3D17M1D8M5D7M2D4M1I8M1D8M1D9M2D10M1D3M3D3M2I5M1I2M1I11M1D14M1I8M519S * 0 0 GAACTGTATTTGTATCTACTTTACGGAGTTGGCGATGTATAAGTGACATAAAATCCTATAAATTAAATCTAGCTAGCGTATAGAAGGTAAATATAAACGACCCTACGCTTACAAACGGTAGCTTACCTTCCGCTCGCTTTGGTTTCATTCTCTTCTATGCCATAACATGGACTAAACCCTGTCTAACTTGGTAAACGTAGACCTTGTATGTGGTTACCAAACCGCAGAATCCCAACGGCAGGACTAGCCCTTCACTTAGAACCGCACCTTAACGGCTGGAGGCTATTACGCTACTCGACTTGAGGCGCCTTCCCTCCTCCTCCGCTCAGGTTGATGGTACTTACTGCTTTGTAGGTAATGGTAAATAGTTTGTTGGTAACTTCTATAGACTGTTATAAAATGTATTCCCGATCATATCCTGTATATGCAGCCGTCCCTTAGCAGAACCGAGAGCGCAGTACCGCGCCTTACACCCTGTCGCTGGTGTACCCCTTATCAGGCCTTCCACGTATAAGGGGTTTGGCCGACATTCTTTCCCCGTTCGGTCCTACCCTTCTTAGCATCTCGTTCCTAGATCCTGTCCGCTCTCAAATGCTCGTGATCTAGGGTCGTCCGGCTGCCTGGTGCGGCTTCGCCTTCTATGTAAGATCATGACGGTTAGCGAAGCATGTAGAAACATATGATTTATTGGTGGTATCGTCCCCTGAGACGCGATTACTTAATCAGTGCATAATTGCATGACGGTAATGGATCGGTAATAACAAGATTACGGTTACTCTCACGATTAGGAAGCCCTACACGCCCCGCCACTTGTATAATCTCAACTAAACCATATATTAGTATGCTAACATCTTAAAAGTGGGCCGGGTACTCAAATGCATTCATTAAACGATGCAGATGTTGTAGGTTACGATGGTAGCGCTGCCGCTGTAAAATCTATAGATTCGGACCTATCCTGCCTTACCGTAAGAGCCTGTTGATAGAACTCATTACTTACTTACTCTATCATGCGAAGACTGTCGGCCCGATCTCTTCCCTCCTGCAGGCCGGCAGGCCATCTTACGGCTTTAATTAACTGTCAGGAATAGCAGAGGAATGGGCTGTCACCATTAGCTGGTTGCCTAGATGTAGAATGCGTCGGTCAATACGGACCCTGCCGCTTCGGACGGTGATAATGGGGTAGTAAAGGTTGAGATCTATGCATGCCCGTTTGACTGATCACCGTATCCAGCTCACGCTAGATTCAATCGGGCTGAGGGGTCCGGGGGCCTCCGCAGACTTCGGTTAGCTGGCTCTTCGTAAGTCTCAACTTGGATTTATACCTTATCCAGCTTCACGGTCGACTATGGCTTAAATCTAACAAACCCGTGGGCCCTTACTTAAGTAAGAGCCAGGAACCCCATGGCGCAATCCTATACGATGATGGCTGGAGGTCACTCTCCTGTTATCTGATTGATTGACCGGATCGTAAATCCTTCAAGCCGCCAGCGGCTTTAAGACCTCATGCACGGTTAGCTCACCTGGTTTGACGCCAACCCGGGCAAAATCCTCCTTATTATTACCGCTTTGTACCCTGGTGTTTATACGGCCGGTTACTATTACCGGCTCCCGTGACAACGGTGCTCGTAGTCAAATACGGCCTGATAAAGCGCCGTAGGCTCCAGTCCGCATTCAGCCGCACCGACTGGGCTTCCGAATCGAAGCGAGGAATAGAAAGGTGTCAGATAATTAGAACGATGGCTCCAGTAGATGATATGTCACCTCGCCGAAGCCACTGGACATGACCTGCTCGCGAGTCACCTAATGACGCAATGACTTCATGGACCCTTTGCCGTGGAGTAGGTCTCTAGTAATTCGGGGAAATAGCCACGAGAGACACGATCTAGGCACCCTGATACCGCACTAATGACTCTCAACACGGAGCTTTATGAGTGGCTCCTTTGGCTATTGCATGATGGCTTACTAGGAAGAGCGATTTGTGGCCTCAGACCCTCTCAATGCGACCATCTAACTCTACATAACTCATGTTTAAGCCTTCTGTTCGCTCTTGACGCCTAGAATAAATCCACTCTAACCGTGTACTATAGTATCTCAAGGCCTCTAATTGCCTCACGCGCTCTGCAATGGGTTTCTGCATGAGCACCTTGTCAGCTGTTCATAATGTAAAACACTTAAAGCCCAGTCCGCTTGTGTCACGGTTCAACGTGAAGGACCGGTGCCTTCCGGCTGCCAACGCAGCCGAGGCTAGTACTGCGTTTCTGCGCATCCAGCCAGGATACCTTCTATGGACTGACTCCCAGCCTAACTTGGTGTATTACACCTCGACCTTCAACGGCCAATGTGTCTATGCTGGCTTACTTCATGATGGTATCGGTGTTGACCATAGGGACGGGTAAACGATGGTAAACCAACGGTTCTACCTTTAAACGAACAGCCACGAGACTTTTTAACTTACTCCCCGAATCACTCGGTAAACGTTCTAACGTCAATGGAGGAAGGCAGGAAGTTCGTAAATGCCGCTTCAACCTCCGGGAAAGCAACGGGCTTCTTCCTCTCCGATGCCAGATAGCCAGCTTGGGCGATGACTGAGCCGGAAAAGACCAGGACCATTAATGCGATGGATGAGTGCGCGTCTAATAGCCGTTATCCGGTACAGAGTACTGCTGCGCGGCATTGCCACGGTAAAGTCTGCGAAGCTGCATCCACTTCATCGGTGCTTCAGAAGCTGCAACTGCCCTCAAATCCTGCGCCGCCAAGCCGTTGACCGGCCGGGCATGTCAGGCTTGTTGTCCGTCAAAGCGGGAATGGGCGTTTCATACATAAATGCAGTACCCTGCGTCGCTGTGTCATGCCGGTCTGCACTTCAGCTGGGCAATATGTCCGTCAGAGAAGCACGAGTGAATCGGCACCTGTCTTCTGTACTGTTGCCTACGTTTATTTGTCAGGTCATCAAGTGCTGCACGGGGCAGCAAGTTCTGTCGCGTTCATTCCTCCAGGCGCATGCGTAATCTGCCATGTTCTTGTTGGTTGCTGCACCATCCTCTTTCGCAGGCTTCATGCAGCACTGAGATCCAGCTGCCAGGCGGAAAGCATACTGATGCAGCCGCCAGCATAAACGAAGCAGTCGATGTGCCTCATTGCGTCCCTTTTATGTCACAGTTTTTCATCCACCATTTTCAAGTGCATTCAGCAGTCAGCTGCTGCTTCGGGTCAATAAAAGTTCCCTTCCGGACTGCCCAACCGGGAAGCGTTCATCCTTCCGGCGTGAAGCCGGTTAAATCTGCTCTGGTTGTCACGTGATTCAAGAGCAAAGCGAGTGGCTTCACTTAATGGTGCTGCAGCCTCCGTCATTAACGGATCCCTTTAACCGCGATACCAGCAAACGATGTTTTTCAGGGATTTCCAGCTCCTTTAGTCGTAGCAGATACGACGGGATATGACATTTCAAGATTCGGCGGTTATTTATTGATGGCGCCAACCTAAGCAGCGTGTCGTTCATCGTCGTGGCGACGTAATACGCCGGTCAATCAGGTCTTCACCCGGCCCGGTACCTCGATTTCGGTAGCGTCCAGCTGGGAGTCGATACGGTCAGGTAAGCACGGTTGAAACGGGCATCCTTTCCTCGGTCCTTCATCATCCTCATTCACGGCCAATTTTCTCGACCCGTGACTAAGTGGTGTCTAAAGGTTTACGTTTCCCATCTACGCTTCGTTTCATCCAGTGACACCTTAAGAGGGAACGGCTGTACGGCGATGGCTGAAAGAGATAGGTCCTGAGCTAATCGCTTCACCGGATGACGAAAACCAGAATGCCACGGTAATCCCGTCCCTTCCGATATAACGGCATCAGTAAAGTCCATGCCTATGCGGATGACGCAGGCTCTGCCTCCCGCGAACGCTATGGAGGCGTAGTACCTAGTCAGCTGCAACGGCGTCTCTTTGTCTCAATTTACAGTTCTATGCTCCCCGCAATGCGGGCAGGCAACATGAACTGGCATAAAATGCGGATTCACTCAGCACGAGCTAATCTGACAGTGCCTGTTGATTTGTGGAGCCACGGATGGACTTTACTAAGACGAGCTTCAATACGGTGTCTAGCGGAGGAGGAACGGTTTCCTGTCATCAAAAGCAGCAATTGTCATGAGACTAATACACCGACTTCACGGTAGTTTTGCTTACCGCCCAGTGCAGAAGCCACGCCCATTAGAAACGCTTCATGGCTTTACCCTTTGCCAACGGGGCCATGCAGGACGGAATATAAGAAGTTTTATCAACGTGGGTTTCATAAAGTTTAGGCATCACATGTCGGCAACCACTGTTGCTGCGATGCTCGCACCCAGCAGCATTTTGGAAGAGACCGACGGGCAGACTTCACATTCACCTCACGGATGTGTCGCTGCCATCGCATTCATGATGGCCCGTGAAAAGAATTTGCCCGCTCCTGGTATGCGGATTCGTCGGGAGCTAATTAACCCGGCCCATTCAACGGCGGTCTGTGGCTGGCCTGAACAGTGAGCGACCGGCAGCGGGACAAATGCCCGTCCTGTTAACTTCGACTGTTCTGATAGAGCTTCATCCAGCAAGCGGCTTTCTTCATGGCTTTATGATGTACTAGTTCGGAATCAACATGTCGGAGCCTCGGAGCGTCGTGCGGAAACGCTGCAGCACTATCTAGAGTGAGAAGTTCACTTCAGCGGCGATCCAACCGTCGTTTAACTTGAAAGTAGTACAGAATCGGCATTCCAGTACCACTCGTTTTACTTGCTGGATCCCCGTCCGTCATCCTCCCTGAGCGAACTTCGTCACCATTTATAGTAAGCAGCTTTACAGCACAGAGTACCCTGAGCTGTAATGCCTCAGCACTGCATTTGACTCATGTCTATTACGTCTGATGGACCTAGTGCCATAATGCTTTAGTTGTCCTTGTCGATCAAGGAAGGCTAGAGAATAATACGCACTACCCTTTCGACTTTGGTTCTAAACGTAATTCCGCTCTTTACTTGACGACTAATTTGACGAAAGAGGAGCCACCTGGAGGACTTCCACTACCGACCCCGTGGACATTAAACAGAGATCAAGAT * tp:A:P cm:i:15 s1:i:99 s2:i:0 NM:i:774 ms:i:548 AS:i:548 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
65 59 0 utg000001l 25214 60 22S10M1D33M2D8M3I11M1I2M1I4M1I7M1D3M3D7M2D2M1I11M2I3M1I12M1D2M2I4M2D2M1I17M1I13M1D7M2I14M1I1M1I1M1I5M1I12M1D8M1D21M2I19M4I12M2D16M2D2M1D20M3D11M3I2M1D8M1I19M2I5M4D18M2D2M1I25M1I12M1D1M2I10M1D6M1I9M1D11M1I8M1I7M7I1M1I9M1D5M2I9M2D12M3I1M2I6M1I4M1D4M2D4M1I5M1D7M2I7M4I2M1I10M1I7M1D4M2D5M2I5M1I1M2I12M1I12M1D12M1D5M3D11M3I4M2I21M1D2M1D5M2D7M2D3M4D7M1I1M3D4M1I3M1I13M2D3M3I13M5D8M3D3M2D10M2I1M2I5M2D6M1I2M2D4M1I8M1I6M1D3M1D16M1D20M3D14M2D11M1I32M2D3M1D15M3D13M1D12M1D1M2D1M1D4M1D29M1D4M3D3M1D7M1D15M6I10M2I9M4D5M1D9M3D8M3I9M5I14M3I1M1I5M4D13M1D8M1D3M6I2M2I6M1D6M2I11M1I9M1D2M1D9M3I3M1I4M2I10M4D5M1D5M3D10M2I7M2I4M6D4M1D5M1D8M5D8M1I6M3D9M3D1M2D26M1D10M1D2M1D46M3D13M1I15M2D2M2D4M2D2M2D6M1I8M3D6M2I4M2D2M1D2M2I18M4I1M2I4M1D2M2D5M2I7M3I33M1D8M2I6M1D15M2I1M1I4M1D6M1I1M2D6M2I11M2I4M2D6M2D10M2D9M4I1M1D11M4D2M1D5M1D28M1I17M1D17M2I2M1D2M1D5M1I1M1I14M3I2M1I2M3I4M1D12M2D17M1D8M1D6M1I23M1D16M1I5M2D8M1D3M8D9M1D13M1D5M1I41M4I7M1I4M2I1M1D27M1D1M1D3M3D3M2D10M1I23M3I3M1D7M2D4M3I5M1I3M2I6M1D6M1D3M1D22M2I3M5D18M4I2M2I22M1I3M1D5M3I9M1D1M2I4M9I1M2I5M1D3M2D1M1D3M1I5M1D7M2D5M3D10M1I6M1I4M6I4M1D8M2D16M1D5M1D8M1I4M2D7M1I3M5I7M3D4M3D7M2D5M6D1M2D8M1D29M2I5M1D24M3D11M1D19M289S * 0 0 CAGTGCTTGGGTGTTAATAGCCACTAACCGCAGAACGTTATTTCATACAACGTTTCTGCGGCAGAGCAAACCTACCGACGCGATCACTAGAGGACAAGCAGGCCTCATCTAAGGTGCAGTTGATGTATCAACTAATTCAGCAACAGGATATTCTTCCAGGCTTCCAGCAACGAGGTTTCTTCCTTCGTGCGATTCCCAATCTGCAGCATCTCGTCGAACCGGCGCAATATGGTAATGGCTACTGCATCAGGCTTTTTGTTTCTTCCCTCCCAATGCCGACAGTAGCGTTGCTTCGCTCCTTCGCCGAAGAGGTCCCGTTCCACTTCTATTCCCTCCCAGCGATAACCAGGTAAAATTTTCCGGTAACGACTGGGGTTGAGAACAAATAACGCGTGGCCGAAGCCACCATAGACGGTTTTACCCCGATGGTCTTCAACGAGATGCCACACTTGCCTCATCATGTTGAGGACAGCCACAAAGCCAGCCGCGAATATCTGGCGGTGCAATATCGGTACTGTTTGCAGGCAATAACCGTATGAGGCAAATATGCGTTACCTTCATACACCATAAAATTCATTAGTTTAGATAAGATTATAAATTTTTATGGTCGTGGTGTTCACTCATTCTGAATGCCATTATGCAAGCCTCACTACGTGTAAATGCAATGTTGACGGTGTTTAGGGTCCGCAGCGTTAACGACGGTATGGTGTCCGTGTGAACCAACATGAAGAAGGCAGTAACGCACCCAACACTGGATGCTGTCCCAATACCAATATCCCACGAGCATGTGCAAGCTAAGCAGCCACCCGTACCGACAATGAGTACTGTGTGCCCTGAACTGTCCGTTTGGATAAAGCAGCAATACCGTGTGGCTTCCTTTAACTGTGATAATTCCTGTAATGGTTGGTTCCATACTCTACTCCAGCCAGAACTGTTGCTCCTTAAACCATGTGGCGTGAGCACCGAGCCCTGTTAGTCCGCTCAGACTGTAGCATGAGCCCCGTGTTATTCGTCGATTTATCGATGTACCGACTCCTGTTGTTTCGTCCCCGTAATCAACGACGACCCGCCTGCTGTTTTCGTTAACTCGATCGGATGCTCAAACCGGCACTGTGTGATTAAGGACTTAATCCGACTCGATTCCTCAGACAATACAGCAAAGAACTAGATGGCGGGTTCCCTTGATGTCCAGCCCGCATATCAGGAAGCACACCCATGATACGGGAAGCCCGACAAGTTTTATAGCTAATTGTCAACGCCCTGCCCTGCATCAGGTATAACGCCAACGAACCACCGATGACTCGAGCAGAGTCCGAGACGAATGCCCGTACTTCAAGACATCTGCAACGGAATTTTCAGAAACTCCTGCCAACCTGAGTCAGTTCAGTCAGGCTGGCGGCATCCATTTCCCCAAATACGGTAATTTATTTTCGCCGTGAAACCGGATGCGCCGCCGTCAGTCGCATTCTTCGGTTTACCGCAAGCGCGTTAGTCATGAGCGTCGGTAAAGGCATTCATCGAGCCGCTCGCCAGTTCATTCAGCGTATTCAGTGCGTCAGGTACGCGTCGATAACATCGCAATCGCGGCCAGTTACAAAGCGGTGCGCAATCTGGGTGTTGTTCCCTAGGCCGTCTGCTGTTGGCGTTCCGGTCAGTGCCGGGACTGTCAGTAGGTCGTTCGTTCATCCATTATTAAAGCCCCGTGTAGCAGTTGCAGCAAGGGTTCAACGTCCTGTTGATGCATTAGCCTTAATAGTACCCCTTTCTCGTTGTGTCCGCAACCTCAAGCGCGACAGCTGACGGTATCTTCTGCACGTTGCCGAATTTGCACCGTATTGCCGCCGCTTCTGCAGCCAAGCGTCCTCTGCGATGTAATATACCGCATTCCCGCAGCCTCTGTCGCCTTCGTGATGCTCGTTGACGCACTCCCGCCTGTTTTGCGTGCCGCGGCAGGAGGAGTCCCCGTTCCGCTTAGTGTTTCAGATGACCTGGCATTCGTCTCGACGTTGCCTGGCAGAATTTTCTGCAGCCGTTGCCGAGGAAAACCGCCCTCAACGCACGAATGACGTATGACCGTTCGTTCTCATCATTTGCTGCTATGCGTGTTGGCCAAGCATCTCGTGCTGAAGTGGCGGCCTCTGACAGCGCCCTTCGTGGCCGCGGTAGGCAGAGGAACCGGATGAGGGAAGCTGCAGCAACGCATCTGTTGGCCTGCACGAATTGCTTTCTCGTTTCAAGGGCACTGGGCCCCGCGTTTTTAAAGGGATATGCGACAAGCACTTTTCCGCTTAGTGGCTTTGCTCATGCCTTCTGCGCCGGAGAACCTTCCTGAGCTGGCTGCACTGTCGGACGTGCTTAAGCGCGTGCTGAGTCAGTTGCGGCCGTCATACAAGGCCGCGACCTGAGCAGCTGATGCACTGGCATCGCCGGCTGATTTCTTCGCGTCCATCCGTGGTCAATACTGTTACAAATGTATACTGAGGAGGCGCGCGTCAAGAACAGTTTAAGACCGCCCCAGGGTACCATCACCGGGCAAGTAAACTTATAGTTTAGTGAGAAGTACCATTGTACACCGTTATAGAGTCTGAGTATTGAACTAGTATTTAAGCAGTCCAAGTGGCAGTAACCAGACCGTAAGTATCGAACCTGTACTGACGTACTCGAGTACGGTGTATCACCCATAGTCGATACAGATTTATAGCCTAATTGTCATGAGGGATTATTACATGTTATTC * tp:A:P cm:i:20 s1:i:190 s2:i:0 NM:i:786 ms:i:630 AS:i:630 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
66 60 0 utg000001l 19497 60 3747S15M3I2M1I6M4I3M1I5M1I14M1D16M1I2M3I9M1D8M1I6M1D32M2I8M3D12M2I19M1I6M1I12M1D5M2I19M1D7M1I3M1I9M2I11M1D3M1I1M2I1M1I10M1I1M1I2M1I3M1I2M2I7M6D4M2D6M1I4M1D3M3I2M1I4M2I17M1I6M2I6M3I4M1D4M3I3M1D3M1I7M1I5M2D15M2I11M1D4M1I1M1I6M1I7M1I3M4I11M1D2M1D11M1I5M1I8M1I23M2D11M3D6M2D3M1D5M4I6M7I16M2I5M1D3M3I6M3D1M1D8M1D3M2D9M1D11M1I11M1I6M3D4M2I5M3I13M2I13M2D7M3D5M2D1M1D7M2D9M1I1M2I7M1I7M2I5M2I6M2D10M4I12M1D11M2D15M1D16M2I3M1I1M1I4M1I17M2D5M2D7M1D13M1D2M1I3M1I7M1D11M1D5M1I12M2I4M1D21M6I2M1D6M4I7M2D12M2I6M1D17M1D5M1I8M1I6M1D4M1D2M1D8M3I1M2I11M1D2M1D27M3D8M1D1M2I4M1I7M1D4M1D2M3D1M1D4M1D13M1D5M1I4M2D12M2I1M1I1M2I9M5I6M1D6M10D4M1D6M2I5M4I10M2I6M1I2M1D4M1I3M1I17M7I5M1I21M1I25M1I3M1D11M3D5M1I1M1I3M1D3M2D4M1I7M3D1M1D3M1D5M1I6M1I2M1I12M3I5M1I15M3I8M1D9M1D5M1I2M1D9M1D16M6D7M2I4M2I2M1D15M4D17M1I15M1D5M1I1M5D20M1I3M4I6M1I9M1I7M1D2M1D6M1D9M1D20M6D16M2D5M1I7M1I5M1I9M1I6M1D10M2D2M1D29M2D13M4D9M1I7M1D12M2I14M2I14M2I25M1D4M1D5M1D18M2I4M1D10M2I15M2D2M2D11M1I10M1D11M1D18M1D9M1D11M3D7M1D21M1I4M1I33M2I8M2D9M2D21M1D14M2I4M1D3M1I1M1I5M1D30M1D6M2I8M1I6M1D4M2D9M2I2M1D14M1D7M1I5M2I8M1D56M3D6M2D3M1I23M3D13M9I7M4D1M2D10M2D25M2D19M1D9M437S * 0 0 GTGGGGTGACTTTGGACGAAATGAAGTCTACTTCTTAATCCCCCTTTCCTCCCCATACGTAATCGTACGATGCGTCACGAGTCAACTGATAACTGAAACCGATGCGATGCTACGCGAAATGACCCTTCTTTGCCTATGAAGGGCAGGGATCACGCTGATTGAGGTCAGCCCGATTATTCCAATATAATGTTGGATTAAATGAACCAAATGAATGCCCGTCTGGCTTCGATTTAATCGAAGCTTAAGAGCCCGCAAGCGAGAAGTATCCGAAATAATCGACCCTGCGGATATTCACTCGACCGCGACATCGACCCCGTTACGGATGGCATGCAACTGCATGCAGGGAATCACTCCAACTCTTGACGGCTCACGACCCTTGGAAGCCCCTATCATTCAAACTGGTTCCCGCACTGTTCGACGCCCGGGTTCTTTAAACGTGCAACCTCGAACTACCTGAACGGCACAGGATGCGAACTCGACTTGATTTAGCATGAGATAAGCAAGGCGCTCCGGCACTCCTCGGATCGATTATCCTGCAACATTCTACGGGGTCAGTAAACTTGAATCCGAACATGTCAAACGGGGTCTGCACGTGGCACGATCGACGTACTGAACTTCCTTCCCCTTCCGCATGTTGTCGCTATCAATGCTCCAAATACCCGCCAACCGGAGAGGCGAAATCGGGCCCTGAAGAAGTGTTCCACTTCCGCCCCTGCTTTACATTTGCACCGGTGGCTGGAATTAAGCCCATAAAGCACTGGCTGGGGGAAATATACGATCGAGAGAAAGCAAATGCAATTCATGCTCGTACATTTGGACGGGTTCGGCAATCCGCGATCGTAAACTCCCAATGCCGCGACTCTTAATCCCCGCCTGCTCTCCCAATGGTTTATGCGTCTGAAGCAAATCGAATGAATGCCCGTTTACCTCCGGATTTCATGAAGTTCAAGCTCCGTATTTCCAGGCCATAAAGTCAGCTTCAAGTGAGCCAGGTGCATGGTGATCCACAGCGGCTTGGGTGACTGAAAAATCCCCTAGTATTTGCCAAGCTGACGCCCCTATTGAAGCGTGAAGGCCTGCATTATGTCGTGATCATGAGCGGATGAAAAGGTAGATGGCGGTGTTTGACGAGATCGTGCCTAGTTCGAGACATCTACCCACCCAAAACTGAAGCTGACGTGAAATCGTTGTATTTGGCGATAATGGCGATGAATACCTCGGACGTACGACGCTCCCCAATCCTTTCGTCTCTCCTTCCTTCATCGTCAAGAAGGGGCCTAGGTCCCCGAGCATTTTCTTTATCCAGAAATCCACTGAAAGCACAGCGGCTGGCTGAGGAGATAATCAATAAACGAGGGCTGTATGCACAAAGCATCTTCTGTTGAGTTAAGAACGAGTATCCAGATGGGACACCTTGCTCAGGTGGAATCAGGTTGTTGAACTAGGAGCGCCACCAGTAGAAACAGACGGAACTTTCAACCGTTAGCCGCATCCTTTCACAAAGCTGGAAATGATGGGCGGGTGAAAGCAAGTACAGGGAAACCAGGTATCAACCACGGAATGCATTTGGCAGCGGGCTTCGACTTCTGGTTGTGCTTATGCTGCCGACTCAAATGTCGATGTAATCATCGATGGAATGAAAGCCCTTCTGAAGCATTGCCCGTCAGGCTAATTCTGAAATCAAAGGCACCCAGTTTCTAAACAGCAACCCGGACCCCATGTACCGACCGATTAACGAAGCACCGCGTAAACGGTAACGGTGGATTCACCACCGACTCCACTTTAAGCTGGATCGGCATGTTAAACGGCGTCTTTAAGGAATGCCATCGCCTACTCCGGCTATCCATCAGGAGTACAGGCTCCTTTATTATTCGCATTGCCCTCAAGCGTATTAACAGACAGTTCAGGAGGATTAATGATGAAGGTACGGCAGCACTCCATTGATTCAGCATCAGAAATAGAGAATTAAAGGCACTGACACAGCGACTAAATGCGCCCTCCTAAACCCAACGATAGCTATCTTGGTTCTTAAGGCTTGTTGAGTGAGATCCGATAGATGAAATGAAGACGCTGTCGTTCAGGGTGTCGACTTGTGTGCAAGTGCCAGGAGGATCTGAATTATCAGTAAACATAGAGAGGTTTGAATAGTCATAGGAAGTCGACTCTACGGACGCGACTTGGATCCAAGCATGAATGCATGACGGGAAGCGGAGACCGAAGCCCGACCTCGAATTACTTGGTAACACCATCGATTGTGCTCAGAACTGCTCATGGGGAGATGAACGGAATAAACAGGCACACGGACGCCGCGACCAGGAGAACGGAAGGGGTTGCGCTATAAACCGTCGGAAAATGCGTGTTGATAGCTTGAATGAAAGACGCAAATCGAGCTCCCATCCCCTTCTTCTCATCGGGCTAATGCGCGAAGTGTTATCCGGGTAGAAGCCGTATTGCTCTGAAGCAACGAAGTCCGTGAAGACGGAAACCAGTTTCTTGTTGTTCGCCATCCTGAAGATCTCCTGTTATCAAGCACTGCACTGACCGAAGAGTTTCTTAAGCAGTTAATCGAACAGACCCGTTGTTAGGTGACTATCGACATCATTACGCATCATTACGGGGTTGGGGGTCATAATGGGTAATTCAGGATGCAGTGAGGTATCTGCGATATGATGTCTGACGCTGGCAATTCGCATCAAAGGAGAGTGAGATCGGTTTATAAAGAAGGAGCGGAGGAAGCGTGCACCGTCGTCTTCACAGCGATGCCAGAGTCTTAGTCCATCAACCGTTCAAACATCGGGTCGGTATTATCTTACTGTTTCTTTACATAAACATTGCTGATACCGTTTACGGCGCTCCAACGACATTGCAAGGAGTTTATAAATGAGTATCAATGAGTTAGAGTTGAGCAAAAGATTGGGCGTTATCAATGTTGTGCAGATCCCTTGTCTTCTCCTGCTATGCTCCAGGTTTCTTCCTGCTCCCATAGTAGATAGAGTCGGCATACAAATATTCCATGAAGGTTTATAAGTCTAATGAAGACAAATCCCCATTCTGCAATGTGCGAGAAATGACTGATACGTGCAAATGCTTATCGAACTCACCGGTGGAAGTCAGTATGCCCTCTCTGTACAAACATATTAATGACGTAATACGAAGACATCCCCGCAACCGCGGGCAGGGAGTGGCTTGAGCTGAACCCTGACTAGCGGGTTTTGTTTATGGAGATGATAAATGCACTTCTTCCAGTCACAGGCGAATGCGAATGGGAGAACGGTTCAACAGAGTTATCGAATAACGGAGGACATCAACGGGACTGCTACGACCACTGGGCTCTGGGCGCACTGATAGCACATGCAATGACTAATATTCGAATTTGAAGAACTGAAAGAGAACACCAAAGCCGCCTGGTGATGGCCGTCCTCCTGCGTGTAATTGGAGACTTTGCGATGTACTTAACCTTCAGGGAATGAACGCACGAGCGACGTCCAACCGAGCCTTGAAACAGTTCGTCGATGGGTTCGGAATGCAGCAGTTCCATCCGGTTAAGGATGGAAGAGAACTTTCCCCAGGCTTCCTGATTCTCTTCCTGCACTGAATAACGATAGCTTTGAAGAGGATCGAAATGGGAAGAAGGGGAAGAGAGAAGGAGCGAGAAGGCAGGAGGAAATCGATTACTGTGATGAGCATCAAGGACGGGCAAGGTTGGATCTAGCAGACATGAATCCAATCATGGCAACGCTCTAGTAACAGGCCAACATTGAGTTATCTTTTCCATGACGACAAACACAAGCCTCTGACAGCGAGAATCATTGATAATTCCGTTACGTAGTTACATTCATGGCCTTGATCGCTACGAAAATCCTGGCCAGCAGAGGAATTAGGACCAGAAGACTCATAATTACATGAGCAAATTAAAGCAATAAGGGAGGGTCTGCCTGATGCTCATTGAAGACATCACAAAGAAATTGCGCAATGCTCAATGGATACGACGAGGGCAAGGCGGCGTCAGCCAAGTCAATCAGATCAACATGAGCGATGCATTCCGAGAGTAGCACCTATGAAGGCCATAACAAAGAAGAGCGCATCCCGATCCCAGCGAGCAAATCAGAGGTACGACCCAATCAATGTCGACCGTATGAATGCCCTCCCAGACTTCTCTCCCGGGGCCAATCACTCCCCTCCTTTCCTCAGACTACCTTGCAATCGAAATGGCTGTTGTTACCGGGCAACGAGTCGGTGATTTATGCGAAATGAAGTGGTCTATCGTAGATGGATATCTTTATGTCGTCAAAGCACTCCTGAAACAGGCGTAAATGCCTCATCCCAACAGCATTGCGATTACTGCTCTCGAATATCAATGAAGGAAACACTTGATAAATGAGAAGAGATTCGTGGCGGAGAAACCATAATTGCATCTACTCGTCTGAAGCCTTTCAGCTTGAGCACATATCACAGGTCATGAGGGGACGAAAATCTAAGGTCTTTCCTTCGAAGGGGATCCGCCCACCTTTCACGAGTCGCAGTTGTTTAAGACTCTATGAGAAGCAGATAAGCGATAAGTTTGCTCAAACATCTTCTCGGGCATAAGTCGACGCTGGCATCACAGTATCGTGATGACAGAGGGAAGGAGTGGACAAATTGAAATCAAATAATGATTTTATTTGACTGATAGTGACCTGTTCCTTCCGTCGGCCATCTTCCTCGCCGCCTTCCTTTTATAATGCACTGTAGTATAAAGCTGAACGAGAACGTAAAATGATATAAACTAATATTAATCCATTTGCATAAAACAGACTACATAATACTGTTAAACACAACATATGCAGTCACTATGAATCAACTACTTAGATGGTGATGAATAGGCGCAGAAGCCGAGGCTTATCTGCTGGCGGAGATCTTAGATGACTTGTCGCCCAATACTCCAAGAAGCCAAAGCCTCGCAATCCAGGTTGTGCCATGACATTTGTGTGCACCCACCGACCTGCATAACCAGTAAGAGAGAGACATACCAAGTGATGTCGACCAACGCAACGTAACTTCTTTCTTTCACGACTTCCCGCGCCCATAAATCATTTCTAGTGAATGTCTGTTATGAGCGGAGAGGGAAGTTAACACTTATGAAAATGGCTACAGGGAAGTCCGTGGCTATCTATCGGCTTATTAGTATTGAAACCGTCTTCGAGACGCTGGAGAGCTAATCGTTCGAGGTATATGCAGATTAATAGACTATATCGTTGGTATAAACAGTGCACCATGCAACATGAATAACAGTGGGTCTCGGCTTCCAGGCCCCTCTCTTTCCGAGCTCCCACAAGATACGATGCGCGTTACGGCAGGCGAGAAGCTGGAGGAAAACGTATGTAATAGAGACTTAAAGAGAGATCCTGTTGAGCGCCAACATAAAGTCGCGGTTATTTTAATAAATTAAGCGTATATATGTTGGAGTTTAGTTATTGAAAGAGGGGTATATTCCTGCAGTAGAAAGCACCAGGATTCCTACGAGCAGATGGTTTAAATGACGTTGCTCCTTTGTTACGTAATGTTTTATCTTACTGTCTTTGATGAGCATGGCTAAATGCGATATCGGAAATTTGTTAAATTGGTTTGCTTAGATAAAGAGAAGTAAGCACTTATTCTATTAATAGATAAATTCAGTCAACTCCCTGAAATGTTTTTCCTTAGGTGAAAGCATTGACTATGTTAATCTAAGCAAATTAAGCGATGTATTTAAACATAACCTTCTTAAAGCTATTCAGGGAGCAGGCGAGGAGGGAGATCGATTAGCCGACATTGAAATGAAAGCGTCCTTAACACCTCGGTTTATAATGTAGGGGCACTCTTTCAGAAATTCGCTCCCCGTTCGCCTTCTTCCCTCTCCTTCTTCGAGGTCTTCTTCGATTTCCACTTTCATTTAATAGAAAAGTGCTCCCGAAGATTCAGTACTTATTTAGCCTCCGTTGAACGGTTAATTCTATGCCCAGCACGAACATTCATGCTTTATCGGGCACGCATCCTTGTCGGGCCACAACAATTTGAATCGAAGAGGCATCCTCTTGATCGATCACAACCCAAAACAATGAATATTTTCTCTGAAAATAATAGACTTATCGAGTCAGAATCCCACGAAGCTCACAGTGTTTTGCCTGCCCTTTCTAGCCCGATGGGAGAAGCGCGAAGGGATGCCTCTCTCTGAATAAACACCCTAAGGCTCAAACAGCACGTAATACTTTATTGTAATGGAATCCTGCCAGCAATAGTTTAAATCAGGCGATCCCCTGCTCGAATTCATTTCAGCATTTATTGGTTGTATGAGTAAGCCGAAAAGACTCGTGGAAGCTATCGACGGACGATAGTAAACCGACTGTTCAGCTGATGAGGGGACTCATCAGCCCCTTCCTAAATATGAAGAGGATCAAGACGTAATGAACCGAGCAGATTCAATGACGATGATACAACGCCCGACTTGTTTTATGACACTGAGAAATCTGCTTCGAGTCTGAACTACCTGCATTGTTTTTATTTACTTATCAAGATTAGTCATCTTCTCATCTTCTTCTCGA * tp:A:P cm:i:15 s1:i:156 s2:i:0 zd:i:2 NM:i:749 ms:i:602 AS:i:558 nn:i:0 SA:Z:utg000001l,16994,+,1293S698M51D4569S,60,226;
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
67 60 2048 utg000001l 16994 60 1293H5M1D6M1I11M1I6M2D3M1I7M2D4M2D15M4I5M6D4M1D34M3D13M1D7M1D19M3D2M1I4M2D4M1I4M4I5M1I3M6D3M2I10M2D20M1D8M2D6M1D2M4I4M1D2M2D7M1D11M1D3M2D17M3D22M2I11M1D7M4I3M1I3M2D2M2D4M2D2M2D2M1I2M1I12M1I2M3D3M1D7M1I28M3D2M4D8M4D3M5I20M1D1M1D1M4D4M2D15M1I11M4D1M1D1M1D7M1I3M1D8M1I7M6D2M1D8M3D22M3D3M1D4M1I5M5I2M2D3M1I5M1D4M2I2M1I5M1D23M3D21M2I10M2I3M2I7M1I27M1D1M2D6M2D6M3I7M1I6M4569H * 0 0 TTTCTTTATCCAGAAATCCACTGAAAGCACAGCGGCTGGCTGAGGAGATAATCAATAAACGAGGGCTGTATGCACAAAGCATCTTCTGTTGAGTTAAGAACGAGTATCCAGATGGGACACCTTGCTCAGGTGGAATCAGGTTGTTGAACTAGGAGCGCCACCAGTAGAAACAGACGGAACTTTCAACCGTTAGCCGCATCCTTTCACAAAGCTGGAAATGATGGGCGGGTGAAAGCAAGTACAGGGAAACCAGGTATCAACCACGGAATGCATTTGGCAGCGGGCTTCGACTTCTGGTTGTGCTTATGCTGCCGACTCAAATGTCGATGTAATCATCGATGGAATGAAAGCCCTTCTGAAGCATTGCCCGTCAGGCTAATTCTGAAATCAAAGGCACCCAGTTTCTAAACAGCAACCCGGACCCCATGTACCGACCGATTAACGAAGCACCGCGTAAACGGTAACGGTGGATTCACCACCGACTCCACTTTAAGCTGGATCGGCATGTTAAACGGCGTCTTTAAGGAATGCCATCGCCTACTCCGGCTATCCATCAGGAGTACAGGCTCCTTTATTATTCGCATTGCCCTCAAGCGTATTAACAGACAGTTCAGGAGGATTAATGATGAAGGTACGGCAGCACTCCATTGATTCAGCATCAGAAATAGAGAATTAAAGGCACTGACACAGCGACTAAA * tp:A:P cm:i:14 s1:i:146 s2:i:0 zd:i:1 NM:i:226 ms:i:268 AS:i:268 nn:i:0 SA:Z:utg000001l,19497,+,3747S2350M26I437S,60,749;
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
68 61 16 utg000001l 30718 60 8S11M2D1M1D12M3I6M6D7M1I4M1D20M2I19M1D18M1I8M1D10M2D22M1I20M1I2M2D2M1D3M1D12M8D2M2D7M2I11M1D9M3D2M1D6M1I32M4D2M2D3M3D3M11D22M2D3M4I19M3D30M2I9M2D9M2D13M1I2M1I8M1I3M2I18M1I11M1I7M2I26M1I4M3D1M1I7M2I6M3D4M1D2M1I21M1D12M1D12M1I2M2D2M1D1M2I2M1I6M2D8M2I7M2I9M1D3M2I1M1D2M1I14M2I32M1I7M1I5M1D2M1D2M1I9M4D5M1D20M2D39M2D24M1I2M2D1M1I9M2I12M2I8M1I14M1I5M4D1M1D3M2I3M2D7M2D3M1D8M4D4M1D2M1D8M1I3M2D2M4I6M1D9M2D7M4D7M1D11M5D1M2I25M2D1M2D4M2D2M1I12M5D12M2D4M1D1M2D18M1I5M1D7M2I13M1D21M1I12M1I3M1D7M1I6M2I10M1D7M1D1M1D2M1D6M2D4M1D11M2I52M1I6M1D16M1I2M2D9M4D6M1D1M3I11M1I1M1I3M1I4M1D1M1D6M4D4M2D15M1D6M3I5M3D1M1I1M1I14M1D6M1D2M1D15M2D33M1I33M1I3M3D2M1I1M2I7M1D10M1D6M1I5M1I3M2I7M1I4M1I9M3I12M1I5M1D6M1I14M1I36M1D9M2I3M1I2M3I2M1D16M2D7M1D5M2D4M1D6M1I21M1D15M1D12M1I9M2D20M1I16M1D20M1D4M2I8M1I17M1D12M1I8M2D11M4I13M2D4M1D10M1I6M3D11M1D1M1D11M2D6M3D10M2I9M1D10M2D11M1I4M5I2M4I4M1D8M3D7M1D4M2D4M1D3M3D4M9I1M1I36M2D7M1D10M1D58M2D17M1I13M1I2M1D1M2D4M1I5M2I1M1I11M1I10M5I4M1I2M3D15M1D12M1I2M2I3M1D14M1I2M1D12M1D6M5I7M1I6M2I7M1I9M2I1M4I5M1D4M1I8M3I4M1D9M2I12M5I4M3D43M1I51M1I1M2I22M1I8M3I5M2D8M4D14M3D20M2I1M3I31M1D7M1I6M2I4M3I8M1D4M1D14M3I21M8D2M1I4M1I3M2D11M4D3M2D6M1D2M1D11M2I10M7I7M1I1M2I14M4I4M7I2M1I2M6I1M1I1M4I2M3I3M1I2M2I3M3I5M1I5M1D5M2D3M1I23M2D7M1I1M2D2M1I8M1I3M1D8M1I3M1D11M3D5M1I13M1I2M1I5M4D5M1D8M1I7M2I3M2I14M1D6M1I1M2D8M2D8M4I4M2I2M4I3M1I6M2D6M3D10M2D3M3D4M2D8M1I11M1I12M1I10M1D20M1I9M4D8M1D10M1I7M5D11M5D18M1I2M1I3M1D9M1D8M1D28M1D5M6D10M3D1M1I7M1I2M1I3M2I10M1D10M1D12M1D22M6D5M1I7M1I11M3I19M1I5M3D16M2D1M1D13M1I10M1D14M1D4M2I4M1I6M2I4M1I11M1I5M1D5M1D22M1D12M2I6M1I4M3I4M2I5M1I6M2I42M2I2M1D1M1D15M1D16M3D3M1I7M3I2M1D7M1D21M1D1M1D3M1D9M3I4M1D3M3I6M1D4M1I10M1D9M1I3M2D24M1I2M2I8M2I3M2D1M1I5M3I11M1I1M3D13M3I3M1I4M2I2M3D2M1D4M1I19M2D6M1I6M1D2M2D10M1I31M1I3M1I1M2I5M1D14M1D1M1D5M3D16M1D6M2I8M1I7M1D6M6I6M5I2M1D21M2D3M4D2M1I13M3I19M1I3M1I4M1D14M3I3M4I4M1I3M3I12M3D10M1D20M1D7M1I17M1I5M3I7M1I9M2D6M2I17M3D12M7D18M2D10M4D3M5I3M1D9M3I11M2D13M1D18M1I12M2D9M4I10M1D7M1D1M1D15M2D2M1D10M1D17M1D3M2D7M1D3M3I6M4I3M1I8M1I7M2I1M1D19M1D15M1I5M1I7M1I3M1D14M1D4M1I9M1I5M3I6M1D5M1D9M1I3M1I2M11I4M2D6M4I8M1I18M2I3M1I4M2D16M2I2M2I9M1D3M1I2M2D27M1D4M4D8M1D8M2D6M1D3M2I7M2I2M1I8M1D6M4I20M1I2M5I9M1D2M3I1M1I13M1D17M1D4M1I27M2D1M2D2M4D5M2I21M1I4M1D2M3I9M1I8M1I9M6I2M1I9M1I8M1I13M1D3M1I2M1I5M1I3M2I7M1D6M1I1M1I5M2I3M1I22M4I7M3D7M2D10M3D6M2I10M1D15M2I5M1I5M1I1M1I24M2I4M2I3M1I5M1I11M3D22M1I21M1D14M1D6M3I4M1I1M1I13M1I3M2I15M1I10M1I5M1D39M1D3M1D8M2I4M1D8M2D1M1I14M2I12M2I17M1I16M4I16M1I11M1I13M1I21M2I3M2D6M1D12M7I11M2I19M2I9M3I2M1D21M1D16M1D13M4I3M1I8M1D16M2D35M1I9M2I8M3I5M1I3M1I2M1D87M1I6M2D3M2D6M1D2M1I7M3I19M1D7M1I16M1I5M1D5M1D2M3D1M1D11M2D1M2D6M1I9M2I32M3D11M1D9M1I2M1I15M1D12M1I2M1I22M2D12M1I4M1D3M3D7M1I4M1D3M1D6M1I3M1I13M2D6M4I28M1D3M1I1M2I20M1I14M1I11M3D40M1I70M1I34M1I11M1I4M2I7M1I10M1D14M2I11M2D6M1I7M1D25M2I2M4D7M2I1M1I12M1I14M2I5M1I5M3D28M1I17M3I55M4D7M1D6M1I17M1D9M4D20M1D33M1I32M1D2M2D12M1I10M1I24M3I11M1D3M1I6M2D5M4I17M2D19M3I6M2I6M1D3M1D12M1D20M1I7M1I6M3D8M8I14M1I26M2I20M2I1M1D30M15S * 0 0 TATCATCTCAGATTTCAATAACATCGCCCGGTCGCATGGCGACCCTTCTCTGCCCGACGGTGAAATCTAAAGGCTTCTGCGTTTCCAGCAGTTCGTTTTGAACCATCAACCGACCCGGCGCTGTGTGCCTGCCGGCTGGTACAGCCAAAGGCATTCATCTTCGTAACATTACGACCGACGGCATGGCCTGCGTATCTCACGTCTAGCGGTCTCCAGCCGTTGTTCGTCAATCCAGTTCACCTCAACGGCATTATGGCGTCGGCGCTGAAGCTGTAGGAACGGGGGCGCCATCATCCCATGAAGTACCACATTACTGCGGTTAGTCCACGTCTTATCCGACGGTCGGTCCTGCAGACGAACGTCCGTCTTACCGTTCCATACCGGCAATACAGCATCGCCGAGCAGAAATCGCTGAGCACATCCCACGCCTTACAGCTGTGGTATCAGGTACGCATTACAGCTGATGCGCGGCGGGCCGTGCCGCCAACGTCCGGCACATGACTGGTCGCAGTACTGGCCATGACATACAGCCCATTTATCAGACATCCACGCACCAAGACGTTCCCCACCTGCCGTAGCGCGGATGGGTCAGCATATCCCACAGACACCAGGCGCCATGTTGTTGCTGTATGCCGGTTTAACGTTCCGTCCGAGATACCCTTATTGCCGCGTCTGCGGTTATAGTTCGACGGCACCTGCAGAATACGCCCGCGCAGATGATAATTACGGCTCACCTGGTCGGCTGCCGACTGCTCCGAGTTGACCTGCACGCCGACCAGTGCCGTGTTCGGGTAGCACTGTTTCACATCGATGATTTCAGTATGACGACCAGAGGGTCGTATGCAGCTGGTCTGTGGGCGTCCGGCGTCATCCTGCGATCCGGATAGGAACGGGCGGCGGATGAGTCCATAAGGGCCGAGATACTGCGAGGTGGTTTTAGCTTAATGGTGATGTCTTTTCGTACCAGCCACCGTTACGTTGTATCTGAACCACCAAGGCGGACTTCCCTAGACGCATTCCCGTCACCCTTTGAGGTGGTTTCCGGTCAGTGCCTGTACACCGAAGGTAAAGCGCAGACGGTCGATGTTGCAGACTTAATGGTGGCTGATCGGCGTGTCATATTTCACTTCCGTACCCAGCAAGGGTGGGAGCCGGAGGATTCAAATCCCTCGGGCGGAGTCTGCTCCTGCTCGCTCACCGGAACACCGTGACACCGGATATGTTGGTGACTTCGCCTCAGTGCCGTAAGCGCGTACTGTTCAGCACCCCTAGATTAGCTCACGGACCTTCAATCGGCCTTCGCTATCGCATCGATCACACCAGCAACTCCTTAGGACTTCAGGTTGTCCTTCGCTTCGCTGTATGGGGCTCCTTACTGCTTCCTTTGACCTCGCGGTCACGCTCATAAATGACAAACCGCCCGCAGGCGGTTTTCACATAAAACATTTGCATCATGAGCGACCAATCACCACAACTGACCACCGTCCCCTTCGTCTTGCCGTGCTGATCTCCTGAGAAACCACGCGGTATACGCACGCATTTCCCCGGTGCCACGAACAGGCAGAACATTGCCTTAGAAGCATTATCAGTGAGGAGAAATAGGTGTTCTGCTTACCGTTATCCGTTGTCTGTACGGGGAATCTGGGGTCGGGTGGCCAGCATCTGCGCCACACCACCGAGCACCATACGGCACCGAGAGAAACAGGATGCCGCTTCATACCACCGGTTAGAATGGCTGCCCCCATGCTGCAAGGGGCTCCGGCGGTAAAGAAACCTTGAATGGCGTAAGAGCCCCAGAAGATCTGGAATACATGGTTAATGGCGCGGCGACCTGGAACACTGAATTACAGGGCGCCATCAGCAGAGTCTCATGTAACTGCGCCGTTAACCCGGACGTGCTCGTCTCCACCGTAATCCCACCCTGATAGATAAGGTCGTCGCTCAGTTTCTGACGAAACGCCTGAGCTGTGGCCCGTGCCCGGATGGCTTCAGCCGGCTTTCACACGAAGGTCGATGCGAGACCAAATCGTTGTAAATCCCCGTAAAGGCAGATGCGCCATGCCCGGTGACGCCAGGGAGTGCGTCGCTGCCATTTGTCCTGTCTATACCTCTCGGTTTGCTCAGCTAGTTTGTGTCGAATATGGTGCAGCATCGCCGTCGCCGCAGTAAATTGCGTGATTCGGCACTGATGAACCAAACAGCCAGCAACCAAGGACATCGCCTAGCCCTGTGCCGCTGACAACGGCACCTGTGATAAGCCAGCGTCGCCAAGCCCAGATTATCCCAGATAGAGATTCTGGCCGTTACGCCACCAGTCATGGACCCCATTGAAAGTCCGGCATCTCAATCCCGCCAGATGAGCAGCATCCCGGAACAGTGTGTAACAGTCCGTCACACCGTGCTGCATAAAGCGCCGCCCGGTGAGATGCGGGCACACAGCGGAACTGGAATCGTCGCCGGCAGACCAGCCACGGCAAATCACTCTGCACCTGCAGCAGCCGCCGGTCGGCCTCACTCAGCCAGCGGACCACCGGGGGCTGGCGTGTAAACAGCGGCCAATTCACCCTGCATTTCTCTTGCCTGCAGCCAGTCTTCCGGATCACGGAAATACGCCTCCGGGCCGGATGGTACCAAGGGAAATATGTTTCCCCCTCGACGGGTCGGCGTGTCGGTTACCACGAAGCCGGAACCACGCGCTGGCACATCGCCGGGCGTGCACAGAATCGCTGATTCTGTCTTGTCACTGGGATTTACTGCGGAAAGTTTGTCAATGGAAAGGAACGCCAAAGTTGCCGACGTTATTGCGGAACTTACAACGCTCAGGCATTTGCTGCATTTATCCTTCGTGATATCGGACGTTGGCTGGTCATATTCATCTACGAGGAAGCCGGACCGCTAACCGCACTCCGTGTACCGCGATAGGTCCAGTGCAGCGTCTTTACAGCATGATACGTCCGGAAAAGCGCCCTGCGTTTCGTCGGCGTGGACAGGTACAAAGGAGCAGCACCGCGCTCAGTTGGTCGCTGCAACCTGCTCAATGCGCCCGGATAGTCTCGCTGCTCCGGATCGTGAATTATGTTTCCGTTGACGAAGTTTACCGCATCCAGAAACGGGCGTAAACCTTACGCCGGACACCGTTCCGCCGACCAGACTGCCAATATCTTTCGCGCCATGTAGGATTAAGCCCGTACAGGTTAGAAACCGTCACCGTGCGCGTACTGGTGCCTTTGCCATTCAGTTCAAACCCTCCCCTGAATGGGATAAGCCTGATACTGTCGCCCCTGCCAGGTGACGGCTCACCTTTTTCGTATGCTCATTACAGAAAATAACGTTCTCCACCGACCTCTGTCAGGTCGATTTTCCCAGAGCACCACGCTGGCTCTTATGGGCACGGGTGCATTCATTCAGTGTTTCCTGCCGGATATCCTGTGCATCTAGTTTACCACCTGTGTTCAAACTCTGCGCTGAACTCAACACGCAGCATACTGACCCGCGACGACCATTTTAGCAGTATACCTTTATCTGCCGCCACTCATAAGGCGTCTACAGAAAGGTGATTTCCAGCCCGTGCTCTTCCAGAAACGACTCTCCAGTACCCTTATCCCAACCTAGGCGACGAAAGGCGTCACGCTTAATTTTCAGCTTGGCATTCAGCCATCGGCAGGCGCTGCGTCCGGAGAATAGCCATCACCAAAGCAGCACCTTCTTAGGAAGGGACCGAAGCCACATCCATACCGGGTTTCACTTTCCAGCGGAAGGTCTTCCATCGTCCACCTCCGGAACAGGCCACCATCACGCATCTGTGTCTGAATTTCATCACGCGGGCACCCCTTGCGGTACATGTCATAATGCCTTCAGAGCAGCCGGACTTACGCCAGCGTTCGTGCCGTCGTTGTCAATCACCACACATGGATTATTCTGCTCAAACGTCCGGACGCCTGCGGACCGGCTGTCTGCCATGCTGCTGCCCGGTGTACCGACATAACCGCCGGTGGCATAGCCTAGAGGCAAGAGCCAGCCGGTAAAGATTCCCCACGGTACGGCTCTCATGCCTCCTTCGTGAAGACAACTCACACGGTGAACAATCCCCGCTTGGCTATCCATATTTGCCCCCGGTTCCCCTTTAAATCCTCCGGTTGCAAATGGAATTTCGCCCGGCCTGAATGGCTGTACCGCCTGACGGATGCGCCCCCACCAACAGCCCCGCCAATGGCGCTTGATACTCCCGACATCCCCACCATTGCCTGCATTAAGCAGAATTTGTCATGTTAAGCGGACAGGACGGAACGGGGAGCTGCGCCAGTTCTGCTCACTGCCGGTCAGCATCTCCGCCATATTCTTGTGCAAGTACCATCAAAGGTCTTGCGTGATGCACTGTCTCTTAGACATACTGTCCGTGGCGCTGCTTCCCACTCTATCGGAGCCGGACTTCATGGTGCCATCCAGTTCCCTGAACCCTGGTCTTCCAGCCTCACAGGTCTTTCTTTGACATGACCGTCTACTGCCGTGCTTTTCATACCGGCCTCATTATCTCGTTACTGTTCCTTCAGGCGCCCTGTTCCTTTGTGGCTTCCCGTTCTTGCCTTGCCGGTCATTCTAGCCGGCCTTTCTAATCAATGGCGGCCCGTTTACCGTTGCTTTATGTGCATTTTACTATCTGCCTTGCTCCTAGAGCGCGTCAGGCCTTAGCTCCTTACGTACTTGTCTCTACAAGTGCCGCATCCACTATGGCGCGTTTGTACTCCAGCGTCTCATCTTTATGCTCATTAAGGGATTTCTCCTGTCGATAAAGCTCCTACGTTGCGCCGCCTCCTCCAGTACCGCGAACTGCTTGACTCCGCCTTCCCACAAATCCCCGGCGCTGTGATGGCTCTGATTTTCTCATTTGCTGCCTTAATGCTTCTCAGCCGTTCGGAGTTCTTGCCTGAACCGTACTACAGGCATCCCACTGAGCACCGTCTTCCTGACGATTCGCCGCCCGCACACCTTCACGCTGGACTTCAGCGGTCGGTCGTCGGCTTCATAATCCTTTCGCCGCCGCCATCGACCCGTGTTGTAATCTGCCTGCGGCAGGATTTTCCCCGTCTTCAGTGCCTTGTTCATTCTTTCCGTAAACGGCGTATATTTCTCCGGAGCGTCTGCAGCCGTTCGGTAAGCCTTCTGCGCCTCTTCAGTATACTTCAGCCGTGACGGAGTCGGTATCGCTCTGCCTGCTGCGCATTTTGTCTGTTGAGTCTGCTGCTCAGCCTTCTTTCGGGCGGCTTCAAGGCAGGACGTAGTCCTTCACGATTGCTCAGTAACGCGCCCGCGCTTCATCGTTAACAAAATAATCATCCTTGCGCAGATTCCAGATGTCGTCGGTCTGCCTTCTTGCATACGCAGCCTCTGCCTTAATCAGCATCGCCCTGCGCGGTATCAGGACGACCAATAAAACCCACGGGACCTAGAATTCACATTTGAATGCCATAGGGCAGTCCTGTCTGCCCAGAGGTCTCCAGCGTGCCATGTTCTTTCTTCAGGCGGGGGTCTGGTCATCAAACCCTTTCGTTGCGGCCTCTCAGTTCGCCGCCTGCAATGCGCCGGCTTCATCGCCGGAACGCTGCAACTGAGCAACATACGCAATCTTATCCAGACACGTTATCGAAACTGCGAGCCATCGCCGTCAGCCCCGACGTCGGGTCTGTGGTCAGCTTCCAGGAAGGCTTCAGCGACCTTGTCCACCTCCACGCCGGATGCAGGAGCAACGCGCCACTGGCTATCGGACGCACTGATCTGAGCCTCACCGCTTACCCCGCCGGTAACCAGTGCGCTGAGGTAACCCCTGGTCTGGTTAAACGTTCCCTCCATGCCCGGCTGCGGGACAGGGACAGCATACGATCTGCCGTCAGTCGCTCGATTGCCGGAAAGGACCAGGCGTTTGTTGAAATCGACAGGGTCGGTATGCCCTGATACCAGGCATACGCCAGCGCACCGGTCCCGCCACTGCCGAGGCCTCACAGATGTAAGGCGCTACATCGCACCGGCACCGCATGAACGAACATGGGGATCATACCCCCGGAAGAATCTGTCCTTCACCTGCCCCCTGTTGCAGGCAGGATCAGCCACGGACTTTGCCGCCTGCAAGCTGCGGCGGCCAAGTCGGTGAACTGTGCAGGCATGCATACGCATGGCGGCTTTATAATCGCAGGACGGAAATCCCCGCTTTCTGTGCAGCCAGCGCCTGTCGGCTTCAGCGACTGTTCAACGACTGCCGCTTTTCTTTCACATCACTTTCCGGTACAGAAGAAAACCGACGCCTGATCTAGCCATCTGCTCGCGTCTAAATCTCTTGAGCGCATCAGACTCAAATCAACGACCAGATCGCCTAGCATTCAGCCTAGACCCCGGACTCCTCCCTGCGATCCCTTCGATGATACTGTCATCAGCATTACGTCCATCCTCCGTCATGTCCGCCACATCGGGGAAGCGGGGGATAACTTCATTCCCGTCCGGCTCAAAGCGGACACCTCCGGCAAGCCCTGCCGCTTCTGCATCAGCACATCATCTTCAGGCTCTTCGTCAGCCTCGCGCCGGTTCAGCAGACTGAATCCAGCAGATGCATATCCGGATCGCTGAAAATACGGCTGAGCACGGTGTACGTCAGCAGGAAAAGTGCATATCCAGCAGGAACATCATGAAAATAATGGGTACTGTAAACCGCTGCCGCCAGTCGGCAACTCCGTGGAACATCCTAACCGGCAAGCATGGCACGGGTCGGGTCGCCCCATCTCACGACGCGCCGGTTTCAGGCAAACTCAGCTCACGTCGAACACTTTCCCGCAGAAACAGGCTTGCGGGCCGGCGTCATCTAGCTCTCTGTCTGTTCAGCGGGCATTATTCACCACAAACTCATACAGATACCAGACAGCCGGTACACTTCCGTTTTCAGCATGAGAAATTGCCTCCGTGGGAGTTAAACACCACA * tp:A:P cm:i:105 s1:i:1033 s2:i:0 NM:i:1837 ms:i:3778 AS:i:3778 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
69 62 16 utg000001l 18937 60 1315S4M1D11M1D3M1D23M3I29M2I3M1D5M1D5M1D3M1D3M2I8M1I10M2I3M1D4M2D11M1D7M2I14M1D4M1I14M1D7M1D10M2I7M1I7M1I15M1I2M2I1M1I3M1I4M1I11M2I8M8D14M1I4M2D5M1D3M2D7M1D3M2D17M1D4M1I1M1I9M2D9M2D30M1D4M1D6M4D10M1I4M1I3M3D13M1I1M1I2M1D5M5D6M4D9M2D3M1I3M1I7M8I3M3I5M1I2M1I2M3I3M1D5M1I14M1I1M2I6M1D9M1I3M1D4M1D5M8D1M2D3M1I4M2I11M1D1M3D8M1I6M1I11M1I2M1I18M1I5M2I4M1D10M2I6M1D2M2D13M1I14M1I5M2I4M1D14M2I28M4I4M1D5M1I2M1D10M1I19M1I3M1I6M1D3M4D4M1D2M2I4M1I7M1I9M1D3M1D3M1D2M1I4M3I5M2I6M3I2M3I6M1D2M2D1M1D2M2D2M2I6M1I4M1D2M1D6M4I4M1I4M1D7M1D5M1I4M1I2M2I11M3D1M2D5M1I2M3D10M1I6M1D6M2D11M2D6M5D9M1I28M1I4M1D11M3D16M1D1M1D4M1I8M2D8M2I1M1D14M1D7M5D2M2D5M1D10M1I18M1D13M3I2M2I5M2D2M1D4M2I4M4I4M3I12M6D5M3D7M2D2M1I3M4I5M1I10M1I3M2I4M2I9M2D4M2D2M2I11M2D16M3D2M1I25M1I6M1D5M2D2M1D5M4D3M1D9M1D13M1D2M1I25M1I3M1I10M2I7M1I2M1D6M1D15M1D6M4D3M1D6M3I2M2I7M1I3M1D12M2D8M2I14M1I2M1I16M2I1M2I7M1I2M1I3M2D7M1D19M3D15M2I26M2D2M2D5M2I13M4I6M4I13M2D8M1D9M3D16M1I17M1I2M4I6M2I9M1I7M1D4M1I2M1D7M4I38M2D15M1D3M1D8M1D4M3I2M1D17M1D6M2I37M2I12M1I6M1D12M7I2M2D11M1D2M2D4M1D1M2D11M2D4M1D7M2D2M2D2M1D3M1I6M2I4M1I2M1I16M1D17M1I13M1I3M1D16M2I6M2D7M1D2M1I15M2D1M2D2M1D4M1D15M2D9M1D24M1I8M1D15M2D13M1D2M2D5M2D4M1I13M4D28M1D14M1D5M2D6M1D3M1D10M1I2M3I22M1I6M2I5M1D20M2I3M2D1M1D9M1I2M2D16M2I1M1D3M1D11M1D22M3D3M1D21M1D4M1D3M1D16M1I4M2I1M1I4M1I12M1D14M6D3M1I2M1I5M2D11M1I10M1D15M5D10M1I16M2I2M2I17M1I3M1I4M1D8M2D8M1I9M1D18M1I5M3D8M1I5M2D2M1D3M3D6M2I15M1D3M1D14M3D17M3D6M4D5M1D13M3D4M2D10M1D12M2D5M1D12M2D12M1D1M2D3M1D11M1D10M1D40M1D9M2D3M1I5M1I4M1D5M1D14M4D7M2I7M1I4M2D12M2D6M2D11M2I2M3D7M1I4M1D10M1I18M4D10M2D12M2D10M1D6M2D3M1D5M6D3M1I7M1I2M2I18M1I4M1I3M3I3M1D1M1D5M4D10M2D2M3D9M1D11M1I12M1D11M1I9M1D3M3D4M3I14M4D13M3D4M1D14M7D1M2D3M1D5M2D1M2D2M7D10M2I12M2D2M1I5M1D5M3D5M2D9M2D1M2D2M1I2M1I3M1D3M1I8M1D4M1D3M1D15M1D1M1D14M1D8M1D1M1D5M1I7M2D15M1D11M1I4M1I2M2I10M1D3M1I7M2I9M4I1M1I10M1D2M3I24M1D11M2D1M1D5M4D10M1D5M3I4M1I2M1I7M2D4M2I4M1I3M1I5M3I4M1I7M3D23M2D4M1I7M5D23M1I13M2I2M4D14M1D6M1D5M1I8M1D2M1D7M1D1M2D15M1D2M1D22M2D3M1D6M2D2M1D10M3I22M1I1M2D2M1D4M3I2M1D5M1I1M1I6M1I2M2D6M7I5M1D5M1I14M1I15M1D5M2I10M2D6M1I9M1I6M1I5M2I4M8I1M3I2M1I3M1I7M1I4M6I3M1D6M2I7M3I7M4D3M1D9M1D7M1D7M2I7M1I1M2I2M1I10M1I5M1I1M4I12M3I3M3I4M3D18M1I2M1I1M1I1M1I4M1I2M1I20M7I3M2I7M2I5M1I4M1I2M3I14M1I4M1D6M1I4M4D3M1D40M2D6M1D11M1I6M1D17M1I2M3I2M1I8M1D1M1D18M7D10M3D5M1I5M4D5M2I1M1I7M2I22M2D1M1D2M2D3M1D14M3D14M1I2M2I10M1D8M1D17M1D5M1D7M1D10M4I5M1I6M1I7M1D8M1D2M1D6M2I4M1I1M1I17M2D5M2D1M1D11M2I2M1I5M1I6M2D5M2I5M3D12M1I4M5I1M1I5M1D1M3D5M1I6M1D1M2D4M1I3M5D2M1D5M3D8M2I5M1D8M3I7M2D29M1I3M2I6M1D5M4I10M2I7M2I9M1I2M1I1M3D5M3D13M1D4M1I1M3I3M4I6M1D2M4I17M2D1M1I7M1D1M1D10M1D11M1I5M1D6M1I2M1I3M1I9M2I6M2I8M2D38M1D20M2I2M1I1M2D8M1D8M1D4M2I2M4I1M1I3M1I9M2I3M1I9M1I2M1I1M1I17M3I1M1I8M1D22M2I2M2I2M1I15M2I4M1D7M4I8M2D15M2I14M1D4M1I12M3D7M1D7M1D2M1D2M2I9M2I7M1D8M4D6M1D5M1D2M1I12M1I13M2I4M3D5M1I23M1I7M1I9M1I6M1I20M1D1M2D5M2I2M1I7M8I14M1I9M1D21M1D2M1D4M2D18M1I4M1D4M2I17M2D6M1I21M1I8M1D5M1I14M2D10M1I10M1I15M2I10M2D14M1I2M3I4M3I6M1D3M3D13M2I7M3I14M1D9M4I4M1D6M2D16M5I1M2I1M1D6M3D1M1D5M1D3M4D2M2I6M1D9M1D2M3I17M3D13M2I12M1D6M1I3M3D10M1I12M2I6M2D9M1D8M4I3M1I3M1I3M1I8M1I3M2I16M2D6M4D9M1D2M1I16M1I16M2I1M2I6M6D7M1D5M1D4M1D14M1D31M1I8M1D3M1D4M2I1M1D2M1D6M1D27M1I1M3I8M1I13M2I7M1D7M3D8M6I1M2I5M1D12M1D15M4D22M4D5M1D9M32S * 0 0 CTAAACTGATGGCTATCACTACTCCAGGCCGCACGTCCGCATGGAGCACCAAAGAGCCATTTCTTTCACAGGTTCAACAATCATTAACATCAGTCGGATGCCTGCAGGATGAAAGCTTGAAGTCACAGCAGAATTACAGCACAGCAAGGACATGCCGCCTGAACCACCATGAGGCTGTATTCATTGTTGCTGTGGCGTGGATGCAGAGCGAACGAATCGCCGCTGTCGTATGCACTGTGCATTGCCAGGAGGATCTTAACTAGTGAACACAGGAGGTTCGAAATGAGTCGAAATTAACTCTTCAGGCACTGCGGCAGCGGCAGAGCAGGCAATGCATGACTAACTGCGCATTTGACGCATTTTCCATGAATCGCCAACATGCATTGTGCTGGAACTGCTGGATGAACTCGGAAAGGAACTATGCATACATTCAAACAGCCGCGACCAGGAAATCCAGGATATTTGCCTAACAGTGGAAATACTTCCTATGGTCTTGAAACAGGACAAATCAAACTCAACGAGCAGCGTGAGTATTACGAACATGTTATCTCAGGGGTGGGAGTAAGCATGCCTAACTGGAAAGCAACGATCCGGCAAGGAATAGTTTCTTGTTCGCCATCCCTGGAAGACTCCAGTGTCACTAATCTGCACTGACTCGCAAAGAGTTTTCTGCGCAGTTAATGCTAAACAGTCATGGGCCTAACCAGCTTGACGAGGATACCAGTGCACCTGGGGTCGCGATGGGTGATTTCAGGATGCAGGCGTACCTCTCACTCATGTCTGACGCTGGCATCGCATCAAAGGAGGTGCATTCAGTTTTGCAACAAGATAACGCTTGAAATGCCGGCAATTCTGCGTCCTTCACAGCCGTATGCCAGAGTATCTGCTGTCGATGATGACCTCATCGAACATGGGTTGTGAGTTTATGGTCTGTTTCCCACTAAACATTGCGTCGATACTAGTTTAGTGAAACGGACATAAGTGCCAAGGAGTTAGTACAACCTATGTGATTAGAATCTGATTACTAGTTAACAAAGTATTGCCGATCCGACTTGTCTTGTGTCTCCATGCACATCACGAAGACTATTTATGTGCCCCATGAGAGCCAGTCAGGCATACAATATTCCATGAAGATGTAAGTCTAATGAAGACAAAGTCGCCCATTCTGCAATGTGCCAGAAATGAACTACCGCAAAATTATGCTCACCCGAATGGGCGGAAACGATACTCTTGCCTCTCTTACAACAGTAGATGATTAAATGACCAGCTCACTAACATCCTGCACTCGCGGGGATTCTTTATCTGAATCGCGCTACCCTCGGTTTTGTTTTGGGATGATAAATGCACTTCCGAGCACCTAGAATGGAATGGAGCCATTCAACATTATGGCAACCGGAGAACATCAACGACCTGCTACGACCACTGGATGAGCTCTGCGCATAGCACATGCAGACGTAACCAATATTCAATTGAAGAATCGAAAGAACTAAGCGCCTGATGCTTTCTTGCGTGTAATTTGCGGAGACTTTGCGGTCTCATGACTATGCTGTCAGGAGTAGAAACGCACGCCTCAGGAAGCAGAACCCTTGAAACAGTTCCGGGCTTCATGCGACGCATATTCCTAAGCGCGTTAAGGAGTGGGAAGAGAGCTCTGTTCCACGAATCAGGGTAAAGGTTGACTCTTAAATGGACCCAACAGGCCTTTGACGAGGATAGAAAATGGGAAGAAGTGTCGACTCAGCCGGGATTTACCTCAACTGTTATAAGAAACATGGATTACTGGGTACTACAGCAGCACGCCCAAACGGCCGCATTGGATTAGAGGAACATGAATCGCAATGTACTAGCACTGGTAAGAGGCCAAAGCTCGGCATTATTTGCCGACCAACACAAGCCTCTGACAGGCGGAATCAACAGTGATAATTCCACGTTAAGGTCCATTCATGGCACTTGATCGACGAAAATCCTGGCCCAGCAGAGGAAGTCAAGCAAGGAAGACACTCATAATTACATGAGCAAAGTAGCACACTCAGGAGCGCGTATGCCTGATGCTGATATGCACATACCAAAAGAATGTGCAGCAATGCTCAATGGATAGACGAGGCACATCGCAGCAGTCAAGTACGTAAATGCTCAGCTGATGCATTCCGAGGCGCAATAGGTGCAAGGCTAACACACAAACCATGTCGCTGCCACCTGCGCAGCAAAGTGAGATAGGAGATCAAGACTTACGATGGCTGACGGATCTGAAATTGATGCAGCAGAATCATACCAGGTGGCGACTTGCAATGGCACTGTGTCCAGGGCAACGAGTGGGCATTTATGCGAAATGAAGCTTGTGGTATGGTGGATGGATATGTCTGTTAACAGGCAAAACAGGCAATTGCCATTGGACAGCATTGCATATTACTCTTAGAATATGGATGAAGGAAAACATTGATAAATGCAAAGCATTTCTTGAGAAAGAGGAGCATTGCATAGCCTGTGCGGTAACGTGAAGCAGCTTTCATCATAAGAGAGTATCAGGGCTTTATGCGGCACGAAAACAAAGCATCTTTCCTTCGACTAGAATGCCTCTTTCACGAGTGCAGTTGTCTGCAAGATACTGTGCAGGCAGATAAGCAGTCGCTGTCCAACATTCTCGCTAAGTGGACATGGCATCACAGTATCGTGATGACAGAGGCAGGGAATGGGACAATTGAACAGTAAAATAAAGCTGATTGTTTTGACGGTAGTACCTGTTCTATGCACAATTGATAAGCATTTGGACTGCCTCACTGCCACGCTAACGTCGAAAGCAACGTAAAAATGATATAAATATCACTATTAAATGTCATTTTGCAGGACAACATACCGACTATACTGTAAACACAACATATGCAGTCACTATGAAGTACTATGCCATCTGTATTAGGCTACTCGCACAGCATGCCCACCCTGATTTGTCTTCATTTTTCCGGGGCATTATCAAACCCTTCACGCCAGGAGGCTAAAGCACAACGGGCGCAATGCCAGTGCAAACAATTGTGCTTCCGCCCAGCCGACGACTGCACTATACAGAAGATATGCAGTGATGTCTGTCAAACGACGCAGCTGACCTCCTTCTTTCACGACTTCCACACCCGGATGCAGCCGCCATAATGTAGTGAATTTATGTTAGCCTAGGAGGGAAGTTAAATCAGGGCAAATGGCTACGAAGTCGTGGCTATCTATGCCTTATTAGTATTGTGCAACGCCCTTCGGATCGTAGGGACCAGGGCACTCATGTAGTGTTTTCAATGGATAGGATATATCGGGTGCTATAACATTTAGCACTCATTAAAGATGCAGCACAGGCGGGTTGTAAAAGGAAGGCAGAAAGCTAAACTCTGAAAACTAATACGATGCCCCGTCATTCAATATAGCATTTTTACATGGAAAATTACTCACATAGTAACTTAAAGAGATTCTTGTTGCCGCCAAATAAATTGCCATGTCTTTAATAAATTAAGCCATTACTATGTTGGAGTTTGTCCGAAAGGCGGGGTATATTCCTGCAGTAGAAAAAGAGCGCATTCCCAGCAGATGGTTGGAATGACCTTCCTGTTACATGTTTATGTGACTTGTTTTCTTTGATGAGGCATGGGTGAACACTGCGAAATATCGAAATGTTAAAATTGTATTTAGGGCCAAAGAAGAAGTAAGCACTTATTCATTAAGCTGATAAATTCAGTCAACTCCCTAAAATCTGTTTTCCTGTGAAAGCATTGACTACTATGTTAATCTAGCAATTAAGCGATGGTTTAAACAAGTCAACCTTTCTTAAAGCTATCGGGATTTAGTAGCAATATGCCATTAGCCGACATTGAAAATGAAAGCGTCCTTAACACTTGATGGTGGGCCACACTCTTTCAGAAATTCCTATTAAGACATTTCGCACTAGTCTAACATGGTTGCCAGAATTGTCCATTCTTCCATCTTCATTTAATAGAAAATGCTGGGCATTCATCGCATTTATATTTGTGCACTGGGTCGATTCCCTGCCGACCGAACATTCATGCTTTATCGGCCTAGGAATGGTGGTAAACAACATTTGAATGGAATGATTATGCAATCACAAGCAGAAAACGGCATCTTTCTCTGAAAATAATAGACTTACGTCGGAATGCCAAAGCAGTTTTTCCATCGCTTGTTCGCCTTCTATTCATGCATTTGATCCTTTATCCTCCTAACACTATCGACCAGGACACGTACAATACTTTTATTGGACTCGTAAGAATGCCTGCCAGCAATAGTTTAAAGTAGGGCGATCTCCATGCGAATTCATTCATAGCATTTATTGGTTGTATGAGAGTAGATAGAAAAGACAACTGGCTTGAAGCTCAAAACTAATAGTGAAACTTGCACTGACTCGCATAGATGGCCTCCCTTCTAACATGACAGAGTTAACATGACTATGAATAAGATTCAATGGACGATGATAATTCACTAAATTGTTTATGACAACTCAGAAATATATGCTTCGAAGGGTGGGACAACATGCATTTTCTTTACTATACAAGATTAGAGTCGTCTGCGAAAGGTTGGGTCGGCCTTCATTTGCAAGTAGTTCATCGATTCATCTGCCTGCCCTTTACGACTTAATTTGACAGCGCTTGCCTGAATCGACCATGCGCAGGCCTGACGCTATAATTGCAACTCATTCCCAGTAGATGCAAGGAGATTCAAATCCTGCATGTGGAAAGTGTACGTAAGAGAAGCAATAATATTATCGTGCAGATGCAGACATTCGGTGGCGACTGCGCTGTTTTAACTCGTGCTGTTTTTGTATGCAATGACAATTCTGGATAAGAGCCTTATCGCAGTCGTTGAGCATTCAGAGGCCTTCTTGAAATATCAGTTCGTAAAAATGATTATAATAGTCAGCATTAGAAGGTGGAACCGTTTAAAGCGATGCAGCTGAACAGAGGTATGAAGGTAAATGTACAATGAAAAAGCCTTTCCAGCGTCAACTTAGCGAACATGCCGCATAAATGCCGGAAGGTGATGCAGATAAATGTCGAAATAATTTCATTACTCATTTCCATTTTACAGAAAAGAACAACACCATAGCATATTAAGCTGGACAGTACGTTATAGCTAACAGGACACTTGCGCCTGCTGTAATTGGGCTGGTAATAGACAACATTAATTAGAACGCTTTATGCGACCATCTCCCATAAAACACGAGGAACATGATTTGATGACTGCTTGCTTCATGCCAGGCTATGTCTTCAAAACATGATATTTTGTGTATCATTAAAGAAAAATACCCATCAGTCGGTTCGCCCGCAAGTATCCTGAATTTTCGTATTGGGCGCTTAAGTGCCTTCCATCGTGCCGCGACTGCACTGTATATCAGAGAAAAATAAGTTTTCACCCAGTGTCAAGCACTCATCTCGAGTCGGCACATGACATCTTTTCGTGAGCAATGGGTATATGCTGCAATTTCGAATCTCCGGACTGCTGCCGTTATTTTGCTGTTAGGATCGCAGCGGAATTCATGACAGACAGAGCTCTTCATCATTTCAAGCTATTAAATATGCCAAAGTATGGGTCCCGGAGGCAGGAAGCACTTGAGTGAAGTGATTACTCAAAGAAATCCTCAAAGTAGTAAGGAAGTAGTATAAATTCAACCGCAACGTTTTCAGCAGCAGTCAGAATTATTGAAGCAAATCTGAACATTAGCTTGAATGACTTCCACGCTTGGAAAGGAGTGGTTATGCCGGCACTGGAAGATTTTCCAGGGATCGAATATGATGAAAGATAGAAAATTACCGCTTAGAAGTGAAAGCAATACTTTATGAGGAGCGCTTTACTCAAAGTGCCTGCTGACTTGCCGACTTCCTGAGTCATTGGCAACAGTGGCATGCACACTAGAAGCCGACGTCTCACTGTCGCACATGATTGGGGACAGTCCAGTGGCAGTCAGCCAGTGCCTGTGCTAGGTACACAATCTTCTCATGCAAAATATGTAAATCGTAGCAACGGAAATCATTCAACACCCGCACCTACCTGGAAGTGCCAGCCTGCCAGCCGCAGGCACTTCCATACGACGTATGCTCTCCGAGCCAGTCTCTGAGCACTAGTGCCCAGCCCAAGCCAATATCGCATTTGGACCATAATGAATGATAATAATGTAAATTTCCTGTGGCTAATTGGATATGTTCTGAGTGCCGCAATCATTGCAAAGAGCATCAAACATCTTATTACATTGACAGTCATGCAGTTAATTTACCTCGGAAAAAGTAGCATCTAGCATGCATCATCAAAATGGAGGTTATGACTAAAACTATGGGGAAAGAAAGACTTAAAGAGTCTTATCGCACTTGCTCAAATGCTGCATTGATATCCGACTTTTGGCTGAATTATTTCGCTTGAAGTCGGCAATGCCACTTCTAAACTCGCAAGAAAACATGACATTTATATATTATTCCACAAAACCAGATTAGCCGGATATGACATATGTATAACAATAATGTTGAAAATGGAAATGATCATAGCATGGGTTGGGCTAAAACTTCGCAATAAGGAAAAACAGGCGATTTAGAAAGCCGAGGCAATAGGCTATCGCCTTTCATCTTACATTGAAGAAAATGACATTGCATTTATTACAAATGAAAGTATGTTAAACATTAGTAACATAGGTTAATGCACAAAGAAATTACCTTCATATTAACTGAATCATGTAGGTAGTAAATAGAAAGACGCTCGGTCGCTAAGCCTAAAGATTACGAATTATTACACTGCCTAGCTATAATCTATGGCAGAATGTAACTGCCTGTAACTCTTGGCAGCCAAATAAACAATTCAATGCCTGACGATGTGATTTCAACATGATGCCGACTCTTTGGTCTGATGCAGCCAGGAGAATAACTTAAACTTTAAAAACCATTACTCAGCATGCAAATGTGGTTTAGCATGATAAGTAGCAATAAGACAATAATTCTAGAAGTATTAGGGACGTTGTCTAAACTGGGCCAGCCTAAAAGTATAGTTCGACAGAATTGACCTATACAGCCACTAGCTGCAGAAACACCATTTTAAAGGACGCGTTATCATTCAAACATGAGCATTTATGATAACATTCATCCAATTGATTTAATCAATAACATTTGAAGATACGCCATAAATCTTTTGGCGTGTCCTGCAGATGGACAGAGCCAAACATAACAATGCCTATGGCTTCATTGGATGAGCTAGCTAGAAAAGCAAGGATAGCCTCCAATAAAGCATCATACATCTTGCCAAGTGAAAGATTTCATTAATGGAATTGATTCAAACATAAGTAAATGGCTTTCATGGAAATGAGTGCAAAGGAAGAAAAAGCCGACGTAGAAATATCAACAGCAGACTCAAACATGACGCAGGCAAACTATATTTCATGCGTTCAGTCTTGGACGGATTGGCTTGAGTAGTAAACACTATGAACATTGAGTCAGCGAACTTCCATTATTCTCCTGAACATAATACGCCAAATAAATACCAGCTTTACGGCCCTTAATATACAGGCTATAGAAAACAGGC * tp:A:P cm:i:26 s1:i:240 s2:i:0 NM:i:2155 ms:i:602 AS:i:514 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
70 63 16 utg000001l 32648 60 245S16M2D15M1D7M2D11M2I5M2I7M1I19M2I1M3I2M4I2M1I1M1I9M1I13M1D3M3D9M1I13M2D19M1I17M1I16M2D19M3I5M2D8M1I2M2I9M3I7M2I22M1D19M1I2M1I1M2I3M1I4M1I2M2I2M1D7M3I8M1I2M1D6M1I18M1D3M3I2M2I3M1D12M3I3M2I8M1D6M1D5M2D7M3I16M1I36M1D11M2I23M1D1M1D14M2D10M1D4M3I6M2D2M3I9M2I19M3D17M3D11M1D1M2D5M2I9M4I19M1D1M1D19M4I31M3I22M6D2M1D3M1D12M2I30M1I1M2D10M2I5M1I15M6I3M5I1M1I2M1I2M10I2M1I2M3I3M1I2M2I1M3I12M2D4M2D27M2D11M1I6M2I5M1D8M1I3M1D8M1I3M3D5M1I9M2I3M3D4M1I1M1I7M6I1M2I6M1I3M2D3M4I3M2D9M1D4M2I5M1D1M1D11M2D8M1D3M3I7M1I1M1I3M3I4M2D5M2I10M3D5M4D10M1I19M7D11M1I2M1I11M5D9M1D6M2I4M1D10M1I5M3D2M1I5M2D6M5D5M1D7M1D4M1I2M1I14M2I4M2D7M3D10M3D1M1D2M1D3M1I4M1I4M1D10M2I1M1D3M2D6M1D2M1I2M1I10M5I1M1D3M1D7M2I3M1I9M1D12M2I1M1D8M6D5M3D4M3D6M1I6M1I1M4I3M3I1M1I10M1I5M3D8M2D6M2D3M1D2M2I7M2I2M3I2M1I24M1I1M2D4M1D5M3I6M1D3M1D4M5D8M1D13M3D14M1I13M6I3M3I4M1D3M1I7M2I5M1I12M5D6M2I22M2D5M1D2M1D13M1D2M3D2M1I26M1I8M1D5M1I12M1I5M1D32M1I5M1I3M2D13M1I21M2I3M2D1M1I6M2I23M1D3M3I3M1I4M3D3M1I6M2I11M1I2M9D2M1D10M2I2M1D10M1I11M2D13M1I14M1D13M2D9M2I15M1I7M2I6M1D20M7I6M1I3M1D7M1I2M2D10M4D46M1D16M33S * 0 0 CGTTATTACGTTGTCTGTACGGGAGTTCTGAGTCGGTAGAGCTACATCTGCTCACACCACGCAGCACCATACTGACAGCGAGAGAAACATGCCATTCAGCCTGCCCAATGTGATCACGGCTGCTGCGGTTGCACGCTGGGGTAAGCATGCTCGATACATTCTCGGCTGGCTCTGCGAGCCAGATGCCGTACTGGAATACACCTGACTTGGCCGGCGACTCTAGGAAAGTCGAAGAGTACAGGCCACATAAGGCAGAGTCTCATGTAACTCTGCCCTAGCCCCGTTAACTAACGTGCTGACGTCCCGCGGCAATCGGTACCTGATACCAGCCGTCGCTCAGTTTGTACCGAAACGCCGGGAGCTGTGGCCATGCCGGATGAGCGGTCAGCCCCGTTTTCACGAAGGTCGATGCGGCGACCAAATCGTTGTAAATCCCCCGTAAAGGCAGATGCGCCATGCCCGGTGACGCCAGAGGGAGTGTGCGTCGCTTGCCATTGTCTATGGTGTACCTCTCTCGTTTGCTCAGTTGTTCAGGAATATGGTGCATCGCTCAGCTCGGTTCGGCCGCAGTCCAATTAGGCGTGATTCGGCACTGATGCAACCAAACAGCACAGCAGCACTGCGCACCGAGGCGCTCGCTGACAACGGCGACCTGATACAGCCCGTCCCTCCAAGGATCTGTAGATAGAGATTCTGTAGTTACGCCACCAGTCATCCTCGCCGGCGCACTTTCGGATCTCGATCCCCGCCAGATGATAAGCATCCCGGAACGGTGTAACAGTCCGTCACCGTGCTCAAGCAAAGGCTCGGTTTGGCGATGCGGCACACATAGAACTTATGAATCGTCCCCCGGCAGACCAGCCACGGCAAATACTGCACCTGCAGCCGCCCAGCGGTCGGCCTCACTCAGCCAGGCATCACGGGGGTGAGTGGGCAACAGCGCCAATACCTCACCCTGCATTTCTGCTTACTGCAGCCAGTCTTCCGGCGACACCACGGAAATAAGCCGCTGCTTACCGGAGATATTCACGGCAGGAAAATCAGCCGGCTTCGGTGCGGGCCTTACCACGAAGCCGGACATACACTGAGGGCACATCGCCGGGCGTGCTAAGAATCGCTGATTCTGTTGTGTCATGGGATTACTTAGAAAGTTTGTTAATGGAAAGGAAGGTCTGACCATGCCGACGTTATATGCGGAACTTACAACGCTCAGGCGATTTGCTGCATTTATCGTGCTCGTGGGTATCTCACGTGCTCCCTGGGTGCTGCCTCTTCGGTGAGCACAGCTAGACGCTGGATAACCTAATAGGGTACCGCGATAGGAGGTAGCTGCAGTGTTGGCCAGCATGATACGTCCGGAAAAGCCCTCATCGTTTCGTCGGCGTGGACAGTACAAAGGAGCACTACAGCTCAGTTCGCTGCACTGCTGCATGGCCAGGCTAAGAGCCGCCGGCTCCGGATCGGCTGTAACTGTTTCCGTGACGAAGTTACCGCATCCAGAAAACGGGCGTAGTAAATTGACGCTCGCCGTTTCGACGACTATCCGACTCTGCATATCTTCCTCATCCCGGTGACCATACCGTACAGTAGAGCTTAGAACCGTAATCACAGGCGCGCGTACTGGTGCCTTTAAGTATTCAGTTCAAACCGCTCCCCTGAATGGGATACGGCTGATATGTCCCCCTGCCAGCTAACGGCTCACTTTTCGTCAGCCGGCCTTACCAAGTCAAACATAACGGTTCTCAAGTAACCTGTCAGGTCGCTTCCTGAGAGCACCACGGCTGCGCCCGCCTGCATTCCTTCATTTCCATCCCTGCTCTTCCTGCTTAAGTCGCCCGTCAGTGCCCGACACGCCCTGCGAGGAATACTAACACGCAGCGACTATGGAGACGACCATTTTTAAAGTATATTTATTGCCGCCACTCATAAGCGTCCACAGAAAGGATTTCCAGCCCCGTGCGTCCTTCAGAACGACTCCAGTACCGGTGGGCCTCCTAAGGGGGACAGAAAGCGTCACGCTGTACGTTTTCAGGTTGGCATTCAGCCCGCCGGCAGGCGCTCGCTGAGAATAGCCATCACCAAAGCGCAGCTTCTTGATATAAGGAAGCAAGCCACATCCATACCGCCATTCACTTTCCCAGCGAATAGATGTCATCGTGCCGGAGAACAGGCCACCATCACGCATCTGTCTGAAATGAATTCAACGGGAGCGTGCGGGCCATGTCATACCGCCCCGGTTTCAGAGCAGCCGGACCTATCTGATCCCGTTTTGCGGCGCGAGTAGATCCAGCCGCGCTTGTTTCTGCCACTCGTGCCAAGCCTGCTCTGACGGCTGTCTGCCATGCTGCCCGGTGTACCGACATAACCCTAGTGCATAGCCGGGCATCATATAGTGCGGTAAAGCATTCCCACGGTTACTAC * tp:A:P cm:i:13 s1:i:155 s2:i:0 NM:i:728 ms:i:392 AS:i:324 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
71 64 16 utg000001l 14281 60 9S21M1D20M2D30M1I1M1I2M2D8M2I3M1I6M5D3M1D16M2D16M1D5M11D19M1I7M1I10M1I23M2I1M1D7M1D2M5D8M1D23M1D16M1I5M2D1M3D4M1D14M1D39M2I12M1D4M1D10M2I12M1D2M1D1M1D5M2I7M1I4M2D3M3I14M1I15M2D6M1D4M2D12M1I5M3D18M1I4M2D1M1D4M1I17M1I14M1I22M1D8M1I13M1I8M3D1M1D2M1D4M2D3M1I16M1I11M1I5M1I5M1D1M1D5M1I14M1D1M1D19M1D18M2D2M4D4M4I2M1D7M8I2M1I14M3I9M1I4M3D1M2D4M2D18M5D7M1I7M3D10M1D8M1I19M4I1M1D10M4I8M2D6M2D8M1D7M1D8M6D18M6D17M1D4M1D2M2D2M1D18M2D6M3D14M2D10M2I11M1I1M2D33M4I13M1I8M3D9M6D12M1D20M3I9M1D1M1D4M3D27M1I2M2D11M2D2M3D6M1I6M2D6M1D9M1D5M1D13M1I4M1I6M3I10M1D8M2D6M2D9M1D6M3D6M3I5M2I8M3D4M1I7M1I8M2D3M1D5M1I3M3D9M1D3M2D14M1D11M2I15M1D11M6D22M2I12M2D4M7D12M1D25M2D1M1D4M2I3M1I7M1D1M1D5M2D16M1D1M1D24M1D1M1D4M1D8M2I3M5I13M2I12M3D25M2D9M1D3M1D6M1I12M3D8M3D7M1D3M1D8M1D7M2D9M2D8M3I5M1D2M2I6M1D2M1I4M1D12M3D31M2D1M1I4M2D7M1D1M2D4M3I22M1I8M1I3M3D2M1I19M1D1M1D7M3I7M2I5M3D3M2I12M1I5M2D3M2D1M1D3M3D10M1D3M1D7M1D2M1I13M3I5M1I4M2D9M1D4M2D9M2D9M1D25M1D5M1D9M1I6M1D16M1D3M2I6M1D6M1D3M2D1M1D16M1D13M3D10M3I1M3I7M2D12M1D8M4D7M1I4M1I10M3D1M1D14M1I12M3D3M1D12M3D1M1D4M4I11M3D5M4D12M3D1M1D1M1D2M7D29M1D11M1I1M2D3M1I5M1D10M1D19M8D12M4D21M7D1M1D8M1D1M2I8M2D8M4D1M1D3M1D5M2I12M2D7M2I5M1D5M1D9M1D10M1D7M1I1M1I3M2D1M1D8M1I4M5I1M1I3M4I7M5D4M2D12M3D3M1D4M1D5M1D1M4D4M1D12M1I27M1D6M6D11M2I6M2D3M5D7M2I8M3D4M1D5M1I3M2D23M3I4M1D11M3I1M1D7M1D19M1D9M1I4M1D5M2D4M6D14M2D11M1I2M1I7M1D8M2D4M1I3M1I6M1D12M2I11M1D1M1D17M1I7M1D5M1D12M2D15M1I8M4I30M1D3M1D2M1D7M1D4M1I12M1I21M2D4M1I1M2D17M1D16M1D3M3D11M1D4M3D4M4D4M2I3M1I8M3D19M5D6M2I4M2I6M3I32M1D11M2D7M3I2M1I3M1I26M3D39M2D18M3I11M2D1M1D3M11D7M3D9M1D12M3D16M2D5M4I2M1I6M1I1M1I11M4D2M5D8M3D7M3D4M1D14M1D5M1I9M2I1M1D9M1I6M1D5M4I5M1D10M1D2M1I2M1I3M7D12M1D1M1D2M1I4M1D3M1D15M1I5M1D4M1I16M4D3M2I3M1I3M2I7M1D2M1D1M2I7M1D2M3D8M1I1M3I6M1I8M1D10M1I13M1I8M1I1M4D7M1I10M1D4M2D4M2I2M1D12M2D2M1D20M1D1M1D3M1I7M2I12M1D6M1I6M2I1M1I5M1D7M1D4M2I16M2D1M8D3M3D4M6D20M1D14M1D1M1D4M4I7M2D9M1I7M1I11M1I6M2D4M3I9M2I3M1I18M2I11M2D5M3D4M1D21M2D8M4D7M1I2M1I6M1D3M2D3M2I11M3I23M1D8M1D2M2D38M4D8M1I7M1I7M2D5M1D6M2D6M3I2M2I5M1D32M3I8M2I3M1I22M6I11M1D19M3I4M2I2M1I3M2I3M2I3M2I5M2I5M1I1M1I13M2D14M2D16M1D1M2I9M4I1M2I3M1D36M1I15M1D3M1I6M1I17M2I8M3I4M2I17M3I9M2I1M1I4M1I1M1I6M1D8M1I9M1I1M2I8M1I18M1I4M1I3M3I3M1I4M2I23M3I4M1I3M1I2M1D10M2D21M1I8M1D9M3I6M1D2M2D3M2I9M1I18M3I6M3I21M1I2M2D8M1I10M1I11M1I11M1I6M1I3M2D2M1D27M1D1M3D7M1I4M1D4M2D1M1D7M1I9M3I14M1D9M2I1M1D20M1D9M2I4M2I14M2D6M1D1M1D7M1I5M1D28M4D19M3I5M1I3M3I5M5I5M3D6M1D4M2D11M4I11M2D5M1I10M1I10M1I1M1I6M2I4M5D11M2I2M1I7M1I6M1D6M1I10M1I9M1D2M1I2M1I5M1D14M1D15M3D13M1I9M1D8M1I6M2I25M1D3M4D3M2I2M1I13M1I22M2D6M3I9M1D2M2I7M7I1M4I3M2I7M2I12M1I10M2I1M1I6M3D7M2D7M1D7M1I4M1D3M2I10M1I9M1D4M2D2M1I14M1I2M1D3M2D4M1I17M1I2M1I3M1I2M1D6M1I12M2D9M1D5M1I5M1I7M1I26M1D1M1D1M1D3M1D12M1D5M2I1M1D18M1I11M1D3M3I12M3D4M3D1M1D11M1D19M1I5M2I3M3D4M2I5M3I8M1I17M1D4M1D4M6D3M2D6M1I2M2D3M1D6M6I2M2I5M1I5M1I1M5I1M1I5M1I14M2D5M3I10M1D5M4I17M2D3M1D13M2I3M2I3M1I5M1I13M1I2M2D16M1D10M2I3M1D2M1I11M2I5M1I6M1D5M1I26M1D1M3I18M2D35M9I1M2I20M3I2M2D13M2I8M3I8M1D3M1D2M1D27M3D2M1D5M1D1M2I4M1I6M1I6M5I5M3D5M3D7M1I5M1I2M1I18M1I2M5I1M2I5M1I6M1I10M9D27M1D4M1D4M1D2M1D4M1I17M2I19M1I5M2D7M4I4M2I4M5I4M1I22M7I5M1D4M3I13M1I4M1I3M2D3M1I8M1I5M1I2M1I17M1I15M4I20M1D15M1D6M1I14M2D11M2I2M1D12M7I5M1D6M1I3M1D16M5D5M2D20M2I2M1I10M2I2M1D10M1I13M1I7M2I23M5D10M1I8M1D29M2I1M1D11M5D37M1D12M4D29M2I20M1I12M1D17M1D4M1I1M1I2M1D19M1D8M1D29M2D21M1D11M1D6M2I12M1D5M1D3M1D9M1I12M1D17M1D4M1D3M2I5M3D4M2I11M1I25M4D4M1I29M3I3M2I3M1I5M5D9M2I5M1D6M3D2M1D28M2D5M1D2M1D4M2I21M3D22M2D1M1D7M1D7M2I18M1I13M2D4M3D11M2D8M2D2M1D3M2D11M3D4M1D13M1I30M3D25M1D5M1D5M2D3M1D6M1D8M1I27M1D13M2I17M1D3M2D6M4D18M2D4M1I13M1D1M1D1M1D6M1D6M3D11M2I5M1D5M2I10M1D7M4D2M1D7M2D16M1D16M2I3M1D11M2D24M1I8M1I18M2D6M1D4M1D7M2D3M3D18M1D5M2I9M1I17M1D8M1D8M2D7M4I28M1I3M4D7M3I5M1D12M2D10M4D3M2D12M2I20M1D3M2D3M1I19M42S * 0 0 GCTGGTGTCGACTCTGAATACCGACTCAATAACACGGCTCTGTATTAAATGCTGTATTAATCATGCTGGCGCAACATGCTGCTTCTGCCAATTCCTGAGTGCGACTGCCATGGTGTTGTGTGAGTTCAAATGGAATGATGGAACGGTCAGGAAGGATGGCCTCCAAATGGATGGTAGCGAAGGAAATAAGAATTACCGATATCGATAAGCTCAGGAATATTTGATTCAGATGATATGACTATCAAGGCCGCCTGAGTGCGGTTTTACCGCATCAACGCTTCACTCGAGGCGTTTCGTTATGTATAAATAAGGAGGACGACGATGCAATATGCGCCATTGCAGGGGCCTGTTGCTGGCTTCGCCCTTCGACGCTCATGGAAACCGAAGGAGGCCGAATGCATACGTGACGGATGGAAACGCCTTATCGACATACTTAATCAGCCAGGAGTCCCAAAAGAATGGATCAAACACTTATGAGGTACGACTCAAATTCACTATCGCCACTTTTTATTGGCGATGAAAAGATGTTTCGTGAAGCCGTCACCATTATAAAATGGATATTAACCACTGAAACTGAGATCAAGCAAAGCATTCACTAACTCCCCCTTCCTGTTTTCCTTAATCGACGGCGGTTTCGCGGGCGATATTCACAGCTACTTCAGGAGTTCAGCCATGAACGCTGCTTATCGCCCTTCTGCCGCTTCTCGTTCCATGCGCTCCTCCCGTCACTACCAGCAGCTTCGCCCGTGAAGAGAAAGAGGCAGAACGGACGACATCGAAAGGCCTGCCCCAGCACCCTGTTTGAATTCGGTGCATCGATTGAGCTTTGCAACGCCGCTCACGGGCCAGCAAAATCCATTACCGTGCGTTGATGACGATGTTGAGTTTCAGGAGCGCAGGGAAAGCAGTGCTACACCGTGAAACGAATGGCGAGAACGGTTGATATTGATTCAGAGGTCAAACGAATGAGGTTCTCTGCACTTGCAACGCCGGGTATGGGAAGCTGGCTGAACGTGTCGGCATGGATTCGGTACGACCCACGGAACTGATCACTCTTCGCCAACGGATTTAAAGCTGATGCCATGAGGGTTCCGATTCATCGCATTACTGATCGTTGCGACCCAGTAACCCTTAATCCGTGGACGAAAGGAAATTTACGCCTTCCTGATAAGCTAAATGGCATCGTTCGTGGTGGGCGTTGGAGATGGCTGGTCCGCATCATCAATGAACCAGCAGTTGATGGCATCGTAAATTTTACGACCAATGATGAGTTCCTATCTCCTGCCGCTTCTCCCACGCGACCTTAATATCGATCTGCGTTACCGGTGACCGGGATGAGAATGCCGCCGCGAACCATTCAAACTGAAGGCAGAGAAATCACGGGGTTGGCAGTCGCATCCAACGGATATTACGTCACAACCCATGATTCAGTGTGCCCGTCGCTTCGAGATCTCGCTCGACCCTAACAAGGATGAAGCCGACCCGCATTGTCCAAAATACTGCATAATGCAGAACGTCATGGCCCGGAACGAACGCGACATCATACTCCGGTTAACGATGAAACCATGCAGGAGATTAACACTGCTGATCGCCCTGGATAAAAACATGGGATGACTTATTGCCGCTCGTTCCCAGATATTCGCCGCGACATTCGTGCATCGTCCATGAACTGACACAGGCCGAAGCATTAAAGCTCTTGGATTCCTGAAACAGAAAGCCGCAGAGCAGAATAGGCATGCATGAAGGACGCTATTATCATGCAGCGTACCGGGATTAGATGTGAGAGTGTTCGAACAGGGATGATGCGTGCCCAGTTACCACCCCTCGGGGCGTTCCGTACCTCGGATTCGCCAGTCCTATGCAGCAAACCCCGCTCGAAAGAATGAGCCTGACATGAAATGTCCTCTCATAATTCCACACCCTGCTTGCTGAGGTTGCACCGGGTGGCTCCGGAATTAACGCTAAAGCACTCGCTGGGGAAACAGAGCAGGAGAACGAAGCCAGACTTGAGTCTGAAATTCATGCGGTGAATGTTACTGAATCCCAGTAATCTATCGCGAAGGAAGGTATCCCTTATGCACCGCCTGCTCTCCGATGGTTTATGCAGTGACGGCAACGGCCTTGAACTGAAATGCCCGGTTTACCTCCCGGGATTCATGAAGTTCCGGCTTCGGCGGTGGTTTCGAGGCCATAAAGTCAGCTTAAGCCCAGCTGCAGTACACAGCGCATGTGGGTGACGCGAAAAATGCGCTCTGGTATCTGTTTACAAGCTGACCCGCGTATGAAGCGTGAAGGCCTGCATTATGTCGTGATTGAGCGGATGAAAAATCCACATGGCGTTTGACGAATCACGTGCTTCGGAGTTCATCGAAATGGACGAGGCACTGGCTGAAATTGGTTTTGTATTTGGGGAGCGACTCGGCGCATCCTACTCCGGTGTATCGCTGATATCTCGGGTCGCGCATTGACCTTCGTTACTCGAGTGCAGACGAGGATGGGGAGCTTCCCGAATCTTCTGTTATCCGAAATGACTGAAAGCACCGGCTGGCTGAGGAGAAATAAACGAGGGGTGGTATGCACAAAGGCATTCTGTTGAGTTAAGAACGAGTATTCTCCGCAGATGGCACATAGCCTTGCTCAATTGGAATCAGGTTTGTGCCAATACCAGTAGAAACAGACGAAGAATTTCATACGTTAGCCGCATCCTGTCTCACAAAGCTGGAAATGATGGGTGGCGAAAGCAGAAGCAGATGAGAGAAACCAGGTTGACAACCACGGAATGCGATTTTCTGAAGCGGCTTCATATTCTGTGCTTATGCTTGCTAAAGATGGTACAGACTTGTTCAATGACACCTCATGCAGGAAACGCCGTGCACCGATTGCCCGTCAGGCTAATTTCTGAAATCAAAAGCCAGACAGCATATTCCGGATAAAACGTCGTAACATTTGCCGTAGCGATTAGTGGAGAAGACCGAATGCGCCGAATGAACGGGATTTCGCCTCTCCATTCCAGCCTGGAGTTCCTGCTTCGCCTGGCCCTAAACGGCGTCTTTAAGGAACGATGAACATGAAAGCAAAATCCACGGAGCTACAGGCTCCCCTTTATTATTCGCATTCACCTCAAGCGTATTAACCAACAGTTCAGGGATTAATGAAAGATGGCACATCATTGATTCAGCATCACCAGAAATAGAAGATTACAGCGCAACAGCAATAAAGGCCCCTCCTATGAACCACCCGGCTATCTGCCACTCATTGTTGAGTGTGGCGATCCGATAGATGAACGAAGACGGTGCGTCGTTCAGGGTTGTCGACTTGTGCAAGTTGCCAGGAGGATCTGGAACTTATCAGTAAACAGAGGTTCGAAGTGAGCGAAATTAACTCTGAGCACTGCGTGAAGCGGCAGCAGGCAATGCATGACGACTGGGGATTTGACGCACCTTCCATGAATTGGTAACACCATCGATTGTGCCGGCGGAAACGGCGAGGGGAACGGAGAAAGGAAGAGCAATACATTCAACGCCGCTCACGGAGAACGAGGATATTGCGGCGCTAACAGTAGGGAAGTAATTCCTGCATTGGAGATAAGCCACTTCAACGGAGCAGCGTGAGTATTACGAATGTTATCGGATGGGAGTAAGCGGTATTGGGACTGGAAAGCAACGAAGTCGTGAAGACGGAAACCAGTTTCTTGTTGTTCGCCATCCTGGGAAGACTCCTGTTATCAAGCACTGCACTGACCTGGAGGAATTTGCGTGCAGTTAATCGAAATAAGGCGTTAGTAACTATCGACACTCATTACGCATCGCTATTACGGGTTTGGAGGTCAATGGGTTCAGGATGCAGCTGAGTATCTGCATGATGTCTTACCCTGGCATTCGCATCAAAGGAGAGTGAGATTGTACTTTTGTATAAAAGATAACGCTTGAAAATGCTGAATTTCGCGTCGTCTTCACAGCGATGCCAGGTCTGTGGTGATGATGACCGTACTCAAACATCGGTTGAGTAGCTCTCTATCGCCTGCTTACAGAACATTGCTGATACCGTTTAGCTGAAACGACATACATTGCAAGGGGAGTTTATAAAACCGTATCAATGAGTTAGAATCTGAGCAAAAGATTGGGCGTTATCTACTTCCCAGTGCTTCTTCTTCTCCGGTGCCTGACTACGCGCTTCGTTTATGTAGATGAATAGATATAGAGTGGATAAATATTCGATGAATCATTATAAGTCTAATGAAGACAAATCCCCATTCTGCAATGTGCGGAAATGACTGATACCGTGCAAAATTATTATCACGAGTACGGTGGAAACGATACTTGCCTCTCTGTACACAAAACATATAGATGATTAAACCCAATTACATAACAATCGCACTCGCGGGGATTTATTTATCTGAACTCGCTACGGCGGTTTTGTTTTATGGAGATGATAAATGGACGCTTCGAGAGTCACAGGAGAATGGAATGGAGCCATTCAACAGAGTTATCGAAGCGGGAAGAACATAACGAATGGCAGAAGATCGGAGCGATATGGGCAGATAGCAAAAGATGCAGGTAACCAATATTCGAATTGAAAGAACTGAAGAACACCCAAGCCTATGGGTGCGGTTTTTCTTGCGTGGATCGGAGACTTTGCGATGTACTTGACACTTCAGGAGTGGAACTCGACGCCATGGCGACGTCCACGAAGCCTTGAACAGTTCGTCATTCGGAATTCCGAGGATATCCCGCTCCCCCTTCCTCTAGGATGGAAGAGAGTATCTGTTCGACGAGGAATCAGTCCTAACGGTTGACTTAAATCTAGCTGACAGTAACAGGGCGTTTTGAAGAGGATTAGAAATCGAAGAAGGCGACATTACGGCCGCCGGGATTTACCCCCTAACCTTTATATAGAAACAATGGATATTACTGCTACAGGGGATCAAGGACGGGTAAAGGAGATTGGATTAGGCAGAGACAGGCGAATCGCATTACTGAAGCATACGGGCCAACGGTCGGAGGCCTGCCGAAGAAGAACACAAGCCTCGACAGCGGAATCAACAGTTGATAATTCCGTTACGTTACATTCATGGCTTGATCGCTACGAAAATCCTCAGCAGAGGAATTAAAGCAGAAGACACTCATAAATTACATGAGCAAATTAAAGCAATAAGGAGGGGTCTGCCTTGATACGGCGCTCACCGCACGCAATTGCATTAAGTACAAAGAACAAACCGCGCAAGGGGCACCGTACATAAGCCGGATCTTTAGTATGATTAATAATAACAGCGATGCATTCCGCCATTGCGGAATACTCCTGATATAAATGATGTCGCTGCCACTCGCGGAGCAAATCAGGATAGGAATACGACTTACGGCTGACGAATACCTGAAAATTTATCAAGCAGCAGAATCATCACCTATTTGGCTCAGACTTGCAATGGAACTGGCTTTGTTACCGGGCAACGAGTATGTGATTTATGCGAAATGAAGGCCTAGACGTGGGGATGGATATTCTGTCCTATCAAAGCAAACAGGCGTAAAATTTCATCCCAACAGCATTGCATATTGATGCTCGGAATATCACTGAAGGAAACCTTGATAAAGTGCAAAGGAGATTCTTGGCGGAGAAACCATAATTGCATTACTCGTCGCGACCGCTTCATCCGGCACAGTATCAAGGGCTTTATGCGCTAGCACGAAAAGCATCGCCCAGGTCTTCCTTCAGCGAATCCACGCCTACCTTCACGCTTGGATGTTTTATGTCTGCAAGACTCTATGAAGCAGATAAGCGATACAAGTTTGCTCAACATCTTCTCGGGCATACAGTGGACACGATGGCATCACAGTATCGTGCGATGACAGAGGCAGGGGGAGTGGGACAAATTGAAATCAAATAATGATTTATTTGACTGATAGTACCTCCTGTTCCTTCGATAAGTACTCCCAATGCACTTCTGTATCTATATTCCTAACTTAGTATAAAAGCTGAACGAGAAACGTAAAAGGCCATAAAGAGCCACCCACGGGCAGCTTTGCATAAAAGACGGATAATACTGTAAAACACAACATATGCAGTCACCTGAATCAACTACTTAGATGGTATTAGTGACCTGTAACAGAGATTAGCGCAAGGTACTTTTGTCTTCTTGCCCTAATTCTTTTAAGCAACGTGGTCGCATCCCCAGAGAAGCACAAATGCCTGGATTCAGTGCAAAGGGTGCCCACTACGACCTGCATAACCAGTAAGAAGATAGCAGTGATGTCAAACGAAAGCATGACTTCTTCTTTTCTTTTCCACGGTACGACCTCCCCCACATCAGGATGCATACGGGTCCCCCTCATAACTGTAGTGAATGTCTGTTATGAGCCGGATAAGGAAGTCAACACTTATGAAAATGGCTACGAAGTCCGTGGCTATCTATCGGGCTTATTAGTATTTGAAACGGTTTCCAGAAGCCTGAAGAGCTAATTGGTTCGGCGATACTATATGCATTAATAGACTATCTCGGTGTAAGCCCGCATGCGGAGCGAATCGCCACTCGCATGATTTTCGGTGTAAAAGGAAGCAGAAAGCTGTAGAATATGGAAACTACAATACGATGCGCGTTAAGTTCAATCACTACTACCGTTTAGATGGAAAACGTATGTAACCAGTAACTTAAAAGAGAGTCCTGTGTTGCCGCCAAATAAATTGCGGTCCTTTTAATAAAATCATTACTATATGTTGGAGTTTAGTGCTTGAAAGAGGCGGTATATTCCTGCAGTAGAAAAATAAGGCATTCCTACGAGCAGATGGTTGGAATGACTATTCCTTTTGTTACAATGTTTATCTTACTGTCTTTACGGTGAGCATGGTGAAAATGCGATATCGAAATGTTAAATTGGTTTTGTAGTACAAAGAAGAATAAGCACTTATTCATTAATAGATAAATTCATTCAACCCCCGGCGAAATGTTTTTCCTTAGTGAAAGCATTGAACTACTATGTTAATCTCAGCAAATTAAGCATCGTCAGGACAGATTATGCGGAAGCGATGCGAGGATTTAGTAGTATGGCCAAATCGGTGCTCGACATTGAAATGAAAGGCGTCCTTAACATTGCCTGCCCTCGGCTTCCTAACTCTTCTTCCGCGTTCAACGTTCGCACGTGTTAAATGGTTTGCCAGAATTGTCAGATTTCCACCTTTCATTTAATAGAAAAGTGCCGGATTCAGTGATTTAACGTTGAGGTGACGGGTCCAATTCTATGCCCGGCACGAAACATTCATGCTTTTATCGGCGGAATGGGTGGTAAATAAATTTTGAATCGAATGATTGGTGCAATCACCAACCCAGAATAAAATGAATATTTTCTCTGAAATAATAGACTTATCCAGTACAGAATCGACAGGATATTCAATCGCCGGTTCGGTTTCGTTTAGTGCATTTGATCCTTTACTCTCTTAAAGAACACCTGACCCAGCAAAAGGTAATACTTTATTGGACTCACGAATGCTGCCAGCAAATAGTTTTAAAATCAGGGGAAGCCGCGAACGGAGCATGCCCGCATTAATTGGTTGTATGAGGTAGATAGAAAGACAACTGGCTTGAAGCTATCAAACTAAGTAGTGATGAAAACTTTCAAATATGGAACTCATCAGCCTCATTTCTAAATATGAAGAGTTAAGACGTAATGAACCACAGATTCAAGTGACGCTGGGTTTCCCTTGGTTTCTCTGATATATCCTACAAATATCTGCTTCGAATGAGCTCTGGACATGCATTGTTTATTACTATCACCACAAGATTAGTAGATGTCGTTGGCGAAAGGTCTGATTAGGGTTATTCATGAACCAGAGGTTCATCTGCATCATTTGCTCTCTGCCTTTTGACGAACATTAAGCGACTTACTCGATGCACGCAATCGTGTAGCAATAATGCAACCACTTAGGTTAAACAGACCCACCCCAAGGTG * tp:A:P cm:i:86 s1:i:864 s2:i:0 NM:i:2430 ms:i:2796 AS:i:2796 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
72 65 4 * 0 0 * * 0 0 TCTTGACTTGACGGGTCCAAACGGATGCACGTGGCTGCATTAGACCATTATTGGTCGTTTTAATACCGCAGGAAGGTGTAAATTCAAGGCAGGAACGGAACTGCCGATGGAAAGCGACATCTGGAATGCACCGGGATGACGACTTGACGTTGGATGGGATAAGGGGGTCGAAGCACGTCATGAGCGGAACTGATCTGGTCCGACAGTTCTTGCCGCTTGAATGGAGAGCTCAACGACAGAGGCAGTAAAGCTGCAGCGACGGCCGGCCCGGATGCAAGAAGCAGCGGCATCTCCGAAGCCGTCTAACGGGCAGCTCCTCCCCATGAAGCACAGAAGGCTTCGCACCGAACGGGCGGGGCGCTGGAGCAGCCTCCGTGACCGCCGTCGGAAGAGTAATAACGGAAGGGCACTACTCAGGGCTCGCCGGGGGAGGTTGGCTGCATGAAGGGTTATAAGCCCCGACCTGGTGAAGCGGCGAGCCGCGGTCGCATGAGGCCCTGGAGACCCCCGGCCCGTTGACAGCGTAGTGCAAGGTGTCTGCCACGGGCAGAATCGTCAGGAGCTAATTAACGACTTAATCGACGTAATGGGTTCAGGCGAACGAGCTGAAGTTCGAAGCAAATCGAGCAGGTATCAGGCAGAAAATCAAACAGATGCGGGGCCGGCGCGTGTTGTGACGAGATGAAGAATCCGTTGACGAAATCTGGAGGGGACGCGGCTTCTACCCCCGGACTGTGCGCCGGAAGAATCTCATGCCTGCACCGACGCCAATGAAACGATACTCGACCCCGAGCTGGCTGCTATTGGCTTAGCCCGCGGATCGTATCGGAAGCACGGCTGGAAAGGTGAAGGCGCGAGCGGCAGATAGTTCGCAAAAAGCAGCAGCCGGGCCAGCTCATGCGCTAGGATCGCAGGTCGAAGGTACGCCGGCAATACTCTGAGCAGGCGGAATGGGAAATGAATCCCGCCTGGAGGGATACGTATGGCGCCGAATAGTCGGGCTGGATAACGTCATGTCGCGGCCACAGCAGACGACTGGAGCCCTGGTGCGGCTACCCCGGAGCATTCAGCCCGTAGGAATTAACGGATGGCACCTGAAGGTCCGGCTGGAATGGATGGAAGAGCAGCGCCCGGCTGAACTGTATGTCGCGATAGATCCCGGTCGCGATCCTTTGGACTTGCCTACGAAACTGGCAGCGATGCTGATCCGGCAGTGATCAGCATGGCGCAGCTTCACCGAAGCCGTTCTCCGTTAGGTTCTCGACTCATGACGACGAAATGTCGTCCTGCCTGAGACGAGATGCTTACGCATTGTCGTCACGCATCGCGGGCCCCGGCCTTATCAGGCTGGTCTGCGAGCACGTACGCCACGTCGACCCGAAGTCATAGAATTCAGCAAATGAGTCCGGCGGTTCTGCAATAATTTTGCACCTGACCAAATCCATGAATCAGAATAAAGCAGCGACTCTGAGCACGCCGGGGATCTTGTGATTTCACCGTGTGGAAGTTGTCTTCCGCGGGAAGAATATCCGGCACTTGGCGTGGGGGAATCTTTATCCGGACATGATGCATGAAAGGGCTACTGCGTGCGCTCCGGCGGTCTCCGTTCGTAGCCCGGTGCAGCTAGAGCCGGCTGGCAGCTAGCCGGATCAATCAGTCGCGGCGGCGCGTCCGCCTCGTTGAAGCGAACTACAATGTGATCTGAGCCTGAGGCATGGGATCGAGACTCTTAAAGTGCCGGCTGCTCTGAGAAGCCGCGATAATGCGTGACGCTGGCCAGGGTGCCCGTGATGAGGGTTCGAGACGCCGCTGCGTGGGTCTGGACTTTCCGCAATGACGCTCTGCAATATATTCCGGGCGACGGGCAAACCCAGTACCCGACAAATCTTGACGTCGGTTACATTCGTAGGATGCTTTGGCATCGCACTTCTCAGCGGACGGATTAAATCGATCGATGCCTGCATGGATCGCGACTCGTTGAAGGGTCCTACTGGATTTCCCGTCATGCCCGAATCCGGGAAGCACTAGATAACGATCGTTTATACGCGCGCCTAGAGCGCTGGAAGCCATTACTCTATTTCTGGTTGGGGCCGCCGTATGGCTCTCAGCCATTCTACCGCTCTACTGCCGCTATCGTTCCCGGGTCGACTGATTCGTTCCCTTGAGTCTTCGATTTAGGCAAGCCAGAATTCCTTGAACAAAGGTGAACCATGATTGCAGGGATATCCCCCGGCAGGAAGCCTGGATGGGGTGAATCTTGGAGACTCGAGTTCAGAGCACGTTCAACGAAGCGTGATTATGGGCGGGAATCACTCTCCCCGCAAAGGTCCTTGGAACGCTTCCTTTTTATCTATGAACCGGGCAAGGACTAAGTCACTGGCAGAGCAAGGCGACACTAGAATATCGACGCCGTATCCGCTTTACGCCCCGAAAGCGGTTTGAATGAAAGGCAGCGGTGCACCGCTAAATCCTCGTCGACGTACGCTTATTGCTCTACGCTAGAACCAGGATATGCGGATCTTGCTCGAGGGTGCAGGATTCCCGGAGCGATGAATCGTGTACGCGTTTACCGAAGTGCAAATGAACCGTTGCCGTCAACCATCAAAGCGAAGGAAGCGTTTAGCCGATTAGAGCACGAACTAGCCTGACGAAAGAAGTCAGCAGTGCGAGCGATCGCATCCAGTGCACTCGTTATCCTGTCTCACGCCGACGGAACATCAATACTTGCAGACAAATTTTCAGAGCTCGTGAAACCTGCCTGACTCGAGCTGCAGCATATGCTGACGCATCTCAGTGCAGTTAGCATTTAAGGCTGTTCTAGGGCGTATGCATGACTCTGACCTAAGCAGACGGTTCGATATCGACGACGAGGCAGCAACAGCCTGCAGGCTAGGTGCGGCTTTGTAGGTTCTAAGGATAGCTTTACTGAAATTTGAGGGGTTCCTTTCCAACTTATGAGTATTTTAGAGTTAATCCCAATACCCCGACTAGGAATCAGCGTACCAGGGGCATTGCCCCAGTACAAGTCGTGCATTCGTGGGCCGGAGGAGGGAGATGTCTCTACGGGGTGCGTTGAGGTATGAACCAACGGAGCAGTTTCACTAGTTATGTCACCACGAATAGTGGATCAAGGAGAAGGTGCAGATTGGGGGTTGGCTAGTCAGCGAGGGTCACCCCCATGCGTGGTGCAACAGATCGATGGCTAGGTAAAGCATCGGGCAGGTTGAAAATGGTTGTAGATTATAATCAGGCTAAGATTCAAGTTCTCATGTTGTCAAGGATACCATGCAGCCTTTTATTTGGAGCACATTGTAGCTATGTTGAAACAAATGTTTGAAATGAACCTTATATCTCAGGCGGTGAGATTAGAGTATTTCGAGTAGTTAGAACTGTGAGTATAGCCGATCATCCGTATACGCAAGCGCGACGGCTGTAAAATCAGATTTTACGGCTAAAGAGGATTAGAAAGGCATGATGTGATGCTGTCCTGTATTTCGTCACCTGAGTTACGATCAAGGCCATAGAGGTTAGTCAGAATAGAAGTAGCTGGAAGGGCATAGTCGGTAGCACGGACCCTGGTTTACGGCTCTGGAGCGGAATACGAAGAGGTAGCGACGGATGGCGAGCACTAAGTAAAATATACAGGGTAACTGGCGTCACAGTGAAGTGAACAGGAAGCGATCTAGATTTGAGGCATTTACATCGGATTTGACTGTCACCCATCAATAGTCGATTGAGGTAACTACGGGGACGAGCCCGCCTTAGTGAGGCATAACCGACAGGACATCTACTAGGCGTTTCGTCAGGATGGGGCATAGATCTAGATGACCGCTAAGATTGAACCGGCGTCAGCAGGAGTTTAGATCGTGACTACCGCTATTAAGGGCACGAGTTAGTACCGCTGAAGGGTAAGTACTTGCTGAACCGTATCTAGTATGGTCCGGTAATGTTTAACCAGAGTCGCCATAAGGTCAGGTAACGGGTATTCAAGAGATTGTCCTCCATAGATCACATTGTCTAGATGCTTTTATTAAAGAAGCTAAGTCCATGAGACGAGTAGATTTTACGTAAAAGGTCAGGCATCCTGTTTCTCGAATCACCGTATACGTCATCAATCTTGTACAACAGCAAATGTAATAAGCGATACCGACTAGAAGTATAGCGCCATTATTATACATAAACGCTGGAATACCGTAAGCGACCTATCGCTTTCTCTACTATACATGACATGGTTCACAAAGGAGATGTTTAATTTTAACTGGTCGGGGGAAGGATGCGAAATTAGAGTACTACCGATTGATTCTCAGGAGATCGGCTAGGCACCCCAAAGAGATGGTCAAATTGTAATTGGTCGCTCTTGGGGTATGTTTTATGTAACCATCAATAGATAGATATTAGATCCGGCACTACGTTGTGCGTTGGGAAACCATCGATGCGGGAATATTACCAAGGTAGGGGAAGCGATAGAGGGGAGACCTAGACAGAAGCGAGGACGATACATCGGGCGGTGGCCCCAGTTAACCGTATCCGTGACAAATAGCGAGGCGTGAGGATTAGATCATGGCTGCTGCTAGGCGTTAGTACGGCTGGATACGCTAGTCAGTATAGTAGGGGAGGCATCACAAGCCACATCCATGTTGTCTAGGTCTGTTTAGAGTCAAATGAGCGGAGCATCCGCCTAGAGGGGATTTGGGATCGCGGCGGGCTATAAGTTAGGCTCGCAGTGAAATAGCCCTATTAACGCCAGGCGATGCGTCGTGAGATAAACCGTCTGCCGCCTTTACTGTCCTGTACGGGGAGACGTATTGGGGATACAACAGCGGGAGTCCTCCTAGGAATCCAGTTTAGGAGTCGGTAATATTTGCCCTATGGATAACTATCGTAAGCCTATCTACTCTGACCCTAGAAAAGCGCTATACTAGTGGGTAGGCGCTCCTATAGGATCTGCTATCTGGCCTCGTATCGTAATGGGTAGCTGCTAAACACGCGTTTAATACAAGGTGCGCGCCGGTACTACGAAGCGGCTACGGACCAATAATCGAGCCGGCCAACCGTGGTCTATACATGGGATTAATACCATGCGAAGTGGGGTTAGATAGGATATAAGAGACGTGGGGGTCCAGGTAAGACCGTCGGCGAGAGCCAGCAAGACCGTAGGTGGGTATGCTAAGTGAGTGGATTGGTCGCGGATCACCGTCAACATGATAGAGAAAGGCAAACAGGGGGTATGACACTTGAAGGGGTACGTCCACTGCGGCAACCCAGCCTGATAGGTGTCTTAATTGGAAATGTATTGAAGCCGATACAAGCCCGCTGGAGATTCACCGTTAATGCCGGCTTCCGGATGTGGGTCGCGCTGGCCGCGGTGTCAACCTTAGAGTGGTTCGAGCGTCGGTGCTAGGCTTTGGCGAGCACAGCCGCATCACTGGGTGTAGGTGGGGTTGTATAACTTATAAGGAACAATCAAGCGCGTCAGCGGTGTGCTCAGCGATTTTATCGCTGAGTGGCCTGTATGCCATTACTGGCGTATAGCCTCACCTCGTAGCAGCTAATCGTTCGTGCGAGCACTCGTCGGTAAGGTCCTCCTCCTAAGGCGACCGTGGTACTTAAGATACTTAGCGAGCGCCGTTTAAGGCCGAAAGTCTAGCGCCCTGGATAGGGTAGCCAGCGTCCAGCGTTAATAGAGGTAAAACATTACCTCGCAGCCTATAGTGGGAAGGCAGGCACATCAAGCTACGGTGATTGTTGCGGTAAGAGGCCATGTGCCCGTTACGTCATCAATGTTAGCCGAGGTAGCGTAAGTTGGGCTGGTCCAGCCACCGGGAGCAATCAGAAGGGGGCCATCGATT *
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
73 66 16 utg000001l 23684 60 182S24M1I2M1I4M1I7M1D8M3I7M1D8M1I8M1I18M1I7M1I11M3I14M3D15M5I4M4I4M1I3M1D1M2D16M2I12M6D3M1D9M2D8M1D13M2I24M2I5M2D32M3I5M1I10M1D3M1D1M2D5M1I1M2I8M2I2M1D1M2I9M1I8M1D3M4I4M2I8M2D2M4I3M3I9M1D11M1I2M3D4M2I21M1D20M2D4M1D3M2I2M1D5M1D10M1I14M2D18M3D23M2D3M1D14M3I5M2D25M1D5M4I16M8D6M5D3M3D17M2D1M1D11M3D8M3D5M2D8M1D3M1I17M2I1M1I5M1D1M2I3M1I6M1D12M2I11M4D6M1D5M1D13M1D3M1D5M1I30M2D6M2D6M1I8M1I13M1I23M1I3M3D10M1I18M2I6M2D11M2D6M1I21M2D6M1I16M1D2M1D6M2D4M3D12M4I7M1I4M3D1M1I3M4D7M2I3M1D19M1D10M1D26M1D4M2D5M7I7M1D3M1D12M3I2M1I3M2D1M1D2M3D13M3I2M1D2M1D4M3I2M3I6M3D3M1I16M2D13M1D2M1I9M2D9M1I8M1I4M2I21M1D4M1D17M1D2M1D16M1I9M2I3M2I5M3D2M1D2M2D7M2I1M1I14M3I7M1D1M1D9M2D3M1I1M4I4M2I7M1D24M1I5M1D9M4D3M1D2M1D3M2D11M8D18M1D24M2D4M1I2M2D2M3I4M2I38M1I20M1I5M1I3M1D7M1D4M1D1M1D7M1D7M1I11M1I4M3I3M1I4M1I5M1I7M1I5M1I15M1I5M1I1M1I7M1D13M1I21M2D12M2I9M1I4M4I3M2D4M4D12M5I13M1I11M1I6M6D8M2D10M2I16M2D4M4I3M1D8M1I10M1D5M1I8M2D12M2D1M1I7M1I6M1I7M1I8M4I40M3I4M1I2M2I7M5I2M1I4M4I3M1D5M2I9M2D7M3I3M1D6M4I2M1I8M1I1M1I9M2I3M3D8M1D2M5I2M2I6M7I13M6D4M2I12M1D6M1I2M1I17M2I1M1D9M1I2M1D6M5D3M1I2M2D33M3I6M1D2M3I2M1I5M1I1M2D5M1D4M1D3M1D5M2D3M7D6M6D1M4D2M2D9M3D3M1D1M1D8M3D2M3D4M1I15M2D2M3I3M1D17M2I1M2I5M1D15M1D6M1D9M2D34M2D5M2D2M1I4M1I3M3I2M1I3M1I9M1D10M2D10M1I2M1D1M3D1M1D3M1D11M1I5M1D3M6I1M1I5M1I10M1D8M1D2M3D3M1I13M3D2M2I2M1I3M1I14M2D7M1D7M2D6M1I1M2I6M1D9M2D3M3I6M2I5M1D3M2D2M1I13M2I4M3I13M3I11M1I6M1D24M125S * 0 0 CATGATGAAAGATAGAAAATTACGACGCTTATCGGAAGTGAACGAATAGCTTTATGGAGGGCTGTTTACAAAATCCGTAGACCTTCAACCAATTCCTAAGTAGATGGCATAACAGCGCATGCACCGAGACACGTTTGTACTGTCCTCGATCGCTGCGCCTCCAGTCCCCCGCCGATCTGCGTACAGTCATAGATGGTCGGGTGGGAGGTGGTACAAATTCTCATGCAAAATATGTAAATCGGTAGCAACTGGAAATCTCTTCAACACCCGCACTATCGGAAGTTCACCAGCCAGCCGCAGCACCATTCCTGCAGTCCTATGTCGCGGCTCATTTCCGTTAAAGATCGTTGATTACAAGCCACAACTGGCATTTAATACATACTTACCCACTAAAATTTCCTGTGACTAATTACTATATGGTTCTGATAAGAATCATTGCAAAGATCAACAACTTGTATTACATTGACAGTTAAGCAGTTGACATTTATACCTCTAAAATATCAGCATCTAGCATGCAACCTATCAAAATGGGGAGTTTATGACTAAAACCATGGGAAAGAAGACAAGCGGAATACGAGATGGCACCCCAACGCTGCAGCGATAAGTGTACGGCGGAATTATTTCGCTGAATTTGAAGGATCCCCAACGCAGAAGTTATAACATTATTATTCACAAACAAAACCAGATTAGATATGACATTTGGTAAATAATGTTATTGAAAATGGAAAGCTCATTAATGGCTTGGGCTTACGACTGCCAGCTCTTTAATATTCGCTCGGGATTCTTCTCAAAAGGTCGGGTCGCTATCTTACGAAGAAAGTGACATTCATGTTAACTGAAAGTAAACATTATAAAGTTAGACCGCAAAAGAAATGTCTTCAGAGCACGCATCAGGTGAGCTAAATAGAAAGACGATGCCGGTACATTATAAAATACGTTTGACTGCTACATGCCTAGTAATCTTATGGCAGAATGTATAACTGCTGTAACTCTGCATACAAATAACATTGCAATGGGTGACGATGTGATTTCGCCAACATGATTCGACTGTTGTATATGAAGCCGGAGAATAACTTATTAAAATTAAAAAGATTACTCAGATCGACCCCATTTAGCAGGATAAGAGGATCAAAACTCCTTGAAGATACTAAAGAGCTAGACGGGGTACTAACAGTACTTCGACAGAATTATTAGTTGACTATACAGCCAAGCTGCAGAAACGACTTTAAAGGACGGTTATCACATTCAAACATTGACCTATGTCAACATTCCAAGCTAATTGATTTAATCAATACAACATTTGAAGATTACAGCGTACTCTTCGGCGTCGGGTCCTGCGAGACTCCGCTAAGATAGCCTTATGGCTTCATTTGGGATCAGAGCTGGCTAGAAAAGCAAGCCTATTCAATAAACCAATACATACAATGCCAATTATAGATGAAAGACCTCAGTAATTAGAATTGATTCACGATAATAAAATGTATTCTCATGGAAAGGGTACCATTAGAAGAAAAGCTAACCAGTGAGAAAAGAGCACGCACAGCAGCGAAACAGGAAAAGAGCTGCCATGCATTGGAGGTGCAGCAGGAACTAATTGGCGGTGATGTAAACTAAACACGTATGAATTCCATTATTCGAAGATAATAATTCGAATAACCAATACTCAGCTTTACAATATACTATACCAAATGGAAAGCGTTATTTCATACAACGTTTCTGCGGCATATCACAAACGATTACTCCATAACAGGGACAGGCAGGCCACCAATATCAGGTGCAGTTGAGCCGACAGGTTCAGCAACACCCGATACTTCTTCTTCCAGGCTTTCCAGCGCACGAGGTTTCTTCCTTCGTTCGCAATCTCCAGATTGGGCATCCTGAAGCGGCGCAATATGCTCACTGGCTATGCATCAGGCTTTGTTTCTTTCCTCCTCGCTTCCGTCGATTTCTTTCCTTCCCCTTCTCTTCACCCAGGCTGTGCCGTTCCATTCTACTCCCTCCCCGGCGATAACAGTAAACATTTTCCCGTAGACTAAACGAGTTCAGAAACTTAAAAGACGTTACCAGGAATCAATAAGGACGGTTTACCCCGATGAGTCTTCAACGAGATATCGACCATTAGCGCCTGATCTATATTGAAACAGACGCCAAACCCATCAGGAATATTATCATGAACAGTGCGAGGTAACAGGTACTTTTACAGGCACCAAATCGATGAGCGGAACATTATCTCTTAAGTCTAGATAAATAAGACGCTTCATTAATGTCACCAAGTAAAGTGTTTTACTGGTCCGTGAGTGTTCATTCACTCGAAGATGCCATGCAAGCCTCACAATAGTTAAATGCAATGTTTGACGGGCTTTTCCGCGTCTACGGGAGACGCGTTTAGCTTAGGGACGCATACTGAAAGACCGGGAATGCTGAGCAGAAGCCAGACAACTCACTGCGGCGGCAGAAGAAGCCGCATGCTCGCTCGTTCTCCATCTCTGTTTCTGCTGCCCTGACTGTCCGTTCTCGGTAAATAAGCAATACCCTGTGTGCTGGTTTCCTTAACTGTGCTAACTTTCCTGACTCATTGCTTCCATACTGACTCCAGCCAGAACTGTTCATCCTAACCATGCGCGGACTTGTAGAGGCACCCGCGCGTCCTGTTGAACCCTTAGACTGTGAGCGGAGCCCCGTGTGCTGTCGTCATTCTTTGATCGGTGCTCGTAATCGAAACTGCCTGTGTCGTTTCCCGTAATCAAACGAATGTGGTTTTCGTGCCCAAATCCATCGGATGCACTGGCACTGTGGGTGTGCACTGCATTCCATCCCCCTGTTCCTGAGACATACGCACGACCTCTGGCGGGTTTCCCCTTGATTATTCAGCCTCGCATATCAGGAAGCACACCGATGGATACGCGACAGCAAGTTTTGGGTAGGCTGATTTTGATCAACGCCTCCTGCACCTAACGGTGAGACGGAACGATATGGCCTGTACGGGATCGGCACCTGCCGGAAAGGCCGAATTCTACATGCCTCACGAGCGACGCCGAATT * tp:A:P cm:i:18 s1:i:150 s2:i:0 NM:i:967 ms:i:404 AS:i:222 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
74 67 0 utg000001l 30270 60 37S15M1I22M1I3M1I3M2D3M1D42M1D12M1I8M1D25M6I3M1D1M1D12M2D8M6I7M3I1M1I2M1D1M1D8M6I9M1I2M2D3M3D11M2D10M1D8M2I6M2I39M2I7M1I22M3I8M1D8M1I3M1D5M1I10M1I1M3I8M1I11M1I11M1I9M2I14M1I3M2I7M1I4M1I11M1I14M1I2M2D7M1D6M2D1M1D8M2I5M3D9M1I4M1D9M1I20M2D9M1D3M1D6M2D20M1I5M1I10M2D5M2I1M1I7M1I5M1I13M2I6M1I21M1I4M5I14M2D4M1D2M1D4M1D11M1D2M1D6M1I16M1I9M1D22M2D7M2D1M2D8M1I3M2D4M1D7M1I5M1I5M2I3M3I23M2I10M1I21M3I5M2D6M4I10M1D6M1I3M2I10M1D7M1I16M3I26M4I1M4I2M1I3M1D4M2D3M1I7M3D4M1D3M1I5M4I7M4I4M3D5M1I4M4I3M3I17M2D4M1I2M1I3M1I3M1D17M5I8M3I2M1I20M1I2M2D5M1D4M1I3M1I2M1I7M1I5M2I6M3I1M1D11M1I9M4D26M2D29M1D2M1D9M2D4M1I5M1D1M2I2M1D6M2D2M5I3M1D7M2I12M2I22M1I6M3D5M2I3M2D7M1D10M2I5M6I2M3I17M3D1M1D19M1D6M2D4M1D15M1I20M1D3M1I7M2D2M1D5M2D2M1I8M1D5M3D2M1I2M1I8M2D4M1D1M2D10M3I13M1D7M1D3M1D8M1D3M2D2M1I26M1I3M1D6M3I2M1I5M1I17M3D2M1I33M2D20M3I2M1D19M1I5M2D11M1D2M1D1M1D14M1D8M1D1M2I21M1I3M1D2M2D9M2D1M1D16M2I9M1D1M3I1M1I4M1I1M2I9M1D6M1D8M1I10M1I1M2D13M1D9M3I2M1I4M2D6M1I5M1D3M2I21M2I10M1I19M3I13M1I8M1I6M2I16M1I12M1I4M1D15M2D13M4D2M1D6M2I1M1I11M1I25M1I22M1D13M6I12M1D26M1I10M1D6M1D15M1I23M2I5M2I9M1D3M1I6M1D2M1D14M1I16M3I7M2D19M2I2M2I8M2I3M1I9M1I11M1D3M1D4M1D11M1I2M1D6M1D34M4I1M3I3M3D20M2D7M1D12M1I11M1D7M8I15M1I5M2I12M4I2M3D4M1D28M3I2M1I7M1I12M1D5M2I11M1I13M1D16M1I8M7I3M1I4M1I9M1I2M1I5M5I48M1I2M2I3M1D6M1D8M1D6M3I6M2I4M1I2M1I9M1I13M1I2M1I7M2I24M1D7M1I3M1D9M5I4M1D18M1D26M1I43M1D4M4I16M1I21M1D2M2I7M1I13M2D2M1I19M1I7M1I10M1D10M2D5M2I3M1D12M3I2M1I5M2I12M1D40M2I4M5D1M1D2M2D20M2D7M3D9M1I6M1I7M2I33M1D2M31I3M1I4M5I5M1I1M1I9M1D16M1I21M1I8M1I4M2D3M1I3M1I15M3D5M1I13M5D2M1D3M3I5M1D8M1I7M2I12M2D6M1I4M2D6M1D2M2D8M2I4M1I2M3D3M1D7M2I8M3I2M1D5M1D9M2D1M2D7M1I4M3I16M2D15M2I13M1I3M1D1M1D3M1D6M1D8M1I3M1I8M1I5M3D7M2D6M5D18M1I2M1I14M2D6M1D5M2I1M1D2M1D5M2I13M1D1M1D1M3D25M1D2M1I2M1I11M1D10M1I15M1I6M1D13M2D1M4D5M2D5M3D6M1I6M1I1M4I11M1I7M1D2M3I7M1I3M2D4M1D4M1D12M1I10M1D15M1I1M2D12M2I3M1I9M1D6M3I6M1D12M1I10M1D6M1D10M3I9M3I5M1I26M3I6M2I13M2I5M2I5M3D9M4D19M1I23M1I2M2I7M1D7M1I13M2D2M1D6M2I12M2I9M1D4M1I5M1I3M2D12M2D17M1I14M1I6M1I5M1D11M3I5M1I3M1I4M2I2M3D2M1D4M1I20M1D11M3D2M2D10M2D9M1D27M1D18M1D4M4D28M5I9M3I1M1D4M4I6M4I2M1D11M1D9M2D4M4D7M1D22M1D5M1I6M1I3M2I8M2D7M1I3M2I2M4I3M1D13M2D5M2D9M1I3M1I14M2I11M1D4M2I3M1I4M1I14M3D6M1I17M4D10M1I2M2D8M2I2M3I3M2I9M2D9M1I2M3D4M1I6M1I5M3I3M3I75M2D12M1I8M1I5M2D2M1D9M2D5M1I3M1D5M3D7M2I5M1I11M1I1M1I2M1I12M1I5M1I17M2D13M2I8M1I8M2I2M1D30M3I16M2I17M1I3M2D2M3I8M1I24M2D1M1D17M2I1M2I8M2I3M1D7M1I3M1D6M1I12M2I8M1D2M1D11M2D8M2D5M2I11M1D1M2D13M2I4M1I6M2I7M1I29M1D11M1I31M12D11M4I21M1I19M3I14M4I9M1I31M5I2M4I1M4I10M1D6M4I32M1I3M1I3M1D5M1I4M2D30M1I7M3I13M4I37M1I1M1I4M1I11M1D2M1D11M2D7M1D8M1D6M2I8M2I5M3I8M1D6M3I5M3I13M1I2M4I3M1I6M1I6M3I11M1I16M1I11M2I18M1D16M1I25M1I2M1I11M2I1M1I16M1I8M2D19M2D1M1I11M1I13M1D15M3I6M1I10M1I35M1I3M2D4M1D7M3I12M1D6M1D20M3I1M4D10M2I6M1I5M1D16M2D35M1I8M4I8M2I6M1I5M1D4M1I35M2D5M1I15M1D1M2D1M1I3M1D2M3D7M2I5M1I14M3I8M1D3M2I25M3D20M1D9M5D1M1D11M1I2M3I4M1I2M1I3M1D8M1I7M1D2M1I25M1I1M2I1M1D8M1D6M1D2M1I22M2I3M1I7M1I24M1I2M1D1M2D3M1D3M3I4M1D1M3D21M1D35M1I16M1D2M1D2M1I35M1I3M1I7M1D2M2D9M1D5M2D1M1D8M2I3M1D16M1I5M1D5M1I5M1D1M1D7M1I13M1D10M1I2M2I23M1D15M1D4M1I12M2I2M1D7M1I28M1D8M5D1M1D30M1D2M1D8M2I4M1D3M1I22M1I6M1I5M3D12M1D32M2I25M1D3M1I3M2I1M1D3M1I1M1I3M2I9M3D13M1D6M1I17M1D9M4D25M5I4M1I27M3I10M2I14M1I5M2D2M2D22M1I34M1I4M1D3M1D14M1D4M2D3M3I39M2D4M1I5M1D23M5I13M2D2M1D58M1D2M1D23M1D9M1I4M2I2M2D1M1D25M1I1M2D13M2I20M1I7M3I4M2D15M2I1M1I23M2D11M3I39M1D10M1I13M1I1M2D6M4I3M2I7M6I17M1I19M1D9M4I5M1D10M4I15M1D11M4D15M2I12M1D9M1D9M1I2M2D5M3D8M1I12M1D1M2I16M2I1M1D19M3I8M1D10M5I6M1D6M2D5M1D12M1D5M2I1M2I11M1D4M3I8M2I1M1D5M1D6M2I11M720S * 0 0 CTGGTGTCCCATCGCATAGGGCTCCCTGATATTCTTCCCCGCTGTCTGCAGTCAACTTCTGCGGTCAGGTGCTGCAACCAGCTTAGGCGTGACACCATTCACCGTGCCACTCTGTTCACCGTCAAAGTGCGCCCCGTTATCCACGATGGCTCTTTTCCGGCACATGCTGCACGGGGTGATCTGATGGCATACGTGCCGTCCTTCAATCGTTCACGGATATCTCACGCATGAACAGTTGAGTATGGGGCAGCGTCGGCAGCTTCATGCTCCCATACCTGTATTCATAACAACAGCGATAGGAACACGGCTCATTTACCTTCACGCCGTCGGTACGGACCGAATGAACCTCCACGCTGACCGGATTGCCGCCACTTCCGTCAACCGAGGGTATCAAGCGCGGTACTCGGAGGATGGCAGCGTGATTTCACGGTCGAGCGTCAGGCGTCCGGGATTCGTTTGGCTGTTCACCGGAGCACCAAGACCACCGGTGCTGATACCGGCATAGTCATCATTGCAGCAGATTCAATAACATCGCCAGCGGTACATGGCGAAGCCCTTCTGCGCCGCACGCTGAAATCGCACGGTCTGTTTCCAGCGTTTATTTAATCAGCCACAGCCCGGCGCGCGGTGTCGCCTGCGCCGAGGTATGCTACCTAAAGGGCATCCATCTTCGTAACAGGTCACGACCGTAACGGGCAATGGCCTGCGTGTATCTTCAACAAGCTCTGTCGCCGTCTCCCAGCCGTTGTTCGGGTCAATCCAGTTCACCTCAACAGCAGTAACCGCATAGTCCTTCAGAAGAGGCTGAAGCTGTAGCGGAACGGCGCGCCATCACCGGCATCCATCAGCATCAGGGTGGTCCGGTTATAGGTCCACGTCTTATCTAGGACGGTCGGTTGGTGCACGAACGTCAGCGTCTGATGCCCGTTCCATACCGGCATACAGCGCATCGCCGAGCAGAAGTGGATAGCACATCCCACGCCTTACGCTGTGTAGGTCATGATGGGATTACAGGTGATGCCTAGGCTTCCGTCTGCAGCGCCAAAGCGTCCGGCACTGGTCGGCCCAGTGGCAGTGATTACTCGATGTAGATAGCGACAGCGCTTCCATTTATCCACATCCGAGCACCAATGACGTTTCCCCATGCCGTAGCCGCCCGGAGGTGATCTTACACATATCCCACAACACCAGCGCTGTTGTGCTCTTATTGAGCGGTTTAAACGTTCTCGTCCCCAGATACCGCTGTATTGCCGCGTCTGCGGGTTATAGTTCGACGGCACCTGCAGAATACGCCCGCGCAGATGATAATTACGAGCCCTGCTGGGCTGCCGAATGAGCCCGAGTCGCTCATGCGACGCCGACCAGTGCCGTGTTCGGGTAGCACTGTTCACATCGATGATTTCAGGTTATGACGACCAGAGCGTTTGTTCTGCATAACTTTCAGTCATCTGTGGTGCTGTCCGGCGTCATCCTGCGCATCCGGATATTAAACGGGCGCTAGGCAGGTTACCATCACCACGAGGCCAGATACTGCAGGTAGGTTTTCGCCTTAATGGTGATGTCTTTCTCGTTACCCAGCCACCGTTACGTTGTATCTGACGAACCAGCAGGCGGACTTCCGACGATTCCTGTCATTGTTGAGCTGGTTTCCACCAGTGCCTGTACACCGAAAGACATAGAGCGCAACGGTCGATGTTTGCAGGTATCAATGGTGCGGGTAGATCGGCGTCATATTTCATCCGTACCCAGCACCGTCTCGCTGACCGGAGGATTCAAATCCCTCCGGCGGTTATGCTCCTCTACAGCCCGGAACAGCACCGTGACACGGATATGTTGGTATTCCCTCGAGTGTCCAGCACCGGCGTACTGTTCCGCAGCGCTGTTTAAGCCATCCAACGCACTCTTTTCAATCGGCCTTCGCTGATGGCAACCGATCACACTCAGCAACTGCGTGGACTTCAGGTGTTTAGTGCCCTTCGCCTCCGGGGTATCCCCTTACTGCTTCCTTTACCACCATTCCTCACCCCTCCATAAATGACAAAATGGCCGCAGCAGAGTTCGCATAAAACATTTTGCACATCAGCGACCAATCACCACAACCTGACCACCGTCCCTTCGTCTGCCGTTGATCTCCTGAGAACCGATCGGTACCCACGCGCATTCCCCGTACAGAACAGGCATGACATTGTGCCCTGGGCAACCATGTTATGCGTACGAGAAATAGGTATCCGTTTTCTGCTTACCGTTATCCGTTGTCTGTGACCGGGGAGTTCTGGCTTTCGGTGCAGCATCTGCGCCACACCACCGAGCACCATACTGGCACCAGGAGAGGAAAACAGGATGCCGGTCATACAGACCCCAATGGCTGCCCGCGGATGCTGCAAGGGTGGCTCCGGCGGTGAAGAATGATCCGGCAATACTAGGCAGCGACGCGAGGACAATCTGGAATACGCCACGTAATGGCCCCGGCGACTCTGGGAACAATATGAATTACAGCGCCATCAGGCAGAGTCTCATGCCGCTCATGCAGCCCGTTAACGCGGGACTGCTGACGTCCCGCCGTACCAATCCGTACCTGTACCAGCCGTGCCGTTTCTGACGAAACGCCGGGAGCTGTGTGGCCGTTGCCCGGATGATGGCTTCAGCCCCGTTTTCACACGAAGGTCTTACATTGCGGCATACAAATCGTTGTAATCCAGGCGTAAAGGCAGGATGCGCGCCATGCCGGAACCCCAGGGAGATGTGTGCGGTGTGCATGCTGCCATTTGTCGGTGTTATCCTCTCTGGCCGTTTGCTCAGTTGTTCAGGGAAACTGGTGCAGCAGCAGCCGTCGACGCAGTAAATTGCGGCTAATGCGTCCGGCACTGATGAACCAAAGCACATGCAGCACATCGCCCGGCTGTGCCGGTGGACAACGGCATGATACAGCCCCGTCGCCTCCATATTATCCAGATGAGATTCTGGCCGTTACGTGCCACCAGTCATCCTCACGATGAAAGTCCGGCATCTCAATCCCGCCAGATGATAAGCATCCCGGAACAGTGTGTAACAGTCCGTCACCCGTGCCAGCTCAAAGCGCCGCTCGAGTCAGATGCGGCACAGCGGATTGGCTGATTCGATCGTCCCCCGGCACTCAGCCACCACGGCAAATCACCTCTGCACTGCAGCCGCCGTCGGCCTCACAGCCAGGGCAGACCACCGGGGTGAGTGCGTGAACCAGCGCCACAATTCACCCTGCATTTCTGCCTGCAGCCAGTCTTCCGGCGACTGGGGAAATGCCCCTCCAGGCTCACCGGAGATGCCCGGGGAAATATCTTCCCCTCTCCGGCGAGTGCTTACCACGAAGCCGCACGACTCCGGGCGCACATCGCCGGGCGTGCGGCTGTAGACTGATTCGTGTAGTCACTAGCTGGAAGTCTTAATGGGTGAAAAGTTGTTAATGGAAAAGGAACCCGCCAAAGTTTGCCGACGTTATTGCTAACTTTACAACCGCTCAGGCATTTGCTGCATTTATCCTTCGTGATATCGACGTTGGCTGGTCATATTCATCCGCGACAGCCGGACTTATAACCGCACTCGTCACCGCGATAGTCCGAGTGCAGGTGGTTTAAGAGATACCCTTTAGAAAACAGCCATCCGTTTCCGTCGGCGTGGACAGTACAATAAAGGAGGCACTCACAAGGGCTCGAGTTCATGCACTGCTCAATGCGCCAGCGGCTGATCGACCTCCTGCTCCGGATCGGCGTAACTGTTTCCGTTGACGAAGTTCACCGCATCCAGAAAACGGGCGTAACCTTACGCCGTCACCCGTTCCCCCAGGACCAGACTCCTTGCATATCTTCCGCCATCCCGGTGACCATACCGTACAGGTTAGAAACCGTCAGTCCTAATCCTGGACCTGGTGCTTTGCCATTCAGGTCAAAACCGCTCCCCTGAATGGGATACGGCTGATACTGGTCGCCCGTGCCAGGTAAGCCCTACCTTTCGTTCTGCTCATTACAGAAAATAACGTTCTCCACCGACCTGTCAGGTCGATTTCCCAGGGCACCACGCTGGCCGACTGCTCCGGACGGGTGCATTCATTGGAGTGTTTCCTGCCGGTATCCTGCATGTAGAGTTCATCAGGTGTTCAAACTCTGCTGAACTCAACACGCAGCAAGCTACTTAACCCCGGGACGACCATTTTTGCAGCAGGTCATTTATCTGCCGCTCATAAGGCGGCGTCCACAGAAAGGATTTCCAGCCCCGTTGTACTCTTCCGAAACGACTCCAGTACCGGTGCTCCTCACCGGGGGACAGAAAGCCCGTCACGCTTACGTTTTCAGGTTGGCATTCAGCCCGGCAGGCGCTCGCTGAGAAACCTCATCACCAAGCGCACCTTTCTTACAGAAGGGACGGGTGAAGCCATCCATACCGGGTTTCACTTTCCATAGGAAGGTCTTCAGCTAGGAGCCGGACACTCCCCATCATCTATCTTGTCTGAATTTCATCACGGGCACCTTGCGGGCCATGTCATACGCCCTTCAGAGCAGCCGGACTATCTGCCCGTTCGTGCTCAGCGTCGTTGTCTGTAATCACCACATGGTTATTCTGCTCAAACGTTGAACGCCTGCGACCGGCTGATGCCATGCTGCCCGGTGTACCACCAACCGCCGGTGGGCAGCATAGCCGCATCAGCCGGTAACAAAGATTCCCACGCCAATCCGGCTGTGCTGCCTTCCGTGGAAGACAAACTCACCACGGTGAACAATCCCGATCTGAGCTCGCTATTGCCGCCGGTTCCCGTAAATCCTCTGGCTTTAAAGGCATTTCGCGCCGCAGCGGCCACTGAGGAACGTAGCCGTACCGCCTGACGCGGATGCGCCGCCAGACAGCCCGCCCTAAAACCCCGCTGCCGATACTCCCGACAATCCCCACCATTGCCTGCTTAAGCAGAATTTCTGTCATCATGGACAGCACGAACGGGTGAAGCCTGCACCAGTTTCTGCTCACTGCCGTCAGCGATCGCCGCCAGATATTCTGTGCAATACCATCAAAGTCTGCGTGATGGTTTTAGCCTGCGACATACTGTCCGTGGCGCTCTTCCCACTGAAGCTCCAGCCGGACTTCAGGCCTGCTATCCAGTTCCCGCGAAGCTGGTCTTCAGCCGCCCAGGTCTTTTCTGCTCTGACATGACGTTATTCTAGCGCCATGGATTATCGCCATACTGTTCCTTCAGGCGCTGTTCTCGTGGCTTCCCGTTCTTGCCCTGCCGGTCACAGTCAGCCCGCAGCTTTTCGCATCAATGGCGGAAGCCGTTTTGCCCCGTTGCTGCTGTGCGAATTATCCGCCTGCTGCGCCGCGCGTTCAGGCGCGGGCTGATACGTAACCTTGTCGCCAAGTGCAGCCAGCTGGCGTTTGTATTCCAGCGTCTCATCTTTTATGCGCCAGCAGGGATTTCTCCTGTGCACCGGCGACGTTATGCGCCGCCTCCTCCAGTACCGCGAACGTACTCAGCGCGTCGCAGATCAAATCGCGGCGCTGCTGGCCTGATTTCCCCATTTGCTCCGGCATGCTTCTCCAGCGTCGTCCGCGTGATACTCTTACGCCTGAAGCGTGCAGCTAGGGCAGCATGAGCGCTGTCTTCCTGACGATCTGCCTCGCAGACAGCCTTCACGCTGGACTGTTTCGGCTTTTTCAGCGTCGGTTCATATAAATCCTTTTCGCCGCCGCCATCAGCGTGTTGTAATCCGCCTGCAGGATTTTCCCGTCTTTCAGTGCCTTGTTCAGTTCTTCCTGACGGGCTTATTTCTCCAGCGGCGTCTGCAGCGGCCGTTCGTAAGGTGCTCTTCTGCGCCTCTTCGGGTATATTTCAGCCGTGACGAAGGTTACGGTATCCGCTCTGTAGCTGCTGCGCATTTTGTCCTGTTGAGTCTTGCTGCTCAGCCTCTTCTTTCGGGCGGCTTCAAGCGCAAGACGGGCCTTTTCACGATCATGCGAGTAACGCGCGCCGGTTTCATCGTTAACAAAAATAATCATCCTTGCGCAGATGCGATGTCGTCTGCTTTCTTATACGCAGCCTCTGCCTTAATCAGCATCCCTGCGCGGTATCAGCACGACCAATATCCAGCACCGGCATCCCACATGGATTTGAATGCCATGGCAGTCTTCGTCCCCAGTCTCCAGCGTGCCCATGTTCTCTTTCAGCGGCGGCCTTGGTCATCAATGGATTTCGTTGCGGCCTCGTTCCTCCGCCTGCAATGCCCCGGCTTCATCGCCGGAAGGCTGCAACTGAGCAAGCTACGCAATCTGCTCCGCCGACGCGTTATGGAACTGGAGCCATCGGCTGTCAGCCCCGACGTCGGGTCTGTGGTCAGCTTCCGAACGGTCCCAGCGACCTTTAGGCTCACGGATGCAGAGGAGAAACGCGCCACACTCTGGTGGCTGATGACCGGCAATCTGAGCCTCACCGCTTACCCCCTTAACCAGTGCGCTGAGTACTCGCTGTCTGGTTAAACGTCAGCCCTGCCGCCTGCCGCCCGGCTCTGGACAGGACCAGCATACGATCTGCCGTCAGTCCCTCATGGTGATTGCCGGAAAGACCAGCGTTTGTTGAAATGGGACACCGTACAGTGTTGCCCTGATACCAGGCATACGCCATAAGCGAGGTGCCAAGCACAGGCTAGGGCCCCACCATCGGCAGGGTGATCGCACCGGCAAGCCGACAGAACATGGGGATGCATCCCGCCGAAGGAGATCCTTCACCTGCCCCGTGTTGCAGCAGGATCAGCCACGGACTTTGCCCGCTTGCAAGCTGCGTGGATTCGGTGAAGACTTGCAGGCAGCATACGCAATGGCGGGGTCCTACTGCCGACGGAAAATCCCCGCTTTGGTGCAGCCACGCCAGCCTGTCGGCTCAGCAACTGTTCACGACTGCCGCTGTTTTTCGCATCATTTTCTGATTATAGAAAATTAACGCCTGACTCTGGCCATCTGCTCGTCAAATCTGAGCATCCAGACTCAAATCAACGACCAGATCGCTACCGGTTCCTAGCCATACCGGACTCCTCCTGCGATCCCTTGCTGATACTGTCATCAGCATTACGTCATCCTCCGTCATGTCGCCACATCCGGGAAGCGGGGATAACTTCATTCCCGTCCGGGCCACGACGGCTAACCATGCTGAAGCAAGCCCTGCCGCTTTCTGCATCAGCACATCATCTTCAGGCTCTTCGTCAGCCTCGCGCCGGTTCAGCAGACTGAAATCCTCCTCAGCTGGATGCATATCCGGATCGCTGAAAAACACAGGCTGAGCACAAATTGTACGTCAGCCAGGGAAGTGCATATCCAGCAGAACATCATGAAAATAATGGGTACTGTAAAGCGGTGCCATTGAGCAATACCGTCATGACATCCCGGCAGCAGCAACGCGCCAGTCGGGTCGCCCCATCGCACGCCAGTTTCAGGGCAACTCCAGCTACCGTCGAACACTTTCCCGCAGAAAGGTAGAGGACCCTGGCCCGTGTCCTCTGTCTGTTCAGGGGCATTATTCACCACAAACTCATACATACCAGACAGCCGTCACCACGTTTTCAGCATGAGAAATGCCTCCGTGGGCCGTAGTAAGCACTTCCTGCTCAATCTGTTTATAGCTTCATTCAGCGTAACGGCATCTGCGTCTTCTGCGGATGGTTTGGATGCTAGGACATCGCCAGATCAGAAACGCCGGTTCTGATGGCGTCTTCAACAGTAAACGTCTTCCGGTTGCTGTCTTAACCCGCCTGTTCTGCCTGCCGTTCATCAGGGCAGATGCTCAATGCGCTGCAGGTAGAGTGACACAGTTCGGCCAGAGAAAGCGTGACGGTCACCCGTTGGTTCAAATGATTCGGTTTTCAGGAGTGAACACGCTGACTCTCTCCGGATTAACTGGCGGTACGGTAATTTCTGCAACCGCAGCAAACGCTCACCATTACCGATACAACCGAATGTTGACCTTGCCTGCAGCAACGGCCGTTCACGGTATCTAGTCATACCACTGACGACACGGTGGCTTTTGTTTATCTAGCGCAGACAAGCACGAAAGGGCCTCTTGTCGTTACGCCCTCCGGCTGGAAAGGCCACGTCAGCGTGGTGCTCTGCCTTCACCACCGAGGGCTCTGGCAGGCGTGGCACGGTCATGCAGATTACAGCCGTATTCACGTTAAGGTTGAATGCTTTGCGTGATCAGCATCGACTAAAGTTTCTACAAGTTATGACTTTCACCGTTAGTATATCCACTTCCATGACGGTTCACACATGCGCCAGAGATACCGTAAGGTACCCATCTAAGGAACACGAGGACCTGTTTACCGTTCTGGAAGGTAACGTTGACCACCAGGTGAACCAACTGTTCACGCTTAAGACCACGCCAGCATAGGTGCTGCTTACCCTGCTCATACCGGGCAATCACGCCATAGCGTGAAGCTGATATGCCTAAGCAAATTTCTGCATGCCATTACCAGCACAGCCATTCAAAGTCTGCATCACGTATTCCATGATACAGACTGATCGTCACCCCTCCATTCAGTTCAAGATGTGAAAGAGTCAAAATCTGTCTATTTTGCCAACGAGACCAGTCACTAAATGTCAACCATGCAGATTTCATCCTCCAGTGACAACCAATAGCCACTCCGTGACAAACCCACAGAGCACTGTCTAAGCACCTTTCAGACCTTCCGAAGTTAACAGTTATCTAAGCAGCAAGGCCGTCAACTTAACACATTTCAACAGACTGATGACGACAATCCATCAATCCCTCCACTCCGCCTCCCCATCTATGGTTCCACCACCATGCTTCCTATAGATGCCTCACATACTGATCGGTGATTAAAAATTTAAAACAGTTCGTGCCAATAGTTTGT * tp:A:P cm:i:117 s1:i:1079 s2:i:0 NM:i:2090 ms:i:4450 AS:i:4461 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
75 68 16 utg000001l 35103 60 11S6M1I10M1I7M3I2M1D6M1D15M1D5M1I11M1I11M3I5M2I2M1D17M7I2M1I3M1D11M1I8M3I11M2I8M1D10M2D7M6I7M2I1M1I3M1D13M6I1M2I5M1I6M1D10M1D6M1I7M1D13M2D11M1D10M1D22M1D7M3I4M1D3M6I5M1I9M2I28M1D22M1I5M1D6M1D10M4D4M1D13M7I8M2I11M1I8M1D8M1I18M4I6M3I20M1I13M4I2M1I3M1I6M1I6M2I12M2I10M1I10M1I6M1D4M3D3M3D15M1D4M2I10M2I9M2I4M2I9M1D23M1I3M1D9M1I2M3I7M2I6M1I13M1D17M3D5M5I6M1D6M2D13M5I5M3I7M1D3M1D2M2D2M2I4M1D3M1D10M1I3M1I6M1D15M1I4M3I4M3I5M1I6M4I5M1D3M1D8M2I11M1D18M2I9M1I3M1I20M4I5M1I9M8I3M2I8M1I1M3D2M1D2M1I6M1I11M2D6M2I2M1I2M2D4M3I6M1I8M1I26M2D6M1D12M5I7M5I4M1I1M2I22M1I14M1D7M1I4M3I2M6I6M2D5M2D7M2I2M3I4M2D3M1I2M1I6M2I7M2I17M1I9M1I7M3I11M6I6M2I3M1D13M1D16M1D9M1I10M5I6M4D5M1I9M1D4M1D2M3I2M1D27M3I3M3I4M2D5M3D14M3I9M1D1M4D6M3D4M1I9M1I2M4I25M1D7M3I1M1D15M1D11M1I8M2I2M2I3M1I2M1D5M1I8M1D5M1I5M2I2M2I3M1I1M1I7M2I3M1D3M3I4M1D4M1I2M1D8M1I11M2I11M2D2M1I12M1I1M1I1M2I11M1D9M2D2M3I6M1I2M2I10M1D4M1I19M2I13M2D4M1D2M2I4M1D4M6I23M1D21M3I2M2I17M1D38M2I4M2I7M2I9M1I10M1D6M3D1M1I16M2D16M2I1M1D3M1I11M1D8M1I2M5D11M1I11M3I5M1D3M2D13M1D3M1I12M4I16M1I4M3D20M1I7M1I21M1D5M6I6M3I9M17I6M1D8M3D9M3D13M2D5M1I9M1I2M3D5M1I5M4I1M3I2M1I4M1I4M1D9M1I4M2D7M2I19M1I5M3I15M1D10M2I3M2I6M1I3M1I8M1D8M1I7M1I10M1D6M4I10M2I12M3I3M1D3M1I1M1I4M2I1M1I11M3D15M1I10M3I18M1I14M1I4M3I6M1I6M1D25M1D54M1I8M1D15M1D9M2D3M1D3M2I6M1I5M2I4M1I3M1I11M1I14M3I5M1I1M1I3M1I3M1I1M1I7M3I15M3I7M2I10M1I3M1I18M1D5M1I2M1D17M2I7M1I23M1D16M1D7M1I29M1I12M121S * 0 0 ACAGTCTGCGTGGCTGCAATTTACCTGCGACATAATTTAGTAGTGGCCTCTCTTCCCACTCATCGAGCCCGACTTCAGCATTGCGATACAGGTTTTCCCCGGCAAGCTGGTCTTCAGCCCGAGCCTTAGAGTCTTTCTTATGACGCTGACGTTGGGCTCCAGCCGGCCAGGATTATCGGTACTGTTCTCGTGCGCGCCACCTGTCGTTGAGATTCAGCTTCCCGTTCTGTTCTGCCCTGCCGGGTCAGTCAGCCCCGGCTTTTCGCATCAATCCGGCCCGTTTTAGCCCGTTGCTGTATGTGCGAATTTATCGCTGCTGCGCCGTCGCCGTTCAGCTAGTGCCTGTAATGATCAGTAACCTGTCGCCAATATGCAGCCAGCTGGCGTTTGTACTCCAGCGTCTCATCTTTATGCGCCAGGCAGGATTTCTCTGTCCCTACGACACTGGCGACGTTGCGCCTACTCGTCTCCTCCCCAGATCTCCGAACTGACTCCCGCCTGCGTACAAATCCCGGCGCTGCTAGGCTGATTTTCTCCCACTTTATCCGGCATGCGGTCTCGGCCGTTCATGGGAGTTCTGCCTGACAGGCGTCAGCAGGGAAGCATGAGAGCACTGTCTTTCCTGACGATTCACCCTAAGTCTCACGCTGGACTGTTTGGGTAGGGGTCGACGTCGGCTTCGTAATTTCCTAGCCTCGCCGCTCGCTAAGTTGTAGTGTACATGCTAGCATTTACATTCTTCCGCCTTACTTGTTTTCGTCGTTCATTTCTGACGCTGATTATTTTCTCCAGGGGCGTCTTGCAGCCGTTCGTAAGCTGGCTGCGCGCCTCTTCGAGTATATTTCGACTATTGACGGTTCGGATGGTGCTTATGCGATTTGTCTGTTGAGTCTGCTGCATCATAGGCTTCGGTCTTTCCTGGCGCTGAGTTTCAAGGCAAGACGGTGGCCTTTCACGTCATCCCAGTAACGCGCCCGCGCTTTAAGCGTTAACAAATAATCATCCTTAGCACTCCAATTCACCGATGTCGTCGGTTATTCTGCGCTTCTTATACGAGACCTCTGCCTTAATCAGCAACCTGCCTTATGGCCAGGACGACCAATATCCAGCAGATGTACCCCACATGGATTTGAATGCCCTAAGTCTGTCTGCCCAGTCCTTCTCTCCATAGCGTGTCGCTGTTGTTCTCTTTTCAGCAGGCGGAGTCTGGTCATCAAACCCTTTCGGTTGGGTCGAGCTCACTCGTTTCGCCGCAATGCTTCCTAGCGGCTTCAATGAGCCGGAAAACGCTGCACAACTGAGCAACATACGCAATCTGCTCAGACAGGTCTGTGGAACATGGCGAGGTATCATCGCCCCGTCAGCCCGACGTCGGTCTGTGGTCAGCTTCCCGAAGGCTTTCAGTGACCCTATATTGTCCCCACGAGCGGATGCAGAGGCGAAACGCTCACTTAGTATGATGGACGCAATCTGGCTAGCATGCTCAGATTATCGCCTTAGGCAATATAGCCCTGAGTACTGGGTCCTGAGTCAAACGTCAGCCGCTGCCTCCATTGCCCGGCTGGGACAGGACAGGACGGTCGATCTGCCGTCAGTCCCGCCTGATTAGGAAGGAAATACAATACTAGTTTTGTTTGAAATCGACAGCGGTTACGGTCATGCGCTTGTCACCTAATGATAGGGAGCCGTACAGCCCAGTCCCGCCGCATGCCAGGCCTAGCGCGCCAATACGGCAGCGATCAGTACGGGCACCGGCAAGCCCCTGAACGGCTCGGCGCATTCATCCGCCGAAGGAGTACCCTTCACCTGCCCCCTGTTTGGCTGCAGCATGAGAATATTAAGCACCCTGGGTTGCCTGCAAGCTGCCGTGGCCACGTCGTGAACTGTGCAGGCAGCAGACCTCGACCATGGCGGCTTTATACTGCCCGACGGAAATCCCCGCTTTCTGTGCAGCCAGCGCCTATGTCCATGAACCGTCCCACTGTTCTAACGACTGCCCTGTCCCGCAGTACTTTCCGTACCAAAATGACGCCTGACTGACCGCTCATCTGCTCGTCAAATCTGAGCGCATCCAGACTCCAAATCAACGACTGCCTTACGCCAGTCGGTCCGTCATACCGGACTCCTCCTCGTCGCGATCCCTTCTGATACTGTCGTCAGCATTACGTCCATCCTGGCGTCATAGTCCTAAGAAGCGGGAAGCGGGAACTTAGTCGTCATTCATACAAGCTGGGACTGACCTCTGTATCTACCAAAGGGACACCTGCAAGCCCTGCCGCTTTCTGCAGAGCACATCATCTTCGAGCTTCCGGTCGGTACTCGTACTCCTCCTCGAGCGGTTCAGCAAGCCAAATCCAGCGCGGATGCATATCCTAATCTGACGAATGAAAACAGCTGAGCACGTGTACGTCACTACCTAGCAAAATAGTGCCAGCTATCCAAGGAACCGTCATGAAAATAATGGGACTGTACGGGGACAAATGCCGGAGTCGGCATACTATACGTGATAGTACGTGGCACCGGCACTCATATGCGAGCCGCTTCGTAGCGATAGCAATTAGCGAGTTTCAGGGCAAACAGCCAGCTCACCGTCCGAACACCACTTTCCCCGGAAACAGGCTGCGGCCCGCCGGCGTTCCTGTCTGTTCAGGGGGATTATTCACCAACAACTCATACAGTCCAGACAGCCGGTAAGATCACGTTTCAGCATGAGAAATCCCTCCGTACAGCTGGTAAGCACCTTCCTGTGCTCCAAGTCTGTTTAAAGCGTTTCATTCATCTAACGCGGTACTCCTGCCGTGCGGTCTGCGTCAATGGTTATGCCACAGCGAGACATCACGCCAGAAACGCGGCCGGGTTCTGATGGCGTCTTCCAATACGTAACTTCCGGTTGCTGTCTATGACCCCTGTCCGTTCTGCCTGCCGTTTCATATCGAGATGCTCAATGCTATGCAGGGCTGACAGTTCAGAAAGCGTGACGATCACCGTTATGTTCAACGGCTTCAATTCGGAAGCTCGTATAAAAGATTGGATATGCATGTGGTACAGTAATTCTGCGGCGGGCTAAACTTATAATTGCCTCCCGCAAGCGACCACAAGAAATATTCATAAAGGACTA * tp:A:P cm:i:18 s1:i:185 s2:i:0 NM:i:904 ms:i:810 AS:i:810 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
76 69 0 utg000001l 20706 60 6775S26M1I18M1D3M1D12M2I6M1I7M5I5M5D3M1D5M1D6M2D12M1I2M4I7M1I15M2D2M1I9M1D3M1D9M1I10M1D14M1D5M2D11M2I2M1D5M2I6M1D4M4I10M13D12M1D20M3D16M2I9M1I31M1I3M1I2M3D16M2D7M1D4M1I10M1I6M2D3M1D8M4I8M3I5M3D3M5D10M1D17M1D13M4D6M1D23M1D1M2I7M1I13M1I27M1D2M5D3M3I9M1D3M1I5M2D6M1D16M2D6M1D7M2D5M1I1M1I3M1D8M1D11M1D10M3D5M1D9M2D10M3D7M1D6M1D20M1D3M2D19M1I12M1D8M4I5M2I2M1D9M1I10M1D16M2I8M1D6M3D12M2D7M2D9M1D8M1D5M2D8M2D3M1I21M2D20M1D2M2D9M1D3M1D12M2I3M1D17M3D6M2D14M4D8M3D13M3I4M7D1M2D6M1I6M1D14M3D3M2D2M2D30M2D10M1D3M2D10M1I7M1I10M2D11M1D2M1D7M2I1M1D7M1D12M1I6M3D6M1D1M1D11M2D2M1D8M3D13M1I4M1I4M3D1M3D14M3D13M4D2M1D2M1D15M1I1M3D9M1D14M1D16M2D11M1D12M1I8M1I18M4D9M4D7M1D7M3D4M3I1M1I8M1D4M3I9M1I17M1D16M4D5M1I1M1I30M3D15M1D1M2D16M2D9M8D5M1D3M1D14M1I2M2D2M4D16M4I10M1I8M2I13M3D3M5D3M9D6M11D4M4D2M1D5M2D8M1I8M1D4M2I10M2I1M1I5M3I2M2I1M4I5M2I3M1I7M1I6M3I2M2I11M2D1M2D5M5D2M2D2M1I3M2I3M2D28M1D20M3I7M2I1M1I3M2I5M1I9M1D20M3D7M1D9M2D15M1D15M2D5M2D3M4D4M1D4M1D5M1I6M4D5M1I8M1D15M1D29M1I7M1D2M1D5M1D2M1D17M2D1M1D2M2I10M1I3M5I8M1I1M2D6M4D6M3I3M4I2M1I16M1I9M1I16M2I2M1I3M2D2M1I9M1I8M2D6M2I2M2I6M3I6M1I4M1I7M3I19M3D11M2D1M1D7M2D8M1I3M4I15M1I5M1I5M5I17M1I2M3I5M1D13M3I7M3I4M2D15M5I10M1D4M3I4M7I16M1I14M1I2M2I5M3I2M1I14M1D4M5I3M1D6M1D17M1I5M3I6M2D14M3I14M1I4M1I10M2I7M1D1M1D5M1I3M1D8M2I4M1I4M1I4M2D6M2D1M1D3M1D4M4D12M1D5M1I6M2D23M2I5M2I4M1I3M3I14M1I3M1I4M1D6M5I5M1D18M1D8M2I3M1D2M2D3M1I10M2I9M1D19M1I9M4D8M3D3M1I5M1I4M1I5M2D2M1D2M1I6M2D12M2D5M2D10M1D5M1D1M2D1M2D4M2D19M2I2M1D10M3D2M1D7M1I1M1I7M1D26M1D4M1I6M2I3M2I15M1I1M2I6M5I5M1D2M2D12M3I2M5D1M1D8M2I4M4I5M6I3M2I4M1I16M2D1M1I7M1D8M3I3M2I7M1D4M3I11M3D2M1I11M2I5M1D36M1I11M1I4M1D9M1D16M1D6M2D4M1D6M7I7M1D1M2D14M1I2M1I1M1I6M2I2M3D7M1I8M1D25M1I4M1I4M1D7M1D4M1I4M2D5M1D3M1D4M1D4M1D5M1I4M1I10M5D8M1D4M1I8M1D3M2I15M1I1M2D3M2I1M3D4M1D1M1D5M1D5M2D3M2D3M1D12M1I5M3I8M1D2M5I2M1I3M1D16M1D35M3I27M4I3M7I3M2D12M2I1M5D14M1I4M2D3M1I2M4D9M4D11M5D5M1I3M1I8M1I27M1D21M2D3M2D6M1D6M1D27M2I4M1D6M1D3M1I14M5I12M3D3M3D11M2D2M3I6M2D12M1D8M2I8M3D2M2I13M1I2M1I7M1I8M3D2M2I4M8D2M1D5M2D14M2D9M1D14M2I9M1I7M1I3M1I3M2I9M1D3M4D9M1D7M1I2M1D5M1D13M2I4M1D15M3I1M2D8M1D20M1I2M1D5M1D16M1I6M1I3M5I2M3D11M1D5M1D5M3D1M1D7M1D15M1D13M2D7M1I1M2D13M3I2M1D6M8D9M1D1M1D8M1I14M2D10M944S * 0 0 ACGTCCTTTGGGTGTTTAACTATCTAGTTACTTAGATATTAGTCCGTCTCAATATTATGGATGCTAGCTGAAGCACGATTCAGTCCCGTAGACTCCAAGGGAAGACAGTCGTCCCTTCCATCGAAAAGTTTGTTCACACCACAGCTCAATGATCACCAATGTATGGGAATTGTTTTTATGATACTACATTCCTGCTTCATTAAGTGGCACAAACCATAATTGCTCTTCTTGGACAGCTGCACTTTACGCTTAATGGCCAGCATTTATCGTTTCCATCTTAAACTGCGCGTCCTGCTGGCATTATGATAAGCACATGACGAGCCTCTTAGCGGAATGCGCTCGGTGCCGCAGGTCCAGCAAAGAGACTGAAAGATGCCACACATGAGGATTACCGATTCTCATGACATATTCAGTTACCGGCCGAAGTCTAATGAGATAACGATCATATACATGGTTCTCCAGAGGTTCATTACTGAACACTCGTTAGAATAACGATCAGTGCGGTTCGGTTTCTACTCATCAAACTTACGGTTGTAATAGTTCTTAATTTCTCGGCTGTAGGGGTCACGAGAACGGAAGGCTCGCTGGTCTTCCAAGACGCTCAATGGTCACCGCAATCCACTTTTAAGGTGATATGGAAGAATTTGAAGAGTCCGGAATATCACCCGCGCCGTGATATGGAACAATACCAGACTTAGTACCCACTATTAATCAAGTGGACAATTCAAGGGATGAAGCATGCCTGCAATCGGAATGCATGGTTACTGAGAAATGTTCCTGTAATGGAAAGATGGGGAAATAGTTAGATAAATGGGCAGTACGAACGACGATGATTGCCACCGTAAACAGAACAACAAATCTATCTCCTGTTATTTTTGCAGCATACGAATAAACACTGCACTGTGCTTCCAACGAGTACATCACGGAGCAATGTCGCTCGTAACTAAACAGGCCTAACTTGTCCTTGATCGGAATCTTCTTCCTACGATCAGGGCGATTTATCTGCGACCGAACAGATGTCAAAACATCAAATAAGTTGATTACGACCGAAGCAGCATGATAGAATTATGAAATCGACATACGTAATGACAGAGAGACTTCCATAATTACATTTCTGGTCACTCTGAATAGCACTCATACTGGCTGTATTAAAGCTATTAATCAGTGCCTCCGCAAGAGCCTGCTGGTAGCATTTCAAGCGACTTAATGCATATGTTATGAGTTCGGGACTGGAATGATGGAATACTTTAAGAAAGGGAATAGACCCGCTCCATGAGCGAAGCCAGGAATAGAATTACCGGGCTGGCCAACCGGCCAGGAATATTTGATTCAGATGAGCTCACTATCAAGCTCGCGCCTGAGTGCGTTTTGATCGCAGCCGACACCCTTCACTCGCAGGCGTTTTCGTTATGTATAATAAGGAGCACATGCATATGCGCTTGCAGGCTGTCCTGGCTTATGCCCTTCCACGCGGGGTCTTTGAACTAACAATCACCGTAAGTGGCGTGACGCTGGAAGCCTTATCGACATACTTAATCAGGGAGTCTCAAAGAATGGATCAAACACTTATGGCTATCCAGGCCAATTCATCGCCATTTATTGGCGATGAAAGTGTTTCGTGAAGCCGTCGGACCTTATAAAAATCAGTGATATACTGAAGTGAGTACGGCAGGATCGCCGGTCTATTTCCGTGCCTCCAGCATTTCGCGGTGAATTTTCACAGCTATTTCAGGAGTTCAGCCATAATCCCCTTCGCGGTGCTTCTTAAGCGGACTGAGTCGCCCATAAGCTCATGCGAAGAGAATATGAAGCGGCAGACATGTGACGCCCCAGCACCTGTCGTTGAATCCTGCATCGATCATTTGCAACGCCACGCTAAATCCATTACCCGTGCGTTTGGCCCGACGGTGTTTCAGTTTGCCCGCATGGCAGAACAATTACATGCTGTCCATGGAAATTAAGCCAGGTCTATCCTTTACGAGGTAAACGGCAACCGATACTGCACTCGCAACGCTGGCTGGAAGCTGGCTGAACGTCGCATCCATTCTTTGGGCCCGCATGACAACTTCTAAGCGTCCTATTCAGACGCTTTAAAGGCTTTCACCATGCGTAATCATAGCAGTGTAGGCCTTAATCCGGTTGCCCAAGCAGTTACGTTCCTCCACTCAGAAGTGGCATCGTTCGTTCCGGTGAATTGAATCTCTGGCTGGTGGGCCGAGCTCGGCAATGAAGAGCAGTTTGTAGCATGACGTTGGACAATGAATCCTATCGATCCCGGATTTGCCCGCAGGACCGTAATCATCCGATCTGCGTGCCGAGTGAACCTCCTGAATGCCGCGAACGCTTCAAACTCGAAGGCAGGGAAATCGCGCCGTGGATCCGCATCCCAAACGCTTTACGTCACCCCGGCCTCCTTCGAGTGGCGTCGCCTTCGATTGCTGGTATCTATGACAGGATGAAGCCAGCGCATTGTCCATCACTGCAGCCACTGCAGAACGTCAGCCGAATGGCACTCTACAGTTGACGATGAAACCATGCAGGATACTAACACTCTGCTATCTCCGCTAAAGAGCCCGTACGACGTACTTGCCGCTCTTTCCATCTTTCGCCGCGACATTCGTGCAGCGTCAGAACTGACGATGGACGCAACAGTAATTGCTTCCTGAAACAGAATGAGCCCAGCACAGAAGGTAGCAGCATGACAGCTAAATTATCCTGCAGCGATGGGGGATGGCCGGTGAGGTCGAACAGGGATGGTCCCTGCCAATCGCCTCGAGGTTGCGCCTCATACTAGCGTCAACGCCTTCGCAGTCGCCGTGAAAGCCAACCGGAAGACCTGAAATGTCTATTCCAACGCCGCTGTGAGCAGTGCGCCCCTTGACTATCGAATCTCCCACCCACTGAGCCTGGGGGAAACAGTACGCGACGACGCCAGAACCCTGTTTCGATTCACTTCCGGCGTGAATGTTACTGAATCCCCGATCATGGACGCGACGAAGGTGCGTGACGCCTGCTCCCATGGTTTATCGATGAAAATCGGACGCGTGCCCGTTTGACTCCGAATCCGGTTTCATGAAGTTCGATCGCTCGGTGGTTTCCCGTAAAGTCAGCTTACATGGCCCCTGGCAGTATCGCCGCTGTGACTGTAGAAAATGCCTGGTTTTGCCAACTATACGCGTATGAAGCGTGAAGGCCTGCATTATGTCGGGCCGGAGGCGACATGAGATTTTGTAGGTCCCCAATCGTGCCGGAGTTGCCATCACCGAAGCTGACGCACGGCATGCTGAAATTGGTTTGTATTTGGGGAGCAATGGCAAACGCATCCTCAACTATCTAGGCCGCAATCACTTTCGTGCTCCGTTCGAGGAGCCTTTCCGCTCGTCTTTGACTCCCGGATCTCAAGTAGCGGCGCGCTAGGTAATAAGAATAAGCTAGGGTCTGCACGCATCTTCTTTGAGTTAGAACGAGTATGAGATGGCACTTGCTCAATTGGAATCAGGTTACGAGGCGCGCGCGCGCGCAGTAGAAACGACGAATTTCGACCTTCACCGCTCCTTTCACACTGGAATATGGCTCGAGCGAAGCAGATGAGAAACGATATGACATGGCCAGTGCGTCCTGGCAGCGCTTCGGGTCGTTCTTGCATGATCATCGGATTGTTCATAATACCGCTAGGAAGCCCTTCTGCACGCTTTGCCGTCAGGCGCTTCTGCAATGAAAAAGCCAGACACCGTTTCCGGATAAAAACCTTTAGACCCATTTGCCGTGAGAAGCACTCGCATCTAAACAGGCGTCACGGACCCGGTTAAGCCACTGACGCGATCAGCAATTCCTCACTGACGGGACGGCGTCTTTGAAACGATGGCACAGTGTAATAATCAGGGGAGCGATAGCCTTTTATTATTCGCATTCACCCTCATCCTTGTATGACCAACAGTTCAGGGATCATGAAAGCAGAAGATGCTTGATTCAGCAACGAAAGCGACCGAATCGCAACACCCAAGTCAATCTCCGGACGAGCACTGGCTTCCCACTCATGTTGTAGATGGCGTGAATAATGAACGCGCCTGTACTGTTCCATTTCCGTGTTGATGTGCAAATTTACCGGAGGAAGTAGCGAAGTGGCTGAGCCGATGTCAGAAATAAGGCAATTCGAGTAGCGCGGATGCGGCACTCAGGGCAATGCAGTAGACCGATGGGAGCGAAGTTGACGCAGACCTTTCGGATAGCGAATAGCGGCCATTGAATGCTGGGTCGAAACGGAAAGCAACCAGCATCAGCCAACGCGACCCTAGAAGCGAGTATTGCCTACATCTGGCGGAATGCGTGTCTCCTGCATCAGATCAAACTCTAAATGGCCCAGCAGCGTGAGTACTACGAAGGTGTCTCGCTGGGAGGCCTCGATGGTCCTAACTGGAGGAAGCACCGAATAGCTGAATGAAGAGTTCCTGTTGTTCGCCATCCTGGAAGACTCCTGTTATCACGCCTGCTATACTGGAAGTTTCTGCGGCAGTCCGGATCGGAAGTACCTAGCCGTTACTCGAGCCTCACTCCACTCGGGCCCGGCTCTATGACGCGCTCCGAGCAGTGGGGCGATGGCCTGGATGGATCCGGGCATGACTCATCAATAATGAGAGCTTAGCCTGGCAATCCGCGGCCAACCGCCTGCCCGCATCTCGATCGATTTTGCCACTCGTGGATGCCTGAGGCGCGTCGCGTCTTCACGGCTGCCAAGTCTCAGGTGGTGCGCTCGCGTGGATAAAACATTAGTGGTCGTTTGTCGGACCGGTTAATACATTCGCAAGCTACCTTGCGGGATTTACCGGGCTATCAATGAGTCTTAGAGTCTAGCAAAGATTGGGCGTCTCATGTGGATCCTTGTCCCCTGCAGACAGCCGAAGGTGTTTATGTAGATGAGGGCCTCATACGATCCGACAGGTATGTCTACATGAAGATTCTAGTCGCCTGCGATAAAGGTCACGGATTCTGCAAGTTGAGAAGCTTAACCGTTGAAGGGTCTCTTGGCCAAACAGTGGAACGAGCTGTGCTAACCGTAAGCTATCATAACCCAATATCCCTCGTACTAGCCGGGGCTTCTGACTCGTCTGGGGTCTAGGCGCTGTTTGACCGCAGCCTCCATTAATGACCGTGCAGTACTAGGCATCGAGACCAGCACGAATTCTTCCACGATCTGCGAGCAGAGTAGCCGGCGGGAGCAGCACCGGATAGCTGGGACCGGGCACTGACCAATTCGAATGAATCCAGAAGCACAGCAGCCGCCTGGCCGTTGGTCGATTACTTGCGGGTTGCGATGGTACCTTCAGGGATACGAAGCCCGCACCATTCCGGAAGCTGCGGCAGCCGTTCGTCGATGGGTTGAATCGGGAATGCAGGATCCGCCTCCGGTTACTGAAGTAGAGGAGGGTCTTTCACGATTGAGCTAAGTAGATTACTGTAATCGACTAGTAGCAACGTTGCGCGGCCGAATGGGGATGAAGGCAGATCACACCTACGGCATTTACCACTGATTCGCAGCGGACCAATGTAGTATCGACGCGGCGCGACGGCCGATTTACGGGCTCGAGCTAAGGATCGCAATCGCCTGAAGGCCTGGCCAAGCTTTGAGTCGTACTTTTCCAGCACAACACCAAGCCTGGACCCCGGCGTAACTCAGTGGTATAGATTCCTACGTTGATTCCGCTGCCTGATCTGCTGACGAAAATCCTGGCTAGGAATCCCTCATAACATAATGCTACAAGCTACAATTAAGCAATAGGATGTGGGTGGTCGCTCTTCCCTGACTACTATCTCACCAAGGGATCGAGACTGCCTGGTCATATGGAAGCGCCTAGCAGGCGGCTTCACCATGCTATCAGATACCTCCGCTGCATTCCGGCGGCACTGAGCAAGCGCTACTAAGATACAATTGCTGCCTCCGCAGCAAATCCGAGCGGGATGGCTATGCTATAATCACCGATAGAACTATCCAATTACAGCACAGAATCATCACCATGTTGGCCTCAACTTGCGGACTGGGTTGTTACCGTGAAGCGAGTCTATTTATGCAGATGAAATTAACTGTAGTTGATACGTATGTTATGTCAGCAAAAAGAAAACGAGGTCAAATTGCCATCCGAAGGCAGTGCATATTACTGCTCTAGAATATCAATGAAGGAACATTACTGAATGCAAAGAGATTCTTAGAACCATAATGCAACCGTTCGAAGCCCTTTCCATCCGACAGTATCAGCTACTACGTTATGCCGCACGAAAAGCATCAAGGTCTTCCTTCCGGAATCCCCCACCTTCACGAATTACGCGTTGTCTGCACTGGAGCGAAGCAAGATAAGGGATAAGTTGAGCTGTCTCGGGCATAAGTCGACACTACTAAGCATCACAGTATTATACAGAAGAGGCAAGGGAGTGACAAATTGAAATCAAATAATACTTTATTTTACGTATAGATGTTCGTCATGCACGATAATTGACCAGCGAGTGCTTTTATAATGCCATCCGTATAAAATAGGCTGAGAAACGTAAAGTAAATAATAGATATTAAATTAGATTTTAATAAAAATACCAACATAATACTGTAAACACAACATATGCATTACATATGAATTGACTATTAGATGGTATTATACTGTAACACAGCATTATAAGCAATATATTTTGCCCCTTTGTCACTATTAAAACCTGTCGCACTCCAGAAAGCACTCGCAATCAGTGCACCTTTCACGGCCCCTACTGCCATAGACCATCGCATAAGAAGTAGTGTCAAACGACGCAGCTGACTTCTTTCCTTTCACGACTTCCCCACCCATAAGCATACCTTTCCCATAACTCTACCAAATTGTCTTTACCCGGAGGGAAGTTAATATAAACCGAGCTCCATACGAAGTTAGATGCTATCTATCATGTAGTACGTGAACGATCTTCCGCAGCCCTGAAGCACTAATCGTTTGGGGTACTATATGCATTAATAGACTATACATCGTTGTATAAACGATTAAACAGTGAATAACAGTGGGTCTGCTCAAGGAAGCAGACTAAATATGGAAAACTACAATACGATGCCCGTTGAGTTCAATACACCGATTTTACATGGAAACGTATGTAATAGAGAGGATAGTAAAGAAGATGCCTGTGTTACTCGCCAACAATGCGGTTATTATTTTAAGAAACTAATTAGATTATGTTGGAGTTAGTGAGTGTCTGTGGGCGCATATTCCTGCAGTAGAAAATAAGGCATTCCTACGAGCAGATGGTGGAAGTCACGCTTCATTTCTTTACAATGTTTTATCTTACTGTCTTTATTACCATGGTAGAAATCGAGTATCGAATGTTAAATTGGTTTTATAGTAAAGAAACAACAGACCTACTGTCATGATAGATAAATTCAGTCAACTCCCTGAATTTTTCCTTAGGTGAAGCATTGACGGTGTTAATCTCATAAATTAAGCGATGGTTTAAACACTCTTTAAAGCTATTCAGGCATTTGATAGTATGTAAAATCGTAAGATTATGGACCGACATTGAAAATGAAAGCGTCCTTAACAGCGCTTGGTATGTCTAGGGTAATTTCGAGGATCCGGACAGTGCACGTGTTAATGGTTTACAGAATTGTCGATTTCCACTTTTCATTTAACAGAAAATTAGCCGGATTCAGTGATTTACGTTTGAGGTGACGTTAATTCTATGCCCCAGCACGAACATTCATGCTTTATCGGGCGGAATTGGTGTAAACAACAATTTGAATGGAAGTAACTTGGATCACCAAGCCAGAAATAATGAATATTTCTAAATAATAGACTTATCGAGTCACCAATCCCAAGGATATTTTCGATCATGTTTCAGTTTCGTTTGATTAAGTCTGCTTTTACTCCTCTAAGAACACCTGACCAGCAAAGGTACACAATACTTTATATCAATAAGAAACCTGCCATAATAGTTAGATTACTAGCAGTACCTGCCCCGTCGGTTTCAGCATTTATTGGTTGAGAGTAGATAGAAGACAACCGTGAGGAAGCTATCAAACTAAGTAATGAAAACTTTCCTGATATGGAACTCATCAGCGCATTTCTAAATATGAAGAGTTAAGACGTAATGAACCACATTCAAAGTGACTAAGTAAATTCAAATCGAGTTGTTTGACATATCCAGCGAAATATCTGCTTCGAATGAGCTCTGGACATGCAATTGTTTTATTTATGACAAGATTAGTAGGTCTTATTTGCGAAAGTCAGGCTGTTAACTCGTACCAGATTTATGCATCCACTTTTAACTCTGTTTACGAACATTAAGGGTACTACATGCACGCAATGGTGCGACTATTAAATAATTTGACGCAATCTCACTCTGCCAGATTTAAAGTACTCAAATGATCTGAAGTCCTACCGTCAAGAAGCAGCACTTATCCGTCCTAAGTTGAGACATTCATGTGGGCGGAGAACTTAGGTGTTTTATAACTCGGTTGCTGTTTGACTACTGATCGAGTACGTTACCGCCTTATTATCGCAGTCCGTTGATGCGCCTTTCTTATGAAACCATTCTCGTGACACTGGTGTGACTTAGTCACATAGGATTGAAAGTTGAACCGTTTTAAAGCGAGGTATAATGAACAGAGATGAAGGTAAATACAATGAAAAACTACTTCCCCATGTACTAGAATGCTTAATAAATTAGCCCGAATATATGCAGATAAATGTTAGAAATAATTTCATTACTCACTTCCCCACTTTTTGGCAGAACAGACACATAGAATATTAAGCTAAGTCAGTTATTTATCTACGACAGACACACCTCTGCTACAATAGTAGGTAATTGACCTGACAATTAAATTAGAAAGCTTTATGAAGATAATGCGAGATAAACAAACTTAGAACACTTACTACGAACATGGTTTCATCATAGTAGAAAATTTAGTTTTTGTGGTGATAGACAGACAAATAGATCATTTTCTTCCTGCACATTATCGAATTTTCTGATGCCTATTACTTTAGTCCCATCGTGCCGCGACTGCAATATGAGAAAGGTCAGAGTGTTACCGAGCCAACCAAGCCAGCGATCATCCCCTATGACAAGCCCACATTTTCGTCAGCAATGGGTATGCAAATTTCGTTCCTAGAACTCCGGGTGCTATCAGTTTTATGTTAGAATGCCCGGCGAACTGCAGAGGCAAGAGAAGACAAACACATATTTAACGGTTTCATTCAAGGGTCTAATGTTGTCTAACAGGTATGGTCGTTTGAAGCAAGGAAGCACTTGAGGAATGAAGTACTTAACAGAAACTCTTTCGTAAATTATAGGAATAGATTTATGGTAGAAAGCAACGTTTCAGCACTACAGTCAGAATTTATTGAAGCAATCTAGAAACCTTATAGATTTGAATGACTTCCCCGGCATTACCTTGGCAAAGAGTTATGTATCAGTCACAACTCGAAGATTTTCAGGATCTAGAATATGATGAAGATAGAAAATTACGACTAGTACGAAGTGAACGAATACTTTTATACGAGAGGCTGTTTTACAAATCCGGTAGTACATAGCGGTCCGCATGTAATCCGGCGTAGAGTCCATGAAGAGGCTCGTTGACGTTGGCCTGCAGCAGTCCTAAATACCGTACAGTCATAGATGGTCGGTGGAGGTGTATACAATCCTGCAAATATGTAAATCGGTAGCAACTGGAATCGATCGACAGCCCACTGATACACGAGTTCTACCAGCCAGCCGCAGCTACGTTCCTGCATACGACTGTTAGGGCTCCACATATCTATAGCAACTTTATAGCGCAGAGCCAGCCACAACTCTAATTTTAATACATAATGAATGATAATAATATTACATCAGTGCAACTTGTAATAGGATTTACTATGGTTCTACAGAATCATTGCAAAGATCAAACAACTTGTATTACATTGACAGTTAAGCAGTTACTTTTACCTCTAATATATCAGCATGGAGCATGCACTATCAAATGAGAGTTGACTAAAAACCATGGGGAAGGAGCAACCATTATCGCACTTGCTCAAATGCATTGATACATATTTTACCCTGAATTATTTCGCTTGAATTTGAATCAATTCGCCAACCGCAAGACAGTTGACTTGGTCTCAAACAAACAGATTGACAGTATTTGACATTTATAAGAAGAGGTTTTAAAATGAAGGACTGATCCATTAATGAGTGGCCTATTCCCAATAGATAGAACTAGGCATTTAGAATGAATCGGTGTATAGCGGCAAGGGCCTCTTATTTCATGTACATTGAAGAAGATACCTTGAGTTGGTCAAATGAAGTATGTTAAATCCACGTATAAAGTGAGTCAGACTTGCACGACGAGATCGTCATATTTAACTGAATCATGGCTTAAATCAGACACATCTATCTCGGCCCGCAAGATTACGAATTATTCTTTACGGTAAATCTAAGTACTGAGAGTATAACTGCTGTAACTCTTACAGCCAAATAAACAATCCAAGCGGAAGTGGTCGCCATAACATTCGACTCTTTATTTGATGAAACGCCAGAATAATTATTTAAAATTAAAGATTACTCCATAAGCAAATTAGTTTAGCATGATAGTGACAATAAAGATTCCTGAAGACTTAAAGAGCGTCTAAAATAGGGCTACCCCTAACATATCACTTCGACAGAAGAGTTAGTCTACCACTTGCATACGACTTTAAAGGACGTTATCACATTCAAACATTAGCATCGTTGGTAAACAATTCCATCCAATTACTTTAATCAATACATTTGAAGATCAAGCATAATGTTTTGGCGTTGGCAGCTGACAGCCAAAAGCACTGCGAGCTGGCTTCATTTGGATATCAGGCCTGGCTACAAAAGCAGCATCTACTCAATAATCCAATACAGATAATGCCAATTATAGATGAAGACTTCAGACCGAATTATTCAACTAATAATCAAGGTATTTCATGAAGCCGTGTAGAAACGAAGAAAAACCGACTTTACAGCAGTAGCCAAACATGAACTAAAACCATATTTCCGTTCAGTCTTAAAAGGATTACAGTGGGTGTAAACACCTGAACAATTGAGTACACCATCTTCCCGCACTGCTTCCAATAATACCACAGCCTTGGATATTAAAGTCAAACTCGCTCGCAGAATTCTTTCAGACGAGCGTGCGGCTCCAAACGATTACTCCATAACAAGGGACAGCCGTATCAAGGTGCCAGTTATGTATCAACGGTTCAGCCCGATACTGTCTCCTTCCCACCGTTCCCAACGATTCTTCCTTCGATTCGATTCCAGATCTGCATCATCCAACCACTCCTTCCACATGGAGTGGCCTGGCTATGCATCAGGCTTTTGTTTCTTCCGCCTCCGGATCGAACAGTTTTCTGCATTCGTTATTCCTCATCAGTGTTGCGTTCCTTCTATTCCCTCCCGGGGATAACCCATAAATTTTCCGTAACGACTGAGTTCAGAAATAATAACGCGTCTGAGAAGCGGTCACTAGTTTTACCCCGGCTTGTCAACGCGGTACGCGCCATGCCTAACAGCCAACCTGTGCGGCCCACAATAGAGCCGCAGTATCTACTGAGTGCTGCATATAGTAAGTACTGTTTGCGGCGGCCCTTATGAGGCGGAATATGCGTCACCTTCACCAATAAATCATGATGCCTGGCCACCAGCAGATTACACTTTTATGGTCGTGGTTGTTCACCCCTTCTGAATGCCATTATGCACTCATAGTTAAATGCATGTTTTACGTTTAGGGTCGCAGCGTGACGGTATGGTGTCCGTGATTGACTAATTAAGGTAATACTGAGCACGATGATGGGGTCTAGCGCCGCAGCGGATGGCCGGCTTAGTGTAGGCGCTAGCTAAGCTCCAACTGCTGAAGGTCCCATAAGGTCTCTGGGCGCGCTCCGTAACTGTGATAATCCTGTGTAATGTCCGTTTCCAGCCTGACCGCCTCAGAACTCGTACTTTGA * tp:A:P cm:i:25 s1:i:171 s2:i:0 zd:i:2 NM:i:1437 ms:i:936 AS:i:936 nn:i:0 SA:Z:utg000001l,13123,+,111S3864M715D7988S,60,1577;
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
77 69 2048 utg000001l 13123 60 111H11M2D6M1D6M3D7M1I2M2D6M1D4M1D34M3D6M1D10M3D2M1D4M1D8M1D11M1D1M2D2M9D6M1D3M1I4M1D3M1D6M2I4M1I5M5D7M2D8M1I2M1D2M1I3M3D2M3D10M2D6M5D13M4I8M8I2M3I3M5I4M3I16M1D22M3D10M5D6M1D5M4D2M1D4M1I4M1I1M2D5M1I15M2D11M2D18M2D1M2D9M3I3M2I11M2D7M1I1M2D4M1D2M1D13M2I3M4D6M1D1M1D7M1I4M2D10M2I5M1I16M2D10M2D1M1D13M1D9M2D6M7D17M1I11M1I5M1I3M3D7M1I6M1D4M5D6M2D8M5D6M4D19M1D2M1D6M3D22M2D3M1D4M1D3M1D12M1I5M1I36M3D9M5D2M2D25M8D3M1I15M5D2M1D19M4D1M1D15M1D15M2D16M1D5M1I7M2D7M1D9M3D5M1D1M1D8M1D13M4D13M1I19M4D8M2D8M2I4M1D4M2D10M1D3M1D14M3D6M2D3M3D3M1I2M1I6M2D3M1D13M1D4M1D2M2D2M1D3M2D10M3D2M2D9M1I17M1I2M1D6M1D14M1D8M3D10M2I2M4D13M1D4M5D1M1D5M3D7M2I6M1D10M1D5M4I6M1D9M2I8M1D2M2I8M1D2M5D8M1D24M1I16M1I4M1D5M1D3M1D10M1I19M1D11M4D5M1D17M5D3M1D5M3I2M1I6M5I7M1D1M2I3M2D3M1D5M1D16M1D7M1D12M2D6M1D4M2D1M3D13M3D29M1D6M3D7M2D17M1D17M1I3M1D5M2I4M2I1M1I3M4D10M3D3M5D6M2D5M8D7M1D8M2D2M2D2M2I14M4D3M2I20M1D9M1D2M3D8M1I14M3D4M1D3M1I5M2D1M2D7M6D3M3D9M1D9M2D1M1D4M1D9M9D1M1D6M1D2M1D4M3I9M2D26M9D3M1D19M7D9M2D9M2D5M1D9M1I4M2D2M1D9M1D3M3I4M2D3M4D1M2D1M1I6M2D8M2D3M1D5M3D5M2I7M1D6M1I1M2D7M2D6M1D17M1I18M2I5M2D15M1D5M3D7M1D7M2D7M1D7M4D11M9D2M9D3M1D11M4D3M1D12M3D4M3D5M1D4M1I6M2D5M4I10M1D7M5I8M2I4M1D14M3D10M1D1M2D1M1D4M1D6M6D30M2D1M1D4M1D16M1D8M1D21M3D11M1D8M5D43M9D22M1I4M1D1M2D4M2D8M1D7M2D10M1D11M1D2M3D9M3D3M1I15M1D11M1D5M1D1M1D2M1D10M3D35M1D2M4D4M1D6M1I1M1I4M3D1M1D8M1I2M3D8M1D4M4D11M2D9M2D8M1I5M1D4M1I7M1I7M10D19M2I4M1D13M3D14M1D36M4D20M1D1M2D5M2D7M5I3M2I3M6I1M1I7M3D9M1D3M2D10M3D4M8D6M5D9M7D4M3D5M1D2M4D7M1D4M2I1M3D9M1D7M1I3M2D6M3D7M1I21M1D1M1D9M1I10M2D39M4D12M2D2M2D15M2D5M1D5M4D9M4D2M7D8M1D1M1D15M1D3M3I2M1D2M1D17M2D17M11D10M1D2M1D11M8D10M1D3M1D10M3D4M3D2M1D7M2D11M3D1M1D2M2D9M8D12M4D11M7D1M1D1M4D5M1I3M7D4M1D9M1I9M3D14M2I3M3I4M2I13M3D2M1D9M2D9M1D8M3D3M4I11M6D1M7D18M1D4M2D2M2D6M1I1M2D3M7D2M1D5M6D5M2D12M1I8M3D6M3D1M1D3M3D13M1D4M1D6M2D9M3D3M1D2M3D9M1D7M1D11M2D1M2D6M2D4M2D5M1D15M4I7M3D7M1I4M2D8M7D13M1D2M1D4M1D10M4D6M4D10M3D2M1D16M3D9M2I4M2D1M2D3M2D11M2D5M7D8M3D5M1I3M1I7M1D5M2I4M3D5M1D1M2D3M1D6M1I2M2D5M1D15M1D11M1I13M3D1M1D11M1I10M1D2M2I9M14D2M1D8M1I3M2D3M2D3M7D11M3D7M1D24M2I4M2I4M3I12M2D9M5D17M1I6M3I2M2D20M1I4M1D9M1D18M1D8M4D4M1I17M7988H * 0 0 TCCCTTCCATCGAAAAGTTTGTTCACACCACAGCTCAATGATCACCAATGTATGGGAATTGTTTTTATGATACTACATTCCTGCTTCATTAAGTGGCACAAACCATAATTGCTCTTCTTGGACAGCTGCACTTTACGCTTAATGGCCAGCATTTATCGTTTCCATCTTAAACTGCGCGTCCTGCTGGCATTATGATAAGCACATGACGAGCCTCTTAGCGGAATGCGCTCGGTGCCGCAGGTCCAGCAAAGAGACTGAAAGATGCCACACATGAGGATTACCGATTCTCATGACATATTCAGTTACCGGCCGAAGTCTAATGAGATAACGATCATATACATGGTTCTCCAGAGGTTCATTACTGAACACTCGTTAGAATAACGATCAGTGCGGTTCGGTTTCTACTCATCAAACTTACGGTTGTAATAGTTCTTAATTTCTCGGCTGTAGGGGTCACGAGAACGGAAGGCTCGCTGGTCTTCCAAGACGCTCAATGGTCACCGCAATCCACTTTTAAGGTGATATGGAAGAATTTGAAGAGTCCGGAATATCACCCGCGCCGTGATATGGAACAATACCAGACTTAGTACCCACTATTAATCAAGTGGACAATTCAAGGGATGAAGCATGCCTGCAATCGGAATGCATGGTTACTGAGAAATGTTCCTGTAATGGAAAGATGGGGAAATAGTTAGATAAATGGGCAGTACGAACGACGATGATTGCCACCGTAAACAGAACAACAAATCTATCTCCTGTTATTTTTGCAGCATACGAATAAACACTGCACTGTGCTTCCAACGAGTACATCACGGAGCAATGTCGCTCGTAACTAAACAGGCCTAACTTGTCCTTGATCGGAATCTTCTTCCTACGATCAGGGCGATTTATCTGCGACCGAACAGATGTCAAAACATCAAATAAGTTGATTACGACCGAAGCAGCATGATAGAATTATGAAATCGACATACGTAATGACAGAGAGACTTCCATAATTACATTTCTGGTCACTCTGAATAGCACTCATACTGGCTGTATTAAAGCTATTAATCAGTGCCTCCGCAAGAGCCTGCTGGTAGCATTTCAAGCGACTTAATGCATATGTTATGAGTTCGGGACTGGAATGATGGAATACTTTAAGAAAGGGAATAGACCCGCTCCATGAGCGAAGCCAGGAATAGAATTACCGGGCTGGCCAACCGGCCAGGAATATTTGATTCAGATGAGCTCACTATCAAGCTCGCGCCTGAGTGCGTTTTGATCGCAGCCGACACCCTTCACTCGCAGGCGTTTTCGTTATGTATAATAAGGAGCACATGCATATGCGCTTGCAGGCTGTCCTGGCTTATGCCCTTCCACGCGGGGTCTTTGAACTAACAATCACCGTAAGTGGCGTGACGCTGGAAGCCTTATCGACATACTTAATCAGGGAGTCTCAAAGAATGGATCAAACACTTATGGCTATCCAGGCCAATTCATCGCCATTTATTGGCGATGAAAGTGTTTCGTGAAGCCGTCGGACCTTATAAAAATCAGTGATATACTGAAGTGAGTACGGCAGGATCGCCGGTCTATTTCCGTGCCTCCAGCATTTCGCGGTGAATTTTCACAGCTATTTCAGGAGTTCAGCCATAATCCCCTTCGCGGTGCTTCTTAAGCGGACTGAGTCGCCCATAAGCTCATGCGAAGAGAATATGAAGCGGCAGACATGTGACGCCCCAGCACCTGTCGTTGAATCCTGCATCGATCATTTGCAACGCCACGCTAAATCCATTACCCGTGCGTTTGGCCCGACGGTGTTTCAGTTTGCCCGCATGGCAGAACAATTACATGCTGTCCATGGAAATTAAGCCAGGTCTATCCTTTACGAGGTAAACGGCAACCGATACTGCACTCGCAACGCTGGCTGGAAGCTGGCTGAACGTCGCATCCATTCTTTGGGCCCGCATGACAACTTCTAAGCGTCCTATTCAGACGCTTTAAAGGCTTTCACCATGCGTAATCATAGCAGTGTAGGCCTTAATCCGGTTGCCCAAGCAGTTACGTTCCTCCACTCAGAAGTGGCATCGTTCGTTCCGGTGAATTGAATCTCTGGCTGGTGGGCCGAGCTCGGCAATGAAGAGCAGTTTGTAGCATGACGTTGGACAATGAATCCTATCGATCCCGGATTTGCCCGCAGGACCGTAATCATCCGATCTGCGTGCCGAGTGAACCTCCTGAATGCCGCGAACGCTTCAAACTCGAAGGCAGGGAAATCGCGCCGTGGATCCGCATCCCAAACGCTTTACGTCACCCCGGCCTCCTTCGAGTGGCGTCGCCTTCGATTGCTGGTATCTATGACAGGATGAAGCCAGCGCATTGTCCATCACTGCAGCCACTGCAGAACGTCAGCCGAATGGCACTCTACAGTTGACGATGAAACCATGCAGGATACTAACACTCTGCTATCTCCGCTAAAGAGCCCGTACGACGTACTTGCCGCTCTTTCCATCTTTCGCCGCGACATTCGTGCAGCGTCAGAACTGACGATGGACGCAACAGTAATTGCTTCCTGAAACAGAATGAGCCCAGCACAGAAGGTAGCAGCATGACAGCTAAATTATCCTGCAGCGATGGGGGATGGCCGGTGAGGTCGAACAGGGATGGTCCCTGCCAATCGCCTCGAGGTTGCGCCTCATACTAGCGTCAACGCCTTCGCAGTCGCCGTGAAAGCCAACCGGAAGACCTGAAATGTCTATTCCAACGCCGCTGTGAGCAGTGCGCCCCTTGACTATCGAATCTCCCACCCACTGAGCCTGGGGGAAACAGTACGCGACGACGCCAGAACCCTGTTTCGATTCACTTCCGGCGTGAATGTTACTGAATCCCCGATCATGGACGCGACGAAGGTGCGTGACGCCTGCTCCCATGGTTTATCGATGAAAATCGGACGCGTGCCCGTTTGACTCCGAATCCGGTTTCATGAAGTTCGATCGCTCGGTGGTTTCCCGTAAAGTCAGCTTACATGGCCCCTGGCAGTATCGCCGCTGTGACTGTAGAAAATGCCTGGTTTTGCCAACTATACGCGTATGAAGCGTGAAGGCCTGCATTATGTCGGGCCGGAGGCGACATGAGATTTTGTAGGTCCCCAATCGTGCCGGAGTTGCCATCACCGAAGCTGACGCACGGCATGCTGAAATTGGTTTGTATTTGGGGAGCAATGGCAAACGCATCCTCAACTATCTAGGCCGCAATCACTTTCGTGCTCCGTTCGAGGAGCCTTTCCGCTCGTCTTTGACTCCCGGATCTCAAGTAGCGGCGCGCTAGGTAATAAGAATAAGCTAGGGTCTGCACGCATCTTCTTTGAGTTAGAACGAGTATGAGATGGCACTTGCTCAATTGGAATCAGGTTACGAGGCGCGCGCGCGCGCAGTAGAAACGACGAATTTCGACCTTCACCGCTCCTTTCACACTGGAATATGGCTCGAGCGAAGCAGATGAGAAACGATATGACATGGCCAGTGCGTCCTGGCAGCGCTTCGGGTCGTTCTTGCATGATCATCGGATTGTTCATAATACCGCTAGGAAGCCCTTCTGCACGCTTTGCCGTCAGGCGCTTCTGCAATGAAAAAGCCAGACACCGTTTCCGGATAAAAACCTTTAGACCCATTTGCCGTGAGAAGCACTCGCATCTAAACAGGCGTCACGGACCCGGTTAAGCCACTGACGCGATCAGCAATTCCTCACTGACGGGACGGCGTCTTTGAAACGATGGCACAGTGTAATAATCAGGGGAGCGATAGCCTTTTATTATTCGCATTCACCCTCATCCTTGTATGACCAACAGTTCAGGGATCATGAAAGCAGAAGATGCTTGATTCAGCA * tp:A:P cm:i:22 s1:i:150 s2:i:0 zd:i:1 NM:i:1577 ms:i:562 AS:i:368 nn:i:0 SA:Z:utg000001l,20706,+,6775S4244M152D944S,60,1437;
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
78 70 0 utg000001l 24064 60 76S12M2I9M2I5M1D25M1I4M2I10M1D21M1D18M1I17M1I25M3I28M1D13M1I6M2D2M1D2M1I8M6I8M3I7M3D2M3D5M1I5M3I2M1I7M2I2M1D2M1D8M1D11M1I6M1I8M2I5M2I1M2I13M1I4M1I7M8I9M2I39M1D4M2D27M2I16M1I17M1D5M1I1M3I22M2D8M1I33M2I6M2I4M1D5M1I11M3I3M5I18M4D10M7I1M1I9M2I2M1I21M2I4M1D5M3D13M1I2M1I7M1I8M3D4M2I2M1D8M2I16M2I7M1D10M1D15M3I8M1I7M1I3M1I3M2I9M1D3M1D10M1I3M1I4M1D20M10I3M1I4M1D6M3I9M1D28M2D7M8I14M1I4M1I8M1I4M2I12M1D2M1D5M1D46M2I15M1I13M2I1M4I2M2D4M2I2M1I5M4D2M1I3M1D1M1D10M1I9M1I19M2I12M2I1M1I6M1D2M2I26M4D6M1D15M2I32M2I11M1D5M1I25M2D4M1D4M1I14M3I1M1I4M2I6M1I11M1D4M1D1M1D11M2I4M2I22M4I17M1I13M1D4M5I1M1I6M1I5M1I1M1I8M1I46M2I2M1I7M1I4M1I8M3I1M6I10M2I1M1D8M5D7M3I8M1I2M3I3M1I11M4D6M1I5M1I11M1I29M1D1M2I7M2D5M1I9M2D1M1I13M2I29M4I11M1D19M1I7M7I1M1I9M1D21M2I1M1I8M4I2M5I4M2I6M4D2M2D7M2D4M1I9M3I6M1I1M2I10M1D4M2D5M2I5M1I1M2I5M2I5M1I18M1I17M3I16M2I42M3I4M1D9M1D2M1I7M1D14M1I2M2D13M5D10M1D3M6D5M1I3M4I5M2I3M1D8M1I8M1I2M1I7M3D1M1I2M1I2M1D6M3I2M2I2M3I8M1D14M1D13M1I23M1I29M1I11M1I7M1D13M1D10M1D5M2D27M3I2M1D11M1D27M4I4M1D3M1D4M1I14M3I3M2I3M2D2M1D6M2D6M1I1M2I2M3I14M2D3M1I6M2I26M3I4M2I6M5I18M1I2M2D8M2I19M4I3M1I5M4D15M3D6M2I11M2D8M2D2M1I2M2D5M2I17M1I8M1D15M1D5M1I2M1I2M4I1M4I2M1I19M1D18M2D9M1D3M2D2M3I6M5I11M3D7M4I3M1I1M2D7M3I25M1D1M1D8M3D6M2I11M3I17M4I1M1I1M1I4M2I12M1I1M2I33M1I13M2I22M4I1M1I4M1I7M1I1M2D6M8I2M3I6M3D12M2D8M1D15M1I3M1I8M1D4M2D4M1D14M2I15M1D7M2I22M3D6M6I3M2I4M3I14M1I2M1I3M2I16M2D17M1I9M1D6M1I20M2D5M1D12M1D3M1D15M1D7M4D7M1D3M1D5M2I3M1I4M2I9M1D4M1I2M2D5M5I25M1I33M1D5M2D5M2I28M2D4M1D16M1I21M1D11M1I9M2I2M2D10M8D10M5I3M1I3M4I10M2D3M1D3M4D20M1I12M1D3M2I21M3I20M5I2M1I30M2I1M1I14M1I15M4I2M3I7M3D7M1D17M2D44M1D5M3I4M1I18M1D1M3D8M1D35M1I6M3D10M3D8M1I11M5I14M5D16M3D4M1I5M4D5M1I4M1I6M2D9M2D4M3D14M1D7M3I5M1D7M1I7M1D61M4D11M2I6M1I11M1I5M2D14M1I27M1I2M2D8M1D10M1I6M1D3M1D19M1I8M2D3M1I3M1D4M2D4M1I12M1D2M1I6M1I14M3I18M1D10M1D14M1D5M1D3M1D7M2D7M3D7M3D20M1I11M1I9M1I28M1D11M2I3M2D7M1I22M1I5M1D7M1I3M3I12M1D6M6D8M1D6M2D1M1I10M5I2M3I6M1D3M2I2M1D11M1I6M2I9M4I9M1I29M1D37M4I14M1I13M2D1M1D4M2D7M1I17M1D13M1D4M1D5M1D10M1I11M1I6M1D5M1I4M1I10M3I12M1D4M1D9M4I28M3I7M1I14M2I3M2I5M1I37M6I4M1I4M2I5M4I3M1I5M1D12M1I2M2D5M1I9M1D2M1I19M2I14M2D18M2I6M4I6M2D2M3D4M1I15M4I4M4D4M1I5M2D6M1I2M1I2M3I18M2D7M2D3M1I6M2D2M2I26M2I9M1I6M1I17M8I4M1D6M3I9M2D5M2I21M3I23M1I2M1D3M2I4M1D2M1D10M1I6M1I3M1I24M1D19M1I21M2D3M2I2M1D11M3I28M1I3M2I15M1D9M2D7M1I10M1I2M2I7M1I17M5D16M1I4M2I4M1I10M1I8M1D1M1D10M3D13M1I10M2I2M1D9M1D11M4D16M1I15M1I12M2I2M1D1M2D3M1D3M1D8M7I16M3D2M6I3M1D7M3I3M1I6M1D3M7D2M1D6M1I6M1D7M4D25M1D2M1D4M1I18M1D13M1I17M1I18M2I9M1I2M1I16M1D13M2I7M2D4M1I15M2I10M1D6M1I13M2I1M1I9M1D9M1I41M3D8M3I11M1I3M1I13M1D4M1D13M1D3M2D5M3I17M1D3M2I1M1I4M1D6M1I2M1D1M1D4M1D3M1D2M1I18M1D12M2I40M1D1M1D21M1I9M1I4M1D3M3D1M1D3M1I16M1I21M2I6M2D13M4D7M1I1M1I2M1I8M2I4M5I3M1I7M2D2M2D22M1D2M1D1M1D5M1D29M1D10M1D1M2I10M2D6M2I16M1D24M2D7M2D8M1I34M1D13M3I20M2I1M1I28M4I29M1I4M1I5M2I1M1I3M1I2M2D3M3D5M3D28M2I26M2I14M1D3M1D1M2D16M2I13M1D19M1I6M2I5M4I7M1I3M1I8M3D6M1I10M1I2M2I4M2I4M1I5M1I7M2D5M5I11M1I15M4D13M1D5M1D5M2D1M1D9M1D3M3I8M1D1M1D9M1D8M1D35M1D11M1D10M1I25M1I15M1D3M1I23M2I5M1I11M1D1M1D6M1I5M1D11M1D2M1D3M1I8M1D11M2I1M1I2M1I9M1I7M2D10M2D7M2D1M2D8M1I5M1D39M1D1M1D34M1D6M2D6M4I10M1D6M1I3M2I7M1I2M2D16M4I25M4I10M1I3M2D10M4I1M1I5M3D4M1D12M3I4M1D5M2D4M1D5M2I1M4I1M1D13M3I5M4I3M1D31M1I7M2D3M1D4M4D2M1I3M3D20M1I6M1I3M1I4M3I12M2D3M2D12M2D4M3D6M2I9M1D16M1I4M1I7M1D16M1I16M1I3M2D1M1I9M2I12M1I8M1I14M1I5M1I1M3D1M1D3M2I3M2D7M1D14M2I3M1I17M3D1M1D12M8I8M4I4M4D11M2I9M1I5M1D9M2I5M1D6M1D4M2D2M3D6M1I14M3D2M1I2M1I8M2D4M1D1M2D11M1I11M2D7M1D12M1D33M1I3M2I14M2I18M1D3M2D16M5D3M2I8M1I10M1I4M3D1M1D1M2D4M1D4M1I11M2I2M2D8M5I7M1I2M1D1M1D15M1D8M1D1M3I8M1D5M1I13M2D3M1I2M4I13M1I3M2I9M4I9M2D13M4I5M2I4M2D6M3I3M1D6M1I1M2D4M1I9M1D22M1D3M1D36M2D25M16S * 0 0 CCCATTTTCTTTTAGTGCTCTTGCGCCGTGCTTACTGGTTTATCTCGAGATATGCCGCGTTATCGCGCACTTGCTCAAATGCTGCATTGATACATATTTTGACCCTGAATTATTTCGCTTGAATTTGAATCAATTCCTCCAAACCGCAGAACAGTAACATTTATTATTCAAACAAAACCAGATTATAGGATATGACATTTGGTATAACAATAATGTTATTGAAAATGGAAAATGATGATCCATTAATGGCTTGGCTAAATTCCGCAATACGATAGAAAAACAAGGCGATTTAGAAATGTATAGCGAGGCAAAGAGAGGCGCCCTGAGTGCACCCGATAGGAAGAAGCAGAAGTGGAGTTATTAAATGAAAGTATGTTAAACATTGGTATAAAAGTTAGTAGTCAGACTTGCAAAAGAAATTAGCTTCAGTTTAACTGAATCATATCTATTATTAAATCAGAAAGACGATGGGTCGCTAATACCTAAAGATTACGAATTATTACATGCCTTAGCTATAATCTATGGCAGAATCGTATAACTGCTGTAACTGTGGCGACCGTATTAAGATGCGTTCCAATCATCGCCTTGATTTCGCCAACATCATTCGACTCTTTATTTGATGATGAAACAGGAGAATACTTATTTAAAATTAAATTCCATTACTCCATAAGCAAATTGTCATTTAGCATGATACAATATTATGACAATAAATGATGAATTCCTGAAAATATTAAAGAGCGTCTAAACTGATAAGCCTAAAATATCACTTCGACAGAAGAGTTAGTTGACTATACAGCCAAGCTTGCAGAAACGACTTTTTAAAGGACGGTTATCACATTCAATCATTAATCTTTTATGATAAACAATTCCATCCAATTGATTTAATCAATACAACATTTGAAATCAAGCAGATAAATATATTTGGCGGTGGGAGCAGAGGCCGAAGAGAGCCAAAGAAACAAATGCGAGGGGTCCCATTTGGATATCAGAGCTATGAGAAAATACCGCAGCAAGCATCTACTCCAATAAACCAATACATACAATGCCCATTATAGTGAAGACTTCAGGTAATTGGAATTGATTCAAATAATAATCAAATGTATTTCATGGGGAAAATAGTTAGAGAAAACGCAGGCAGGGCTCGGCACTAGATTCGCATATCGCTAGATAAACATGACGAAAAACCATATTTCATGCGTTCAGTCTTAAAGGCAATTGGCGGTGATGTAAACACTACGAACACGTGAGTCATAGAACTTTCCAGGTTCTCCTGAAGATAATAATCGCCAAATAAACCAATACTCAGCTTTACAATATACTAACTAACCGCAGAACGTTTATTTCATACAACGTTTCTGCGGCATCAAAACGATTACTCCATAACAATTGTAGACCAAGCAGGCCACTCAATATCAGGTGCAGTTGATGTATCAACACGGTTCAGCAACACCGATACTCTTCTTCCAGGCTTCCAGCAACGAGGTTTCTTCCTTCGTGCGTTGGCACTCCAGATCTGCATGACCTCCGGACACGGCGCAATATGCTCACTGGCTACCTGCATCAGGCTTTTTGTTTCTTCCGCCCCCGAGATCGAAAGAGTGTGCCTGGCCGGTGGCGAGCCTCCGTCGCCGAGCCGTTGCCGTTTCCACTTCTGCTTATTCCCCTCCCGGGGTAACCATCCTAGATTTTCCGTAACGGACCGGGGTTCAGAAATAAAATAACGCGTCTACAGAAGCCGTCATAGACGGTTTACCCCGATGGTCTTCTAACGAGATGCCACGATGCCTCATCACTGTTAACGAAAACAGCCACAAAGCCAGCCGGAATATATCGCGGTGCAATATCGGTACTGTTTGCAGGCAGACCGTATGAGAGGCGGAATATATGCGTCACCTTCACCAATAAATTCATTAGTTCAGGCCAGCAGATTATAATTTTATGGTCCGTGGTTGTTCACTCATTCTGAATGCCATTATGCAAGCCTCACAATATAGTTAAATGCAATGTTTTGACGGTGTTTTCCCGTTACCTCCCGCAGCGTTAACGGTATGGTGTCCGTGTGAACCAATACTGAAAGAATGGGCATGAGCACACCGATACGACTGGATGCCTGGTGCCACCAATACCAACTGTATGCGCATGTGCAGGGCACTCACGGCTGTACCGCTGGACAAATGAGTACTTAGCTGCCTTGACTGTCACGTTTCGCTCGCGCGAGGAGACGCATCTCAGTGCCGTGCTTCCCTAACGGGCGTAAACTTCCTGTAATGGTTTGCTGTTCCATACTGACTCCAGCCCAGAACTGTTCATCCTTAAACCATGTGTGTGGCATGAGCACCCGCGGCCCCTGTTGAACCGCTCAGACTGTGAGCATGAGCCCCCGTGTTATTCGTCGATTTGTCCGTACGTAATTGAAACTGCCTGTTGTTTTCGTCCCCGTAATCAAACGACGACTTGGTTTTCGTCCCCAAATCCGTACCGGATGCTGCACTGGCACTGTGGGTGCGGTGCGACTTAATTCCATCCCTGTTCCTGAGACAATACAGCACGACCGCTGGCGGGTTTTCCCTTGATTGTCCCCTCTAGCGCATATCAGGAAGCACCCGATGGGGATACGCGACAGCAAGTTTTGGGTAGGCTGATTGTCAAACGCCTGCCCCTGCATCAGGTGACGCCTCAGAACGACGTATGATGCCACGGGATCGGCGCACCTGCCGGAAGGTGAATTCAGCCATCGGCTCCGAGTAATTGCCAATGATACTGCAACGGAATTTTTCAGAATATCCCTGCCAACCTGTCAGTTCAGGAGTGGAAGCGGCAGAAGGAAGAGTGCCGAAAAGAAGGATCGTACAATCTTAGAATCTCTTTCGAACTCCTTCACTGGGCGCCGTCAGTCGCATTCTTCGGTTGTTTACCCGCAAGCGCGTTAGTCATGGTGTAGCATAAATCTGGATCATTCCCGAGCTGCGGCCAGTTCATTCAGCGTATTCAGTGCGTCAAGGTGACGCGTCGATAACATCTGCAATCGCGGCCAGTGATACAAAGCGGTGTTCGCAATCTGGTATTGTTTGTTCCTGAGCGCGGTTGGTGCTGTTGGCGTTCCGGGTCAGTGCCGACTGTCCAGTGGGCTTTCTTCGTTCATCCATTACCACCTTAACCGCTTTGGCGTGCAGCAAGGCGTTTCAGACGTGCTGTTGGTTGCACTGCTGAGCTGCACTATCCGCCCCTTTCTCGTTGTCCGCATCCTCAAGCGCGACAGCTGAAGCTATATCTTGCACGTTTTGCCGAATTTGCACCGTATTGCCGCCGCTTCTGCCGCACTTTGCTCTGCGATGCTGATACCGAGCTTCCCACGAGCTCCTCCTTCGCTCCGGCTGGAATGCAGCGCCGAAGCCGCCGCTGTTTGCGTCTCGCGAGCAGAGGGAGGTGGGGCGTTCCGCTGCTGTTTCAGATGACCTGGCATTCGTCTCGCACGTTTGCCGCCCTGGCAGAATTTCTGCCGCCGTTGCCGGAAGCTGCACGACCGGCACTTGATGATGCGTTCGTTTCTGATGATTTTGCTGCCTCTTTGAGGCCACCGCATCTCGTGAAGTGGCGGCGGCCTCTAACGGGTGGCTTTCGTGGCCGTGGAGGCAGACGTGGCGGCTGATTGTTGTGACGCTGCATCGCATTCGGTTTCTGACGTTTTCGCCGCACCGGCACTGGCCGCCGGAGTTTTGGGGACTCTGCGGCTGCGGCACTTTTCCGCTCGTGCCGTGGCCTTTGCTGATGCCGCTTCTGCGCCGGAGGACCCTTCCTGAGCTGACGATGCAGCCTGTCCGGCGCGGACGTGCTGGCGGCGCGTGCTGGCTTAGTTGCATCAGTCACGGGGCCATCGGGTACCTGAGCAGCTGATGCAGGGCATCGCCGGCTGATTTCTTCGCGTCTGCCGTACTCTGTGCCTACGACGGCGTTACGCGCCTTTGCGCGAGACGAATGCCCCGGAACCCGACGCAGCAGGCAGCGACTCGATTCTCCGTTCATGAGGGGCAAATGAAATGCCGTCCCCGTTGAATCTTCATACACGGTATGGTCCCGGCGTGCATCTTGGAGTGGAAACGTCATACTGCAGGATGACACTGTACTGACCGTACTCCACATCCATGCTGTAACGCCCGGCTTCATCCGGATTCTCTGAGCCCACCGTGTTCTACCACCCGTGGTGCTGTTACCGTCGGCCTTTCAGCTGAATGGTGGAGTTCTGTACCGGTTTTCCTGTGCCGTCTTTCAGACTCCTGAAATCTTTACTGCCATATTCGCCAGCAAAAGCACCGGTTCCGTGGAGCGTCCACCACTGTGTTACCTGGCTAATGATCAGAATTTATAACCGACCCAACGATGAATCCGTCCGTACGCAGTCTCATGCCGCCAGCCTTCAGCAATAACAACGACGGACGCTGCCGGCATTAATCTGTATACTGCACTCTCCACGCCACTGAGGTATGCCGCATTGCATTTCGTCCCTGGCAGTGGTCGTCTCTTTCGGCCCGGGGAGTGATTTCCGTCTTACGGTAGATCGGGCATTGTACTGCCGACCACTGAAAGCCTCCTCCGCGCGAACGCGCAGGGATGCGCGCCGGCGACCATGTTTGTAAAACCGGTCCGGCCATCACGCTCACATAACGTCCACGGCAGGCTCAGGTGAAACGTATCCTCCCCGGTCATCACTGTGCTGCTCGTTTCGACGCGGCGAAGCGAACCAGGGAAGCCAACGGCCCCCACACTGTCCCGTTCAACGGTACTTCACGTTAATCCCTTCGATGACTCACACCGTATCCCGCCGACAACGACGGCAATGTACCCGGTTTCATTGAAGACTACGCCACCGTAAACGACGTACCATGTCCTTCCGCACGGGCCGCGCGGAGTAACTGTCACCGCAAGTGCGGCAAAGAAGACAGCAACGGCAATACACAAGTCACTCACATCCGTTCCTCTCACTGTTTATAATAAACGCCCGTTCCCGTCCCACGAGGTGAACCTCTGTAACACACTCAGACCACGCTGATGCCCAGCGCCCTATTTCTTAGTACGCCATAACTGCGCATCGCTGGCAAACGTATACGGCGGAATATCTGCCGAATGCCGTGTGGACGTAAGCGTCGAACGTCAGGATCACGTTTCCCGAACTGAGGCGCCTGGCGTGGATACAGGCGATGCGATCGCGATTCCTTCCTCCTCCCCGAGCGAGCAAGCCAAGCACCGTTCATCAGTACTTTCAGATAACACATCGAATACGTTGTCCCTGCCTATGACAGTGCTTGATTCAGGCCTCCTCCGGGTAGAAACGTCAGCGGAAAGCAGCACTATCTGGCGATCAATAAAGGATGGTCATCGGTCACGGTAGAAGTCCACGGGTCCTGACGGCCAGTCCACATGCTTTTCACGCCTGGCTAGGAAAAGCCCGCTCGCCGCCTTTACAATGTCCCCGACGATTTTCCGCCCTCATCCGTACCGTTTATCGTACAGTTTTCAGCTATCGTCACATTACTCATCCGTCCCCGGAGTTCGCATTCACACTGCCACTGATATCCCGGTTTTAGCGGTCAGCTTTCAGCGTCCCTGTTAGGAAAGGCCGGAGGATTGCCATCGCCTAGTAGATGGGTGGGGGCCGTCAGGCAGCTTCAGGAACACGTCGTTCATGAATATCTGGTTGCTCCCTGCGCCAAACATCGGCGTTTCATTCCCGTTTGCCGGGTCAATAAATGCGATTACGATTGGCGGCAACCGACCAGAACTGTAGACGCTCAGTTTGCCTTCCTCCGTGTCCTCCATGCCTCCGGCGCTCCCGCTACCTGACTTCCGTCTGTTGGTCTGTACGAACCCCAAGAGGGATGCGATAGCCTACAAGGCAATCCTTCCACTCTGTTCGAAGCTCCTCCAGTGTTGCTTGGCGTTATCCTCCGTCAGCTCGACTTTTCCATAGCAGCTCCTTGCCCTAGATGGGATTCAGTCTCTTGCCTTTGGAAAAATCCAGGTGACCTTCCGCATCATCTAGCCCGACCGACGACGGCCTCCACGGAATGCAGCAATTGCCAACGTGTTCACACTGCGGATATAAAGTAATAATCATGGCCCGGTTTGATATTGATGGCGGCTATCCAGTACAGCGCTAGTCCATCAAGATAACGCGTGCCTGGTTTCAACCGTCTGATATCCGCAATCTGCTTTTCCTAAGAACCAGAACCAAACTGTACCGTCCGTATAAACGGCAAGATGCGGCGTGGCGGTTATCTGGAAAATAGCCCGGCGTCAGCTCAATCCTCGACGGTGCTGCCGGTGCGGCAATCCGGAACCGATACCGACGGATGTACGCCTTGCTGCCCCCACGCATTTACCGCCCGGACTGTCAGCCTGTAGTTCCCCAGCGCCAGTTGCGTGAAGCGGTATGTGATGCGTTGTAGAATCGTACCAGCCGAGGATTGCACTCGGCGCGGGGCCGTCGTCCACGTCGCGTCGCCTCAGCATTCCGCTCACGCCCTTCGCCCCTTCGGTGTGTCCCATCGCCCCCTCATGATATTCCCGCTGTCTGCATGACTTCTGCGGTCAGGTGCTGCAGCTGGCGGCGTGACACCCATTCACCGTGCCACTCTGTTCGCCGTCAAAGTGCGCCCCGTTATCTAGATTATGGCCTCTTTTCCGGCTAATCCTGCTGCACGGCGGTGATGGCATCCGTTAGAGCGTCGTCGTTCTCACGATACTGACGCATAGAACAGTCGCATGAGGCAGCGTCGGCAGCTTCAGCTCCCATACGCTGTATTCAGCAACACCGTCAGGAACACGGCTCATTTACCTTTTCACGCCGTCGGTGACGGACCCTCCACGCTGACCGCGGATTGCCACTTGCGTCAACCAGGCTTATCACGCCCGGTATACCGGAGAGATGGCAGCGTACACTTCACGACGGTCCAGCGTCGGGAGCGTCGGGTCTGGCTTGTTCACCGCCAGAAGCACGACCCGGTGCTGATACCGGCATAGTCATCATCGCAGATTTCAATAACACGCGCCGAATACCGGGGAACCCCGATGCCTCCCGAAGCTGAAATCCACGTCTGCGTTTCCAGCAGTTCTTTCTGCCATCCGCCCAGCCCGGCGCGGTGTGCCTGCCCCCGGCTGGTACAGCCAAGGGCATCCATCTTCGTAACAGTCGACCGTAACGGGCAATGGCCTGCGTATCTTCAACAGCTCTGTCTCTGCCGTCTCCCAGCCGTTGTTCGGGTCAACCGAGTTCACTCAACGAAATGGTAATAGGCGGCTTTATCTTCAGGGCGCTGAAGCTGTAGCGGAACGGCGCGCCATCAATGAGGCATCACCACATTACTTGAGTTATAGGTCCACTTTATCCGACGGTCGGTCCTGCACGAACGTCAGTGGTGCCCGTTCCATACCGGCATACAGCGCATCGCCGAGCAGAAATCAGCCCCACATCCACGCCTTACTGACGCTGTGGTCAGGTGAGCATTACAGGTGGGTGATGCGCGGCTCCCCGTCCCGCCAAAGCCGTCCGGCACTGACTGGTCGGCCCAATCTATCAGGAATACATGCGGGGCCCATTTATCCCAAGCTTAGCCGCCGCACCAAGACGTTCTCCCCATGCCGTAGCGGATGGAGTGGAAGCCCAAGAAGAGACTTATTGAGGTATGCCGGTTTAAACGTTCCGTCCCGACAGATACCGCTGTATTGCCGTCTTGAGGGTCAGTAGGGCACGCCTGCGCCGATACGCCGCCGGAGGTGGGTAGGTTGCCGGCTCTAGCTGCTGGCTGCCGAACTGCAGCGAGTCCACCTGCACGCCGACCAGTGCCGTGTTCGGTAGCACTGTTCTACATCGATGATTTCAGTGTATGACGACCAGAGCGTTTGTTCTGCAGCTGGTCTGTGGTGCTGTCCGGCGTCATCCTGCGCATCCTTGGAGCAGGATATTAAGCCAAACGCGCGGCGGCAGGTCTACCCATCACACCAGGCCAGATGCTCTGCAGGTGGTTGAGCTGTAATGGTGATGTCTTTTCTCGTTACCCAGCCACCGTTACGTTGTATCTGAAACCAGCAGGCGACTTCCGACGGATTCCTGTCACCCTTTGAGGTGGTTTCCACCAGTGCCTGTACACCGACCATAGAAGGGGCAGACGGTCGATGTTTGCAGACGTAATGGTGCGGGTGAATTGTCATATTTCACATGCCGAGCCCGAGAATTAGCCGAGGAATGCGATTCCCGATCCGCAGGGCTTTATTGCTCCTAGCCCCAGCCCGGAACACCACCGTGACACCGGATATGTTGTATTCCCCTCAGTGTCCCAGCATCCATTCGGCTCTTTCCTCATGCAGCGCGCCGTTGCACTCATCCAAGCGACCTTCAATCGTAGTGCGCTGATGGCGGTGGCACAATCACCACACTCAGCTAACTGCGTGGACTTCAGCTTGTCCTTCATTCCTAGCGGGGTCCCTTACTGCTTCCTTTACCCATTCCTCACTCCATAAATGACAAAACCGCCGCATAGCGGTTTGGTTTAT * tp:A:P cm:i:119 s1:i:1131 s2:i:0 NM:i:2370 ms:i:3658 AS:i:3658 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
79 71 0 utg000001l 27909 60 25S4M1I7M4D11M2I6M1I18M4I4M1D13M1D12M1I10M1I2M1I7M1I3M3D8M1I6M1D14M1I9M1I8M2D4M2D5M2D4M1I5M1D3M1I7M1D4M2I22M3D18M1D19M6D1M1D32M2I24M2I10M1D10M1D3M2D24M2I3M2D4M6I14M1I6M1I5M1I5M1D24M2D2M2D4M3D3M3I4M1I7M2D5M1I3M1D33M2I9M3I38M1D30M1I5M2I8M1I25M1D5M1D6M1I15M4I8M1I2M1I2M2I9M1D16M1I3M2I14M1D14M1I34M1I4M1D25M2I2M1D12M1I4M1D22M1I23M1D9M2I3M1I5M1D5M1D11M2D2M1D16M1I14M4I3M1I11M2D17M336S * 0 0 TTTGATGGCGTCCTTACCTTATGTTTAACTGCCCGGCTTCATCCGGATTCTCTGAGCCCACCGTGTTCACCACCACAATCCGTAAGCTGTTACGTCGGCTTTCAGCTGAAATGGTGCAGTTCTGTAGTACTCAGTTCCTGTGCCGTCTTTCAGGACTCCTGAACATCTTTACTGCCATATTCACCCCAAAGCACCGGTTCCGGCGGGCTGTCTAGCCTGTGTTACCTGGCTAATCAGAATTAACCGATCCCAACGATGAATCCGTCCGTACGCCAGTTCCTTCCATGCCTTCATAAGCAATATGGACAACAGGACGGACGCTGCCGGATTAATCTGTATACCTGCACTCCACGCCACTAGGTGCCGCATTGCACTTTCGTCCCTGGCAGTGGTCGCGTTAGTCCTTTCATACCCGGGGAGTGGATTTCCGTCTTACGGTAATCGGATGTACTGCCGGCAGACTTGACTCGCTAGCCGGCCAGTGAATCACCAGACCTGCTTACTGATTTGTAAAACCGGTCGGCCATCACGCTCAATAACGTCCACGCAGGCTCAGGTGAAACGTATCCTCCCCGGTCATCACTGTGCTGCTCTTTTCGACGGGGTGAAATCCCCAGGGAACCCCATCATCCCCACACTGTCCGTCACTCATACGGTACTTCACGTTAATCCCTTTCGTCAGATGACCTACACTCACCGGTATCCCGCCCGACAACGACGGCAAGATGGCCCGGTTTCATTGAAAGTAGCCCACCGTAAACGTACCATGTCCCTTTCCGCACGGGCTGAGAGTACTGTCACCGCAAGTGCGGCAAAGAAGCAAACGGCAATACACCAATCGCATCGTTCCTCTCACTGTTTGGTAATAAACGCCGTTTCCCGGACGAACCTGTAACACTCAGACCACGCTCTTACCCTCCGCTTTCTTAATGCCCCAGATAATGCACATCGCTGACGCAAACCGTATACGGCGGAATATCTGCCGAATGCGTTCATTAGGGCACGTGGCAGCGAACGTCATTCAGCTACAGGATCACTAGCCGTTTCCCGCGACCCGCTGGCAGCGTGAGCACAATACGGGGGAGAACAGCTGTACCGCCTCGTTCGCGCCGGAGCCTCATAAATCACAGCGCACCGTTCATCAGTACTTTCAGATAACACATGAATACGTTGCTTACGACAGTAAATCGCTGTGATTCCTCTACCGAATATTCTAGCGGAAATATTATTAGCAGTCAAAGGATGGTCATCGGTTATCAAGTGACAGTTAAGGGTATAGTACGGCCAGTTAAGTGGGTCGGTTCAAGACATAGCCGTTCTTGTTGA * tp:A:P cm:i:11 s1:i:109 s2:i:0 NM:i:213 ms:i:714 AS:i:714 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
80 72 16 utg000001l 6139 60 133S10M1I5M1D3M2D4M1I7M5I27M1D10M2I5M1D12M1I3M3D20M2D1M1D6M1D6M3I2M2I12M3I17M4I5M1I14M1I2M7I3M4D2M2I2M1I2M1I6M4D4M2I1M1D7M3I5M4I4M1D5M1D1M1D5M1D6M3D9M1I11M1I6M1D15M2D13M2I9M1I5M1I12M1D4M3I2M1D5M2I5M1D4M1D1M1D13M3D10M1I6M1D3M1I13M1D12M1D5M3I2M1D2M2I6M4D2M2I8M1D1M1D6M1I18M1D2M2D11M2D2M1D1M1D14M3D10M1I4M1D11M1D17M1D6M1I9M2D11M1D3M3D1M1D5M1D17M2D11M2D30M1D6M1I8M1I3M1D15M2I8M1I4M1D12M1D6M1D5M2D4M1D1M1D8M1D6M2D2M3D2M3D1M2D11M1I8M1I8M2I13M2I4M3I3M3I6M3D9M1D1M2I16M2D21M3D5M2D4M2D4M5I28M2I10M2D2M1D2M2D21M2D4M1D2M2D4M1I6M3I12M3I4M1D23M15D1M5D18M1D15M1D1M1D2M2D9M2D5M1I9M1D15M5D16M1D10M1D6M1I7M3D4M2I4M1D10M3D16M2I14M1I5M1I4M2I3M3D4M3D6M3I27M1I23M7D10M3D7M2D10M1D17M3D8M2I27M3I16M2D35M3D5M3I5M1I12M2D5M3I2M3D12M2I4M1D5M1D19M1D5M1I15M1I34M1D22M2D22M5I2M1D18M1D10M1I14M2I9M2D3M1I6M2D4M3D7M1I6M2D1M2D7M1I1M2D9M1I3M2D23M1D3M3I13M2I7M1D10M1I4M2I2M1I2M2D3M2D3M2I2M2I14M2D2M1D10M1I10M7D15M2I4M1I2M1I6M2I10M1D4M1D10M1I3M3D5M1D8M1D2M2D1M1D2M1D8M1I3M2D34M2D8M1D9M1I9M2D1M1D10M1I2M1D9M4D2M1I5M1I7M3I12M2I8M1I8M2I11M1D9M1D12M3D20M1D11M6I1M1I7M2I7M4D16M2I8M1D2M2D3M1I5M2I5M3D5M1I13M8I1M1I3M3D13M1D1M2D4M3I5M3I1M2D4M2D2M2D62M1I11M1D25M1I3M1D1M1D4M7D4M13D2M2D10M3D6M1D10M1I4M2I4M3D3M1D13M1D9M3D4M2I6M1D4M1D7M2I1M1I2M2D5M1D1M2D5M2I15M1I9M2D31M1I5M4D4M3D6M1I9M1I16M1I12M2D8M2D19M1D5M2I5M1I11M1I1M1I11M2D10M1I9M1D5M3I7M1I4M3I5M1I3M1I7M2I7M2D23M2D24M1D5M2D17M1D3M2D20M5I2M3I19M6D5M2D13M3I7M1D5M2I7M3D3M2I3M1D9M5I4M1I11M2D13M1D3M1I6M3D12M1I4M5I7M5I5M4D4M3D13M2I7M4D2M2D11M2D4M2D4M1D15M2D3M3D5M1D4M3I3M2D4M1D3M2I4M1D6M1D5M4D7M1I9M6I14M1I13M1D7M1D9M1D5M1D7M1I2M3I7M1I15M2I5M1I9M3I19M2I20M2D15M1D7M1D5M1I4M3D9M2I4M1D3M1I4M2I4M1D7M1I4M2D3M3I10M1I6M1I9M2D7M1D3M4D2M2D6M1I6M1D12M3I25M3I8M3D1M1D11M1I4M1I3M1D18M4D6M5I2M1I5M5I10M2I9M5I12M6I4M1I1M1I5M1I14M3I41M1I35M1D7M1D11M1I10M1I4M2D9M1I6M1D10M1D19M1I10M6I2M2I3M1D8M1I7M1D15M1I3M1I3M3D13M1I7M1I20M4I9M1D11M1I27M1I8M2I6M1I3M2D13M7I5M1I2M4I4M3D4M2I2M1D23M1I4M1I16M4D19M1D28M3I20M3I2M1I2M1D3M1I12M3I10M1I7M2I4M2I9M8I9M1I1M2D10M1D5M2D2M1D11M1I12M1D3M3D4M1D1M2D22M1D6M1I3M1D8M2I3M1D6M1D14M2D6M2I8M1I10M1I4M2I3M2I2M1I4M5I3M1I4M8I11M2I25M1I4M1I5M2D5M2I11M1I7M2D9M1I5M37I26M1D8M3D4M5I5M3I1M1D10M1I17M2I1M1D16M2I3M2D15M7D4M2D4M4D2M1D5M3I3M5I5M1D7M4I13M2D14M4D2M1D1M1D12M3D5M1I10M3I11M1I5M3I8M2I1M1I4M1I3M1D20M5D5M1D3M3I6M3D8M2I19M1I9M1I5M1I10M1I2M1I9M9I9M2I9M3I30M3I41M3I7M1I4M2I12M1I9M4I1M1D7M1D1M1D6M3I8M2I1M1I19M2I6M2I10M1D1M1D6M1I25M1I13M2I1M6I5M1D5M1I4M2I9M1D4M2I1M1D9M3I3M2D12M1I11M1D1M3I6M4D11M1I6M2I7M2I6M3I5M1I1M2D13M1I1M2I2M1I4M1D1M1D6M2I10M3D8M1I5M3I3M1D4M1D19M3I10M5I5M2D1M1I13M1I2M1I17M1D1M1D2M2I4M2I2M1D3M2I1M1D14M2I5M2D3M1D9M2D2M1D3M2D11M2I16M2I3M1I8M3D4M1D4M3D3M3I3M1I3M2I7M1I22M1D6M4D4M1D8M1D9M2I26M1I24M1I5M1I2M2I1M1I10M3I2M1I10M1D1M1D3M1I30M1I3M1D4M3I3M1I12M4D18M1I3M6D16M1I1M1I8M1D15M2D2M1D13M2D3M1I6M2I8M1I10M4I1M2I4M1D3M1D2M3I7M5D4M1D10M1D14M1I11M1D14M2I1M2I7M6I6M1D3M3I6M4D7M1D13M6D7M1D15M2I2M1D2M1I23M2I4M2I2M1I17M1I3M5I10M1I2M7I13M1I9M5I8M1I12M8I7M5D6M2I7M4I3M4I3M1I2M1D3M2D2M2I9M3I6M1I7M1D3M1D3M1D22M4D4M3I5M2I8M8I1M1I2M2I1M1I4M6I1M1I3M1D11M1I4M1D24M1D28M7D11M1D4M1I3M1D2M5D6M2I3M2I22M3D17M1I13M1D25M1I3M1D5M1D1M2I13M1D20M1D22M1D6M2D43M1I4M3I1M1D4M3I1M2I14M5D17M1D1M2I11M2D10M1D14M1D17M4D7M2D9M3I16M3D1M1I4M3D2M2D16M1D4M2D20M3D1M3D3M6D13M1D4M1I14M1I1M1I7M4D6M1D18M1D13M2D26M1D4M2I8M1I7M1D10M1D6M1D10M1D3M1D17M2D6M10D5M2D5M1D13M2D11M2I2M1I2M3D25M4D20M37S * 0 0 CCTAATGGCCTTCTGTCGTACTAGTGCTCTTCCCTCGTTCGGGTTCGGATCGTGCTCAGATCATCCCTCAAGCAGTCGAGGCCCAATTAGCGACATCTTCCAGCACATGCAGCTTCTCGAAGGGTCTAAAGCTAAGCTCGGCCGGACGCTTCGTTCGGTAACTTTACGCCGATTTTGGTCAATCACCTTGTTTTCCCGCACGACGTCGTCACCGGATATGCCACAGGCTCAGTGTAGTTGAAGGTTTGATAGATTCTTTGGGATTGGCTTGGGTTTATTTCTGGTGCGTTTCGTTGGAAAGTATATTTGCAGTTTTCGCAGATTAGTGGCCAGGCTCGCTGCTCAGTGCAGATTACGTCCTCCTTTTCCTGCTTAGTGGTAACACCCCTGTTGGTGTTCTTCACGGAGACACCATCGATTCCAGTAAGGTTGATTTGGTCGGAAGCGGTTATCTTCTGGTTGCCTTCACCGCGCTAGATACCTTCGCTCGTCGGGCGCTTCCTCCCCGAAGTCGAAATCAAGCTGCCCTCCAAATATTTTCACCGACCTCAGAACAAGAGCGGTATCGAATCTTTAGTCCCTGTCCACCATGGAATACAGGGCTTGATAATGGGTCTTCTGAATACATTTTCTAAGGTCCGTCAGCTTCTTCCTGGTACATAATCTCTTTGTGGCTTTCCCGATGTCGTCACGCACATGGGATGCGTGATGACCTCATTAAACACGCTGCATCCCCTCACCTTGCAGGCAAGTCGATTTTGCGTTGATTTAATGCAGAATATGCAGTTACCGAGATGTCCGGTATTTGCAAATTCGAATGGTTGTTGCTTCGGCACCATGCGAGGATATCTTCCTTCTAACATCGACAGCGGCCAGGAGCTCGCTTCCGCGTCGCGGCCGCTTCGGGTTCATCAGCTCTGATGCCAATCCACGTGGTGGGATTCCGCCTCGCCCGAAATCATCACAGAGCTTTGGCGACAGGAACGGTTTAATCTGTCATTGCAGAACGCCGGAGGTGAAGCTGCTCATATTTCTATCACCATATCCATAAATGGCTTCAGAACAGCATTCGTCTGAATATCCTTCACTTCATACGTGACTCAGTTGTGAGTTAGCATCCTAGGTTGATAGACCTGCAATACGGTGAGCGCTATCCAGAACTTCACAACTTCCTGACAAACCGATAGTATTGGATGTTCAACCTGTATCCATGAAACGTAATGCACGTCCTGCCCGTCGCTTTTGCTCCATTAGGAGAGCAAATATGCTGACGTCTGCCACCGGAACTACGATTATGTGGGCGCCTCCTGTCTCCCCATCTTCGCTCCTCCATACTCCAGGTCTCGCCTTCGTCTGACCACTTAACGCCACGCTCTGTACCGAATGCCTGTATAAGCTGGACCTCACCAACTCGCTGTCACGCATGCTGCTCAACTGGCGTTACCACAAAGCCAGAATCCCCTGAAGGTTAGGAACAACATGAGCCTGCTGCTTTAATGCTGCGCTCAACACACTTCCAGCTTTCTGCATCCAGCCGACCAGATGCCATTTCAACCTGACGGAGACAAAGTCTAAGCAGGCCCATAGCTTCCTGTTTGGTCTAAGCTGCCATTCGGTCTCGGAATGGTTACTACGATTATTGGTTTGGTTGGGTCTGGAAGGATTTGCTCACTGCGTGAATAGCGTTTTGCCTCTGCGGGGCTTCCATTCCCACGCTTAGGTTAGTTTTTCATGACTTCCTCTCCCCCAAATAAAGGCCTGCGATTACCAGCAGGCTGTTATTAGGCTTAATGTAGATGGTCCTTAATTCTCATACCGCCATCTAATTCGGAGCTGCGATCTGGCCACTCCTTAAAAACCAGTTCGTGCTGATGTCTTCCTTCCCGTTCTTCCCTCAGCAACGGTAATAAGGTTCGCCAGACCTTACCTTCGATAAGGAAAGACCTGCATTTAGATGCGATCCGCGCTCGATTTATGCTGCTGGTTACTGTTGCGCCTGTTAGCTGAGACGTCCGGCGCACAGAAGCTATTATGCCGTGCCAGGTAATGAATAATTGCCTCTTTGCCCGTCATAATTGCTCCTTTCAGTCGATAACGGCCTTTGATTTCTGCGATCTTCCCCTATGTGCCTCGCATGCTTTCGGCGCTTACCGCCATGACAGGAAGTTGTTTACTGGTTCAGGCATTCGCCTCACACGGTTAATTCCAGTCATATGGACAAGCTTAATGCCACCTGCCCTCATGTCCGTAATCCCCGCATCACCGCATTGGCCCGCAGCTTTCTGATACGTTGTGGTAACCAGCCAGTGCTCCGGTTGATTTCCACGGATAAGACTCCGCATCCGGATACACTTCGGTGCTTCTAACCAGTTCAAAACCATATCAACCAGCTCGCTGACGTTTGGCAGTCCGGCGGTAACGGATGCTTCTTCCCGATCACCATGCAACAAATTGCCCGCTGATGGCAGAAATGAGTGTACTCGAAGCCAGCGCATTCCGATGATTGTTCCATCGGTGATCCCGTTTTCCGAAAGCCAGAACCCACTGGCGCATTCGGTTTCCTTCTTTCCTCCAATCGAGTCGAGTCGGATGGGAAAGTTGCCAGTAACTGGAGGAACACCGTTGATGATCTGCGCTACCTGCTGTACCTGCGTTCGTGGTACTTGTTCCGGCAATGTTGTTGGCGATCCAAACGCATCTGCTCACGTAAATAACCATCTGTGCTATTGTTTTTCATAAGGATCACCCCGTAAAGTACAGTCTGTGTTTAAGGTCGAGTTTTGGTTTGCTGGCTATTGTCACGCCTGCCTTCTGTTGCTTAGTTACGGGTTGATTTCGAGTTGGGTCCACTTATCGCGGATTGGCCGGGAGAGCCAGCACGTTACGGACGAAGTTGTTCTGGCATGCCAGGAACAGCACACATGTCGCGGTGGTTACAGTCGGTCACGTTCACGCACCTATCGGAGCTGCCCCGAAGCGCCACTTCCTTCTGGCTGATGGTGCTTGATAGTCTTCACCACCATGTCAAACATCGACCTTGCGGTCAGTCTTCTGCTTCACCGCCTATGCCGCTGCTGAATTGCAGCATCCGGTTTGTTCACAGAAAGGTCGTTTTCTCAGGCCCGTCACGCCAGAATTCTGACGAATAATCTTTCTTTTCTTTAATGTCTGTTGCCCTGTTTTAGGGATAGCATCCCCAATTTGGAGGTTTATGTTCTAGTTTTAGGCGGGATTTTCCTCGTTTTGAGGGATGCACCATTCTGAGATGTTTGTTGGTAGAACCTCTCCAGCTGCCTATGCTGCTTGATAAGAGCCTCATCTTTGACGAGTTCTTCTAACTTGGCTTCATTGCACCGTTTGACAGGTAACTTTGATCTCGCTTAAGATGGTTTCTGGCTTCTGTCCGGTTTATTCAGTCAGTGTACTCATCGCAGAACCGGCAACTAACCGATTTGAACTGTCTGCTTGGTTAAGATCTGTGCATGACCTCAAGCATAGTGTGATAGTCTGGCGAACCATCATCGAGATCTGCCACATTACGCTTGGAGTGGAATACCCGCGCCGAAGTTTGAGGTATTTGGTGGTTTGTCATAATGACTCCTGTTGATAGATGCTACCGATCTAACTCTGGATGATATGGATTTGTTCAGAACGCTCGGTCATGCCGCTTGGCGTTTTCTTGGTGCGAATCCTCGCAGCAACTGTGTTGCGCCAATCGAGCCATGTCGTCGTCAACGACCCCCATTCAAGAACAGCAAGCAGCATTGAGACTTTGGATCCCGTTTCTCCTTCCTGCCTGGATCTGCGACTTACCCAACGCACAGCTTCCGTCTTCTCAGTTCCAAGCATTGCGATTTGTCTACCATACCAGCACGCATGCGGGGAATCCAGGGTCTCGTTGCGTTTGTTTGGAACCATATGTAAGTATTTCCTTAGATAACAATTGATTGAATGAGGAATGCAAATAATGCAGACCATAGTGTGGTTTGACCTTAAGCCTTTAGAGGGCTGGAATGTAAGAGCGGGCTTTATGCTGTTGTTTGTCTTTTTGTTACTCGGAAGGCTTTACCCTTCCGCATCAACGCTTCCACCATGCCTATCGTAGTTAAAACCCTGCCTTAATGAATGGCCTTGTTGATCGCGCTTTGATACGCCGAGATCTTTATTAGCTGTCTTGGTTTGCCCAAGCGCATTGCATAATCTTTCAGGGATATGCGTTGTTCCATACAACCTCCTTAGTACATGCGAAGGCTCTTACCCCCTGAGACTCGGCCACCCCACTGTCGATATTTATCCCTTGCGATAGATTAACGTAACAAAGAAACCATTAACAAGAGGAAGCTGTAACGAAGTTCTTGCCTGAAGCATTTATGAAAGAAATGAACTTGGGGCTTATCCCAGGAATCTGTCACCGGACAAGATGGGATGGGTGGATGTTCGGCGTTGGTGCTTTATTAACTATGGCATCAATGCATTAAACCTGCTGTAACGCCGCATTGCTGCCAAAAATTCTCAAAAGTTAGTTGAAGAATTTAGCCCTTCAATCGCCAGAGAAATCTACGAGATGTATGAAGGGTTAGTATGCAGCCGTCACTTAGAATGAGTGGATACCCCTGTTTTCTCTCATGTTCAGGCAGGGATGTTCTACTAAGCTTAGGACCTTACCAACGGGTGATGCGAGATGGGTAAGCACAAAGTGATTCTTGCTTCGTTCCTGCTTGGAGGTTGAAGACTACATTCCATGACCGCACCAACAGCTCCATAAGCATTCCCAACGGAATGTTAATTCTCGTTGACCCTGAGCAGGCGATGTTGATGAGCCAGCTGATTTCTGCAGGCCAGACTTGGGGGCGATGTACCCGTCGGTAAGAAAAGCAGGATTAAGTCGTACTGTTTTACACCATATACTAAACCCCACAGTACCCAAGGTATCCCATGGACTTGAGAGGTAGAGTGTTCCGTTGTGGGGAAATTATACGCTAGTCAGTGGCCTGAAGAGACGTTTGATGATGATCGGCATGTTCTGGTATGGCGCATAGCTGATAACAATCATTGAGCAAGAATCTTCATCGAATTAGGGAATTTGCTGGTATCGCCCGGACATAACATAGTAAATGTCGCATTGAATTATGAAGAATGGTTTTTATGCTCAACTTACTCGAGACTACGCGCAAGGCTACCTCGGCCGTACTTGGTCTGTTTTCCTGTCCTGATTAATTCTCTTGCTTCATGAGATGAGCTGGACTACTGCTCCGTAAGGCTTGTATTCATAAAATGTGATGGAAAAATGGAATTCTCCCAAACAATGACAAGAGTTGGGTTCAGAAGATAATCGCTCAAAGCTTCAGTTGAAGATGAGGGCAAGAAACCCCGCAGATGACGAACCCGCATGCCAGATGTGGCTTGCGAAGGCGACACCATTGGTTTGGTAAGCAGAACTGTTTATCTCGGCATCAAGCGATCTGACAGATTTTAATCGGGAAAGGAATGTCATTAAGGGCGTGTTGGAGAGCGTTCAGATAGAGCGTACTGATGAGGAGGACATAAAGACGATGTTATGCATATGCATTTCATGGCGGTCAGAACAATTCGGACTCTACGGGCTCTCGCCTGTGATGATATATTAAAGGTGCCGGCGTAAAGATATTGAAGGCGGTTTACTCATTGGATATAGTCATTAAGGCCAAATTAAAAGGATATAAAAAGATGCCAAGGATATTATTTTATCACGTCGGTCACCTCAATTTTCAGACATTAGCCGGGCAAAAGATGAGGCCGGAGATATTTAACAGAACTACTTATCAGAAAAGGCTCATCTCATGCCTCTGAACATAGATAAGATGCTGAGATAGCTGAAGAGAGCCGCATATCGGAGCAAGAAGGAAAAGTGATACTGGAATGTTTAAAAGCAGTGGGCAAAGTTAAGGATTGACAGGTCGTATAGGATAATCATTATGCGAACAGAATCATGCCTGTTTACATAGTACATAATTCCTTACGTTATCGTAAGCACTTGCTCCTTGCGGTTATCATTCCCTAGGCTTCCTCTCTTTTCTTCTAGACCAGGTGCTAAGATAATCATATGCAGGACGATGATTGCAATCCTGATTGCTGCCTTGAATAGTTTCTACACCTGCAGCAGAACGCGCCGACGTGGCCAAGATTAGAGAGTATGGGTATAATGGGGTAGTTATTGTCTATGCCCTTAGTTTGTTGAGCTTGGAGCCTTTGTTTTTCTGCCTTAGTCTGTTCCACTGCCCAGCATAAGGGCTACATCTACCCACTATCGCCCATCGGCATTGCCTCTGCACTCGTTCATTCATATGCAGCCCTGTTTTCCAACTATACATGTAAGGAGAAAGAATCACGGCGCTCAGCCGCGATTCTTTGCCTCACGATTCGCCCCAAAAACACATAACCAATTGTATTATTGAAAATAAATAGATACAACTCACCGATTTTCATCCCCAGCCTCCTGCCACAGCTTCCGCAAATAAATTCATAAACATACGATAACCATCTTGCGGTGATAATTATCTGGCGTGTTGACATAAATACTGGCCACCCTTGACATCACTAAGGACGCACTGACACCATGAAGGTGACGCTCTTAAATTAAGCCCTGAAGAAGGACGCATTCAAAGCAGAAGGCTTGGGGTGTGATACGAAACGAAGCATTGGCCTGTACGTGCGATTCTAATCGTTGCCAATGCCAATCGGGGGTTTTCGGTTCAGGACTACAACTGCCACACCACCAACGACTGACAGGAGATCCAGATGGATGCAGACACGCCGGAGGAACGTCCCCGCGCAGAGAAACAGGAGAGCATGGAAAGCAGCAAATCCCGTGGCTGAGCGGGATCGCCACACCTCACTTCTCTCGGCGAATCGCAAACCGAAATCACGAGTGACGAAAGCGCACTAATCGATAGACCTTACAGGTCGGCTGAATACCAAACAGATTGAAAGGACCTGCAACGCTTGATGAGCGCAAGGAACCAGGCACATGGTAAGCAAGCTGGCGAACGGGCATAACATGCAGTGGACGGAAAATTAAGGAAATCATTCCTCTTATCTTTACTTAGATATCTTAGGTCGCTTTATCTCAATATTATATGGATAGCTGGCAACTAATTCAGTCATTATTAAACACCAAGCAGACGCCGCAATATCACTA * tp:A:P cm:i:68 s1:i:596 s2:i:0 NM:i:2322 ms:i:1656 AS:i:1673 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
81 73 4 * 0 0 * * 0 0 TAGGTCGCTGAGTGCGATCCCGTTCAAGGCAATAGAATTTACGTTTTCGTCTCGTTCTAACTCCGAGCTCGGCGCACCGTGCCAGAGCACATCCTCAACGAACGTGCCGGACTTGTAGAACGTCAGCGTGGTGCTGTCTGGTCAGCAAGGCATCGCAAGAATTATCGGACGGCAGCACCCGTCGGTGTACTAAGCACGCAACCAGCTTACGGCTGGAGGTGTCCAGCATCAGCGTATATTGCAGGCGCTTTCACTGAAGCGCCGTACCGCCGTAGGGTCAGGGTTTGCGTAAATGATGGTAAAGCGGTACTGTTAAATGCGACGGTACCTATCGGTTTGGTTTGCTCGTCGCCTCGTAAATTACTCATGGATGTTCGGCGGATCGTCTCCCAACCCTATTGGATTATAATGCGAGCGGTTAAAGTTAGGCCCGGGTGAGGCTCCCTACAGTCGAGCGCGTACTGCGCTAGGTTGGCACTCTGTGGTACTGCGGCCGATCCGGCTCGTTGCCCCGGTCGGCCGGGGTTCGTAAGAGCACGCGCGTCAAGGTTTCGTGAAGTTATGTGCTCCTCCGCGTTGGGATCCCCATAATCCGGCTGTTCTGCCGCGGCCAATGCATGACGTATCCACGTTCGTCGACTCAGGTCCTAGATGATTTCCTAACCCGTCAGCCTGGCGCCGTCAACATGACGTCAACATGCAGTAGCAAGTCGGGGCCAAACCATTGTCGTACTTGCCGTGACTTTGGTCATGTCGCCTAACGGTCGAGACGCGTTAGGGTTGCGGCAATTAGCATCGCATGGCTTGGTCGCATCAATTAGTTTAACAGGGTTAAACAGCCGTTAGACTCAATGACTAGCCCTGACATGTACTATGCGACTATAATGGTACAGCACGGGTCGATGTAAGAGACAGCCTACGGCCGTATATTATTAAGACGGGTTTGACTGCGCGACCGGACTGAGATTGCGTCTGAGTAAAGGCTGGCGACTTTACGAGCCTTTGATCTAGAAGATCTAATCACCGATTGCTAATCGACATTAACGGTGCACGGTCCACTGCAGCGTACTTTCAGCGTTTCTCCACGCAACGACGGTAATTAGTGCCTGGCCGCATCGACTCCGATGGAGCTTCTAATGAAGCGGTCCGTACAGGCCGGGGAGCGCGGGGTAAGCATGGAGGCGGTAACCTTGACGACGTGAAGTTCATGTCGTTGGCTAGCGCCCTGGCTTTTATTCCTAGGTGGAAATGGTCGAAACCGAAGTTAAAATCCACCCGCCGACGCTATCGCTAGATGAGATTCAAAGCCCGGCCGACGGAATGCATTTCTATGAATGAGTACAACCCAGCCTGTTGCAACGGGCAGATAAATGCCGTTTGACGCTGTTGAATGACCCCAGATCGACGAATGCACGCGTCCAATGACCAAGCCCGTTAAGACGAACGGCGAAGGCAACGGAGAGGTCCGACGACGTTCAAATGATAACTCTGAATGAAACGGTCTGTCCTTCATCGACTCCAAACGGGTCACGGCGTCACGGAATGAAAACGTGAAGTCCAACGGAACTGTCACGACGGACGAAAGAATGACGCTTCCATGAATCCCGACGCTCATCCAAGCTGAAGCAGGAACGCTAAGCTACTGATTCAGGCATCAACGGACCATTACATACAAATCGAAATGAAAACTGCAATGCCGAAGCAAACGGTGGACTGATTCACTGTTGAATTGTCGCGGCAACGCACTTCAGGTGCGTGAGAGCGCGGCGGGCGGTCCAACATGCGCTAGGACCGTTCACGACCTTATGAAGGTTTAGTAACGTCTGTTCTCCCGTTTGCACGGCGTTTGGGTTAGACCATTTAAGCACGTCTATCGGCTCGCCTTTGACGGTTCTGTTCGCTATAAATCTAAACTAAGAGCCGACTATCCAGTCGCGTCCCTAGAAGGCACTGCGACCCTTCATGAAGCCAGGCCATTTTGAGCCTCGTCTCTAGAGACCGGCAACGCGTAAACATTTTAGTAGCGAGCCAGCACGCGGCCTTATGATATGAACATGACGCTGCATAGAATTTTCGACATAAGCCCGCAAGCTCGTTCTAGACCCGTTTCGGGTTGGGATCGGATGGGCTATCGGTTTCACGGGGAAGACTAGCCTGGAGGCCCATGGATGCGGGGTATACCCGCAAGCGACTTAACTGGTAGCGCACGGACGAGCGTCAGTTCGGTTAGTCGTTCGGGCTGCATGCGTCCCCATGAGTAAGGTCGGTGACTTTATTAAGCCCGAGCGCGAACTATCGGACATGCGGCGTAATGGAGCGATTCGCGGTCGGGCTCGATTCATTTCAGTCTGACATGACTTTCTGACCTAGAACCGTACATCGCTTATCGATATGCGCTCGATAATGAGCAACTCATCAAAGTTAAAATGGATATGCACGTAAATTTCGTCGTGAAAGATCCGTGCGATACCGTTAGGACATCTGTAAACAGGTATCGACTACCCCATTTGAACACGATCTGCCCGTTAGCCTATTCTCGACCTTGAGGCTGGAGGCACACCGCCCGACTCCAGGACGTGAAATCTGTCATTTCTAGATGCGATGGAGACGAGGATGACGCGTCAAGTAGTGCTATCCAAGACAGCACGTCGGTCCGTATCAAAAGAGCCTGAAGTTCGGACGGTTCTAGGTCTTTCGCCGGGTCCTGATTAAAGTTCGAACGCTGACATGCGTATGTGTCCCCAGCTAAAGCAGGCTGATCTGAAAGCCTACTGGATAGGGTTTAACGCGTCAGCGTGAACTCGACTATTTGTTACGAAATCACGTAAACTTGCTTTCAATAGACCTTTAATTGAAGGCGTCTCCGAGTGGTTTCCGTAAAGATACCCGACGAAGCAGGATTCCAGGAATAGACGGCGAGAAGCAGGAAGAGGGAACAGGAAGCCTAACGCATAGATATTAATCGAGCTGGCGTTGGCGGCACTCCCCGTCCTGTGCAGTGCAAGTGC *
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
82 74 0 utg000001l 21787 60 87S9M1D19M2D4M1I2M1D1M1D5M1I13M1I7M8D3M2D10M4I1M1I18M1I1M1I8M1I4M1I12M3D5M2I10M1I12M1D8M2D8M2D4M3D2M2D5M1I5M4D4M1I15M1D13M5D2M1D7M1I1M1I2M3I3M1D10M2I14M1D2M1I30M3I1M3I9M1I2M2I5M1D10M1D4M2D5M2I3M1D2M1D3M2I20M2D1M2D3M1D1M1D2M3D6M2I13M2I7M1I4M1I3M1I9M1I1M1I7M1D4M1I6M2I6M4D2M1D5M1I3M3I2M2I1M1D16M3D4M1I7M1I3M1I7M1I4M1I6M2D4M1D6M1D1M2D17M2I11M1I6M1I7M2D3M1I5M1I10M24D12M1I15M1I10M2I3M2I9M1I9M3D3M2D7M1D4M2I8M1I2M1I5M2I7M2D4M4I2M1I3M1I6M5I4M2I4M1D37M1D4M3D14M1I7M1D12M1I1M1I12M1D7M1I7M2I10M2I20M3D4M2D11M2D39M1D14M3D5M1I7M1D2M1D8M2D6M1D11M1D33M3D6M1I20M1I4M2D3M1I9M4I2M3I5M3I1M2I5M1I6M1I3M2D22M2I2M1I1M1I11M1D6M1D3M1I3M1I5M3I7M1I9M1D20M3I10M3I6M4I7M2I7M1I12M1I7M2D3M1I2M2D2M4D11M1I4M3I4M1I9M2I19M1D5M5I3M2D3M1I4M8I6M1I6M4D1M2D5M3I8M1I11M4I12M2I5M2I2M1I1M2I28M2D4M2I17M1I25M1D5M1I5M2D3M2I5M1D3M1D24M2I11M2I4M1I3M1D5M1D8M2I1M1D5M4D6M2D2M3D3M4D5M2I17M1D14M2D16M2D17M1I1M1I4M1I5M3I4M1I3M2D9M7D14M1D3M2D5M1I6M1D9M4D10M3I6M1I9M4I2M2I3M5D7M2I7M9I3M1I3M1D10M2I1M1I6M1D2M2D13M2I1M1D22M1D4M2D1M1D8M2D4M4D2M1D6M2I6M1D5M1D23M1D25M1D1M4D9M1I2M1I7M1I6M1D6M1I2M1I8M3D6M1D2M1D4M2I9M2D2M1I5M1D5M3I8M1I4M4D6M1D6M2D4M1I7M3D36M2I5M2D5M2D1M1D6M1D26M2I8M1I6M2D2M1D8M1I2M1D1M2I13M2D6M2D8M1D5M3I5M1D1M1D3M1D9M2D5M3D6M1D3M1D25M2I4M2I9M3D5M6D8M2I15M1D6M1D13M1D11M2I1M3I9M1I5M1I25M2D18M1I1M3D2M1D2M1I10M2D6M2I8M4I9M1D8M1D22M2I44M3I2M1I7M5I1M2I35M4D3M2D2M1D7M1D1M2D1M1I4M1I9M1I7M2D2M1I13M1D1M2D14M1D5M1D19M4I7M1I1M1I5M1I12M3I27M1I9M1I3M1D11M5I9M2I1M2I4M2D1M2D13M4I1M1I6M1D13M2D8M1I2M3I2M1D2M7D7M3D5M6D17M2I2M1D3M1I6M1D5M2D14M3D8M1D17M2D11M1I4M4I1M2I5M1I5M3I13M3D6M1D6M4D9M2I3M2I1M1D4M1D6M2I20M1D17M1I2M1D1M1D21M1I8M1I1M1I12M2D4M1D5M1D11M1D3M1D11M1D3M2D16M4D2M1I17M3I2M1D6M1I3M1D11M2D4M1I10M1I9M1I13M3I2M2I13M2I3M2I1M1I2M3I4M1D8M1I11M1D15M3I7M4D6M2D2M2D2M3D3M4D5M1D8M3D9M1D9M1D13M2D3M1D6M1I2M1D4M1I14M1I4M1I7M5D5M3D1M2D2M2D10M2I4M2I6M3D6M3I3M2D19M1I21M1I4M1I16M2I4M1I33M1I8M1I8M1I1M2I6M1D5M2I2M2I1M1I3M1I4M1D3M1D2M1D3M4D7M2I4M3D2M1I5M1I11M5D3M4I4M3D5M1I5M2I7M1D7M3D3M1D5M1D8M2I9M1I25M1I14M2I1M3I12M1D10M3D10M1D8M1I7M2I1M1I6M4I3M1D1M1D9M1I3M2D9M2D1M1D7M5I2M1I12M1I5M2D15M4I4M2I3M2I10M1D4M2D5M2I5M1I1M1I3M1I4M1I6M1I2M1I41M1D3M1I4M1D7M1I1M1I1M1I3M4I4M1I4M2D6M4D4M5I13M1D7M1D3M1I5M2D2M1D8M1I3M1D8M2D1M5D18M2D10M1I2M1D7M1D2M1I4M1D1M1D3M3I4M3D4M1I5M1D4M3D2M1I25M1D15M2D7M1D10M1I22M1I8M1D3M2D2M1D1M1D12M1D10M2I9M2D17M1I1M5D5M4D7M4I7M2D4M1D7M3I5M1I1M3D4M1I2M1D5M1D1M1D2M1D14M1D4M1I5M1D7M2D6M1I13M1I4M2D9M2I10M9I9M5I4M1D5M1I2M5D11M1I2M1D13M1D2M1I5M1D11M1I11M2D2M1I3M2D18M4I1M1D20M3D9M3I9M2D19M1D5M1I2M1I24M3I11M1D5M1D25M1I13M1D7M3D6M1I5M1I9M2D6M2D4M1I6M3D7M1I5M3D2M1D6M2I10M2I16M3I2M2I2M1D3M2I12M1I1M2I34M2D5M1I5M2I5M5I17M1I1M2I4M1I8M4I7M1I3M2I8M1I1M3I14M1I8M2I1M3I5M3I7M4D22M2I21M1I16M1I14M1I9M3D5M3I3M3I6M1D8M1I3M2I2M1I3M2I1M2I2M1D8M2D2M1D9M2D7M1I9M1D16M2D3M6D2M1D16M1D3M1D7M1I2M2I2M1D3M4D7M1D2M6D1M1D26M4I13M2I6M1D4M2I13M4I15M1D1M2D9M2D15M2I11M1I9M4I14M1D14M3I4M1D16M2D6M2I14M6D4M5D18M2I3M4I13M2D4M1I6M1D13M4I4M3D4M3D1M5D5M2D14M1I3M2D3M1D10M1I2M1I4M3I20M1D24M1I6M3D5M2I3M5I7M3D7M1D17M5D12M2D36M1D1M2D14M3D11M1D13M1I4M1I4M1I3M7I2M1D15M13D2M7D6M1D2M3D3M2I7M1D2M2I6M1D9M9D16M1D3M2I7M3D13M1I2M3D16M2I1M1D3M2I15M1I4M2I7M1D1M2D28M1D2M1D15M1D5M2D2M2I2M1D8M2I6M1I10M1D3M1D49M1D1M1D2M3D10M1I6M1D15M4I5M1D4M1I4M6D5M1I6M2D9M1D3M2I4M1D2M5D10M2I5M3I2M1D6M4D2M4D7M1D11M1D21M2D2M1I9M3D6M1I4M1I7M1I7M3D10M1I2M2I1M1D3M1D9M3D15M3I18M2I7M1I22M1I3M1D17M1D4M1D6M3I8M1D4M2D1M1D3M1I1M2D16M1D11M1D3M1D7M1I10M1D2M2I5M2I11M1I7M2I3M3D2M2I6M2D4M1D2M1D3M1I16M1I5M1I13M2I6M1D4M2D24M1I14M1I3M2D8M3D5M1I7M1D10M1I11M2I1M1D15M2D9M1D2M1D10M2I2M1I12M3D20M2D10M1D14M2I7M5D19M1D12M1D11M3D2M1I8M3D3M1I3M2I19M2D3M3I13M3D7M2D5M1D3M1I2M4I5M1D2M1D3M1I6M2D5M1D7M2D4M5D5M5D8M2D2M5D2M3D7M2I7M3I2M1D14M1D7M1I8M4I18M1I5M2I9M1I1M1I1M2I22M2D4M1D3M1D4M2I4M5D7M2I3M1D2M3I36M1D3M4I15M1I2M2D3M1D11M1D8M1D8M2I1M1D16M3I16M634S * 0 0 GATTGCGGCCTCCGTCTCTTGATATCTCGTCTCTCACTCTATCTCAACCGCCTCGGAGGTTTCCAATCCCGAATGATTGCAGTCAAGCCAGAAGACCTGAATATTTTCTCTGAAAATAACTAATTATCGGAGTCACGAATCCGGAAACGGGGAGAGTGTTTCACGCCGCTTCGTTGCTTGGATTTGACTGCTTTTACTCCCTCTCTAAAGGACCTGACTCATCAAAGGTACACGTACCTTTTTATTGGACCGCAACTGCTGCCGGCAGGTAAAGGGTCCCTATCCTCCGCCCCGAATGCCCTGCCCGATTTAGTTTCGCGGTCGTATGTTACAGTAAAGGACCGCGCTCTGGCTTGAACTCGTAAAAACGCGGCACTTATGAGGTGTTCGACTGACCTTAGAATACATCGGACTTCACCCCATTTCTCCGTATACTCCATGCGATTCCGAAGAAGCAGTACTCCAACTAACGTATTTGACTCGAACTGTTTATGACTAAATCGGAGGAAAGTATATCCTTCGAACTCGGCCTCTGGACGATGCAAGCGTGTTTTATTTACGTAGCCAATGCTGTAGATGTCGTTGGCGGACATTGATGTTATCGTTATTCGACTGAACCCAGAGATTCTCTGCAATCGCCTTTGCTCTCTGCCTTTTGACGAACACTTAAGCGGACTGTACTCGATGCACCGAACTGGTGCCCCGACTAATTCTGCAATCCATTCCCCGAGTCGACCTGCACAATGGAGATTCCACAAATCCTGCTGGAAGCGGAATGGAAGGAGATAATGCGTTAACGACTTGAGACACGTTACGTATGGATATTAGACATCGTTTCCTTCTCGTGAGGTTTTTACTTGAAGTGACAAATTCTGGATACACCACTTATTATCGCAGTCCCGTTGATCCAGCTTTCTTGACCGAAACCCTTCTAAAATTATAATGGTCATGATAGGATTAGCGAAGGTCGAACCGTTTTAAAGCGATGATAATGAACAGAGATGAAGGTAAAGTACAATGAAAAACTTACCTTCGATGAGAACCGTAGCGAATGCTTAATAAATGCTCGCAGACCGATGGGAAGAAGGTTAGAAATAATTTCATTACTCACTTCCCCATTTTTAAGAAAGAACAACAATATAGAATATTAGACCTCCATGCGTTGATTTGACATAAGGACACTTACGGCCCCTCTATGCTGATAATTTGGTAGTACTGACGGTTAAATTTGACGAAAAGCTTTGAATAATCTCGAGATAAACAAACCCGGCGACGATAGATCAAACCTGCTGTTTCATCAGGTAGAAAATGTCATTTTGTGGTATATAAAGACAAAAGATAGATCTATTTTCTTCCTACTTGCAGAAGCTCTAACGGTGATGCCTATTAATTTAGTTCCATCGTGCCTAGAACGCAATATGGGAGAAAGGTCAAGTTTTCGCAGTAGATGAGTAGCCAAGCGATTCCTTCCTAAAGACCCTTTTCTTAGAGCAATGGGTATGCAATTTCGTTTCCGGAACTCCGTAGTGGCTTTTTGGTGTTGAATGCCCGGCGAACGGGCAGCGAGACAAACACAGAGCTGTCATCATTTCAAGCTATTAAATATTGCTAACAGGTAGTTCATCCGAGCAGGAAGCACTTGAGTGAAGGAGCGAAGGGAACCTCTTTCGTAAAGTTATAAGGAATAGTTCAACCGCAACGTTCAGCAGCTACAGTCAGACGATTTATTGAAGCAATCTGAAACCTATTAGATTTGAATGACTTCTAATTATTGGAAAAGAGTCGTATCGCGTGAGCAAACGCGACTTCTTTCCGCATCGCCCGCGAATATGACGGCCGGCCAAATTGACGACGGTATGAGGGGTAGGCTGCTTTTACAAAGAAGGCGACTTTTGCCAAGTACAATCCTGTGCCGATTAGAGCATCATTGGCAACGGTGGCATCCAAGCGAAGGACGTTTGATTTAATGAGGCACATAGCAGTCCTAATAAATCAGTACAGAGCGTTCGATGTAGAGGTACAAATTCTATTTAAATATGTAAATCGGTAGGACTGGAAATCATTCAACAGTGGGGCAGGTCTGACGAGCCAGGCAGCACGTTCCTGCGGACGTGTCGGGCTCACCAGGTACATGATTGCGTGCCAAGGCCAAGCCCGGATTTAGATACGGATACATAACATATTAAAATTTCGTGACTAATTTATATGGTTCTGATAAGAATCATTGCAAAGATCAACAATTATTACGTGACAGTTAAGCAGTTAATTTATCTAGCCAAATATCAGCATCTAGCATGCAACTATCAAAATGGAGGATTAACGGAAAGAAGAAGCGGAAGGCAGGCTTGCATGTGACCGCCACTTTACGTACCTGAATTATTTCGCTTGAATTTGAATCAGATTCTAGCAAACCGCAACGGTTATTGGTCGCCTGACAAAACCAGATCTACAGTGACATTTGGTAACAATAATGTGATGTTATTGAAAATGAGAAAAGTAATCCATTACGGGTCTAGTCAAATGCGCAATACGATAGAAAAGCCGGCGATTTAGAAAGCGTATAGCGAGGCAAAGGCTACTGTGGTCGGTACATTACGAAGCTGACATTGAGTTTATTACAAATGAAATATGTTAACATTGGTAAAATTAGTCAGACTTGCACAAAAGAAATTACCTTCGGAGCGCAGAAGCCCGAATCGTTAAATCAGAAAGACGATGGCTTAGATAGATCTCCCGATCTCGTTACATTGCCTTATAGATCTATGGCAGAAGTGACTGCTGTAACTGTGGCTACAAATAAACACGCCAATCGCGGGTGAAGTACGGTGATTTCGCCAACATCATAATTCGACTCTTTATTTGATGAAGCCAGAGAATAACTTGATTAAATTAAAGATTACTCCATAATCAACGAGGTTGTGCTTTAACATGATACAATATGACAATAAATAATTCCTGAATATTAAAGGACGCGTTAAGATAGGAAGAGGAATGGAAGAAGTTAGTTGACTATCACGGCACTTGCAAACGACTTTAAAGGACGTGGCCCGATCGACCATTAATTTGATAACGATTCCATCCCGTACTTCCTTCCACTCCGGTGATTTGAAGATTATAAGCAGATAAATTTGGCGTTATGCAGCTGACAGCCAAATAACAAATGCCTATGGCTTCATTTGGATATCAGAGCTGAGCCGAACCCAAGCATCTACTCGATAAACCAATACATCAATGCCAATTAGATGAAGACTTCAGGTAATTGAACGATTCAACAGGAAGAAGGGATTTCATGGAAGCTTACAGAAACGAAGAAAAACCGACTTTACGAAATATCAACAGCACTCAAAACATGACGAAAAACCATATTTCATGCGTTCAGGTCTGCTTAAAGCAATTGGCGTGGTGATGTGGTAAACACTGAACAATTTGAGTCATAGAACTTCCATTATTCTCAGCCTCCGTATAAGACCATCCATCAGCTTACAATACCCAACGACCGGACGTTATTCATACAACGTTTGCGCATATACAAAACGATTACTCCATAACATGGGAGAAGCAGGAGTGTACGAGTTGATGTATCAACACGGTTCAGCACCGATACTTCTTCCGGCTTCCAGCAACGAGGTTTCTTCCTTCGTTCGGATTCCAGATCTGCAGCATCCTGAAGCACGCGCGAATATGCTCACTGGCTACCTGCATCAGGCTTTGTTTCTTCCGCCTCCTAAGTGCTAGAACGTTTTGCTACTTCCGTATCCTTCACCAGGCCAGTGCCGTTCCTTCTCTTCTGCTCCCGTGAGACCAGGTAAATTTTCCGGTAACGGGACTGAGTTCAGAAAGAGAAGCCGCCTGAAGCGCCACGTCATAGACGCGTTTACCCCGATGGTCTTCAACGAGATGCCGCCAATTACCGCCTCATCACTGTTGAACAGGCAAAGCCAGCCGAATATCTGGCGGTGCAAGTACGGTACTGTTGCAGCAGACCGGTATGAGGCGAATACTTGGTGAGTCGGTCAACAGACGGGTTCATTAGTTAAACGATTATAATTTTTATGTTAGCGTGGTTGTTCACTCATTCTGAATGCCATTATGCAACTCTAGCACAATAGTTAAATGCAATGTTTGACGCTGCTTCCTAGTTAACCGCAGCGTTACGCGAGGGACGAAGATCGAAACGGGACTATCACGGAGAATGTGAGAACGCCCCGATAATAACCGACTGCTCTGACGCGCATCGCACTGACTGTAGCATGTGGGACAAGCTCGAGCTAATCCTAGGCTGCGCTGACTGTGGTGCCCTGCGTCAGACATTTCAATAAGCACCATCTAGTGCTGTTCCTTTAACTTAGATAAACTTCCTGTAATGGTTGGTCCCACCTGACTCCATACCAGAACTGTTCATCCTTAAAGCCACTTGTGGCGACCCGCCAAACGGTTTGAGCCGACGGCCAGACTGTACGTAGCGGGCTACAGTCGCGGCGGCAGCCGGGACTGATGGAACTGCTGTTGTTCCTTTCGATCGTAGATAAATCCTTCTTTCGTCCCCAAATCCGTACCGGATGCACTGGCACTGTGGGTGCGACTTAGATTCCATCCTGTTCCTGAGACAATACATGGAATGAATGACCGGCTGTTCCCTTGATTGTCCCTCTACAGTAGTACCGAAGCACACCCATCCGATAGGGACAGCAAGTTTGAGGCTGATTTAGGTGACGCCTGCCTGCCCTGCATCAGGACGTAGCCAGACGGAACGATATCTGATGGCCACGGGATTAGCACCTTAGAAAGGCCGAATCGCAGGAGAAGGATGGCAGAACATCTGCAAAGGACGAATTTTTCAGAATATCCTGCCATCCTGAGTCAGTTCAGTCAAGGCTGGCGGCATCATTTTCGCGACTGACGATGGCTTCTTTTCCGTGAAACCGCCTGCCAGCGCCGTCATAGTCGCATTCTTCGGTTGTTTACCCCAAGCGCGTTAGTCACTGTGTTACAAATCTAGATCATTCCCGAGCTGCGGCCAGTTCATTCAGCGTATTCAGTGCGTCATGACGCCGTCGATAACATCTGTACTGCAATCGCGGCCAGTACAAAAGCGGTGTTCAACCCGGGAGCCGAGCTCCTTCCCCCTGAGCGCGGTTGGTGCTGTCTTTGGCGTTTCCGTTCCATTCAATTAAAGCGTCAGTGGGCTTTTCTGTTCGTTCTTCATCCATTACACTTAACCGCCTTTGGCCGTGCAGCATGCGTTTCCGGGTTGCCTGTTGGTCGGACTGAGCTGGCACTATCCCTTTCTCGTTTGTCCCGCATCCTCCAAGCGCGACATGAAGGCTATCGTGCACGTTTTGCCGAATTTGGACGTATTGCCGGGTGCCAATTTTGCTCTGCGATGCTGATACCTGCAGACTCCGAGAAGCGCTGCCTTCGTGGATGCCGTTGACGCACTCCCGCCCTAGTTTTGCGTTATTGCCCGGCAGAGGAGGGCGTTTCTCATGCTGCTGTTTCAGATATGGCATTCGTCTGGACGTTTTTGCCGCCCTGGCAGAATTTTCTGCCGCCGTCCGTTGCCGAGGAAGCTGCACGACCGGCGATAATGTGATGCGTTCGTTTCTCTCCTTCCTTACGTCTCATCGACGCATCTCGTGCTGAAGTGGCGGCCTCGTGAATCAAATTTCGTGGCCGTGAGGAGGCGGCAGACGTGGTTACCGGCTGTTAGAAGCTCCAATTCTGACGTGTTTCACGGCACTGGCCGCCGCGTTTGAGAGACTCTGCGGCTGCTAGATTTTCCGCTTCAGTGAGCTTTGCTGATGCCGCTTCGGCCGGGAGGACTTCCTGAGCTGACGATGCAGCCTGTCCGGCGACGTGCTGAAGGCGTGCTGAGTCAGTTGCATCAGTCACAAGGGCCGCATGAGCAGCTGATGCACTGGCATCGCCGGCTGATTTCTTGCTCGATGTGCCCGCTCCTTCTATCTTTGCCACCACGGCAGGAAATAGAAGCCACTACGCGCCTACCTCCATCGGGCATACTGTCATGGCACAGAGAAGTATCGGTCCGTCCCGGTTGAGCAATCTTCATACACGGTGAACTGTCAGGCGTGCGATGGTGGGAATGATTAGCATTCATGCAGGAGGACACTGTACTGACCGTACTCAATGGATGCTCTGACGCCGGCTTGCTTACTCAGATTCTCTGAGCCCACCGTGTTAGCCCACCGTGGTGCTGTTACGTCTGGCTTTCAGCTGAATGGTGCAGTTTGATCCATTTCCTGTGCCGTCTTTCAGGACTCCTGAAAGGCGGCGATCTCCGAGATCCCACTCACGCCCCGTTAGATCGGGCCTCTATGTTACCAACCTATAATCGTGAGATTTATGAACCGATGGATCCGTTAATCGCCAGTCGCCACTGCCGCCGGCTGTTCATACGTAACCAGTAACGGAAGGACGGCTGCCGTACGTGGTACGCTTAGACTCCACGCTACGCTCTGCCGCATTGCATTAATTTCGTCCCTGAGTGAATGGTCGTCTCTTTCATACCCGGGAGTGATTTCCGTTGTACGGTACGTGATTGATTGCGTAACATAAGCGACTGCTCACTCGAGAAGCCCAATGAAGTGACTGCTTACTGATTGTAAACCGCTTTGATGAACCTAACGACGTATGCACGCAGGCGTCTCATAGTGAAATGGCCCGCTTCTCTCCTGTTGCTGCTCTTTTCAACGGCGGCGAACCCCAGGGAAGCTCCATCACCCCACTGTCCGTCAGCTCATAACGGTACTTCACGTTAATCCCTTTCACGACTCACGGTATTCCCCGCCGACAACGACGGCAATGTTCCCAAGTTCGATTGAAAATAGCGCGTAATCTAAAAGCCAGTTTACGTCGCACGGGCCGGGACTGTTGACGGAAATAGGGAAGACAGGACGCAATACAAGTCGCCAGCATCGTTCACTGTTTATAATAAACGCCATTCCCGGACGAACCTGTAACACTCAAGCCTGACCTGCCCGACGCCTGTTCTTAATCACCGACAATCCGCTCTCCACCGCCTCTCCCAACGGTACTCCCCGTGACGATCCGTTGGACGTAAGCACTCCGTGATCTAATGTCAAACCGTTTAGCGAACATGGCGGTTCGCTCGCTCTGGCCGGCGACTACTAAATGTACCGCATGAGAAGTTCATCAGTACTTTTCAGATAACACATCGAATACAGACTTTACCTGCCGCTGACAGTACGGTGATTCAGAATCCCGTCGACGGAAGGCATAAGGTCTGGCGATCAAAGGATGGTCGTAACTGACAGTTACGTAACGCCGTCCGACCTGACGGTCCACATGCTTTGACGCTGGCGCTGAAAGACGCCTGTAGCCGCCTTTACAATGTCTGAGCGACGATTTTCTCGCCCTTCGCTTCTGCGTACAGTTTTCAGCTATGATTGGTCTAGTGCTCGTCTCAGAGTTCGCATTCGGCAGGAGAAGCTTTTGACTAGGTCAGCTTTCCGTTCAGTCAGGAAAGGCCGGCGATTGCCGCCGCTGGTAATGGTGGGGCTTCACAGCTTCAGGAACAGTCGTTCATGAATATGTGCCATCCCGCTCAAACACTCGGCGTTTCATTCCCGTTGCCGGGTCATAATAAATCCATCTAATGCGGCAACCAGAACTGGCTCAGTTTGCCTTCCTCCGTGTCCTCCATGCTGAGGCCAATACCGCGACATAATGTTTGCCGTAGGCCGGGGCAACCGAAAGAACTGGCATTCCTATCTCCCTGGCATCCTTCGATATTCCGACCCTCCAGTCCTGGCGTTATCCTCCGTCAGCTCGACTTTTTCACAGCAATATTCCCCAGCTCCGATTCACGGTTATCTGCCTTTGAAAATCCAGGTGACTTCCGCATCCATCGCATGATCAAATTGAATGGCCTCCACGAATGCGATTTGCCAACGGTGTTCACTGCGGATAAAATAATAAGCCTTGATAGGTCCACCGGGGCTCCCGTTACATCTGGTCAACCTGGCGGCTATCCAAGTCGGGGTCC * tp:A:P cm:i:46 s1:i:422 s2:i:0 NM:i:2578 ms:i:1054 AS:i:758 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
83 75 16 utg000001l 25869 60 51S6M1I17M1I19M1I14M1D3M1I30M3I1M2I3M3I3M2I3M2D4M3D12M1D13M1D12M2I10M2I6M1D3M1D10M1D6M2I1M1I14M1I12M2I7M1I13M2I22M1I21M5D4M2D3M1D14M1D10M1D5M2D8M3D20M1I10M1D18M1D16M1I2M1I3M2I6M1D7M1I2M1D5M2D15M1I17M2D9M2I26M2I4M2I9M1D4M3I10M1I20M3I11M3I2M1I1M1I5M3D4M1I9M1I3M3D6M4I22M3D9M3I17M2I20M2D2M4I2M6I4M1I2M1I21M2I3M1D35M3I33M1I13M1I2M2D10M3D6M1D3M2D5M2D1M1I4M2I3M2I8M2I13M1I1M5I4M3I5M2I12M1I5M5I2M1I1M1I19M2I10M1D9M2I4M2D21M1I20M7I6M1I1M1I12M2D5M1D2M1D12M3I1M1D4M1I32M2D6M1I14M3I3M2I22M3D6M6I3M2I14M1I4M4I4M1I1M1I3M1D1M1D10M2D17M1I38M1I4M1D13M1D3M1D14M8D9M1D33M8I7M2D19M1I6M1I28M2D9M1D6M2I11M2I10M1I7M2D4M1I1M1I8M1I8M1I9M1I5M1D6M1D3M1D7M1I9M2I2M2D5M2D4M3D4M1D8M1D25M4D2M1D17M1I12M1I10M1D14M5I12M1I8M3I4M1I5M1I9M2I9M2I18M1I2M1I6M1I3M1I6M5I1M2I2M1I6M3D7M1D17M5D11M1D8M1I18M3D2M1D24M3D25M2I20M3D21M1D6M2D1M1I40M2D3M3D23M1D25M1D21M1D5M5I13M5I4M10I13M1D9M3D1M1D29M4D11M2I6M1I9M2D7M1D48M1D3M1D10M1I5M2D23M1I5M1D15M1D5M1I5M1D3M1I12M3I47M1D3M1D21M1I3M2D3M1I50M2I6M1D17M2I16M2I7M2I3M2D15M1I4M1I5M1I5M1I4M1D5M3D26M2D9M1D1M1D5M2I26M1I4M2I10M4I2M1I3M3I1M1I7M2I21M2I17M1I2M1D13M1I3M1I4M2I16M3I39M2I3M1I25M2D15M1I1M1I7M1D8M1D4M5I30M1I1M1I12M1D5M2D2M1I4M1I9M1D2M2I19M1I8M1I1M2I10M9I1M1I9M2I15M1I5M1D3M1D8M1D6M3I3M2I4M1I4M1D8M4D5M1I5M1I8M1I12M1I10M2I10M1I4M2D18M2I14M1D4M3I4M1I16M4D10M1I1M1I2M1I29M1D8M3I10M1D21M1D17M1I6M1D17M2D7M1I10M2D19M1I7M1I8M1I17M2I2M2I8M1I3M3D7M3I7M1I8M1I6M1I23M1D21M3I3M2D5M3I10M1D3M4D23M1I15M1D5M1D9M2D20M1I10M1I7M1I6M2I4M1D4M6D2M4D7M1I5M3I6M1I8M3D10M3D13M1I10M2D8M1I2M1D11M4D16M1D6M1I20M3D1M2D4M1D23M1D3M3D2M2I3M1I1M1I7M1D5M1I21M1I8M1D22M3D17M2D14M2D6M1D10M1D14M3I8M1D42M2I2M4I1M1D5M1I7M3D3M2I6M2I3M3I21M2D2M1I4M1D5M1D3M3I16M1D15M3I2M1I3M1I2M5I18M2I12M3I28M3D45M1D13M1I2M1D1M1D13M4I16M1D52M1D1M1D11M1D10M4D9M2D3M1D6M7I18M1I3M1I11M1I4M2I6M2D13M4D6M1D3M1D5M1I2M1I9M1I8M1D4M1I5M1D7M4D5M1I3M1D18M2I23M1I5M1D1M2I20M1I24M1I9M1D8M2I6M2D31M1I6M1D4M1D27M1D6M1D11M1D2M1D1M1D11M1I5M2I6M1I6M3I2M1I2M1I5M1D5M1I6M3I2M3I3M1D2M1D9M3D21M1D6M1I9M1I11M1I12M1D7M1D6M1I30M1I30M4I8M2I5M1I6M1I19M1I3M3D9M5I7M4I18M1I4M2D10M2D9M1I2M1D5M1I14M3D12M2D5M2I10M1D35M2D45M1I10M1I42M3I5M1I11M2D4M1D2M1D4M1D3M1D5M3D9M1I25M3D7M4D4M4D2M2D7M1I12M3I3M2D11M2D20M1D2M1D47M2D6M4I10M1D6M1I3M2I7M4I2M1D8M1I13M2I29M3I2M2I4M3I12M2I5M3D4M1D6M1D27M1I17M1I4M1D2M5D3M2I1M1D7M4I8M5I12M2I1M1D2M1I3M1I37M1I13M1I11M2I9M4D5M2D4M1I8M2I7M2D14M1I15M1D4M1D3M1I10M5I16M1I3M2D1M1I5M1D3M2I20M1I9M3I5M1I5M1I1M3D1M1D3M2I3M2D7M1D13M1I6M3I9M2D2M1D16M1D16M1D3M1D7M1D8M1I1M1I8M3D19M3D7M2D1M1D10M7D12M2D4M1D1M2D31M1D12M1D13M2I6M1D2M1D10M1I11M1I6M2I10M1I7M2I4M2D2M4D7M1D4M2I7M4I13M1D5M1I32M2I7M1D13M3D13M4D6M1I16M1I12M1I7M2D6M1I9M8I2M1I3M1I9M1I5M1I22M1D11M1I3M1D2M3D7M1D3M2I13M4I4M1I9M6D4M4I32M2I3M1I18M1I5M1I2M1I7M1D5M3I6M1D4M1D8M1I16M1D7M1I16M1D15M2D4M4I4M1I9M2I2M1D2M3I8M2D6M1D23M1I4M1I11M1I10M1D8M2I7M1D17M1I9M2D4M2I11M1I4M1I33M1I1M1I4M2I3M1I3M2D10M1D6M1D13M3I10M1I1M3D14M1I4M1I5M2I13M1I11M1D7M1D12M1I9M1D17M3D13M2D15M1D5M1D4M2I1M1D7M3D4M2I6M1I6M1I2M3I3M1D7M11I15M1I17M2D7M1D9M1D7M1I19M1I26M1D6M2D16M1I3M5I5M3D7M1I2M1I4M1I12M2I13M3I9M1D16M1I6M64S * 0 0 TAAGGATATTATTTGACGGTGTTTTCCGCCGTCCCCGTAGAATTTAGGTGATGGTGTCCCGTGTGAACCAATACTCGAAAGAATGGGCATGAGCACCGATAACAACCGGATGCATGGTGCGCACCAATACCAACTTGTATGCGCTGGACCTGTGGCGCACCGGCACTCCACGAGCTGTACCGGACAATGAGTGACTGTGGCTGCCCTTGACTGTCCGTTTTCGATAAATAAGCAATACCTGTGTGCTGGTTCCTTTAACTGTGGATAGACTTTCCTATGTAATGAGTTGCTGTTCCATACACTGACTCCAGCCAGAACTGTTCCATCCTTAAACCACTTGTGGGGCACCGGTCCCTGTTGAACCGCTCAGACTGTGAGCATGAGCCCCGTTATTCGTCGATTTGGTGCTCGTAATCGAAACTGCCTGTTGTTTTCGTCCCGTAATCAAACGACGATGTGGGTTTTCGTGCCAAATGTAGATCGATGCACTGAGACTGTGGGTGTGCGACTTAATTCCATCCTGTTCCTGAGACAATACAGCACGACCGCTGGCGGGTTTCCCTTGATTGTTTGCCTGGGATATCAGGAAGCACACCCGATGGATACGCTTAGACAGCAAGTTTTGGTGAGGCTGATTTGTTAAAACGCCTTGCCCCTGCATCAGGGACGTAGCCAGACGGAACGATATCTGATGGCCACGGGATCGGCGCACCTGCCGGAAAGGCCGAATTCTCACCGGCCCCAAGGCCTCTTCAAGAAACATCTGCAACGGAATTTTTGCCAGAATATCCCTGCCAACCTGAGTCAGTTCAGTCATACTATTGGCGGCATCATTTTCCTAGCAAAATACGGTAATTTATTTTCGCCGTGGAAAGCCCTGCCAGCGTCAGTGTCGCCAATTCTTCGGGTTTGTTTACCGCAAGCGCGTTAGTACTGGTGGTGATAGCAAAATCTGGATCATTCCCGATGAGCCTGCGCTCGAGTTCATTCAGCGTATTCAGGGTGCGTCAGGAACGCGTCGATAACATGCAATCGCGGCCAGTAAAGCGGTGTTCGCCAATCTGGGGTATTGTTGTTCCCCTGAGCGGTTGGTGCTGTTGGCTTCCGGGTCAGTGCCGGACTGTCCAGTGGGCTTTGGTGTTCGTTTCATCCATTACTTAACCTTCTTTGGCGTTGCAGAGGCAAGGCGTTTCAGACGTGCTGTTGGTTGCACTGCTGAGCTGCACTATCCCCTTTCTCAGTTGTGTCCCCACTGTAATGCGACAGCTGAAGCTATCTGCTGCACGTTTTGCCGAATTTTGCATGTATTGCCGCCGCTTCTACTGCCGCATTTTGCTCTGCGATGCTGATACCGCACTTCCCGCAGCCTCTGTCGCCTTCGTGGATGCCGTTGACGCACTCCAGCCGCCGCCGCTTTCGATTGCCGCGGCAGAGGCATCCGTTCCGCTGCTGTTTCAGATGACCTGGCATTCATCGGGACGTTTTGCCGCCCTGGCAGAATTTTTCTGCTGCTAGTTGCCGGAATCAGCTGCACGAAGCGGCACTTGATGATGCGGTTCGTTCTGATGATTTGCTGCCTCTTTGAGGCCACCGCATCGTGCGCAAACCGGCCTCTGACGCTTTCGTGGCCGCGGTGGAGCAGACGTGGCGGCTGATTGTTGTGACGGTATGCAGCATTCGTTTCTGACGTTTTCTCGCCGCACCGGCACTGGGCCGCCGCGTTTGAGGACTCTTGCGGCTGCGAGGCACTTTTTGCGCCTTCAGTGGCCTTTGCCTGATGCCGCTTCTCTGCGCCGGAGGACGCTTTCCTGAGCTGACGATGCAGCCTGTCCGGCGACGTGCTGGCGCGTGTCCATGAGTCAGTTGCATCAGTAAGGCCGCGACCTGAGCAGCTGATGCACTGGCATCGCTTGGCTGATTTCTTTCCGCGTCTGCCGTACTCTGTGCCACGGACGCGTTACGCGCCACTCTTCACCATCAGTTCAAGACGACGCAGCACCTCCGGCCGGGCATCATCCTCGTCATGGCACAGAGAAAATCATTCAGCGTCCCGGTTGTGAATCTTCACATACACGCTGATGGTCCCGGCGTTTACGCGATGGTGGAAAACTTACACGTCGGTTCGGTCAGACCTGCAGGAAGCCCTGTACTCTCATCCACATCCATGCTGTAACGCCCGGCTTCATCCGGATTCTCTGAGCCCGCCCCGTACCACCACGTGGTGCTGTTACGTCTGGCTTTCAGCTGAATGGTGCAGTCTGTGTACGGTTTTCCTGTGCCGTCTTCAGGACTCCTGAAATCTTTACTGCCATATCTCGAGCCACAACGGCACCGGTTCCGGCGGGCTGTCATAACACTGTGTTACCTGGCTAATCAGAATTTATAACCGACCCCAACGATGAAATCGTAGTACGCCAGTCGCCACTGCCGCTCACCACTTCATAAGCAATATCAACAACGACGGACGCTGCCGGATTAATCTGTACCAGTGCACTCCACGCCACTGAGGTATGCGCCGCATTGCACTTTCGTGTCCCTGGCAGTGGTCGTCTCTTCATATACCGCGGAGTCCATTTCCGTCGATCGATCCATTGTACTGCCGGACCACCGACTGTGAGCCACTCCATGCGGCGTACGCACTGACCTGCTTACTGACTTTGGCCTCAGTCGATCAAAAGCCAGCCATCACGCTCAAGACGTCCACGCAGGCTCTCATAGTGAACGTATCCTCCCGGTCGTATCACTGTGCTGCGTCTCTTTCTTAACGCGGCAACCCCAGATAGGAAGCCATCACCCCCACACTGTCCGTCAGCTCATAACGGAGTACTTCACGTTAATCCCTTCAGATGACTCACCGGTATCCCCGCTACCGACAGAATGCAATGACCCGATGAGTTTCACTTGAAAATAGCCACCGTAAACGTCAGATATTTAAGGTCCGCACGCTCGGAGGTGACTGTCACCGGCAAGTGCGGCAAAGACAGCAACGGCAAGTACACACATTACGAACTCCTATCAATCGTTCACCTCTCACTGTTTATAATAAAACGCCGTCCCGGACGAACCTCTGGTAACACTAGGACCACGCTGATGCCAGCGCCTGTTTCTTAATATACCATAACCTGCCACATCGCTGGCAAACGTATACGGGCGGAATATCTGCCGAATGCCGTGTGGACGGTAAAGCGGTGAAACGTCAGGATCACGTTTCCCCGACCCGCTGGCATGTCAACAATACGGGAGAACACCTGTACCGCCTCGTCCGCCGCAACCATCATAAATACCGCACCGTTCATCAGTACTTCAGATAACATCGAATACGTTGTCTGCCGCTGACAGTACGCTTACTTCCTAGAAACGTGATGGAAGCACCACTATCTATGCGATCAAAAGGATGAGTCATCGGTCACGGTGAATCATTGAACAAACGTATACGGACGAGTTACACTGCCTTTCACGCCGTGGGCGCGGAAAAGCCGCGCTCGCCGCCTTACAATGTCCCGACGATTTTTCCCTGAGCGATCCGTTTATCGTACAGTTTTCAGCTATCGTCACATTACTGGGCCGTCCGGAGTTCCATTCACACTGCCACTGATATCCGCATTTAGCGATGCCTTCCAGTCCGGTGTCAGGGAAAAGCTCACGCGATTGCCGCTGGTAACCGGTGGGGGCCGTCAGGCGCTTCAGGAACACGTCGTTCATGAATATCTGGTTGCCTGTGCACAAACATCGGCGTTTCATTCCCGTTTGCCGTCAATAAAATGCGATACGATTGGCGGCGGCAAGAAACTGGCTGGTTGCCTTCCTCGTGTCCTCCATGCTGAGGCCAATACCCGCGACATAATGTTTGCCGTCCTTTGGTCTGCTCAATTTGACAGCCACATGGCATTCCATTATCACTGATCCTTCCACTGGTCGAAAATCCTCCAGTCGCTGCGCGTTATCCTCGTCATCAGCCGACTTTTCCAGCAGCTCCTGCCGAGATGGGATTCGGTTATCTATTAAAAGCTTTGAAAAATCCGGTTGACCTTCCACGCATTATCATCGCTCGCCCGACCGACCTCCCACGAATGCCGATTTGCCAACGGTGTTCACTGCGGATATAAAATATCTATAAATACAGAACCAGGCCCGGTTTGATATTGATATACTGGCGGCTATCCAGTACAGCGCCGTCACCAAGATAACGCGTGCTGGTTTCAACCTGTCTGATATCGCAATCTGCTTTTCTAAGAACGAACTCAAACTGTACCGTCGGGTCATAAACGGCGGCAAGATGCGGCGTGGCGGTTATCTGAAATAGCCCGGCGTCAGCTCAATCCTCGACGGTGCTGCCGGTGCGGCAATCCGGAACGATAAGACGCCGGATCGCCCTGCTTGACTACCCACGCATTTACTGCAGCCAACTGTCAGCCGGTGCGTTCCCCAGCGCCAGTTGCGTGAAGCGGTATGTGGTTTCCGTTAGTCCGGGCCGTGCTGACAGCTCGCTCTTGCCGTCGCTGTTACGGGTCAAACGGAGCAGGAGGAACTCACGCCCTTCACCACCTTCGGGTGTGTCCCATCGCGCCAGCACCTCATCTTCCGCTGTCTGCAGTGACTTCTGCCTTTCATCTATGCACCGCCCTGGCGGCGTGACACCATTCACCGTGCCACTCTGTTCTCCCGTCAAATCCGCCCCGTTATCACGATGGCCTCTTTCCGGGAATGCTGCACGGTGATGGCATACGTGCCGTCGACTGGTTCGTCACGGGGTACTCACGCAGCGGAACAGCTTCGCCTGGAGCCGCAGCGTCGGCAGCTTCAGCTCCCATACGCTGTATCAGGACACCGTCAGGAAACACGGCTCACTTTACCTTCACGCGTCGGTGACGGACTGAACCTCCACGCTGACCGGATTGCCACTTCCCCGTCAACCAGGCTTATCAGCCCCGTACCGGGAGGATGGCAGGCGTGATTTTCACGGTCGAGCGTCAGCGTCCGGAGTCTGGCTGTTCATTCACCGCCAGCACACGACTACCGGTGCTGATACCGGCAGTCATCATGGTGCAGATTGTCTTCAATAACATCGCCCGGTACATGGCGTACGCCCTTCTTGCCGACGCTGAAATCCACGGTCTGCGTTTCCAGCAGTTCTGTTTAATCAGCCACAGCCCGGCGCGGGCGTGCCTGCCCCGGCTGGTACAGCCCAAAGGCATCCATCTTCGTAACATTACGACGTAACGGGCAATGGCCTGCGTATCTTTCAACAGCTCTGTCGCCGTCTCCCAGCCGTGTTCGTATAATCCAGTTCACCTCAACGGCATTATGGCTTTCCTTCAGGGCGTCGAAGCCTTGACGAACGGCGCTAGCCATCATCCGGCAGCCACATTACTGCGGTTATAGTCACGTCTTATCCGACGGTCGGTCCTGCACGAACGTCAGCGTCTGCCCGTTCCATACCGGCATACAGCGCATCGCCGAGCAGAAATCCTATGCGAGCACATCCCACGCCTTACGCTGTGTGGTCAGGTACGCATTACAAGCTATACTTAGCCAGCTGGGCCTTGCCTCACAAAGCCGTCCGGCACTGACGGTCGCAGTACTGGCCGATGACATACAGCGCCCATTTATCCACATCCGCCGCACTGCATTCCCCACCGCTGCCGTAGCGCGCCGGATGGGATCAGCATATCCCGCAAGACACCAGGCCATGTTGTTGCTGTATGCCGGTTTAAACGTTCGTCCCAGATACCGCTGTATCTGCCGCGTCTGCGGTATAGGTTCCACGGTGCACCTGCAGAATACGCCCGCGGCAGATGATAATTACGAGGCCTATTTGCTGGCTGCCGAACGAACTCGGCCGAGTCCACCTGCACGCGACCAGTGCCGTGTTCGTAGCACTGTTTCACATCCCTGATGATTTCAGTGTATGACGACCAGAGCGTTTGTTCTGCAGCGTTATGGTCTGTGGTGGTACGGGGTCATCCTGCGCATCGGATATTAAAACGGGGCGGGATGCAGTACCCATCACCACCGAGCGATACTGCTCAGTGGTTTTGCCCTTAACTGATGTCTTCGTCAGAGCCACCGTTACGTTGTATCTGAACCAGCAGGCGAGACTTCCGACGGATTCCTGTCACCCTTTGAGGGCGGGTTTCACAGTGCCTGTACACCCGAAGGTAAAGCGCAGACGGTCGATGTTTTGCAGTAAACGCATCCGGGTGATCATGGCGTGTCCGCTATTTCACTTCCGAGTCACGCACCGTCTCGAGCCGGAGGATTCAAATCCCTGGCGGCGGAGTCTGCTCCTGCTCAGCCCGGAACACCGTGACGCGGATATGTTGGTATTCCCCTCGATGTCCTCAGTGATGGACGGCGTACTGTTCAGCAGCAACGCCTAGCGCTTTAAGCCAGGTAAGGACCTTCAATCGGCCCTTCGCTGATGGCATCGGATACGGACCCATGCAACTGCGACTTCAGGTATATTGTGCCCTGGTTCCGGGGATATGCCCTTACTGCTTCCTTTACCCATTCCTCACCGGTTACCATAAATGAACAAACCGCCCGCAGGCGGTTTCACATAAACATTTTGCAGAGCATGCATCACCACAACCTGACACCGTCCCTTCGTTATGCCGTGCTGATCTCTGAGAAACCACGCGTGACCCCACGCGCCGCATTCCCCGGTCATTCGAACAGGCAACATTGCCCGGGGCAACCATGTTATCCAGGTGAGGAGAAAGCGGTGTTCATGCTTACCGTTATCCGCGTTGTCTGTACGGGGAGTTCTGGCTTTCGATCTCAGCATATATGCGCCACACCGCTAGAGCACCATACTGGCACCGAGAGAAACAGGATGCTGCCGCTTCACTACCGGGCTCAATCCTGCCCCCATGCTGCAAGGGTGGCTCCGGCGTCAAAGAAGCATCCGGCATGATGGCTGCACCCCAGGACAATCTGGAATACGCCACCTGACTTGGCCTGAGGACTCTTGGGAACAATATGAATTACAGCGCCAGGCAGAGTCTCATGTAACTGCCCCATAACCCGACTGGTGCTGACGTCCCTGCACGGCAATCCATCACTATCCGTACCAGCCGTCGCTCAGTTTCTGACGAAACGCCGGGAGCTGTGGCCAGTGCCCGGATGGCTTCAGCCCGTTTTCTTCACGAAGGTCGATGCGGCGACCAAATCGTTGTAAATCCCCGTAAAGCAGATGCGCCATGCCCGGTGACCTCACCAGAGGGATGTGCGTCGCTGCCATTTGTCGGTGTACCTCTCTCGTTTGCTCCGGAGTTGTTCAGGAATATGGTGCAGCAGCTCGCCGTCGCCTTCAATCAATTGAATCAGCACTTGATTGCGTGATTCGTAACCATAACACCAAGCAGTT * tp:A:P cm:i:136 s1:i:1351 s2:i:0 NM:i:1765 ms:i:4686 AS:i:4686 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
84 76 16 utg000001l 18718 60 34S7M1I7M2I6M1D6M2D1M1I9M1I3M1I2M1I14M1I12M5I3M2I3M1D22M3I2M1I12M1I4M1D10M1D3M1I6M1I28M1D4M3I3M1I4M2I6M5I14M6I1M1I15M1I9M6I35M5I2M1I2M1D5M1I6M1I2M1I3M3I8M4I14M1D5M1D15M1I13M3I18M1D7M2I7M1I8M1D6M1I5M1D2M2I8M1I3M2I3M1I8M7I35M1I3M3I11M2D5M1I9M4I11M4I1M1I12M1I6M1I4M2D7M2D8M3I4M1D5M1D24M2D41M1D5M2D5M5D5M5I11M1I3M1I7M4D3M1I2M2D7M2D4M1I4M2I17M3I5M7I3M1D4M1D5M1D14M1D2M4I2M1I3M2D4M2D5M1I8M2D2M3D2M1D5M2I2M2I6M1I5M3I33M2I19M1D2M1I2M1I5M1D14M1D16M3D4M1I8M2I12M1D3M1I2M1I6M1I23M4I15M1D4M2I5M2I22M1I3M2I1M3I7M2I13M2D17M3I2M3I5M2I3M4I1M1D17M1I1M2D10M2I6M3I6M1I4M1D5M1I2M1I6M3I3M1I9M1D5M1I13M5I7M1I2M2D5M5D9M1I2M1I12M1I5M1I3M1I4M2D15M1I5M1I7M2D2M3I9M1D6M2I4M7D8M4I3M1D5M1D1M1D22M1I5M1I6M1I16M3D4M1D3M2D9M1D14M2I11M2I6M1D16M1I4M2I2M1D1M2I4M3D7M2D12M1I1M1I7M1I2M1D4M1D5M4I8M1I5M1I3M1I4M1D4M1I3M1I12M4I11M1D4M1I4M1D4M1I5M1D8M1D11M1I5M2I3M1I3M2I10M2D6M1I9M1D7M2D12M1I14M1I4M1D6M1D5M1D23M1D15M1I9M4D4M1I12M3D11M6I1M2I19M3I1M2I7M2D15M2I13M1D2M1D7M1D19M1D3M1I2M2I2M1I7M2D6M1I6M5I5M3D6M5I9M2I4M2I3M2I7M1I3M5I2M1I1M2I3M1D15M1D2M2D3M3I9M7D3M3I6M2I5M1I4M1D9M2I12M4I17M2I29M3I11M3I2M1I13M1I9M2D6M2I5M3I13M1I4M1I2M3D11M1I5M1I2M1I32M3I15M1I21M1D25M2I1M1D8M1D15M4D11M1I10M2I1M1I5M1I5M1D2M2D19M2D23M1I22M1I23M2D12M1I10M2I1M1I20M3D6M2I2M3I2M3I6M1D8M1I19M2I28M4D15M1I14M2I15M1I1M2I40M2I3M1D5M1D11M6I10M1D7M1D19M1I2M2D33M1D20M2D6M1D21M1D15M1I5M1I5M1I30M3D19M2D21M1D45M2I6M1D9M2I20M2D5M1D22M1I2M1D7M1I12M8I3M3I7M2D5M2D1M1D4M1I1M2D1M3I15M1D3M2I5M1I5M3D5M1I13M2D16M2D11M2I7M1D13M1I30M3D5M1D3M3I4M2I12M1I6M1I6M2D20M3I31M1I9M3I31M2D17M1D11M1D7M1D5M1I37M1I18M4D8M1D19M1I7M3I9M3I16M2D22M3I10M1I3M3I11M1D3M2D5M1I1M1I6M3D20M1I1M1I2M1I13M1I8M1D17M1D13M1D3M2D37M2D6M1D11M1I7M7D14M2I1M1D5M4I7M1I21M1D3M2D32M24D26M1I8M1D15M1D3M2I4M2I2M2I8M5I5M1I9M5I2M2I6M2I19M2I1M4I9M1D4M1D6M1D4M1D17M3D14M1D9M1I4M1D17M1I9M1I3M1I4M1I13M1D2M1D4M2I5M3D5M1D13M4D13M3I16M2D12M1I5M1D4M1I16M1D2M1D4M2D6M2D3M2D5M2I4M1D17M1D18M5I6M2I13M2D15M2I3M1D6M4I1M8I12M1I6M2I6M1I4M1I2M2I1M1I10M1I10M2I7M1I10M13I3M7I1M2I7M2I9M1I8M1D6M1I9M2I1M4I6M1I10M5I1M1I6M2I8M2I26M1D17M1I4M3I5M1I9M1I5M1I7M2I8M3I11M1D4M9I6M2I4M5I7M1D3M1I4M1I5M1I3M2I1M3I3M1I8M1I10M2I4M6I10M1I1M1I19M1I9M2I10M2I18M1I11M3I4M1I3M6I1M1I12M1D2M1D3M1D17M1I2M3I2M1I4M1I9M2I8M1I3M2I6M5D2M1D8M2I1M2I2M1I4M2I7M2D2M1I4M1D7M2D5M1I16M1D34M5I4M1I18M3I1M2I3M1I1M2I6M1D12M3D1M1D3M1I9M1I3M2D2M1D3M1I5M8I6M3I5M7I33M2D2M2I7M2I1M1I3M1D3M1I10M2I2M1I5M1D3M1D9M1I5M2D15M7I7M1D4M4D2M2D4M2D7M1I2M3D7M1D6M1I4M1I9M1I7M3I2M1I9M1D23M1I2M2I12M5I7M1D3M1I3M1D6M5I11M1I7M3I3M1I4M4D10M3I11M4I4M4I6M1D10M2I10M1D4M1I17M2I3M2I1M1I6M1I19M2I5M2D5M2D8M3D2M2I14M1I4M1I1M2I8M1D3M1D1M2D5M1I1M2I7M1I10M3I3M1D8M1D6M6I1M1I14M1I10M1I2M1I1M1I12M2I15M1D6M3D3M2I3M1I2M2I7M3I5M3I31M1I24M1D4M1I16M4I3M1I3M2D6M4I4M1I18M2I6M1I22M2D14M1I10M1D8M7I3M1D5M1I30M2I3M1I6M1I6M3I8M2I5M1I7M1D1M1D6M3I2M1I7M9I24M1D28M2D15M2I58M1I8M1D14M1D13M1I4M1I24M2I18M1I5M4I17M1D4M1I11M4I1M1I30M1I1M2I3M2I2M1D5M1I14M1D6M3D4M3D2M2D10M3I2M2I1M3I3M2I4M1I11M1D7M1D4M2I4M2D19M3I6M2I9M2I12M1D3M1D12M7I3M1D4M2D15M2I3M2I2M2I4M1I10M3I48M1I9M1I4M1I8M2I4M2I9M2D10M1D11M1D12M2I2M1I10M3I12M1D12M1I11M2D3M3I7M1D27M1I9M1I3M2I9M2I2M6I18M2I2M2I4M1I7M1I4M3I3M1D1M1D6M3I6M7D3M1D12M1D21M1I2M1I8M1I1M1I29M1D7M1D1M1D15M1I7M1I18M1I11M2D17M5I19M3I3M2D10M1D6M1I3M1I20M2I4M1I9M1I9M1D6M5D1M1D6M2D5M1I2M1I6M1I5M9I4M2I7M1I7M1I9M1I3M1I14M2I2M2I11M4D2M1D5M1I6M4D11M3I4M1I7M1I12M1D2M2D16M3I2M1I6M2I6M1I3M1I21M1I1M1I3M1I8M1I22M2I10M1D26M8I1M1I5M1D3M1D11M1I3M2D4M1I7M3I2M2I15M1I10M1I3M2I6M1I3M1I11M3I3M4I6M1D3M2I13M4D10M1I10M1I9M1D6M2D1M1D8M4I6M3D6M2I20M3I20M1I7M2I17M1D13M3D9M1I6M1D12M2I2M1D3M2I4M1D9M1D3M1D12M1I4M1I5M5I1M2I6M1D3M1D7M1D7M4I3M1D13M1I5M2D6M3I16M6I3M1D8M2D5M1I1M11I3M1I1M2I2M1D5M2D4M2D8M2D8M1D3M2D2M1D8M1D4M5D2M1D3M2D6M2I5M1I18M1D3M1I5M3I13M1D4M1I5M2D15M1I5M1I14M409S * 0 0 AAAGAACGTTGTGCAGATCCGGTCCTTCTTGTCATGCAAATCACGAAGGCTTTATGTGATGAATCATAGATATAGGTCGGCATACAAATATTCCATGAAGGTTTATAAGTCTAATCGAAGACAAATCCCCATTCTGCAATGTGCGGTAAGAAATGACTGATACCGTGCAAATTATTATCACGAGTACGGTGGAAACGATACTTGCCTCTGTACAAAAGAGGCCAGGCAGCAACAACCCAATATTACATAACAATCCTCAATACGCGGGGATTTATTTTATCTGAACTCGCTACAGCGCCGGTTTTGTTTATGGAGATGATAATGCGATTTCCGCCGAGTCACGGCATCCCAATGCGAGGCCGTGCTTCAACAGAGCTTATCGAAGCGGAGAACATCAACGACTGCTACGACCACTGGATGATATCTGGGCGCAGATAGCACATGCAGACGTAACCAATATTCCGATTAACGAACTGAAAGAACAGGATCCGCCTAGATGCGGCGTTTCTTGCTTTGCGTGTAATTGCGGAGACTTGCGATGTACTGACACTTCAGGAGTGATGGAACGCCCGACGAACTGGTCGTCCACGGAAGAAGCCTTGTTGAACAAGGTTCGTCGATGGGTTCGGGAATGCAGGATATTCCCACCTCCCGGTTACGGATGGAAGAGAGTAATCTGTTCCACGAATCAGCGTAAATAGTTTGACTTAAATCGACCAGTAACAGGTGCTTTGAAGAGGATCATGAAATGGGAAGGAATAGCGAAGGAGAAGGGGAATCGTACGCCGCGGCAGCGATCAAGAAACATGGATATTACTGCTCCACAGCCACGTGAAGGACGCGGGTAAAGAGTTTGGATTAGCAGAGACAGGCGAATCGCAATCACGGCAGCTACAGGCCAAACATTGATGAGTCTTTCAGGACACAACACCCTCTGACAGCGAGAATCAACAGTGATAATTCCGTTACGTTACATTCATGGCTTGATCGCTACGAAAATCCTGAGCACCAGGAATTAGAAGCAGGAGCACCTCGCTCAATTACTGAGCAAGGTGGACTAGTAAGGAGCGATGGCTGCCTGATGCTGATTGAAGACATAGACAAAAGAAATTGCGGCAATGCTCAATGGATACAGAGAAGGCGAGCAATTCAGCTACGGTTAATCAATCAACACTGAGAGCGGCGAGGTGATGCATTCGAGAGGCAATAGCTGAAGGCCATATAACAACAAACCATGTCGCTGCCACTCGCGCAGCAAATCAGAGGATAAGGAGATCACGACTTACGGCTGACGAATCTGAACTATGAGCAATTACAGCAGAATCATCACCATGTTGGCTCAGACTATGCAAATGGAACTGGCTGTTGTTACCGGGCAACGAGTTGGGCATTTATGCGAATGAACCGTCGCGCAGAGCGGGAGCGATAAGCGCTGAGCAAAGCAAACAGGCGTAAAATGCCCATCCAACAGCATTGCATATTGATGCTCTGGAATATCAATGAAGGAAACATTTAGATAAATGCAAGCGATTCTTGCGGAGAAACCATAATTGCCGGATCGTTCTTCAGCCCCAGAACCGCTTTCATCCGGCACAGTATCAAGGGTCTTTATGCGCACGAAAAGCGCAGAGCTTTTCCTTCGAAGGGGATCCGCCTACTTTTCACGCTTGGATGTTTGTTGCACAGACTGGTGAGAAGCAGATACACCGATAAGTTTGCTCAACGCTCTTCTCGGATGAGTGCCAATCGCCTGGCAGCCAGCTTGGTGATGACAGGAGGCAGGAGTGGGACAAATTGAAATCAAACTGATTTATTTGACTGATATGACCTGTTCGTTGCAACAAATTGATAATCGAAATGCTTTTATAATGCCAACTTATAAAAGCTGAACGAGAAACGGACATGATAGAATATCAATATATTAAATTAGATTGCATAAACGACTACATAATACTGTAAACACAACATATGCAGTCATAGCTGAATCGATCTACTTAGATGGTATTAGTGACCTGTAACAGAGCATGCCGCATCTGCTGCAAGGTGGCAGAATGTGTCTCTGCGGCTGACTAGGTATCAAACCTGTCGCATCGAGCCCAAGCAGCACAACGGGGCATTGCAATCCAGGTGCAGGCTTTGTGCCACCCACTACGACCTGCTGCATAACCAGTAAGAAGATAGCAGTGATGTCAAACGACGCAGCTGACTTCTTCTTTCTTCTTTCACCGACTTCCCCACACCCAGCATGCACCTTCCTCATAACTGTAGTGAATGTCTGTTATGAGCGGAGCGGAAGTCAACACTTATGAAAATGGCTACGAAGTCGTGGCTATCTATCGGCTTATTAGTATTTGAAACCCCTTCTTCAGAAGCCTGAAGAGCTAATCGTTCGGCGATACTATATGCAGCATTATGACTATATCGTCTCTATAGACCTTGCACCCATGCGGATCGGCACTAATCATTGGGTGTAAAAGGAAGCAGAAAGGAATATGGAAAACTAATACGATGCCCGTTAAGTTCAATACTACTAATTTTAGATGGAAAACGTATGTAATAGAGAGTAACTTAAAAGAGAGATTCCTCTGTGTTGCTGGGAGACGAACGGGAAGCTTCCCTATCCAGCAGACACGAGATCTACTATATGTTGGAGTTTAGTGTTATTGAAAGAGGCGGGTATATTCCTGCAGTAGAAAATTAAGTGCATTCCTACGAGCAGATGGTTGGAATGACTGAGTTTCCTTTGTTACAATGTTTTATCTTACTGTCTTTGATGAGCAGCTGGGTGAAATGCGATGTAAGAGCCGGAAATGTTAAATTGGTTTGTAGTCAAAAGAAGAAGTAAGCACTTATTCATTAATAGATAAAATTCAGTCAACTCCCTGAAATGTTTTTCCTGCCTGAAAGCATTGACTACTATGTTAATCTCAGCAAATTAAGGCGATGGGTTTAAACATAACCTTCTTAAAGCTATTCAGGATTTAGTATGGCCAAATCGATTAGCCGACATTGAAATGAAAGCGTCCTTAACACCTCATTACTTAGAGGGGTAACTCTTTCAGAAATTTACATGGAAGTTCGCACGTGTGTTAAATGGTTTGCCAGAATTGTCAGATTTCGATTTTGATGCACTCAGGCAAGTGCTCTCCGATTCTAGTGGCTTCTGACTCTATACCTTTTGATGACGCGAGCGATTCGCTGCCAGGCAGAAAGGATGCGATGCTTTATCGGGCGGCGGAATCGGTGGTAAAACAACAATTTTGAATCGAATGGAATGATTGGTGCAATCACCAACCCGGAAAACAATGAATATTTTCTCTGAAATAATGACTGTTTATTACGAGTCAAGAATGCCCAAAGGGGATATTCGGATCGCTTGTTTCAGTTTCTCGTTTAGTGCATTTGATCCTTTACTCCTCCTTAAAGAACAACCTGACCCAGCAAAAGGGCCAATACTTTTATATTGGACTCAAGAATGCTGGTAAGCAATAGTTTAAAATACTAGGGCGATCTCCGCTTAGAATTCGGATTCAGCATTTATTGGTTGTATGAGAGTAGATAGAAAAGACACATGGGCTTGAAGCTATCAAAAACTAAGTAGTAGTGATGAAGAACTTTTCAAATATGGAACTCATCAGCCTCATTTCTAAATAACTGAAGAGTTAAGACGACGTAATGAACACAGATTGCTTAAGTGGACGATGATAAATTCACTAACATTGTTTTATGACAATATCCAGAAATATGCTTCGAATGAGCTCTGGACATGCAATTGGTATTATCATACAAGATTAGTAGATGTCGTTGGCGAAAGTTCGTGCTTCTTTCCCCTGGAACCCGCTTCTGCTCTTCTCCTACTTTGCTAACTCTCTGCCTTTTACGAACATTAAGCGACTTACTGATGCACGCAATCCTTTACCCAATAATTGCCGACTCATTCCCCAGTAGTACTGCAAGGAGATTCCAAATCCTGCATGTGGAAAGTTGGTTGACAGGTCAAGAGAAGCAATAAATATTATCAGTCCGGATATTGAGACATTCGGTGAGAACTGCCTGTTTTAACTCGTGCGTGAGGTTTACTTGAATGACAATTCTGGATAAGGCCACTTATTATCGCAGTCGTTGATTCAGAGCTTCTTATGAAACCATTCGTAAAAATTATAATCCGTCAGATAGCATTAGAAGTGAACGGCGTTTAACGGCAGGCGATAATGAATAGATGAAGGTAAAGAAGTACAATGAAAGCCCTCTTCCATCGAGGAACTTACCAGGGAAACGCGCATAAATGCTCGGAGGCTTGCATAAAGCTGTTAGAAATGACTGCCAGGCCGCTTCCCCAAGAGTGGCGCAGAAAGGAAAGAAGAGGAATATAGGGTCAAGCTCGACAGTCAGTTATTATCTACTACGACAGGACACCCTCTTGAGCCCTACAAACCTTAGTAGTGACTGACTCAAAGGGTTAAATTAGAAAAGCTTTATGAGACTCGTTCTCCGCGAGGACCTAACCAGATTGCGAGGAACACTATCACTTACGATGAATACATCTGATTGTTTCATCAGGGCTACGAAAATGTCCATTTTGTATTAAACACGACAAAATATAGATCATGTTTTCTTCCTATTGCACATTATCCTGAATTTTCGGTGATGCCTATTAATTCTATTCGATCGTGCCGCGACTGCAATATGGGAGAGAAATCAGGGTTACCTGCATAGATGAGTACACCAAGCGATTTCATCCCTATGATGACATAGAAGTCCTTTCAGTGCAATGGGTATACTGCAAATTTTCGTTTCCGGAACTCCCGGGCTGCTAGTTTATGTTGTTGAATGCCCGGCGAACTGGAGGCAGGAAGACAAACACAGAGCTCTTCATCATTTCAAGGCTATTAAATATATTTAGCGGACCACAGACAGGTATCGTTTGGAGCAGGAAGCACTTGAGTGAAGTGATTACTCAACGGAAACCCTTCGTAAAATTAGGTAGCAGGAAAGCCGTAAGGAAGGCACGTTTCAGCAGGCTCACCACAGTCAGAATTTGTATGCGAAGCAAATCTGAAACTATTATAGATTTGAATGACTTCCCCAATTATTGGCTGAGAAACGTATGTATCAGTGTTGCCTAGGCAAACTCGAAGATTTCAGTAGAGGGATCTAGAAAATATGATGAAAGATAGAAATTACGCTTCTCTCGCATGGCATTCAGAATCCTTCTCCTGCGGCTGTTTTACAAATCCGGTGGACTCTTAAACCAATTCCTCTAGCAGGTCATTGGCAACAGTGGCATGCACCGAGAAGGAAGGTTTGTAATGTCCCATCCGGCACATAGCAGTCCTAAGACGGTACAGTCAGTAGGTCGGTGGGAGTGGTACAAATTCTCTCATGCAAAATATGTAAAATCGGCTGCACCGGAAATCATTCAACATCTCACAAACTATCGGGGTTCGATAGCCAGCCGCCAGCACGTTCCTGCATACGAAGTGTGTCTGCGTCGATACCATCTCCTATGAGCAACGTGTTTAAGAGCCAAGCCACAACCGGATTTAAACATAATGAATGATAATAATAATATTAAAATTTCCTGTTGACTAGCATTTACTATATGGTTTCTGATAAGAATCATTGCAAAGATCAACAATGTATCACGAACCAGTACAGCAGTGAGATTTGAGCCCTCTAAAATATCAGCATCTAGCATGCATCTATTAAAAGGGCGAGTTTATGACTAAAAACCATGGGAAAGAAGACTTAAAGATTTATCGCACTTGCTCAAATGCTGCATTGATACATAGATTTTGTAACGGATGCTTATGACATTATTGGATCATAATTCCTCTCAAACCGCAAGAACAGTAACATTTATTATTCAAAAACAAAACCAGATTATAGGAGTACTTCTACCTCCCTGATAATGTTATTGGCTCCTCTGGATTCCCACTGGCTCCCTTAATGGCTTGGGCTAAATTCTCTCGCAATACGATAGAAAACAGGCGATTTTAGAAATGTATAGCGAGGGCGACACGAGCTCTTATTTCATCTTACATTGAAGAAAATGACATTGAGTTTATTACAACATGAAAGTATGTTAAAAACATTGGTATAAAATTTAGTCAAGTGCACAAAAGAAATTACCTTCATATTTAACTGAATCATCTATTATTAAATCGAAAGACGATGGGTCGCTAATACGCTAAAGATTACGAATCATTACACATGCCTTAGCTAATCTATGGCAGAATGTATAACTGCTTGGACTCTTGGCATACAAATAAACAATTCAATCCTGACGATGGGTTGCCCAACATCCATTGCCACCCTTGGTCTGATGAAGCCAGGAGAATAACTTATTTAAATTAAAAGATTACTCATAAGCAAATTGTCATACATTTAGCATGATACAATATGACAATAAAATAATTCCTGAAGATATTAAATGCCCGTACCTAAACTGGTAGATAAGCCTAAAATATCACTTCTCGACGAAGGAGGTTAATGACCAGCCAAGCTATGCAGAAACGATTTAAAGGAAACGGTTATAGATTCAAACATTAATTTCTCTTGATAGTTCCTTCCATCCCTGCCTTCTATCAATACAACATTTGAAGATTGACTAATAAGAACTATCTTTGGCGTTATGCTGCAGCTGACAGAGCCAAAATAACAAATGCCCCTGGCTTCATTTGGGAACTCAGAGCTGGCTCAGAAAGCAAGGCATCTACTCCAATAAACGATTACCATACAATGCCAACTAGATGAAAGACTTCAGGTAATTGAATTGATTCAAATAATAATAATCAAAATGTGTATTTCATGGAAATAGTTAGAGAAAACGAAGAAAAACCGATTTAGAAATATCAACAGCAGACTCAAACATGACGAAAAACCATATTTCATATGCGTTCACGGTCTTAACTTAAAGCAATTGGCGGTTGATGTAAAGAGGAGGAACGCATTCCAGAGCGAAAAACGGCTTCCATCTCCTGAAGATAATCGCCAAATAAACCAATACTCAGGCTTTTACAATCACTCGACTGACGCCACGAACGTTATTTCATAAACGTTTTCTGCATATCACAAACGATTACTCTGATAACAGGGACAGCAGGCCACTCAATATCAGGCTGCAGTTGATGTATCATCAACGGTTCAGCAACACCGATACTTCTTCAGGCTTCAGCAACGGAGAATTCTTCCTTCGTTGCAATTTCCAGATCTGCAGCATCCCTGAAGCGGCATTAATGGCTATGCATCCACTGATTTGTTCTTCGCTCCTCCTCCCCGCTCCCCATTTCGCCCTAATTTTTCTCCGTATCCTTCTCACGGAGCTGTGCGTTCCATTTCTGATGATTCCCCTCCGGCGATAACCAGGTCACACCTTTTCCGGTAACGACCGAGTTGGAAATAAATAACGCGTTATGCCCGGAATGGCCACGTTCATAGACGGTTTTACCCCGATGGTGCTTTCAACGAGATGCCCACGATGCCTCATCACTGTTTGAAAACAGCCACAAAGCCAGCCGGAATATCTGTGCTGCAATATCGGGTACTGTTGCAGGCAGACCGGTACGAGGCGGAATATGCGTCACCTTCGTACCAAATAAATTCATCATTAGTTCCGGCCAGCAGATTGACATGCTGGTCGTACTTCAGCCATTCATCGGCATCCCATTATGCAAGCCTCAATATAGTTAAATGCGAATGTTTGACGTGTTCCGTTACCCTAGAGCAACGACTGTGATGTGTCCGTGTGAACCAATACTGATGAAAGAATGGGCATGAGCACCGATAACTAAACCGGGATGCTGGTGCCGGCAATACCAACTGTCTGCATCTTGCAGCACCGGCACTCAACCGGCTGCATACCGGACAATGCTGACTGTGGCTGCCTTGACTTGTCCCAGCTGTTTTCGATAAATAAGCAAGCCCTGTGCGGGTTCGCCTTTAACTGTGGATAACTTCCTGCAGTAATTGATGCTGTTCATTTCTCATCTCCCTCCCCGGATATTCCTTCCTTCCTGATGCTCTCCTTAGCATCTCAGCAAGCACCGCGCTCTTTGAACCGCTCATAACTGTGAGCAGCCCCGTTGTTATTCGTCGATTTTGGCCTTTAATCCCCGCAAACTGCCTGTGTTGTTCGTCCGTAATCAAACGACGATTGGTTTTCGTCCCCAAATCCGTAACGGATGCAGACTGGCACTGTGGGTGTGCGACTTGTGGATTCCATCCTGATGTTCCTGAAATACATGCGCACGACCGCTCTGGCGGTTTCCCCTTGATTGTCCCTCGCATATCAGGAAGCACACCGATGGATACGCGACAGCAAGTTTTGGGGCCGCAGTGGGGCGAACGCCGCGCGCGAAGCGAAGGAAGCGGCTCAGACCGAACGATACGCTTACTCTCACACGGGATCGGCGTACTTCACGCGACGAAAGGCCGAATTCTCACGGCCCAAGGGTATTCAGAACATCGCAACGGGAATTTTTGCCAGAATATCCCTGCCAAGCTTCAGTTCAGGTCGGCTGGCTCGTGCATCATTTTCCGCAAATACATGTCAAGTTTTGTTTCTCACGAGGTTAGAACAGC * tp:A:P cm:i:85 s1:i:769 s2:i:0 NM:i:2506 ms:i:2208 AS:i:2192 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
85 77 0 utg000001l 28921 60 71S7M1D4M2I14M1D10M2I2M2I1M1D4M2D29M2I4M1D3M6D6M1I6M1D6M2I9M5I5M2I6M1I2M1I3M1D1M1D31M4I8M1D6M1I2M3D2M5D10M7I2M1D7M2D3M2D11M9I2M1I11M1D9M1I8M1I13M1D6M1D15M1I12M3I15M1D5M1D8M1D9M2D12M1I7M2I7M7D4M1D2M4D3M3D7M3D4M2I1M1I8M1D3M1I3M1D10M2D6M1D5M4D8M1I2M1I1M2I1M3I8M1I1M2D9M1D11M4D11M2I3M2D15M2I9M6D1M2D3M1I5M1I1M1I2M1D9M1D10M3D2M2I3M1I2M1I7M2D3M1I26M3D8M1I7M3D6M3I7M1I23M2D7M1D18M3D9M1I9M1D9M1I8M1I4M1I6M2I3M1D10M1I13M3D3M2D21M1I11M2I6M1D5M1D3M3I7M3D7M1I9M1I18M2D9M3D9M4D6M4I6M1D4M2D6M1D8M3I2M1D6M3I9M1I4M3I3M3I25M4D3M1D5M3I4M1D3M6I4M1D6M2I6M2I1M4I5M1I10M4I2M1D8M2D17M11D10M1D9M2D3M2D1M2D3M2I8M1D3M1I16M1I21M2I6M3D9M1I3M4D6M1I4M1D5M1I23M1I18M3I4M1D23M4D10M1D9M2I25M1I16M1D8M1D7M1D3M2D11M1I15M7I22M1D4M1D6M4I7M1I2M3I6M2I26M1D1M2D12M1I4M2D7M1I4M2I2M1I2M4I5M1D5M1I2M1I4M2I5M1D2M1D3M1D6M2D2M4D16M5I6M2I8M3I6M1D5M1I12M1D5M1I7M2D2M1I9M3D17M1D11M1I17M4I8M2I13M1I5M1I3M2I8M1I8M1I8M1I8M1D1M2I9M1D5M1I5M3D7M1I17M1D2M3I5M6D3M7D3M1D7M3I14M1D9M1I20M1I2M1I4M2D11M1D5M1D2M3D4M2D6M1I1M2I6M1I12M1I1M1I3M1I14M1D12M3D8M1I3M5I14M2D4M1D2M1D4M1D11M1D2M1D6M1I11M1I2M3D21M1D14M1D8M6D15M1I5M4D3M1I3M1D10M1D4M1D1M1D1M1D5M1I8M1D3M1I2M5I15M3I7M2D9M1I6M1I2M2I5M5I2M2D7M4D3M1D3M5I11M2I6M2I9M1I11M1D4M2I2M1D3M3D5M1D6M1D5M2I2M1I9M1I9M3I3M1I1M1I2M5I4M3I11M1I10M1D4M2I3M2D2M7D11M1I4M2D1M1D3M2D3M1D2M1D1M1D3M4D2M1D25M1I11M1I5M1D12M1I5M8D16M2D10M3I10M3D7M4D6M2I13M1D4M1I16M1I2M3D10M2I13M2D2M1I2M3I5M2I1M1I3M1D3M3I8M6D8M1D5M1D7M4I9M1I1M2I17M3D1M1D13M4I6M2D5M4D10M2I1M1I2M1I4M4D7M1D9M1D8M4D8M2D2M1I11M6D3M1I1M1I12M1D5M1I9M2I7M1I3M1D14M3D7M1D12M5D11M1D4M1I11M1I6M2I10M1D7M1D3M2D8M2D2M1D4M1I5M2I19M1I5M2D1M1D2M2D4M1D6M2I13M1I1M2D2M3D2M1I7M3I5M1D3M3D8M1D2M1I1M1I1M3I14M1D8M1D1M1D4M5D5M2D2M2D11M2I5M1I9M1D7M4I9M4D3M1D6M1I9M2I3M1I1M2D12M2D8M3D7M1I4M1D13M2I16M1D10M2D2M1D27M3I4M1D3M1I22M1I6M1I6M1I5M2I11M1I4M2D4M4D14M2D8M1I11M1I19M1I36M1I8M1D2M1D2M2I27M1I4M1I5M1D8M2D5M2D5M1I8M3D9M2I1M1D5M1D9M1D12M1I17M1D2M1D12M1D1M2D9M1I6M1D1M2I3M5D5M2I24M4D5M1D1M2D4M1I5M1I2M4D2M1D2M2I11M2D11M2D6M2D11M1I2M1I8M1D4M2D15M1D11M2I12M11I15M1I9M4I3M1D4M5D3M1D8M1I21M1I8M1I17M1D5M1D5M2D2M2D17M4D8M147S * 0 0 GTCGTGCGGCCAGTCTCCTTAGTTATGGGTCCCCATTACCACGTTTCCCGCGACCGCTGGCAGTGTCAACAATACGGGGAACATAGGTGTACCGCCTCGTTCGCCCCCAGATAGCTAAAATCGCACCGTTCATCAGTACTTTCAGATAACACATGAATACTACGTGCTTAAATACGTACGCTTACTTCGAACCTAGAGGTTCCTACGGAAGCAGCACCACTATCTGGCGATCAAAGGATGGTCAGTAGTGGGTCACGTAACACGTGATGACGGCCGTTAGATAGACCTGCTTTCGCCGGCCGGAAAACGCGCAGCCGCGCGCGCTCGCCGCTTTACAATGTCCCCGACGGATTTTCCGCCCTCAGCGTACCGTTTATCGTACAGTTCAGCTATCGTCTACACATTACTGAGCGTTGGAGTCGCATTCACACTGCCACTGATATCCGCATTTTAGCGTCAGCTTTCCGTCCGTTAAGGAAGGCCGATTGCGCCGCCGTAGTACCGGGGTCAGGCGGCTTCAGAATAGTCGTTCACTGAGAACGATATCTGGTTATCCTGCGCCAAACATCGGCGTTTCATTCCCGTTGCCGGGTCAATAAATGCGATCTACGATTGGCGGCAACCGATATACGGCCGTTTGCTTCCTCCGTGTCCTCCATCATGAGTCAATACCCGCGACATAATGTTTGCCGTCTTTGTTGGTCAATTTTGACAACACGGTACCGGCATTCCACTTATCACTGGCATCCTTCCACTTTCCGAATCTCCTCCAGTTAGCTCGTTATCCTCCGTCAGCTCACTTTCCGACGCAGCTCCTTGCCGGAGCGGCCGGATCGGTTATCTGTGCCTTTGAAGGTGAGACCTTCCGCATCATCGCTCACGCCGACCGACGGCCCTCCACGAATGCCGATTTGCCAACGTTCACACTGCGGATATAAAAGTAATAATCATCGCCGTTTGATATTACTGGCGGGTACAGAATCCGCCGTACCAATAACGCGTTAGCTCAATGTTCATCGCACTGTCTCTGTAAAGAATCAAATCTTGATTTTCCCGATAAACGAACTCATCTGCGTCCTAGCGTATACTAAACACTGAAGATGCCCGGCGTCAGAATTGACGGATTCTCTGAGACCTCTACGCGGCGTGCTCAATCTAGGTCAGTGCGGCAATCCGGAACGATACCGACGCTTAATCCCTGCTGCCCCCACGCATTTACCGCCCGGACTGTCAGCCTGTAGTTCCCCAGCGCAGTTGCGTGGAAGCAATACTTATGGTTTCCGTCGTCCGTCCGTTACAACCAGCCCGCTCACTGCCGTCGTCTTACGGTTACCACGTTTAAGCTACCAGGAAACGCCCTTCACGCCCTCGGCTTGTCCCCATCACGCCAGCACCTGATATTCCGCTGTCTGCAGTACTTCTGCGTCGGGTCAGGCGCTGGCAGCGGCGTGACACCATTCACTTCACCCCGTGCCACTCTGTTCGCCGTCAAGTGCGCCCCGGGCGTTATCTACGATGATGGCCTCTCTTTTCCCTAACATGCTGCACGGCGTTGGCATACGTGCCGTCCGTTCTCTACGGATACTCACGACGCAGCGGAACAGTCCTCGCTGGCGCAGCGTCGAAGCCTCTCCCATACGCTGTATCTGCCTCAGCAACACCGTCAGAATAAACACTATCATTTTACCTTCACGCGTAGTGACGACTAGCAACCTCCACGACCCACTTGCCACTTCCGTCAACCAGGCCGTATCAGCGCGGTACCTAGAGGATGGCAAGCGTGATTTCACGTCAGAGCGGTCCGAGCGTCAGCGTCCGGGTCTGCTGTTCACCGCCAGCACGACCACCCCGTGATACCGGCATAGTCATCGACTCGCAGATTTCAATAACCTCACATGTAGTGACGCGGCCTTCTGCGCCGACGCTGAAATCCACGAGTCTGCGTTTCCAGCAGTTCTTGTTTTAATCAGCCACAGCCGGCCGGTGCGCTCCGAGACCTGGTACCAGCCAAAGGCAGTACATGGTTCGTAACATTACTCGTAACGGGCAGCCGGCGGTTATCTTCAACAAGCTCTGTCGCCGTCTCCCAGCCGTTGTTCGGGTCAATCCAGGTCGCCTGAATCGTTATGAAGGCGGTCCTTCAGGGCTGAAGCTGTAGCGGACCTTAGCGCCATGAGCATCCAAGCATACAGGTATCCGGTTATAGTCCCTTTATCTTAAAGGTCGTCTCTGCACGGCACGAACGTCAGCGTCTTCTGCCCGTTCCCTCCAAGGCATACAGCGCATCACCGAGCAGAAATCAGCCATCCGACCCACCCCTTACGTGCTGTGTAGTCAGGTACGGGATTACAGGTATGCCGGCCCGGCGTGCGTCCGCAGCCAAGGCCGTCCGACTAGGTGGCAGTACGACTCGAGCTATAAAGATATCGCCATCCTCGAGCCATAGTTCCGATGCCGCCCAATTCCACGATGACCGTCGATATTAATCCCACCCGATACATGTTGTTGCTGTATCCCACGTTAAACGTTCCGTCCCATATCTCCGTATTGCCGTGCGGGTTATAGTTTGGACACCCACCTTACAGAATACGCCGCAGATACTACGTTGCCCTCCTGCTGAGCCTGCCGAACTGCTCCGAGTCTATGCACGCCGACCAGTGCCGTGTTCGGCTAACTGTTCACCGGCCATTATTTCGATAGAGGTTGACGACCAGCGTTTGTTCTTGGTGCAGCTCAGTCGTGGTGCTGTCCGGCGTCATCCTGCGCATCCGTGCAGATATTAACGGGCGGCGGCATTAGCTAGCCCACCCGGCTAGATACTGCAGGTGGTTGGGCCTTAATGGTAGTGTCTTTCGTCACCCAGCCGTTAAGCCGTTACGTTGTATCTGTGAACCAGGCATATAGACTTCCATAATTGGTGTCACCCTTTGAGTTCCACCAGTGCTGTACGCAGGAAGGTAAAGCGCAGACGGTCGATGTTGCAGACGTAATGGTGCGTGATCGGGGGTCACTTTCTTCACTTCTATTCCGTGGCAGCTAGCCGAGGGTTATCAAAGCGCGCGGTCAGTGCCTCCGGCCGTTCATCGACATCACCGACGATAGAACACCGGATATGTTGGCTTCCCTCAGTGCCTAAGCGTACTGTTCAGCAGCACCCTTTTAAGCCATCCCACCCTCTTTCAATCGGTCGCTGATGACCATCGATCGTACACTCAGCAACTGCGTGACTTCAGGTCCTTCGCTTCCTAGCGGGGTCCCTGCTTACTGCTTCCGTTACCATTCCTCACTCAACAATGACAAAACCGCCGCAGAGTTCTCGCACATACATTTTGCATCACCGTACAATCACCACAACGATGACCACCGTCCTCCCTTCGTCTGCCCGTTGATGGGGGAACCACGCGTACCGCCGACGCATTCCCGTGACAGAACAAACCGACCGTTCTGCCCTGGGCAACCATGTTATCCAGTGAGTAAAGAACGGTGTTCTGTAGTACCGTTATCCGTTGTCTGTGACCGGGGGAGTCCTGGCTTTCGGTGGCCATCTGCCACACCACCGAGCATACTGGCCTACGAGAAAACAGGATGCCGTCATACCACCGGCCCCAATGGCTGCCCCATGCTGCAAGGGTGAGGCGGTAGAAGAATACCTTAAGGCATGGAGGCAACACCGTACGAATACGCCTGACTTATCGAGCGACTCTGAAACGATATGAATTACCGCCATCAGGCAGTCTCATGTAACTGCGCCGTTTGGGCACGAGTGCTGACCTCGTTGCCCGGCAATCCTAGGTCTGATACCAGCCCGTCCTGAGTTTCTGACGAAACGCCGGGAGGTGTGAGTTGCCGTGCCATCGCTTCAGCCCCCGTTTTCACACGAAGGTCGGATGCGGCGACCAAATCGTTGTAAATCCCGTACGGCATGCGCCATGCCCGGTGACGGAGTGTGCGTCGGTGCCATTTATTCACCTTGTATAGTTTTAACAGTGTTTAAGGAAGTATTGGCTAGCCGTCACCAAAACTTAGATTAAGCGTCCAAAGGTGAACAAAAGGCACAGCAGCGCCACATCGATAGTGTTAGAAGGTTTAGTTATCC * tp:A:P cm:i:15 s1:i:173 s2:i:0 NM:i:1317 ms:i:798 AS:i:790 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
86 78 4 * 0 0 * * 0 0 GTCTGTTCTGTGGACGTGATTGCGAGCGTGTGACTATTGGGTTTAACTAACTGTGTATTCGGTCCGACTGACGAATCCGATTAAACGGACGCCAATGTCATGAAATGCTGTAACGGACGCAGGACGCTCTTGGTTCTGCAGTATTCTGTTACCAATCTCATCAAAGCGGCGTTGGTATTAAATGGCCTGAATGTCAGCTCGTAGGACCCCTCCATTGGATCTCAACTCAGGAGCATGGAATGGTTCATGATCACGAGATCGAACCACTGACTCATGACTCCCACCGCTATTCACCCCAATTAACGGGTTTCTGTCTAGACTCTGAAACCCCGCTCGGCCTCCAATATGTATTAATTAATGTAGATGGACATGCTGACGCCAGCCTTAACGATCCTTATATGCACCGAGTTTTCGATGCCTTGAAACTGTTGTTGATGCTCGATTCAAACGCATCCTGCAGTGGTTCATGAATGCCATCGACTCCATCCTCGGTAGCGGGAAACGAATTACCGGCTCCAACTCAACCGGGATATTCGTCGGACTATCTCATATCATAAAATGCATCGTGCGGTTTGACGCCGCTGACTAAGCGACTAAGTCGACCCAACGATTTCGTCCTTGACGCTCGCACCACCTGATACTACTGCATCCTCGACGGATGCTCCCTTAGCGTAGCTTGTTGATTCAGTATGATGCATCTAATCTGACCAACGAACTTCTTCGTGACTTTGCCATTGCACGTGAACTGTTGCATACCCTTACACCTTCCCAATCCTTTGACGTATAAATCCGATCCCCGTGCTGCCCTCGTACGCTGTATCGAAGTACTGACGCCGCATCTGTAAACATACTGCATAATGCTACGAATTACGGAATGGATCACTTAATGACTCCGACTGCCAACTAGATTCATCGCCTTTATGCAAACCAATGTTCGTGGAACCCCTTCCTACGGTAAAATGGATATTAAACTGAAGTGGATGGCCTCAGCGGTAAACCCGGTTTAACTTTTTAGACAATCACCGGCTTTCCGGTGAATTTCGCCACCTTTCCACGACCGAATCCTGAACTGGACTAATCGATTCCTAAGATGGTTGCACTCGGCCAAGCCGTTGACAGGATAGACCTAGTTGGACTGCAGGGAGGAGGACTCATGAAGCTGACCTGGGATCGACGCCCATGGCACCCCGGACACTGTTTCTAGCATCCTACGGACTCTTATCCCGAGGTCGTCCGGGCTACGCCACGGCCACGCCGCAGCGCTTGGATTGACGCGTCCGTTGGACCCCTTTCGAGTTTCAGGGGACGCAACCGAAGCGCGTAGCACGGTGGTTCGAGCGGGCCATTAACTAGGTTACTGTACTTCCAAGCGCTCCCACTCGGCCCGTATGATACTCCGGCCCCCAACGCCTGACCTGGAAGCTGAGCCCTGGTTGCATGAATTCGTCATCGAGGAACTTACCACTGGTTGACAGACTCGCGGTCCGCTGGTCACGAGACGAATGCCCATTCACGGTTTCACGAATCTAACGTGACGCATTTCAACCAATCGCTCGTAATCCAATTAACGCCCGCAGCCGAGTCTACATTTCCTGACGGACGCCAAACCCATCGTTCCATTAACTTAGAATTCTATCGCTGGTTGCCCGCATCATGTAATGGCAACTGCTCAACGAATTCTGTAGCAACCTGAATTAACAGCCAGGTGGCGTGGCTCGTAATCCTGCCACGCGGATTTGATCGACAGATGCCACGCAAAATAATGATCAGGTACCGATTAAATTCCCCGTATGCCATGGCTCTACTGATGGAATTAAAGAACTCCCGCCTTCAATGGCCCGGGAGGAAACCTAATTGGAACCGCGATTGGGCAAACGGGTTGTTGACTCGTCGGACCCCCTGGTTAAACCGTGGACGCCGTCCATTCAGCACGGAATTTAGTACTGAACAGGCTGGGGACCCCAGCATGAATTCCGAGACTGACATCCGAAGCTGCGAACCGTCACGGATCCCAATTCTAACGTTCGTAACCGTTACCGTGGCACGCATCCATGCCAAGAGGGAATGCTCTAATGTAGTACTAAATAATGGACGCTCATGGACTATCTCTTTGCCACGATATATTTCCCCGATATTTCGCCCGACATTCAGCGTTAGATACGTTGCGCCCGCTCCTAAGGCCGAACCGAACCCTACTGGTACGGTCTCCAACCACGCGACTCGAACCAAGCATGGCGAGCGCTCCCACGGGTCGATTGACTGACCAAATCCGAGCACGGATTAAGAATAATCTCTGGCACATAGGTCAGGACTCCGGGGGAATGCCGTGAAGGGTCACCTAGCTGAGTCGAGTCAACGCATCGCCCTACATTCACGAGTTTGCACGGGTTAACAATGGGACGCAGCGCAATGACCTGACGCAAACTTTAACTTCCTGTAGTTACAATTGCTAGGTCTACTCAACGCTGAATCCTAGCGCTCGTATGGGAAAGCCGATTACTCCGAATAAGGTACCGCTCCTGTTCGGCGATTCGTTCGTCAATAGAATAATGTTGGGAATCGCCGCGATCTATATCAACGCCACCGCACTAAACTTATCGATCTCACCGCCGCTTGACTCGAGCGTATTTGGTGCGATGTAGCGAGCGCTTGGATCTCATGCAAATGCCCGTTCTCCCGCTTTTCTAACGTACGAATTTAAACGTATTCCATAAATCGACATTACAACCCCAAATGAATCGCCGACGCATTACTGGCCCAGCCTTGGACGCAAATGGTCCGCCTCCCTGACGCCAATCCCAGCGCTGCAGCACCGCCGGTGCATTATTGCAACTCCGTACGGATAGTGGACGGCGAACGTAAACCTCATTAGCAGTGCCGCAATTTGTAACGCGTGATTCAAGGGGTCATCGCACGTAACGCAGAGCGCACTGAATAAATTCATCGTTGTATTTGGGGATCGATTAGCATCTCCGGGGCGTAACGGATTAATTCCGACCTCCCCGCAATCATTTCGTCTCACTCCGATTCCAACGAGACGGGACTTTCCCATCGACGTTCTGTTATCCGAATCGCTGGAGGCCAGCAACTCGCAAGCCCTCACGGCACGGGTTATCCCACGGCACTGTCTGTTAAATTGGCTGGAACGCAACGTAAAGCTGTGCTCAATTGGAATCACGAACGTGTTCAAACTTATCGCGATCTAGAAGCCAACACCAGGATTTCGACTAATTTACGCGATGCTAGTTGTCGGCCCCTGGAGTGATGGTACGAAAGCAGGGATTCCGACTCGAACCAGCGCGACTGACTCCCTAGGATCCGTTAGTATCGAAGCCGGTGGCTTCAATTCTTGCTTTACGACGGGTACGTTCGGACCTCATGGTAAAGACGAAAAGCCTAATTCCGCTCGCTAGCGGTGCTGAACGCACGTTACCGTAAAGCCAAGCCTGAGCGAATTTAAGCCTAATAGGTCCTCAACTCCTTTGCCGTAGATTCTATAACGCAGCCCCGAATGAACTCAGGGACTCTTAGGATTCACGCTCATTTAGGCTGAATGCTCCCAATTCAAGCCCCGTGCACGCAACGGACGCTACGCACTGAAAGGACTTATCGCCACGAGACGCCATCTCGACTCGCCTGTTCTTATTGGGATCCCTCCAAATAAACCAAGCAGTTCGACCACCGAATCGGACGCAGATGGCAAGCTCCTTATTCTAGGATTCCGAACGCCGCAGGATTTTGTTCGTCCGTTACCGCAACGCAGCGGACCTAGACTTAGATAAGGGGCTCCTCGTATGCCTGAAGTCTGAATCAGTCTAAGCCCAAACCATACGCAGCCCTATTGTTCAAGATTGTCGACGTGTTGCGGTTAAAGAGTACCGGTATCTCCGTAATCTATCGCCGATCCGCATCGGCGCAATTACCTCCACGCAAATGGATCGGAGCGGCAGCGAGGCGATCCCGAGGGACCTCACTCTAGCGATCCGAAGTTTGACGCGATACCTTTCTATTAACGCCTGGAATTAACGGAAGCTCCATTGGGCGTAACATGGCTGACGGAGGATGGACCATAACCGGCAGCACGCCTAACGCCGAGCCAGGAGCGGGTCTGCTGAACTGGAAATCTGCGCCGCGTGTTTCCTACGATCGAGCCGGACAGCAAGTGCCGGGTACCCCTCCAGCGAAATCCTGGTATGCCGCGACTGCTTTGACCCACTTCATCTCCAAGCCTAACGCAACGCCGTATTTAGACGACTCCCGCAGCAACGAAGTTAATGCGACGCATCGCACGTTTAAGTTTCTGACGTACTCCATCTACGGCAAACCTGTTATTATCGCACTGCCTGACTCTGGAAGTTTCTTAAGCGATTTTAAAGGTGCCCGAACCGACGCACGGACCCGTTCAACTATCGACTATGGATCGCATCGGACCACGCATTGGGATCGTAGCTAATTCCATGCCAACTCAATCTGCACTGATTGGCGCCTGAGGCAACGTTTGATCGCATCAAACGTCGATCGTTGTAGCTATAAATCCTATATAGGGTGACGATTCCTCGAGCGTCGTCGCCAGCGATATGCATGTAGAATCTGTAAGTTGCTAATAATACCGTTAACTCAATACGTGGGTACTTATTAGACTGTTCTTTATCCATATTAACATAGACCTTGCTCTCCGTTGAGACCTAACGCTTGCCAAGGATTTGGGTGAGCGTAATGAATTGGTTGAGACAGAGTTGGACTAGGTAAAGAATTATGCCGGAGTTAAAGTCGAGATCCATTGTTTACATGCGGCTACAGCTGTTTATGTAATACCGACTCATGGGCCGATCCATACGGTATCCCCTGAAAATTTAGTTGGTAAACCCGATAGATCGCGGTCTGCGTACGAGTACTGGTGACAGTTCAAAATTATCACGATTAGGTTGGGATAGCAGGTGGTTGCTAACTGTACGCTGACGCTCGACAGCTCCTTATAACCTAAGAAATATCCTATAGATCACCCCTCTACGGATTATTTCCTGTGCCAAACCTACTAGCTAAAGTTTGTCCAAGTAGTGAAACGTCAGAAGAGTCTAGGGATGGGCATCTCTCAGGCGAGCCGGTTCGCTCGCGTGGCCGAAACGCAATAACAACTTACTACCCTCACTGGGAACGACCCCTGCAGAGCTACTGGCTAATATTTGAATGTCAGGCGTAGCGGCTACGAATAAATGGCCGTTGGTCCGATTGGGTCCCAACTGACTTTGCGCCATTGGTACCTTCCGGAATTGAGAACTCAGCACAGCAGCGTCCAAAGAGACTATGCAAACGATTCGTCAATACTTTGATCGGGATTATGAAGAAATGATTATTTACCTATACCGGTTACAAATGGAAGAATATCTCTGTTTACAGAATCGAACCTACTACGTGACTTAGATCAGCCGTACCCCTGATAGCTTTTGAGGATACGAGTGAAAGCCCAGAACCGTTAGCCTCGGCGGAATTACCGACCTTTATAAGAGCTAATTAAGTACTATCACAGCTACAACCAAGACAACTAGGATTCCATTAAGCGAGGGCAGTACGCGGTATCTATGGCAACTAACAGGCTCACTTGAATCTGTTTCGCTCACAACATATCTCACCAGTGCTCGTATAGAGTTCACCACGTTTGGGTTCTCATAGCTCTGTTCGACCGTTATATGCTTAGATAGCGAGCCGCTATCCTGGCCCGCTAGGAATCGAGCGACGCTCGCCTAAGCCGTACGGGCCGTACGACGATAGGAGATTAGGTGACTCATGCGAGACGTAACTGACAGAAATTAACCGGTGAGATTAGTACCACGGTGACGAGTACTCGACACCAAAGCAGGCACGAGTCAACTAAGTCCTGTACGAATGGGCTGGATGCATTTAGGGACGCGATAATAGCTGGAGCAAGGTGACCTGGGACTCATGTCACGGTGTACGGCCCAGCACTGCCATCGGGGAGAATGGATCATCCACTCGTAGCAAACCTACAGATTATCGAGGGCAAGGCCAGGGAAATGATAGAAGTCTAACGACTTGCAATGACCGTGGCCGTATTTGACCCTAAGTGAAGCCAACGCAAGTTGGTATCTGCGAGTAGAAGTAAACAATTGGTACTATCGTTCTAAATACTCGTATTTATGTCAAACAGCATCTAGGATTATAGTCCACTTAGAGCACGCGGTCCCATATTACCTTAACTCGAGGATTAGGTGAGGAAATAGCTATCTAATGCGACGAGTCTTGTACCAGCCGGGAAAAATTGCGGTATAATAGTTGGCGATAGGCTTTCACGTCAGAGCGCCGAGTGGGTACACGACTTTTATGCACGCGGGCATAGGCATCGCCTGTATTTTAACTTTACGAGATGAGGCGATTAAGCTTCGACTCTACGAAGTTAAAGAGTTTCTGCTATCTATGGGAGCGAGCATTAGTTATAGGTAAACTTTAAACCAATAAATCCAAACTACGAACTGAAATGAGATCTCAACTGTGTTGGTACGGGATTGTACCTATTGAGGGTTAAAACACTCCTATTTGTTATTTCTGTATGATTAACTCACTGTAACGTTCGTTGCGGCCGTACTACAGTACGTTATAATGCCTGTAATAAAGCTACCGAAGTGGCAGTAAATTAACTATATCGACGTATAATTAAATTAGATGTTGCGGCCTATTAAAGACATCTATCAAACACATAGGAAACTGCATTGACACTGAATCAACACTTTAAATTATTAGTATGAATCTGAGCAAAGAGCATTAGCAGATTTTGTGTTAAATTCTAATCGTGACCTGTTACCGGTATGACTCCGAACCTAAAGCCTAACACCACCCCAATCCGTGAGATAACATAGATTTGTGCCCCGCCACTAAAAACCATCGCGTAGGCGACTGAATCTAGTCATGAGCAGCATTATTCTTTCTGTCAACATAATTTTAAAAGACGCGTATCATACCTTTCCCACGACTTATACGTG *
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
87 79 16 utg000001l 40502 60 1266S14M1D2M1D3M2I8M1D3M2I24M1D3M1D7M1D10M3D10M2I3M1I2M2D8M2D5M3D2M2I3M1I14M6D14M1D24M1I6M1I7M1D8M3D4M1I1M2D2M1I5M2D6M2D14M3D21M1D16M2I31M2D9M2I2M1I1M1I8M1D17M4D8M3D2M1D15M1D2M4D5M2D2M1I17M1D7M1I1M1I5M1D15M2D11M1I2M1I18M1I13M1D34M1I5M4D30M1I2M3D1M4D31M1I5M1D8M2I3M1D9M1I12M5D7M2I13M1D15M2D7M1D2M2D11M2D2M2D3M1D47M1D7M1D15M1D10M2I26M1I17M1D8M2I3M1I10M1D4M3D15M2D17M2D3M2I2M3I14M1D2M5D8M1I19M10D7M1I14M5I3M1I1M1I4M1D10M1I1M2D8M2I1M3I6M2I2M2I9M3D9M1D22M1I16M3I1M1I6M1D2M1I3M1D20M2I5M1I11M1D23M1I13M1I8M1D9M4I2M1D7M5D18M1D8M1D3M1D31M1D32M1D3M2I12M1I5M1D24M2I4M5D2M2D17M3I1M3I8M1I6M1D14M1I2M1I3M2D11M4I27M5D5M1I5M1D3M1I1M2D13M2D9M1I12M3D11M1D7M2D21M1D4M1I21M3I5M1D14M2D5M1I23M9D16M2I3M2I23M2I1M2I30M1I54M2D9M3D8M1I4M4D3M1D12M1D4M1D2M4I6M1D17M2D12M1I6M2D8M3D6M1D10M5D12M2D5M2D6M1D12M2D10M1D18M4D5M1I3M2D3M4I15M1I5M1I4M1D3M1D53M2D1M1D2M1D5M1I7M2I7M1I31M2D14M1I18M1I1M1I3M1D2M1I8M1D15M1I7M2D4M1I5M3I39M5I1M1D8M1D8M1I8M5D2M2D12M2D3M1I8M2I13M1D2M1I2M2D2M1I6M3I18M1D21M4D6M2D8M2I14M1I5M1I3M2D12M1D8M5D11M1D17M1I2M2D18M1I6M5I19M2D7M1D14M2D15M2I2M1D4M3D7M5D7M2I14M2D9M1I3M1I4M1D20M1D5M6I29M1D19M1D4M1D8M1I9M2D2M1D3M3I15M4D8M1I12M1D11M2D1M1D5M1I10M1I14M1D11M3I15M1D7M2D3M1D4M2I13M2I20M6I6M1D7M8D2M1D6M1D2M2I7M2I4M4I9M2D9M2D3M2D8M2I5M1D4M1I3M1I6M2I3M1I7M3D11M1I3M2I7M1D12M2D4M1D7M10D5M3D5M1D5M2D6M1I17M1D4M1D3M2D29M1D4M1D18M1D4M1I6M2I9M1I1M1I14M1D8M1I2M3I7M2I7M3I9M2D19M1I11M1I1M1I8M1D6M1D3M2I5M4I11M2D12M1I8M1I20M1D2M3D10M1D8M5I7M1I7M1I9M1D6M1I4M6D8M2D11M2I10M1D5M6I7M1D5M2I1M1D4M1D11M1I7M2I14M4D11M1I19M3I9M1I8M1I23M1D14M1D5M1I15M3I16M2I1M1I5M3I4M3D17M1I2M2D4M2D5M1D7M1D8M5D9M2I4M1D6M1D18M3I2M2D12M1D3M1D10M3I5M1I4M4D23M1I16M5I5M1D10M1I5M1I15M2I1M3I23M2I10M4I9M1I7M1I13M3D8M1I19M1D6M2I14M3I11M3D6M3I14M2I2M2D2M1I6M3D3M1D3M1D4M1I15M2D35M1I3M2I1M1I13M1I14M1D9M4I12M4I6M1D18M3I15M1I13M2D3M3D10M3D16M2D13M1D2M2D10M1I13M2I1M1D19M1I5M1I13M1I10M1D18M2D9M2I12M3D5M1I48M1D7M1D6M1D16M3I2M1I8M3I24M4I4M1I2M1I6M1D7M1I2M2D25M1D9M1D21M2I17M1I7M1D4M1D19M1D21M2I6M2D20M1D6M1I2M1I34M1I7M1D2M2I6M1D4M2D10M5I6M3D4M2I5M1I9M1D4M3D1M1I13M2D10M2D7M2D4M1I12M3D4M6D2M1I3M2D2M1D8M1I12M1D33M1D5M1D1M2D13M1D1M3D2M2D9M1I14M1D1M1D1M1D17M2I7M2I5M1I4M4D6M2D6M1D5M2D3M2D2M4D6M1I3M3D3M5D13M2I3M2D2M1I3M4D3M1I11M3D19M3D2M1D20M1D5M5D12M1D2M1D3M1D6M6D8M2I26M2D17M1D2M2D7M2D5M2D21M1D6M2D3M1D10M2I72M1D13M1D1M1D37M1D1M1D8M1I9M1D7M2D16M5D7M2D5M1I24M3D10M1I17M2D2M3D3M1I3M2D1M1D6M2D8M3D5M10D9M1D1M1D6M1D3M2I3M2I1M1D3M2D6M2D4M1I8M5I2M6I2M4I3M2I1M3I3M1D9M3I1M3I4M1D6M1D11M1I27M1D4M1D4M1D16M1D14M5I4M1D8M3I28M1D15M1D5M2D3M1D6M1D8M1D17M5D11M2D5M1D14M2D5M1I2M1I16M4D27M1D36M1D12M1D3M1D13M1I3M1D3M1D24M1D2M1D6M3I5M4I6M1I6M3D4M1I9M3I15M1D6M1D1M1D10M2D1M1D25M1D7M1D6M1D10M1D20M1I5M3D16M1D10M1D6M2D2M1D5M1D1M1D20M1D11M1I30M1D9M2D2M3D15M2D1M1I9M2D13M3D17M2D26M4I3M2I6M1I6M2I17M5I47M2I9M1I39M1D13M5D8M2I2M1D17M1I15M1D7M1D3M1D6M4D3M1D8M1D7M2D1M1I7M1I4M2D3M1I6M1I22M1I3M1D4M1D4M1I18M1D19M1D5M1D9M1I4M1I10M2D2M2D4M1I6M2D8M1I2M1D3M2I4M2I7M1D2M1I8M2I5M1D29M1I9M2D1M2D9M1D10M2D21M4D7M1I8M1D4M1D1M1D9M1I2M3D16M1D8M1I15M2I6M1D10M25S * 0 0 GTTACACTATCACATCGTGTAACGGTACTTTCCTAATTATGCATGACTATCTCGACGGCCAGTGCCACTATTGACGACCTATCCGACGACGGTCCACCAATAACCCCGCCTCGCTACCTGTTGTAATTTAAACGCTGCGGCCGGCGCAGCCGAAGCCCGCGCGTATGAATGCGCTTCTATTCTCCTCTTCCGATCCCCGGTTAACTTTGATTCTGATGCGATTTGACGTGGCCTTTCAGCCGCTTTCCTTACGTTCCGTACCTTTGTCTCACGGGCAACATGTGACGCCGACTGCGATATCGCGGATGAAGCAACGCGGTCAATGGGATGCAGCAGCCAGGCACCGCCGTTTTGCTGATACGGCTGAGTTCAACGCTCGGCAGGCGCCTTGATGACCTCGAGGACCGGTCGCGCGGAAGCGGTAGACGGCAGGCGGTACGCGTTAGAGCACGCCAGAGATGACAACTTCCATCATCCGGGGGAGAAAACCCGATCTACCCCACAAACATTTTCCCCGATCATTCACAGCTTCCACGCCGCAGCTTGCCGCACCTCATCAGTTCAGACAAACAGGGACGGGCTGCTATTCAACGGCACGCCTATGTCATGGCATAGCTCATGATGATATTTCAAAAGATTACGCTCTATAGATCTCGCTCGCTGACTGCTCCGCGTACCTGAATGGCTGACGTTCCCATCGTACCCGCGGTACTCGTTTCATCGGCGCGGCAATGGCAGCATCGAACAGTATCGAAATCATAAGCGCCTCCCGTTATTGCCCGGATTCTGGCCAGGCCGCTCGCTCTGTCATTTCGGCTGTAAGGGGCAGAGACGAAACGCCGTCACGGGCAGCACAAATGCCACAGGTTTGATAACCCCGTGGCGTGAGTGCATCAGTATGCAGCTTCACCAGTGCCGCCACGACCGTGACCAGGTCAACGTATCCAGAATCACGGTATCCGGATGCGCTGATCCCACCTCATTTTCATGTTGAGCAACCTCCGAGGGGAGTGGGCGGAAGCGATTTCACTCGTGTCGACCACACTCTTTTCAGGTGCCACGGAGTGGGTCTCTTCTTTCTGTCCCGTCAGGCTGACATCACGTTCGTTGTTCACCAGCGAGCGGAGACGGGCAAGTAGTTCATCTTCGTCACTGGGACTCCGGATCAAAGCCCCGACGGCTTGATTACGGTTGTGACTAACACGAACTCATGATAAGGCCAGCAGCATCCAATCAGGCGCTGACTGCACGGCGTAAATGGATCTAGCCGGATCGCCGGTGTACCAGAGTTTTTCTGTCAAACGGGCAGAGGCGTTAATGCCCTGTGTGTGCGTCGCATCCTGAATGCAGCCAGGCCTTAAGGACCCCGTCTGAGTTCCCCAGGCACCATCGGTTGTTCGGCAGGAAGTTCTTTGACGCCGTTTTCCACGTACTGTTCAGAAGATACACGACGATAGCGATCTGATACATTCTATAGGACCGCTTTGCCCAGGTTCACCGCCGTCTCCAGCTCGAATTAGAGCCACGACGGGTATCCAGCTTTCTCCTTGACGGCTTTGAAGGAACGGAACAGCTACTAATATTTCAATCGAACACCGTCAGAAGGAGTCCGGATGCAGCTTCTCCTTGAGTGGTATAACGTGGACTTGTCACGCTGCCTCACTCCGTGCCGCCGGACTGCGTCATTATTCTCCTCTACATGCGGCCCATACTCACCTCAAACCGACTCGAAGGCTTCACCGGTCATGGTGTATTTGCTGATTAACGGGCAGAACTGCCTGCATCTCTTCGACCTGAGCAATAGGGTCGTTACGCATGTTCTGCATGATGATGCGACGGCGGCGTAAGCCGCCAGTCGCCAGATTGATTCTGCGGATCCGGCCGGCAGGGAGAATCGGTATTGCGGATTCATTCATGCTTCGGATCGACATATCCCGTAAATTCAGTGAGGGGAGCCGCCACGGGAACGGATAACCTCACCGGAAACATCGGCGAACGTACAGCGCCATGTTTACCAGTACCCGGAATTTGTGAGAGATAGACTTTCTCGTGGTGAAGGATAGCTGGACGGAAGGAAGAGACGCAGAAACATAGATCAAACTTAAATTTGCTTAATTGCCGCCAGGTTTGGGCTCGCGGTTTGTGTACACGAGACTCCTCGTAAAATTGGACTAGCCGCGAGGAAGCGGTAAACCATAAACGCGAGGATCGCCTGATGCCGTTCGGCAAACGAAGTTCCTATCGTTTTTCTGTTCGTGTCGTCGGCAGCCTCCGGCAGAGCACATCCTCATAACTAGAACGTGCCCGACTTGTGATAAACGTAGTCATGTGCTGGTCTCGTGGGAGCATGACCGCAAGAATTCCAACGGCATAAGGGTCGGTGGTGCCATCCCACGCAACCAGCTTGACGGCTGAGGTCCAGCACAGCGTCGTCATTGCAGGCGCTTTGCACTGATCCGCCGGCGCGGTTGCGGGTATGAGCCGGGTCACTGTTGCCTGCGGCTGGTAATGGTAAAGGTTTCTTTGCCGTCATAAACATCCCTTAAGACTGTGTGTTCAGCAAATCGTTAACGGGCATCAATCGTATTACCTGCAGCCAGGGTGCCGCTGCCCCATGCATCGACGTCAGAGCGGATGTCACTGCGCCTGTGCATACTCTGTGGTGCTGCGGGCAGAATGCGGCGTTCCATCCGTCGACTCGGCATTCTGCCCAACGCGTGCCTGTTCTTCGCGTCGAGCCTCCTCAAGTTGAGGATTCTACCATCGGCTGCTTCTGCCAGGAAGCGCTGCGGTGATCTGCTGAGGGCATTCCGGCTGCGCCGCTGGCGTTCGCCCTCCGTCGCTGGCACTAAAGTCAGCCTGCGAAGTTGAGGATGAGTGAAAGAGAGGAAGAGTGATGGCATCTCTTTGGTCATTCACCTCCCTGAGAGACGGGATTACGTGCATCCAGTGCATCACGCATGACGGTGATCGCATCGCTGCTGTTAAAGTTCATCAGCCAGTCATGGCATCATGGCCTCCTGACGCTTAGACCCTGCAGCTCGGTATCGAGCACAACCTGCACGGACAGGGCCGGTATGCCGACGTCTGTGCAACACCTGATGCGTCATTCAATGCATGTCTCCGGACGTCATCGAAGATGGCTTAGCGATGCGGTCGGCCTGCTTCTCTCGTACATTAGTACGTGATTTCCACCCTGTATTCTCAGGCAGCACCGTAATTACTGTGAGCCATCATGACGCCGATGGAGCCTGTCCGGGCTTGGGTGACCAGACGCCGCGGGAGGAGGGGACTGGCAAGCAACTGACCTGCACTGTACCGATGTCGTTGGCGAAGCGCCCATACCGATTTATGTCACGAACGCACACGGCGATGATGTCAGCGGCAGTCAAATGCCCCCGCCACCATCCCGCCGGCGTGTCCATATCGAGCAGAATGCCGTTAATAAGATCGATCGAACCGCTGTGCAGCCTGGAAGCGATAATGCCGTTGTAACCGGTTGCCTGACCGAGCTCCTGCAGCAGCCCGCGTAGTCCGGCTGACCAGCGTGCGGACCTGCGGAAGGACGGAGCGTCCAAGCGGAGAAGACTGCGGCTTGTCGTGTTGTCCGTTCATCGGGCCAGCACTTCCGGGGCGTCGCGGTGCCTCCCTCGCAGTCAGGCTGTCGCCGGACACCGCATCCGTCAGAGGCTGCTGCTGATCCCCAAGCTGATGCAAGGCACAAAGAGACCCGCATAGGCGGGTTCAATAGACCAGGCTCATTAAAGGCCGGGCGGCAATATGCGGATTACATATGCTACTTCCTCTCTCTTCTAGCTGTTGATGTCTACAGGGGCGCAGCCCGGATTCAAATGCTGCAGCCGCCAGGCGGGCGGTTTAAGACGGCTGCACGGCGGCTCGATCGGCCGGACCGACTTGATGGGCAAAGCCTTCTACGTAGGTACCGCGTTTTGCCACTCTTCGTAGGTACTCAGTCATGGCTTCTATCAGCTCACGGTTTCCTTTTGACTTTCTTTCAGACCATCATCATCGACCACGAAGCCTATTCACGGTCGCAGTTCCCCCAGGCACCGACCGTTCGGCTCCGGCACGGATTTGAGCTGACGTAAATAGAGGATCGCGGACGCTCCTCTTCCATAGCAGAAACATCTGGCTTCATGGACTGGATGCGAGACTGAATTTTCGCCCCATAAAGTGACGCCCACGATCGTTCGCACTGATGTCCGTTGATGGGCATTCCGGAAATGGGAAGTACGAGACACCCAGCCCGGCAGCGATACCGCAGCAGTGACTGCTCAAACACGGGTAGCGTTATCCGTATCCTGAGCGTCTTGCAGGGATTCAGGTGAGTACCGGCATCAGCTGCGTACTTTGCCGCCTCCTCCAGCCCCGGACCCTAGGCGCCGCGGCGTAATACGGGCACTTCACCACAATCCAGCTCAGGTCAGCCTTCCCGCTGCCCTCCTTAGGGACTGTTCGCGCTGACGACAATCGCTCCGGTGAACTGCGTATCCAGCTCACTCAATGGCGGGATAATCGCCTTCATCACAATGGCGGCTCTGCGATCTGCGTGTTCTGCACCGTAGAGCAACCTTCATCTGCTGGCCATCACCCTTAAAAGACCGCCATTTGCGCGCGGTATCTGCCGTCCTCCTCAAGGGTTCAAAAACGTGAATGAACGAGGCGCGCCCGCCGGGTAACTCACGGGGTAATGTACAGGTCCGGTTTCTGCGGCATCCAGCCAGGATACCCGTCCCTATGACGTAATATCCCAGCCGCCGGACCGCTGTCGGTATTAATCTGCACAAGGGACGACGGCACTAGTCGCGATCGAGGGAGCTCTATCGAGGGATGCTTCGGGCTGACCATCGAACTGTGTCCCCTGAAAGCCTAGACGAACTGGTATCCCCATAGCTGAACGAACAGTCACGTTAAAGGCGCAGTGCATACGCCTTCCCGAATCATCATGGTAAACGGTGCGTTTCGGGGCTCGGTCAAAGGTAATGCTGCAGCAGCAGTTCATCCTCGGCAAACATTCGCCCTTCCATGCCGCTTCACCGCGGGAAAAGGACGGGGCGTCTTCTTCCTCCCCGATGCCCAGATAGCGCCAGCTTGGGCGATGACTGAGCCGGAAAAGACCGACGATATGATCCTGATGCAGAGGCTGGATGGCGTTGGCGCATGCATCGTTATTGCGTACCATCCTTCTGCGGATTCCACTCGGTAAAGTTGGGCAACAGGGCTGCAAGGATTTTCACTCGGTGGGTTCGACCGAAGCGCGCAACTGCCCCCTCAAATCCGCTGCCACCCGCTTCATCAGACCGGCATATTCCGGGACCGATTGATGCCGTCATCCGCGAGGGAAGCGGGAATTAGCGCGAGGTCGCCATACAAATGCAGTTCTCGCGTCCCTGTGTCATGCCGGTCTGCACTTCATATGCAATATATTTTTCAGGTCAAATCGACGAGGCCGTAAACTCCACCCTTCATTCAGCTTTCTGTGACTGTTGCCACCCGTTTACCTGTCATCATGATGCAGTCCGCCGGACGGGCAGCAAGTTCTTCCTGTCGCGTCATTCATCCTCTCCGGATAAGGCACGGCGTAATCTGCCAGTATTTCTTGTCTGGTTGCTGCACCATCCTCTTCCTGCACAAGGCTCGCCAGCAGCGCACTGAGATCTTTCCAGGCTTGCGAGGCAAGGAGCTCTGATGCGGATCGCCGCCAGCGCATAACGAAGGATAGAGTGCCTCATTGCGTCGCTTTTTGCTGTCCCACAGTATTTTTCCTTCATCACCCGATTTTCGACCTGCCTTCAGCACAGTCAGCTGCTGCTCGCTTCGTCAGATCAAAATATCCGGGTATTCGTGACAGTGAACGGCAAGCGGAAGCGGTTCATCCCCTTCAGGGCGTCGTCAGTGAAGCGGTTATAAATCTGGTTTACCCCTTAGTACTTACGTGACCGCGTACGTAAACAACCCCGTTTTGTTTCGCTTAATCGAGTGCATCCTACCGGCTTTCCGGACGGCACCCCGATCCGGTTACACTAGGAACAGGGAGCGAGTCCTAGAGCGTTCATACACAATGGTCGGGTACAATCCCGCCAGTTCAGCAAGATACGGGGATATCGACATTTCGCACCATTCGGTCGAGTTCATCGGTAGCCATTACTTGACTCATCGGCGGCGCGTCTTCGGGTGGCGAGTCACGCTCTCGTGGTCAAATTTACGTAGCCCTCCTACCAGCCCCATCCCCATACGCACTTCGGGTCAGTCGGGAGTCGATACCGGGTTCAAGCCAACGGTCAGGAACGGCGCTGAATAATGCTCTTCCGCTCTGCCATCACTTCATAATGGACGTTCGCCAATTTTTCCCCACGTCTCACCGAGCGTGGTGTTTACGAAGGTTTACGTTTCCCGTATCCCCTTTCGTTTTCATCCAGTCTTTGACAATCTTAAGAGCTGGTGAACGGGCTGTACGCTGTCCAGATGTGAAAGGTACAATGTCAGGGCTCAATCTTCTACCGGATGACGAAAACCAGAGAATGCCACCGTCACCAGATCCCGGTCTTCGCAGATAACGGGCATCAGTAAAGTCCAGCTCCTTGCTGGCGGATGACGCAGGCATTATCGCAGAGATAAAACACGCTGGAGGCGAGAGTCGATTATCGAAAGCGTTACTTCTGCGATCCAGCTTCCCTGCATGCCCGATTGACGAACATGAACGCCACGAAATTGCGGGCGGAGAGCGGCAAGGACTTGGATTCCTGGCTGCAACGCTGATCTACTGACAGTGCCTCTCTCATTTACCGTGGAGCCACGGATGGACTTTGAGACGAGCTTCAATACGCTTGATCAGAGGAACGTCGGCAACAAAAGCTTCCTGTTCATCAATATCATCATCAAAAGCAGCAAGTTGTGATAACCTCACATCACCGACTTTCACGGTAGTTTTTCGCTTTACCGCCGAGGCAGAAGCCACGGGTCATGAACGCTTCATGGCGTATGTAGAGCCGTGCTTTTGCCAACGGGGCCAGCGCCAGCAGCGACGGAAGTCACGAATAGTCGGCTCAACGTGGGATTTCATAAATTTGGGGCATCACATCGTCGGCAACCAGAATAAGGGGTGCCTTGCTTATGCTCTATAAATAGCATAACATATACCGGATCTGAAGACGGTTTGACTGTACTGCCACCCATGCGCTCTTCTACGCGTCACCCCCTATGTAGTCGCTGCCATCGCATTCATGATGGCCCTATGAAATTAATGTTCCCCAGCGCCTTCCTGGTATCCGGATTCTTTTCGGAGATAGTAATTAGCACCTCAGATTCAACGGCTTTATGGTCGAGAAGAGGAGGCGGGAAGCAGGCGCGAACAAAATGCCGCAGCCTGTTAACCTGACTGTTCGATATATTCACTGAGCAACCCCGGTAAGGTTCATCCAGCGGCTGCTTTGTTCATGGCTTTGATGATATCCCGCTTCAGGAAATCAACATGTTGTATTCTTCATTCCGGCGTCCGGAAAACGCCGGATGCAAGGAACTAGGAGCCGTCGAGAATACTGATTTCACCTGCGATTCCAGACAGCAACGAGGAATGACGAATTGCTCATTCCACCACTTCAGCGGAGTCTGGCATTCTTCAGTTCCTGTGCGTCGGCACGCGTAAGTCGATGGCGTTCGTACTGCACTCCTTCTATGGCTTAGCGATCTCCTCCCCCTCCTGCCGCTTTCTTCCTCTCTCGGCCTCATTTCTAGTTCTCAATTTCAGCATCCCTTCGGCAGCCATTTATGACGGCGGCAGAGTGATAAAGCTCTCATTACCTTGCCACCGCTCGCAGAACGGCATTCCCTTGTTCCTGCCGTTGAATTTTCAGACTCAATATCTACAACCCGACGAAATGTCAGCCCATAGATGCGCTTTTGTTGACTTCCATTGTTCATTCGACGGACAAAACAGGAAGCGAAAGAAGTAGAAATTCGTTCTACTGACCTGTCGTTTCCTTCGGCGCCGGTATTTTAAATAAAACATTACAGTGACGAAGAAGAACGGAACGCCTTAAACCGGAAAATTTTCATAAATAGGCAAACCCGCGTGACGCCGATCCTCGCCACCCAGG * tp:A:P cm:i:107 s1:i:1023 s2:i:0 NM:i:1882 ms:i:3624 AS:i:3624 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
88 80 0 utg000001l 22800 60 24S4M1I6M1D6M1D2M1D9M2I1M4D6M1D4M1D5M4D8M1I814M7D14M1I5M5D1M1D2M1I3M1D3M2D2M2D3M2I11M1D23M4D3M1I1M1I4M2D5M1D1M2I7M2I4M1I3M1I7M2I6M2I1M3I2M1I2M1I3M4I1M1I4M3I1M1I3M3I12M4D13M1D12M3D7M4D10M1I9M1I9M1I4M1I9M1I3M2I6M1I1M2D4M1D43M1D3M1D8M1I1M2I8M3I3M2I6M4D4M1I1M2I4M1D5M1I4M1D7M2I3M1I10M1I2M1I1M1I12M3I2M1I7M1I5M1D61M1D9M2D5M1D18M1D6M2I21M1I2M1I26M1D16M4D12M2D7M1I4M2I2M4D8M1I13M3D10M2I5M1I3M1D2M1I9M1I8M2I5M1I18M1I6M2I2M6I5M2D1M1I2M1D14M1D13M1D8M6D4M2I5M3D5M1D5M2D18M3D16M3D3M1I11M3D3M6I1M1I9M3I2M1D1M2I19M2I1M1I14M2I4M1D6M2D2M1I14M7I9M2D7M4I4M1D3M4D5M2D8M1I7M1I11M1I2M2I4M1D10M1D5M1D4M1D4M3D4M2I4M1D3M1D3M2D3M1I13M3D4M2I10M1D9M1D14M1I6M1D1M1D7M1I3M1I3M2I6M2I3M1D3M1D10M7D5M1I1M3I9M2I3M1I1M1I10M2I1M4I7M1I9M2D10M4I12M10D4M2D10M1I4M1I7M2I10M2D2M2D10M1D11M2I4M1I5M1I4M3D9M4I8M1D3M1D21M3I14M1D14M1D2M1D3M2D3M1D9M1I10M1I4M1D15M2D6M1D22M1D6M2D3M1D5M2D13M5I19M1D5M3D10M4D25M1D1M1D6M1D1M1D5M1I4M2I8M1D5M1D7M1D9M1D4M1D1M1D8M1D20M2I4M2D2M2I3M2D3M3D6M1I22M9D5M1D2M4I8M1D10M2D15M1D9M2I7M1I3M1I6M2D5M3D11M9I6M1I11M2I8M2D14M3D2M1D3M1D11M1I13M1I5M6D10M1I2M1I9M2D5M2I3M3D11M3D8M1D5M1I11M1I2M1I3M4D4M1I5M2D5M2I1M1I12M1I3M1I2M1I4M2I5M1I3M1I9M1I3M2I3M2D12M1D13M1I2M3D21M1I7M4D5M1D28M4I1M1I2M1D18M1I9M1I6M3D15M2I7M2D1M1I2M1I2M1I5M3D5M2I2M3D3M1D4M2D5M5D1M4D24M1I3M3D13M1D15M4I7M6D4M1D1M1D3M1I5M1I2M1D3M1I2M1D5M1I6M1I7M2D1M2D8M4D12M3D4M2D6M1D5M1D17M1D21M2D5M1D4M1D4M1I29M2I9M1D7M3D5M3D1M2D15M4I12M1D1M1D2M1D3M2D1M2D7M5I10M7D2M1I15M3I5M2D5M1I5M2D6M1I1M2I9M1D6M2D9M2I6M4D7M2I4M2I2M1D1M2D6M4I3M1I6M1I12M1I2M2D5M1D2M1I13M3D1M1I26M3I2M1D12M1D3M1I3M5I7M2D3M3D4M2D19M1D9M3D3M1D1M1D2M1I4M2I2M1D7M1D6M4I4M1I16M1I8M1D6M1D4M1I2M2D1M3D4M2D5M6D5M1I7M1D15M1D8M2D9M5D2M1D3M2I5M1D15M2D2M2D6M3D1M1D10M2I6M6I3M1D8M2I3M1I7M2D2M1D3M2D8M4D7M2D3M4D1M2D1M1D5M2D3M1I11M6I3M2I5M2D3M1D4M1D15M1I1M4D4M3D8M1D1M1D8M5D26M1D6M1I8M1D6M1I26M1I2M1D6M3I18M1I2M1I3M3I3M1D8M2D2M1D5M3I13M1I9M1D5M5I7M4I14M2D4M2D4M2D6M5D2M1I13M7D3M1D1M2D2M1D2M1D2M1D9M1D3M2I8M3I5M6I3M1I6M2D7M1D8M3I3M1I5M1I8M1D6M1D17M1D2M3I3M1D6M2I11M1I9M2I14M1D9M1D6M1I21M1D3M1D17M1I3M1D4M5D17M1D3M2I1M1D11M1D8M1I13M2D2M1D8M3I5M1D1M4D9M1I3M1I6M2I8M3I20M4I2M3I30M4D2M2I5M1I12M1D13M3D7M1D6M1I11M6D19M1I7M1I11M2D2M4D10M1D3M2D6M3D23M1D4M1I3M2D4M1D4M1D6M4D13M3D7M2D9M4I7M1I3M2D3M2D1M3D7M2I4M1D4M6D1M1D10M2D2M1I8M2D6M4D5M3D9M5D8M4I8M4D22M2I2M1I16M1I26M4I4M2D2M2I3M1I2M2D13M3D1M1D2M4D25M2D10M1D9M1D18M1D2M1I5M1D3M4D2M2D2M3D6M2D2M1I5M1D4M3D4M2D5M1I5M1I1M1I3M3I4M1I1M1I6M1I4M2D3M6I2M6I3M1I5M3I4M5I5M3D9M1D3M1D11M1D7M2D9M5D13M6D2M1D10M1I5M1D7M2I1M1I10M1D1M2D16M1I20M6D1M1D15M3D6M2I11M1I2M3D9M3I7M3I1M2I12M1I10M1I2M2D4M3D5M2D2M3D16M3I1M1D10M5I5M1I2M1D12M2I3M6D1M1D3M1D12M1D12M3I3M1I11M1D1M1D2M5D3M1I5M1D2M1D3M1I3M1I1M5D3M1I5M1D5M1D2M2I3M1D25M2D4M1D4M1D5M1D4M3D14M2I1M1D4M1D3M1D18M1D4M1I4M2D10M1I5M3I1M3I3M1D13M1I2M4I11M3D5M1D2M2D6M3D6M3D4M1I7M1I9M1I14M2D7M2I3M1I5M1D8M4D3M1D19M2D14M1I14M2D22M1I4M2D5M2D3M2I5M2D3M7I3M2I4M2D11M2D34M1D7M1I37M2I5M2I4M1D4M1I2M1D7M5D4M1I3M2I8M1D3M1D8M1I4M1D2M1I9M2I9M1I6M2D1M2D2M1D9M1D5M2D6M2I3M1D11M2D6M1I4M3I14M6I7M1D2M1D14M1I8M2D4M2I2M1D4M2D3M2I1M1I3M1I4M1D3M4D15M3I6M3I6M1D3M1D11M1I2M3D10M2D17M2I5M1D16M9D4M3D6M3I12M2D11M2D2M3D6M4D10M1D2M4D5M2D11M1I10M5D21M4I18M8D3M3D1M3D7M1D16M2I3M3I6M4I1M1D3M3I11M8I3M1I9M2D6M3D1M3D9M2I6M1I7M3D5M1I14M1I2M2I7M2D20M2D4M1D4M1I5M1I4M1I2M2D2M1D9M2D7M1I10M3D7M4I4M1I15M4D1M2D6M4D3M1D14M2D2M1D4M1D5M1D3M3I7M1D8M1D5M2D18M1D8M3D11M2I2M1I7M3D6M1I4M3D7M5D1M1D3M1D11M1I3M6I3M1D2M2I5M1I3M1I3M4D4M1D10M1D8M7D20M1I16M3I12M1D23M1D12M2D14M2D1M2D4M2D27M1D1M3I3M1D7M1I3M1I3M2I6M2D13M2D1M1D6M6D4M3I14M1I1M2D12M1I3M2D5M2D1M1D2M1D3M7D4M2D14M2D4M1D6M2I3M1I10M2D10M1I6M2I13M2I10M1D3M2D9M2D2M3D18M1D6M1D5M1I11M3D13M1I5M3D7M1D6M1D1M2I11M1D13M1D1M1D16M1I2M1I2M1I4M2D3M5I2M1I9M1D4M1D4M1I4M5D5M3D11M1D7M2I10M1I2M1I3M6D15M3D15M1I9M1D5M2D7M1I9M1I3M1D5M4D9M2D3M1D4M4D5M1D5M1I1M1I5M1D8M1I14M1I2M3I7M10I4M7I3M2D4M1I15M4D4M1D8M2D1M1D18M6D2M1D4M4I11M4D12M2D37M2I2M1D3M3D3M1D14M1D13M1I6M1I14M4D10M2I5M2D2M2D11M1D4M4D1M3D4M5D9M2D5M1I7M1I5M2I3M1D6M3D10M4D5M7D4M3D3M2D10M2D6M4I6M1D9M1D6M1I4M1D7M3D2M2I2M1I4M1D3M1D11M3I16M2D6M3D2M1D7M1D6M1I5M4D4M2I16M3D8M2D2M1I11M1D4M1D2M1I1M1I2M2D7M2D9M1I3M1I5M2D2M2D32M3I2M2I4M5D2M2D2M1D5M2I5M3D5M2I11M1D4M1D3M3I2M1I8M3D14M1D1M1D18M10I6M1D11M1I4M1D2M1D8M2D4M1D4M2D2M1I7M3D1M1D11M1I1M1I3M2I3M1D5M1I2M3D1M2D3M1I4M2I2M1I5M1I8M1I6M2I3M1D3M1D1M1D7M5D1M1D1M1D8M4D1M2D14M1I6M2I9M1I14M1I3M2D2M2D1M2D3M1D1M1D6M3D21M4D7M2D7M2D2M1D8M1D4M1D1M1D5M3I17M4D7M2D14M4D5M4I6M5D12M1I4M1D11M3D11M1D8M1D3M2D6M1D2M2D17M3D4M3D1M1D4M1D6M1D9M1I3M2D19M4D6M1D2M2D4M2D10M1I3M1D1M1D2M2D5M3D10M4D9M2D32M1D1M2I4M1D5M1D2M2D6M1I3M2I1M1I1M4I3M3I5M3I1M1D13M2D14M1I22M9D19M1I1M2D7M2D23M1D3M2D35M1D23M2D4M1I7M1D12M1I3M1I15M3I9M3D4M1D8M4D1M1D8M1D9M1I4M1I6M1I4M1I9M1D7M4D5M1D5M4D14M1D8M2D2M3I2M1I26M1D13M1D2M3D2M2D10M2D13M5D6M1I5M1I5M2I2M1I2M3I9M2I16M1I1M1I16M1I10M2D5M7I15M1D3M1I8M1D7M1D9M7D9M11D9M4D5M1I2M2D8M2I11M1I4M2D3M1D7M1D6M4D3M2I2M3I9M4D3M1D4M1I19M11I13M1I7M2I12M2D4M1D2M1D7M1I8M1D8M1D3M3I10M1I9M3I2M1D7M1I7M4D1M1D1M1D25M2I8M2I8M1D3M1I15M2I2M1D16M3D9M1D2M1D7M1D19M4I10M2D12M1I6M1I15M1I36M2D17M1I5M2D4M2D5M3D5M1D3M2I7M2D7M2I21M1D5M13S * 0 0 CCGTATTCTGCTTGGTTATGACCTTGATGGCAGATAATGTTAGGATAATTTCGGATCACTTCCCATTTTGGCAGAAGACACAATATAGAATATTAAGCTGGACAGAGTCGATTATTACACCCGCCTTACGCTACACCCTATCGTACATCTAAAGGTTAATTAGAAAATTTATGAAATAATACTCCCAAAACACTAGCTAAACATATTACATCATGCTTGTTCATCAGGTAAATGTCATTTGGTATAGACAAAATAGATCATTTTCTTCCTATTGCACATTATCCTGAAATTTTCGGTAATGGGTTTAAGGTTCATCGTGCCGGACTGAAAATCGGCTAAACCGTCACCGGCCTGAGATAAGCGATCATTCATGACAATAAAGTTTTTCGTGAGTAATGGCTAATTTCGTTTCCAACTCTATCAGTTTTATGTTGAATGCCCGGCGAATGGAGGCAGAGACAAACACAGCTCTTCATCATTTCAAGCTGTAAAATATTAGGTAAAGGTATCGTTTGCGAGGCAGGGAACCAAATCAATGAATGACCGACGAAACTATTTTAAATTACTAAGGAAACACTTCCTCGTAAAGAGCGTTCAATGCAAAAGCCGATTACAGAATTTATTTATTGAAGCAAATCTGAAACCTATTATAGATTTGAAGTACTTCCCCAATTATTGGAAATTATGTATGCGTGAAGCCGAACCATTTTTCCAGTAAGGGGATAACCATAGAAGTATCATAAAGTGACTAGAATGAACGAATATTTATATGAGGAGGCTGTTTTACAAATCCTTAGTACTTGCTAACCAATCCTAGGCAGTCATTGGCAAGCGCATCGCAGTAGAGAAGGACGTTACCGTAATGTCCCAACCAGCAGTCTCTAAAGTGGAGTCAGTCATAGATGGTCCTGTATTAGCAAACTCTAAATTTGTAACACGGGCGCAACTTAAATCATGCAACAGCCGAGTGGGAATACCACTTCAGCCGCATAACGATTCTCACGACGGCCGTCCTGCAGCGGGTCCAGCGTACCATCTCCTATGAGCGACTTGTTAGCAGCTAAGCCAAGCCATTTATACATAATGAAGTAATAATAAATTTCCTGTGTAACTAATTTACTATGGTTTCTCTGTAAGAATACCTCGTGCAAAGTAAACACTTGTATTACATTGACAGTTAAGCAGTTAATTTACCTCTAAAATATATCAGCATCTAGCATGCAACGCCGGCCTGAATGTTTACTAAAACGACCCAGGAAGAGACTTAAGAAGATTTATCGCACTTGCTCAAATGCTGCATTAGATATCCTATTTGACCCTGAATTATTTCGCTTACATTTGAATCATTCCCCAACCCTAAGAACAGTGACATTTATTATTCAAACAAAACCATTAGGATATGACATTTGGTATTAACAAGCTGTTATCCAAACCGGAAAATGAATGCGCTTAATGAGTCGGCTAAATTCTAGGATACGATAGAAAACAAGGATTTAGAAACCAGCGACGAGGGACTTATGTTCACTGTAAGTCGAAGATGACATTGAGATTTATTACAATGAAAATATGTTAAACATTGGTATAAAAGTTAGTCAGACTTGGACGGAAATTACTTCATACTTTACTGACGATGAGTAGTGGATCAGAAGACGATGGGTCCTAATACGACAGATTACGAATTACTGCGTGATAATGGCTGGCAGACTTAACTGCTGTAACTCTCTTAAGACAAATAAACAAGCGGATTAGATGACTATCTAGTACTTTCGCCAACATCATTCGACGACTCTTTATTTGATGAAACGCCAGAATAATATTTAAAATTAAAGATTATCCTCCATAAGCAATGTCATTTAAGCCACAACTAAAGATAAAACAGATTCCTGAAAGATATTAAAGGAGCGTCTAAACTGTAGACAGCCGACATATCACTTCGACAGACCAGTGGATTACAGCAAGGTCCAACGGTACTTTAAAGCACGGTTATCACATTCAAACATTAGATTTATAAACAATTCCATCCAATTGATTTAACATCAATACAACATTTGAAGATCACCCAATATATTTTATGCAGAATCCGAGGACAGGTATCACCCAAAGACAAATGCCTGGCTTCATTTGGGTTGGCTATGAGAAAAGAGCATCTACTCCAATAAACCAATACAATGCCATTATAGATGAAAGACTTCAGGTAAATCCGGAAGTTGATGTCAAATAATCAAAAGCTTGTATTTCCGGAAATAGTTAGAGAAACGAAGATACAAGAAGCTTTAGAAACACCCAAATAAGATCAACGACCCAACCATATTTCATGCGTTGCAGTTAAAGGCATTGGCCGTAAACACTGAACAATTGAGTCATAGAAATTCCATGTCTCTCCGACCATAATAATCGCCAACAAATAAACCAATACTCAGGTTACCTAAACTAACCGAACGTTATTTCATAAGACGTTGCGGGCATACCAAACGATTACTCTCCATAAATAGAAGCAGGCCTCAACATCAGGTGCAGTTGATGTATCACGTCAGCAAGCCCGATATTCTTCCCAGTTCCAACGAGGTTTCTTCCTTCTGTCCGATTCCATCCGACTCTAACGAGCATATGCTCACTCTACCTGCATCAGGCTTTTGTTTCTTCCCTCCCGGATGCCGGACTTTTTGCTCCTTTAATCATTCTAGCCCCAGGCTGTGCCGTTCCTATTTCTGATATTCCCTCCCGGGGATACCAGTAAAGTTCCGGTAACGACTGAGAGTTCAGAACAACGCGTAGCGCCGAAGCCATCAGGTCACGTTACCCCGATGTTCACGAGTGCCATTAATAATTCTTGCAGCCGAACAGGCCACAAGCCGGACGCCGGAATATCTGGCGAGTCGTGAATGAGTAGTGCAGAGGCAGACTAGGGTATGAGGCAAATATGCGTCACCTTCACAATAATGCTTAGTTCCGGCCGATTATAAATTTGGTCTATAGCCGCTTCGCAGAATGCCTGCAGCCTCACAAGTATAGATTAATGCAATGTTTTGACGGTGTTTGCCTAGTCCGCAGCGTTAACGGTATCTTGTCTAGTCGATAACAAGGAAACTGAGGCCGAGCGGTACTGATATCGAGCACCAATACCAACTGTATCGCATGTGCACACCAGCGACGCCGGGGCCGTATAAACAATGAGGACTCGTGGCATGCTGTACGTCCGTTTCCATACTAAGCCCTGTGCTGTTTCCTTTAACTGTAAATTCCTGACTGGTGCTGTTCCATACTGACCCAGCCAGAACTGTTCATCCTAACCATTGTGGCAGTGAGCACCGCGGCCCCCTGTTGAACGAACAGCCAGACTGTGGCTAAGGCTCCGATCCTTTACTTTGGTTTAAGTCGTAATCGAAATGCTGGTCCGTCCTTGCTCCGTAAACGATGTATTTCTTCTACAAATCCGTACCACCCTTATCACTGGCACTGTGGGTGTGCGACTGCTTCCATGCTATTCCTGAGACAACCACCCTAACCGACTTTTGCTAGTGGGTTGCCTCCACGCGCATATCAGGAAGCACCCATGGGATACGCGACAGGTTTGGGGCTTCTAAATCGTAGAACGCCTCTCGCAGCCCATCTAGGATACGCTAAATCAGAGGGCGATGTCACGACCCCGGAAGCTTCGCTATTAAGGCATTTACGATAGATCAATCAGAATTCTGCGTCAAACGCGATTTTCCCAGAAAGACTCCCTGCCATTTGGTCAGATTGGGATAGGCATCCGACAGCCCGTCGGTACACGTCTTCGCTTGTTGACCGCGCCATTCAGTACGGGTCTAGCAATCGCCTTATACGTCCCGGCGCGGCTAAATTTGGGTCCACCGTATTCCGTACGGGTCCACTCCCGTTGCTATAGTGAATCGAGCCGTAACGACGCGGTGTCCCAGAATGGTCCCCCTGGAGGCTTCCTGTTGGCGTCCGGTTGCTGTTGTACCGATATTTCCGTCTACGTCCGTTTTCTGTTCGTTTCATCCATTACCATGACCGCCTTTGGCGTGCAGCAAGCGTTTCAGACGTGCTGTTGGTGCACTGAGCCTGGCACTATCCCCTTTCTCGTTGTCCGCATCGCCAAGCGCGACATGAAGGCCTATATCTTCTGCACGTTTTGCCGAATTTGCAATTTACGTATTTATCGACGCCGCTTCTGCCGCATTTGGTGCGATGTAGACCGCACTTCCCCGACTCTTCCCTTCCTCGTACAGCGTTGACGCATCACTCCCGCCGCCTGTGTTTTGCGTGCCCGGCAGGAGTGGCTCCCGTTCCGCTCCTGTTCAGAGCTCTGGCATTCGTCTCGACGGACGTTTTGCCGCCCTGGCAGAATTTTCTGCCGTTGCATTGCCGAGGAAGCTCAACGACGGCACTTGATGATGCGTTCGTTTCTGATGATTTGCTGCTCTTTGTCCGACGCGCATCTCGTGCTGAAGCGGCCTCTGACGGCTTTCGTGGCCCGGTGAGGGAGTGGCAGACGGTGCTGATGGGATTGAGCGCAGCACACTGGTCTCCTGAAGCGGTCTGGTTTCGCCGGCACTGAAGCGCGTTTTGGGATCCGGCTCTGCACCTGCGGCGCTTTTCCGGTTCGCATCGTTGCCTCTGCCGGTCCACGAACCTTCCTGAGCTGACGATGCAGGCCTGTCCGGCACGTGCTGGCGGCGCGTGCATGAGTCAGGTTGCATCAGTCACCGCGACCTGGCATGATGCACTGGCATCGCAGGGCTGATTTCTTGCTGTCCCGTCTCTTGCCACGACGCGTTACGCGCCTCTTCCCATGAGTTCGACCAAGACGAACGGCATGCCTATCTAATCATTCCTATGGCACAGAAATGTAAGTGCCGTCCCGTGAATCTTCATACGATGGTCCCCGGCGTGCGATGGTGGAAACCGTCAACCTGCAGCAGAGTGACACTGTACTGACCTGTACTCCACATCGCTGCTGTAACGCCGCCGCGGCTTCGCTCTATGGATTTATAGCCATTTACCACCGTGGTGCTGTTACGTCTAGTTCAGCTGAAGGTGGAGTCTTGTACCGGTTTTCCGTGGCTGTCTTTCATCGACTGGACGAGTATTCTATCTAAATCACCGGTTCCTAGAGCACGGGCTCGATCAGAAGTGGGACCAACGGATGCTTCGAGCTAAATTATACGAATCTAAGTTATAGAGCCGAGCATGGATGCGTTAATCGCCGATCCTCAGCCTGCCTTCATAAGCAACAGGACTGACGCCTGCCGCTTAATTACTTATACCTGCATCACGCCACTGAGGTATATCCGCATTGCACTTTCTTCCTGGCAGTGCTTTCATAGGGCCTCCGATACCGTCCGTTATAATCCCTTACCGTAAGGCACTCATGTACCACTGACTAGGCTCAGCCACTCCGATGTACGCTCTGCTTACTGATTTGTAGGTAACCGGTCGGCCATCACCACAGCCAACGTCCACGCATAGGTGAAATATCCTCCCCGGTCATCACTGTGCCTCTGACTCTTTTAGACCGCGAGTGGAAGCACGGCCGCTCGTCACGTCACTCATACGTGGTCGCACGTTAATGCTTTCAGGCAACTCACCGTATCCCGCCGACGACGGCATGTACCCCAGTTCATTGAAATAGCCACCGTAAACGACTATTATCGCCGTGCACGCGTCCGCTCGTATAGTACTGTCACCGCAAGGTACGAGCGGCAAAGACACGGCATACATTAATCGTTCTCACCTGTTTATTAATAAACGCCCCGTTCCCGGACGAGCTGTAACACTCAGACCACGCTGATGCCCGCCTGTTCTTAATCACCAACCTGCACATCGCTGGCAACGTATAGGGCCGAATATCTGCCGAATGCCGTGTAACGTAAGCGTGAACGTCGTCAGAAACCCTACGTTTCCCCAGCCCTGGCGATTAACAATACGGGAGAAGACCTGTACCGCCTCGTTCGCCGGCCATCATAAATCACCGCACCGTTCATCAGTACTTTTGGAGATAACACATGAATACGTGTTGTGGACATCTAATCACGGTGATTCCGAAACGTCACTACGAAGGCAGGACGGTACCTGGCGTACCCAAAGTATTAGTCACGTGACCACAAACCCTAATAGTGACCGTGCTCCTCATCAGTCCACATCTGGCCGCACTCAGGAAGCCGCCTGCATGCTTTACAATGTCCCCGACTTTTCCCTCACTTATCCGTTTATCGTACAGTTTTCAGCTATGGTCTATACATTACAGCCGTTATCCGAGTTCGCATTGCACTGCATACATTAGTCGCATTTTATAAGTCCTTTCCGTCGTAGGTTAGAAAGAAGTCCGGGCCAGCCGCTGGTAATGGCCGTCAGGCTGCAGGAAGCGTCGTTCAGGTGAATAGTTGGGCCACAAACATCACCGTTCGGTCGCGTTTCACGGGTATTGGATAAATGCGATACGATTGTAGCATCTGCAATCTGCTTTCGTCCGTACCGGACCGTTAATAAAACTAGCCTGCTCCCTGTCTCCAGCCTAAGAGCATAATGTTCAGTCTGTGCTCAATTTATGACAGCCCACATGGCATTCCACTTATCACTGGCGCTCCTCTTCCACTTTCTGAAAACTCCTCCAGTGCTGGCGATTCTCTCTAAGTCCTTAATTTTCCCAGCTCCTTGCCCCGATGTACGCTTCTAAATCTGTTACTTTGCCTATCCGACTTCCCATGCTCCACCGACCTAGCCAACGAATGCCGATTTGCCAACGTTTACACTGCGGATAAAGTAATAATCATGGCCGGTTGGTTGATACTGGCTAGGTATCAGTATGCCGTAGACCATAACGCGTGGTTCAACCTGTCTTGTACCCCGGATGCCTGCTTGCCTTGTTTGACAGAACCCAAACTAGTACGTTAAACGTAATACGCGGTGAGTAGCGATTGGCAGAAGTCTAAGCCCGGCGTCACTCAATCCTCGTAGTCGCTGCCGGCAGCGGCAATCTAAACGATACCCCGACGCATCCACCCTGCTGCCCGCATTTACCGGACTTTAATTAAGCCTCTTAGGTTCCCCAGCGCCAGTTGCTTGAAGGCTGTAGTTTCCACGTCGTTTGAGCGTAGAACCACCGGTTCAACTCATAGCCTTACGACGTCGTTAAATTCACGGTGCGCACCTCGGCGCGAGAAGCCATAGTCACCACCGTCAGTCAGACGCTCTTAGCAGGTTGCGTATTGCGTCCTGCTGCACATGGAGCGTGACACCATTCACGTGCCCTCTGTTTAGCCGTTAAAGTGCCCCGTTATCCACGACCTCTTTCCGGCAAGTTGCTGCACGGCGTGATGGCATACGGGTCGTCGTTCTCACGGTACTCACGCAGTGACAAACACAGTCGCTGGCCAAGCGTACTGGATTCAGCCATACGCTGTCTCAGCAACACCGTCCGAAGACAACGTTACCTTCACGCCGTTAACCTGGCAAATTTCCCACGCTGACGGATCCATTTCTAAGTTAGCCGAGGGTCTCCGGTACCCGGGCCGTGCACCTGTGTGATACTTCGCCGGTCCGTGATAGCTGAAGCCGTCCGGTATCTCATTTCTTCACCACACGACCAAGCGTGGGTACCGGCATAGTCATCATCGCACTTTCAATAACATCGCCCGGTACACCGACCAGCCCTTCTGCGCCGACGAAATCTACGGTCCGTTTCCAGCAGTTCTGTTTGTAATCAGCCACAGCCCTAGGACGGTGCTGCCCCGGCTGGTGAGCCAAAGGCATCCATCTTCCTTAACATTACGACCTGGCATCGGTATCTTCAACAAGCTCTGTCCGTCTCAGCGTTTGCTGTAATCCAGTTCGCCGCCAACAAATCTTAAGGCGGTCCTTCAGGGCACTAGTGAAACCTAGGCCATCATCCGCGCGGCATACCACATTATGCCGTGTATAGTCCACGTAGGTCTCGACGTCGTTATGCACGAATGACGTCAGCGTCTGCCCCGTTTAATAAGCAGCCCGATATAGAAATGAGCCCACATCCACGCCTTACGTGGTTAGACGGCATTACAGGTATACCGACATGGGCGTGCACCCGCTTTAAGGCCGACTCTTAGCAGTACTGGCTCATGACATACAGCGCCGTGCCTTACATCCGCACCAAGAACCTGTTCCAGGGTCCCTGACGGATGGTTAAGGCATATCCCACAGACAGGCCATGTTGATCGTATCGCTGTTTAACGTTTAGTTCTAGGCCTCAGATACCGCTGTATTGCCCGCGTTATGCCTTACGTTACAGGTAAATCGAATACGCCCGACATCATCCATATAATCTAATCCATGCTCCGATTGGCTGCCGACCTGAATTAGATTGTTCGGGACGCCGACTTTCCCGGCTGGGTCGATTAGCCACAGCGTTTGCGAGGACGAGCTGGTCGTATCCTTCCTGGCAGGTCGGTGAGCGATGCTCCCGTGCATGGGGAGGGACGGGCTCGACCAGTACCCATCACCACTGAGGCCATATCGCAGGGTGGTTTGCGCTTAATGGTATGTCTTTTCCGTAAGGTCCAGCCGTTGATGCGTTGTAATCGAAGGATTAGGGACTTCCGGACGCTTCCTGTCATTTTTAGTATTCCACCAGTGCCTGTACCATAGAGACGGTCATGTTTGCACTATATCAATGGTGCTCGTAGATGTCATATTCGTCTATCCAGCACGCGTTGACGGAGCCAAATGCATTTAGGCTTGCCTCCTCACCAGCCCGGAACAGTCACCGTGACAGCGATAGCTAGATCCTCTAGTGTTGGTCTAAGCGGAATGTCTCAATCGACGGACCGTATTTCTAAAGTTCCATCTAATGATTACACTGACTCGGTCCTGGCATGGATCACACCCAATGATTGCGTGACTTCAGTCAGTGCTTCGGTCGGAGGGGTCCCCTTACTGCTTCCTTTACCCATTCCTCACCTCCATAAATGACAAAACCGCCGGCGTCCGCACAACATTTTGCATCACGGGTACCAATCAGATAATCATTTGACCAAGTCGTCTCTGCCGTACTCCTGAGAACCACGCGTATCGAACCGCGTCGCACTTCCCCGACCAACAGGACATTGCCCTAACCATGTTATCCATTAGAGAAAGCCTGTGCTTAGCGGCCGTCGTTATCCGTTGTCTGTACGGGGAGTTCGTGGCTTTCGTCAAGTGCTACTTACCCGATACATGTAAGCCGAGACAGTAAGGGAGAGCACCGTACGGTCCTCTCCCAGCCTCGCAATGGCTGCCCCGGAGTGGTACAAAGACCGGCAGCAACCGCGGCACTTAGCGATAGCGAAGCGACGCCCCAACCTATCCGAATAGTGACTAAGTGGAGGATAGGCAACCAGTGCCCTAACTCGCAGCGATCTCATGAGCTTAGATTGGGGACTGTTAGACGCTGACGTGCCCGGCAATCCGTACCTGATACCAGCCCGTGCTGAGTTTCTCACGAAATGACGGGAGCTGTGTGGCCAGTGCCCACTGGCTTCAGCCCCCGTTTCACACGAAGTCTTAGATGCGGCAAGCCAATCGTTACCGTAATCCCCAGTGAAGGTCCGCCATGCCCGGTGACGCCAGGAGTGCGTGTGCGTCCGTGCCATTTAGCGTCATCCTCTCGTTTGAGCCAGTTGTCCAGGAACTGTGCAGCACCGTTTCCGCAGTAAATGCGCCGTACTTCGATAATAAATACAAAACAGCACAGCAGGCACATCGCCGGCCTGTGCCGTGGACGGAGCTGATACAGCCCCGTCGCCTCCGAGAGTACGAGAGAGATTCTCTATAGATTCAGCGATGCTCGATGAAGCTTTAAGCATCAATCCCGCACAGATGATAAGCATCCCGGACAGTTCTTTATGTTTGG * tp:A:P cm:i:181 s1:i:1094 s2:i:0 NM:i:3497 ms:i:2124 AS:i:1522 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
89 81 16 utg000001l 13612 60 14S12M1I4M2D7M3I4M1I19M1I18M1D21M2D6M3D14M3I19M1I2M1I6M1I1M2D6M1I12M1I36M1D54M1I8M1D17M1I59M4I31M3D4M2I3M1D5M2D4M3D31M3I50M1I14M1I20M1I2M1I14M2D35M1D37M1D4M4D8M1D19M1D11M1D14M2I2M3D8M1I14M1D9M1I11M2D39M1D9M1D9M1I18M2D13M6D7M5D13M3D3M2D4M4I4M2I2M1I39M1D2M5D8M1D23M1D11M2D3M1I30M1I69M1I7M1I6M1D20M2I12M3I5M1I14M4I10M1D4M2D10M3D20M1I32M1I16M1I17M1D13M1I16M2I5M1I1M3I8M9D18M2D6M1I6M1I21M2D3M2D3M1I10M1I2M1D9M1I3M1D4M2I4M1I3M2I14M1I13M3I4M1D5M3I13M3D1M2D3M1D1M4D6M1D4M2I1M1I8M1D24M6D7M3I4M1I2M2D24M1I5M2D7M1D8M1D16M6D17M1D5M1D8M2D1M3D7M4I1M1D8M1D10M1D1M1D15M1I2M3D24M1D7M2D7M2D7M4I17M4I7M1I14M2D12M4D1M1D13M1I9M2D18M1D4M3I11M1D3M4I13M1I2M3I16M2D1M3D7M1D4M2D6M1D9M2D18M3I1M4I3M1I3M2I1M1I47M3D15M1D30M4D12M1D16M1I3M2I4M1D8M1I7M2D3M4I7M1D6M1I7M3D18M4I5M1I18M7D8M3I3M2D5M1I28M1I5M1D4M2D11M2I14M3D25M1D3M2D19M6I19M2D15M1D2M2D3M1D5M2I11M2D3M2I3M1I7M5I2M2D12M5D12M1D5M4D13M1D3M3I5M1D11M1D3M2D10M1D5M2I4M1D3M3I1M1I3M1D3M3D8M1I11M1D12M2I19M3I4M4D3M1D4M6I2M1I28M1D3M1I7M2D4M4I9M2D6M1D4M2I1M1I5M2D6M2D2M3D10M1I6M1I1M4I5M1D3M1I20M3I3M2I9M7D11M1I3M1D6M2I2M1D3M1I19M1D23M1D12M1I2M1I10M2D9M3D11M2I20M3D7M1D6M1D16M1D4M1D1M1D13M1I4M3I10M3D1M1D22M1D3M3D13M3I7M1D5M1D9M3D5M4D7M1I5M3D1M1D7M3D1M3D12M4D7M1D2M1D10M2D2M1D7M1D1M3I11M3D6M2I9M3D1M5D14M1D21M6D6M2D23M7D8M2I12M1D8M2I5M1D5M1D9M1D10M1D7M1I6M1I15M1I7M1D2M5D4M2D12M3D9M5D3M1D14M1I15M1D9M1D12M1I6M2D3M1I7M2D21M5I5M6D4M1D23M1I13M3D3M2D9M6I4M1I20M2I8M1D8M2D2M1D2M1D2M1D6M6D2M1I5M2D11M2I18M2D7M1I6M1D22M1I1M2D19M1D6M1I4M2I4M1D26M2I15M1I9M1D4M1D8M1D5M2D12M1I5M8I3M3D16M2I6M2D3M1D11M1I32M1D8M2D8M1D11M1I15M3D6M1D8M2D2M2D11M3D21M1I13M1D5M1D9M1D4M3I2M1I23M1I6M3D49M1I16M1I5M2D12M7D4M4D13M2D3M1D5M3D10M1I7M3D2M2I2M1I4M1I2M2I11M3D5M1D9M3D8M1D1M2D23M1I20M1I6M1D5M4I16M1D2M1I2M1I3M6I13M4D3M3D6M1D3M1I3M1I5M1I7M1I5M1D10M6I2M1I3M1D3M2I2M3I4M3D3M1D8M4D8M1I4M1D4M2D22M3I7M2D4M3I15M1I1M4D5M3D1M1D5M3D1M2I3M3D11M2D4M1I7M1D1M1D16M6D3M6D4M1D9M6I8M1I7M5I6M2I6M4D8M2D10M1D3M2I11M2I2M3D5M1D4M3I10M1D14M1D1M1D4M1D6M5I1M1D11M1I3M2I25M6I11M1I1M1I10M1I1M1I13M1D28M4D3M2D3M2D8M3D6M1D2M4D6M1I5M2I1M1I15M1D1M3D23M4D2M1D5M3I6M4I5M1I4M2D2M1I5M1D4M1D27M2D5M2I2M5I8M3D3M1D4M1D7M3I3M1D7M1I5M1D9M2I5M1I5M2I6M1D6M2D1M1D14M5I20M1I3M1I2M1I3M1I4M9I3M1I4M1I2M1I1M1I5M2I2M1I15M2D11M1I2M1I14M1I13M2I2M2I3M1D24M1I6M1I13M4D4M1D3M1I6M2I8M2I9M3I12M2I10M1D6M5I9M2I1M1I1M1I8M1I3M1I7M2I10M2I5M1I4M1I27M2I11M1D3M2I12M4I15M1D5M1D15M1I12M1I8M7I4M1I8M1I1M1I3M2I3M2I5M1I1M1I3M3I4M2I3M1D3M2I6M1I2M1I7M2I3M1D3M1I6M1D6M2I1M1I4M1D10M1I1M2I3M1I2M1I13M1I6M5I5M99I5M2I1M3I6M1D10M4I5M2I19M2D1M2D8M1D1M1D6M1D3M1D6M1D7M1D19M4D7M2D4M1D6M1D14M3D3M2D15M1D5M1D5M1D4M2D4M2D1M1D2M1D5M4D7M4D7M1D3M6D5M1D3M5D1M2D2M4D2M2D5M2D3M1I3M2D2M1D6M3I7M2D4M1D12M5I14M2I9M1I3M3I2M1I5M1I13M2I19M1D10M2I1M1I2M1I12M1I5M1D22M2D1M1I9M1D8M1I6M2I10M3I11M2I3M1I14M1I9M1D2M2I20M1I3M2I1M3I5M1D2M2I5M2I9M1D15M1I1M1I2M1I2M2I7M4D2M1D15M1I4M3I2M1I10M1D3M2I8M1I3M1I2M1I6M1I12M1D5M1I4M3I1M2D7M1I2M1D3M2D4M1I14M2I3M1I14M1I12M2D6M1I3M1D4M1I5M4I6M1D2M1I24M1D1M1D9M1I26M1I4M1I9M1I3M1I5M1D5M2I3M1D3M1D9M3D1M2D9M1D11M1I8M3I4M1I5M1I5M1D6M3I8M1I31M3D2M5I2M1D7M1D5M1D17M1I1M1I1M1I5M1I6M2D28M3I18M2D3M1D16M2I3M2I2M1I3M1I25M2D16M3I4M1D2M1I11M1I4M1D7M4I6M1D2M1I3M1I3M1I4M1I26M1I2M1I7M55S * 0 0 AATAAAATATTAAACTGTTCGCTGTAGGGGTCACGAGAACCACGAGGCCTGATGTGGTTAAAAGACCAGGCACAATCTTTACTACGCAATCCACTATTTAAGGTGATATGGAAGAAGGCATTTGATCCGGAGTTCGAAGAGCATCCTCGCTAGGCTGCTTGGAACAATACCAGGACTACTTCGTATGACTACGACTATTGATAAAATCAATGGTGGGACAATTCAAGCGATGCAATGGATGCAAGCTGCAATCGGAATGCATGGTTAAGCCTGAAGAAATGTTTCCTGTAATGGACAGATGGGAAATATGTCGATAAATGGGCAATACGAACGACGGCAATGATTGCCAGAGAACTGTGTTGGTAAACAGAACAACAAAGCTGCCTGATAGCCTTCTTATTTTGGCATCAACAGAATAAACACTGCACTCTTGATTCATCGGTTAAACGAGTGAATACACGGAGCAATGTCGCTAGGGTAACTAAACAGGAGCCGACTTGTTCTGATCTATTGGAAATCTTCTTTGCCTCTGCGAGTGTGAGGGCATTTATCTGTGAGGATATGAACAGATGTCAAACATCAAATACATCATTGATTACGACTGGAAAGCATCAATAGAATTGAAATCGACATGACGTAATGACAGAGGAAAACTTCACCGATTAATAATTTCTGGTCAGACTCTGAAATACCGACTCAATAACACGGCTGATCCATTAAATGCTGTATTAATGATGCTGGCGCAACATGCTCTGCTTAGCATTTCAAGCACTTAAATGCCGGATGGTGTTGTGTGAGTTCGACTGGAATGATGGAAATGGTCAGGAAGGAACTTATGCAGCGATGGCTACGCGAAGGAATAAGAATTACCGATATCGATACATCAGGAATATTTGATTCAGATGATATGACTATCAAGGCCGCCTGAGTGCGGTTACCGCATACCAATAACGCTTTCACTCGAGGGGCTTTTCGTTATGTATAAATAAGGAGCACACCAGTGCAATATGCCATTGCAGGGTGGCCTGTTGCTGGCTGCCCTTCCGAAATCTTTACTTGAACGAATCACCCGTTCAAATTACGTGACGCTGGATGAGAACGCCTTATCTACGCCCAACTACTTAATCAGCCAGGAGTCTAGAAGAATGGATCAAACACTTTATGGCTATCCAGACTAAATTCACTATCGCCAACTTGAGTCGGCGATGAAAAGATGTTTCGTGAAGCGTCGACGCTTATAAAATGGATATTAATACTATGAAACTGAGATCAAGCAAAAGCATTCACCAACCCCTTCCTGTTTTCCTCAATCAGCCCGGCATTTCGCTGTATTTTCCACAGCTATTCTCGGAGTTTCATGGCTGAACCCCTTATCCTAAGTCAGGATCGTCTGTGAGGAATAGAGCTCTTGAGGCGTCACTACCAGCAGCTCGCCCGTCAGAAAGTGCACCGAAACTGGCAGACGACTCAGAAGAAGGCCTGCCCACCTGTTTGGGAATCGCTGCATCGATTATTTGCAACTACACGGGGCCAGCAAAAATCCATTACCGTGCGTTTGATGACGATGTTGAGTTTCAGGAGTGCGCGCATGGCAAACATCCGGGTACATGGTTGAACCATTGCTACACCAGGTTGATATTGATTTCAGAGGTATAAAACGAATGAGTACTGCATCGCAACGCTGGCTGGGCTGGAAGCTGGCTGAACGTGTCGGCATGGATTTCTGTCGACCCACAGGAACTGATCACCTCTTCGCCAGACGGCATTTAAATGATGCCAGCGATGCGCAGTCAGCCTCATCGCATCATGACACTTCGTTGCCAACCAGGTCACACGGCCTTAATCCGTAGACGAAAGAATTTACGCCTTCCTTATAAGCAGAATGGCATCGTTCGTGCTGTGGGTGGGCTGGATTGATGGCTGGTCCCGCATCAGTACAATGAAAACCAGCAGTTTGATGGCATGGACTTTGAGCAGGACAATGAATCCTGTACATGCCGGATTTACCGCAAGGATCTGATCATCCCGATCTGCCGTTCTACCAATGGATGCGGATGAACCGCGTCCCGCGAACCATTCAAAACTCGCGAAGGCAGAGAAATCACCGGGGCCGTGGCAGTCGCATCACAAACGGATGTCACAAAGTCAACCCTCATGATTCAGTGTGCCCGTCTGGCCTTCGGATTTATGGTATCTATCACACGAGGATGAAGCCGAGCGCATTGTCGAAAATACTGCATACATGCGAACGTCAGCCGGAACGAGGAAGATACGTAATAACGGTTAACGAACGCAGCATTGCAAGGAAACCTCTGCCCTGATCGACATGGAGGCAAGAACATGGAACCAGAAGGTCTTATTACCTAACTTCCCCAACATTCACGAGACATTCGTTGGCATGACGTCCAGAGAACAGCAACCAGTTAAACGACTTGGAACCTTTAACGCTGAACAAGCATCACGAGCAGAAGATGAAGCAACCAGACGCATCAAACATTATTATGCAGATGAGTGGACGATTATACAGTCAGAACAATGTCGAGCACGCATGATTAGTGAATGACATAAGCTCAGATGAGGTCAATAAGGCCATTCAAGAAAGTCTAACGTCAGACCATACCGAAATCAGTAGCGGAAGAATGGACATATCATGAAGAAACTTTACGCATCGTTTGGACACCTTATTGAGCTTAATGAATGTTAAGTGCTACGGAAATTAACGCTAAAGCACTGGCCTGGGGAAAACAGTACGAGAACGACGCCAGAACCCCTGTTTGAATTCACTTCCGTGAATGTTAGTATGGATCCCCGATCATCTATCGCGACGAAAGTATGCGTACCGCCTGCTCCCCGTGATGGTTTATGCAGTGACGTGGCAACGGCCTTGAACTGAAATGCCCGTTTACCTCCGGGATTTCATGAAGCCATTGGAGCGGCTCCTTCATTCGAGGCCATAAAGTCCAGCTTACAGCCCAGGGTGCAGTACAGCATGTGGTGACGCGAAAAATGCCTGGTATCCTTTGCCAACTATGACCTCCGCGTATGAACCGTGAAGGCCTGCATCATTATGTAGTGATTGAGCGGGGATGAAAGTACATGGCGAGTTTGACGAGATCGTGCGTCGGAGTTCATCGAAAATGGACGAGGCACTGGCTGAAATTGGTTTTGTATTTGGGGAGCAATGGCTCGACGCATCCTCACGATAATATCTGGGTAGCGCAATCACCTTCGTCTACTCCGTTACAAAGCGAGGCTGGGGTATTCCCCGGCCTTCTGTTATCGAAATCCACTGAAAGCACAGCGGCTGGCTGAGGAAACATAAATAATAAACGAGGGGCTGTATGCACAAAGCATCTTCTGTTGAGTTACAGAACGAGTATCGAGAGCACGCACATAGCCTTGCTGTAAATTGGAATCAGGGTTGTTGGTACAGTAGAAACAGACGAAGAATTCCATACGTCGTTAGCCTCATCCCTTTTCACAACAGCTGGAAATGATGGTGGCGAAAGCAGAAGCAGATGAGAAACCAGTGATGACAACCACGGAATGCATTTCTGTGAAGGCCGGGTTCATATTCTGTGTGCTTATGCTTGCGTCGACATGGGACTTGTCGTAATGACACTCAGCAGGAAACCCCCTTCGCAGCATTGCCCGTCCATTCATGAGGATTCTGAAATCAAAAGGCCCGGACAGCAGTTTCCGGATAAAAACGTCGATGACATTTGCCGTAGCTGATTGGACTGAAGGCACCGCGAACGGTAACGCTGATGATGGGATTCACCGACTCATTTAAGCCTGGCAATCGGCATGTTAAACGGCGTCTTTAAGGAAACGATGAACATGAAAGCAAATCATCAGGAGCTACAGGCTCCTTTTATTATTCGCATTCACCCTCAAGCGTATTAACCAACAGTTCAGGGATTAATGAAAGATGGCAGACATCATTAGATTCAGCATCAGAAAGTAGAAGAATTACTTAAGGGACACAGCAATAAAATGCCGCCTGAAAACACCAGCGCTATATTCCACTCATTGTGCTGTGGCGATTAGGATGGAGAGGTGAACGAAGACGCCTCCGTCGTTCAGGGTTGTCGGACTTGTGCAAGTGCCAGGAGGATCTGGAACTTATCAGTAAACAGAGGTTTCGAAGTGAGCGAAATTAACTCTCAGGCGGCACTGCGTGGAGCAGCAAGAGCACCAGGGCAATGCATGACGACTGGGATTTGACGCAAGACTTTCCATGAATTGGTAACACCATCATTGTGCTGGAACTCTGCTGGATGAACGGGAAAGAAACCAGCATCAAGCTAAACGCCTGCGACCAGGAGAACGAGGATATGCCTAACGGTAGGGAAGCTTCGTGTTGAGCTTGAAAGCAAATCAAACTCAACGAGCAGCGTGAGTATTACGAAGGTGTTATCGGATGGGAGTAAGCCGGTATTATGGCAACGGGAAGCAACGAAGTCCGTGAAGACGGAAACCAGTTTCTTGTGTTCACCGCCATCCTGGGAAGACTCCTGTTATCAAGCACTGCAACTGACCTGGAAGAGTTTCTGCGGCAGTTAATCGAACAAGACCCGTGATTAGTAACTATCGACATCATTACGCATCAGTCCGCTACGATTGGAGGGGTAATGGGTTCAGGATGCAGGTGAGTATGCATGATGTCTGACGCTGGCATTCGATCAAAGGAGAGTGAGATCGGTTTTAAAGATAACGCTTGTGAAATGCTGATTCGCGTAGTCGTCTTCGTTCACTAGTGCCAGAGTATCTATGTCAGATGATGACGTACTCAACATCGGTTGAGGCGCTCTTTATCTTACTTCGTACTAAACATCAGTGCGCTACGGCTTTAGTGAAACGACATCATTGCCAAGGGAATTTATAATGAGTGATGATTGAGATTACTCACAAAAGATTGGGCGTTATCAATGTTGTGCAGTACGCTTGTCTTGTCTCCATGCAGACATCACGAAGGTGTTTATGTAGATGAAGGTAGATAGGGTCGGCATACAAATATTCCATGAAGGTTTATAAGTAATGAAGACAAATCCCCATTCTGCAATGTGCCAGAAATGACCTGATAAGTGCAAATTATCACGAGTACGGGTGGAAACTACATACTTGCCCTCTCTGTACAAACATATAGATGATTAACCCAATATTACATAACAATCGCATCGCGGGGATTTATGTTATCTGAATCACGACCTGGCCGGGTTTTGTTTTATGGAGATGATAAATGCACTTCCGAATCCCGGAATGGATGGAGAGCCATTCAACAGAGATTATCGAAGCGGAGAACATCAACGACTGCTACGACCACTGGATGATAGCGGCGCAGCAAGAATATAGACACTTGCACATAACTGGTAACCAATACTCTCGAATATTGTCACAAACTTTGAAAAGACACTACCCGCCCCTACGCGCTCTCCGCGTAGCACTCTCTACACCCTCGTACCTGTCATCCGACATTTCATTGTTTGAACGGTCTGCACGGTTAAAGGATAACTTTGCCTTGTGAACACTTGTGTAGCTACTTCAGTTGTCTGGGCCTACCTTGTACAGGATACCCCACCTCTACTAGATGGACGGCTACCCGGTCCTGTACCACCTCAAAGGAGCTTAAATTGAATAACAGTCGTCGTGCGGTCGATGCAGAAGTGTCACACCGGTTAGAAACGGGAAGAAATATCTGTCCACGATCAGCGGTCACTTGACTTAGTACGACCGTCCCCTGATTTGAGAGGTACAGAAAATGGAAGAGGCAGTCGGCTCGGGATTTACCAACCTTTAGAAGTAATGGAACTTGGTAACAGAGCTGGATTTACGGGACAGGCACGGAATCCATTCAAGGCGCTAGCCAGGCCAACATTGAGAGTCTTTCATAGGACACAAACACAAGCCTCTGACAGCGAGAATCAACAGTGATAATTCCGTTATTACGTACATTCCATGGCTTGATCGCTGCAGAAAATGCTGGCCAGCAGAGGATCAAGCAGAAGACACTCATAAATTACATGAGCAAATTAGACAATTAATAAGGCTAGGAGGATCTGCCTGATGCTCTTACGCAACCACAAAGAAATTGCGGCAATGCTCAATGGATACATAGACGAGGGCAAGAGGCGTCAGCCAAGTAATAATCAACACTGAGCGATGCATTCCGGAGGCAATAGTAATAGCTGAAGGCCATACCAACAAAGCCATGTCCCTTCATCGCGCAGCAAATCAGGTAAGGAGATCAAGACTTACGGGCTGACGAATACCTGAAAATTTATCAAGCAGCAGAAAATCATACCATGTTGGCTCAGACTTGCAATGGAACTGAGCTTTGTCACCGGGCTCGAATTATCGGTGATTTATGCGAAATGAAGTGGTTCATCGTAGATGTCCGGATATTTATGTCGAGCAAAGCAAAACAAGGCGTAAATTACTCATCCCAACAGCATGCCATATTGATGCTCGAATACTAATGAAGGAAACACTTGATAAATGATGCAAAGAGATTTCTTGGCGGAGAAACCATAATTGCATTACTCGTCTCGAACCGCTTTCATCCGGCAACAGTATCACGTATTTATGCTAGGCGCACGAAAGCATCAGGTCTTCCTTCGAAGGGGATCTCACTTTCACGAGTGCGCAGGTTTTGTCTGCAAGACTCTATGAAGCAGATAAGCGATAAGTTTGCTGATAACATCTTCTCGGGCATAAGTCCTAACGCCGGCAGCCACAGTATCGTGCTGATGACAGAGGCAGGAGTGGGACAAATTGAAATCAAATAATGATGTGCTGTTATCTGAACTAATATAGACCTGTTCGTTGCAACAAAATTGATAAGCGATAACCGCTGTGTACGCCAACCGCTCATAAAGCTGAACGAGAAACGGTC * tp:A:P cm:i:84 s1:i:777 s2:i:0 NM:i:2109 ms:i:2756 AS:i:2571 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
90 82 4 * 0 0 * * 0 0 TGGCGCGATCGTATACTGTTTAACCTGATGTATTGCTGTTTCTTTCCCGTTCGTCTCAGCAGTTCCATTACAATCAATGGTTACCAATTCATGGAAGGGCTTGCGTCAAATCGCGTCGTGCTGCCATTGCTGCTCTGCCGCTTCACGCAGTGCCTGAGTTAAATTTCGACTCACTTCGAACCTCTGTTACTGATAAGTTCCAGATCCTCCTGGCACTTGCTAAATCCGACAACCGCTACCCGCGTCTTCGTTCATCTATCGGATCGCCACACTCACAATAGAGCCTTAGAGTGAGGTGGACTAATAGTGAGTTCGGGAGCGAGGGCATTTCTTGGTCATGTGTCCGTATGGCCGTGATCTGACGTTCGTTTATTTACTACTTTCATGCTGAGACGTAAATACTTGTCTTCAGGTCTCATCTTTCGGGCAGAAGCCGAGGAAAAGGAAATAATGCGATATAGGAGCTGACTCAGGTGAATTTGCTTTTCACTGTTCGTCGTTTACTGCCTCACCACGTTTACGGTTAAAATGCCTAGACAGTAATGAGTCTATCCGTACGCTCCGTTGGGGTCGACCTCGACAGATTGGTCGTCCAATCGCTACGGCGAACGTATTTATGAGGTGTTTATCTTGCGAATCTGCTGTCGGCTTTCTCTTTCCTCGAATTCCATAGCCTGACCTGCGGCAGCCGGATCATGCACTCCCGTTTAGTGAAGGTGTGCTTCATACAGAGTCTAAGTGTCAAGCAGGCACACCGCCCAGAATATGGAAGGTAAGTCAAGAGAACAAATGCGAAGATTAGATTG *
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
91 83 4 * 0 0 * * 0 0 CTCGTCTGCTTAATGCATGCGACGCCCTCCGAACTTAGAGGTGTAAAGCTGATAAAACAGCGGGGGTAAATAAAAACGTCGCCGTCTGCTATCCTTCTCCAGTCGATCCCAGTACTAATGCACGAGTTCAGTATGTTCTTCATCGCTTTATTATCAGGTTCCTAGGGTTTGGCTTGGTGCGCATAGCCCATGGAGCGTCGGAAGACGTTCTACGTTTATCCGCTCAATATTTGTTTAACGATCTAGGCTAAGGGTAGGGTTTAAGCCCGCCAACGGGTACGGACGTCCCGCTACATGTAATTAGCGGTAAAGCCATTTTCAATCCATCAACACAACAGGAGTGCAAAGTTGACCGACAAGCCACCTTACATTTCCCACGAAGACGGCGCTTGGACATTTTACCGCCACCGTAGTCAGGCCAAGCACAATGAGCCGCTGCTCGCATTGATGTCTTAATAGGTTGAATTAGCCGCATTGCTCTTTACTTTAACTCCCCTTTATTAGAATAACATTTGTAAGTACTATTAATTTCTACGACATGGCCTTTCATGCTGTCTCCAGTTTTAGATTATTTGTCTCACCGGCACTCTGACAAGTGCGACTCCCATGAGAACGCGGAGCCGTGATGAACTTGCAACCGGCTAAGCAAGGGCCATTTCGGTGGATATACTACTCTCATGTTTTGGTAGCTTACAGCACTCTATGTTCTCAAACGCGTTCCCAAGACAGTTAGCGGCCAGTACACTCGGAGCCATGGCCACGATAACCTAACTCTTCTAGAACAGCCAGTCCGATCACGAAGATTTTCCCCATGGTTAGGTGTTAACCGCCCCAGAAAGTCGCGCACCATGAGTTACAACGACGCTGGAGGGACAAAAGTCGGCCCGCACCATGGTTTAGCGACTAGCACTCTTTAGATGATAGGCCCTGGCCATAGCCTACTTAACACTCCACCAAGTATCGTACCGCATCGTTCCCGGCTGTACCCCATGTAATTCTAGCACGGCTGGCAGTCTCAGGCAATGGCACCTAAACAGGTTATCGAAATCATGCCACCTCCTCCGTTATTGCTTTACAGCGCTCTGTCATTTCGCTGCCACCGGCAGAGACACGAAACGGGTTCCGGCACCGCCACAGATGCCGCGCTAGGAATTGGCAGTATGCCCGATTATCAGTCAGTCGATACAACTATTAGAGTGTCACCAGGGTCAACACGACCGTGAGCCAGAAGTCGCATCCCGCATCCTATCTATCCGTAGATCCCACCCTCATTTTCTATGTTACGTCAGCACATTTTCTAGCGAGGGCGCTTTACTTATCGCAGTTCATCCGTCATCAATATTTCCTGGTGGCCCACCCGTCATCTTGTTCTTTCTTCGCGTCATGACAGCCACGTCCGTTGTTGTCCCAGCGAGCTAGAGACGGGCAGAATCAGTTCATGTTCTTTAGTACAGGGATTCCTCCAATACGAAAGGGTACGGAGTTGTACCAACACGAACTAGCACGATAGCCAGCAGGCACAGGCGGCCTAACGATCAACTGAATCATGGCTCAAAACCTCAACTTCACGCGATTTCGACGGGCGAGGAGCAGTTATTCGTCCCTTCGCTGTCGGTCGCATCCTGAATGCGACCGCATCCCAGCCAGTGTCGACCAAATGTCCTTATTATGCCGCAGCACCATGGTGTTGAGCTCTAAGGAAGTTCTTTGTACCGTTTGCCGTACTTTAGCGGCCCACATAAAATACAAGCTAATTATCAATCTAGATATAAGTCCCCCATGTTTCACCGCTGTCTCCGGCTAGAATTAGAGCCAAGACTATCGACGTCTATTAGCGTTGAAGTACGAACCTCCGATAGGGCCGGACACTTTCCATTAAGAGCCACATGATCCTAGCTAGTGGCGTCCTAATCAGTCATGGTCGGTTGATATCAATAGTCACTACGGTCTCCATTAGCCGGCCGTCACGGGTGATGCTTATGTTATTCTCCTCACTTAGGGCCGCTATCTAAGCCAACTGATGAAGGCTTCACGGTCTGACATGGTATTGCCTGCTAAGCAAATTAGATCGATATTCGATAGCATCGCGACTTGGTCACGCATGTTGCAGGCTAGATGGGCCTCCGACGGGCTAGGTACCCCGGGTTCTTAGGAATGTTCATCCGGCAGCAGACGCAGTAATCAGATTCACTTCATGCTTCGGCTGATCATATCCCGGCGTAAATTCCAGGTGAGTTAGCGCCGGCACGAACAGGGGATACATCAAGGGAAGCTCGGTGAAAAACGTTACAGCGCCATCTTTACCAGAGTTGTAGAAGTCCGCGATAGACTTTCTCGTGACTTAAGGCAGCTCGCATGGAAAAGAGACTAAGAAACAGCGGATCAACGACATATTAAATTTCCTCTAGCTAGTCGCCGCCAGCAGTTGGCGGTTGTCATGGACATAAAATCTAGGTCAAAGCGAGCGCAACATTTAGTGAGACATAGGTCAACGGTAAACTATTGTAGATCGACGTTCCTCTAAACGCGGTCCAGTTTTCGTCTCGTTGGCATAGCTCCCATAAGCACATCCTAACAGAACTGTCGACTGCCGAGACGTCATGTCGATCTGCCTGTTACCAGCCATACAGGGATCGAGCAGGTCACTGTATGTCAAGAATGAGACATGAAGCTTACACTAGCTGGGGACTTCGACGCATCATAGGGTCATTGCAGGGCGCTTTTAGCCAGCGTAGCCGCCGGCGGTCATCCCTCCTCCTAGGTGGGTTTCTTCGGTGATAGATAAACCGTCTTCGTCAAGCTGTAGTGTTTAGCAAATGGTTATCGCAGCCATGCTGTGCCGGGTATGCGCCTGCACCGACAATCCCTGCCCACCGCACCTGCGGCCGTGGCGCATTGCTTAGATGTCAGATATTGGTGGTCAGAATGCGGCTGAGCCGTTTCATACTACGGTCACCTCCTAGGGGTCCCTAGTGCCTGTTCTTCTAGTCCTTAGCCTCCTACAGTTGAGGATCCCCATAATGCGGTAATGTTTTCCCGCATGCTGTAATGTAGCGTCCACGTCGTCCCTGTAAGCACTCCGTTTCTCTAGCCGTCCTATAGCCTGGCGCCGTCGCTTAAGGTGATAGACGTCAGCCTGCGAAGCGAATCGAGCTAGAAACAGTTGTTGATCGAGTCTCTTTTATTGCTTCCTATAGTACGAGGCCCAGTCGTTAAGCGATTAAGTACGAACGGTACGATTAGCCGTGGTGCTCTAGCTATAACAAGTTCAGCCAGTCCCGGCAGCCAAGCTCCTGACGCTGTGTACATCCAATACGGTGGCCACGCTAATCGGGTAGGCCTCGTATTACACACTTTGACAGACATGGCTATTAGGTTGATACGAGCTCCTGCAAATTACTAGTGTCATCGAGACTGGACGGTAAGAAGTTGAGCCTTACTCCGTGACAGTACATCCCTATTACGTCCTTAGGCCTACGTCGTCCTTTTGGCTAAACAGTCGTCGGGTGTGGGTCAGCCATGATACCGATGAGGCCTGTTTTACAATCAGAGTCTGCGTACACAGCGGGGATCGCGGGTGGCAGCAATAGTAATGAGTCGGCCTGTTGGTTGAACCAGCGCCATACATTTGGTCT *
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
92 84 4 * 0 0 * * 0 0 GCGGGAGCCTGTCGCTCGTACTCGACCTGGCAAGGCTCGTAAATTCATCAACTGTTGGCCGCTGCTTGTTGTAATGCCGAGCGTTGTAAACGAAATAACGTTTGCGATGTTAGTCAGGTAAAGGTGGTCCCATTATGTACTGTTAAGAAGTAATGGAAGTTCACTCAATTGTTAGTTACAGCCCGCATCCTTGCAAGGGAACGAGGAACGGTTTAGTTCCTGTTGGCTTAGTTCGTCAAAGTGCTTTTCTTCAGTTTCTCACGTTGCCATGAAGCCATTTGATCTATCTTTGAATAATTCCAATTACCTGAAGTGGTCTAATGGCAAGTGCTTTATCCAGGCCTTAGTTCCTTTCTAGCCTATATCCAAATGAAGCCAGGCAGGGGTTGGGAATGTTACAACGTCAGCTCCTGAACGGATCCTGTCTGACGTGATCCAAATGTTATTAAAACCCGTGGATGAAGTCTAGTCAAACTTTAAACCGTTAGTTTGCAGGTTGGCTGTATAGTCAACTAACTGTCGAACTATTTAGAGCCAGTTTAGACGTGCGTGCCCGGAATGCTTTATTACTGCTCAACCCAACCTGTCGGTAACTTCAATTGAAGATTATTCTCCGTGCCATAGAACCAAATTGAATCAAAGATCCATTGACGCTTTATTTGTATGCAGTTACGCAGTTATACATTGCTAAGTCTAAGGCAGTGGATAATTCGTACGTATTTAGATGGCAGGCATACGTCCGTTAATTAAAGCACTCGTACGATTAACTAAGGTAAAGTTGGTTTGCGACGTACTATTCAACGGTCTATTTCAGTCGCCTCGTGATTCGACTGCCTGGCTCGAGCGTCTAGACGGTCAATCACGTTGGATGTACGAATTTAGAGACCGTAGCGTACGTCCGGTCCTGTCTACAATCTATCTAGGTAAATTACCAGCAAATGTACGTGCGTTGGAAATCGTCAAAATTCAGCAGCCATTTACATCGACTTAGAATTTACATCTGCGAGCTGTCAAATCGTCAGGTTTATCCACTCATTTGATAGTGCTTAATCCATATGTCAAAGCACTGTAACTGTCATCTAAGTCGAATTACCGGTAAACTATAGTAAATTAGTACAGGAAGTGCTTATGTACTTCAGGTCTAAATTGGCTGTGGCCTTGGGACCTTAGATAGGTTTAACATAGGGATAGAAAGCGCGTCGTGAATTCCGAGCTGGCGACCGATTCCAGCCATTACATATTTGCATTTGAAATTGAGTTGCCGACGTTGGCGACCGAATTTACCGCAGCGACTGCTGTCCCGCTTAGTTGAGGACATTACAACGTCCTGCGTGCACGCTGCCACTGTTGCATGGGACTAGGAATCTGCAAGTCACGGATTTGTACGGCCAACACCTCATAAAATATTCGTTCATTCCGATAATCTGATTCTATGGTTGCTCCTTCACAATGCCTCGTGCACTTCAGGATAACTAGCTTCCAAGCATTGGGGAAGTAGATTCAAATCTATAATAGTTTCAGATTTGCTTCTAAATCTGACGTGCTGAAACGTTGCGTGACGATAGTTTCCGTAATTTACGAAATTTCTTTGAGCATCATGCCTCAACTCCTTCCCTCCAACGATAGCACATTGTATCACCCGAACGTACCTTGAAGCTCTGGCTATGTGTCTTCCTGCCTCCAGTTTGCCAGGCATGCCGCACGAAGCAGTTGGCCGGAACGAACTTGCAGCCGATGCTCACGAAATTAGTTGAGCATGAATCGCTTGTAGCCATCTGCGAAAATGACGGTTACCCATTGAATGCACGATGGAACCCGTACATAGGCATACGAAAATTCAGAATGTGCATGAATAACTGTCTGTCCTATATCATACAAAGGACATTTTCATGAAACGATTACGTAATGTTTAGCGGGTTGTTTACCGCGACTTATTCGACTTTTCTAATTAATTTAAGTACGAGCCGGTGGCGGGTGTTAATTAATAACGGTTCCATCTCATATTCTATTGTTGGCAAAATGGGAAGTAGATGAAATTATTTCTAACATTACCCTGTGCAGAGTCTCTGAGCATTTCAGGGTCTACCGGGTAATTCGCTTGACGTCTCGTCATCTATTTCTATCGGTTGAGCGTTTATCGTCTGAAATCTACATCTAATTTGCGATTTCAGAGACAGCAGTGACGCTCATAATCCGATTAACGGTTGCTCGACGCCGGATCAACGGATCCCAAATAATCC *
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
93 85 16 utg000001l 29927 2 2637S5M1D5M3D5M2D2M1D13M3D4M1D3M2D2M1D10M1D33M4589S * 0 0 GTAATTACCAAATCGACTAACAGTCTTGGAAAACTTGACTAGTTGGAGAATATCCTTACATGATGAGCATGGTCGTGTACGGTCTCGGCTGGAGAAATTATTTAGGTTAGAAAGCCCTCATTTATTCAATTCTTCGGGTTGTTACCGGACATTTAGTCTATAAAATCTGGACCATCATTCTAAGCTGCCCTTCCTTCATACGTATTCATTGCGTTCATACCGTCAACATTAATCGGGCCAGTACAACGGTGTCTAATTGGCTATTGTTGTTCCTAGCTTTATTATTGGCTTCATTAGTAAGTCTAAATGGCTTTCCTGTTTAGTTTACATCTAAATAGCCTTTGATGCAGCAAGCGTTTAAAGTGCTGTTGGTTAGACTTATGAGCTGCACTATCCCCTTCATCTAATTGGAAGGAATGTCTGTGGACGTTTTAGAATTTAGACGTATGCCGCTTTATCGCACTTTATGCGATGTATACGCCGACTTCCCGCTATGTCGCCTTCGTTGGATGCCGTGACGGACTCCCCTATTGCCGTATGCCTAGAGATGTAGCTTCCTCCTTCGGCATTCGTCTGACGAGTGCCTAACCCGCTTCGTTTGCCGACCTGGAATAATTAGACCTATCGATGCGTTGGTTTCTGATTTATGCCTCTTTACAGCACCCTAAACCTTAGCAACCAGCCCTGGCTTCGTGAGCACGCTGTTAGGAAGGAGGATCTAATGCACTTCGTTTCTTTACCCAGCCGGCAATAGGATTTGCTCTGCTCGGCTGATTTAGCTTCAATCTCGTTGCAGTCGGTCGTTAAAGCTTCATAGACGATGCAGCCTGTCCGTGGTGACTGTGGGGCCAGTTTAAGTACGTGCAGCGTACCGATACCTCAACCTGCAACGGCCGGCTGATTTGTCCGTCGTAGTATTAAAGCCAGACGCGTTACGCTATTTGTCGCCATCGTTACGTCATCATAGACGCAACGGATACCTTCATCGGCATCATCCTAGTAAGCGGCAGGAAATCAGCGTCGCTTTGTTGGATCTCTTCCTCACGCTTAAACGTAAGTGCAGATAAGTACGGTAACTTAGAATCTAATCGTACATGATGTAACGGCAGCTTCATGGATTCTGAGCCACGTGTCACGTGATGTTGGTCGGTTGGCTGAATGGTGCATTTATCTAAGTTCCTGTTAATTCCTGAAATCATTCATATTTACCCCAAAGCCAATTCAAGCGGCTGTCATAACACTGTACTGGCTAATACTAATTACAGCCAACGATAGTTTCTCGCCGTCACTATCCAGCTTCAAGGAAGAAAGAAGGACGGATTAATCTGTATATTAATAGACTAAGCTCGACGCAGTGCGTGTCGTAAGGCTTGGTTGGTCATTTCGTACGGTAACCGGAGTGATTCGTTAACAGTAATCCATTGTGGTCTATACTAACCTAATAGGTCCAACTGCTCAACGTTGGTAAGTTCGTCACATAACGTCACGCATAGGCCCAACGTATCCTCATGTCATCACTGTGCTGCTTCCTTCCATCTAAGAAGCCATCACCCACACCTATGTTTATAACGTGACTAACTATAATCCTATATGGTATTTCACGTAATCTAGTCATCCTCAGGAAGGAAGCACCATTTATCCATGACACTAAGTAACGTACGGTTACGTCGGACTGTCCAATCACAGCGGGCAAAGACAGCATAAAGCAATACAAGTTCTATACTGATCTATACTACGTCCTGCCGGTACTGTATAGACCAACGCATGATGCTAGACCACTGTTGTGGTAACATTAATACTGATGGTCTCGGACTTGACATCGTGTGGACGTACGTGAAGTCCGGTGACGTTCTACTAGGCGGACGTACGGAGAACTAACCACTCCACGTCTACGGAAGACCCGTTAAACAGTGACTTTCAGCCCTCCATGGCCGTGTTTATCATAAATACTTTGACGAGGTCGGAGACTAACTATCTGTGAGTTACGAAGCGTACTCCTTTAGAACCACCGTAAATAATACTTAGGTCAAAGGTCATTCGTACGGAGACTCTCGTCACGCCTGACGCCTTACTTTAAAAGCCCTTTATCGTAATTTGGTGACGATCGTCCCTTACTAGTCACGAGTTTACAAGTTACTGCCTATACATTTACCCGTACTTCACGTAATTCAAGGAGCGGAAGATAGGAATATGGTGAGCAAAGGTCCACGGTCCTGAGATCCAGGAGCCTAGACGTCGTTCATGAATATCGGTCCTGCTAGCCATCGGCTTTCCTTCCCGTTTAGGTCAATAAATGCGATACGATTGGGGCAACCAAAACTCAGTTGCCTTCCTCGTGTCTCATGCTGAGCTATCTAGCACTATTTGCCCGGGTCTTCTGCTAATCTAACTACATGGCATTCACTTACTGATCCTTCACTGTCGAAAACTCATAGTGTATGGGTTATCGTCCTCATATTTCTACGGGACTCTATTAGAAACCCATTCCTTCCTTCCGAAGGAAAGCCTCACGAATGCTAATTGGACCTGTTACCACTTAGATATAAAATAATAATTTACTTAGATACCGGCTCAGTACATAGTCTAAGATAACGGTGCTGGTCTGACTTATGATATCTAATCTGCTTTCTAAGAACCAACTCAACTTACGTCGTATAACGGCAAGATGCGTGGCTTTATGAAATAGCCGGCGTCAGCTCAATCCTGGACGGTGCTGCCGGTGAGCAATTAGAACGATAAGTCTCGCCTGCTTAGACGGAATACCGGAAGGAATGTAATTTACCCGGCTGCCTAGTCGTGAAAGCTTATAGGCTTCGTAGTTCATCGTAGTAACCAGCTCACTGCCGTCGTTACATGTTAAATCGGTCGGAAACTCACGCTTCACTTTCATGTCTCATCCATAAGCTGATATTCCCCATGTCTTACGATCCTGTCGGTCAGCTGCTTAATGAGGCGGCCCTTCTCGTAAACTTCACGTCGGTCAACTTAGCCGTTATCACGATGGCCTCTTTAGCGTGATCTTAAAGGGTGATGGCATACGTGCCGTCGTTCGTACGGATACTGCAGGAACAGTCTGGGGTGGAAGGGAAGTGCGAGCTCCCACGCTGTATTCATCATAGACACGTCAGGAAGCTTCACTTTATTCACCGTCGTGACAGCTGACTAACGGACCTGACCGGATTGCCACTTCCGTCACCAGTATTAGTATAGGGATGGCTATTCCTTCCTTCCAGGTTAGTCCGGAGTGGCTGTTCACACCGCCAGCACACGACCTACATTAATATGAGGTTAATAATTTTCAATAACCCGCTTACATGAAGCGCTTCTGTGACGCTGAAATTGACGGTCTTAGTTTCCATTTCTGTTTAATAGACCTACGGAAGGAATAGGCTCCTTGTTAGGTACGGCCAACTAATCATGCGCAACCTTAATGGTCAACGTATTTCCGACACATGTCGCTCGTTGTTGGTAATCCATGTTCAACGGATTATGGGTCTGTCATAGCAAAGCTGACCTTAAGAGCGTAATACATTAAGCGGGTGACAATATGAGCGACGTTTAACGACGTTACGTCTCGCCTTCAAGTCTGCACCACAGGTCTAATTAGTCAACGCTGAGCAACCCCAATCGATAGGGCCAGAGATCTCTCGAGCCGTACCTTACAAGCTGTGGACCTTACGGAAGCGTCGCATCACTAGTATCAACATAATTTGGTACCGCTCACAGCAGACGTTTCCCCATGCTGGATGGGTATCAATATCCTACACAGCCATGTTGTGCTGTATGCCGGTTTAAAAGTTCGTCGTCATCTATGTATGCCCGTCTTGAGCTTGGACGTAAGTGCAGACAAATACGCTACGATGATAATTACGGCTCACCTGCTGGCTGCCGAACCGGTCCTGCGACCCATGCACTTCCTGAGCACTGTTTCACTCAGCTTCATAATATCTATAGGCCGCATAGTTTTGTCTTAAGCGGGCGCAAGGAGGCGGAATCCTTACGGTAGCTCGGTCCAAGCATCCTATTACATACCGCTAGATATGCCGATAGATTTAGTAGCTCGGTATCAGTGTTTGACCATTAACTAGACGTACGCGTGATAGGCTGATGCATATTTCCTCCTTCTCTTCCATATGATTTGACTTCTAATTAGTATGTACCGCGTAAGCTCCATAGATTCAATCCTTTAGTCGGTTCCGGTTCACCTTCTTCAACTACGGTCGTATCCCCACGCGTCTAACGGCCCGTCATCAAGGATTCAATCTAGCTCGAGTATCGATCACCCATAAATGGAGAGAGGAATGCCTTCCTACGGCCTTCTGTCATCCTAATTGATAACGGACAACTTCAAGTGATGGACATTTTCACATGAGCATCACGTAAATAAGGCCTTAGTCGGTGCTAATCTCCTTCAAAGCATCTATTAACTTTAATCCCACATTCGACCGGACAACCTAAACACCCTGGCTTCACAAGTTATCATAGTCAACGTCTATTCGTATTAGTTTAATCGATGGAGCGCCAGCATTCTAGATTAAGGCATACTTCTCGGCTCCATTGTTACGATCACGCATGACTGTCTGCTGCCCGTACGGTGTTAGAGGAAGAAGTACTAAAGGCACTTAGACAATCGACATACTGAGCGACCGGTGAGTCATCTAAACAGTCTAAATGATAGCCCACCATGCTGCGACATGGCTAAGCATTAGAAGCGGTGACGGCTATGCAGCACCCTATCGATACGTCTGTTTGGACGATGAAAACGCTGATTACTCATCTAAGGCGGTCGCTGTATTTCACGACCAGTGCTCTTCTCGCTTCCAAATTACATCCTATCGACCGTCACGGCTAGTTGTAGCGATAGGGCTGTGGGTAGGGCTCAGTCGACCCGTTCAAGCATCGCCTGCTGCATAAATGATTTAGTACCGTAAACGATGAACAAACAAGGAAAAAGGAATGAAAGTCTCGTTAAGTCAGAAACGATTAATAGGTCATTAAAACTTACGGCTCGATCAATTCAGCTGATACGATCGCCTCGCCGGCGCTCCTAATAATCGACGGTAAACGGACTCACGTAAACGACATTACAATAGAATCGTTTATTAAGAGTCAATAGAAAATCAACAGTATAAATCTAAACTAGCTCATGTAAGAACAGTAACTACAATTTAAGTCGCCATCCAAGCTGCTCATGAGGCTGATTCACTATTAAGACCACGGCTCTGCTATGCGACATTAGATCTCAAGCGCACCGGGAAGGAAGAAAGGAGTATGCGAGCTTCTTCCCCTTCCTATAGATAAGCCATCGAACGGATAGAAACTTTCTATAGGTCACGAAGCCCGACCAATGGCACAGCCGGCGTGAGAATCGATCTGTCTTGTCATGGATTACTTAGAAATTTATTAGAAAGGAAGTCCGCCAAATTTAAAGTTATTTAGAACTGTAAAGCTCAGGCATTTGCTGCATTATCCTTCGTGATGGTTAAATATTACTGTCAGCCTGACATCCCTCCTCCCACCGTAGATGGAGTAGCAGGGCTGTGGATGAGTTGGAAAACTACCTGATCATTCGTCGGTGGACAGTACACGAGCACGGAAGGAGGAAGGCTGATGGACCCTGCTCAATCCGTCGTATTTAGTTACCAGTCCCCTTGTACGCTAACTGATGGTGACGACAGGTTCATTAGACCAAACTGCGACTATTTAAATACGATGGTCACTGGTCTCATTAGAATACGTACAGTTTCCTTCTCGCGTACTGCCTTCCAAAGCTCGCTGAATGGATAGGGCTGATACTGTCGCCCTGCCGACCGGCTCACCTTTGGTCGTATAAAAAGACGTCTCGCATATCTGTCAGTGATTCCCGCTCATACACGCTCGACTGCTCAACGGTGGATTCATTCAGTGTTTCCTGCCGGATACGTGCACGTTGTCACCTGTTCAACTTAGAACATGAAACCTCCTCCTCCTGGAAGGAATCTACATTTATGCCGCCACTCAAGGCGGTAGTCACAGAAAGGATTTCCAGCCGTGCTGTCGCCAAACGACTCATCATGCCTCACGCTAAAGAAAGCGTCACGCTGTACGTTTCAAGTTGGCATTCATCATGCAGCTGTGAGAATAGATAAAGCACCTTCTAAGGACGAAGTACATCCATACCGGATTCAGTCGCGCTATTCGGTTAGTACCGGGAACAGCAAGATACCGATCTGTGGCACTTCATCAACTTCCATGCGATAATGCCTTCATACGGTCCAAGGAGGCCCATGGTGATAATGTTCGTTAAAAGTCGTGACGTAGGGACCGTATGTCTTCAGCCTATCGTCGGAAGCGAGGAAGGAAGCCCTTGACCAGCCCTGCGATAGGTAAAGATTCCCACGGATTGTAGGTCCTCCTGCTAACAATCCAAGGTGAACATTCTGTTAGGGCTTCAGTCGCTTATCTCGCTTAATGGATTCACGAGGCGGCCTGAATACTGTACCGCCTGACGGGATGCGCCGGATAAACCACTCATCTCAATTACCTCATTAATCCTTAGCAATCGGTCATGCCTGCTTAAGCGTATTAACATAGACCTTAAACGGTCATAATCTGTGCGATGTAAGCCTATTAATTGGCTGCTTTGGTGCAAGATAACGTTGTGTATGCAAGCTTTCTAACATGTCCCTGAGGAAGGAATATTCAGCCGATCCAGGTCTTCCTTGCTCTCATAGTGCGTCGACGACCGTTACTATTTAACTTTAAGGCTTTCAGGTGGCTTCAGCTGCGCTTCCATTCATACGGCTGTCTAATCAAGCGGCCGTTTTGCCCGTTGCCTTAGTGCGAATTTATCCGCCTGCTTAGGGTTGGGAGCGCTCTGATACGTACATGTCTAAGTGCATCATGAGTTGTACTCAGTCCCTTTATTAAGCAGGATTGGTGCTGAGACATTCCGCTTCCTCAGTACGGTAACGCTTCACGCTTGTCGGGACATGCTGGCTGATTTTCTCATTTAAGCGGTTGCGGAATGGGAAGGAGCGTGGACGCAGGCAAGCAGTAACCTTCGCTATTCACGGACTTCATTTAAAGTTCGATTAGACTTCACTCGTTGGTCTATTCAGATTCGTGCTTTCATTTTCCGTGGTGTACTATCGGCATTAATTCAGGCTGAGTTCTTGCGACGTAGTCCTCATGTCGGACTATATTCGTACTTCCGTGACCTTCGGTATCATGCTGCGCATTTGTTATTGAGTGCTGCTCAGCTTCGTCGGGGCTTCAAGCAAGACGGGCCTTTGGATCAGCCAGACGAGCCCGCTTCATCAATTAATC * tp:A:P cm:i:5 s1:i:42 s2:i:0 NM:i:16 ms:i:92 AS:i:92 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
94 86 4 * 0 0 * * 0 0 AAAAAGAGGAGCTTGATGACACGATGAACTGCCGGTCAGGACATCCCCTCAGCCGGGAAAATGTTGAAACTGAACGGATGAAAATGAGGTGGGATCAGCGCAGCCGGATACCGTGATTCTGGATACGTCTGAACTGGTCACGGTCGTGGCACTGGTGAAGCTGCATACTGATGCATTCACGCCACCGGGATGAACCTGTGGCATTGTGCATGCAGCGGACGCGTTCGTGCAATGTACGGTGCAACGCAACCCAGCCCGCGCGTGCCTGACGCAGGCAACTCTACGGGGAGCGGTGCTGATTTTCTTCGATAACCTGTTCGATGCTGCCATTGCCCGCCGATGAAACGATACCTAGGTACATGGGAACTGGTCAGCCAGCATGCTATCCGGTGAGCAGTCAGGTGCGGTGACGTGGTGTTTTGATGACCCTGAAAATACAGCTATGCCGGACAGGCGTGCGCGTTGAAGGCTCCAGCCCGTCCTGTTTTGTCCGGACTGATGAGGTGCGGCAGCTTGCGGCGTGGAGACACGGACCATCCTTAGGAGGAAAATTCTGCTCGGTAATGTTTCGCCGGCTGATGGCGGAAGTTGTCATCTCTGGCTTGGACGGGGCGTACTCCCTGCCGTTAACCCGTCGCCTGAAAGGCGTATGAGGCCATAAAGGTCTTGAGCAGCCGTTGAAATGCCCCAGCCATTAAGCAAACGGGGTGCCTGGTGCGCGCAACCTACATTAAACCGCGTTGCTTCATCCGCGATATCGCAGTCGGCGTCAGGTTGCCCGTGAGACAAAGCGAAGCCCTGAGCGAACTCGAGAAGGAAGCGGAGAGGAGAGGACCGAATCGAGAATCCGCAGTCAGAATCAAATTAACCGGGGGATTTGCCCGTAATCAGCTGGGTAATGCGCCGTGTCCTTTCCTCGCGCCGCAGGCAGTGCTTAAAGGGGCAGCGTTCATCCTGACTGACCACTGAAGACGTAGAGGCATCTTTAGTGTGGTGTAACCCGTTATCTTCGCGGGGCTCATCTTTCGTTGAGCAGCCAAAGACTGGCCATGCTACAGGTCTATCGCATTGGTAGTACAGGGAATATCCGTTACCCCATTTACACTTATGTAGAACTAATCCCGATGGCGGTGCCGCTGACTAAGCGTTTAAACAAATACTTGAGCGTAAGACCGTGAACGTCTGTCGAAGAGCTGGCTATGCTGCAGCATCAACGGCCGGTAATAAAGCGATGAAACATACTGAACTCCGTGCAGCCGTACTGGATGCACTGAGAAGCATGACACCGGGGCGAACGTTTTTGATCCTCCGCGTGGTTTTTGATGGAGGCGACTTTTCCGGCAGTTGCCGTTCATCTCACCGGCGCTGAATACGGGTGAAGCGAGCTGGACAGCGATACCTGGCAGGCGGGAGCTGCATATCATCGAAGTTTCCTCCGTAGCGTAGCCAGGTGCTAAGATTCGCAGAGCTGGATGCGTCGATGGAGTCTAGGATTTATCCGGTATGAGCGATATCCCTACTGTCGGCTACGTTTGATCACCAGTATCTGGTTAGAGCGACTACCGGCGCGACGGCTTACTGCGGGCTGTGGTGGAGTTCAGCCGATCTGACTTATGTCATGCTATGAAATGTCGACGCTATGCCTGTACCAAATCCTACAATGCCGTGAAAGGTGCCGGGACCAGCGGTGGTCAAGTCTAAGGGAGAGCGGCCGGGCACGAAGCGGTTCAGACGTTTAACCG *
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
95 87 16 utg000001l 36314 60 3628S26M1D6M1D16M1D2M1D2M1D6M1I10M2D3M4D24M1D1M1D3M3D4M2D19M3I17M1D2M3D13M1I1M2D3M1I13M4D2M3D2M1I4M2D2M1I14M2D12M1D9M1I5M1I15M2I2M1D3M1I8M2I20M2D11M1D4M3D2M1D2M1D4M1I2M1I7M2D3M1I20M1D6M1I4M1I6M2D1M1I8M2D4M1I5M3I4M2D2M1D14M1D9M2I4M1I8M3D10M1D14M1D4M1D2M4D9M2I3M3I4M1I4M3D21M4D9M5D39M2D4M1I14M2D12M5I7M2D2M2D3M1D2M4I4M7D8M5D2M1D25M6D5M5D2M3D2M2D10M1I6M1D4M1D4M1D5M1I3M4I5M1D25M1I5M2I13M1I2M2D12M2D26M4D7M1D6M1I10M1I3M1I4M1D4M1D1M1D11M3D6M6I13M1D13M1I6M2D7M2I4M2D10M1D2M1I11M1D4M1D3M1I7M3D2M1D5M1I14M2I2M1I8M1D3M1D1M1D6M1D13M1D10M1I8M2D9M1D6M3D3M2I2M1I10M1D4M1D7M1D7M1D5M2D29M3I5M1D12M8D1M2D10M5D6M5D4M1D2M1D23M7D26M2D12M2I13M1I12M1D2M2I1M1I21M2I1M1D5M1I3M1I22M1D17M1D8M1I19M2D1M1D20M1I11M1I3M3I27M1D13M1I6M2D7M1I4M1I2M1I37M3I9M2I13M1I18M1I4M1I2M1I2M3D13M1D7M3I14M1I15M2I13M1I5M7D3M1D10M2I6M3D3M1I10M1I3M1D7M2I11M1D1M3D1M1D14M1D5M1D11M1I10M1D2M2D2M2D14M1D1M1D2M1D1M2D17M1D16M4I3M1D2M1D7M2I6M1I5M1D3M2I2M3I8M2D5M2D1M1D6M2D11M1D11M1I10M1D5M1I2M1I27M2D15M1I39M2D22M1D13M1D7M1320S * 0 0 CTAAACATAAACCTTTAAACCAGGTCGTGAAGATAAAACGCGTTGTAAAGTACCCCCGTCAACTAGATGTAGATGTAAGGATCTAAGAGGAGTGTTGCGTCCCGATAGGTTGTAGTATCTGATAGGTTTGATGAAAGTTGTTAAGGAATATGGCCTGCTGAATAACGTCCGGTGTAATCGGCGTAAATTTAATGAAATAAAACATTAAAGTACGACATGCAGCGGCGAAATCACGCTGATTACGGTAGGGCTGATACGACCCGTCTACACCAGTCAATGGAGGTTACATTTACGCGCTTAATAGATGAAAAGTTATTAATTGAATATCCACTAATCACGCTGATAAAACATGTCACAGAGCATTGTTGAACCCGAGTAGCGATTGGCGATGCAGACGCAAGAGTGAATGCGGCTAAACATCTGGCTATTAAATTTACACGGGCTAACATACGGCGACTATGCACTACTTCCAGCGCTTGATATAGATTTAATAAATAAGCCGGGCTAGGCTGAGGTAGGACATAGGCGTCAATTGACCCTTAATTTTCATGTGCAAGCAGTTGTTCGTAGACAACCGAAACGTACGGTGGAGCCGGAGATAATCCAAGGGAATATTTCATCTAGGTGAGAAGTGTCGAATTGACGAAAGCTAATCCTGAGGACAATATCGATGGCGTGAGGAGAACATGTAACGGCTGTTATTCGTGGTGGGATTAACTTAGAAAGTTTTAATTTATGAAAGGAAGAGTCCACAAAGATTAAGGTCTTGAAAGCTGAGACATGAGCAAGTTGCTGCAAGGTCTGTGTATTTAGTGGAATCAGGCTGGTCATTGACGAACATTCATGACAGCCAACCGGGTACAGCGCTACGCGGCCAGAGTACCCAAGGTCGATGCATAAGTCAGGGCAAAACGATATGATACTCGTCTAGAAATAACGAGCCTAATTCACGTTCAATTTCATCGCTTTCATACAAGGGAAGCACTAGATAGCGTACATGCGTGATGGTGGATCTAGCTAAACCTTACTCATGAATGACAGTAATAGGGTACTCTTCGTACCGAAACTTTAGAACAGGACTAAGCGTTAAATACATACCGACAAGTTCTAAGACTTATGCAAGTCTGTTTGATAGGTAAAGATACATCTACACGTCAATGGGAAGGTACGTCGTCGGATAAGTGCTCTCTTGCCTGTTTCCAGGGTTAAAAGGTTTCAACGTGACTGAGTGATACACCCTTCATAGAATATGTCTATCATAGGGTCGGTATAATAAAATAAATGTCGTCTGCGTCAATGTGATAACGTTCTAGCCATAGTCAATCCAGTTACAAGAAGCTGGCCAGGAATGCCCTAACGGGGCGTGGATCGATTTCTATTAGAGCTCCCCACGGATATGCGATGCTGCGAAGATGCTAAGATGAGAAGCAACAAGCCCTAACGTAACCGACAGACGATTTGTAGCAAAGTAAAGATGTCTTAGCCCAATAGATAGCATGCGGTCCAGAGTATTTACAATAGCGTCAAGAAACTTCAGTACAACTCCAATCGTTGATAAGCTGCTAGCAAAACCAATTCATACATTAGTTTCGACTTGGCGTAAACAATAGAAATGAAACCGTCGAGAACGGTAATAGCCCACCGACGGTTGATCCAAGCTGCGGTAGGTGTACAAACACTACATTTAAATTTACATAGGGGCAGAAGTAGTGATAGACGTCCAACGAGGCTAATACGCCAATGGACGCAATATGGTTGAATTTATAGTGGGCCGGAGAAGTAAGATAATGTTACTAATTTAGCTAGGAAATGATCACCGTCACGTGGCGTCAATTGTTTAATGGACTTACCATGGTATCCAGATGTGGAGCGAGGCGGTGGAGTAGAGAATAATATGTATTTAGGTGATCAAACGTTAGGATCTAAACTAGACCTAGAATGAGTGCCATAGCCGCTGCTAGCCGCTCGCTTCACCTTATAAGGTAACGTTACCAACGTGATGTAGCAATATACCCCGCTATCATGACCTGGTTATAAAGTTCTGACGTGCACTTTACTCATTCGTTGCAAATGGCGTTAACACAACATCGGCAATATGTTAAACAATCGCGCCCCATACCTGCTCCAGGGTCGCTAGTCAATCCTAAGTTGGACAGGGACACGCTTAATTGATTAAACCCCGTAATTCTGTCGACGTGATGAGCCAGCAACATGGCATCGGCTTCATCGACAGTTCAATAATGCCCGTTATGAGCAATAAGAAAGCCTGGAGAGACCAGATGAGAAATGGAACCGAAACTTCTGCTATAAAGTCGTTTGGCAATAGCTCGCTTCATCACTAACCTGGCTCCCATGGTGTCAACTAATATCAAATACAGTCGCCGGCTGGCAAGTATTTAGAATAAAAGATAGTCTTCTTGATAGTATCACTCGTATTCAACGCTCAGTAGTCGTACTGTCATTCAGCGAGGACAGTATTTGGTTGGTTTTACAGAGTTTATGGCGTCCGTAAAGTAATAGAATGAGTTTATAGCAGTAATGATAGTACAGTTTAGATAAGGTTGCTCATTAGTGGCTGTGCTAATCCTATGCGGCCTCCCATGGCTCGCGTTAGTGGCTAATAATGATGGATCAACCTTGTCTATGCATACCTCATGGCGGTTTGTGGTACCAAGCATTCATCTGTTGCTGATGCCCATAGAGGGCTTTGGTACAGGCGACTATTGCTAACCTCACGATAGGTTAGGCCACTTAGATGTCTCACTTGTGAGGCGGCAGTTAAGAAGTAGATCCGGAGGCGTACGAAAGTTTAGCTGTTGAATTAGGCTGGCTTCATAAGAGAAGCGTAAACAGCAATTTGTTCTATCGAGTAACGCTAGTAGCCTGTTTTAATAGCTTCTACATAGGTCCTAATTGCCTTGGCCTAGGTTTTCAACGTAGCTAAGTGATCACGTGTCACGTTAATGAGGATTTGAAGGTTCCATTCACAAGTTTGTAATTGTTCGACGTTTCTGTCTATCATGAGGCCGGTCAACTTCTAGCTCGTTGTGCATACGTCGTTATTTCTTAAATTTCATGCAACTATTCATAGGGTCGCCGGTTGATGCTGACGGTGAGTCGGCCAGTTGTCGTGAAGTGATTAGTAATTCTATTCGTCGGCGATGGTTTGGATGAGACGCTCGGTAATTTAGCCTTAGCCGGTGACCATAGCCAGGTCTGATGTCGTTTGCTGGCCTACTCAATTAAAGACGTGGAGTGCTAAGATCTCATAAATCGTTGATTATGCTATCGATACGAAGCCAGAAAACAGCAAGCTAATATGGGGCATTCCATGTCTGCTCCTGACTTAAGCCCTCGCGCTTACAATAGGATTTTCCAATGTGCTACCTAACGCAAGATTTCAACTTCCAATCTAATACAGCGTACCGGACTGTTCTTCATCCGGCCTTCAGTATGCCCGGCCTCTCCCTTCAATTTTGCGTGCTATCGGTTAATGAAAATCCTACTCCATGCGGTGCGTTGCCGCCTGCACCCCGAGTCCATCGCTGCAAACGGCTGGAATGGCTAACATACGCAATCTGGCTCGCCGACACGTCGTTATGGAACTGTGAGCTCGCCTGTCACTCACCCCGACGTCGGGTATGTGGTCAGCTTCCCGAAGCTTCAGCGACCTTGTCACTCACGCCGGGATGCAGGAAAGCCACTCTGGCTGATGGACGGGAACGGCCCCGCAGCCGAGCCCTAACCAGTGCGACGCTGAGTGACTCGCTGGTCTCAGTTAAACGTCAGCCGCTGCCTGCCCGGCACGACCAGCACTGATCTGCCGTCAGTTGGCCTGGATGCCGGAAAGGACCAGGGTTTTGTTGAAAGCGGAATTAGATGGCGTTGCCCTTGATACCAGGCATACCCCAGCGCACCGGTCGCCACCCTCAGGCGCCGCTAAGATGCATGCGCTGATCGCACCGGCAAGCCTCTGAAACACTCGAGTACGCTCGCCGGGAATCTATTCGGTTCATGCCCCTGTTGCAGCAGATCAGCCAAGCGACTTTGCCCGCCTGCAAGCTGCGTGGCCACGTCGGCAACGTGCAGCATACAAGCAGATTGGCAGGCGTTATCGCAGGACGGAAATCCCTTCTGTTCATGCCTGTCGGCTCAGCGACTGTTCAACGACTGCCTCTATTTTCGCATCACTTTCGATAAGAAAAGCACGCCCCAACTGAGTCGCTCTCTATGACGTCGGCTTAAGCGACTCAAATCAACGACCAGATCGCCTTTAAGACCTTATTGAGATCTAATTCTCTATTCGTCTCAGCCATTAACTACGTCATCCTCCGTCATGTCGCCACATCCGGGGAATGGCGAGCAACTTCACTTCGTTCCATCAAATGGACACCTCCGGCAAGCCCTGCCGCTTCTGCATCAGCACATCATCTTCATAGCGGCTTCGTCGATCACTCGCGCTTCATCCGTCTAAGACTGAAATCCATGGATGCATATCCTTGACCGGCAAAACTAGGCTGCTAAATCTAGTCCACCCTGCAAAGTGCGATGAGGCAACACTCATGAAAATAATGGGTACTTAGTAAAATCGGTTCATGGCATATCGTGGATGACATCCGGCAAGCACCGGCACGCTTTGGGTCGCCCATCCGCATCCAGCTTCAGGGCAAACCGTCTCACGTCGAAACCTTCTAAGAACAGGCTGCGGCCCGCTGGCGTCGATCTATGCGGAGCAGTGGCCGAGACTCATACAGACATTCACAGCTTTCAGCATGAGAAATCGCTTCAGGCGTACTAATTTCCTGCTCAATCTTTAACGGCTTCAGATTCATGGACGGCAATATGCGTCTGCGCCTGTATTGGTCCGCCAAGGGAATCCCTACAGAACGCGTCGCCGGTTCTGATGGCGTCTTCCCACAGTAAACTTCCGGTCCTTTCTACACTCTTCATGTACTGCTTCATGGATGAGCGAGATGCTCATATCCCTATGCAGGGCATATCAAAGTTCAGAAAGCGTGACGGTCACGTTTATTCAAATGCATTCGGCTTCAGGAAACACTCTGTCGACTCTCCAATTACTGGCGGTGACGGTAATTTCTTGCGTACACAACAACGGAAGAAACTCATGTATTACCGGATACAACCGGGAACTGCTTTACTGCCTGCAACGCAACGCCGTCGTTCACGGTGATGAGTCACTCAAGCGAACAGGAATCTAGCCGAGCGTTTAACACGCACGAAAGCTCTTGTCCACTGCCCTCATGGAAGCAGCAGGGCCTTCAGCTGTCGGTCACTTTATAGCCATCTGGCAGGCGTCACGGTTAATGCCGGTTGCTTGTTACCGTGCTGCGATCTGTGCCATCGACGGACGTCTCACATTGGTGATTTAGCTTCCGGCGATTACTTCCTTCGGTTTCTACGGATCGCCACTTACTTAATCGTACGGAACATTAAACGTCCGTTCGGGAATCCGATTTATAGCACGCGGATATCGCCTTCATTAAACGACGCCAGCAGCCTGCTTCCCTCATCCCGGGCATCCACGCCAGCGGCAAGCTGGATATCTCCGGCACTTCTGCCCTGCCCGGCTTCATTCAGTCTGCATCCCATCATTCGTCATTAGCTCAGCGGATCGTTTTAGATCGCATTTCGGTATGTTTTAACTTTGGGAGACGCAAGGAGAGAATCGGTCCGTAAAGCGATCGCGTAAGAGATAGCTCCTGTAAACCCCACGTGGTCCCGGCACCTTTGGACGGCAATTGTAGGATTTGGTACAGCATAGCGTCGTCTCAATTTCATAGTACTGACATAAGTCAATCGTGAGCAACCCCACAAGCCCGCAATCCTTGTCGTCGCTCGGTAGTTATAGCCGCTGGCCACCATCGGTGATCAATCTGACAGTGCCGCGTATCGCTCATCCTCAATAAATTAGACTCATCAACGCAATGGCTGTAGCAATCGGCACCTGAGCGGCAGGAAACTTCGATATGCGTATCGGCCTCATGGTTCAGCTCTTCACGTGTATTCAGCCGTGAGATAACGGCAACTGCCGGAAAAGCCTCTCATCAAAATACGGGGCGACCAAAACCGTCCCGTCTATCCTCGATGTCTTCATATGCAGCGTTGAATCGAGGCACGGGGAGTCCAGTATGTTTCAATCGCTTTATTACTTCTCAGTCATTAATGCAGCGCATAGCCAGCTCTTTCGACGCATCGTTCATAAGGTCCTCAAATCCTTTTGTTCACTCGTTCGGCTAATCTAAGAGACTTCTAGCTATCAACGGTTTTCTCAGCCACGCTGCATGACATGCCACCGGCCATTTTCATGTTGCTGAATAAACGGAATAAGAAATCATAAGCACGCTGCCGCTATTTTCAGGATGAACGGCCCCTTTACGACGCCTGCGAAAGGACCCGCGCACCTTACCCAGCCTTGATTACGGCAAATCCCCGGTTGAACTTGTCGATTCGGCCGTGCTGGGTCGACGTGCTAGCGTCTTCCTGATCAGTTCGGCGTCACCTTTGTCTCACGGCGAATATGTGACGCCGAATTCGGGAGTCGCGACGAAGGCAACGCGGTTAATAGTCCCTAATGAGCAGCCGGAGTCGGTTTTAACCGTGGCCTGATGGAATTTATCGTGATAAGACTTTATGGCCATCCCTTCAGCCGGCGACGGTCCAACGGCAGGCGGTACGCCCCGTCAAGCCAGAGCCATCAACTTCCGCCATCATCGGCGAACCCGATTACCCAGAAATTATTTTCCTCAGGCTTCAGCGGATCCCGCAAGCTGCCGCAGCCTCATCAGTCCGGACAACAGGGACGGCTGGAGCCTTCAACGCGCACGCCCTGTCGGCATAGCTCATTTTCAGGGTTATGTAAACACCGTACCGGACTTAACTGCTAGGTTAAATACCCAAGTAAGACGCTATCCT * tp:A:P cm:i:13 s1:i:138 s2:i:0 NM:i:632 ms:i:602 AS:i:602 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
96 88 0 utg000001l 40354 60 1837S8M1I3M1I20M1I12M2D5M1D3M2D6M1D1M1D7M3I12M1I13M2I15M2I3M1D20M4D4M2I1M1I9M1I1M1I10M1I6M1D18M2I8M2D28M3D8M2I4M1I8M1I17M2I6M1I6M2D7M3D24M2D4M1I9M2I11M1I4M1I2M1I3M1D12M1I11M1D7M1D8M1I4M1D4M1D2M1D16M1D2M1D4M1I5M2I10M3D10M1D8M1D9M4I6M1D1M2I23M4D36M1I3M4I13M1I5M1I11M1I1M1I5M1D20M1I5M2D14M3I16M1I4M1D20M2D16M3D14M1I2M2I4M1D2M2I2M1D9M3D25M2D8M1I17M1D3M1I4M2D17M3D4M1I10M3I7M1D7M2I4M3D23M1I3M2D3M1D6M1D2M1D12M1D5M1D5M1D36M1D8M1D7M1D4M1D12M2I12M2I28M3D12M1I1M2I11M2I28M3D13M2D6M2I20M3D21M1D10M1I15M2D4M1I3M2I10M1D26M2D16M1D4M2D3M1I5M2I6M2I22M1I12M1I11M1D7M1I5M3D10M1I25M1D1M3I1M1D7M1D6M1I11M1I21M1D5M1I6M1D7M2D10M1D15M1I15M1I2M2D2M2I7M1D10M2D22M1I3M4D11M2D10M10I10M3I22M2I4M1D6M1D1M1D2M3I26M1I5M2D14M1D10M1D14M1I15M2D17M2D3M1I10M2I18M1I14M2I21M1I38M1D10M1I11M1I27M1I10M1I21M1I1M1I1M1I25M3D9M2I21M3D12M4D5M2D16M2I14M1I11M2D2M1I1M1I12M2D5M1I11M2D3M1D9M1D19M3I17M5I23M1I8M1I11M1I13M1D4M2I3M1D4M2I3M1I24M4I43M1D7M1I3M1D11M5I20M1I15M1I2M2D14M1D17M1I13M2I22M2D9M2I38M4D42M1I3M2D3M1I21M1I3M1I2M2D14M3I1M1I13M1I5M2I4M2D22M1I12M1I5M1D8M1I12M1D12M7D19M1D8M1I2M2D18M1I15M1D14M1I5M1I8M1I24M1I28M2D11M1I28M2I17M1D1M2D22M1D6M1I1M1I11M3I10M1D17M1I6M1D10M2I3M1D9M1D9M1D6M2D11M1I9M1D3M1I9M1I3M4I19M1I11M1I4M1D5M2I2M3I3M1D2M1D4M1D20M2D12M1I22M1D5M3I4M2I5M2I22M6I6M2I13M1I12M1I12M1D8M1I9M1I3M1I2M1I88M1I30M1D9M2D20M2I16M3I17M1D6M1I9M1I11M2I9M2D8M4I12M1D10M1D14M1D37M2I4M1I14M1D5M1D24M2I30M8D1M1D9M3D16M1D7M2I35M9I2M2I1M1D3M2I11M4D11M6I2M2D3M2D27M1I7M1D18M1I10M3D16M1I16M1D22M1D9M2I17M1I7M1D8M2D8M1D11M2I5M1D5M1I4M2I1M1D6M1I6M1D8M3I30M3I28M2D21M2D16M2I24M3I7M1I3M2I2M1I7M1I11M1I13M3D8M1I13M1D12M2I22M2I14M2D12M2I8M1D15M2I1M3D12M2D16M1I52M1I19M4I2M2I2M1I2M3I2M1I14M1I4M1I5M1I35M1D12M1D8M1I3M2D24M1I4M1D4M4I3M1D1M1D4M3I8M3I5M3I6M1I12M1I13M3D50M2I21M1D9M1D5M5I5M1I2M1D4M4I1M2I13M4D4M1D8M3I2M1I9M1D2M1D8M2D22M1I8M4D47M1I10M1I2M3I2M1D11M1I15M1D3M1D20M1I1M2D4M1D1M2I4M2D5M1D9M1D19M1I5M1D3M2D4M1I36M1D6M1D4M2I37M2I3M1D11M1D11M1I5M2D3M1I4M1D16M5D1M3D2M1D7M2D7M2D21M1D5M2D6M2D4M1D4M2D2M3D17M1D4M2D3M1D8M1D3M1I7M1D1M1D11M2I2M1D10M2D7M1D11M2I23M2D13M4D12M1D11M1D4M1D6M1D5M3I4M3D9M2I9M1I12M1D23M1I1M3I1M1I12M1D2M1D5M2D6M1D2M1D3M1D44M1D15M2D5M6D17M1D5M1D5M1D7M1I7M1D21M1I27M1D2M1D2M2D5M1D8M1D10M1D1M1D12M1I33M1I3M1I2M1I22M1D10M5D4M1D15M1D14M1I1M1I3M1I6M1I8M1I4M3I8M1D1M2D5M3I4M2I14M1D12M1D17M2I8M1I16M1D18M1D11M1D13M2I7M1I1M2I24M2D1M1D2M2I13M2I36M1I33M1D35M2D3M1D6M1D9M1I11M1D3M1D3M2D23M3I11M1I1M1I7M3D3M3I3M1D29M2I5M1D16M3D1M1D4M2D4M2I15M1D35M2D17M1I2M2D10M1D10M1D9M2I4M2I2M1I35M2I10M2D57M1I11M1D6M1D29M4D8M1D8M3I4M1D4M1I17M5I3M1I7M1D12M1I1M1I3M2I7M2I3M1D5M2D6M1D17M1I5M1D3M1D13M3D13M1I5M3D3M1D23M3I14M3I25M1D7M2I2M1I4M1D6M1I1M2D6M1D12M1I28M1I1M1I40M2I3M3I15M2I10M1D6M2D6M1D12M1D3M4D13M4I3M3I1M1I7M3D1M1D10M1I19M2I11M1D4M1I13M1D16M1I12M1D7M1I4M1I12M1D7M1I4M2D8M1I12M1D10M1D4M2D10M2D10M1D16M1I5M1D6M1I14M1D11M4I6M3D5M1D23M1D4M1D32M1I24M2I9M24S * 0 0 CATTGGGTGTTTAACCTCTGAAAGCGATTCGCGTAAGGGTCACCGCTCCCTTATAGACCCACATGGTCCCGGCACCTTTCACCGGCATTGTAGGATTTGGTACAGGCATAGCGTCTACAGTTCATAGGCATCAACATAAGTCAGATCATCGGCTGAACTCCAAGCCGCATCATCTATTCCTAGCCGGTAGTCATAGCCGCTGGCCCATGATATTTCTGTGATCAATTGACAGGCTAGAAGGAGCGCCGAAGGGATCCCGGGATTCCACGAAACGCATGCGTTGTGCTTTGAATCCGGCAGCTGAGCAGGCAGGAAAACTTCGATATGCAGCTCCGCCGTGAGAGGTACCGCCGTCCCTCTCTTCACCGTGTATTCAGCGCCGGCGGTGAGATAAACGGCAAATGCCGGAAATCGCTCATAGTAAAACAAGGGCGACCATCAAAACGTCGCCCCGGTGTCCATTGCTTCTCCAGTGCATCCAGTACGGCTGCACCGTCATGCAGTATGTTTCATCGCTTTATTACCCATCCTCAGTTGATGCTGCAGCGCATAGCCCAGCTCTTTCGGAAGACGTTCACGCCGTATCCGCTCAATGACTATTTTGTTAAACGCCGTGGTCACAGCGGCAGGCCATCGGGATTTTCACCACATCAATCGGTAACGGTTTTCCCAGCCACACGCTGCATGACATGCCACCGGCCTTTCAGTTGGAATAAACGCGCCGGGGAATACGACGGTTACCCACAAGCACGCTGCCGCCTTCGTTTCAGCGCCCCATGACGCCTCCGTAGATTCGACTCCGGGGGCGCGACCACAAGCCGGCGCATCCCCAGCTTGATTACAGGCGATTCCCGGTTAACTTTGATTCTGCTGCGGATTTTGACCGTGACCCTTTCAGCCGCCTGGCCCTTTCCTTTACCAGTTTCAGCGTGACTTTTTGTCTCACGGGCAACCTGTGACGCCGACGCGGGAGATATCACGATGAAGCAACACGCGGTTAATGGCCATTGCGGCGGGGCACCAGGCACCGCCGTTTTGCGCTGATACACCGGCCTATTTCAACGGCCTGGCTCAATACTTTTATGGCCATACATCCCCCTTTCAGCGGGGTACGTTAACGCAAGCGGGCCACGCGTCCAAGCCAGAGATGACAACTTCCGCCATCATCCGGCGAAACCCGATCTACCCAGAAATTTTCCTCACCGATGGTCAGCGTGTCTCCACGCGCAGCTGCCGCAGGGCCATCAGTCCGACAAACAGGGACGGGCTGAGCCTTCAACGCGCACGGGTTTGAGCATAGCTGATATTTCAGGGTCATCAAACACCACGTATCACCGGACTGACTGCTCACTCCATGTAAGCTCTGGCTGACGTTCCCAGCTGTATCGCGTATGTTTCATCGGCGCCGGCAATCTCGCAGCAAGGAACAGGTTATCGAGATCAGCCAGCGCCTCCCGTTATTGCATTCCTTAGGCCAGGCCGCGCTCTGTCATTTCGGCTGCCACACGGCCAAGACACGAAACGCCGTTCCCGGCAGCACAAATTGCCACAGATTCATCCGCGTGGCGTGAAGTGCATCAGTATGCAGCTTCACCAGTGCTCCCGCCACGACCGTGACCAGTTCAGACGTATCCAGAATCACGGTATCCGGCTGCTGATCCACACCCATTTCATGTCCGGTCAGCACATTTTCCGGCTGAGAGGGTGTCCTATGACCGGCAGTTTTCATCCGTGTCATCAAGCTCCTCTTTCAGCTCCTGCCACGCTCGCGCGGTTGTGCTTCAGTTCTTCTTTCGTCCCCGTCAGGCTGACATCACGGTTCAGTGTTCACCCGGCCGCGGAGACGGGCAAATCAGTTCATCTTTCGTCATGGACTCCTCCACAGAAACATCTACGAAGCTCATGATCCCAGTTGTACGGACACGAACTCATCAGGGTCAGCCAGCAGCATCCCAGGGTGCTGACTGAATCAGGGTACTCCAACCGCGCCGTACTCCCCCGGTGTTACCCCAGTTTTCGGGCACGGGGCAGTTAGTCAGTAGCATTTCCGCTGTGCGTCCGCATCCTGAATGCAGCCATAGGTGGCGCAGACTCGCGTGCCTGAGGTGTTCCCCAGCACCCATCGTGTTGTCCGGCAGGAAGTTCTTTTGACGCCGTTCCTACGTACTGTCCCTAGAAACCACAGGACGGAGTGGCCACATCGCCATACATCCCTTATAGACACCGTTTGCCCAGGTCTTTCACGTGTCTCCAGCTCGGAATATGCCTACGACGGGTATCCAGCTTCCTTGACGGGTCGAAAGGAACGGAACAGCGCCCAGCCTTTTCGGATCGAACACGATGATATTCACACCGCTGGCGTTCCCCGTAGGCTTCGATATCGTCGGTCGGGTCATACGTGGACTATGTTACCGCTTGCTCCACTCCGTGCCGCCGGACTGCGTGATGTTATTTCTCCACTGCGCTCCATATCCTCCACCTCAACCGGATCCGAAGGCTTCACCGGTCATGGTGGTCCCTTAAGCACGGCAGAAACTGCCTGCATACTTGCCTCACCGCTTCCAATGGCCTCTTCGTCACGCATGTTCTGCATGGATGCGACGGCGGCGGTAAGCCGGGTCGCATAGAATTCTGCGGATCTTCATCCGGCAGGCGACGCAGGGTCATCTGAGATTCAATTTCAGGTCCTTCGGCTTGACATATCCGAGCGTAAATTCAGGTCGGAGCCGCCACGAAACGATAACTCACCGGAAACAATCGGCGAAACGTACAGCGCCATGTTTACCATTTAGAATTGTAGAGATAGACTTTCTCCGTGGTGAAGCAGGGAGCTCTCACGGAAAAGAGCTAAGAAACAGCAGAACAACACTCTTAAATTCCTTAGCCCATTTGCCGCCAAGAGTTGGGCGGTTGTACATCGACATAAATCCCGTAAAAAGCCGCACAGGCGGCCTTTAGTGATGAAGGGTAAAGTTAAACGATGCCTGATTGCCGTTCCGGCACGGCGGAGTCCGTTTTTCGTCTCGTCGCTGGCAGCCTCCGGCCAGCACATCCTCATAACGAACGCCTGGACTTGTAGAACTATTTAGGCTTATGCTGGTCTGGTCAGCAGCATGGGCAAGAATGCAGACGGCAGGACCCGTCGGTGCCATCCGACGCAACCAGCTTACGGCTGGAGGTGTCCAGCATCAGCGGGGGCCTTGCAGGCGCTTTCGCACTCAATCCGCCGGGCGCGGTCTGCGGTATGAGCCGTTACTGTTGCCTGCGGCTGGTAATGGGTAAAGGTTTCTTTAGCGTCATAAACATCCTTACACTGGTGTTCAGCAAATCGTTAACGGCATCAGATGCCGGGTCATGCAGCCAGCGGTGCCGGTGCTACGCCTTCCGCATCAGACGATCCAGCGCAGTCAATTGGCGCCTTCACCTCTGTGGTGCTGCGGCCAGAATGCGGCGGGCCGTTCACGGTCATACCGGGGTTTCTGCCAGCACGCGTGCCTGTTCTTCGCGTCCGTGCCTCCTCCAAGTTGAGGATCCCCATAATGCGAGCTGTTTTCTGCCGCAACGCGCTGCGGTAATCTGCGCGTTCACGTCCGGCTGCGCCTGTCCCGTTCTCGCCCTCCGTCGCTGGCACCACGTCAGTAACGTCATCCTTGCGAAGCAGTGGGCTGAAACAGTTGTTGATTGAGTCTCTTTTGGTCATTGCGCCGCGTAGAGAAGGGGATTGATCAGTGCATCGAGTGCATCACGCATGACGATCGCATCTAGTTAGTGTTAACAAGTTCATCAGCCAGTCCGGCATCGACCCTCCTGACCGCTGTACACTGCAGCCTCGGTAATCCAGCACAACCGTAGCACGGACAGGCTTATAGTGCCGACAGCTTGCGCAACATCTGCGGGTTGGGGCCGTCTTAAACCGGCAGATGTCTCCCGGCTTTAACGTCATCCGAAAGATGGCTGTAGGGGTTGCCAAGCTACTTTATCGGTCCCCGGCTGTAATCAGCGTACTTCACCACCCTGTTTCTCCAGCGCAGCACCGTGATCAATTACTGTGAGCCATCATGACGCCGATGGAGCCTGTCCGGGCGTCTGCGTGACCAGACGCAGGGAGCGTAGGCGGCACTGGCAGGCAACGTTACCTGCACTGCAGTTCATGTCGTTGGCAAGGCCCATACAGGCTTTTATGTCTACGCACACGACTGCGATGATGTCAGCGCAGTCAAATTCCCCGCACCATCCCACGGGCGTGTCCATATCGATAAGAATGCCGTCCCGTACCAATCGCTGGCAGCTAGTTGCAGACGGGCGATAGTCGCCGTTGTAACCGGTCATCCCCGAGTACGGCTGCAGCGCCCGCGTCCGGGGCCGTAACCAGCGTGCCGGGACACCCGGCAGCACGGCGATGCCGTTCATGATAGTGATAACTGCGGGCCTTCCGTGGTCCGTCATGATGCCCCGGATAATGCCAGCGTCGCGAGTGCCTCCTGGCAGTCAGGCTGTCGCCGGACACCGCATCCGTCAGGCTGCTGATCCCAAGCTGGCCTGCCAAGCGGCACAAAGAAAACCGGCGCATAGGCGGGTTCAAGGCATCAAGCGGCTCATTAAAGGCCATGCTGGCAATATGCGGGAGATTACGCAGCTCTGCTGTCACTCTTCTCCTCCTGTTGATTGTCGCAGCCCTAATTCAATCGCTGCACCGCCCGATGGCGGGCGGTTCCGTAAGACCGGCTGCACGGCGCTCCATGGCTTTCACGGACTTGCTGGCGGCAAAATTTCCGATAGTCGTACCGCGTTTGCGCATCCTTTCTCGTAGACCTCAGTTAAGCTTTCTTTATATCAGCATCACCGCTTCCAACAACTTCTTTCCAGACCATCGGATGGCCACTAGACCGAGCCTATCCAGTCGCAGTTCCCAGGCACTGCGGGCTTCCTGAAAACTGAAGCGCTTTTGAAAAAGGTAACGTCAGACGCGGCGAACGATGGCCTCTTCCATGACCAGCCATAGCACAGAAACATCGGCTCGCCTGACGGGATGCGACGAATTTCGCCGCCCCCATAAAGTGACCTCCACGACTCGTTCGCACTGGCCCGTGCCGTCGAGTAGCTCATCTGGGCATCATTCCGGGAAAGCTGCTCATACGAGACACCCAGCCCGGCGACTAGGATAGCCCGCAGCAGTGACTGCTCAACACGGAGGCCGTTATCCGTATCCTGAGCCCCGTCTGCAGGTTCAGTGAGTCACCCGGCATCAGGTCGGTACTTTTGCGCCTCCCAGCCGGACCCTAGCACTGCGGCGTAATACGCGCGGCAATTTCACCAATCCAGCCGTCAGCCTTTCCCGCTGCTCCTGACTGTTCTAAGCCAGAATAAATGCTATCGAGCCGAACTGCGTATCCAGCCTCTCAATGGTGGCGGCATACATCCCCTTCACAATGGCGCTCTGCAGCTGCGTGATGCAGCGTGAGCATCTTCATCTGCTCCATCACCTGTAAAACACATTTGCACCGCGAGTCTGCCCGTCCTCCACGGGTCATGAAACGTAGTAAAGCCGTGAATGAACGAGGCGCGCCCGCCGGGTAATAGCACGGGGTATCCATGTCCATTTCTGCGGCATCCATCAGGATACCCGTCCTCGCCTGACGTAATCCCAGCGCCGCACCGCATGTCATTAATCTGCACCGGCACGGCAGTTCCGGCTGTCCCGGTATTGGTTTCGGGTTGCTGATGCGCTTCGGGCTGACCATCCTAGAACTTGCCTAGAAAAGCGCCGGGACGATAGTGACGAGACCATAGCATGACGAACAGTTCTTCACCGTTAAAGGCGTGCATGGCCACCCTTCCTCCCGAATCATCATGGTAAACGTGCGTTTTCGCTCAACGTCAATGCAGCAGCAGTCATCCTCGGCATAAACTCTTTCCATGCCGCTTCAACTCGCGGGAAAGGCAACCGTCGCTTCTCTCTCCCCGATGCCCAGATAGCGCCAGCTTGGGCGATGACTGAGCCGGAAAGACCCGACGATATGATCCTGATGCAGCTGGATGACCCGTTGGCGGAGGCCGTTATTGCGTCAGAGATCGTCCCTCAGGCATTGCCATTCCAAAGTTGGGCAACAGGGCTGCATCCACATTTCACTCGGTGGGTTCCACGACCGCAACTGCCCTCCAAATCCGCTGCCACCGCCGTGATAACCGGCATATTCGCGCAGGCCAGAGGGTGCTCATGCCGTCCGGCGCGCAGAAGGGTGGGAATGGTCGGCGTTTTCATACATAAATCCTGCATTATGCCTGCGTGCTGTGTCGGTGCCGGTCTGCACTTCCAGCTCTGCATATATTTTCAGGTCAGACACGTCAGAAGTGTCGTAAGTGGTAAACTCCACCCTTCGTCCGTCTTTCTGTACTGTTGCCCCGTTTACCTGTCATCAGGTCATGCAGTGCCGCACGGGCAGCGGCAAGTTTCTTCCTGTCGCGTCATTCATCTCTAGCGACAGGCATGAAACGCCTGTATCTATAATGCGCCAGTGTTTTCTTTGGTGCTGCACCATCCTCTTCCTGCAGCAGCCAGCAGCACTGAGATGCAGCTGCCAGCGGGAAATACTGATGCGCAGCGCCGCCAGCGCATAAACGAAGCAGTCGAGTGCCTCATTTGCGTCGCTGTTAGGGCGTCCCACAGTATTTTTCCTGCCATCCACCATTTTCGACCTGCTCTTCAGCAGGTTACTATGCTGCTTCGGTCAGATCAAATATCCGGGTTATTCGGAAAGCGACGACTGAGGAAGCGGTTCATCCCCTTCCGGCGTCAGTGTGAAGCGGTTACGAACGATCTGCTCTTTCGCGGTATCCGTACCGATTTCGGTAACGGGTGATCCCGTTTTTGTTTCGCTTACGTGGCATGCCTGACCACCGGCTTTCCGATCATCCCTTTAATGGGGAACCCGGAACAGCCCATGTTTTCGAGCGTTCATACAAGGTCGGGTCAATCCCGCCAGTATCCCAGCAGATACGAGTATGGGACATTTCTGCACCATTCCAAGCGGGTATAGGTTTTATTATGGCCTCATCCACACGCAGCAGCGTCTGTTCATCGTCGTGGCGGCCCATAATAATCTGCCGTCAATCAGCCAGCTTTCCTCACCCGGCTCCCCATCCCCATACGCGCATTTCGTAGCGGTCCAGCTGGAGTCGATAGCGGCCGTCAGGTGAGCTCTAGCCACACGTCAGGAACGGGCTGAAACAATCTCTTTCCGCTCTGCCATCACTTCAGCATCCGGACGTTCGCCAATTTCGCCTCCCACGTCTCACCCCGGTGTTTACGAAGGTTTACGTTCTCCCGTATCCCCTTTCGTTCATCCAGTCTTTGACAATGCACCCGAGCTGGTGAACGGGCTGTACGTGCCATGTGAAGGTCACCTGTCAGGGCTCAATCTCTTCACTGGATGACGAAAACCAGAGAATGCCATCACGGGTCCCAGATCCCCGGTCTTTCGAAGATATAACGGCATGAGTAAAGTTGGAGCTCCTGCTGGGGATGACGCAGGCAGTCTATGGCTCGCAAGAGATAACAAACCTAGTTGGAGGGTCATCCGGCGTCCGATTTGAGGCCAAACGAGTCTCTTTGTCGCACAAATTTAAGATACTCTGCTCCCTCCCCGCAAACCGGGCAGGCAACATGAAAACGCATAAATGCGGGGATTCACTGGCTGCACGCTCAATCGTACGACAGGTGCCTCCCATTTTGGCGTACCGTACGGATGGACTTTGGCCAGACCGAGCCTTCAATACTAGTGTCACCCAGGAACCTTTAGAGAGCCTTCCTGTTCAATATCATCATCAAAGCAGCAAGTTCATCATAACCCTACATCCACCGACTTTCACGGTAGTTTTGCCCGCTTTACCGCCAGCATCAGAAGCCACGCCCATTAGTGAAACACGCTTCATGGTGAGCGTGTTCCGCATTGCTTTGCCATACCACGGGGAGGGCGCCACTAAGGCGACGAATATCACGAATAGTTCAACGGGTCATTTCATAAAGTTCTCGCATCACCATCCGTCGGCAACCAGATAAGGGTGTTGCTGCTTATGGTAAATACTAAGGCATAAACCCCAGCAGCATTTGGAGAAACTGACTATGAACACGGCAGACTTCACCACATTCACCTCACGGATGTATGATCGCTGCCCATCGCATTCATGATCTCACCCCTGAAAGGCAGTGTTTCCCCAGCGCCCTTCCTGGCTGCGCGGATTCTTCGGGGAGATAGTAATTAGCATCCGCCCATTCAACGAGTGTGGGCTCCGGCTCCCTGACAGTGAGCGAAGCCCGGCGCGGGGTAGACAAAATGCCCAGCCTGTTGACTCGTAACTCTGTTCGCTGGTTATTCACTCATAGCAACCCCGGTATCAGATTCATCCGGGGGCTGCTTTGTTCATGGCTTTGATGGATATCCGTTCAGGAAATCAACATGTCGGTTTTCTTCCAGTTCCGGAAAGCCGCTGCACCGACACGCAGGCGTCGAAGTAATGGCAATTTCACTGCGATCGCGACAGCACGAAAATACAGAATGCGGTTTCCACCACTTCAGCGGAGCTCCTGGCATTCTTCAGTTTCCTGTGCGTCGGCCTGCAACGCGTAAGTCGATAGGACGAGTTCGTATCCTCAATAGTTCCTGGCTGGAGATCTGCCTCGCTGGCCTGCCGCAGTTCTTTGCACAATACCGCTCCCGGACTTTTCGTTCTCAATTTCAGCATCCTTTCGGCATACCGGTTTATGACGGCGGCAGAGTCATAAGACCCGCATTACCCTTGCCACCGCCTCTAAGAACGGGCATTCCCTGTTCCTGCCAGTTCGTAAAGCGGTGACTTAGATACTCGCACGAAAATGTCAGCCAGCTGCTTTGTTGACTTCCATGTTCATTCCACGGACAAAACAGAAAGGAAACGACAGAGGCCAAAGCTCGCTTTCGAGCAGCTAGGTCGTTCCTTTCGTCCCAGGGGTATTTTAAATAAAAACATTAAGTTATGACGAAGAAGAACGGAAAACGCCTTAATGCGCAAATTTTCATAAATAGCGACTCGAGGTCGCCGCCGTTCTGTTT * tp:A:P cm:i:144 s1:i:1339 s2:i:0 NM:i:1526 ms:i:5862 AS:i:5862 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
97 89 0 utg000001l 23583 60 1589S7M3D3M1I19M2I7M1D18M3D7M2I1M1I4M1D5M1D3M1D9M1I10M32D2M1D3M2I5M1I1M1I9M3I4M1D2M4D5M1D2M4D2M1D4M3D5M2D6M2I2M1D3M1D2M2D3M1I7M1I4M1I10M5I3M1I6M5I13M1D5M3I3M2I30M1D11M2D3M1D5M1I9M1I19M2I5M1D4M1D6M1I11M1I3M1I3M1D11M2D10M7I1M1I3M1I3M2I8M2I3M4D13M2D2M3D29M1I2M1I7M2I5M2I6M1I5M1D3M1D8M2I17M1I6M1I8M2D2M4D2M1I12M2D3M1D8M1D5M4D3M3D59M1D1M1D13M3D5M1D2M1I8M5D2M1D2M1I2M1D7M2I4M1I5M1I7M1D7M1D2M3D3M2I3M2D4M1I6M1I12M1D15M1D13M2I1M5I27M1D5M1D2M2D4M1D12M3I3M4D7M1D3M3D3M4D9M2D1M1D9M2D7M1D3M2D6M5D5M3D9M1D14M1I4M1I27M2I3M2I18M1I2M1I1M1I18M4D10M2D26M1D7M3D5M2D1M1D6M1I1M1I12M1D12M1I3M4D16M1D22M1D1M1D2M1D15M1D4M1I11M2I2M1D8M1D3M1D11M2I2M1I5M1I4M1D10M2I16M1D9M1D3M1I2M1I6M1I12M3D3M5D1M2D16M3I3M1I9M1I4M2I9M2D10M1D4M1D5M1I4M1I11M1D2M1I30M1I2M1D1M2I12M1D5M1D2M1I4M3D6M1D7M2D6M1I11M2I12M4I12M6D4M1I2M1D33M6D11M1I8M2I2M3D7M1D11M1D6M6D10M1D5M1I3M1I1M1I5M4D4M3D2M1D1M1D3M1D4M2I19M3D6M5D3M1D11M2D14M1I4M1I4M3D3M1D26M2I9M1I2M3D14M5298S * 0 0 CTCTGTTACTAATCCCAAAGGGATATTTTCGATCGGTTGTTCAGGTTTCGTTTAGTACATTTAATCCTTTACTCCCTAAAGAACATGATCTCGATCCCAGCAAAGGTCACAATATTTATTTACTCAAGAATGCTGCCACAGCAATAGTTGTAAATCAGGCGGTAATCTCGCTTAGAATTCATTCCAGCATTTATTGGTTTGTATGAGAGGTAATAGAAAGACAACGCGTATGAAGCTACAACCCACCCAGCCAATGACTGAGACTTTTTCGACCAAACTCATCAGCCTCATTTCTAAATATGAAAGATCAGTAAGACGTAATGAACAATTCAAGTGACTAGATGATTCACTAAATTATTTTAAACACATATCCATCGCCGAAGTATGCTTCGAATACTGCATGTTATTTAATAGATGCATAGATGTCGTTGTAGAAGGTCATGTAGTTTATTCGATGAACCAGATTCATCTGCGTGCCGCCTATTGCTCTGCTTTACGAACATCCACCGGACTTACTCGGCTGCTACACGGACTTAATAATTTGCACTCATTCTAGTAGTACTGCACAGGTTCCAAATCCTGCATGTGAAGTCCTACGGTCAAGAAGCAATAATATTAGCCGTCCCACTTGAAGCACGATTGGGTACAGTGGGTTTGACCGTGACAAATTCTTGGATATCACCGTTGCATACGCTTACTCCGATCGTGTAGTCTAAATTATCCATTCTAAATTATAATGGTCATACCGTACTAAATTAAATAGGTTTTAAAGCGATACTGAACAGATGAAAGTAAAGTACAACCAACTACTTTCCAGCGAACTGAGAAATGCTTAATAAATGCTCTAAGTATGATTGGCAGATAATGTTAGAATAATTTCATGTACTTCCCACTTTAAGACAACGGAATATTAATAATGACAGTTATTTACCACTATTCCTCCTACGGTAGTAATTACACTGACAAAGTTAAATTAGAAGCTGTTGACCATAATCTCCAGACAACAATCTAGACAATAATCATGCTTGTTTCATCATGAAAGTGTCATTTGGTAACGACAAATAATCATTTCTTCTATTGCACATTATCCGACGGGATTGCCTATTAATTAGTTCCTTATTCGCCGCGACTGCAATATGAGAAGGTCACTTGCAGTGATGAGGTACCTACCGATTCATCCTATCGACAAGGACATTTTTCTTAGCAATGGTCCAGCAACGAAATTTCGTTACGGAATGGCTCATCTATCGTTATGTTGAATGCCCGGGGACTAGGCAGCAGGAAGACAAACACATATGCATTTCAATAAAGTCATGGTCAACAGGTATCGTTGGAGGCAGGAAGCACTTGGAGTGAAGTGATAGAATGACTTTCTTGACAGTTACAGGAAAACCGTTACGCAAATTTCCCCACCCGTCAGTTATTAGCGACTAAATCTAAACCTATTATAATTTGAATGTAATCCCCAATCCCAGCGTACTTATCATCTTCTAACCACTCGAACATTTTCAGGGATGTAGAAGTACATGAAAGTGAATTACCACGCTATCACGAACGAAAGCTTTACGAGCTGTTGACAAAATCCGGTAACTTGCTCAATTCCTAGGCAGTCATTGGCAACAGTGCATGCACTCGAGAAGGACGTTGTAATGTTGCTCCGACAGCATGTTAAAGTACAGGTCGGTCAACCTGCTTGGCAAATATGTAAATTGGACTGTAGAAAATCATCGCACTCGGCAGGTCAGCTTCACCGACTGCATACGACGCTGTCGGGACGCCTCGTCCATAGTGCCGGCGCCAACTTATAGCAACTGTACAGCCTACAACTCTAATTTAATACATAATGAATGTATAATAATATTAAATTTCTGTACTAATTTACTATGGTTTCTCATAAGAATCATTGCAAAGATCAAACACTGGTCAGAAAGTTGACGGGTCTAACCGTCTATTTATCTAAATATAAGCTCAGCATACGCGGTAGCCGCACGCTCAAAACCGTTGACTAAACCATGGAAGAAGACTTACGATTTATCGCACTTGCTCATTCCCGTGCACCGTGATATCATTTACCTGAATTATTAGCCGCTTGAATTTGAATCAATTCCCAAAACCGCAAAGACCATACTTTATTCAACAAACTAGATCTAGGACTCGTTGACAATAATGTTATTGAAAATGTCAAATGATCCATTAACCTATTGGCTAAATTCCTAATACGATAGAAAATAGGCGATTTAGAAGGTACGAGCAAATCCATATCTTTCATCTTACATTACGAAAGAATGAAGGTTTAAACATGAAAGTATGTTAACATTGTAAAGTTAGTCATATTGCACGAAATTATTCATATTTAACTGAATCATCTATTATTAAATCAGAAGACCTATCGTACTAGACTAAAGATTACCGAATGATACCCTTAATGTATGAAGCGTATAAACTGTAATCTGCCTCCTTAATAAAGGTTACATCTACTTATTCAAGCTTCTATTCGACTCTTTATTTGATGAAGCCGGGAGAAGGTGACTTATTTAAATTAAATTACTCCATAAGCAAATTGTCATTTAGCATGATACTACACCAATAATTCCTGAAGATATTACTAGTCGACTGGTACTCCATAAATATCACTTCGACGACAGTAGTTGACTATACAGCCACTTGCAGAACGACTTTTAAACGACCGTTACACTTCAACTATTAATTTTTATAAACATTCCATCCGTACTTTGATCAATACAACATTTGAAGATCAAGCAGACATATTTTAGTTGCAGCCCTACTAAGTAGAGCGTAACAAAGCCTTATTCACTTACATATTCCATGTAGCCAAAGCAAGCATCTACTCTACAAGCAACCAATACATACAATGCCAATTAGATGAAAGACTTCAGTAATGTCGACCGTGATTCAACGACTAATCAAATGTATTTCATGGCAAATAGTTACGAACTACCGACAAAACGACTTTGACAGATGACAGCGACTCAAATGACGAAAAACCATATTTCCATGCGTTCAGTTAAAGGCAATCCAATGTAAACTACTGAACAATTGAGTCAGACAACCTTCCATTATTCCTGAAAATAAGTACGCCAACCATCCATGACCTACTTTACTAATAGACCCCGAACGTTGTTCACTCCTATACGTTCGGCTCCAACTTACGATCCATAACATAGAAATGAGCTCAATAGTGGCAGTTGATGTACGGTTCAGCACCTCCCGTATTCTCAGCTTCCAGCAACGAGGTTCTTCCTTCTAATTCCGATTGCATGCCGCATCCTGAATCCACAGCCAACTTATACTTAATCACGTTGTTTCTTCCCTCCGGATCGAATACGGTTCTTATTCCTTGACGTTAGCCGGGTGCATTTCTATTCTGTGCTCCCCGTAAGGTACCCAATTTCCGTAACGTACCGGTTCAGAATAAATAACGCGTGCTGAAGCCACGTCACGTTTATCCGATGGTCTTCAACCATTCACGTGCCTCATCACTGTTTAAATACAACAAAGCCAGCCGGAATGGCTTTAATATCGGTACTGTTGCAGGCAGACCGTATCAGGCAAAGAATATGCGTCACCTTCAATAAATTCACGTTCCGGCCCGACCGTACTGTTCTGTTATTCTATTCAGCAGTATGCTGCAAGCTAGTAGAATCAATGAATGTTATCGTCCGCAGTTAGCGTTAACCTTATCTTGTCCGTGGACCCAAGCCGACGAATGGCATGAGCACGTAACCGACTGCTGTGAGCACCAATACCAACTGTAGATGTGCAATAGCAGGCACTCACGGCTGTACCGCTACGTGAAATGGTGCCTTTGACCTTCCGTTTGATAATAAGCACTCTGTCGTTCCTGTTAACTTGCTCTGATTCCTTGGTCAATGTTTACTGACTCCATCAGAACTGTTCACTCCTTAAACCTATTGCGGGCCCGTACCCTGTTCATCTAAATCAGACTGTGATCAAGGTTCCCCGTGTCGTTAATTCTTACTGTATTGAATGCCTGTTTATTTCCGTAATCAAACCACGATGGGTCCTTTCTAGATCCGTGTAATCGGACCCGGACTGTGATCGACTTAATTCCATCCTGTTCCGGACAATACAGCGACGAACCTGGTGGGTTTCCCTTGATTGTTCCGCATCATGAATGACGGAACACGATGATTACCGACAGCAAGTTTGTAGCCCTGTCAACCTCCTTTCGCCTGCATCAGGTGACGGTAACGGAACCGACGTATCATCACGGATCACCTGCCCGGAAAGCCGAATTCTCACGACATCTACAATATTCAAGACATCTAACCAATTTCTAGAATATCCTTCACTCGGTGAGTTCAGATCTATCAGGCATCATTTCAAATACGGGTCACGTTTTGCTTTAGAAGCTCTGCCACCCTCACGTCATGTCGCATATTCCTTCGGTTGTTGGCCCACTCGCGTTAGATATGGTAGCAAATTAGCATCATTCACAGCTGCGGCCAGTGCTTGCCGTATTCAGTGCGTCAACCGTCGAGCTCGTATTAAATTCTAGTAAATTAATGGTCCTCAATCTGGTATGTTTCTTTCACGGTCCCTTGGTCCGTTCCGGGTCGCTTACGTGCTTGACTTTCTGTCTGTTTCCATGTAATTATTAGGACTCATTTAGTTCAATGGATGCACCGTTTCAACGCTGTTGGTTGCACGTGATTGCTCAATATCCTTTCCTTTGTCCGCATCCTCACCGCTACTGAAGCTACTCTGCACTTTTGCCCGAATTTTTACGTATTTGCCTATTCGACGCATTTTATTCTGCGTGATACGGACTTCCCGGACTGTCTCCTTCATTGCCGATGCCGTTTGACGGACTCCTATGTTTCATGTTGAACGGAGCATTTCTCATCGACTTTCCAATGACTAGTCCATCATGTTGATTCGTCTCCTTAACTTTCCTCTTACGATTTTCTGCCCCAGTCGAAGGGAAGCACAACGCTATGAAGCGTAGGGTTCATGTTACTATGATCCGCGTCGCTTTGTAAGAAGCACGCATCCTCCGTGGCTGAAGGCGGCGCTGGAAGTGCCTTAGCAGAAGTAGGAAGAGACGTGGAAGGGTGTGACGCTGCAGGCATTCGTTGGATAGTTGCCCGCACCGGCACTGAGCAGGGATCCGAGCCTGGCGGCACATTGCCCGCTTCAGGATCCAGCTCCCGGTTGAACCATTCCTAGCCCGGCAGCTGTCATCCGACGCACGGGCTCCGAATCGGCGCGTGGAGCATCCCCAGACAAAGGCACTGGTAAGTGGCGACGCAGCCGCAGCATTCACTTACGATCCCCATCTACTTGCACGACGATTGCCGCTGCGACAGTCACGAGCCAATTGAACCGCAGCAGCGGCCGGCATCACGCGTCAGGCACAGAAAACGAGTGCCAGGGTCCCGTTGTGAATGGTGCGCCAGATCTATTAGGGGTCGCGAGTATGCGGAACCGATGCAGCGGGCAGAAGTAATGACATGTACCCCACTCCATCTAAACGCCCGGCTCCATCCGGCATCCTCACGGACGCAGGATCGATCTTAGTGCAGTCAGCATGTGCGCCTACTATGAGTGCCTGAATTTAGCATGGCCGAGTCTCGTGCCAGTCTTGCCCACTCCGAAGCGTACACTGCCATGCCCCAAAGCGCCCGGTTCCGGCGGGGTCCATAATACTGTATTACGGCTAAGCATCAGAATGTAGACCTAAACCCAACGCATGAATGCGTAGTCAGTACGCAGTGCCCTCACGGCCAGCTGCCGAGCAAGGCAAGAGCCAAATCAAACTGAACCGACGACGCTATCCGAGTAAGTCAATGTTAGGGTCTCATTCCCGAACTGCTTCTGGCCGTTGCCTCGCAGGCATTTCTCGCATATTTTCTAGTTCTAAGTAAGCATCCCTACGCGATCATCTAAGCCGGACGATACGAAGGGCTCTACTGCTCCTATTGTAAGCATTAGACGCTAGGTCCGCAGCGCCACTGGCGACTGAGCGCGGTTCACTTAAGACCAAAGCATGTCCGCAGGAACCGAGCTAATCCGGTTCACCCCTCGACTCGTGAATCCGAACCGGTCCACAGCCCAACTTACCATAAAGCAGCTCCACCCGATTCGGGCGCCACGAACTCAAGCTATCCGCCGTACACGTCGAACGCAAGCCTGTACCGAGTCGAAACAGGCTGCTACGAAACGGTTCCTATTGCCTCGACCGCGTTCGCAGGCCGGCCTCCCCACTAGCAAGACAGACCTTAAAGTCACATTTGACTCAAGCCAGCCTGCACTGGAGGCATAAACGCCCCGATTCCCGATCGACGAATCGATCAGTGCCAGAAACCCGCATTCAGCAGCAGGCAATCGAAGCTAATCAGATTCCGCACCGGCCAAACCCAGACCCGTTGAACCATCGGTTTACCGACACTAAGCCGACTAGTTAATGTAGAATGAGCGATCGATTGATTCAGTAAGGCCCCGCAACAATTACACGGGGAGAACAGGGTAACCGCATCCGCGATGCTCTAGCCAATCAATCCACAGCCGATAGCGCCTCGATCACGAATACGTCCGCCATCCCGACAGCGACCGGATCTCCGAATATCCGAAGCATTACAGCCCGACGAACCGTCATCGTACGAATTTAGACTGATCGACGAGTCCACCTCACGCCGGAACTGCTTCTCCGAATTGGCACGATCTCCACTGCACTCCGCGACGGTCGCCGTACATTCCCGTCACGATCACGGAGAGCAGGGATTCAGAGCATCGGCATTAGCGAGCCGTTCCGACGAAGTCCGGAAGGCCGATTCATGCAGTTCGGTAATGATCGTACGGAACCTAAAGCCTCTCAACACCGTTTCATTCCGATTTGGACCGAACCGCGATACGATAACCCTTGAAGCATGAAACAGAATTGCCGGTCTAGCAATCCCCATGCAGCAGCGATAGCGACAGTAATGTTTGCCGTCGTCTCAATCCGACGCCATTGCTAAGCATCCAGGGAGAGCAGCGTCTCCATCCTGGGTTCGAAATTCCCAGTCTGAGCGGCGTTCCTCCCGTCAGCTCCGCACCCTTTCCAGCAGCTCCTTAGCATGAGATGGGATGCGGTTCTCCTTAACCGCTTACTAGCAGATCGAAGCCTCAGTCGAAACCGACGCAGCACTCCAAGGGAAACCGCATTACGCGACGGTATTCACCGGGCGGATATAAAGTAAATAAAGCCCGGTTTGATACTGGGGGCTCCCAGTACAGCCGTATACAAGAGATAACGCGTGCTGGGTTCAATACCCTGATCCGCAATCGCTTTGCAGGCGACCAGAATCAACTGTAAGCGTGGTCAAGCTAAACGGCAGGATCGGGCAGTGGAAGTCTGGCGCCCGGGAGTCGACAATCCACGGTGCTGCCGGTGCATCAAACGATAGACGAACGCAGCATCAGATTCCGTCTCGACCGCATTACGCCGGACTGTCACCCTTAGTTCCCCAGTGCGATGCGGCAACCGGCGTTTCATCGATCCTTCCGGCGTTGTAAGCCCCTCAGATCACGTCGTTGAACTTACGTCAGACTGGAGAGCAGGAATCCACGCAGTTCGTAGTCCGAAGCCAGCATTTATTCCAGGGTCTGCAGTAATTCCGTCAGTGCGTCGCAGCGATTAAGAGTCCACCGGTTGCCACTCCTGTTCAGCCGCGTCAAATGCGCGTTCCACATCTACGCTCTCCTTTCCGAGCAAGCGCTGCAACGATGGCATCCGTTGCGTTCTACGAAGGACTCACAGGAGCGGAACAGTCGCAGCTGGCAGTACTCAACGCAGTCGGGATTGTAATTCCAACGCAACACGGTATTAAGGATCCTACGTCAGAGGAGCGCGAAGCCTTTGACGGATCGAATTCCATCTAGGCAACTCGGATTTCATCCGCGTCAAGGTCCGTCCGTCATGCATCGGGCGATGACGGAGCATTCGATTTGAGCGGTCAGCGTCGGAGTCCGGACTTAACGCTTCACCGCAGCACGAAGCGCAGTGCTGATGGCAGCATTGCAATAGATTTCGCAGTCAAGCGACAGAATGCCGGGATCTACGTCCTGATGAACGGAAGCCCGAATTATCTCCTACCGGTCCGTTCAAGGGTCGGTTCCGTGGATCGCTCCCGAAGCGTCGGTAGATCAGAAGCTCCGGCACCAAGGATTGAACTGGCATTCGCCTGCGTACCATCGAAGCGTTCGAGTTCTCTCTTCCCAGCCGTCCGTCTCCGATGCCGTTTGTTCAGTAAACGCGTCTAAGAGCGGCGCCAGCGGAGCGGCGAATCATGTCGGAGCGTCGAACGGATCGAGGAGCCGTCTGAGGTTGGAGCGGCTGGATCTGAGCGACGAGGGCTTGCATGCAATCACGAAGCACGGATGCTCATGATTCAACCGTAGCACCACAGCTTCGATTTAGTCAGCAGAAAACTTCAGGCTTCTACTGCATTTCCAATCCTACCCCGGCGGTCACCGGTAAGAATGCATCACGCGAGCAGAGATCGGAGCGCTCCAAAGCATCCAGCGGCAGGACCGTTATCATGTAGACGCGTGTGGTCAGTAGGAAT * tp:A:P cm:i:12 s1:i:88 s2:i:0 NM:i:637 ms:i:168 AS:i:98 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
98 90 0 utg000001l 34893 60 10S14M2D9M1I13M2I8M4I53M1D12M2I11M2D22M6I1M3I8M1I7M1D15M4I7M1D2M1D9M1D1M2D11M6I2M3I3M2I6M1D11M6I2M1I4M2D23M1D2M2I3M2I2M1D32M2I14M2I14M1I6M2D2M3I12M1I20M2I2M3D16M1I1M1I11M1D11M2D4M1I20M1D14M2D5M3I3M1D5M3I14M2D23M2I3M1D4M2I1M2I20M2I6M4D9M1I36M5D14M3I22M2I1M1D8M1D11M1I6M2I4M1D8M1D10M1D2M1D15M2I3M1I3M1I7M1D4M1D1M2I14M2I19M1D11M1D4M3I19M1D25M2I5M1I6M1I23M1D9M2I9M2I5M1D17M1I6M1D7M4D5M1D5M1I4M1I7M1I5M1I1M2D23M1I16M1D3M1I1M1I4M1D3M1D6M1I2M1I5M2I30M2D24M1D7M2D5M1D10M2I33M2I3M2D7M1I1M3D12M2I16M3I3M1D11M2D2M6I33M4I2M1I2M1D23M3I8M3D44M2I11M1D9M1D6M2D15M1D1M2I12M2I2M1D7M6I4M3I8M2I6M2I3M1I2M1D15M2I4M1I9M1D10M2D16M1D14M2D9M1I4M1I22M1D3M1I41M1D6M1D8M3D3M3D10M10I2M4I4M1I2M1I12M1I8M1D18M1I5M1D12M1I10M3D8M5D17M7I1M1I21M3D5M1D9M1D10M5I5M2I11M1D4M1D1M1D4M2I6M2D11M2D3M1D6M1I1M3I5M1I3M1D7M3D4M1D20M2I10M1D18M1D3M1D3M1D26M1I20M1I7M1I25M1D2M1I3M1D10M2I8M1I22M1I9M1D22M3I18M1D8M5D1M1D33M1D2M2I10M5I5M3D24M1I3M1D5M1D10M3D24M5I6M1I21M3D5M2I3M1I20M2D12M1D6M2I12M2D3M1D22M2I17M2I1M1I18M2I22M2D8M1I2M3I7M2D1M2D17M1I5M1I15M3I9M2D10M1I2M1D23M1D1M4I26M1D1M1D14M1I15M1D17M3I14M6D19M3D21M1I5M3D1M1D15M2D9M1I3M1I14M1I7M1I30M2D2M1I23M1I2M1I16M1D11M2I16M1I13M1D10M3I47M2I11M3D1M2D2M3I15M1I5M1D12M1I10M1D8M1D25M2I18M1D8M4D6M3I43M2D2M1D2M1D11M1D11M2D17M2I28M2I4M2I8M1I1M1I9M2D4M1D3M3D7M4I1M1D3M1D14M3I19M1D9M1D5M1D5M2I4M5D14M1D4M3D14M5D6M4I6M1D10M3I1M1D7M1I13M1I8M2D5M2I4M3I2M1I4M6I5M2I9M1I5M1I15M4D6M1I7M1I33M3I5M4I3M1D29M1D11M3D17M1D33M1673S * 0 0 GCGCAGCATGCTGAATGGCTGTACCGCCTGACGCGGATGCGCCCCGCCACAACAGCCCCGGCCAATGGCGGTGCCGATACTCCCGACAATCCCCACCATTGCCTGCTTAAGCAGATTTCTGTCATCATATGGACAGCACGAACGGGTGAAGCTGCGCAGTTCTGGACTGGGCTTGGTGCTCGCTGCCGTTAGGCTTCTCCCGCCGACTTAATGGAGACGCAGCGAAAACGGCGGCTCTACAGGCGGTATTGGTACAAGAGAGCATGTCCTTAATTGTAGGCGCTCTTCCCACTCACTCCAGCCGATTGCCAGGCCTGCCATCGAATTCCCGCGAAGCTGGTCTTCAGCCGCCAGGTCTTTTCTGCTCTGACATGACGTTATTTCAGCGCCATAGATTATCAGATAACTGTTCCTTCAGGCGCTGTTCCGTGGCGGCTTCCCGTTCTGCCTGCCGGTCAGTCAGCCCCGGCTTTCGCATCAATGGCGCTCCGTTTTGCACCCAGCGTTGCTGTGCTTAGAATTTATCGCCTGCGCCGCGCCAGCGCGTTCAGGCATGCGGTACGTAACCTTTAGCCAAGTGGTGCAGCCATAGTGAGTTTGGGCACTCCGTCTCATCTTTTATGCGCCATAAGGGATTTCTCCTGTTAAGACAGAGCTGGCGACGTTGCCACCGCCTCCTCCAGTACCGCAACCATACTCTCCGCTTCCACAAATCCCCGGCCTGCTGCTGATTTGCATTTGCTCCGCTGCTTCTCCAGCGTCTTAGAGTTCTGCCTGAAGCGTCATAAGGCAGCATGAGCCAAATTTATTCCTGACGATCGCCGCAAGACATTGCATTGTACGCTGGACTGTTTCGGCTTTTCAGCGTGCTTCATAATCCTTTCGCCGCCGCCATCAGTGGTGTTGTAATCCGCCTGCACCATTTCCCGTCCTTCTTTCGTGCCTTTCCGTTTCTTCCTGGCCTCGGGCTTATTTCTCCGGCGTCTGCATGAGTCCGGCCACTTCTGCGCCTCTTCAGTATTTCAGCCGTACGCTGCGAGCTCGAGCGGCGCTCTAGGCAGTGCATCTTACATGTCCGCTCTGCTCAGCCTTCTTTCGGGCGGCTTTCAAGCACGACGGGCCTTTCACGATCATCGAGTAACGCCCCTTCATCGTTAACAAAATAATCATCCTTGGCAGATTCCATATGTCTGGTCCTTCTTATACGCAGCCTCTGCTATTAATCAGCATCTCCTTAGGGTGGTATCAGGACAGACCACATCCAGCACCGCATCCCACATGGATTTGAATGCCATTAGGACGAGTCCTGTCTGCCCAGGTCTCCAGCGTGCCCATGTCCTTTCAGGCGGCGGGTCTGGTCATCAAATGGCTTTCGTTGCGGCCTCGTTTAGCGCCTGCAATGCCCGGCTTCACCTCAGGAACGTGGGCAACTGAGCAAAGCAACCGCGCAAGTGGTGCTCCACGACACGTTATGGGACTGGCGAGCCATCATCAGTCAGCCGAGGACATTTGGGTCTTGGTGAGCTTCCGAAGGCTTCAGCGACGTGTCCACCTCCACCGTACGCACAGAGAAACGCGCCACACTCTGGCTGATGACGGCAATCTGAGCCTCACCGCTTACCCCCGCCTTAACCAGTGCCTGAGTACTCGCTGTTGGGTTAAACGTCTGTCGCTTCAGCCGCTGCCGCCTGCCAGCCCGGCTCTGGACAGACCAGCATACGATCTGCCGTTCAGTCCCGCCTGATTGCCTCGCTCAAGGGGATTCTTCTGGCATGTTCACTTGTTCTTTCCGCTGATACCAGGCATACTCCAGGCACCGTCCGCCACCGCCAGCGAGGTGGCGCGCCTACAGGAGCAGCAGGGTACGCAAGCAGGCACCGCGAGAACAGGGGGAGCCGCTAGGCCGACAGGAGTGCTTGCTGCCCCTGTTGCAGCAGGATCATGGACGGGACTTTACGCCGCCTGCAAGCTGCGTACCCTTCGGTGAACTGTGCAGGCAGCATACCGCATGGCGGCTTTATACTCTGCCCGACTAGAAATCCGCCATGTCTGTGCAGCCGCTGCCGTCGGCTCAGCACGACTGTTCCGACGACTGCCGCATGTTTTTCGCATCACTTTCGTGACAGAGACTGACGCCTGACTTCTCTGGCCATCTGCTCGTCAAATCTGAGCATCCAGACCCAAATCAACGACCAGATCGCCTAAGCGGGTTCAGCCATACATCTACCTCCTCCTGCGATCCCTTCTGATACTGTATTCTAGCATTACGTTCCTCCGTCATGTTCACACATCCGTGAAAGGAAGCGGGATAACTTCATTCCCGTCCGTAACGCACGGCACAGCTCCGGCAAGCCCTGCACGCTTTCTGCATCAGCAACATCATCTTCAGGCTTCGTCAGCCTCGCGCAGGCCGGTCGTCAGCAGACTGAAATGCTTAGGCAGATGCATATCCGGATCGCGCTGAAAACAGGCTGAGCACGGTACGTCACGCATAGGGAAAATGCATATCCGATAGCAGACTCATGAAAATAATGGGTACTGTGTTAAAGCGTTCAGTCGGCATGACCGTGGATGACATCCCGGCAAGCAGCAACGCACACCAGTCGGGTCTCCCCATCGCCCGCGTTTCCGCGCAGAAGCGCAGCGCCGCGGGCACAGTGCTCCGAAGGCAAAGAGGAGCGGGGCCGTCCTCTGTCTGTTTAGGATGGTTCACCACAAACTCATACCATACAAGCCGGTACACCACGTTCAGCATGCAGAGAATTGCCTCCGTGGTAAAGTATACTAGCACTTCCTGCTCAATCTGTTTATAGGTCGGTTGCTGGACGGCATCTGCGTCTGTCGTCCACTGGTTATGCCAATGACAGCGCCATAGAAACGCGCCGGTTCGTAATGGCGTCTTCCCACAGTAGACTTCTTCCGCTTTAGGTTTGACTGCGCCTGTTCTGCCTGCCCGTTCATCAGGGCGAGATGCTCGTACGGTGCATGAGGACAGTTCCAGAAGCGTGACGGTCACCCGTTGGTTCACTGATTCAGTTTTCAGGAACATCGCTGACTCTCCGGATTAACTGGCGTAGACCCACTTTCTGCAACCGACGCAGCAAACTCACTAAGTCCGGATACAACCGGAATGTTGACTTGCTCTGCAGCAACGCGTTCACGTTGGGTCATACCACTGACCGACACGGTGGCTTTTGTTTATCCGCAGACACAGCGCAATCGACACCTCTGGTCGGTTACCCTCCGGTGGAAGGCCACGTCAGCGTGGTGCTCTGCTTTCATTCACGCAGGTGCTGGCAGGCGTCACGTCATCCGGTTGCCGCTGTTACCGTGCTGCGAGTGTCTGCCATCGACGTCCCACATTTATTGATACTTTCACATTTAGGGTGATCACTTCCTTCCGTGCGCCGAGATAGCCGAAGGCCAGGCGCTCACGAGACACGAAAAGGCAGCGAAGGATGCCGATGCTGGAACCGGTTTGCTCGGCATATCTCGCTTCCTGCCTGGCCGCCAGCGACGCCTGCTTCCTCGCTGCTCTCGCCTGCATCCACGCCAGCGTGAAGCCTGGTATCCCGGCAGATTTCCCTGCCCGGTCGCAGTGAGTCTGCATCTTCATCATCGAGATAGCTGTCGTTAGGGACTCAGCGTCAGTTCACGCCATGGTGAGTCAATGTATGTTGACTTTGCGCCAGACGCGACCAGTCAACGTCTGAAATGGATTCGCGTAAGGGTCACCGACTCGCGTAGCTAACCCACAGGGTGTCCAGCGGCACCTTTCACCGGCATTGTAGGATTTGGTACAGGCAGCGTCCTCACATTTCATAGGTAATGACATAAGTCAGATCGGCTGAACTCCACAAGCCCGCATCATCGTCTCCGCCGTAGTCAGGTCGCTGGTGGCCTACACTACTGGTACGTAAATCTGTACCCGTGTAAGGGATATCGCTCATCACGATAAATCCATGGGATTCCATCCACGCAATCCAGCTCTGAGATCCGGCACCTGAGCAGGCAGGACAAACTTCGATATGCCTCCCGCTGCCTAGGTTATATCGATGTCCAGCTCCTTCGCCCGTGTATTCAGCGCCGGTGAGATAAACGGCAACTGCCGCAAATCCGCCTCATCAAACAGCGGGGCGACCAATGATGATAAAAACGTTAGCCCAGTGTCATGCTGCTTTCTCCAGTGCATCCAGGTCCGCTGCACCGAGTTCAGTGTTCATCGCTTCTGCGCGCTCCTCGATTCCTTGCCTTCTGCCGAAAGAAGGCCACGTGCAGGGTCCCGAGCTCGCGACTGGTTTTGTTTAAACGGTTGGTCAGCGGCAGGCCATCGGGATTTTCACATCAATGGGTAACGTTTTTCCCATACACGCTGCATGACATGCCACCGGCCATTTTCAGTTGCTGAATAAACGCACCCGGGGAACCGACGGTTGGCCCACAAGCACTGCCGCCACCTTCAGGGATGAACGCTGCCCTTTTACGACGCCTGCGGCTAGAAGGGACAACCAGCGCATTACCCATAGTACTTTACGGCAAATCCCCCGGTTACTTTGATTCTCAGCGTTTGATTTTACGTGCTTTTCAGCCTGGCCTTTCCGTCAGTTTCCGGCGTACCTTGTCTCACGTCGCAATACTGTGACGCCGACTGCGATATCGCGGATGAAGCAACGCGGTTAATAGGCCATTGCGGCGGCAGGCACGCCGTTTGTCGATACGCTGAGGTTTTCAACGGCCTGCTCAATACTTTTATGGCCATACATCCCCCTTTCAGCGGGACGGTTAACGGCAGGCGGTACGCGTCCAAGCCAGATGACACTTCCGCTATCATCCGGCGAAACCCGATCTACCCAGAATTTTCCTCACGATGTAGTCAGCGTGTCTCCACGCAGCAGCTGCCGCACCTCATCAGTCCGGACAAACAGATGACGGCTGAGGCCTTCAACGCACGCCCTGTCCGGCATAGCCTGATATTTCATCAGGTCATCAAAAGGATAACACGAGAGCACCGCAGTAGAACGCTCACCGACGGATTGTGAGAGACCGCGTGTCTGCGTTTCTATCGCGCCTGGCGGGGATGGAGGGAGTGCGCAACCATGTTATCGCAAATCAGCCACTAGCCCGTTATTAGAGGTTGTCCATAGAGGGCGTCATTTCGGCTTGAGCCACACCAGGCGCAGACAGGAAGCCCGTTGCTAGGGCAGAGCACAAATGCACAATTGCTCAAGATTGAGTCAGGTCGATGGCGTGAAGCTTCACCAGTGCAGGCTCTCAGTTGACTCGATTTCATAACTGTACAAGAGTCG * tp:A:P cm:i:51 s1:i:542 s2:i:0 NM:i:969 ms:i:1860 AS:i:1860 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
99 91 0 utg000001l 40370 60 4727S28M1D10M2I5M2D17M1D8M1D8M3I11M2I11M2D1M1I17M3D12M1D7M1D2M3D8M2D6M5I9M1I7M2D11M1D3M1I12M1I6M1I5M2D5M2D9M1I13M1I10M4D12M1D29M1I5M1D10M1D5M5D5M1D9M2D3M1I2M1I15M5I5M1D5M4D7M1D2M2D11M3I15M3D8M1D8M2D18M5I15M1I8M3D20M3I2M2D6M1D3M1D5M5I5M2I3M1D5M1D14M1I1M1I3M3I10M1I3M1D2M4D7M1D2M2D14M5I5M1I30M1I7M1I1M2D8M4D19M1D7M4D11M1D32M2D4M1D5M1D2M3I5M1I11M4D20M1D6M3I3M1I3M2D11M2D7M3D3M2I8M1I6M2D3M1D6M1D4M1D2M1D7M1D5M1D3M1D9M3D2M2D2M1D15M3D1M1D10M1I11M3D12M1I3M1D7M3D1M4D10M2D8M2D5M1I4M1I3M4I5M1I6M3I4M1D17M1D6M3D13M1D5M2I10M1I1M1I8M1D13M1D4M3D5M1D6M2I7M1I8M2I3M2I3M8D13M1D5M1I12M1D14M2D6M1D15M2I1M1I1M3I6M1I9M2D6M3D1M1D7M2I13M1D19M2D8M1I7M1I2M1I1M4D7M1D1M3I1M1D6M1D8M3I4M4I12M1I7M2D6M2D5M1D4M1D7M1D3M1D2M1I7M2D4M2D21M1D5M2I12M1D4M1D24M1I3M2D3M1D11M2D4M4I7M1I12M2D13M1I13M1I5M1D12M1I7M1D3M1I3M1I3M3I8M1D8M1D9M2D8M3D1M2D4M5I2M3I10M3D3M1I2M1I9M2D4M1I7M1I16M2I4M2D5M2I3M1D13M3D15M2D2M2D9M1D16M1D8M1I11M2I15M1I16M2D2M1I35M1D6M2I1M1I9M4I18M1I2M1I16M4D8M1I1M2D4M4D1M1D16M2I23M2D5M3D3M1I1M2D14M3D5M1I2M2D4M3I4M2D10M1I5M2I7M2D44M1D12M1D3M1D20M1I12M2D12M1I27M2D12M1D6M1D4M1D2M1I21M1D8M1I25M1D4M2D9M1D6M1D10M1D1M2D10M1I3M3I1M4I2M1I5M2D8M1D5M2I14M1I10M1D3M1D3M1D4M1D6M1D1M2D1M1D11M2D2M1I2M2I3M1I3M1D15M1D7M2I2M3I1M1I3M4I11M2I3M1I7M2D2M2D14M2I8M2D3M1D2M3I4M1D3M1I1M1I20M1I5M1D3M1D2M1D1M1D1M1D5M2D14M1I1M2D4M1D3M1D24M2D9M2I3M1D7M1I10M2D2M1D31M2I3M1I3M3D4M2I7M1I5M2D8M1I6M2D5M2D26M1D5M3D6M1I2M1I8M1I5M1D1M2D9M1D8M1I3M2D1M1I2M3D10M1D11M1D5M3I6M1D11M2D12M1D8M2D14M5D3M1D4M1D10M1D2M1D31M2D2M1D14M3I13M2I4M1D1M2D5M3I3M1I1M1I6M2D8M2D9M1D3M3D9M3I9M2I6M1D11M2D3M1I21M3D4M1D3M1D4M2I7M1I4M2I3M2D3M1D4M2I28M1D14M2I1M4I5M1I6M4D5M1I13M2D6M4D3M1D7M1D1M1D34M2D15M3I1M2D11M1D6M3I6M1I2M1I18M2I5M1I16M2I4M1I10M4D7M3I3M1D21M1D3M1D10M1I5M2D10M1D4M1D10M2D5M2I8M1I3M1D9M1D14M1I23M1D6M1I5M2D1M1D1M1D2M1I9M1D1M1D11M1I3M1D6M1I3M1D5M1D10M1D5M2I6M4D2M3I1M1I5M1I6M1I4M1D12M7D2M1D9M3I5M4D8M1D1M2D34M2D10M1D2M1I3M3I2M1D1M1D5M2I4M4D10M3I5M2I7M9I20M1I3M2D9M2I3M1D2M4D2M2D6M3D10M1D12M1D6M1D7M2I2M1D15M3I35M2I1M3D8M2D5M1D15M2D16M1D22M1I1M1I7M2I23M2D5M1D5M1I1M1I8M1I4M1I11M2I13M2I21M4D3M2D6M2I12M2I1M1I3M1I10M1D10M1D1M1D7M1I8M1D24M1D12M1I12M2D17M1I19M4I2M13I2M5I4M2I2M1D8M1D12M1I5M2D7M2I8M2D5M6D1M1D2M1D6M1D4M14D13M1I11M1D4M4I3M1D1M1D4M2D5M3I12M2D10M1I16M2D9M1I1M1I5M2I33M1I21M1D35M1I6M1D2M1D2M1D11M2I14M3D37M4D16M3D12M2I33M1D8M1I15M1I10M1I3M2D18M1I7M6D8M2I7M2D7M1I3M1I10M1D5M1D7M2D3M3I16M1I2M1D5M1D7M3D4M1D4M1I44M1D1M1D9M1I5M2D7M6D15M4D3M2D6M2D10M1D8M2D2M1D6M1D6M3I12M7D5M1D2M1D3M1D10M2D3M2D3M1D5M1D13M1D1M1D10M1I4M2D7M3D22M6I35M4D7M4D13M1D4M1D19M1D2M1D5M2I9M1I11M1I26M1D5M4I7M1D2M1D5M2D3M6D9M3I6M2D17M2D8M1D4M1D6M1I8M1D1M1D10M1D17M1D5M1D22M4I10M1D14M2I5M3D33M2D9M2I3M1D4M2I2M1I44M1I9M1D7M2D5M1D9M6D5M2D7M1D5M1D18M1I2M1D7M1D4M1I2M1D1M3I5M1D3M1D3M2D5M1D3M1D3M3D18M1D41M2I2M1D8M2D16M1D7M1I2M2D2M5I17M2D4M1D16M4I3M2I1M1I1M2I8M5I2M1D4M3D1M1I22M3D1M9D4M4D2M2D4M2I2M2D13M1I8M1D6M2I9M2D3M1D6M1D4M1D12M1I11M2D22M1I12M1I1M1I7M1I2M1I3M5I1M3I11M1D1M1D2M3D4M2D6M1D1M2I5M1D74M1D3M1D18M2D7M1D9M1I10M1D4M2D8M1I5M1I32M9D1M1D9M1I2M2I4M2I2M2I6M3I8M2D6M1D34M2D11M2I16M1D3M1D6M3D9M3D7M2I38M2D4M4I6M3D5M1D5M4D22M1D12M1D4M3D17M2D25M1D6M1I9M3I6M1I14M1I8M1D3M1I7M1D8M1D6M1D2M1I5M1I7M1I3M1I17M3D4M1I1M7I14M1D13M2I1M1I4M1I1M1I7M2I2M1D4M1D20M1D6M2D1M2D8M1D7M1D3M4D16M2I23M1I19M2I11M1D12M1I4M1I18M1I14M2D8M2I6M1I7M4I2M1I5M1D4M3D3M1D2M1D11M1D10M1D4M2D11M4D2M1D7M4I7M1I7M1I6M2D4M1I12M2D16M1D9M1D6M3I1M1I7M1D5M1I34M1I16M1I15M2I6M30S * 0 0 CAGTGCTTGGGTCTACCGCCGTCGCATCTTTATCGCACAGGAATTCCTCCTGTGCCGACAGCTGGCGACGTTGCCGCCTCCTCCAGTACCGCGACTGACTCTCCGCCTTCCACAAATCCCGGCGCTGCCTGATTTGCCATTTGCTCCGGCATGCTTCTCCAGCGTCCGATGCGCCTGAAGGCGTGCAGGGCAGCATGAGCACTGTCTTCCTGACGATCGCCCGCAAGACATCTTCACACGCTGGACTGTTTCGGCTTTTTCGCCGTGCTTCATAATCCTTTTCGCCTCATCACCGTGTTGTAATCCTCATGCACCAATTTCCCTTTTCCTTCCTCTTTCGCGTTTCTTCCTGACCTCTGCGTATTTTCTCCATAAGGGGTGCAGCAGGGTCGGCCACCCTGCCTGCGCTGCGATATTTCAGCCGTACGTTCGGTATCGCTCTGCTGCTTGGCATTTGTCCTGTTGAGTCTGCTGTTCAGCCTTCTTTCGGGCGGCTTCTAAGCGCAAGACGGGCCTTTCACGATCATCCCAGTAACGCGCCCGCTTCATGATTCCAAATAATCATCCTTGGCAGATTCCAGATGTCGTCTGCTTGGTAACCTCGCAGCCTCTGCTTAATCAGCATCTCCTGCTAGGTATCAGGACTAAGTACAGGAGCACCGCATCCCACATGGATTTGAATGCCGCGCATTTAGCCCAGTCTCCATGCACGTGCCCATGTCTCTTTCAGGCGGCGGGTCTGTAGTCATCAAACCCTTTTCGTGCCTCCTCGTTTGCTCGCTTGCAATGCCCCGGCTTCATCGCCGGAACGCTGCACTGAGCAACATCACGCAATGACCTATAGGACTGGCTCAGCCATCGCCGTCAGCCCCGACGTCGGGTGTGGTCAGCTTCCGAAGGCTTTCAGCGACCTTATTCCTACCTCCGCCTGCCCTAGGGACTCCGCGAGATTCGACGGGATGGACGCAATGAGCGCCAAGCCCCGCCTTAACCAGTGCGCTGAGTACTCGCTGGTCTGGTTAAACGTCAGCCCTGCCGCCTGCCCGGCTCTGGACGACCAGCATCACGATCTGCCGTCAGTCTAGCACGCATGTTAGGAAAGACCAGGGCTCCGTTGTTGAATGGACAGGTAGATCAGTTGCGATAGCTGATACCAGGCATACGCCATAGGCGCAGCGGTCGCCACCGCCATAGGCTAGCCCACCATCAACCGGATCGCAAGGGCAAGCCCCTGAACATGGGATCATCCGCCGACAGGAGTCCTTCACCCCTGTTGCAGCAGGATGACGCCACGGACTTGCCCGCCTGCAAGCTGCGTGGCCACGTCGGTAGAAACTTTGAGCAGCGACTAAGCCGGCTTTATACTGCCCGACGGAAATCCCCGCTTTCTGTGCAGCCATGCCTGTCGGCTCAGCGACTGTTTCACGACTTCACTGTTTTTCACCCATCTTTCTCGTACCCCAAAATGACGGTACTCTGGCCATCTGCTCGTCAAATCTGGCCGCATCCAGACTCAAATCAACGACCAGATTGCTACCGAGCGTTGATAAATAGACTCCTCCCTTAGAATCGCGTGGGTAGATCAGCGCGGCCGTACTAAGCGTCGTTACTATCACACGGGAATAGGGGATAACTTCAATTCCGTTAAGTAAGGTACAAACTAGACAGGCAAGCCTGCCCGCTTTCTGCATCAGCACATCATCTTCAGCTGTCGTTCACTCGCGCCGGTTCAGCAGACTGAATGCATGAGCACAGATGCAGGACTGCAGAGAAAAATCATAGTGAGCTCGACCCTTACCGTCAGCCCGGAAGTGCATATCCAGCAGAACATCATGAAATAATGGGTACTGTAAAGCGGTGCCAGTCGGCATACTCCGTGATGACATCCCGGCAAGCTTAAGCACGCCAGTCGGGTCTCCACATCTCACGCTCAGTTTCAGGGCACTCAGCTCACCGTCGAACACTTTCCCGCAAGAAACAGGCTCTGCGGGCCGCTAGTCCTCTGTCTGTTCAGGGCATTATTCACCACAAACTCATACATACCAGACAGCCGGTCACAACCACGTTCACGCATGAGAATTGCCTCCGTGGCCAGGTGGTAAGCACTTCCTGCTCAATCTGTTTAACGTTCATTCATGGACGGCATCTGCGTCTTCTTGCCTGGGTGGCGCCGCGACTTCCGAGGAGGCAACGCACGGTTGATGGCGTCTTCCACAGTAAACTTCCGGTTGGTGTCTGACTCCGCCTGTTCTCCCGTTGCCGTTTTATTCAGTTCGTTCAATCCCGCTCGATTACTCAGAAGCGACGTGATACACGTTATGTTCACAACCGACTTCGGTTCATAGAACATTAGTACTCTCCGGATTAACCCGGTACGGTAATTTCTGCAACCGCAGCAAACTCACCATTACCGATACAAACGACCGGAATGTTATCTTGCCTGCAGCAACGCTTTCTACGGTATGGTCATCACTAATGACCGACACGGTGGCTTTGTTTATCGCAAGACAAGCACGAAAGCTCCCTCTTTAGTTACGCCTCCGAGCTGAAGCCACGGTCAGCGTGGTGCTCTGCCTTTCACCACCGAGGTGAGCATGAGGATCTAGTCATCGCATGTATGCTTTACCGTGCTGCGATCTTCTGCCAACGACGTCCCACATTGGTACTTTTCTAGGTTAATATTCCTTCGGTCACGTCGCCTTACCGATACTGCTGACTCAGCCACAACGAACGAACATTGAATGTCGGAGGGAGTCGCACCGATGGCATCCTATTCGCTGTAATGACGCCAGCAGCGCCTGCTGCCCCTGCTCTCCGGGCATCACGGGTCGGCGACCTGGTATCTCCGGCAGATTTCTGCGCGCGCCGTAGCATTCTCCGTCTGCATCTTCATCATGAGATAGCTGTCGTCATAGACTCAGCGTCAGTTCACGGGCGTCAGGTCTTTATTTTGCCGACGCGACCAGTCAACGTCTGAAGGCCAATTGCTAATGTATAGATCGCTCCCTTATAAACCCACAGGTGTCCCGGCACCTTTCAGCCGGCATGTGTGGGATTTGGTACAGGCAGCGTCTCACATTTCATAGATGACATAAGTCAGATCGGCTGAACTCCAAGCCGCATCATCGTCTCCGCCGTAGTCAGCTCATCTAGCTCATACTGGTGATCAAATCTGACATGTGCCGGATATCGCTCATCACCGATAAATCCGGGATTCCATCCACGCATCCAGGCGGAAGCACCTGAGCAGGAAAACTTCGATATGCAGCTCCGCCGAGAGCCGAGTTGAGGTGCCGTGTATTCCTCGCCGGTGAGATAAACGGCAACTGCCCAAAATCGCCTGATACACTCGCGGGGATAGGCCACACTCCTTCTACGCTGTGTTGAGTGCTTCTCCAGTGCATCCAGTACTATGCAACCGACAGTTCAGTATGTTTCATCGCTTTATTACCATTACTCTCAGTTGATGCTGCAGCATAGCCCAGCTCTTTCGGAAGACGTTCACGCTGTATCCGCTCAATATTTTGTTAACGCCGTGGTCAGCACTCAGCGACCCATTTCACACATCAATCTAACGGTTTTTCCTCAGCCACTGCTGCATAATCATAATCCTATTTCAGTTGGAATAAACGCATGGTGAATTAAAGACCGACGTTATCACGCCGCCTCACTCATGCCCTTTCAGGGCCGAACCTGCTGCCCTTTACGACGCCTGCTATAGCGAAAGACGACAACCGACAGTGACGAGCGTATTACGCTGAAAGTTCCCGGTTATTTGAATTCTGCTCTGCCTATTTTGACGTGTAGTGGCCAGCTCCGTCTTCCGTGGCCCAGATCCGGGGCCCTTACGGGCAACCTTGACGCCGTAGAACCGCGACTCTAGGATGAAGCAACGCGGTTATATCATTGCGGCAGCACCGGCGCCGTTTTGCTGATACCCAGGCCTTTCAACGGCCTGCTCAATACTTTTATCATACTCCCTTTCCTCGAGCATACCGTCTGACTCAGCAGGTCACGCCCCGTCCAGACATAATCATAAGACGGATGACAACTTCCGCCAATCACCGTGAACCCGATGCGTACCCCAAATTTCTCACCTGATGGTCACTCGTCTCCACGCCGCAGCTGCAGCTATCAGTCCGGACAAACATGAACGAGCTCTTCAACGCGCACGCCTTAATGATAGTATTTTCAGGTCAGTCAAACATCACGTATCACCGCATAGTGTAACCTCACCGGATGTAATGGTGTATAGTGACGTTCCCATGTACCCGCGTATCGTTTCCATCTACGGGCATGGCAGCATCGAACAGGTTATCCAAATCAGCCACCTCTCCCGTTATTGCATTGGCCTAAGCGCTGGTCAGTCTCGGCTGCCACACAGCGGCAGAGACACGAAACGCCGTTCCCGACCAGCACAAATGCCACAGGTTCATCCGCCTGTGAACAGGTCGCATCAGTGATGCAGCTTCACCAGTGCCACACGACCGTGACCAGTTCGACGTATCCAGAATCTACGGTATTATCTGCTGATCCTTGTAGGTTCCATCATTCAGGGCCGGAGTTCGACACTTTCAACTGTCCTGCCCGCCTTTCCCCTCCTTAGTCATGGCATTTCTCAGTCACTCTTTCAGCTCTGCCACGCTACCTCAGTTCTTCTTTCGTCCCCGTTGAGCTGACATCACGTTTAGTTGTTCACGGCCGGCCCTATCTTGAGACGGTGGCATGTTCATCTTTCGTCATGACTCCTCCACAAGAAACAATGTAGCACCCATGATTACGCCAGTTGACGACACGACTCATCACTGGTTACTCAGCAAGGCATCAGCGGTTAGACTGAATCATGGTAAATCACGCGCTGTACGCCGGTGTCAGTTTTTGGTAACCTGCGGGGCAGTGGTAGTCACTCTTCGCTATGTCGTGCCGCATCCTGAATGCATACTAGCCATTAGCACCGAATGCGCTGAGTAGTTCCACGGAGCACCGGAGGCTTACAGCAGAAGTTCTTTTGACGCCGTTTTCCACGTACCTGTCGGAATACTAGACGGTACCTCACATCATCCTATGAGTGACACTGCTATCACCTTCTAAGTCTTTCACGTCTCCACTGAATTAGAGCCACTACGACTTATCCAGCTTCCTTGACTCGTTTAATGAATAGAACGACAGCGCCTCCTTTCGGATCGAACACGTATGATATTCCTCACCACTCTCGTTCCTCTCGGTGCTTCGTATGTTCTCTTCGTCGTAACCGTGACTTTAAGCCTTGCTCCACTCCGTTACGCTGGCATGATCTGGTTTATTCTCTCTGCGACCCCTCTCTGTTATACCTCAAACCGGATCTAAAGGCTTCACCGGTCATGTGTATCTTGTTTGATCACGACCAAACTGCCTGCATCTTCCCACCCAGTAGCAAGCCTTCGTCACGCAGGGTCTGCATGATGATGCGACGGCGTAAGTGATAGGTCCGGATAGATTCTTCAATCTTCATCCGGCATGAGGACGCAAGGTTATCTTAGATTCATTCATGCTTCGGCTTGTGACATATCCCGGCGTAAATTCAGCTATCATCGCCACGGAACGATATCTCACCGACTCGTGAAACGTACCTCATGTTTACCGGTCCCGGAATTTGTAGATAGACTTTCTCGTGTGAAGGGCAGGTAGTAGCGCAGCAAACAGCAGAATACTACCGTACGTACATTTTCTTATGCTATTTGCCTCACTCAGTTGGCGGTTGTACATCGACATAAAATCCCCGTAAAAGCTCAACATAGGCATCGTCATGACTGTAAATATAGTTAAACTACATTATGAATTGCCGTCCTCCTGGATTCCTTTCTTTCCTTCCTCTGCATACTCCCTCCGCCCAAGCACATCCATAACGAACTCGTTGGACTTTCACGTCTACCGTCTAGCCGGGTGGGTCAGCAGCAACCAGGCAGAATGCCAACGGCAGCACCCTTCCTTATGATGCACGCAAACCAGCTTCTATGGAGGTGTCCAGCATCATAAGCTGTATATTGCATCTAGGTGCTTTGCAGCTCAATCACGGGCCAGTTCGGTATGAGCCGGTACTTATTTCCGTAGGGTAATGGTACTGGTTTCTTTATGGTCATAAACATCCCTTTACTGTGTGTTCTATAAATCGTTAACGGCATCATAATGCCGGGTTATGCAGCCGGCCTTGCTTACGCCTGCATCACGAGCCGGTGCACCCACTGTCTGCCTCGTGCATCTGGTGCTGTGTGATAGAAGCGCGTGAGCTTACGTTTTCACGTTATACCGGGGTTTCTTCAGCACGGGGTCATAATTTCAACGCGTTAGTGCTCTCTCCACAGTTTACGATCCCCATAATTAAGCTGTTTTCTGCCCGGCAAATTGCCTCGTATTGGCGTTCACGGGCTTCGCTCATCCGTTCTCTCCGTCCTTAATACACGTCAGTAACGTCAGCCCTGCGAAGCAGTGTGGCTGAAACAGTTAGTTGATAGAGTCTCTTGTAGATTCTCCGCCTACGGGGACGGATTCCTTTCATCCGTGCATGACTACTAAGGACGTGGGGTACTCACCTTGCTGTTGGTATAACAAGTTCATCATGAGTCCGGCATGATCGCTCCTGACCGCTGTACAATGCACTCTGGGTATCCAGCACAACCTGCGACTAACGGTATATGCCTACTTCTAGCAAACATTATCTAGGGTTGCGTCCCATCCGGGACTGCATGTCTCCGAGACGTCATCCGGGACATCTATGTAGGGTTGCTATTAGCTTATCGCTTAGCTGTAAATCCGTGATTTCCACCCTGTTTCTCCAGCAGCACCGTAATTTACTGTGAGCCATCATGACGCCGATGGCTGGGTCGGGCGTCTGCGTCAAGAACTCGGGGAGGCGGCACTGGCAGCAACCGTACCTGGACTGCAGTTCTATGTCGTTTTAAGCTAATACCGGTTTTATTTAAGCACCGCTATACTATCCAGGTACTTTAGCAAGTCAAATGCCCCTCATCCACCACTGCCGTGTCCTATATCTAATAAATCAGTCCACCATCGACCCCGCAGCCAGGCGAGGTAGGAGGCAGAACGCGTAGTAAGCCGGTCAACTCGAGCTCCGGGGCAGCGCGTTCCATTTCCTCCCCGCGCGTGCGCAGGGCCCCGGCGACAAGGCATCCGAATTCGAGCCAGCTACCTTACCAGATAAATGCGTGCTTGAGGGGCTATCATCACCGGATAATGCCAGAGCGGTGCGCGAGTGCCTCCTGGGCAGTCAGGCTTCACCGACGACCCGCATCAGTCAGGCTGCATCCCAAGCCGGCCTGCAAAGGCACAAAGAAACTACCGAGGCGGCGCAGGTTCAAGGCATCCCGGCTCATTAAAGCCATGCTGGCAATATGCGGAGATTACGCAGCTTAGTGCTATTCGCTCCCTGTTGATTTGTCGCAGCCCGGATCAAATGCATGCCTCGAGGCGGGCGGTTGCGACCGGCTGCACGGAGGGGCTCATCGTTTCACGACCTGCTGGGCAAAATTTCGATAGTCGTCACCGTTGCACTCTTCTCGTAGATGAGTCCGGCTTCTATCAGCATCACCGCTTCCAATTCTTTCAGACCATCGAGCCGGCCAAACGAAGCTGGGAATCCAGGAGTGCAGAAGTTCCCAGGCAGCGGCTTCCGAAGGAAGCGCGGCCCCTTGAAGGTAACGTCAGAAGCGAACGAGCCTTCTTCCAGCCAGCACAGAAGCGCTCCCTACGCCGTTTCTACGGCATCCATTCCGCCGAGGGACCGGGCCCACGACTCGTTCGCACTGGCCGTGCCGTGGAGGCTATGGCGCTCATTCTTGGATTCCGGGGGAAGCTGCTCACGAGACAGCCGAGCAGGATATACCGCAGCAGTGACTGCTCAAACACGGAGCCCGTTATCCGTATCGGACAGCCGTCTGCAGTTCAGTGAGTCAGCGGAGGCATCAGGTGCGGTACTTTGTGCGCTCCCCAGCCGGACCGGCATGCAGTAGGGGCGTAAGCGATTTATCCACCAATCCAGCCGGTCAGCCTTTCCGCTGCTCCTGACCTGTTCGCCCAGAATAAATCAGCCGTAACCGTATGCCCAGCTCACCTCAATGGTGGCGCATACATCGCCTTACAATGGCGCTCTGCAGCTGCGTGTTCTGCAGCGTGTCGAGGCATCTTCACTCTGCTCCATCTAAGTGTAAACACAGTGCACGCGAGTCTGCCGTCGGCGCGACTTACCCAAAACGAAGAATGAAACGAGGAGGCGCGCCAAGCCGGGGGTCAGATTCACGGTTCAGGTACAGCGCGGCAACGCGTCCGCCAAGTAGTAATACCCAGCGCCGACGAGCAATTGCTTCATGCCTCCGGGTCGGCCGCCCACCCGCCGCTTTCGCAGCGTGCCCCGGTATTGTTCGGGTTGCTGGATGGCCATTCGGCTGAGACCAACTGTCGGAAAAGCCGCGACGAACTGGCTCCCAGCCTGAACCCGACAGTTCACCGTTAAATTAGGAGTGCATGGCCACACCTTCCGAAGCATCATGGGCTCGTGCGTTGGGGCCAACGTCAATGCAGCAGCAGTCATCCTCGGCAACTCTTTCCATGCCGCTTCAAGCGCGGGAAAGGGCACGGGCTTCTTCCTCCCGGTGGGATAAGCCACGCCAGCTTGGAGGATCAACGGCCCCGGGAAAAAGACCCGACGATATAATCCTGATGCAGCTGGATTGAGGCGGCAGAGCGTTATTGCGATCACAGAAGCGGGGTCGCGGAAGTGCCCGGTAAAGAGAGGGCAAAGAGGGCTGCATCAAGTCTCACTCGTGGGTTCCACGAACCGCAACTGCCCCAAATCCGCTGCCACCGCCGTGATAACCGGCATATTGCCGCAGCGTGCTATTAAGTCCGTAGGATGAATCTGCCGTCCGTCAGACAGGGGCGAAATCGGGCGTGAGTGCGTACAGATCGCTCCTGCGCGCTTCTGCACTTCCCGACTCTGCAATATTTTCAGGTCAGACACGAGTGGAATTATTCAACTCCATTCGTCCGTCTTTCTGTACTGTTGCCACCGTTTACCGTCGTCATCACAGGTCATGCAGTGCCGCACGGGCAGCGGCAAGTTCTTCCTGTCTAGTCATTCATCTCCCTCCATAAGGCACGGCGTAATACTGCCAGTGATGTTCTTGTTGTTGCTGCACCATCCTTCCTGCAGGCTCAGCAGCGCAAGGCGATCCAGCTGCCAGGGGAAATACTGATGCGCAGCGCCGCCGCATAAACGAAGGGCAGTCGAGTGCCTCATTGCGTCGCTTTGCTGTCCACAGTACTTTTCCCTCCATCCAGAAGAGTGTGCGGACGCTCTTCAGCAGAGTCCGCCTGCTGCGGTCAGATTACAAAATACGGGTTATTTCGGGAAGTGAACGCACCGGAAGCGTCATGCTCCCCTTCAGGCGTCATGTTGAAGCGGTTATAATCGCTCTGTTCGCGGTATCCGTACCGATTTCGGTAAGGTAAAACCCGTTTTTATTCGCTTACGTGGCATGCTGAGGATTTTCCGTAGACGATCCCGTAATGGGGATGACAGGGACACCGCTGTTGGGGCGCCTCGTTGCTACAGATGCGCGTAATGCGCCAGTATGCAGCAGATACGGATATCGACATTTCTGCACCATTCCGGCGGTATAGTTTTATTGATGGCCTCATCCACACGCATGCAGCAGCGTCTGTTCATATCGTCGTGGCGGCCCATAATAATCAGTCAATCAGCCAGCTTTCCTCACCCGGCCCCCATCCCCATACGCGCATTTCGTAGCGGTCCAGCTTAGGAGTCGATACCGGCGGTCAGGTAAGCCACACGAGAGTCAGGAACGGGCTGAATAATCCTCTTTCCGCTGCCATCACTTCAGCATGGACTATCCCAAGTTCGCGGTCCCACGAGTCGCCACGAAGGGGTGATTACGAAGGTTTACGTTTTCCGAGTATCCCTTTCGCTAGTTTGCTCCAGTGTTGACAATCTGCACCGAGGTGAACGGGCTGTACGCTGTCCAGATGTGAAAGGTCACTGTCAGGTGGCTCAATCATCCTCTTCACCGATGACGAAAACCAGAATCTGCCATCACGGGTCCAGATCCCGGTCTTCGCAGATAACGGCATCAGTAAGTCGAGCTCCGCTGGGGATGACGCAGGCAGTGTAGCCGCAGAGTAAAGCAGAATCTGGAGCGTGCGCGGCTTTAGGGACGGCGTCTCTTTGTGCCCCAAATTTAAGATACTGCTCCCTCCCGCAATGCGGGCAGGCAGCACATGAAAGCATAAAATGCGGGGATTCACTGAGCCAACCGGCTCAATCTGACAGGTGCCTCATTTGGCGTGGAGCCACCTAAGGACCTAGATGACTTTACTCTCAAGCCGATATCAGGACCCTTGTTCTCCAGGATTTCCCAATCAGGTCCAAAAGCAGCAAGAATCATCATACCCGCCACATCCACCGACTTTCACGGTAGTTTGCCGCTTTACCCGCCCAGGCACCAGAAGCCACGCCCATTAGTGAAACGCTTCATGGTGAGCGTGTTGGTGCTCAGATAGAAATCCTGTTGCCAACAGGCCCTCAAGAGGGCTACGAATATCACGAATAGTCGGCTCAACGTGGGTTTTCATAAAGTTCTCGGCATCACCATCCGTCGGCAACCAGATAAGGGTTGCTATGCTTATGCTCTAAAGTAGCATAAACACCCCAGCAGCATTTGGAATAACCTGACACGGGCAGACTTCACCAAGTCCTCATCACGGATGTTCCATCCGATCTCGAAGGAGGTGCTGCTCGCTAACCGGACGGGGGTTTCCCAGCGCCCTTCCTGGTATGCGGATTCTTTCGGGAGATAGTAATTATAGCATCCGCCCATTCAACGCGGTTTGGCTCCAGGAACAGGCTTACGAAGCCCGGCGCGGACAAATGCCGCAGCCTGTTAATGACGGTATGTTCGATATTTCACTAGCAACCCCGGTATCAGTTCATCAGGGCGGCTGCTTGTTCATGGCTTTGATGATATCTAGTTTCAGGAAATCAACATGTCGTTTTCTGAGTTCCGGGAAAACGCCTGCACCGACAGGGAGCCCGTCGAGATACCGGCATTGCCCGCGATTGAGAAGAGCACGAAAAGTACAGAATTGCGGTTTCCACCACTTCGGATGTCTTATCTCTGGCATTCTTCAGTTCCTGTGCGTCCTGAATCGTGCGCACGCGTAAGTCGACCCGTTCGTACTCAATAGTTCCTGGCTCGATTCTGCTCGCTGGCCTGCCGCAGTTCTTCAAAGCCTCCGAGCGCAGCTTTTCGTTCTCAATTTCAGCATCCTTTGGGCATACCATTTTATGACGGGGCAGAGGTCAGCACATCACCTCATTACCCTTGCCACCGCCTCCCGACGGGCAATTCTCAGTTTCCTGCGTTTCCTCCTTCGAATGGTACGGATACTCGCACGAAAATGTCAGCCAGCCGTGTTGTACTCCATTGAATATTCATTCGCACGGACAAAACAGAAGGAAACGACAGAGGCCAAAGCCGCTTTCAGCAGCATGTCGTTCCTTTTGCGTCTCAGAGGGTATTTTGTAAAATAAAAACATTAAGTTATGACGAAGACAGAACGGAAACGCCTTAAACCGGAAAATTTTCATAAATAGAGCGACCGCGAGGTCCGCCATTTCTCGTCC * tp:A:P cm:i:72 s1:i:544 s2:i:0 zd:i:2 NM:i:2099 ms:i:2628 AS:i:2628 nn:i:0 SA:Z:utg000001l,35452,+,19S2929M96D8747S,60,664;
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
100 91 2048 utg000001l 35452 60 19H14M2D4M1D18M6D1M1D596M3I28M1D7M4D1M1D8M1D8M4I2M2I5M1D3M1D19M2I18M1D3M2I10M1I2M1D16M2D19M1D12M1I5M1D12M1I4M2D6M1D25M2D12M2D8M1I12M1I4M1I5M2D4M3D3M3I2M2D4M1I11M1D3M1I12M2D4M6D32M1D8M1D2M3D1M1D11M1I2M3I2M2D14M1I5M1D2M1D7M1I17M3I5M3D1M1D10M1D2M1I3M5I2M1D6M1D3M1D6M3I10M5I19M2I2M1D12M1D4M1D5M2D5M2I15M4D15M1D16M1D3M1D7M1I3M1D3M1D6M5D20M1I5M1I11M3D10M1D15M1I1M1I7M1D1M1D5M1I1M1I5M1D5M3D7M1D33M1D33M1I1M1I7M1D6M2D5M1I17M1D2M1D19M1D11M4D31M2I1M1D8M5D3M2I10M1I6M1I5M4D1M1D5M1D3M1D5M3D11M2I5M2D5M3I4M2D5M2I13M1I5M4I20M5D6M1D5M2D12M1D6M1I10M1D5M2D3M5D25M1D6M1I5M2D5M1I9M2I7M1I1M2I2M1D5M3I5M1D2M1I6M1I6M3D2M2D61M1I3M1D20M1I33M1I10M3D29M1I2M1I9M2I6M4D2M2I16M1D42M1I2M1I6M2D4M1I7M1D19M1D1M2I29M2D28M1I17M2D6M1D3M1I2M3I5M1D5M2D11M2D45M2I10M1I4M2I2M3D1M2D8M3D10M3D7M1I1M1I5M3D1M1I13M1I2M1I3M1I5M3D4M1I11M1D5M2I8M2D5M1D11M4D27M1D6M4I15M2D5M3D9M1D5M1I5M1D8M1I11M2I12M1D5M1D3M1I5M1D12M3I1M1I10M3D10M1D4M4I2M1D3M1D18M3I10M2D4M2I3M1D3M1I1M2D5M1I10M5D1M1D12M1D1M1D2M1D1M1D14M5D12M1D5M1D2M1D9M1D7M3I3M2I1M1I7M2I19M2I5M2I7M2D3M4D4M2D7M4D4M1I2M2I12M1I27M1I5M2I10M1D3M2I7M3D4M1D24M1D14M1I19M1D12M1D3M1D16M3D21M8747H * 0 0 CGTCGCATCTTTATCGCACAGGAATTCCTCCTGTGCCGACAGCTGGCGACGTTGCCGCCTCCTCCAGTACCGCGACTGACTCTCCGCCTTCCACAAATCCCGGCGCTGCCTGATTTGCCATTTGCTCCGGCATGCTTCTCCAGCGTCCGATGCGCCTGAAGGCGTGCAGGGCAGCATGAGCACTGTCTTCCTGACGATCGCCCGCAAGACATCTTCACACGCTGGACTGTTTCGGCTTTTTCGCCGTGCTTCATAATCCTTTTCGCCTCATCACCGTGTTGTAATCCTCATGCACCAATTTCCCTTTTCCTTCCTCTTTCGCGTTTCTTCCTGACCTCTGCGTATTTTCTCCATAAGGGGTGCAGCAGGGTCGGCCACCCTGCCTGCGCTGCGATATTTCAGCCGTACGTTCGGTATCGCTCTGCTGCTTGGCATTTGTCCTGTTGAGTCTGCTGTTCAGCCTTCTTTCGGGCGGCTTCTAAGCGCAAGACGGGCCTTTCACGATCATCCCAGTAACGCGCCCGCTTCATGATTCCAAATAATCATCCTTGGCAGATTCCAGATGTCGTCTGCTTGGTAACCTCGCAGCCTCTGCTTAATCAGCATCTCCTGCTAGGTATCAGGACTAAGTACAGGAGCACCGCATCCCACATGGATTTGAATGCCGCGCATTTAGCCCAGTCTCCATGCACGTGCCCATGTCTCTTTCAGGCGGCGGGTCTGTAGTCATCAAACCCTTTTCGTGCCTCCTCGTTTGCTCGCTTGCAATGCCCCGGCTTCATCGCCGGAACGCTGCACTGAGCAACATCACGCAATGACCTATAGGACTGGCTCAGCCATCGCCGTCAGCCCCGACGTCGGGTGTGGTCAGCTTCCGAAGGCTTTCAGCGACCTTATTCCTACCTCCGCCTGCCCTAGGGACTCCGCGAGATTCGACGGGATGGACGCAATGAGCGCCAAGCCCCGCCTTAACCAGTGCGCTGAGTACTCGCTGGTCTGGTTAAACGTCAGCCCTGCCGCCTGCCCGGCTCTGGACGACCAGCATCACGATCTGCCGTCAGTCTAGCACGCATGTTAGGAAAGACCAGGGCTCCGTTGTTGAATGGACAGGTAGATCAGTTGCGATAGCTGATACCAGGCATACGCCATAGGCGCAGCGGTCGCCACCGCCATAGGCTAGCCCACCATCAACCGGATCGCAAGGGCAAGCCCCTGAACATGGGATCATCCGCCGACAGGAGTCCTTCACCCCTGTTGCAGCAGGATGACGCCACGGACTTGCCCGCCTGCAAGCTGCGTGGCCACGTCGGTAGAAACTTTGAGCAGCGACTAAGCCGGCTTTATACTGCCCGACGGAAATCCCCGCTTTCTGTGCAGCCATGCCTGTCGGCTCAGCGACTGTTTCACGACTTCACTGTTTTTCACCCATCTTTCTCGTACCCCAAAATGACGGTACTCTGGCCATCTGCTCGTCAAATCTGGCCGCATCCAGACTCAAATCAACGACCAGATTGCTACCGAGCGTTGATAAATAGACTCCTCCCTTAGAATCGCGTGGGTAGATCAGCGCGGCCGTACTAAGCGTCGTTACTATCACACGGGAATAGGGGATAACTTCAATTCCGTTAAGTAAGGTACAAACTAGACAGGCAAGCCTGCCCGCTTTCTGCATCAGCACATCATCTTCAGCTGTCGTTCACTCGCGCCGGTTCAGCAGACTGAATGCATGAGCACAGATGCAGGACTGCAGAGAAAAATCATAGTGAGCTCGACCCTTACCGTCAGCCCGGAAGTGCATATCCAGCAGAACATCATGAAATAATGGGTACTGTAAAGCGGTGCCAGTCGGCATACTCCGTGATGACATCCCGGCAAGCTTAAGCACGCCAGTCGGGTCTCCACATCTCACGCTCAGTTTCAGGGCACTCAGCTCACCGTCGAACACTTTCCCGCAAGAAACAGGCTCTGCGGGCCGCTAGTCCTCTGTCTGTTCAGGGCATTATTCACCACAAACTCATACATACCAGACAGCCGGTCACAACCACGTTCACGCATGAGAATTGCCTCCGTGGCCAGGTGGTAAGCACTTCCTGCTCAATCTGTTTAACGTTCATTCATGGACGGCATCTGCGTCTTCTTGCCTGGGTGGCGCCGCGACTTCCGAGGAGGCAACGCACGGTTGATGGCGTCTTCCACAGTAAACTTCCGGTTGGTGTCTGACTCCGCCTGTTCTCCCGTTGCCGTTTTATTCAGTTCGTTCAATCCCGCTCGATTACTCAGAAGCGACGTGATACACGTTATGTTCACAACCGACTTCGGTTCATAGAACATTAGTACTCTCCGGATTAACCCGGTACGGTAATTTCTGCAACCGCAGCAAACTCACCATTACCGATACAAACGACCGGAATGTTATCTTGCCTGCAGCAACGCTTTCTACGGTATGGTCATCACTAATGACCGACACGGTGGCTTTGTTTATCGCAAGACAAGCACGAAAGCTCCCTCTTTAGTTACGCCTCCGAGCTGAAGCCACGGTCAGCGTGGTGCTCTGCCTTTCACCACCGAGGTGAGCATGAGGATCTAGTCATCGCATGTATGCTTTACCGTGCTGCGATCTTCTGCCAACGACGTCCCACATTGGTACTTTTCTAGGTTAATATTCCTTCGGTCACGTCGCCTTACCGATACTGCTGACTCAGCCACAACGAACGAACATTGAATGTCGGAGGGAGTCGCACCGATGGCATCCTATTCGCTGTAATGACGCCAGCAGCGCCTGCTGCCCCTGCTCTCCGGGCATCACGGGTCGGCGACCTGGTATCTCCGGCAGATTTCTGCGCGCGCCGTAGCATTCTCCGTCTGCATCTTCATCATGAGATAGCTGTCGTCATAGACTCAGCGTCAGTTCACGGGCGTCAGGTCTTTA * tp:A:P cm:i:137 s1:i:1034 s2:i:0 zd:i:1 NM:i:664 ms:i:2288 AS:i:2288 nn:i:0 SA:Z:utg000001l,40370,+,4727S6938M246D30S,60,2099;
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
101 92 4 * 0 0 * * 0 0 AGGGTCCTTGGGTTGTGACCACGATGACAGACGGTGCTGCGGCGTTTATCACTACAAGTCAAACAGCTTTTCCAGCAAACCCTTGCCGCAGAAAGTGAGGGCAGTTCATTGCTGGGTCTGTGCCACGTTACACAGGACCATTAGCGAACGTCCGAAACATGGGGCTCGGGTATCGCCCGACCGTAAGGGACGCTCGAAATCGTGGCTCCGATTTGCATCAAGCCGTCACGGTGAACAACGGGTCAGCATGAAATCGGTATCACGTTGGATACTTGGACCATAACCAGCGACTGATGCGCGTAACCGACGCCGGAATTACCAGATGACGCTCCCGTGCTTGTTCACTTCTGCTGACGAAGATCGTGATTGGTCGATTTTCCGAAGCCCGACCGATATTACGGTTTAAGCTGACAACTGGCATCCAACAGTACAGTTATCATGAAAAACACCGGGTGAGTCGGCTCACTCAATCACCCGACTAAAAAGGTCACTGCCGTGGGACAGCAACGTGACTCAGCAAGGGATAAGAAACCACCGGATTCATCCCCACGCTGCGGTGTAGCCGCGCATTTACTCCCCGTATGTTCAAGCTGTAATCTCAGTGCTGTCGTAGCCGCAGGACAGAGGTTTAGTGCAACAAGACGATGGTGCAGTTTCAGTTCGTTGACGGGCCGGGTTAACTCAGCGCTCGGTGCGGTTCTTTAGGTTTACGTCGACCGGACAGGGAAACGACGACCGCCCTTCAGTCTTTAATTCACGAGACCTGATGACAGGTAAACGCTCAAACATGTCACAGACCGACGACTTTATTAGGGATCTACTTCTGTGGATTTGAAAAGTATCGGTTGAGAAATTAAATGAAGCAGTACACAAGGCATTCACCGTGCTAGACTTTCACCGTCACGTGGTGCTAGAGCGATTCAATCGAAACTCGATACATACATTTCCCACCCCTGCTGCGCTGAATCCAAACCGGCAGCGTACGTGCTTCGTTGGTTCGTTCGCCGGTATATACGGCAGGATCCGGCTAGAGCACAGTCTCTAGTAGCGACGCACCGTCATGAAATTCAGCGCTCTACTCCGCAGCCCTGTTCGGATTTATTTAATTCAGCGGACACCATTTCCACGCAAGACCCGGCTCCGCCAAATTTTGATTCACCCCATTAGATCACTAATATCTATGGGTCTAGCCTCTAGAGCCATTGCTCCAATGTCCGTGCTCGCGGTACACCGCGGTATAGAAGAAGCCCGAGTGCCTTTCCCGCGGTCCAAACCGTCAATGGAACAGGCTATTGCGTCGTTACGACTTGTTGCAGTGAATGTTTAATAGAACTAAAGAGCCCGTACTTACTGATCTCCGATGAAGGCTTACTTAAACGCGCTTTTAAAACGGCCCAACGGCCCGGTCTACCTGAGATATACCGCTTTCGTCTGCGCCGACACATGAAATCGCGCGGTTTAGTTCAGCGAAGTTCTTTTGATTAATCATACGAACACAGCGACAGGGAACTTGCTTGGTTGGTTAGGCAGATTGACAGCCGCGGCGCTGGTACAGCCACTAGAATGGCCATCTTCGTAGCCTGAGACTGCTTAACGGACCCGATACCCTTATTATCCGTATCTTCGAGCCAGCTCTGTCACGTTTGACGATAAGTTCACTGAATCGTGGCGTTAACGGGCAGATCGGCAAATCGCGGCTCTACGGCTGAGCAGTCCTTCAGGCGCTGAATGACAGGCGCTCGCATACGATAATGAAACACGGATGCTGCACAGTTTACCCGTGACACCGTTTATCCCTGATACTAGTCCGTCTCTTAAGTAAGAGATCTGTCATGGATTTAGTTCTGCGCGTTCTAGAACATACGAGCACTGATAAACGGCTAACCGCCATGGATCGAGCGAAATCGCGCTCCTAATACGCCGCATTACCACTGTGGTCGGGTAGGCAAAGATCCAGACTTACGCCATCGCTTCGATTCATACGCGCGCACGTCGTCCCACAAAGACGGCCGGTCCACCGATAAACTTATTCTCCAGTGGTACTGACCCACACGCTCCTATGAGCTCCGCTGCTCTTACCCGCCTTCTACTAGAGGCAGCTTTCCCCAATCGAATGACGACGATGGGTTTGAGGCATATCCCACGCCAACGGCCAGTCTAGAACTTTGTTGATATCCGTACCGTCCCTCCTTTCCGTTGACAAAACTCTAATCTTCAGTCAGCGGTTGATGCGTAGCGTTGCCCAACGGTTAAGCAGAATGAGGCCCCTAAGGGGTATGCTCGTGACGCTAGCCTGCAAAATGGCTGCCAGTTGCGAAGCCCGCAGTCGCCTCGTGCTAGAACTGGGATTGTAAGTTGTTCGGCTACGCTATGTTTCTAAGCTTAAACGACAGCCAAACCGTGATTTTCACCGTATCAACGAGCAAGCGTTTTACGTCCAGAACGGTCGTGACACTGTCCAACCAAGGTCAGGAAACCTGCCAGTTAAGTACGGGCGAAACGATGATGCTCGCTCCATCCCGGCGGATCTACGAGCCGCAGACGCCCCGACTCTATGCAGACTTCACTTGACATCTGTAGTTGCTTTAACAGCAACAGTTACGTTAGTACCAACCCAGCGAATAGCATATTGCGCTAATTCCTTCACTTTCGATGATCTGTTTTTAAGCGAATGATTGCTGTACGCCCCGAACCTAGCTGCGCGACACCTTCCGTGCTTTGCACTATCATCTTAAGATCAGTCGATTTCATTCCGTACCCAAAGCGCCACGTCTCGAGGCGACCCCAGGGATTGCCGATAGTCAGCCTAGACCCGTGCATTATGCTCGTTTAACGGACTAAGAATAAGACAATTACTAGATATGTTATCATATTTGAACGAAGCGATCGTGTGTCCGCCCTACAGCTGAATTACCTGTTCAGCGACGCGCGGTGTCTTTGCAGCTCATTGCGCCATCTAAGGACTGTTACAACGCATTATCGGCCGTCTAAATACTCCCATGTACTAGATCGATAAAAGCGGCACTGGGTCGGGTTTAAAGTGCTTCTAGGTTCTAAGCGGGGCAAGTGTACGCCTTACTGACATTCCTTTACCCATTTGCCCGGTGACATAAAACCGCTCAGGGGCGTCCGCGCCAACGGTTTAAACAGCACTCGGACTAGATAGTACCGTTGCTCGCCTTCGTTGCCTATTCGTAATCCCTCCCCGGCCTTGTACGCACCGCCCGTTCACGAATTACCTCATGGACGCATGGAGTCTGTTACATGGGCATTTACGCTGTTATCCGCGTAGAAACAGCGAAATAGATCGTCCTTACCGTCTGATTACATGGATTTGTCTTATAAGGCGAGTTCTACAATGCGTAACTAGTTTTTCCATTGAACGATGGTGCTAGATAAAGAAGCACGCGACGAGCCTGACCGACGGACCCGGAGAGAGCTACTCGCAGAATCGATTAGCTTACCCTAAGCCCCGGTGGATACCGTATAGCCGCAGTGATTAGTTAGAGGCTGATGAGCATGCCGAGAATCGGCTTGAGCGAATGGAGAGGCAACTACACGAGGAGCGTACGAGGTACCGCCCTTATATTGACCGCACTGAGATGGACTTATGAAGCGCTCTCTGAGTGTTGACATCAAGTAAAGAGATCTCAATCAACAACTGCATCGGATCCCGACTTCATCGCATTTACGGAATGAGAGGTCGATCTGATACTGAAGCGTCTAGCCATTTCTTATGACGTATAGAAACGCCAGGGCATGTTGTGCAGGGTCCAAACGGTTGTCAAGCCCCCGTTCACGCGGGAACGGATGCGGACGAAAACAGCTTGCATTTTGTAGATCCCCGGATCGGGCGATGCCACGAGGACGCGTAAAGAACAGAACGGAATGTGTGCGTCTAACCAAAATCTTCTTGCTCATGTGACTGAACGTTCGTTTGCACTCTAGTTGTAAGTAAGAGATCCAGCGACTTTGGATCGTCGCATCGTCTGATGCAGGGCAGCGCATACGGTGCTAGCGTGAGTTGCATGCAGGCATCATCGATCCGATGCTCCAGACGCACAGCAGCGACACATGACTAGATAGTGACGGTAAAGAAACAGCGATAGTTCATCAGCTCACCGTCTAACAGATTATCGTTACGCAATGGCCCGGATTTATCTCGTTGGACATCGCAAGTCCATCTATCTACCCCGGACCATTGCTGAACCGTACGGCCTAGATGCGGCCTCATCTAAGATAATGTGACGGTCCGTCGCCCTACAATTCTCTCGGCCACGGCTTGGCCTTGCGAGCACACGAGCAATGACTACGAATCGTTGACGATAGGGACGTACACACGCCTGAGCAAATCACTCTGAGCTGCTACGCCTAGTCGGCCTCATCGGAGGCTGCCAGGCAACGAGAAGAAAGCAACTCGTATTGGGAACCGGCAAGAGCACACGGGCCGACTTTACCCTCATCATTTCTTGACATCATGCCCCGTGTCTTTATCTAGATCGAGACTATAGGGAGGGGACCTCAGCCAACGCTCGTAGGCAAAGCGTGAGCAGGGAAATTAATATGATCTGTTTCTTCTGCGTCCCCCTCCGAGCTCCTCGAGTTAATCTAGAAACAGGTGGCTCGGCCAAATTCTGAGGACGGGTAACAGCGGGCGTACGTGCGCGAGGATTATTTCTAGCTAGTTATTTATCTCTTGTCGGGCATTGTTACTGCTCGAAGGTTTGTTGGGATAGGAGATCGAAGGAAGCACGCACGCACAGATGCCGGATTCTTTGCCTTATCCGGAGCGTCTGCCGCTCCATCGAAGCATGGAATTTGCTTAGCATTTATCTATTTATTAACCCTCGTTGCTGGTTCATATTCATGGAAAACAGCCGGGTAACGACCATAGCGGCCAAGCTCGTCGCCGAGATAGTCCAAATGAGGTTGCACAAGGGACTCGTCTTAGCAGGCAAATAAGGACCGTAATCCGTTCGTCCTGGCCGTACTAGTAATCAAGGGTAGAGAAGAGACATCACGCACGGACTAAGTTTGTAAATGAATCAGGGTCGCTACAAGCGGTAACATTAACCAAGTGTTGACTAAATGACGTTTCTTAATCGATTTGTAAACGCGTCACCCTAGAAACCAGGGGCCATGAGATCGAAACCTTAGCCGCTGGGCCCCGTTCCCTATCCCTAGCCAAACGTGATTTAAACTGTCCTAGATACCCGGTGGCTCGATCCCTAAATCGAAACCGTCACGTGGGGCAACGGTGCGTAACTGATAACCTGTTGTGGGTTTGCTTAGGGTTTGAGTTCCTGACCAATACTAAACAGGGTACGAACAACCAACGAACTCTCTCACTGTTAACACGATGCCGCTGGGAACATTTCGTTCGTAGTAAATCCCAGCCTACGTTTATCCTAATATACTGTCCGTACATTTCGGCAAAGCACAGGGCACGTAATGAATCCCCGCCCGTCGAAAACTGCGTAAGCGTTAAGTGCGATGTTTCACTGCCCATAATCTAGTCGCTCCGTTACCACCTGTTCACTCTTAGCTAGTACAACGCGGCTGACCCCAGCGCTCGGGTGTTTGCCAGGTCACTTCCGCGCCTACCCATAGAGCAAAGAACAGTCCGAAGCCTGCATTTTACATACGCCCGTTGCGCTCGTCCCAACAACTGACCGTATAGGATCTAACGGGGGACGAAAGACAGTCACCAAATTGACGGTGTTCCGTGGCAGTTATGAACAGGTCCAGGCGACTACAACTCATTAACAAAACGGGTAAGGACATTTCTTACGAGCGGAAAAGCGGATCTAAACAGGAAACAGCCGGACTTAAGCCTACTAATACCGTGATTCTACGTCCGACGCAGGTTCGACGCTCTTTTAACGCGCGAAGGCCTTCACAGCATCAGCGATGGTGTCCAATTTCAACCGCTGAGCACTCGTGCATGAATTCGTAACAGCGCTTTCCAGCAGCCGACCGTATTCGCTTTCTTCAATCGTCGTTGTTAACGTGAAATGACAGGTCTGTCTTAGCCATCGTTACAAAGACATGCAACGGGAGCTGTCCGTAATCGATCGTGACGATCTTACCGGGTCGCTCTCCATGCCAGCGCTAGAGATGAACGATACGCGTCACAAGGGACGATCGTACCAGTAATGGTTGATAGTTACGTGAGGCTAATAGGCTGCTCATAGATCTAAAAATATCAGCTTTGGACAGCGCGCGTTGAACCCTTAATCCAGCTGGCTTTAAATGGGATTTTATAGCGCAGCTCGGCGGTAAATGTGACATATCGGCGAGGACGCTGCGCCACGCCGGGGCTCGCCGGATGATGGCGACAGGTGTTCTTCGATACCCGGACGCGTACCGCCGTTAAGCTGCTTAGCGAAATGTTCTGTCATCATGGGCCCATAAAAGAGCTGATGAGTGAAACGGCCCCGTCGTATCACTTGACGAACGGCTTCGCCTGGCGCCGCTGACTTTGTATTGCAATGGCTCCCGGCCACGTGGGAGTCTCCTGCATAACGGATTTTGGGGCAGATAGTTGCCGTGTACAACGTCAAGCCGGACGCCAACGGAAATGTCAGGCCTTGAAACCGTCACACGAGACTTGATTCAGCCACCCAAAGTCAACTGTTTTCTTAATATCGCCGTAACTATGGTGATTTGGTCCTAGCGCCGGCAGCGTGGCCGTAAACTTTCCGTCAAGCATGTTCCTGACGTGGGCTTTAAACCCGTTCTTTAGGTCAACCGTCGGTAATCCCCGGAGGCTTTCAACTGAAAATGAGCCTGGCAACCGTTTGTAAGCGCGTTTTGTTAAACTTATTGCGATTATCGTGAAACGCGCTGCCTGCTGCTGCTAACCACGGCGTTCAACAACAAAGAGATGAGTGGATACGTAAACGTCTTCTGAAAGAGTGCGAGCCCTAGCTGGCAGCAGTAATTTTGTGATAGGGATAAAGCGTTGATGAAAGATTTAATGCACGCGCAGCGATCGGATGCATTCTAATCTTGCCACCCGACGACTGGCGACGTTTTTGATGTGGTCCGCCTATAGCCATGAGGCGCGATCTCCGCATATGCCTATCTACTCACGCATCCGTCGACCAGACTGTGACAGGACATGTATCTGAACGTGTTTTGATATCTAAAGTCTTCCTCGCCTGAGTGGGATTAGAGCGGTTTCTAGGATGGGTTGCGGATTAGATGGGGGCCTCATGTCATGGAGGCGGATCGAGACAGATCCGATTTATTTTAGTGCCGTATCTATCACGCAGCCTGTCAGACATACTGTTTCGTGGCTTTTCTAGCGTCATGTTATAGATCTTTCACACCGCCGATAGCTAGTCTTAATCAAAAATCGAGGACGCTTTTCCCGTCATTTCAAATGGGCAATGCCTGTTGAACTGTCTGTCCTGTAACATGGCTTATACGGCTTTATACGCGCCTACGCGTTGACAGCCGTTCGTAACACTATTTGATCGACTGGTTCGAATGGTCGTAAAGAGGACACTTGACGGTTCGGTATGTGGACGGACTTACTTAGCTTAAACCAAATTTTGTTGACTTTGGTTAAATCATCCTCACGACTTCTTTCCCTGAGACATGCTTCAAGCGCGACGGGCAGAACATTTCACCGATTGTACTATCGCGATCTAGCGCCATTCATCGTTAGCACCGTAATGACCTGTCCGGATATGATTTACCAAAGCTGTCAGTCCGTTCTTATACACCAAATCCGCTCCTTGAACGTAACGAGCGATGGCTGTAGGGTACTAAGATAAGCCATCGTAAGGCGACGACTAGAATGAAGTACTAACAGGGACGAAGTCAGATTAGGGACCCGTCTATTTAACCAAGCATGTACCGACGGTAAACATATCTTTCTGACTTTCGAAAGGAAGGGACGGGTCTGGTCTCATCATCTCGCTTTTATGAAATTTAATAATACGTGCTGACAGCGCCTGCAGGAGGGTCGGAGCGTCAACTGACAAGAGAGCCGTCGCGGCCTAGGCTCGCGATTAAACAAAAGGTTTATGGAGGGGTATGAAGATAGATACCGTTGAACGGCTAGCAGGCAAGAGACATTCTGAGCGTATCTGTACTTGGCTAGCTTTCTATCCCAAGACGAAATTAAGGCTACTTGTCATTTAATCTGTAGGTCACGACTAGATGCGGAACCGAAGGTTGAGCCGAACAGAGGACGCGCTCTAACCGTCAATCGTCTCGCGAACTGATCGGCCTCGCACCTCACGCTGTACCCCGCCTGAGTCATGAACTGACTAAACATGTGGTGGTTAACGGTTCAACGGACAGGTCGCCCCTTGACAGACGGGTACATCAGATAAGCAACGATTAAAGCGTCGGTCCCCTATATTGCCTGAAGCACCGCAGAAGACGGACCAGCCGTTGTTGAAGTGACGGTAAAGATTAGTCATGACGAGGCGACCTAGGCTTTACTCCACGGAGCGAAGCTCTCGAGCGCGATGAAAATGGTACCACCGGCGAGCCGCCGGCTGAGTCGGTGAATACGCTCCATCCTAAACAGACAGAGGAATGCTTCACCTTACACCCTGTTTCTGCGGCTAGAATGAGCCGCCTCTTTGACGACGCTGCGAGCTGAGTGCCTTAGAACTGTGTGCGAGATGCGAGCAGCCCCGACTGGCGGCTTTGCTACCTGCCTCGCATAGGGAGTGCCCCACGGAGTTCTTGCCACCGGCACCGCTGTCGACGCTCCGACTGTTCTACGCTATCCATGTTTTCGCTCCGATATGCACTTTTCCGGGTCTACGAGCAAAGACGTAGGTACTGTGAGCCGGTGCTCGTTGGTAATCTCGAATATGGATGT *
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
102 93 4 * 0 0 * * 0 0 AATAGTCGTCATTGGGTTACTCGCGGCAATCGCCCGACCTGACCCTTTCAACGGACTTTATGAAAGGACTGTTTCGGGCTTCCACCGCGTTCCACGTTTATTTAATTCGTTCTATATGCCTTTTCGTGTCCCCTCTCCTACCCACCGAAGCAGGAGCGCCAACAGGACCGTAACGGGCAATGGCGCCTCATTTTGACAACATGTCGTTTCCTTTCCCATGTTGTTAGTTCGGGATACGTAGATGGAAGTGGTCAACGGGCACCTGGCTTAGGCTTTTCATGTCCGACCTTATGAACGTGGCCTTCATGGAGGGGCAGAGATCGGGGGATCACCGTTCTTAGAAGGCGGTGCTCGCAAAACGAACGTTATACTTACCTTCAGCCTCACCGGCACAACCTTAATGCCGAGCAGAATGGGTCAACCGGATCCGATCGAGATAGTATTCCACGCAGTCGATGATGCGGCTGCCGACGAGGCAATCTAGGGATCTATTACGGGTCCATGAATAAGCCAGACCTATCCTACACCGTGCTCACAGACGCCTCCAGCCGGAGTGGGGATGCCATCCACGTGAAGACAAGTTGGTACTTATTGGGATGCTCGAATTTGGTGGGTTCGTTGGGTCGCCTTGGGGGTCAGTGTTTAGAACTCACTTCTCAACAGCCCTAAGTATCACGGTGAGTCCTTGTCCAAACGCGTCCCAGTATGGAACTCAGAAGTCCCTTATTTACTTTTATCGGCTACAACTCATGGATAGCGGGCTACGCCCGAGCTACTAAAGACCATGAGTAGCTCCGCAGGCCGGGGCGGTTATGATGAGTACTGGCATCCGGTCAGTGAACGGGCGCCTTAGACCGTTGTCACCACAGGGTTGCCTACTGTCGACTAGAGCGCGCGGCTACGGTCAGGTCGATGGACAGATTTAGACTCCCGACGAGATCCCAGCCGGAGGGCTCCACATGGAGCCTTAAGTTCGACGGTAAAGGACGAGGGTAGGTCGCAGAATGCAATGGCGCGGTAGATCTCGTCAGAGCTCGATCTCGTACCGGTCCACGTCTTCCATTGTTATTCCAAATCCCTTATGTTTATCCCTCGTGCCCACCAGCCCGGACGAGACGGTGACTAGTCATAGGTGGTATTCCCGCGGGTGTTGACTGGCGATCTCAGGGTTGGACCCTACTTTACGTGACTGTCACGTCGCTGCTAACTGGCGCTCTCGCCGGTCTGACTGGCACTGAATGCGACGCGACGGAGCGCTCGCCGCGGGCGGCGTTCCTAGTGGATGCTTCAGTATTCCACCTGGGACCCGGCAAAGCCCGTGGATGCTTAATCAAAACAATCTCTCACGTGATGCTTTGACCAATCACTCCCAATCCAAGGCATACCCGCTTTCCTGGCTATGATGCGCTAGCGTATTCCTGAAACCAACGGTTTGACCCTAACGGTAATCCCAACCACATGAAGGAAACTAAAATTCGATCCGTTAAGACGAGTGGCTTGGTAGAAAGGTGTTCGTGAGTTCATGTTGGGTACGCGGTTGCCTTCGCTGAGGAGCATCTGCGTGCACCAGGTACCACCGTCCAAGGGTAAAATGGACAGGTACCCCACTCATAAGATTTTTGATCTCTGCCAGCAAGGGTGCTCCGTCAAACCCAGCAGAAGCTTCTATGATCCGGTCAACTGCGACAGACAGACGCCCGTATATGTACCGTGGTGGCGATCCTCTTTTCGTCAAAGTCGAAGCAGGGTCATAGGTAAGTAGCCCGTGACCTTTCGATTATAAGCCGTGACCGCTGAAGCGCCCGCCTACACGCGGTCGTGATAGGTGGCGCTTCGACACTGAAACGAAGGGGCGTATAGCGGCGATATGCCCTGATTTAGCCCCCGCCGGCCCTCGTACGAATATGTTTGGGAGCAATAAATTACCGAACTTCGTATAAATTAACCGAATACTGGCGACGCCGGCACGCCAGTGAGTCTAGCCGCCATTTTAGTCTCGTTTACGTATAGTACGGTATGACAAACTCTACGAGCCTCGCCGCAGTAATCGCGTACTGGGGATCGATGAAGGAAGAACATGACATCAATTAACTCGGCAGCCTTGGTGTGTGACCACACCTAGATACGGCTAGCTGCTTGCGTACGTAGCACGTAGATAGATTCATCACTATCCACGATGAAATTAGAGACTGACTTCAGATGACCCCGTAAACCCGTAACACAGTAACCGGGAATGCTTGTACCCGGCTTGTGTAACATGACGGGCACGCTCTAACAGGTCACGGCAAATGCCCGCAGTCGCACGGACGCATTCACGGTTCTTACTCCACTCAGGGAGAGGGACCAATGCGAGGGCCCGGCACAACAGGAGCCAAATAGCCATTTACCTGCCCAATCGCTTAAGGTCCCCGGGGACAGTTCTGAACCGCGCTTCCACTGACGCCGCAGCGAACGGCCACCTTCTAGGTCAGACCATTCACCTTCCCGAACTACGCGCTCTTTGATCTCGTCGCGGCGCGGAGACTCTATGACTCTGATGTATCTGTACTTAACGGGAAAGTCGAGTAAATGAATGAAGGAGCCAAATACTGTGACAGCTTCTAAAGCAGACGAGTGTACCGCCGCACCTATCGTTCGTCCATGAGGACGAGCTTAGAGGCCAGATCGTTTGCCCTGACCGGACGCTCGTGACTAATTAGATCGTACCGATAGTCAGGCGCAGGAGGGGATATATTAGAAACAGCCAGGGTCTCGCTGGCGTGACAGTTAAATTATTACACGCGGATGGGGTCTCGCGGACCCCGAAGTGCGCCATGTTACGTTAAGCTCCCTCGATCCGAGACTCGTAACCGGCTCCCTGAGCAACAGTACCCGACAACGCAGCAGGAGAACGGGTACGAATTTTTACGGCTGAATGCTGCACAGTTCTCTGGCTAAAGATCGCACTTGCGCGGGAGATCCAGACCAGCATGACAGGCCACCCAGGAAACGTGAGGATTTATCTGGCGGCCCGCTTCGGCCTCATTCTCATGAAATAACCTGCCTGAATGGTACGGTTACGCTGCCCCTTGGGAGCTAGTTTGAAGGGAGTCTTTCGGTCTGTCAAGAACAGCAGAAATACAGAAGGTTGCTGCATCACCTGTTACGATATTTACTCCCCAGAGTTACGATCCCCCGGCTAATCTCTTAACGCGAGCTCACTCTACTGGTGACTCCTGCCCTACCAATACTCATGCATCAGGGGTCCTGTTCAAACTGTGTCCAACATGAATCTAATGACGCCAGCTCAATGGGAATACCGGGGCAGGAGTCCCGTTGCTTCCCAGGGTCAAGCGGGAGAAAGAGGATTGCCCTCCAGAAACGATTGTGTACTTAGCTCTCCAATCGTAGACGAACCGTTACACTAGCGAGCACGTTTGGGGTCATCGTCAGCTCCATCGAAGCTGGCCGCGTAGACGACGTCTACGTCAAACTTTTGGTTTCGATAAGGACCGACGTACCGTTTGGTCACCCTCGGTTTCATTCGAGCCAGAAGAGGCACCGGTTTAGATGGTTAACGAGATCGCATCGGGGCTGAAGCCAAGGATTGGATGGCCGGCGATTCAGCCCATATTCAGGTCAAGTGTGCGAGTCGCTCCGCCGGTTGCGTAGAGGCATACCGGAGATCAGTTCGCCGAAAGCTATCTAACCCTGAATGCGAAATGAGCTGGCTCCCTGCGTGCCCGTACCCAAGCGACCGCCCTAGCATTGTTCGTCACCGTTTGGTAAAGATTCCGGATTGGCACTGGCGCTCCGCTGCGAAGACGAGACTTTATAACACATTCAGTGCTGGCTAGATGAGATGCTCGCTAGATTCGAGACCGCGGGTCGAGCCGCAAAATCCGACCGCGATGTAAAGCGCCTGAATCGGCATCGCCTGACGGCTCCGCCGCAGAACCTCCAATGAGTTTCTTAAATTCACCATTCGGAGCACCATGCGTCAGGACAGGAAGCAGGGGACCCGCGCCCGCTAGATCGGGAGCATCGCTGGGATCGTAGCAGTCCAAATCGCGCGGCGCCAAGTTAGCTGGAGACAGGCGCGCTGCTCCCACGCCAGCTGCCTGACTCCAGCTGCCAGGCGACTCCTGAACCCGTCGAGTAGCCAGTGCGGGAAGCACGGCTCCAGCCATGACTACTCATACCGTGTTCCCGTTTATGATCGTGTTCCCATCTGGCCTGCTGCTCATACTGTTGTAGTCTCACGATTTAGCAGGAGTGCCCGGCTGGCCCCTATAACTAGGCGCTCAGTGCGAAGCCCGGTCGTTGGGGTTGATTTGTTATGGGATAGCGACGGTCGTCGGTCGCGTATTCAGGCTTCATCTAGGCGATAGGATTTCTTTAACCTATCGAGGACACGTTCTAGTCTGGTCACTGTCAACGGCACGCCTTCCAATCCTTTTAGGGAGCGCAGTTGCGGTAAGAAGTGCTGGCGGCCCTCGAGCTGGCTTCTTGGGCTGAATGGTTGACCGACGATTCAGGAGCATCAGGACTATGCTCCTCCGAACGAGACTGAACTTAACACCTCACCGCGAAGCGATGCGCGGCCTCCAGATCCCTCTGCCGGAGTTTTAGGCGAGCGGATTGCTTGCATCGATCTCCGAGCGCCGGTGCTGGATTTATCCCTGACGGCCACTGCCTGGGGTGCAGGTTCGGCGTACATCCTGCGGGCTCGGGGTATAGCCGAGGTGACGGCCAGCCTGCTGCTGTGTACCCGCTTATTGCCGCCTCGGCTGGCGGCTTCAATTAACAACCGTGTTGGTACGTCACACTATCCTACGACTTGTTCGTTATTCATTGCGAATAAAGTCGATGGACCTCCAGAGCCTGCTCCTCATTACATGTGTCCCCGATTAAGCTATCCTAGGAGAGCAGATCACGAGCTAACTGCATTGGTACGGTACTCTTATCGACCGCCCCTACCCCCAGTCTCCATATGCCTCCATGGATATAGTTCGGCTGCACGGTCTAGGTACTTGGGTAACGGACCGCTGCCGCGGCGCCGCCTGCCGTGCAATGCCCCGTTGATGGTACTCGGGAACGGAACCGTTACAACAGATCTGACCCTGCGGCCGACAGGTCCGACGCGGTGAGTACTCTCTATCTACTGGTGGACGAAGCTGCTCGGGGTTACTCCCCGTCGAAGGATGGCCGACTAGAGGTCTGACGTACTCAAGTAGGTAAAACTAGTCGATTAGGGTCGATGGACGCACTCGTTGAGCACCGCTAGGCCTCGCTGGGACCAGTGCGTGCGATCGGTGCTTGCGCGGTTAAGCTCCTAAGCCCCGCGTCTTAATCCCAAGCCGACCTAGCCGGAATAAAGCGTCAATACACGATCTCACTTGTGCCTTACGCGAAACGAGCACAGGGTGCGAAATCGGACATGGCTTTACTCGGCGGGGGTTACAGATCCATGACTCATGGCAACCCACGCTAGGGCTTAGTTTAAGATGGCAGCGGGTTCCACGGCAATGCGGTCTAAACCTCTGAGACCCTAGCCGAAGGTTGTGCTCGCCCGCGGTGCTCCGACCGTACGTTAGTCCAGATCCAATCTTGCTCATCGCGAGGCTGCAATGCGGCCACCCGCGTCAACGGGGAGCATTGATCTAATGGCTGGGGTCTCACCGACGGAATGCGATCGCGGTTCATCGCTGTCTACTTAGACTCAGCGTAAAGTTAATCGCCGCGTCTCTCGAAGCATCGCCTAGAGATAAAATGACGCTGACTGTTTTGCTCGCCTATCAAATTGGGGTCCTTCATCGTACAGCAAATAACGAAAGAGACCCCCGACAGGCGGCCAGCTTGAGCCACCGCCCAATCCTGGAGCCCCCGGGGTTTAGAGAGCATTACGTATGGGGGTCTAAATGGTCAAGGGGGACAGCGAGACCGCCCCATTCCGATCCTGGCGGAACCCCCGAACCTCTCGTACAAACGGCCCCGCCGCTTCTCGCAGAGCACACGATGCTACGGGGCCGCGGTATGATGCCAATGGAAATTCATTCCAAGAGCGGCGCCAAATACGGTGCAAACAGGCGGTATGGGTCAGTTAACGATTTGTAGTACGTCAGCCAGTGGACGTCTGACCCAGCACGAAATAATGTTACGCGGTGTAAAAGGGGGTGGAGATCGATCTCTCCATCAACGGGCAAGTACCCGGCACGGGTCGCTGCGAACGGACTAGATGCCGGCAAACCTCAGGTAGTACCGTAACACCTCTCCCGCAACACGGGCTCTTGCGTTGGGGGCGGTAGGGAGCTAGACTTACGGTCACGAATTCTGTTAAGTTAACTTACTGTAAGACCACCCTACGTAACGTTCTCGAGTTAGTAAGCATTTCCGTTGGATTATGGAGGAAGCCATGCCATTCAGGGACGCACTCGGGTGCCCGTTTGCCACGTGGAAGAATGCCAAACGTCCTCTTTACTCACATTCATGCTCCCACATAAACTTCCGGCTTTGTAGCGCATTCTTGGGTGCCTGCTAAGCCATGATGCTCAATGGGCAGGTAGACGAGAATTTGACGTACCGTTGTAAATGATCGGTTTCCGTTAACCGTGATTTCTAGATTAACGCGGTAAATGGCACTTCGACCGCAGGTCAACTCAGCCAGGTTTAAGACATGGACCTATCAGTACTTTCGCGTGTTCATTAAGTGAACTTGTATTGACCGGTTGACGAGTCAGGTAAAGGACTAGTCCTTTTACTAGGCTCTTCACACACAAGCAGACAATAGCAACGAAATGAATCCGCGGCGCCATCGCTGCGTGCCTGCGGGCGAGTCGGAAGAATCTCAACTCATTTAGCCCTAGCCACCGTCTAGCAGGTAATAGATGCCTGATGCGAGCTTGGCTTTACCCCGACTCTCATTGACGGACGATGTACAGGGGCAGTGCATGGAGAGTTATACTTCCCGTCATTAACGGAGCCACTCGCTGATCTAATCGAACATTCGAATCCGTTGCTATGAACTCCGCAGGGTGAGGAACTCTATACGCCTTCGCGTCAGCAAACCACGGAGCAGGCGCCTGTCTCTGCTCTTAGCATTCACGGTATGACCCGGGCCACCTCTTAACGATCTCGCTCGCACGGCTCGCACTAGTCTGCATCTCAGTATCGAGATATGTCATAATGGTTGTCAGTCCCCCAGGGCCACGGCTAGGACTTTCAGACCGTTTAACAGTCAGACGCCGTCGAAACTATACCGCGCTGACCGTTTATTCTATAAAGTCCACGAGCGGCATTACAGCACGGTGGGCACTGGGCACAGCATTATTTAGACCTCATAGGAGAGAGGTCAATGACAGTACGACTCGTTGAATCGGATTATTCACGATGCTCGTGGGAGTAGCGTCTGGCCAGTTCTATACCAATCGACAGTGCTCCGGAATACAGTGCGCGACGAGCAATTAGACTGTACCGACTCTACGCTGTGAATTCGTCAGGATGCGACTAAACCGCGACGCATTAGCGCCTCATTACGTTATCGCGAGCTCTCCTCTCACGGGCGATCCCTAGTCGGTGGTTAAACGCAATCGTCGAAATCCCTCAAAACGTGTAATCATCAAACCTCGTAGCGTCATGTTGCCGTGGACTGAGTAATCTAACTCGTCAGGCTGTTTCATTGGGAGTGGCCGTACCGCGGGTAGGCTCTTTGCCCGTCTAAGCCCGACCTGAGCCGTGGGTCATGACATAACGGATACGGAGCGCATGGCTATGGCTAAATTGTACCAGGGCACCGGAGCTTCGACCCTCACCACATCAATCGGTCAACGGCCGCCAACCGCATAGACGGGGAGATGTGGTCTTAGTATGCCTAAACGCAAATGAGGCGCAATACGAAGTCACGCAACGCTCGCTTGGTTGGTTGGATGAACGCCTTCTCTAACTTGAAGCTTCGTGTAAAGGACAATCTGTACCCAGCTTGATTAGGACCTCTTAATTCACGCGGCCTGCGGTACGTGACGGCGGCGGTTGCTTAGCGCGGCGTTTCCTTTATTACGGTTCCGACGAGAGTGGCACGGCACAGCCGAACGCTGACCGCGATGCGGATGAATAACGGGAGTAGATCTTGGCTGATATACTGATATATATTTGCGCGCACCATGACTCATAGTTTTACGGCTTAGTCAGATGCCGCAAAGCCGCTT *
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
103 94 4 * 0 0 * * 0 0 TGCTACTCTTAACGTAGCTGCTATGCCTATTGCCAGGCTCCGCTGCCCTCAGACCATCTGAGCGCGACCTCCGCTGTCGAAGATCAGTACGCACGAGTAGCTCGCTCGCAACATCCGTTTAGTATTAGATGATCGGGCAGTTACTATGATATGTACGGCGCGCCGGGTCCGGGGATTTCTCATTGCTGATCATTGAGAATAGGTCAGTTTAGAGACCTCGTTCGCGCGCGAGCGACCATCAAAGATTAGACCTGCATCGCCTCCATCCCCGTTCCCTCCGAGCCGAAGAGCTGGGGTGGCCAGGCGGGCGAGAAGTACGCATTCTCCATGAGTGCGCTTTTAGCGCTTTCTATCGATGACGAAAAACCGTGTTGGCAACTTTAGGCACTACCCGCACTGAGGTTTGGAATGATTAGCGATCTTAATGCTTCACTCCCAAGGGAATAATCCTTCAATCTTATTCGTCTAAGCCCTGCCTCAATTAGTATGCACTTTACGTTAGAGCTGCTCTTTCCTCTCGGTGCATTCGCCTCCTAGCTCAAGGGAGTAGTGCTATTAAGCGACTTTTAACACCGCAGTCAGATCCACGCACGAGCTCCGGATTGTTCTTTATTTAAATGTTTTTGTCGATTGGCGTACATTGCTCTTCATCTAGCGTTAGCTAACTTGACGTCCGCCCTTATTTTAGTATCCATTTGAGCGTTGGATCAAATACATCTGTCCGGTTATTTTAGTAGAGAGTGCGCTAGGACCCCTTTGTTGACGCATCAAACCTTAGGTGAGGCCTTCCGCTCTTTACTAGTGCCTGCTCTAAGACTAGGAGGTCTAAACAAGCAGGCAGAGAGGCACCGAACGGAGCGCCGAGGCGCAATGCCATGGGGGAGCTGTTACCGATGGCTCAGGTCGCCTTGTCCGGAAATATTCGATTAACAATCCAAGATTTAATATTGGACGTGTTTTGATTTATGAACTAAAACTACGTCTACAACGTTAACAAGTACTTTACTATCTAGCCAGGTACTCTTCAGCATCTCATATTGTCGCAGCTCGCCTCCCATTGATAAAACCACGTGTAGTGTTACGATTAAAGAGGACTCCGCATCTTACTCCGCATCGTTTAACCTATTCCAGTCAGGAGATCGCTTTCTAGCGGACAGGGAAAATGGTTAAAGCGAGGCGGAATTTTTACGCAATGGATCAGATAACGTACATGAACACGCTTATTACTGACATTTGACTATTCAATCGGCACTTTACAAGGCTTCCATACACCTAGATCTTTCCTAATCGTCCCATTTTCCGTCCGTGTCGGACAATGCGTTGCATAATGCAATACGTGGCGCCTCATCCCTGTGTGCATCGTTTAATTATTCGCCAGCTCCCGCCGAAGTTCCCCGTCAGCGTGGTCATAGTTTAATGCGGGATTAGCGGCGTGCATGCGACGAGAGGCGCCCAGGCGCATATGCTCGCTCTGAAGGTTTCAACTAGGTCGTTAAAAGTTGTTGCCTGGTTTTTAGCCCGTACCGATTCTTGAAATAGTTCACCTATGAAACGGGATAACACAGTAGCAAGGTATCCGACCCTACTGCGCACTGGCCCTTAATGATTATCCAAGTGCTCATACAGACGTTTCTATGCATTTGGTCAATGGGGCTGCGGCAAGCATATCGCCCCAAAGGATGTAGCGGGTCTCCCTGCTTTCTTCGTTTTAACTCGCATTGGAAGCAGGCGAGGCGGGTGGTTCCTGCAGCCAGGGTTTGTGGCCTCGACGCAAATGTTGTTTGCCCAACGAATGAGGGCAGGACATTCCTGCCTATCAAGCTTAAAGTTTTATTAATTCTGTAAGGCGGTTAACCTCCATGGAAACAGTTATTGCTCACAAAAGATCCATACCGTGTCGCGCTCCATGAAACAACGATGCATTAAACCCTTAATGACTCTTCTGATGTCCCGTCCAGTTGTTTGCGGGTGATCAGCCTCTCAAAGTTCGACTGAGTCGCGTTCACGTTGCGCACGTCAATCGGGGGAGCGGGCTCTAACGAGAAAAGAGTGCCGGCAGGCGTAGAAGAGAAGGACTGGCCCGACTGCATTTACGTGTGGATGAGAGCTACGACCCACGATGGAAACAATAAACAGCAGAGCATCATTTTCAGCTTTCCTCATGAGCTATGTAGCCTTCGTGTACATTTGCATGAACAGATGCCCTCCGCCAGTACGCATCCGGATGTCAGGTGTCCCGTTCGCCGAGTTGAAAAGTTCTCTGGCATTTTGTCTAACAGTTCTGCCTGAATGGCGTGCTCCCTGCTCTGATTAACATATGCCCGACCCTCAGGCGATACGCAAGGTGGATGCATAACCTCCCAAACGCAAACAATCGCATGTACTGCTCATACATCAGATCTTATACATCTCGTTCCACCCTTTATTTGAATTTGCAATCCAGCCCCTGTCATACGTATGCGCTCGAACTGGCCAACTCAGCTAAGCGATCTTGAATAGGATATGTGCTGCAACACGTCAGTGCCTGACATTAGCCCGATCAATCATAACGACGACAACCTGCGTATTAAACGAGTGCCAGCGTCCTGACTTTTTCAGGGGCTTGGTGTTCAGAAGAGGCCTCTGCAACGGAAGCCGCAGAAGGGGAAAGAAGCATACTCGTCGGCGCCCCTTTGTTAATTTGGATTTGGATGTTAGCGTGACACTACGCGCGGCACGTTGCGGAGTCACAGCGGCTGCCGTAACCATGATAAAAACAGGGCCATCGTCACTGATTTCTTTTGACGTCCAACGTCGCAGTTCAACGAGCCGCCAAGGCTTCTAGGAGCCATCCTTTTGATTGACGTGAATTTCTAAACTTTATAACTCCAACAGTTTTTAAGCAACCGCGGCCGTTTCAAGCATGGATCGATCGATGCCATGCCTCCATCTCACTCCACGCTTAATTCCTCGGACGCCCGCCAGGTGCTACTGCTTAGACCAGATTCCGGAGATCACCGAGATTGCCAGTGGGCGCTCCAAAGCTCCCACATCGACGTCCGTCAGTGCACTATGCTTTTGGCTATACAGGCCATGCCTCTTAGTCAGACAGAGGACTCGCCATTGCAACCTAAGAAGGATTAGCGCGATTAATGTTCCTGTTAGAGGATGGCACTTAAGCCATCAGGTTAGTGTTTCTGAAATTGCGATGTACGCGAAAGAAGTGGCACCGCGCTGTGAAACCAAGAAAGTCAGTTAACATCTGGGCTGAGTCCAACAAGCTCTGATTGTTTAACAATCAGATTGTTTGATTACGAAAGTATGCACGAAAAACGGCAGGGAAGTGGTCGGCATATAAACTCTGCCGACAAAAGAAGAATTTCACGAAGATTAGCCTGTGGCACACTCCCAGCGTGGAAACTATTACTAATGAATTCAAAGGACACAGTGGCCTCGGCTCGTCATTGTGCTTGATCATGGTGAAGCAAGTGGCGCCTGTGAATTTGATCCGTCTTCCGTTATTTCAGCTGCGTGCCACAAAGGCAACGCACTGGCCTGAGGCTCACGACTTCAGAGTGCCTGACAAACAATGCACTTACCTAAACGTTGTGCCATAAATAAATTGACGAATGATTCTGCGGGGCTATAGTACTAATCACAGTGTTCAAACGTTAGAATTTGCACTCCAACACTCTGCAATGGTTGCGTCGCTACATCTAGTTCGTCCGAACCCTCTAGAGAGTCGATGACGCTCACCTCACTAGGACATTTTCTTCGATCGGGTAAGCAAACTCACCCTAACAGGCGTGGCTCCGAACAACGTTCAGTTACGTGCCCAATTGGTCAATAGTCAGACCCGGCATTGAGCACGTACCCGACAAATACGAAACATGAGAGTGCAGACAGTGGCATTCAAAGTGTTGCGTGTAACTATTCTGTTGTGAAAGATGTGCACCGAACAGTCCCTCCAGCATGAGTCAGTGCACGTACAAATATGGTCGGCCTGTTGGCGTAGCATCACTTACGGTGTCACAGCGCAAACTTAAATCAGTCGGGCATCGTGAATAGCCGGCTTGCATCTTCCCAAATAACGTTTATGAGGACCCACACTGACTCAAGCAGCTCTGTTTCAATTGGAGATATCAACCACCCAACGGACTTAAATGCAGATTAAACCATCTTGCCCCAGCGTCACAGCAACAGCAAGAGATAGTCAACTAACAGGACCTACCGATGTTGCACGACCAACATGCAGTGACATTTGCCTGCACTCTTTCAAACGTCGGACGTGCCCTCGAACTGTTCACGAAACCTTGTGCAAATTGAATGGCACTCGTGGACCTTTGTTCGTTCTGGCAACGATTCGTGCTTAACAAAAGAGGATTGAAGAAATAAAAATATACCGAATCCCATCAGTTAAATTCGGCCGACATCCCCGACACCAGCCAGAACACCCCTGGCGTATATACCGAAAAGAATCGAGAAGCCGCAATACTCCCGAGTCGGCATCAAGGGGGACGAGCATTTGGCAGTGAAGCGTTCTAAGGCTTTCAGTGCTTAAAGTCTCGTGACACGACTATCGATCAGATGTTAAAATTCGAACCTCGCTGCGCCGGTATCAAACTCATTTGGTTGGCGATGCGTGAACTGTCAACGTAACCGTAACCACTTAGGCTGAATTTGTCCTAGGTGTCCTTTCTTTCGAGTCTCCCGTTCAAGTTAATTCGTTCCCCGTCCAGAATTACCTTAGTATGCTCGTTTAGACCGTATTCGTCCACCATTAATCAACAGTGCAAAACATATTTTATCTTTAACACCGTCAACACCAAAGTGACTGATTAACACGAGTTCAAACCAAATGGCATTTGGGCAAAACATTAACGCCGATTTTATTTGTCTATCCAGATCAGGGGTAGAACACACCCGCTGCTAGCAAAGATCATTAACGTTTCCACTAACTATAGAATGATCATTTGCTCATGGTTTAGATCGCTATACAAACAAGGAAGCTTGATGCGTTTGAACAGAGATCAACGTTTAAACGAGGCAGCTCACAGGCAGGGCCGAGAAGCAGGAACGCGGTGTGTTTGTTGTCCGTGAGGTTAGTGGTGTCCGAGTTGTTTGCATCTCCCTGTCGTGTAACATGCGGATCACGAACGACACCCGAACTTTCAAACCCTTTGCATGCCATCAATTTTTCGTAGCCCATCTCTTTTAAACGCGGTACGATACATGAGAACGTCGTTGTAACGATGGCGTGCACTTTCGGCGTCTTTATCATCGTATTTTTAAATTAGCCGAAGCCATTTCGATTAGTTAATTAGTTTATTTCGATCTGTGCTTTCTGAAGACTAAGTTGTAGAATGGTTTGGACTGCCAACGTCATGCGATAGGCCGCTTCTGCC *
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
104 95 4 * 0 0 * * 0 0 TAGATAGCGGTCGGCTCCGGCCTGAACGCATCCAAGGCATCGGAGTAAGCGACGACTGCCGCAACGTGTGATAGTGTTCCATCGTCGACCATAGGCCGAAGCCCGAAATGCCGCAGCCGAGAAGGAAGCATGTATCATTGCTAACCGTTGACTGCTGTGCACGTTTCGGAAATGGACGGTCAGGTTTCCCACGTTAAAAGGAAGGTATGACATGCACGACATAAGGGAGCCCGTCGAATACTGGCGATTTCACCTGCGATGCCCGACAGCACGAAAGTACAGAATGCGGTTCGCACCACTTCAGCGGGGTCTCTGGCATTCTTCTATTCCGTTGCTGTGCACGTGCTCGTTAAGAGTGGCTTAGATGAGTTTCGTGGTAGCCAACAGTTCGTAGTACGTATGCAGTACCTGCTTACGAGATTCTTCGTAACTAAGAGGCGACG *
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
105 96 0 utg000001l 24970 60 71S30M1I28M1I11M3I2M1D9M1D27M1I9M1I3M1I11M1I17M1I3M1I4M2D9M1I2M1D2M2D2M1I16M4D2M1D11M1I32M2D6M4D12M2I4M1I5M3D14M1I4M1I12M1I9M2D2M1I5M3D3M1D3M2D2M1I11M2I4M2I9M2I1M1D4M3I3M2D19M1I21M2I4M1I17M1I37M1I3M1I4M1I34M5I3M1I6M3I9M6D3M2D3M1I7M3D10M4I4M3D5M1I5M1I2M1I11M1D15M1I10M1D3M1D1M1D38M1I2M1I14M3I10M1D7M3I13M2I8M3I5M4I3M1D6M1I1M1I4M1I8M1I4M3I5M1D16M3I5M1D2M1D5M2I1M1I3M1I7M5I2M1I6M1I1M2I10M1D2M3D6M2I5M1I1M2I7M2I3M1I2M1D4M3I11M1I1M4I4M1D4M2D22M3I1M1I10M1I3M1D27M1D6M3D4M1I8M4I3M1D12M1I4M1I3M1D11M3D3M2I2M3I2M3I2M1D7M9D6M1D6M2D4M4I24M3I14M4I1M1I11M1I2M2I7M1D38M2D19M1D5M1D8M4D17M2D11M1D5M2D18M1I11M2D1M2D6M2D5M2I5M1I2M1I9M2I14M1I5M1I14M3I3M3I3M2D5M1D2M4D15M1D2M2I6M1D4M2I5M2I1M1I24M2I4M2I9M5I46M4I8M4D19M1I4M1D2M2D11M1D5M2D4M2D4M1D26M1I11M2D2M4I2M2I4M2D15M1I1M2D7M1I5M1D18M1I19M1I9M4D6M2I19M1I2M2D11M2I2M3D4M1I3M1I25M1D4M3I14M4I4M1I1M1I4M2D12M5I39M1I1M1I7M1I2M1I14M2I4M1I7M2I4M1D2M1D4M4D7M2I5M6D14M2I6M2I1M1I4M11I2M1I8M1D18M4I7M2I7M1I38M3D6M7I3M2I6M1D11M1I2M1I3M2I16M2D4M2I13M4I9M2I2M2I4M2I5M2I7M2D3M1D18M1D8M1D5M2D4M1D5M5D9M1D4M3I9M1D12M1I7M8I2M1D5M2D7M1D36M1I19M1D5M2D4M2I9M3I1M2I14M1I5M1D14M1I3M2D15M1D14M1I9M2I2M2D5M5D13M3I11M1D17M1D3M1D1M1D5M2D4M2I7M1I12M1D24M3I13M5I1M1I8M4I4M4D6M1I2M4I11M1I15M2D1M1I15M7I1M2I18M1D3M1I6M1I8M5D24M4I4M1I5M2I10M1I8M2I6M4I11M3D11M1D22M1I18M1D14M2D19M2D12M1I17M2D3M2D4M2I12M2D15M1I6M2D4M3D22M4I13M2D23M1D26M1I3M2D2M1D9M4D11M2I6M1I31M1I14M1D1M2I10M2I2M1I2M3D5M2D11M1I6M1D23M1I8M2D5M1D11M1I5M1D3M1I12M1I33M1I10M1D12M1I11M3D4M5D3M1D4M1D10M2I6M3I12M1D10M2I36M3I15M4I1M1D3M2D6M1I4M6I12M1I5M1I11M2D3M1I1M2D10M1I5M1I8M3D5M1I1M1I13M1I29M3I5M4I2M3I8M1I8M1I3M1D1M1D3M1D11M3I51M4I11M1D4M2D17M1D6M1I16M2I4M1I5M2D9M1D16M1I3M1I2M3D8M1I3M2I13M1I17M1D4M2I41M2D14M2I4M1D12M2I33M1D11M3I1M4I5M1D15M2D4M1D44M2D25M4D3M2D3M2I4M1I5M3I9M6D3M3I2M1D7M2D5M1I22M1D7M3I3M2D6M1D7M1I18M1I5M2I9M1I8M2I16M1D9M2D7M1I2M6I2M1I15M1D37M1I4M1D13M1I5M3I10M1I4M4D15M3I15M1I17M6I11M1D11M2D1M1D4M1I3M1I3M1I2M1D30M3D6M2D12M2I5M1I2M2I14M1D2M3D1M4D3M5D12M1I6M1I2M1I5M3I13M1D3M1D8M3D14M2I8M1I7M1D5M1D6M1I9M3D6M2I4M1D5M2I7M1D18M2I9M2I7M1I9M1D3M1D4M1I10M1D2M3D9M4I1M1I21M1I6M3D13M1I7M3D5M1I29M1D21M1D11M1I12M1I10M2D2M1I14M1D6M2I4M1I15M2D24M1D11M1I6M1D7M2I2M2I4M1D3M3I9M1I31M3I2M1I8M1I4M2D5M1I14M1D4M2D7M3D16M1I2M1D1M1D5M3I5M1I14M1D2M2I6M1D4M1I2M1D1M1D11M1I9M1D4M2I3M1I6M1I1M1I3M1D3M2I7M4D5M5I10M1I3M1I2M1I9M1D1M1D24M2D2M3D4M1I27M1I14M1D5M2I5M1D1M5D10M4D7M1I1M1I2M2I5M1I4M2D9M2D1M1I3M1I20M3I3M1I6M2D8M2D1M1I5M2D3M1D16M4D3M1D19M2I12M1D2M2I3M1D4M1I1M1I9M2I1M1I4M1I4M2D6M2D20M1I22M1D12M1I32M1D18M1I16M1I3M1I2M1I5M1D5M1I3M2I6M1I3M2I1M4I22M1D7M3I13M1I13M1D3M1D6M1I2M1I13M1I1M2I4M1D62M2I7M1I12M2I5M1I1M3I15M3D11M2I6M1D1M2I4M1I11M1I15M4D13M2D1M1D5M1D7M3D9M1I4M1D15M1D9M2I20M2I3M2I3M2D17M1D1M1D35M1I19M1I15M1D7M5I1M1D14M2D4M1D2M1D4M1D6M1I5M1D2M1D6M1I13M2I9M3D10M4D5M2I2M2I7M9D7M1I4M2D25M1I8M1D6M1D6M1I6M1I17M4I5M1I6M1D9M1D2M1I3M4I4M1I2M2I5M5I22M1I23M1I19M1D5M1I3M3I8M4I1M1I5M3D4M1D34M1I11M1D3M3I6M1D3M1D2M1D7M1D7M2D4M1D7M1I3M2D12M1I3M1D15M2D4M1D10M1I5M1D6M4I3M1D2M3I1M1D5M1D9M5D15M1D31M2D3M2D2M2D9M1I16M1I3M2D1M1I9M2I13M2D5M1I14M1I5M4D5M2I3M2D9M1I13M2I20M1D2M1D12M2I1M1I7M1D6M2D9M2I4M1I7M1I20M1D17M2D4M1D4M2D11M2D2M1I8M3D6M2D4M5D12M2D7M1D3M1D8M1D16M1D16M1I3M1D13M3I16M1D9M1D3M2D9M1I22M1I4M2D8M1I11M1D5M1I6M1I2M1I4M2D1M1D7M1D3M1I5M1I11M1D8M1D1M3I17M1D1M2I8M4D3M7D6M2I3M5I5M1D1M1D9M1D1M3I5M1I17M1D18M1I1M2D13M1D8M3D7M1I6M3D29M1I22M1D10M1I3M2I2M1I9M1I22M1I9M3I6M1I4M3I1M2D13M1D20M1D3M1I5M2I11M2I2M3I6M1D11M1D27M1I26M1I12M5D8M1I1M2I1M1I2M1I3M1I4M1I3M2D13M1D7M3I20M1D9M2D5M1I2M1I4M3D14M1D12M1D7M2D15M2I6M1I20M1I10M3D19M1I2M3D9M1I1M1I5M1D7M2I1M1D13M2D11M2I7M2D3M3I7M3I6M1I1M5I10M1D3M19I9M3I14M2I6M2D3M1I8M2I11M7D18M3I7M1D29M2D3M1I7M2D16M2D6M1D3M2I6M2I5M2D1M1D2M1D6M2D13M1I6M1D17M2I1M1D7M1I4M1I4M10I9M2D3M1D3M1D6M2D4M1D2M2I11M1I13M2D4M3I27M1D7M1I10M1I2M1D2M1D4M2I45M1D12M1D24M2D38M1D3M2D2M1D19M1I7M3D13M1D2M1D9M1I9M1I10M1I6M1D8M2D4M3I4M1I18M1I35M4D7M3D5M1I2M1D24M1D9M2I3M1D7M5I30M31I6M1I9M1D8M4I5M2I2M1I6M2D25M1I1M2D3M4I7M1I3M1D8M1I2M1I13M3D5M1I13M5D2M1D3M3I5M1D8M1I7M2I17M539S * 0 0 AGCGGCCGTCTCTATGCTTGGGTGTTTAACCTTAAACCAATACATACAATGCCAATAGAGGCACCATGCCGAGGTAATCCGAATTGATTCAAATAATAATCAAAATGTATTTCATGGAAAATAGTTAGAGAAAACGAAGAAAAACCGACTTTAGAAATATCAACAGCAGACTCAAACATGACGAAAAACCATATTTCTATGCGTTCAGTCTTAAAGCAATTGGCGGTGATGTACTATGAACTATTCGATCAGCTAATTCCCCTTATTCTCCGACCATAATAATTACAAATAAACCAATACTCAGCTTTACAATATACTAACCGAAGGGTCATTGCCAGACCCAGGGTGCGGCATATCACAAAACGATTACTCCATAATCAATCAAAGGGACACTCATCAAGGTGCAGTTGACGTATCAACACGGTTCAGCAAAGCCCGATATTTCTTCCCGCTTCCAGCAACGAGGTTTCTTCCTTCGTTGCGATTCCCAGATCTGCAGCATCCTGAAGCGGCGCAATATGCTCACTGGCTACCTGCATCAGGCTTTTGTTTCTTCCGCCTCCCGGATCGAACAGTTTTCTGCCTTCCTATTCTGCCTTCGCGAGGTCCGATTCCATTGGATATTCCCCTCCCGGCGATAACCAGGTAAATTTTCCGGTAACGGACCCGAGTTTCAGAAATAAAGGACGCGTCGCCGGAAGCCCATAGACGGTTTTACCCCGATGGTCTTCACGATACGCCACGATTGCCCTCATCACTGTTTAGAAAACAGCCACAAAGCCAGCGGCCGGAATATCTGGCCAGTGCAATATCGGTACTGTTGCAGGCAAGACCCGGTATGAGAGGTAGAAGAGTATGCGTCACCTTCACGATAGATTCATGCGATCCGAGCAGGCAGATTATAATATTTTTATGGTCCGTGGTTGTTCACTCATTTGAATGCCATTATGCAAGCCTCGCAATATAGTTAAATCTGCAATGTTTTGACGTTTAGTTTTCCGTTACCCGCAGCGTTAACGGTATGGTGTGTCCGTGTAGGACAGTAATGAAAGAATGGGCATGAGCACAGAACAAAAGCGGATGGTGCCTCCGCCCAATACCAACTGTATGCCGCCGTGCGCACTCGACCTAAGGGGCGTGACAGCTAAATGAGTGACTGTGTTCCGTAATGACTGTCCGTTTGGTAAACCGCACAGGCAATACCCTGTGTGTGCTGCTTCCTTTAACGTGGACGATAAACTTCCTGTAATGGTTGCTGTTCCATACTGACTCCAGCCAACTGTTCATCCTTAAACCCTTGTGGCATGAGGCGCATCGCTGTTGAACATACAGACTGTGAGCATGAGCCCCCGTGTTATTCAGTCGATTTGATCAATTGAACTCCATCTGTTAGTATTTCGTCCCATGGTAATCGACCGACGGGTGGTTTTCGTCCCCAAATCCGTACCCGGATGCATGGCACTGTGGGGTGCGACTAGGATGCCGAGCCGATGTTTCCTGAGACAATACAGCACGACCGCTGGCGGGTTTCCCTTGATTGTGCCTCCTCGCATATATCAGGAAGGCACCCGATGGATACGCGACAGCAAGTTTTGGGTAGCTGATTGTCAAACGCCTGCCTGCATCAGGACGTAGCCAGACGAATGACGATGGTACGGGATCGGCGCAGGTCGGAAAGGCATGAATTCTCACCGGCCCCAAGGTTCAAGATATCCAACGGAGATTTCAGAGACTATCCTGCCAACCTGAGTCAGTTTCAGTCAGGCTGGCGGCAGTGGATTGCCCGAATACGCGGTAATTATTTTCGCCGTGGAAAGCCCTGCCAGCTAGTCGTCATAGTGTCGCATTCTTCCGGTTGTTTACCCGCAAACCGTTAGTCATGGCCTTATAAAGTGGGATTTCCCCAGCTGCCTCCGCAGTTCATTCAGCGTATTCAGTGCGTCAGGTGACGAGTCAGTAACATCTGGCGGATCGCGGCCAGTCAAAAGCGGTGTTCGCAAGTACTTGTTGGTACCGAATTAGTTTGGCGTTCCCGCTTCTTCGTGTTCGATATTCTATCGTAACGTCCAGTGGGCTTTCTGTTCGTTTCATGCACTTATTACCACCTTAACCGCCTTTGGCGTTGCAGCAGCGTTTCAGACGTGCTGTTGGTTGCACTGCTGAGCCTGCACTATCCCTTTCTCGTTGTCCGCATCCTCAAGCGCGACAGCTGAAGCTATATCTTCTGCACGGTATTTTGCCCAACGTTAGTCTCAAAGGTACTTTGCCACCTTTGCAGCTCACGCAAGCTCGTGTGAGCTGGGAGGACTCATTCCGCAGCCTCTGTCTCCGCCTTCGTGATGCCGTTGACGGCACTCCCGCCGCCGCTGTTTTGCGTGCCCAACAGAGGCGGGCTTCCATGCTGTTTCAGATGACCTTAGCATTCGTCTCCCGACGTTTTGCCTGAAGCAGAATTTTTCCTTTGCAGCCGTTGCCGCAGGAAGCTGCACGACCGGCTACTTGATGCGTTCGTTGCGCCGTATTTTGCTGCCTCTTTGAGGCCACCGCATCTCGTGCTGAAGGCAGGGCGCGTAACGCTTTCGTGGCCGCGGTGCGGGGCGGGTTGAATGGGTAATTGTTGTGACGCTGCAGCATTCGGTTTCTGACGTTTTCGCCGCACCGGCACTGGTGGCAGCCCCCGTTTTTGGATAGCGGGTAGCCTTAAGCACTTTTCCGCTTTCAGTGGCCTTTTAATGCCGCTTCTGCGCCGGAGAGGACGCTTCCTGATGAGCTGACGATCGCAGCCTTGTCCGGCGACGTGCTGGCGGCGCGTGCTGAGCGGCTTAGAGTGCAAGACGGTTACAAGGGGCCGCGGTACCTTACATGGCAGCTGATGCACTGGCATCGCCGGCTGATTTCTTCGCGTCTGCTCGTTCTCTGTGCCACCACGACGCGTTACGCGCCCTCTTCCACCATCAGTTCGACGACGCAGCAGCCTCCGGCCGGGCATCATCCTCCGTTTCCTGGCACAGAAAATGGATTCAGCGTCCCCGGTTGAATCTTCATACACGGTGATGGTCCCCGGCGTGCGATGGTGGGAAAACCGTCAACCTGCAGGAAGTACTGTACTGACCGTACTCCACAGCCGAGGGTACGCCCGGCTTCATCCGGATTCTCTGAGCCCACCGTGTTCACCACCACCGTGGTGTAGTTGACGTCTGGCTTTCACTATGAATGGTGCATAGTTCTTACCCTTTTCCTGTGCCGTCTTTCAGAACTCCTGAAATCTTTACTGCCATATTCGCCGCTAAAGCCCACCGGTTCCGGCGGGCTGTCAGCACTGTGTTACCTGGCTAATCAGAATTTATAACCGACTCCCAACGATGAATTGGTCAGTATCGCCAGTCGCCGCCTGCCGGATAGCAAGAAGGTAACAACGTGAACGGACGGTGCCTATTAATCTGTATACCTGCACTCCAAAGCCACTGAGGTATGCCGCATTGCAGCACTTTCGTCCCTGGCGTATTACCGTCCATTTCATAGATATACCCGGGGGTGGATTTCCGTCTTAATGGATCGCTGTACTGCCGCTACAAGGCGACTGTAGCCACTCCGGCCATGGCGTACCGCACTCTACTGCTTACTGATTTGTAAAACCGCCGTTATCATGACTTAATACACATGGACGACTCACCGTCCGCATAGAACGAGACATCCTCCCCCGGTCATCACTGTGCTGCTCTTTTCGACGCGGCGAATGGAGCGAAGGAAGCCATCACCCCACTGTCCGTCAGCTCATACGGTACTTCACGTTAATCCCTTTCCATATTAACTCACCGGTATCCCGCCCGACAACGACGGCACATCCGGTTTCGGCTGCTGAAAATAGCCCACCGTAAACGTACCATGTCCGTCCTCCGCACGGTAGGGGATGACTGTCACCGCAAGTGCGGCAAAGAGAAAGGCAATACAGGCACTCGCATCGTTCGCCTCTCACTGTTTATAATAAACGCCCGTTCCCGGACGAACCTGTAACACATAGCCAGACCACGCTGATGCCCGCCTCGTTTCTTAATCACCATAACCTGCACAACGGGCAAACGTATACGGCGGAATATCTGCCGAATGCCGTGGACGGGCGTGAACGTCAGGATCGCGTTTCCCCATTCTGAACGCGTCAACAATACGGGGAGAACACCTGTACCGCCTCGTTCGCCGAAGCCGATAAATCACGCACCCGTTCATCAGTACTTTTGAGATAACACATCGAATACGTTGTCCCTTGCCGCTGACAGTACGGGTTTCAGCGAAACGTCAGCCGGATGAGGCGAAGCACTATTATTGGCGATCAAAGGATGGTCATCGGTCACGGTGACAGTCACGGGTAGCTGACGGCCAGTCCACTGCTGCTTTCACGGCCTAGGAAAAGCCGGACTAGCCGCCGCCTTTACAATGTCCCCGACGATTTTCCGCCCTCACAGCGTACCGTTCTGAGTCGCGTTGGACGGTCAGCAGTACACTCCAGGGATCCCGGGGTTCGCATTCACTGCCACTGATATCCGCATTTTTAGCGGTCAGCTTTCGCGTCCGGTGTTAGAAGGTAGAGGATTGCCGCATGATGACTGTACCGGGTGATAGACCTGTTCCCGAACACGTCGTTCATCGAATATCTGTTATGCTCCTCGACAAACATCTATAGTTTCAATTCCCTATTTCACTGTACAAATAAAGCGATACGATTGGCCGACCATCCAAGAACTTATCAGCTCTCCTGTTTGGTTCTCCTGTCTCATTGCCTGCTACATGTACCCCGCAGACATAATGTTTCACGTCTGTTGGTCCTCAATTTGACAGCCCACATGGCATTCCACTTATCACTGGCATCCTTCCACTCTTTCGAAAACTCCTCCAGTTAGCTGGCGTTATCCTCCGTCAGCTCGACTTTTTCCATCATCGGTGCCGAGATGGGATGGGTTGCGTCTATCCGTGGGAAAATCCAGGTACCTTCCGCATCATCGCTCGCCGACCGACGGCCTCCACGAATGCCGATGATTGCCACGGCCGTGTTCACACTGCGGATATAAAGTAATAATCATGGCCCGGTTACTTGGGTACTGAGGACTCGGGTCCAGTACAGCGCCGTACCAATAACGCGTGCTGGTTTCAACCTAGTTAGATATCCGCAATCTGCTTTTCCCGAGAACCAGAACTCAACTGTACCGTCGGGTCATAAACGGCAAGTGCGATGGGATGGGGGAGAGTACTGGAAAAGAGCCGTCACATAGGCTCAATCCTCGGACCGTGTGCTGCCGGTGCGGCAATCCGGAACCGATATCCGACGGATCTCTGAGCCTGCTGCCCGCATTTACCGCCCGGACTGTCAGCCGTAGTTCTCCAGGGTTGCGTGAAGCGGTATGTGATTCCGGTTCTGGTTCCCTGCGTTAGACTCAGCCGCTCACTGCCGTCGTTTAACGACGTTACCGTTAAACACGCGGGAGTACGCCCTTCACCTGCTTGTCCCATCGCGCCAGCAGCTGATATTCCCCAGGTCGCATAGTACTTGCGTCGGGTCAGTCGAGGCTAGCACATGGCGGCGTGACACCATTCACCGTGCCCTCTCTGTTCGCCGTCAAAGTGCGCCCCGTTATCCACGATGGCCTCTTTTCCGGCACATGCTGCACGCGGTGATGGCATACGTGCCGTCGTCGTTCTCACGATACTCACGCAGCGGAACAGTCGATCGCGCGGCTTCATCGGGTGGCATTCATAAGCTTCATCTCCACGCGGCCCTGTATTCAGCAACCCGTCAGGAACACGCTAAGTACGCTGCCAAGCCGTCGGTGACGGACTATGATCCTCCACGCTGACCGGATTGCCACTTCTCGTCAACCAGGCTTATCAGCGCGGTACCGATGATGGAACCGTGATTTCACGGCTAGGGTCGGGGTCAGCGTCGGGGTCTGGCTGTTCACTAGGGAGCACGACCACCGGTGCTGATACCGGCATAGTCATCATCGCAGATTTCAATAACATCACCGGTACAGGGTGAAGCCCTTCTGCGCCGACGCTGAAATCCACGAATTCGGCATTCCCAGGAATTCGGTGTTCTTAATCAGCCACAGCCCGGCCGGTGCGCCTGCCCCGGCTGGTACAGCCAAGGGCATCCATCTTCGTAATAGATCGACCGTAACGGGCAATGGCTGCGTATCTTCAACAAGCTCTGTCGCCGTCTCCCAGCCGTTGTTTCGGGTCAATCCAGTTCACCTCAACGACGCATTATGGCAGTCCTTCAGGGCATGAAGCTGTAGCGGAACGGCACGCCATCATCCGGCATCACCACATTACTGCCGGTTATAGTCCACTAGAATCCCGACGCGTTAGCGCCGCACGAACTATGGTCGGCCTTCTGCCGCGTTCCGCTCATACCGGCATACAGCGCATCACCCGGCAGAGACTTGGCTGAGCACATCCCACGCCTTACGCTGTGGTCAGGATGGGCATTACAGGTAGTACCACGGCGTAGCGGCGTGCAGCCAAAGCCGTCCGGCACTGACTGGTCGCAGTACTGGCCGATGACATACAGCGCCCATTTATCTACCCATCACCACAAACCTATTTCCCATGCTATCGATGGGTCGCATATCCCAACACAGACAGCCATGTTGTTGCTGTGCCGTTAAACGTTCCGTCCCATACCCCGAGCTTACCCTCCGCGCGTCTTGAGTAGTTCGACGGCATCGGGCAGAATACGCCCGCGCAGATGATAATTAGAGCCCTGCTGGCTGCCGAACTGCTCCGAGTCTACCTGCACGCCGACCAGTGCCGTGTTCGGCACTGTTTCACATCGATGATTTCAGTGTTGACGACCAGAGCGTTGTTCTGCTGCAGCTGGTCGTGGTGCTGTCCGGCGTCATCCCCTGCGCATCATCTGGATATTAAACGGGCTAGGTAGTACAGGTTACCCATCACACCGAGGCCAGATACTGCAGGTGGTTGGGGCGGGCACTAGTGATCTTTGCGTTCTACCCAGCCGCGTCCGTGCTGGAACCAGCAGGCGACTTCCGACGATTCCTGTCACCCTTTGAGGTGGTTCCACCAGTGCCTGTACACCGAAGGTAAAGGCAAGACGGTCGATGTTTGCAAGTGATTAAGCTGGATAGATCGGGCGTCATATTTCACTTCCGTACCCCAAGCGTCTCGGAGCCGGAGGATCAAATTCCCTCAGGCCGTATTGCTCCTATCAACCAGCCCCGGAACACCACCGTGACACCGGATATGTTGGTATTCCCCAGGATTATCCCTCATTCTCTGTTCACAGACCCTAGTTTAAGCCATCCAAGCACTCTTCAATTCAACTGTCGCTGATGGCATCGATCACACTCAGCAACTGCGTGGACTTCAGGTCCTTCGCTTCGCGCGGGGTCCCTTACTGCTTCCTTTACCCATTTCCTCACGCTCCATAAATGACAAAGCTCCGCAAGCGAGTCCGCACAAAACATTTTGCATCAGCGACCAATCACCACAACCTGACCACCGTGATCCCGGGCCGTCTGCCGTGCTATCTCCTGAGAAACCACGCGTGGTACCGCAATCGCATTTCCGATTAACCCTGGACGGCAAGACATTGCCCTGGGCAACCATGTTATCCAGTGAGGAGAAATAGGTGTTCTGCTTACCGTTGTGACCGTTGTCTCGGGAGTTCGTACTGGCTTTCATAGTCAGAGCATCTGCGCCACCACCGAGACGCACCATACTGGCACCCAGAAAACAGGATCATTCTATAAGCACCCAAATGGCTGCCCCCATGCTGCAAGGCTCCGGCGGTAAAGAATGATCCGGGGATGGCGGCAGCCCCCAGACAATCTGGAATACGCCCTGACTTGGCCCCGGCGACTCTGAATACATACTGGCATTGAGCGCCTGACAGGCAGAGTCTCATGTAACTGCGCCCTTTCTGCAGGTTACTGAACTGATGACGTCTGCCCAATCGGAGAGGATGTCAGTCCTTATTATCTTAACGAAACTGATTCTATCAGTTTCTTACCAGAAACGGGAGGTTGTAACTAGAGTGCCATCATTCAGCCCCCGTTGCAGAAGTCGACGGTTAAGCGGTAACAAATCGTTGTAAATCCCCAAATCGAAGATGCGCCATGCCCGGTGACAGGGATGTTAGTCGGTTAGAGCCTTCATGTACCTCGTTTGCTCCGCGTGTTCCGGAATATGGTGCAGCAAGCCGCCGTCGCCCGCAGTAAATTGCGGGGTGTCCGGCACTGATGAACCAAAACAGCAACAGCAGCACATCTCACGGCTGTGCCGGCACGGAAGAGGCTACAGCCCCGTCGCCTCCATATTATCCAGATAGAGATTGCTTAGATTCGCCACCAGTCATCCTCACCGATGAAAGTCCGGCATCTCAATCCCGCCATGATAAGCATCCGGAACAGTGTGTAACAGTCCGTCACCGTGCTCAAAGCGCCGCCCGGTGAGATGCGGCACACGAGTGGGATCGGTTCTCCCCGGCAAGACCAGCCACGGCAAATCAACGCAGGCAGCGAGCCGGTCGAGCTTCAGCCAGGCAGACTCACAACCGGCTTGAGGTGAACAGCGCCACAATCTCACTCATGCATTTCTGCCTGCAGCCAGTCTTCCGGCGACATACGGAAATACGCTCCGGCTCACCGGAGATATTCACGCAGGGAAATACCTTTCCCCTCCGATTGGGCGTGCTTACCACGAAGCCGCACGACTCCCGCTGGCACAGCCGGCCGGGCGTGCTACAGAAATCGCTGATTCTGTCTGTGCTTTCGGCTTCTGCATTGCGAAGGTCTTAATGGGAAGGAAGCCGCCAAAGTTGCCGAGGACGTTATTGCGGAACTTACAACCCGCTCAGGCATTTGCTGCATTTATCCTTCGTGATATCGACGTTGGCTGGTCATATTCATCCGCGACAGCCGGACCGCTAACCGCACTCGTCTACCGCGATAGTCCAGGTGCATGTTGAGTGAGCATGATACGTCCTCAGGGGAAAAGCGCCATCCGTTTCCGTCGATTAACAGTACAAAGGAGGCACTCACCGCTCAGTTCAGCAACTGAGATGCGCGGCGACGGATCAGCCTCCTGCTCCGTACTGAGTAACTGTTTCCGTTGAAGGAAGTTCACGCATCCAGAAAACGGGCGTAAACCTTACGCCGGACCACCGTTCCTAAACAGACCTGCATATCTTCCGCCATCCCGGTACATACCGTACAGGTTAGAAATACAGTCGGCGTGGGGCTAGTCGTCATACTGGTGCCTTTGCCGGTCGATTCAAACCGCTCCCTGAATGGGGATACGGCTGAGCCATACTGCGCCAGGCGACCGGCTCACCTTTTCGTTCCTTACTCACAGAGAAAAATAACGTTCTCCACCGGCTCTCTGTCCTTAGATTTCCAGAGCACGCTGGCCGACTGCTCCGCACGGGTGCATTCATTCAGTGTTTCCCGTCACATACCGTTCTTTATT * tp:A:P cm:i:111 s1:i:1072 s2:i:0 NM:i:2568 ms:i:3556 AS:i:3565 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
106 97 16 utg000001l 31 60 49S5M1I22M1D20M1I2M2D5M2D32M2D1M2D21M3D6M3I12M2D17M6D3M1D14M3I9M3D3M1I4M2D6M3I20M1D5M2I15M1I4M1D7M1I9M1I6M2I1M1I19M1D13M1D4M1I37M1D2M1D11M1I5M1I5M2I4M3D8M1D6M1D1M2D14M1D8M1D7M2I1M1I14M1D3M2D4M5D5M3I12M1D7M1I9M3I44M1D15M2I8M1D10M1I6M1D9M5I2M1D14M2D5M2D12M1D14M1I18M1I3M2D8M1I33M2I3M1D22M2D1M1D17M3D13M1D10M2I8M1I12M7D9M1D20M1I9M2I7M1I18M2D6M1D24M1D8M4D3M1I13M1D16M2D1M1I7M1D1M1D3M1I9M4I2M1D2M2D3M2D6M1D4M1D16M1D9M2D22M1D15M2I5M2D6M1I14M1I6M2D6M1D4M5D4M10D3M3D7M3I12M2D4M2I12M1D9M1D11M4D3M9D4M1D1M3D11M1D1M3D6M5D1M7D1M2D9M3D4M1D2M2I9M2D1M3D3M1D11M1I13M4D18M1D6M1I1M1I1M1I15M2D18M2D4M2D2M1I5M2I5M1D3M2D14M1I13M1D9M1D18M2D9M2D1M1D3M3D7M2I1M1D37M1D6M1I19M3I5M1D1M2I5M2I2M2I11M1D5M5D6M5D17M4I2M5I3M1I40M1D3M1D14M1D7M1I3M1D3M2I6M3I11M3I12M1D22M2I15M1I7M1D3M1D10M1D3M1D24M2D4M1D10M2D13M2D4M1D10M1D3M1D18M2I6M1D9M1D17M2D13M4D7M1I2M1D10M3D1M1D6M1I5M2D9M1D16M6I5M1D9M2D5M1D3M1D9M1I3M1I3M1I21M1I2M1D6M1D3M1D6M2I2M2I5M2I3M1I4M2D6M2D2M1D12M2D9M4D6M1I3M1I1M2I13M1I2M1D5M4D1M1D9M3D13M1I6M1D1M2D6M1D3M4D5M3I6M1I8M1D1M2D4M1D3M2D3M3D5M2D4M2I1M1D3M1D11M1I12M3D8M1D4M1I9M1D9M7D10M2I7M3D2M1I8M1D3M3D10M2I2M3D4M1I2M2D25M2D10M2D11M2I12M1I8M1I7M1D8M1I11M1I1M1I21M1I14M1D15M1D6M3I35M4D42M4I7M1D5M1I5M1I5M2D17M2I4M1I7M1D18M1I12M4D4M2D1M1I3M2I24M1D5M1I9M4I1M1D6M1D2M1D1M3D1M2D6M1D3M1D3M1D12M1D1M1D7M1D5M1I8M4I14M1I14M1D2M2I8M2D3M2D3M1I13M1D16M2D15M2D5M3D11M1D3M3I4M1I3M1D5M1I2M1D13M1D18M3D18M1D1M2D5M1D7M2I8M2I11M2D7M1D16M2D22M2I19M3I9M1D16M3I20M5D2M2D8M1D13M2I13M1D12M2D10M1D6M1I9M1I15M8I6M4D3M3D14M1I2M1I5M1I30M1D6M4I1M1D14M3D10M1D13M2D4M3D9M3D8M1I3M5I3M2D6M1D5M1D25M4D18M1I11M1I7M1I22M2I4M1I4M1I11M1D7M3D2M1D32M2D3M4D3M2D3M2I5M2D3M2I1M2I2M1I7M3I5M7D14M1D7M2I18M1D21M2D8M1D11M2I34M2D15M1I7M1I7M1D2M1D1M1D15M1I6M1D1M1D7M1D4M4D46M1D20M1I18M1I9M2I1M1I16M3D9M2I3M1D4M5D5M2I13M1D12M1D7M1I7M6D7M3D9M1I18M3D1M1D1M1D19M3I3M1D6M5D2M2D16M3I2M1I17M1I5M2D8M1I15M1D7M1D7M1I22M2I3M1D7M2D4M2D7M1D2M1I32M1D13M1I9M2I22M1I13M4406S * 0 0 CGATCTAGCTTAATACCCCGAAGTACGTAAAGTGATAAGGAGCTAGTTAATATCATACAACGTGCGTGGAGGCCATCAACCACGTCAAATAATCAATCTACCGCATATCGTATTAATTGATCTGCATCAACTTAACGTAAACAACTTCAGACAATACAATCAGCACACCTGAATACGGGGACCTCATGTCAACGAAGAAGACCCGCAGAACAACACGAAGCCGGACATTGCTCCCCAAATAACGATTGAACAAATTAACATCGTCGGCTAAAAGCCAGTCGGGAATTTCTAGCCTGGTATAATTGAATGCCTGCCGTCGGAGACTAACGTCAGAAAAAGAGCATACATATAATTAAAAGTGATGAAGAATGAACATCCCGCGTTCTTCCCTCCGACAGGACGATATTGTAATTCGTATGCTTACTCGGAATGCAGCATATCGTCTTCATTGCGTTACCACTTCCTCAATCTAACGACATGCGTGTTGTGCTGACCAACTTCTAAATAGTTTGATGATTAGGCAGTTATGGCTGTGATCAGTCAACCACAGGGAATAATCCTTCATATTATTATACTCTTGATTAACGCTGCCTCAATTGCTGAATGCTTCCAGAGACACTTTATGTTCAGACCTCATGCAATTACAACCAGGGACTCATAGAAATGGTGCTATTAAGCAGTTTTTACACGAATCAGATCCACCGGCTTAATACCAGCAGATTATTCTTTATTCATTTTGTCCCTTCCATCGCGCTTGCTCTTCATCTAGCGTCAATATTACTTCAAATCTTCTGTATGAAGATTGAGCACATAGTCGCCTTACATACATCTGTCGGTTGTATTTCCTCCAGAATGCCAGCAGGACCGGATTTGTGGGTTACGCAAACCAATACTATTAAGTGAACATTCTAATATTGACATAAAGTATCAACAACACAGGAGACCAGATTGAACGATAAAACGATAATGCAAAAGCCCGCCTCGTACCACTGGAAGGTTTTACAATGGCTCAGGTTGCGTTTAAAGAAATATTCGATCACTTGAAAGATTTAGACTGTGAATTGTTTTATTCTGAACTAAGAACGTCAACGTCTCACATTATATTTGAGTAGCTCACAGATAATATTCACATCGTGTTGAAATAAAGCGTCAAAGAAGGAAAGGTTGTAAAGCTAATTCTAAAACTCACGCTAATTTGTTTAAAGTAAAGGTCGCATCGAAATGCTAAAGGATTACTGCCTATCGTAATTTGATGAACATAAAAGATATTACTATTTGATAATTCATTACTATTACTGTATGAAGGATTCAGAACACTACAAATCTTTCGACTTAGAATAGTGTCCGACCCGGTTTTCTTCGTGTCAGCACCGGGGGCGTTGGCATAATGCCATAATTGTACGCGCTAAACCCTGTGTGCATGCCTTTGTTTATTCCCGGACACTCCCCGCAGAGAATTCCCGTCAGGGCTGTGACATACGTTAATCCGGGAATACAACTGACGATTCATCTCACTACGTCCGACTACAGGATAAATATAGGACAACCCAACGCGTAAAGCCGTGGTCCGCTTTGTTTAATTTTCTACACATACGATTCTGCGAACTTCAACGAGATCGGAATAACACCATGAAAATGCTATCCGCTACTGCGCTGGCCCTGCTTATTACAGGATGTGCTGAAAGACGTTTACTGTTCAAACAAACCGGCAGCAGTAGCACCAAAGGAAACATACCATCGTATTTCTTCGTTTCTGGAATTGGCTAGAAGAACTTCATGCTGCATACATTTGTGGCGGCAGAAATGTTGTCAACGAAACCCAGCAAACATTCGTAAATGGATTGCTCGGTTTATTACTTTAGCATTTACTCATGGAAGCGTGTATTAGCCAATAATTGCCTGAGTTGCCATTGATATGGGCACTCTATCTGCACTGCCGTGGGTCTGGTTTACTTCTATTCCGCCTTTGTTTTGCCAGCTAAGTGATCAGCCTCTCTCTGAGGGCTGAATAATGCGTTCAGCTGTCTTGGTCTCGGCCTATTCGGGAGGGCTTATCGCCGGAGAGTGGTGGCTTCACGACTGACTAACGACTGCTTTGATGTGCAAACCGACGACCACCTAACATCATCATCACGGACCCATCACTTTCAGCTGTGTACTAGACTCCTTCTATTTGCATCGAGCCGGATAGCAACAACCACTGACGCAATATGCAGAGTCAATTGCCGGTTCGCCAGCTTCGTTTATCGGATTGTCGCGCTGGGCTTTGTCACTAGCGTTACTCAAGCAGCAACCTAGATGACATGAAGACGATGTCGATGCAGATAACCAGCCTAGATAATTCTAGGTGACTCTGCTCATACATCAATCTCTGTAACGTTCGACGGATCTTTGAATTTGCACATTCAGGCTGTCAGCCTTATGCTCGAACTGACCATACACGCCCGGCATTGAAGCCCAGATATTATGCTGCAACGGTTCATTGCCTGACGGATATCACGATCAATCATAGGTAAAGCGCCACATGCTCCTAATCTTGCTGCCGACATGCCAAGCGTCCTGACTTTTCGCAGAAGTGTCCTCAGGCTTAAGCTTGCTTGCGGTAGGCATCCCACCAACGGGAAAGAAGCTGAGTCCAGCCTATGTTGATTTGAGTTTTGGGTTTAGGTGACAAGTTTGCGCTGATCGCATGGAGTAAGCTTAATCTCTCTAGCCACCCTATGATCACCGGCTTCTCTTTCTGTAACGTGGTCGTTATCAGATTCCCCTAAAGCACTCGGAGCATATCGGAGCCTTACGTTGATTATTACTTCTACGCTCTGCTTCTGGCTTTTTACCGACCGAGTTTGATAAGCAACAGTCAATCACGGTCAGATAGGATGTAGCCGATAACACGCTCGTTATAAGCGATTGCTACTTAGTGGGCTATTAGGAGGTACGAATGAGAATAAGACCGAATGACTTGTGGCCACCCTAATCGTTGCGTCGTCGATTACTGTTTTGTAAACGCGCACCGCCATTATATCTGGTTACGCGAAGGACCCCATTGCAAACGCAGGATTGCCCCGATGCCTTGTTCCCTGCCGCGAAGGCGGCCAACAGTAGTTTTATCTTTCTGGCATCTTCATGTTACCCCAATAAGGGATTTTGCTCTATTTTAATTAGGAATAATAGAGGCCGTGATTACGAACAAATCCAGGCTACTCGTTTAGTAATCAGATTTGTTCGTGACCGATATGCACGGCAAACGGCAGGAGTGTTGTCGACCTCCTGCCACCCCGCTTCACGAATCATGTGTAAAGGCCGCACCCAATCTATTACTAATGAATTCATAAAGACGGTGGCTACGGCTCAGTTTGGTCCTGTTGCCGGGCGGCGGATGACGCCTGTACGCATTCGGTACTAGGGTTCTGCTTCTGTAGATGCTATTCAACTATCATTCAACAACGCAAACCCGACTTGGCTAACCAGGCTCGACTCTTCAATTACTATGATCGTATCCTCGGCCTTCTGTGCCAGGTCTACACGGAAGCGTCTCGTCAGGCTCTAACTATTATATGCGAACTGTTTCGGGATTGCATTTGCAGATCTCTGCCTGCGATGGTTGTTTAGTTCCAGACGATACGTCGAAGTGACCAACTAGGGAATTCGTAGTAAGCGCCGCCTGGTATTCACTACCACAACGAGCGAATCTAATACTATTCAGTAAATCCAATTTATTCAATAAGTCAATATCATGCCGTTAATATGTTGCCATCGTGGCAATCATGCTGCTAACCGTGACCGGATTCAAATGTTGTCTGCGTACCATGATTTCTTTGGATTGCACCAGAGCAGTTCTATAGGACAATTTGCGTGACCAGTGGTTGGGTAAGGTTTGGGATTAGCGGGTACAGCGCGTACCTGCTGCTGCTGGCATCCTTGAATCGACGCCTTTGCATCTTCCGCCCACTCTTTCTAACTCCCCCACAGCTCTGGCTTTGTGGCAATATCAACCGGACCGTCCTATCATGGCCAATCTTGCATCTTGCCCCGTCCCGTCGCGGGCACTACGGCAATAATCCGCATCTAACGCTTGTCAGCACTTGCATACCTTTGCCTTAGTATTCATTCAAGCTCTTGCCACACGGTATTCCCCGATACCTTGTGCGCAATTGCATCAGATAGTTGATGGTGGCCTTTGTCGGTTTCATTCGGGGTCGATCGAGTCGTGCTAGCAGCAGAAGGCTCGCAGGAGTAAGGAATTGGCGGGTCGGCTTCGCTGCGTATGCATATCCGTTGCAGTGTTCGAAGTAGGTGATAAATGTTCGATTTAGGGCTTAGCTCCAGATGAGGTCGGAATGAAACGGTTGCTGCGGCTCGATGTGCGTCCTTCTATTCGCATGGGGTTGGGGACCAAGCTTTGATGCGTGCAGAACTGCGCTTAGATGGAGTCACAGGCGGTCCGCAACGCTATCCATGATTGCTGTGTTGACTTGGACCATTTGAAAGCGTCCGTGGGTGGGCATCCCTGGATCACCCCGTTCTGTTGCTGCGATCGGAGCGGCCGCGATCCAGGCGCTCACGAGTAAAGCGGTCAGAACTCGTATTCAGCAGCACGGATAATCGGCGTGCAGATAACCAGCGGAGGTCCGTGGATCCATACTTCTACGGACGAATCGGCTGCTTATTGTGGAACCAGTTGTTGAGAATTGCGTGGATTAGATTAAAGAAAGTTAGATTGATGCAGCAGGTTGATAGGAAGTGTTGCACTCTAGAGTGCAGCATGCAGTAATCAGATTGCTGGTTGCTTCACGTACAGCTAGGCGGAAAGTGGAAATTTTACGGATTCCATGATCGAAATGTTGCTGCAGATCAATAACGTAAAGTCCGGTACGGTTAAGGATGTGGCTTGAATGAATTGGGTTCGTCGGTTATGTCCTACGGTTCGGGGCTGGAAGTGCATTGCCAACCGAATATCGCGTAAGTTACTTGCTGCCAGAATCTAGTGGGTGATCCGATCGCGTGCGGTTCCGGATGCGAGCAAGCTGCTAAGAAATGCTAGATTGGCTCCTCTTCATATTTCCTAGAGCCTGCACGGTTCGAGGAATTACGCGTAAGCAGTTCGTTATTGGGCGGGGGAGATGCCTGATTGCTTCGCTGTAGATGAGTGCAACGAGCAGCTCGAATTCATTTAGATTTGAGAACGGTTCGTGCCAATCCTGCTCGTTGCAGGTCTTTTAGGTTTCGGGGTGGGTTCGGTTCCGCTTGATCTGCCTTGCCACGCGCTGCTTGGAGAGTGAGTCGGCGTTAGCCAGGGCATTCGATTCGGTTGATCGCTTCCTTTGCAGCTTCGTAGACCCATGCAACTCCGGTAATTTATTAAACCGAAGATTCCTGTAGGCGCTCGATGCAAGACCCGGATTGCCGTGAAGTCGCGTTCATTAATCGGGAGAGTAGGGTGTCCCTAAGCAGTCAGTGTTATTGCGTCAATGTTGTGACGTGATTGTTTACACCGGCTAGTTCTAACTTAAGATGGTAAGGTCGTCGCGTTGCTCGTGCGGTTGAATCCGTGGTTATACCGTTGGTCCGGCTTGATGGCATTTAGAGTAACTTGCGGCCTAAGGTGGCTTTAGAATAGGGATCAGGTCGGGGTCTCGCTCCTCGTGTCTATTCTTCCGCGCCCTCCCTTTGCGTTCCGATGCGTAGGGCGTTGGTCTGTCTTGGAGTTCGACGCTAGAGTCAACGAGATGCAGCACCGTACGCGATTAGAAACCATTCCCGGCCAACTCATTCGAGTGGATGGCTGGGCGCCATCGAGTACTAGCTTCTCCTGCGGCGCACTGTTATCGGGATCGCTGATAGTCAGTTCTCGGTTCATGCGCGGTACACGCGGACTTCCTTTAATTTCATCGCATCGGTTTTGGCGATTCCCGAAGTCGCTCGAGGTAGAATGCTCCGGTATGGGCTGCACATGCGATCTAGTTACAAGTTGTGCGAATCTCCGTTGGCACGTCAAATTGGTGGCGAGACCGTACTCAGAACTGTCGGTCCCGTGAGGTCGAATGATGTGTGCAGTAGATCGTGCGCATGTGTTCGGGTCTAGTAGCATTTCGGATGGTTGCCGATTAGAATCAGTTCGCATTCGTACAGTGAGCCTTAGGTATCCTTTAGCTCGAGACCTTGCCTCCTGGCGGGTGTAACATGCGGAGGGGCTGGATTGGCAACTGTACGGATTCCAGAGGACCGATGGATGGTCGCACGCTATAGTTTATTATCTTCTCCCTGGATCAGGCAAGCATTGCAGCGGATGCCCCGAACCCGAAATCAATGCCTTGCGAAAATCAGTCTCGGTTGACTACGGGAAAGTCCGTATTGAAGGGCGGTAAGGTTAGCGATACGGCTGATTAATAGGTCCTGCGGAAGACCTTCGCGTCACCGTTAGACATTGCTTCCGGGTACAGAGACCCCTTAGTTTCCCGAGCGAGACTAGATCTGTAATGCTGAGGTACGAACGTGCCACCGACGCTTCCAATTCTTTGATGTCGGACGGTCACGCTGATGTCGCGTAGCACCTCGCATACCAAAGTCTCACGAGTCCGTGATACTTAAATGGCAAATGTAGAGCCGTTGCTCGCAGTCCGGGCGGCGTTAGCGTCTACTCCGGGCAAGCGCCACGTTGTGTTTGCAGTACTCTGCGGGGCACTCGGAGGCTGGCCGAGTCTTATTCAGTCCTATATCAGCTCTGCGATGCCAATCGACTTCTGTGGGGGCATTCCTGCATGAACCCGGTTACAGTTGGTGAATGGAACCAGTTTTAATTGGTGAGTTTAAGAACGGCCTGGAAGGTCCGCTTTATGGGTCCTGGGGCCATACTCAAGAATCGGCTTGGGAACAGCAGGTCTGGTGAAGATATCCTTGGTACTGGTTACGTATGAACCATTCGAGCGAATTGGGATAGAGAGACCTGGACAAGACTGCAGGCTATAGCCAGGGTCAGTCCCAGAACTTCACGATTCGCTTCCCTGAACCGAGACCCGACGCAGTCCGACTCTTACTTGCCAGGCAGGAACTATAATGCATTAGCGTTGCCCCGCGCCTTGCTTCATTGAGTGACACCTTTGAAATCCGCTAAGGTCAACGGACGAAATACTGAGTGCAGGACCTCACCCTTGATCCCTCTTGTGATTGCCTCTCACTGCCGAGGTCGATGCTTCGATTGATTGAGACGCAAGTGCCCCAAGGGCTGAATGCCATTACGATAGCGGATTAGCTTTGGAATAAAACTCGCGCCGATCAATCGAATGCGCCTATGGATCAATCGTGAGGCCGGTTACAAGCCATCCTAAAGGATCTAGGAACAATTCAGCCGCCTTAACCCCAACACTGCCGGTTTGGTTCGCCGCACTCAGCATGACCAGTACGCGCCATCCAATCCGACGGAGACCATATTAAGTACGGAGAGCTTCCTGAGCGCTTTCGATCTCGCTGCTTCTGTGCCGCGAGGAGGCTGATACTCGGGATGGTGCTTCTATTATCCAATCAAGCGCCGTACTCGGTGACCCTTGTTTGCTGATGTGCTGCTTTGGTACTGAACTCGAATAGCGCTTTATTTGGTTGCATTCCCTGCGCGTAAAAGAAGGCGCTTCTCAACCCATCTAATGAGTTCAGTCATGTCCAATAGCGATGTATTGGATCGGATACCACCGGTAATTACTCACTGTGGCATTTTAAGGGGTAAAGATTCCTTACCGTATTTAAAATCACTTCTTTAGCGGGCCGACTTCTTCCCATTTCCCCGGGCCTTCAGAAATGGGGTAATAATGTATCGCCAGAGTTACCCCATGCGGAGACCAGAATTCAGCTGAGATGCTTTATCCTGAATCTAGAAGGCGCCTTCAGTACTGCCGCTTCATTCAGTCGCAACCGTCCACGCGCTTTAACCAAATTTATATGCTGGTGCGGTATGGTAATCACGGATTGCCTACTCGCACATGGAGGTCATTACGCTGTGCCTATCGAACCGCTGAGTGCACTCCGGCTTCACATTTGGGTCAGCTTAGCGTTAGTCCCGGCACGATTAGAGTAGTTTACTTCAAGGAAGTTGACAGCCTATTCTTTTGTCAGGGACTGCCTGATTTAAGGATCGCAGTCAGGCAACACGCTTCGAATTTTCCATTCCGCGTCGAATTCGGATCAGATCTGACCGTACCGCATTTTATTGCATACACTGTTGGGTAAGATGAGTGTGCCTTGCTTCCACTAGTACGGTTAACTCTCTGGGTTACTGCATCGCGTATGCGGGCATTTCTAAAGGTCATCAAAGAGAGTGCCGAATGCATTTAAGTCTAGTGGTAACGTGTTCCCTCCGAACAAGGTTGGACAAACTTCACTGGGGCTACGCAGAAATCCATATTCAAATCCGACTCCGCGTTATAAGCGCATGGATGTGTACGCTTAGGGCGGAGCTGGAAACGGAGCAAATCACTGTCACGGCATCGCTATTCAGGGTGATGCTCTTGTCGGTCAACGGTTGAGTGTACTAGCTCGCACGCGCCCGAAACCTTCAGTAAAGCGCTCAAACACAAGGGGCTAGATGATCTGGGGCTCTAG * tp:A:P cm:i:67 s1:i:616 s2:i:0 NM:i:1198 ms:i:1974 AS:i:1974 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
107 98 16 utg000001l 16 60 72S14M1I6M1D20M3I11M1I36M2I11M1I7M2D17M1D7M1D5M3I5M1I5M1D24M2D1M2D11M3D9M1I3M2I4M2D4M1I10M1I19M1I11M1D8M1I27M1I1M1I17M3D50M1D4M1D14M1I11M3I3M5D5M2D26M2I3M1D8M1D9M6I13M3D6M1I34M1D18M1I42M2I9M1I10M1I10M1D6M2I10M2I27M1D16M2I7M1I9M1I8M1D37M1I3M2D20M1D19M2D38M2I9M1I2M4D1M2D2M3D23M1I32M1I17M1I18M1I6M1D1M2I5M1I3M1I25M2I26M2I4M2I4M1I3M2D2M1D6M1D7M1I14M1D7M1D17M1D7M1D14M1I14M1I24M1I4M1D15M4I8M1I3M2D1M1D6M1I4M1D4M2D1M1D8M1D12M1I19M2I4M1D14M2D20M1D14M1I8M2I19M1D4M1I38M2D59M2I2M2D9M2D1M2D1M1I8M4D35M1D18M2D24M2D1M1D9M1D7M1D5M1I37M3I2M1D5M1D1M2I9M3D6M1I7M3I3M2I24M2D8M1I4M2I6M2D14M1I2M3D2M2D24M1D7M2I24M3I3M1D11M1D7M1I10M2I1M1I2M4I6M1D3M1I3M1I3M2I8M1I3M1D2M1D43M2D50M4I11M2I4M2I2M3D20M1I8M1D3M1D9M2D10M1I10M3I2M3I6M4D2M1D1M1D8M1I14M1D7M1I12M1D6M1D33M1D19M1D20M2D18M3I17M1I3M1I5M1D3M1D13M1I2M1D7M3D11M1I3M2D14M3I7M2I7M2I3M2D4M3D15M3D3M4D11M1I32M1I1M2I4M1D10M1I5M1I11M3D4M3D3M1D11M2I10M1I29M1D5M1D13M3D16M4I9M1D12M2I12M1I2M2D11M1I9M1I19M1I7M3D33M1D45M1D8M2D5M1I11M1D9M1D6M4I12M1I9M1D10M1D5M1I14M1D6M1D2M1I9M1I13M1D1M2I7M2I10M1D14M3D6M1I7M1D4M1D7M1D8M3I13M2D2M1I3M6D2M1D12M3I11M1I1M1I10M1D7M2I22M1I21M1I16M1D1M1D12M1D2M1D25M1D43M1D14M2D22M4D10M2D8M4D3M1D11M5D12M1I26M1I28M4I18M6D16M1D9M1D6M3D4M1D13M4D38M1I2M1I9M3D2M1I12M3I9M1I14M2I3M1I11M2I3M8I6M4I25M1D9M2I8M2D4M3D7M2D5M4I3M1D2M2I14M1D4M1D2M1I38M2I1M1D4M1I13M1I8M1I17M1I7M2D3M1I2M2D7M1I5M2D11M3D4M2D9M3I6M1I12M1D2M1D6M3D7M1D6M4D3M1I5M1I8M1I6M1D9M2I18M1D13M1I9M2D7M2D32M1D20M3D4M1D8M1D10M1D15M2I19M2D3M1D41M1D4M1D33M1I5M1I7M2I4M2I10M1I2M1I23M1I5M2I5M4I6M1I4M1I16M1D7M1I4M1D4M3D13M1D6M1D19M2D9M1D5M1D2M1I7M1D7M2D9M1I34M2D16M1D6M1D8M1I3M1D8M1D3M1I9M2I21M3I15M3I13M1I17M2I12M1I4M1I2M1I2M2D11M1D1M2I10M2D10M1I7M1D2M3I1M1D47M1D8M1I3M1I11M1I1M1I8M1I11M2I12M1D15M3D15M2D5M1I1M1I11M1D3M2D20M2I7M1D9M3I2M1D3M1D4M2I1M1D15M1D3M1D76M2D1M1I6M1I6M3I1M1I9M1D19M7D7M2D6M1I6M1I7M4I13M1D5M1I8M2I4M1I10M7I4M1D13M1I75M1I5M1D2M2I15M1I14M1D53M1D63M3D16M1I6M1I19M1I20M1D1M4D1M2D5M1D2M2I4M1I2M3I1M4I4M1D27M1D30M3D9M3D14M1I7M1D11M1I4M2I19M1I28M3I1M1I19M1D4M2D3M2I3M3I4M1I7M1I4M4D9M2I2M9I32M2I2M2I10M1I16M1I4M2D27M1I4M2I17M1D10M1D21M1I2M2D16M4I13M3D6M1D9M1I14M3I12M2D12M1D5M2I3M1D13M4I7M1D12M3I1M1I8M2I11M3D6M1I3M2D5M1I7M2I1M1D10M2I9M2D4M1D21M1I4M1D18M2D1M2D8M2D11M2D21M3D4M2D6M4D16M3D1M1I11M1D3M3D1M2D5M2D13M1I14M3I10M1D26M1D11M2I13M1I2M2D5M1I7M1D14M1D11M1I5M1I17M1I7M1D1M1D38M1I10M1D6M1I13M1I9M2D5M1I46M1D9M2I4M1D4M1I4M1I4M1D2M1D19M1I7M1I3M1I2M1I10M3I2M2I4M1I8M3I17M3I5M1D17M2I2M1I9M3I1M1D7M1I9M1D6M4I3M1I3M2D2M1D2M1D1M1D13M2D8M1D11M2D20M2D7M1I2M1I13M3I36M2I4M1D1M1D12M4D15M1I33M2I13M2I7M2I1M1I8M1D1M1D6M1D14M1D9M1D8M3D18M1I11M1D18M2D3M1I19M1D3M2I5M1D16M2D23M1I3M2D40M1D2M1D5M6I2M1I22M2I12M2D10M3I5M1I13M1I6M3D21M2D7M2I2M2I2M1D2M1D2M1D8M1I8M1D5M1I2M2I9M1D3M3I15M2I7M1D5M1D8M1D12M3I8M1D16M1I4M2I6M4D19M3I8M1D3M1D35M1D16M1D5M1D7M1D8M5I6M1D8M5D7M3D3M1D8M2D10M3D14M2D16M2I26M271S * 0 0 CTACATAACAGAACGGCGTAGGTCGCCGCCGCGTAACCTGTCGGATCACCCGGAAAGGACCCGTAAATAGTAATGATTATTATCAAGCATATCACAACGTGCGTGGAGGCCATTGACAAACCACGTCGACATAATCAATTATGACGCAGGTATCGTATTAATTGACATCTGCATCAACCTTAACGTAAAAACAACTTCAGACATACAAAATCAGCGACACTGAAATACGGGCAACCTCATGTCAACGAAGAACAGAACCCGCAGAACAACCCGCAACATCCGCTTCCTAACCAAATGATTTGAACAAATTAACATCGCTTGAGCAAAAGGGTCGGGAATTTCTCAGCCTGGGTCATTGAAGCCTGCGTCGGAGACTAACGTCAGAAAGAGCATATACATCAATTAAAATGATGAAGAATGAACGTGTCGCGTTCTTCCTCCGAACAGGACGATATTGTAAATTCACGGATTACGAGGGCGGCATTGCAGTAATTGAGTTGCAGTTTTACACTTTCCGACAGTGACGACAAACTGCGTGTCAGCTTATTGTCCACAGACTAAATAGGTTGAATGATTAGCAGTTATGTGATCAGTCAACCACCAGGGAATAATCCTTCATATTATTATCGTGCTTCACCAACGCTGCCTCAATTGCTCTGAATGCTTCCAGAGACACCTTATGTTCTATACATGCAATACTACAACATCAGGGTAACTCATAGAAATGGTGCTATTAAGCATATTTTTACACGGAATCAGATCCACGGAGGGATCATCAGCAGATTGTTCTTTATTCATTTTGTCGCTCCATGCGCTTGCTGTTCATCTAGCGTGCAAATATTATTTCAAATCTTTCTGTATGAAGATTTGAGCACGTTGGCCTACAACATCATCTGTCGAGTCTGTTCCCTCCAGAATGCCAGCAGGACCGCACTTTTGTTACGCAACCAATACTATTAAGATGAAAACATTCCTAATATTTGACATAAATCATCAACAAAACACGTTGAGTACAGACCAGATTGAACGATAAAAACGATAATGCGCAAACTACGCGCCCTCATCACATGGAAGATGTTTACCAAGCGGGCTCAGGTTGCCATTTTAAAGAAATATTCGATCAATGCGAAAGATTTAGACTTGAATTGTTTTATTCTGAACTAAAACGTCACAACGTCTCACACAGTATTTACTATCTAGCCACAGATAATATTCACATCGTGTTAGAAACGATAACACCGTGTTAATAAAAGCACTTAAAAAGATGTAAATGTTAAATTCTCAAGAAACACGCATCTTATAGAAACGTCCGATGAGCTTGAAATCAAGAGAAGTACATTTCAGCAATACAGGGAAAATCATGCTAAAGCAGGAGTTTTCGATGGGGTCACAAATATCCATGAACATAAAGATATTACTATATTTGATAATTCATTACTATTTACTGAGAGCATTCAGAACACTACACAAATCTTTCCACGCTAATCATAACGTCCGGTTTCTTCCGTGTCAGCACCGGGGCGTTGGCAGTAATGCAATACGTGTACGCGCTAAACCCTGTGTGCATCGGAGTTTAATTATTCCCGGACACTCCCGCAGGAATTCCCCGTCAGGGCTGTGGACATAGTTAATCCGGGAATACAATGACGATTCATCGCACAGTGACAGCACATTAATAAAGTTAACAATATGAAATTTCAACTCATTGTTTAGGGTTTGTTTAGCATTTGCCACATACGATTCTGCCGGTAAAAGCATCGGGAATAACGCCATGAAAATGCTGTTCGCTACTGCGCTCATGCTTATTACAGCAGTGCTCAACAGCGTTTACTTGTTCAAAAATGACAACGTGGCAGCATAGCCACTCAAAGGGAAACCACTTATAGATAGCTTTCTTCGTTTCTGGAATTGGGCAGAAGAAAACTGTCGATGCAGCCAAATTTGTGGCGGCGCAGAAAATGTTGTTAAAACGAAACCCAGATAGCAAACATTCGTAAATCCGGTGCTCGGTTTTATTACTTTAGGCATTTATCGCTGGAAGCGCGTGTATTGCTACAATAATTGCTGAATTACTCATGCCATCGATATGGCGTAACTCTATCTGCTTGCTCATTAATATACTTCTCATTCCTCCAGTTGTTTTGCCATAGTAATCAGCCTCTCTGGTCGGTGAAATAATCCCGTTCAGCGGTGTCTGCCAGTCGGGAGGCTGCATTATCCACGCCGGAGGCGGTGGCGGTTCGCACCTAACCTGACGACTGCTTTGATGTGCAACCGACGACGACCAGCGGCAACATCATCACGCACACGAGCATCATTTTCAGCCTTTAACCATGCTAACTCCTTCGTATTTTTGGCTCTGCATGGAGGCAGGACATCACGCTGACGCATCTGCATGTATGTCGTAATTGCCGCCGTTCGCCAGCTTCGTTTCTGGCATTTGTCGCGCTGGGCTTTGTAGGTAATGGCGTTATCACGGTAATGATTAACAGCCATGACAGGCAGACGATGATGCAGATAACCAGAGCGGGCGGAGAGATAATCGCGGTGACTCTGCTCAGCCATCAATCTGACCGTTCGGCCCGCTTCTTTGAATTTGCAATCAGGCTATTCAGCCTGCTGAACTGACCAACCAGCGCCCGGCAGTGAATACGAGATATGCTGCAACGGTCGATTGCCTGACGGATATCACCACGATCAATCAGCTACGACCGCCACGCTCCTTAATCTGCTGCATTAATGCCACAGCGTCCTGACTTTCCAGAGAAGTCTTTCAGGCCAAGCTGCTTGCGGTAGGATGAGCAGAAACGGGAAAGAAGCTGGTAGCCGTCGGCTCGCCTGTTGATTGAGTTTTGGGGTCCTTACAAGTTTGCGGTGATCGGAGTAATAGTAAAGGCTCTCCTCGCCTAATGACGTCATAACCATGATTTCTTCTGGTTTCTGACGTCGTTATCATTCCCTCAGCGACCACGCCAGCATATCGAGGAAACGCCTTAGTTGATTATTGATTTTCTACCATCTTCTATCGGCTTTTTAACGCGCGAAGCGTTTGATAAGGGAACCAATCGAGTCAGTACCGATGTAGCCGATAAACACGCTCGTTATAAGCGAGATTGCTACTTAGTCGGCGAAGTCGAGAAGTACGAATGAACTAGGCGATAAGCGGCACATCGTTGCGTCGATTACTGTTTTTGTAAACGCACCGCCATTATATCTTGCCGCGAAGGTACGCCATTGCAAACGCAAGGATTTGCCCGATGCCTTGTTCCTTTGCCGCGAGAATGGCCAACAGTACTGTTCTGGCATCTTCATGTCCCCAATAAGGGGATTTGCTCTATTTAATTAGGAATAAGGTCGATTACTGATAGAACAAATCCAGGCTACTGTGTTTAGTAATCAGATTTGTTTCCGTAGACCGATATGCCAACGCGATCGAAGACAAACGGCAGGGAGTGTTAGGCGCGACCTCCTGGTCGCTCGCAATTCACGAATCATGTGACAAAGCGCATGAGTAACTATTACTAACCTGAATTCAGGACAGACAGTGGCTACGGCTCAGTCGCGGTTGTGCTGTTGCTGCGGCGCGCGATGACGCCTGTACGCATTTGGTAAGTGGGTTCTGCTTCCGGTATTCTCGACTGCTTCAGCACAACGGAAAGAGCACTGGAACCAGGCTCGCCGACTCTTTCACGATTATCACGAATGCTTACCTGTTGTGCAGATAGAACTCCCGAAATGACGGTCTGCAGGCTCTAACTATTACCTGCGAACTGTTTCGGGATTGCATTTTGCAGACCTCTGCCGGGATGGTTGGAGTTCCAGACGATACGTCGAATGACCAACTAGGCGGAATCGGTAAGCCGCCTCTTTCATCTCACTACAACGAGCGAATCCTAACCCATCGTTGAGTCAATTACCAATTTATTCAATAAGTCAATATCATGCCGTTAATATGTTTCATCGTGGCAATCATGCTGCTAACGTGACCGCATTCAAAATGTTGTCTGCGATTATGACTCTTCGTGGCGGCATTGCACTACAGAGCGTCATACAGGCGGGTAGGCCAAAGTTTAGGTGACCAGGGTGGGTTGGGTAAGGTTTGGGATTAGCATCGTCACAGGGGTCTGCTGCGCTTGCTGGCATCCTTGAATAGCCGACGCCTTGCACTGTCGCACTCTTTCTAACAACTCTCGCCCCACAGCTCTGTTTGGCAATATCAACCGGACGCTCCACTCCGGCAATCTGCATCTGCCCCCGAGCGCGTCGCGGACTAACGGCAATAAGATCCGCATAAGCGAATGTTGCCGGGGCTAGATTGCAGTATACCTTTGCCTTAGTATTTCCTTCAAGGCCTTGCCACACCACGGTATTCTCCCGATACCTGTGCAATTGCTCGCAGATAGTTGATAGCCTTTGTTTGTCGTTCGGGCTGAGTTCGTGCTTACCGCAGAATGCAGCCATACCGAATCCGAGCTTGTGATTGCGCCATCCCCCATAGCAGACTCATCACATACCGTACCGGAAAGAGAGTCAGAAGCCGTGGCCCGTGGTGAGTCGCTCATCATCGGGCTTTGTCGGCGAATGAAATTAGCTACGCTTTCGAGTCTCATGCGCCTTCTCCTGTACCTGAAGCATCATGTTAGGTTTCCGGCAGAACATGCTAGGTATCGATATACATTTGGTTGGCAAACTTGAGTGGTTTCACTGCTGGCGTATGACCAAAGATGAACGTGTCCCGCCTTTGATTTCTTTTAACTACCATCCCGTTTGTGAGTTGCTGATTCGGTTCGCGGTCCCATTACCTGTAGTGATGACCAATAACTGGCTTCCGACTCGGTATTCGTTACAAAGGGATAATCGGCGGTCGCGGCAATAACATATTTTTGATTTGCCTACCAGTTCGATGATTAACGGAAGTTCATCTGCTTTATGGGCAAGAGCTTTAGCCAGAATTTCTTTGTCCGTAATCGAGATTAAAGAACCAGCACCGCCATTAAGCAGCAGTGATTAACGTTTCCACGCTCTGATAAGCCATCAATCATCATTTGCTCATGGTTTCCACGTACAGCTCTGAACCAGGGAATGTGCTTAATTCCAGGCATTCAACGTTCTGCACCATCAACCAAATCGCCACCGAGATAAAGCAGGTCTTTTTGTTGTCCGAATCCAATCGTATCCAGTTGTTCATCAGGTTCGTGTGGCTGAACCGTGCAGATCGCCAACTACCAAATATTTCGGATTTGCTGCCATCAATTTTCGTAATAGCGCTCTCTTTCACTCCATCCGCGATGAACCATGAGAACGTCGTTGAACGATGTGGCGTGCATTTTCCGTTCTTTTATCATCAACGACTACTTCTGACATTTACCAACCGCGACCCATTTCAGTCTGCGTGCTACTTCTGTCTGATTTCCGTATGTTTCAACGAGCATGTCTGGAATGGTTTTACTGAGAACGTCATGCGGCCTCACTTCTGGTAGGTTTTCGCAGTCTTTTTGAATTTCTGTTGTATACTGCCTTGATCGCCTTTGCACTCTTCGATAGTCCAGCGATGGCGGTTATGGTTTGATTCGATTTCGTCTACTGCTTCCTGCCATGCGATGCGGCTAATCAGGTCATTCGACGCGATACGAACGAGATTTCCGCTTTTGTGCTGGTTGCAAGACACGCATTGCTTGAATATTGCGTTCATTAAAATGGAGTTGAGGTGCCGCAAGCAGTTGTCCGGTAATGTTAGCGGGCAACCCCAACTGAGCAGACGTGAGCGGTCGGCACGGAGATACGGAGGTAAGTCGCGGTTCCCTTCTCTGATGAAGGCGTTTACAGCTTGTTGGGCTTGTTTAATCCAGTAACTGCGGCTTTAACGAGTTTTCGAAATCTTAAGTTTATCTTCTGTTTCTGCTCCTCGTCGTCGTTTCTTCTCTGCTGCTTTTCCCTTCTATTTCGTCGTAGTTCGAGTGCTATCTTGATTCGGACACTCTGGAGGCACCACCACTGATTAGCGAATGCAGGGTGAAACCATTCTCCCGGCATTCATCGTTTTTACCGGCGTCCCGCGCTGGTTTAGCCATCACTTTCTTTCCTCCGTGCATCGAGCTATTCTAATCGCGTATCAGTTCTGCGCAGCAGTGCTCACACGTGAACTTCCAGCACATGCAGCTTCTGACCGCAGTTAGCACGCTCAGAGGACTCGACGGTTTTCTTATTCAGATCTTCGATTTTGGTCAATCACCTTGTTTTCCCGCACGACGTCTTAGGGAGCATGTACCCAAGTGAGCCGTGTAGTTGAAGGTTTTTACGTTGAGGACTTCGTTTGGGATTGGCTTGGGTTTACCTTCTGGTGCGTTTCGTTGGAAGGGTATTTGCAGTTCGCAGATTATGTCTAGTGATACTTCGTCGCTGTCTCACACACGTCCTCCTTCCTGCGGTGGTAACCCCTGTTGGTGATTCTTTCACGGAGACCATCGATTCCAAGGTTTGATTTGGTCGGAAGCGTTTAGTCTTTCTTTGCATTCACCGCGCACCGATAACATCGCATCATGCAGCTTCCCTCCCCGAAGTCGAAATCAAGCTGCCTCCAAATATTTCGCCATGACTCAGAACAAGAGCCGGTATCGAATCTTCCTTAGCTCGTACCAGTTGTCCTGCTATACAGGGCTTGATAATACCTTCTGAATACAGTCGCGATACGTTAAGCGACATTCTTCCTGGGGTACATATAATCTCCTTGGCGGTTCCCGATGTCTAATCGCACATGGGATCCCGTGATACCGCCATTAAAACACGCTGCAATCCCTCCTCATCTTTGCAGGCAAGTCCGATTTTGCGTTGATTTTTAATGCAGAAGCTGCAGTTACCGAGTGTCCGGGGTATTTGCTCGCAAATCCGAATGGTTGTTGCTCTTCGACCATGCGCGTATCTTCCCTCTTCTACAAAGTCTGACAGTTTCAGCAAGATATCTGATTCCAGGCGTTTGGCTTTAGCCTTGCGTTGCCTCATCAGCTCTGATGCTAATGACGGTGGTAATTCTAGCCCGAAATGGTCATCACAGAGTATTTGTGAAGGAACGAATTTAATCTGTCATAGGTGCAGAACGCGCCGCCGACGTATGGAGTGCCATATTTTACCATATCGATAAATGGGTTTCAGAACAGGCATTCGCGTCTGAATATCCTTTGGTTCCCATACCGTTAACCGGTTGGCTGTCCACAAGCTCCGGGTTTGATATCAACCTGCAATACGGGTGAGCGGTATCTCAGAACTTCAACTTCCTTAAACCGATATGTCATTGGATGTTCACAACCTGGTATCCATGAAAACGTAATGCACGTCGTGTCTCTTCGGAGCCTCGTCCGTCCGTATAGATGATGGAATGTTATGCTTGAACGTCGTATTAACGGGCACGACGAATACTAGTCCATGCAGACTGGTGTCCGTCTCCCCATCTGCTTCTCCATCCCGCTCACCGTTTGCTGGTTTCTGTCTTGACGGTTTATTAACGGTGATCTTCTCGATTGACTTCTATCGGTTAAGGTGTTCTGGACCCGTATGCCTGAATTCGCCTTACACGCATCCTGCAGAGTTTAAACAGGTAACTACGAAC * tp:A:P cm:i:180 s1:i:1523 s2:i:0 NM:i:1591 ms:i:5648 AS:i:5648 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
108 99 0 utg000001l 10316 60 1822S26M1I2M1D21M3D2M1I1M1I7M1I9M1I4M1I3M2D12M7I21M1I6M1I8M1D7M2I7M1I10M1I3M1I3M4I3M6I3M1I1M4I6M1I3M3I2M1I21M1D4M2I10M1I4M1D1M1D6M2I2M8I4M2I22M1I4M45I4M2I16M1D14M1D8M1I6M1I2M3D4M1I3M1I4M3D12M9I12M1D1M2I4M1D11M1I5M2D11M3I3M4D12M3I5M1D7M3I5M2I2M1I5M2I7M3I3M1I9M3D2M1I13M3D5M1I10M2I3M1I5M1I4M4I1M1I8M1I2M3I6M1I2M3D9M1D18M2D3M1I4M1I10M3D6M1D4M1I11M4I5M2I5M1D9M1I5M5I5M1I2M6I9M2I13M2D2M1I19M2I15M1D16M1I13M1D5M2I2M1I2M1I4M1I1M4I5M2I1M4I10M4I6M3I1M2I1M1D6M1D38M4I5M1I5M1I18M2I1M1D3M1I6M1I8M1D13M1D12M1D17M1I4M1I4M1I19M1D16M1D9M1I1M1I5M2I5M3I5M1I15M2I11M3I15M2I25M1I4M1I5M1D17M2I16M7I2M1D1M1D3M1I9M1I2M1I17M1D1M1D2M2I5M7I4M1I6M1D10M1I3M2I1M1D5M1D4M1I9M3D1M1I13M2I8M4I9M2I16M2I1M1I3M2I24M1D10M1I3M3D2M2I11M1D1M2D16M2I17M1D18M3D14M1I6M1D11M3I2M1I9M2D1M1D11M1I8M3I15M2I8M5D2M3D2M4D1M4D5M4I3M1D4M8I8M1D4M1I3M2D12M1D6M1I2M1I1M1I12M2D2M1D12M3I2M1I8M1I4M1I4M4I10M1D6M1D11M3D3M1D4M2D6M1I3M2I27M2I16M2I2M2I1M3I1M2I7M7I10M1D6M1D5M2I2M3I2M4I2M1D20M4I2M3I5M3I8M3I2M1D2M1I24M3081S * 0 0 CTGTTCTTTCGTGGTGGTGAGTCCGTTGCTTGGGTGTTTAACCTTCGTCAAAGTTAACCAGCATCTGTTAGGATGTTTCAGCGTACCCCGTAAATCCAGTCTGTTTGTCACGGTTACAACAGTTTTGGTTAGTATTATAAGATTAAGTCCACGTTCTAAGTCGCCACGTTTGGGTTTCTAGGTTGGGGTCCAACTCACTTAGACAGAATTTTGGCCCGGACTCCATCGAACAGCGCAAGTTGGGCTCGCGGGTCATCAGACCCAATCGACGCACCCGTAAGATGGGTCTACAAATCTCGTTACTCGTCCCTACGTCTCACCACGTTCGCATCAAAACAGGCATCGGTTCTTCGCGGGGGTCCCTGCTTTCTGTAACGCCTCGCTGCTGCCAACGTCTTCTGAAATCCTGAATTCAAACTATGCATCTGCTACCGGTCAAGTTAAAATGTTGTAGCCGGTTCGGTGCTTATATCAGGATCGGGAGCCGAGTTGAAACCATTTCGCAAATCCCGTTTCTGACGATTTAAAGCACGAAGCATTCTTTCTCCGATTCTCTATGGAGGCATCATTATGCTTTTTCTTTCTTTCGCTGTGTTTGTCTTATACCTAGGACTGTTTCGCAGTAACGATCTCACCCATTCGGATGTTCCCTCGTTTTCCGCGATTTCCCTCGTTCTACGCAATGCACCATTCATCGGAGATTGATGTTTTATTTGGTCAAAACCGCTTCTCACGCTGCTTAATATTCATTCGTTCTGACGAGTTCTAACTTGGCTCCATTGCACCGTTTGACAGGTCGACTTTGTAATCTCGGTAAGTTGAGAACGCAAATCGCTTACGATTCTGTCTACGGTTTATTCATATTCGACGATGATGTCGTTTTACGCAGAATGGCAAGCAGCCCCACTTTAAACTGTCGCCTGCTTCCACGTGCCTCGCCCGAATAACGGACTCGCCCCTGAAGCAGCATATTTGATAGTCTGGGGGCCGGTAACCATCATCGCGGGAGATCTGCCATTGATTACGGCTCCCGTGCCTTAGCAAAGTCTCTGCCGAAGTTGTATGCATTTTGGTATTTTAGTACCGATTCCTTGTCATAGGTACTGTAATGATTTGTGACTCTAAGTGCATGGACTCGAGAACGAAACGCTTCGTTCGCTGGCCGCTCGGTCGGGCGTTTTTATTGGTGAGAATCGCAGCAACGTACTAGCGCCAATCGGATCGAGCCATGTCAGTCGTCAACGACCCCCATTCAAGAACAGCAAGCAGCATTGAGAACTGTCGGAATCCAGTCCCTCTTTACCTGCTGATCTGCGACTTATCAACGCCCACAGCTTCCGTCTTTGCGTCCGGGATCCCAATTTGTTCACGAGCACTCCATAACCGGCGTTAAGCTTACAACGGCAAGTTCGATTCGGCGTCAGGGATGCGTATCCTGGTGTTCTATCGACTAAATTGAATTAGGATGATCTCCGACTAATGCAACACGCGGTGATTTGAATCTCGTTTCGCAATGGAATGTGCCCACCTATAAGCGGATTATTCTAATCCTGTTGTTCTAAAGGAAGGGGTCGTCACACCATGGAGGTTTCGATAGGCCCCGTTATAGTTCGTAAAATTATTTCACCTCCTGCATAACGCTCGCAGGTCTTGACGCTTGTTAAAATCGTGCGGTCCTCCGCCCAATCTTTAATCCTGTTTGTGTGATTCGCCCCGTCACGCCCATTGCGGCGCTGTATTTCAAATGCATTGCCTAATCCTGCAGTTCAGGCTCAGGTCGCGTCGGTACACTTCCTCAGTACATGCAACCATTAGCCCGCTATAAATAGTCAACACGCACGGTGTTAGTATTTTATCCTTGCGGTAGAGTTAACGTATGAGCACAAAAGAAACCGGTTAGACAAGAGCAGCTGCACGGACGGACGCACGTCGCCTTAAAGCAATTTTATGAAAAGAAAATGAAATGGCGGCTTATCCCAGGAATCTGTCGTCGCAAGACGAGCAGATGGGTATCGGGCAGTTACGGTACCTGTTATTTAATGGCATCAATGCATTAAATTCACGGTAACGCCGCTTTGCATGAACAATCGCCAAAATTCTCTCAAAGTTAGCGTTGAAGAATTTAGCCCTTCAATCGCCCCAAGAAATCTACGAGATGTATGAATGGCGGCCGGTTATAGTATGCAGCCGTCATTAGAAGTGAGGCTGAGTACCTGTTTTTCATGAGCCGAGGCATGTTCTACGCCGGGACCTTAGAACCTTTACCAAAGGTGATGCGGAGATGGGTAAGGCACAACCAAAAGGCCAGTGATTCAATGGCTTCTATAGTCGATTGAAGGCTAATTCCTAAGTGACTGAAGCCACCAAAGACAGGCTCCAAGCCAGACCTTTCCTGACGGAATGTTAATTCTCGTTATACGTGAGCGAGGGAGGCCGTATTTCGCGCAGGTGGATTCTGCGACAGACTTGGGGTGATGGCGTTTACCTTCTAGGATAACGGTACCGAGCGGTCGGTCGTTACAGGTCAGGGGCCTAACTATACAGGACCCAATGGGTCCCGATAATCCAGATGGGTACGAGTGTTCCGTTGGCGGGAAATTGCTCGTCAGTGGCCTGAAGAGACAGGTTCTATAATCCAACGCAAGCGTCGGTCGCAGTCGTTCTTTACAACGAGCATACGAATTTCACTGGCACGAATCGTGCAAACGAATTGTCGGAAACTTCTATACAACAGATCAACAGTAAATGGATTGAATTATGACGCAAGGGTCCTGCGTCCAACTTACCGCAGCCAAAATAAAGGAAAGATAAGCGCTCAATAAATCCTGTCTGTTTCCTTAATTCTATCGATAATGATACCTGCATGCAGGATCCAATTATTTGTGGTATTCATAAAATCGATGGAAAACTTTTCTCTTTACAAACAAATGACAAGAGTCTGGTTCCCAAATACCAAATGGGACGCTTCTAAGTTGAAGATATATTAAGAACAGCCTCGCAGATGACGAATCATTGGGATTCCCATCTTTTGTTTGAAGGCGACACCATTGGTTTTGTGCCAGAACTGTTCGGGGTAGAACCACATCCGATCTGACAGATTTTAATCGGGAAAGGAATGTCATTAAGCATGCGTCAGTGGGAGAGGCGTTCAGATAAGCCAGCCACTGATGTATGAGGAAATACCAAAGACGATGTTATGCATATGCATTCATTTCATCTAGATAGAACAACGGTGAAGGTAGAAGCCAAGCTACCTGTATTTGGCGTATTTAAAGGTCTGTAGAAGCCAGATATTGAAGGGGAGCTTTGACTCATTATGGATAGTCATTAAGCCAAATTAAAAGGGATAAAATGCTAAGGATATTATTTTATACGTCACCCCAATTTTCAGACATTATCGGGCAAAGATGAGGGCCGGAGATATGTTGTAACAGAACATTATCTATCAGAAAATAGCCATCTCATGCCTCTGAACACAGTACTAAGATGCTGAGATGAAGAGATGAGATCAGTTGAGGCAAGAATGAAAAGTGATACTGGAATGAGGGACGTTAAGGATAGGCACAACCATAGTACGGATTAGTCTAGGAGTAATTATGCGGAACGAATCATTGCCTGGTGTTTACATGACCATAATTCCTCCTTACGTTATCGTAAGCATTTGCAGCTCCCGATTCCTTTCGACGCCACTACATTCCTGGTTTCTTTCATGGGTGCCTCATGAGAATGGTCTTGGGGCGAAGACGACATTGTCATCATGTAATGCAGGAACCATGATTCCAATCCTGATTGCTGCCTTGACCGACGTTTCTCTAACAATCGCCGACGAAGGCACGACCTCAATAGAACTTCTGAATGACTGAGATTAGTTGGGGTCGTGACCCGGGTAGCTGCGCTTTGTTGGCTGGCGTTGTGTTCATCAGGTGGTCCTTCTTTCGTGTATCGTTCATCCCTCTCACGGACTCAACCGTGGTATCCTATCTATAAGCTCCCATTCAATCTTCCATCCTGCATCGTTCATTCATATGCATGCGCTTTCCAAAGGGTATAATTGTAGGGGATATAGAACGAATAACCGAATAAGACCCGCCGGCCCGCTTCGGTTTTCTGCCTCACGATCGCCCCCAAAACACAGATAACCAATTGGTATTTATTGACGAAAGACCGACCTAGATGACTAAACCTACGAACGACAGCAATTCGGATGATCTCTACCAAACATTAACCGCCATCCCGCAAAATAATTCATATTAAAACATACAGATAACCATCTGCGTTAACTAGTCTCTGACAGTGTTAACCTAATACCACTGGCGGTACTGAGCACATCAGCAGCATAGACGCACGCACTGACCACCATGAAGGTGACGGCAAATGTGTAGATTAAGCCCTGAAGAAGCGCAGCATTCAAAGCAGAAGGAAGCGCTTTGGGTGTGCTTCCATCCCGAAACGAAGCATTGGCCGTAATCTGGCGAATTCGGATTAGCTGCCAATGTGCCAATCTGCGGGGGAGCTTTCGTCGTTCTAGAGACGACTGACGGGACTGCCACAGATATACATAAAGGACTAGACTAGAATCCCAATCGGATGCCACGACGCCCGCAATTCGGAACGCTCGTTCTTAATAGAAATACGAGCAGCAAGCTCGACTTTGCCTCACGAAACCCAAGTCTGACTCCTAGTCTCATATTCTACAGCGATCGCAAAACCAGTAGAATGCCGCCGAGGCCATTCGAAATCGCAAAGCCTTGACGGAATTGACTGAGGTGAACGGAATGTGACTAGAATCGATAGATTGAGCCCAAGGATAGCTGTGAGGCACGTGAAGAATCAGATTACGGACCCATTCGAACCGCAACGGGAGCGCTTGAGAATCCAACGGAACGATCCGGAAATCAATGGTACAGGTTAACTGTAATATTGGCGACGCGCATAATCACGTCTCAAGCGTTTACGTGACGCGTCAAAATCTAGACTAAAATGGCAGCCAATTCCGTTAAGCCTAGTACTAGATAGGGAGCCTCTTAGTCCGTCCATGGAACAGTTTGTTCCACCATAGCCAACCTAATCGGTATAAAGTACGCATTGTTTACCTTAAATAACCCGCTGACTTCCACTGCTTCGGTAAGGGGTCCTAAAACCAGCCGTACTGTATTTGACCACGTTGACCAATTATACGTACATTTAGTTCGAAGTGGGTCGCGTTTAGACTTAAATACGGTTATATCTCCTCATCGCGATAATTGCCATTAAGGGCTGCTGAATTGACGAGTTGATTCCGCTGCGGATAAGGGAGCGGAAGTCCATGGAATACGCCGAGTCGCCGTGCCTTAGACGATACTTCCCATCGCGTTATCTCTCTAAATCGCTACGAGTCCCTGGCGGCGTGAGCGGGCAACGTTATTACCAATTAGATCTAACATCTAATTCGCGGCGTGAAATGCATTTCTATAAATAAAGTGAAAGCCACATTATGTTAACCATTCTCACGTAACAGAGCCCCAGTGGGATAATCCACCAGTTACCTCGCGATTAACATAGACGGTTAATTAACGAGGCATGCGGGATTCCGAGGAGCGTGGGCATATTAATCTGACGCTATTAATAACGCGTTAATGTATTGGGGGTCAATTCAGCAGTGATTCGATACGTTGGATCGCATTACCGTTGGCTGGAGGATGGTTTTAATGGAGGTGGGAAATGTTGGACAGACGATATAATGGGCGATACGAGTAGACGATGATGCCCGCGTACCAATCCTCATTAGTACCTTTACCGTTGGCCAATACCGATAGATAACGTGCACTGTGTTGTACGTCGGCTTCCAACGGGACGAACCAAACACGGAGTCATACGGTATAAGACGTAAAAGGATCAGGTGGAGTGTATTCTTTACACTGAACGCGTACGGCGATTCTTGTCCACGTAAGAGATAACATACTCAATGTGCACTCATCGACCCCTTAGTCGTCGACTCGAGCGGGCCCGTGAGAAACTTAATGCCGTAACACGGAACGGGTTGCTCCAGGATGCTATCATTTCTGGTTAAGGTACCCGGTACAATAAAACAACGCCGATAACTGCCGTGGCGTGAAATGTAGGTCCTATTAGCCGCGAGATCCTGTAATGGGTGACGATTTCAAAAGGCCAAGCTTAGTGCATCCTTCCTTGGCAGAGGTCAAAGGATGCCACTCGTGCTCGCTCGTACGAACCGTGGAATGGTTAAAGACGAGGGAGGGTTGGACCCCGCTTAATCCCGGCAATCCCGCATTTACTCGCCGATTAGCTTCCCGCTGGTTTGTTACTTCGCGTAACATCACCTCGGACTGTGCGGTTTACCGCGGTACCGGGACTATAATCCGCCGGCGTTTCGTTATGTAATATGGGAAACCAAATGAGATCCGTAAGTGTTAGTACCACTAATCACTTCGCTCCGATCTTCGCACGGTAAGGACCATTATAATCGTACTTCCTTAGAAGTCACCACGGTATCGACTATGGTTACAACAGGGATCCCGCTACGAATTCGTGGACCATATCTCAGCCGTTATAACTCCGCACTTGTTATTACGATTGGATGTTCGTTGCACGTCGCCCATCGGTATCGTAGCAGTAGCGACGTTCCCCACCTCAGTTCTAAGCCCGCTTTCCTGTTTAAGGACTCCATCCGTTTATAGCCGGAATTTCGAGGGCTTTCCCGCAGAAGCTTCCATCCATACCCAATCGATTCAGACTTGGTGCGGGGCCGACGCTCGCGTTCGGCTCCTAGCCGTGGCGTGAAGGCGAGAGTATCCATCTACGGAGCATCGCTCGAGACTCCCTAGTTACCAGCCCTATTCACGTATAATAGGTGCATGATTCTTCGTTAGAGCGGACAAATCCA * tp:A:P cm:i:24 s1:i:203 s2:i:0 NM:i:650 ms:i:380 AS:i:395 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
109 100 4 * 0 0 * * 0 0 TCCGACAACGCGCCGTCCTGCGGGCCTTCATGTGTTATAAGCCATCGAGTTGCTCATCGCGGACATCAAATTGTTATCTTTAAACCGCGTGGCCTGCTAGAACGCCTTCAGCTAGGTAGGCCTAATAATCATTAAATGTATACTTAGTAAAAGGCTATGCGCGGTCACTATGTTCGTCTATGAGATCTTATTTAAGTATTAACGTTTTAGACAGGGATGATTTAAGGTTGCTGATCAAAATTACTGCCCCTGAAGACTTGACTAACGATAGGCGTACTAGGTACTTAGTGCTCTTTGCTCAAACATTTACAACTAACACAGAGCTTTAGAGAACTAGTCGCGGATATGTACTAACGACAGTAGCTTATTATGTACTTTCTAGGCAAACAGAGGAAGCCAGCCTAAGTGCACGTGCTCGCTACCGTATTAAATTGGACTAGTCAAAAGTAAGATGACCCACGCTAGCCACGCTGACCCGTCATGCGACTCTACACGGGAGTACTAGATGCTTAAAGTCCACCAGGGCCACAGTATGTCTAGGAGAACGCTATTAGGCACCAAGCAGACGCCATCCCATCGTTTAACGTTATCCTCGGCCTCCGTCCATAGAACCTCTGTAACGACTAAACATACTTGAGCTATAATGTTCTTGATGACTAAACTATCATATAGGTAATCTATCGCTGGTGGATGCGTCATTGACTTAAATTGAGTGCGGTCTCGCTGTTCCTAGACTAGATGAATTGCTAAACGGGGAAGACTTAATTCACTAGGCGCTTATCGCGCGTTCAACGATGCTCTTTACAAGACGCCTCCCATCTGGATTTATTGGGTAAATACCTGTAGTGGTCGTCCGCGGTATGTCGCGATGAAGAGCTAAACCATGCTACAAATGTCGTAAGTCAATAAAGTAGATAACCGCATGCCTAGTCCTACTTGATTCACCTGGCGCGGCAAGACAAAGCCCTCAAGTTACAACTTTATCTAGGGTGTCCCCTACGTGACGCCGCATTTCTGAACGATTTTCAACACTTCTAATCAACTTCAGTTACCACAAAGAATTGAGCATTGCTGCCCTGACCGCATTTTATAGTCGGTCCGTGCTGTTAGGAGCGCGGTTGCGCGTAAGTAACTGATGTAGGGACAGTCAGCTCCCTGCGAAGGTCGTTCCGCTGTAGCTGCGCTACTGAGTTTCTAGTCGCATTTTAAAGACTTAGGCTGCAGGTACAGAAATGCAGCGGCGAGATAGCGCTCGATTTACGTGGTCAGCCTAGTTGCCTCGGCCGGTCAGGCTAAACCGCGGCCTAATGTTTACGTTGTGATTAGCCCCTTTACGGCCGCCCTGGCATTCGTGTAACCATCGTCACTGGTCCGGCCTCCATTGTACGTGTAGCGCTGTCATAACGACTTTTTAGACGACTCGTGACGCCAACCCGGTCGGTATGTTACGTTGGCCTGTGCATATGAGTTTCGAGCACATCGCTAAGGCCTACACCACGGGTGGCACGTGTCAGACCTGTGCTATGCCATACATACATAATCATGGCCATGTCAACTTGGGCTCATATGCCGCTATCTAATCCACAGGCCGCTACTCGCGTGCTCGTCGTGCTGGTCTATCGCAATGATGGTCGTCCGCAACGAACGGACTTGGCTTTAATACCAGCGGCAAAGGGCCTAGCGTACAGTTTCTGGGGACAACTAGACTACAAACGTGCTACATGCGACAATCGTGACTAATCTGCACATGCGCGATGCAGGGGCCATCTGCTCACGCCGGTAAATGCTTACACAAAGCATTTGAGCGCCGGACTGTCGACCTGTGAATCGTGGTGGTCGAATTAATCCAGCATGTATTTGCTGGTGGTCCGTAATTGATACAACACTATGCGCGGTTGCGTTAAAATTAGTTAGACGGCTAGGGCTCATAGATTCAATTGCTGTGTTCAAACCACCGACATATTGCCCATGATCCAAACCTGCTTAATGAGTCAGATGAGATCGCGGTTAGCGTGCTCGACTTGTTTAAGGTCTATCCCACCCATCGTTGGCCAACCACCTTTTAAGCGGGTCGGGCTGCGCCTCATCGTTCCATACGTGCGTCGTCGGTCACGACCTCCAGCCAGGCTTACCTCTAGCTCCCACAGCGTTCGGCGGATTGCCACTCAGCGCGGCTAATGGTTCGGCACCCTGGCTTTCCGCGGCTAGCCACTGTTATTAGCGTCGCGTGCTTAGCATGGCTCACCACTTAAAATGCCGGTCAGATTCCTCCAGGCTTAAGACAAATGACGCAGAGAACGAGGTACATTCACAAAGTTAGGCTTCGGGATGGATAACAGCGGTCGGGTACCGTCTAAAGGCTCGCCGGTCGTGACTCGTGAAATGCGCGTAATCGTAGCTCCCAGGTTACACCAACCCGTAAAGCAACCCAACGTGCTAAGAGCGGCAATGGCCCTTGCCTGTTTAAAACCGTTGTTTGAGCTAGGGACGGGACGCGGTTATTAGCCAGGCTGGCTAAAAGAATGGCCAACTTTAACACGTACTACTGATTAGCCTTAAGCAATACATGTACGTATAATTAACCAGCTCTATGTCTACGTTGGCCCAGCCAGTTGTTAAATCTATTACGCGAAGTTTAGCAGGCTTAAACAGTCGTCGATTCAGAGCGAACAGGATGCTGTAGGCGGACGCTAAAGAATACATCCGGCACTCTAGAGCTGCTCTGTAGTTACGTATCACGTGTATTACATAGTCATTTAATCCGAACTTCCGCGTCGTATGCCGTTTAAAGCAGCCGGCGCGACTCAGGACACGAACCTAACACATCTCGCCCGTCATCTAATGTATTAATAGGCAACATCCCGACCGTCCGTGCGCGGGGCCGTCCTACAGGTACTGCGAATACTGGCAAACCGTAGACAGGCCAATCTATGACCATGGCCGCTGTTTG *
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
110 101 4 * 0 0 * * 0 0 GGGTGAACCTCTGGGAGAGCACGAGGGCCTTCCGCGTCCTCGCTGCGCTCCATACACCGTACGAGAGGCGGCTGAACATTTCATGCAAACACCCACAACGATCATCTTCGCACTCTTCGTCCTCCTCGCGGATTTCCTCCCTCTGGGGTCGAGGCGTGAGACGTGAAAGATCTAGTGAAGAGCCAACAAACGGTACGTCTAGCCCCGCAAGTCGCTATCCGAGGCTACATCGGGCGATACTATCACTCATGAACTGTAAGGAACAGGAATGCCCGTTCGCATACTCCGTGCTTAACTATCTAAGCAGCATGGCGCGTCGTCGTCGACGTGGCCGCCGATGATAAAAGCCAGTTCGAAAGGATGCTGAAATTAAACGAAAGCTCGCTTGATCCATACATTTCCGCGAAGAAACGGGGATGATAGGCTGATAATGTGGTCGAGATCCAGGCGTTAACGTGTCTGTTCCACGAACTCATTCACACGCGCTCTCAACGCACCCATAGACGCTGCACACGTTTCAAACGCACGCCAGAGATCCCTGAATTTAGAAACTCGCACTCGTCATGCCTATCTGTTTAACTGGACGTGAAAGCTTCAGTCCATTCTGACGGCATCTGCGTCTTTATGGTGCATGGTTATGCGCTAAACGGAAAAACGACGAGGCACTCCCCGAACGCCATTTATGATGAATTTACGAACAAAGTACCCTTTGGATGTCCAACGCCGCCTGTCTTCTGCTCCTGCAGCGTTCTAACCTAGCAGATGCTCCAGATTAACAGGCTGCGGCTGACAAGTCGAGGCGTACGCTTCTAGCGTTGGTTTCGCTCATCGTTCGTTGCTCAAGAATGCTCACCCTGACTCAACCGGGTGACTGGCATTACGTTAATTTCTTGACCAACTCGCAGCAGATATAGACACCCTTTCTAAAACCATCGCGCATCTTTGGTTGTGAGAGCAGGAGGAGTCGAAGCCGGGTACGCGCATGCGAAAGCACTTTTGTTGAATCGCGACAGAGCGCAGCTCTTGTCGGTCCACCCTCCAAACAATGGAAGCGCCGCGTCAGTGCTCTGCTGTTTATAGAGCATAATCAATGAAGGCGTCAACATTCATGCCGGTTGCCGACGGATGTTACGCCGTTAAACCGTGGTTAGAAACGACGTCCCACATTATCTATTTCACGTTCCTGATCATTCATTCCGTCGCCCCTTAGAGTACTGCTGGTGGCGGTAAGGGGACTAAACAGCCACGTGCCGTTCGGGAATTACCCATAATATCACGGTTCATTAATGGCCGCCAGCGAGCGCCTGCTGCCTAGTCAACCGGGCAAACCACAGCGTGAAATATGGTGGTAAGGGGCGGGTTTTCCTACGAATTCTCGCATTCCGCTGCTGCATCTTCAACCTGGCACTCGCTCTTCCGACGTTCTGGCCACATGAGGTCCGTTGAAGGCCGGGCTTTACAAAGTCCATCTTTTTGCCGGACGCCAAAGGCTAAGAGCGGTTACGAGCGCTCATTTAAGTGAATCCCCGGGACAGGCTTCGCGTAAGTCGCCATCGCCGTAGCTCCACGCACTCGTGGGGAGAGTCATCCGAAGAAGAGTGGGGGAATAAAGAGACGCCGTTAGCCGGGACTGTTCGACGCTCCATCACGCCTTCAGGGTCGGCTCCCTGGGGCTCACGATAATGCCTTTGCGCCGTAATCCTCACTCAATGCCACCCCAACCTGACTGATGCCCGTTATTGGTGAACAATTGGACGGACTTAGACCATCGATGGCATTCGTCGTATCTCGTATCCGTGAATGAGTACGAGCTATCTAAACTACCGATCCGGCACCTGAGGCAGGAAGACTTTAGATATCCAGCTCCACCTGCCTGATACAGGTCAAAGACTTCACGAACGAAATTTATTCACACCATTAGAACGAGACAACAGGTGCGCAAACCACGAGCGTAGAGACGCTCCGGAGGCGAACAAACCCGCTAAACGTCACCCCATTGCTTTAATGATGCCTTCTCCAAGCATCCGATCGCATGCCTCCGCGTTCTTCCAATTCCTCCCATGTTCGGCTTTATCTAAACCTCGTTGGTCATCCAATTCCCATAGCGCAACTCTTTCGAGAGTTCACGAAATGTGGGCTCGAGTACTTTTGTTAACGCGTGGTCAGCGAGGCAAAACCCGGCGTTACAGGAAGCCTAATACAGCCCTAGTTTCCCGGCCACACGACGATGAACAGTTAAAGCCGGCCGCGGTTTTCAGTTCACAATAAACGCACCGGGAGTGCCGACAGTTGGCCGCATAAAAAGGTAGGGCGCCATGCTAGGTTTGCTCGGAACGACCTGCTTTTGACTACAGCTTAGACGAGACTCAGCATCCGAACGTATCCCTGAAAAATCTCCCCCGTTATTCTTCTGTAGTTCGAGGTTTTTGACCGTGTACCGTTAGACCTGACCGCTTTCCGTTACCGTTTAAGCGTACCGATTTGTCTCCCACGTGAAGTAATGTAAACAAAACTGCATCGCGATGAGGCGAGCCCGAAATTGGTACGTACATGTGCGAAACCAGCACCAGGCACCGCGTTTCAATGGCCTCAAAGCACTTTTCATCGACGCTGCTCGACCTTTTATACGAACGCTCCCCGCTTTCACCAGCATTCCCCGTTAACGAAGATAGCAGTACGCTAGGATTCCGACGCAGCATCTAACTTCAGGTGACAGTACATATGAAAATCCCGATCTACGAGAAAATTTTTCCTCACCGTATTTCTAATTGCCCGCGGTGCCGCACCCTTAGACAGTCCATTCGCTCAGAGCTGCGTGCGCGTGCCTCCGCGCACCTGTCCCAGCTGATATTTCCATTATGGCACTAGCCCACGCGTATCGCCTAGCTGGCTGCTCGCTAAATGTAGTACGTAGCGTTCCCAACCAACAGAAAAGTACCGCGTATCGTTCAGCGCCGGGCAGTGGGAGTAATGAAGCCACGTGACATGACGAAATCAACCGCCCGCCGCTCCTACCCCGTTAACTTGCAGGATTTGATGACAGGCTCAAACGTGCTTTCAACAGTACATAAAAGACGAATGAATGGCGAGAGCCCGGAATAAGTTCCCGGCGAGGCCAAATGCGGAAAAGAGTCGCATATCTAGAATTGGAATGCATAGTTGAAGCTGACGCATCGTAATGCAGCTTCCCGTGCGCGGAGCCGCTGAATTGACGAATTCAGACGTATCCCGAATCACCCTGCTTACGGACGCATCGCTGGGATTGCTCAGAGCATTTCGTGCTTTGTCACACATTTTCCCAACCTGGAGGGATGTTGCTGGCTGTTTGAAGCGTTAATGAGTTGAAACCCTATACTGGTTCGGCTCTGCCGACAGGCGTCCTTGATCTTTCGTTCGCGTGCACCAACGACTCCAGTTCGATTCACGAGCAACGGAGGCCTCCCTGGGAATCTTCCGTTCTTATCTGCCAGCGTTCATCTTTCGTTCCTCGCTCCTCCGGAGGCTCATCGCCCAAGCGCTCGTGGGCTTTGTACGGGGCATCGCTCCGTATAGAGCAAAGAATGGACCTCATCTCCGGGGTGATATGAAGTGGATATGGAAGTACCCGCCTAGATCACGCCATTGGTCGCAGTTTTTCAAAGCTCAGTGAAAGAATCGTCCATTCTAAGGTCCATTTGGGAATGATAGGCGTACGAGTGGCACTCGTAGGCGGACGCGTTCAACGGCGTTCCCCAGCGAGCATCGTGTTGTCCCAAGGAAGTTCTCTTTTGGCCGTTGCTAGTCGTCCGCGCAATACGGGTAGAGATGGCTAAGCCCTCTAATGACTAATCGACAATACTCGACACGTGTGAAAGTTTCACGTGCTCCGGCTTAGGGATCAAGCCACGACATCCGGCCTTTTACTTATAGCGTTACAGGACTAGTAGGACGGGAGCCCGGCTCGGTTTCAATGCAAAACTAAACCTGTGCACCAGCCCCGTGAGTGTTCAGCGGGCGTGCGCTCCGTTCATTCGACTAGTCGACTTGTTAACGGTGGACGACCGCGTGCTAGACTGCGTGGTAGTTTGATTGTCTATAATGTCCATCACATATCAGCTAACCATCCGGATCCCAGCCGCAATCACCCTTCACTGTATTTAATCACACAAAGCATCTTATTCTGCCTTATTCGGCCTCGCCCGGATGGCCTCTTCGTTCCTCGCATGTTCTGCGGCTGCTCCATGCATAAGGCAGCAGTCAGGGCTCGATCCCGAGTGCGGGGTCTTTAAACCAGGAGCATGGAAAGGCAGTGACGTATGCAATTTCAAATTCATGCTGTCAGTACTATCCGCAGCGTGCTTATTCGCATGGGCTCGCGCAAAGAGAGTACGCACTCTACGCCGAGGGTAGGTTTGGTTTACGCTCCGTACAGCGCCAAGTTTAACGCGTCCGGAATTTGTGGAGCCGAGCATATGGTTTGCTCGTGGTGAGGGAGGAGTGCTCGCCGCAGGAGGGCGGCTCGCGCTATTCGGGTCGAGGACTTTTCTTAGCCTGTTGCCTAAAGCGATCCCATTTACCTACTCGACAAATCCGATCGACGCGCCAGGCGGAACGGCCGGCGTCAGTGGAGGGGGCCCTAACAAATTAAACGATGCGGATGGGGATCCCAGGAGGGAGAGTGAATTTGTGCGTAGTCGGCTGGCATGGTAACGATAGAGGCGGATACGGCTCGTGCCGGGTGGTGCCGGAGCTCTTCACGACCGTGGTCCTGGTCTGGTTGAAGCCCGGACAAATGCCTCGGAGGAAACTGGGCCAACGGCATAGGCTTCGTGGTCGATGAGGATGAGATGAGCTGAAAGAAGTTGAGGTAAAGGGGTGATGTGCGAGGCATTTCGCACTCTGCGTACCTCGGGCGCGGTTGCGCATCCTCCTAAAACCTGTTGTGAAGCTCCATACGTAAAATTTCTTTTGCTCGTCATAAGCCATCCGTATAAAATGTTTAGCAAATCGTCCTCGCATCGATTAAGGGTCATGCAACCGCCCGGTGCCCTAGGTCCCCACATGCATCGAAGGCGTTGCAAGCAGTCAACAGAGGCTGTCAGACCGTATTAATCAGGCAGAGTCGCGGCGATCCGTTCCATGCATATCGCCAGCATTTAGGCCAAGGCCCGTCGCTGTTTCTTCACGTCCGTGATCCTGAGCTCCCCGTGCGCCGTTGGCATGAGCCAGGCTGTTCTTGCGCAACCCATGCAGCCTAACGGCATTGCCCCGTGAAGCGACGCCCATGGCGTTTACACCTCCGTGACGCTGGCGCCGTCAGTACCTCGTCATTGCAGACGGCAATCAAGAACGAGGGATCTGACCAGTTATTGTTGATTGAACGTGACTGTTGGTGCTTCGCCTAGCCCTAACTGCTCGAGATCGACGCTGCTCGTCGATGCAGTGCATCACTAGGGGATGACGAGTCAACGCATCAGCTTGCCATGTCTGCAACAGCCGCCATTTTACACCCCGTTAAGCATCGTAGGACGGTACGTACTGCAGCCTCATTATCTTAAATCCACCGGCGGCCACCTAGCGGTGA *
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
111 102 0 utg000001l 18516 60 967S30M1D19M1I7M1I6M1I2M6I3M5D34M1D10M1I4M1I4M3I6M1I5M1I10M1D2M7I5M2I1M1I13M2D16M2I3M1D3M5I3M1I3M3I10M3I4M2I29M1I7M3D7M1I8M1D5M4I1M2I3M1D23M1I17M1D3M1D16M2I9M3I3M1I2M3I11M3D26M1I2M1I3M3I2M1I4M2I3M1D12M1I29M1D4M1D7M2I7M1D8M2I1M1I3M1I5M1I5M3D1M5D5M1D6M1D3M1I1M1I2M1I6M2I29M1D6M1I10M1I5M1D11M2I12M3I2M1D11M2I14M1I10M2D1M8D2M1D4M6D4M2D26M1I5M1I4M1I10M2D7M4D7M2I3M1D4M1D14M1D10M2D42M4D9M1D1M1D5M1I2M2I6M1I11M4D5M1D2M1D4M4D5M2D8M2I2M1I7M1I3M3I2M1I8M1D12M3I17M4D2M1D4M7D6M1I8M2D2M4D4M1D1M2D9M1D6M4D6M1I29M1D14M2D2M2I5M7D11M4D8M2D1M1I4M4D1M1D8M2I6M2I4M1I26M1I10M1I3M1I1M2I6M3I5M1D14M7I1M4I2M1I3M2I6M2I11M1D3M7I2M1I10M1I4M3I2M2D25M5I2M4I7M2D5M3D1M2D12M1D25M1I6M1D4M1D6M2I4M4I8M1I9M1D18M1I8M1I4M2D3M1D11M1I5M1I8M2D1M5D4M3D4M1D7M1I5M1I4M3D6M2D3M1D5M1I3M3I3M1I13M2I8M1D3M3I12M1I1M1I4M1D1M6D9M1D3M1D5M2I2M1I4M5D3M3D4M4D1M1D17M2I7M3D1M1D8M4I6M1I4M1I5M4D8M1D12M1I5M1I1M1I1M1I5M2I7M1D6M1I4M1D6M1I5M1I6M1I13M1D1M2D14M2I9M2I3M1I5M1I17M1D5M1D9M1D13M1D2M1I16M1I6M1D5M2I7M3I7M3I9M1D3M2D1M2D3M2D4M2I5M2I4M1D17M4I3M1D2M1D6M3I1M1D13M2I2M1I14M2I7M2I5M1D4M6I5M4D5M5D15M1D8M1D2M1D7M1D1M2I4M1I6M1I8M6I6M1D2M1D10M1D4M1I17M4I2M2I24M10D3M3D9M2I21M1I1M4D1M1I4M1I17M2I34M1I21M1I16M49S * 0 0 AAGCCGGCGTTTCCAAGGGTACGTCAATGACATTTGCCGTACGTGACCGGAAGCACGCGAAACGGTGACGCTGATGGGATTCACACACCCTACTCATTTAAGCCTGGCAATCGGCTGTTAAACTGGGGTTTAGGAACGATGAACATGAAGCAAAGCCATCAGGGAGCTACAGGCTCCCTTTTATTATTCGCATTCACCGGCCGTATTAACCAACAGTTCAGGGATTAATGAAGATGGCAGACATCATTGATTCAGCATCAGAAATAGAAGAATTACGCATACAGCGACTAAATGCGCCGCCTGAAACCACCCGGGGCTATCTCTTCCCTCGCCTTGTTCTTCGGTATGCCCGTCGATAGATGAACGAAGACGCCTGGTCGTTCAGGGATTGTTGGACTTGTTGCAGTGAGGCGGAAATAGGAGACGAGACAGGCGAGGTTCGAAGTGAGCGAAATTAACTAGGCATCCGTGAAGCAGGGCAATGCATGACGACTGGGGGATTTGACGCAAACGGTTTCGCATGAATTGGTAGCGTGTGCTCTGGAACTGCTGGATGAACGAGGAAACCAGCAATACATCAAACGCCGCGACCCGGAGAACTACCAGGATATTGCCTATAAATGGAAACTGCGTGTTGAGCTTGAAACAGAAGGTTACGACTCAACGAGCATAGATGCGTACAGGTTGACAAGTGAAGCGTATTGCCTAACTGGAAAGCAACGAATTAGTCCGACGAAACCAGTTTCTTGTTTACATCCTGGGAAGACTCCTGTTATAAGCACCTGCACTGGTACTGGAAGAGTTTGCGGCGTGCTATGCATCGCCTGGCGTTAATATAATGGACAAGCCTTACGCATAGAGTACGGATCGATCGTAGGTTCGCAACCAGGGCATAGGCGACGCTGGCTGGCATTCGCATCAAAGGAGAGTATGCAATCGGTTTTGTAAATACAATCCGACTTAATGAATTTCACGTCGTCTTCACAGCGATGCCAGTCTGTAGTGTCAGATGATGACCGTACTCAAACATCAGCGGGTCATATTATCTTACTGTTTCTTTACATAAACATTGCTCATCCGTTTAGCTGGAAACCGACATACATTGCAAAGGAGTTTACCACTGGCTGGTATGATTGAGTTAGAGTCTGAGCAAAGATTGGGCGTTATCAATGGTTGTGCCATCTCGTCTTCTCCCTGCAGGTAAGCCGCAGGTGTTATGTAGATGAAGGTATAGATAGCGTGAGGTATAATTCCATGAAGGTTTACAGTCTAATGAAGACAAATCCCCATTCTGCAATGTGCCGAGAATGACTGATACGTGCACTGGCTACGAGGAAGACGAGTAGGAAAGGGAAGAGCTGGCCGCCTCCGGCCCATAGATGATTAAACCCAATATTACACCGTACTAAGCCGGGGATCTTATTTTATCTGAATACGGACCGGGTTTGTTTATGGAGATGATAATGCATTCTGAAGTCAGGAGTGAATGGAGAACACATGTCAACGATTATCGAAACTAGGATAGTAGACTAACAACAGCCTCCATGATATGGGGCAGATAGCACATGCAGACGTAACAATATTCGAATTGAAGGACGAAAGAACACCAAGCCGCCTATCGAGTTTTTCTTGCGTGTAATTGCGGAGACTTTGCGATGTAGGATGGAGCCACATGAAAGTCCAAGAAGCCTTGAAACAGTTCGTTAGATGGGTTGGGAATGCAGGATTCCCACCTCCGGTTAAGGATGGAAGAGAGTATCTGTTCCACGAATCAGCGGTAAAGCTTTGACTTAAATCGACCAGTAACAGGCCTTTGAAGAGGATGTCAGAAAGGCGGAAGAAGGCGCACGAAGAGGGATTTACCCTAACCTGTTATAAGAAACAATGGATATCTATCACGCTCCAAGACGGACCGATTTGGATCGAACAAGCGCGTGAAATGGGTAGAAGCATAACAGGCTATTGAATCGTCCGGCTCCGCTCTATCGCGCCGAATCGGCCGTGATAATTCCGTTGGGTCACTTCGGTATTGAGCCCATATCCTGGCACAGGATCAAGCGACACTCATAAAATTACATGAGCAAAATTAAAGCAATAAGGAGCGCGTATGTGATGCTCCACTTGACAGACATGCCCACAAAGAATTGCGGCAATGCTGGCTGACTGTGAATACATCAAGGACGAGGGCAAGGCGGCGTCACTCTCACAAGTTAATCAGATCAACACTGAGCGATGCATTCGAGAGGCAATAGCTGAAGGCCATATAACAACATCAGATCCTGCCCACTCGCGCATAAATCTTAAGAGATGGAAGCAAGACCACGAGGAACTGAATAGCGACCAAATTTATTCAAGCAGCGATCACTCCATGTTGGCTCATACTTGCAAATGGAATGGCTGTTGTTACCGGGCATGAAGTCGTGCGGGCATGGTCTGATATCGTTAGATGGATATCTTTATGTCAAAACAGCAAAACAGGCGTAAAAGTGCCATCCCAACAGCATTGCATATTGATGCTCTCGGAATATCAATGAGGCATTACTCGTGGGCAGTGCGCGAAGCCATAATTGCATCTACTCGTCGAACATTTCATCCAACAGTATCGACTAGGTATTTTATGCACGACGCACGAAAAGCATCAGGTCTTTCCTTCCGCATGGGAGTGAGCTTTCACCGAGTCCCGCAGTTTGTCTGCAAGACCTGCGAAGGCAGATAAGGGCGATAAGTTTGCTCAACATCTTCTCGGGCATAAGTCGGACAGATGGCATCACAGTATCGTGATGACAGAGGCAGGGAGTGGGACAAATTGAAATCAACCAGCGATCGCTGTGTAGGGGCACCGCTGTGCTTCTGCAGCCAAATGCTCACGCCAATGCTTTTATAATGCCAACTTAGTATAAAAGCCTGAACGAGAAACCTGTAAAATGATATAAATATCAATATATTAAATTAATTTGCATAATAAGACCCCTCTGTAAAACACAACAATGCAGTCATCTATGAATCAACTACTTAGATGGTATTAGTATAGTGGTCACTTAACAGGCTTAGCAAGTGATTTTGTCTTCTTGCGCCTTGTTACATCTAATACGTCAGACCCCGGAGCGCGACGCCTCGCAATCCAGTGCAAAGCTTTGTGTGCCGACGACCTGCATAACCAGTAAGAAGATAGCAGTGATGTCAAACGACGCAGCTGACTTCTGTTCTTTCACGACTTCCCCACACCCAGCATGCATACCTTTCCGCCCACTGTAGTGAGTGTTCATGTTGAGCGGTGAAGAGGAAGTCTG * tp:A:P cm:i:26 s1:i:212 s2:i:0 NM:i:825 ms:i:260 AS:i:104 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
112 103 0 utg000001l 40469 60 3654S18M1I6M1D3M1I5M1I2M1I4M1D4M2D1M2D7M2D27M1D3M3I3M3I3M1D17M3D8M2I2M1D10M1D12M1D4M4I10M2D3M4D10M1I6M1I27M1D10M1D2M1D5M3D10M6D1M1D5M1I14M1I4M1D37M2I7M1D2M3D10M1D7M2D14M1I3M2I8M3D2M1I4M2D7M1D4M1D2M2D11M2D14M5I4M1D4M1I1M2I3M1I9M2I1M1D8M3I6M1D4M1D3M2I17M2D34M1D39M5D28M2D3M1D21M5I4M1I5M1D5M1I11M1D12M2I30M1D6M3I3M1I1M2D8M1D12M2D3M1D15M2D2M2D27M1I10M3D11M2D1M1D1M2I5M1D14M3I10M1D6M1I8M1I1M3I4M1I7M3D8M3D10M1I9M3D9M3D1M1D15M1I6M1I1M3D12M8D4M8D9M2I1M1I2M1D3M1D6M4D2M6D12M2D3M2I7M2D17M3D4M2I7M3D2M2D14M2D3M1D2M2I19M3D12M1I27M1I1M1I2M1I7M1I2M1I11M1D4M1D12M1D4M3D2M1D4M2D3M2D22M1D3M2D6M3I6M2I14M1I1M3I1M1I5M1D6M3I5M1D18M1D8M1I8M1I6M1D14M4I1M1I6M1I15M1D3M1D2M1I4M1I9M1I3M4D8M1I4M2D11M6I2M4I3M1I25M1I16M2I10M3D4M2I9M1I21M2I11M1D4M2D8M1I23M3D5M1I3M2D3M1I10M2I3M1D29M2I4M2D5M1I10M4D3M1I9M2I3M3I18M1D10M2I11M2I22M1I13M1I23M2I27M1D5M1I19M1I7M7D9M1I1M2D3M2D1M3D3M1I6M2D2M1D5M1D13M1D2M1D3M3D2M2D1M1I1M2D6M3D1M1D8M3D4M1D2M2D5M1D6M1I23M1D38M1D11M1D7M1D9M1I1M1I8M2D5M1I14M3D4M3D4M1I8M1I7M2D6M1D18M1D2M1D5M3D9M2I5M1I3M1D9M1I10M1I2M1I4M2D10M6D1M2D14M2D3M1I14M1D7M1D4M2D6M2I40M1D4M1D8M1D6M2D7M2I19M3D3M1I21M1I3M1I2M1I20M1D3M3I5M1I6M1I25M1I15M1I8M1I15M2D14M7D5M1D22M1I8M1I2M2D4M1D5M3I15M1D18M1D8M1I24M1I6M2I11M2D9M2D44M2I12M1D1M2D5M4I4M1D3M2I4M2I6M2D1M1D6M1I1M2D1M1D15M12I7M1D4M2D22M1D12M3I14M1D6M1I13M2I3M3D15M2I19M2D2M1I6M1I3M4D2M1D3M3D7M1I29M3I4M1I18M2D9M3D9M3I3M2I7M1I27M2D2M1I4M3I4M1I29M3D2M1D10M1I3M1D5M1D9M2I3M1D10M1D10M2I8M1I9M2I6M1I13M2D1M1D9M1D11M1I12M1D14M1D7M1I12M3I4M3I13M1I4M2D3M1D10M1I8M1D1M3I10M2D9M2I7M2I20M1D3M5I9M3I3M3I7M1D2M2D5M1D11M1I27M2D2M1D3M1I2M1I15M1I2M1I9M1I6M1I19M4D3M1I6M3D13M5I11M1I8M2I9M3D15M2D3M1I5M1I1M1I7M4D10M2I14M1D10M1D3M1I8M1I13M2I17M3D7M3D12M1I11M1I15M1D2M1D9M1I21M1D5M1I4M3D2M1D6M1I1M1I7M2D7M1I10M1D1M2D3M4D6M4I7M1D6M2I6M1I25M3I4M1I25M5D18M2D16M1D12M3D9M3I1M1I8M2I13M1I7M1I13M1I1M2D10M1I3M2D7M1I5M6D18M1D7M3D10M4I4M1I6M2I10M2D1M1D20M1I8M2D14M1D1M1D13M1I9M2D6M1D5M1D5M1D5M1I3M1I6M1D6M2I7M4I12M1D6M1I6M1I5M1I14M1D10M1I17M1I8M2D8M2D6M4D6M1D8M3I8M4I3M1D1M1D7M1D4M1I11M2I9M1D1M1D4M1D2M1D6M2D19M1D15M1I15M1I38M1I2M7I6M3D14M1D2M1D5M2I7M1I45M1I11M4D24M1I32M1I8M1D21M2D7M1I3M1I2M2D2M3I3M2D3M1D4M1I4M1D8M4D5M1D3M6D10M3D8M1I1M4I4M1D15M1I8M3I9M1D3M2I3M2D3M1D47M2D10M2D9M3I4M2D6M1D14M1D8M3D13M3D7M4D2M1I2M1D10M1D6M1D12M3D3M2D3M1I11M1D6M1D4M2D3M1D3M1I16M1D1M1D10M1I4M2D7M3D23M1D18M2D4M3D5M1D7M5D4M1D3M2I8M1D1M2D7M9D8M1D9M1I5M1I2M4I31M1D3M1I5M2D13M2I6M1I1M1I2M2D3M1D7M3I6M1I21M1D3M2I6M1I19M2D5M1D3M1D14M1D9M1D5M1D10M2I2M2D7M1D5M2D2M3D3M1D5M1I9M1I5M5I1M1I3M1D1M3I1M1D9M1D10M1D19M1I13M3D5M1I18M1I22M1D15M5D5M2D1M1D9M3D22M1I2M2I9M1D5M1I5M1D1M2D5M4I5M7I3M2D21M1D3M1I1M2D6M2D6M2D15M1D3M1D6M1D2M1D19M2D5M3D8M3D11M2D25M1D6M1I4M1D3M1D10M3D4M3D6M1I5M1D5M1D10M1D11M1D8M1D14M2D10M2D3M1D6M1D17M1D5M1D6M3D4M3D2M2D8M1I12M1I1M1I19M3I17M2D22M1I8M1D4M1I24M3I8M6D5M1D2M2I4M1D12M2I6M2I2M1D4M1D15M4D14M2D7M1I6M1I15M1I3M4D13M2D1M1D6M2I18M2D17M1D4M1D30M1D12M1I3M1D1M1D17M2D3M3D16M1I20M1I10M4I6M4D5M4I6M3D4M2D2M1D2M1D8M3D2M1I2M4D9M2D8M1D4M3D17M2D5M1D11M1D22M1I7M3I3M1D4M2I6M1I5M2D8M2I2M1I20M1D11M3I16M2I9M1D3M2I17M3I14M2I6M1I4M1I5M2I2M1D11M5D2M4D1M3D4M3D1M3D15M2D7M1D8M2D4M1I9M3D14M1D7M1I4M2D9M7D1M3D5M3D30M1D5M1I4M1I12M1D12M3D3M1D2M1D8M1I2M2I12M1D4M2D8M4D24M2I3M1I11M1I15M1D15M1D9M1D7M3D4M1D13M1D1M1D8M4I31M2I16M16S * 0 0 GCGCGGTCGCGGCGCCGCCAGCGAGCTCACGCGACGATCGGCAGGGTGATCGCACGGCAAGCCGCGGACGAACATGGGGATGTGTGATGACCACGGAGTCTCTTCACTGCCCTGTTGAGCGGATCAGCCACTTTGCCCGCCAGTGCAAGCAATGGCTTCCGGTGGGACTGGTGCAGGCAGGCATACGCATCGGCGGCTTTATACTGCCCGACGGAAAATCCCGCTTTCTGTGCAGCCATGCCGTGCTCTCAGCGACTGTTCAACGACTGCCGCTGTTTAGCGCATCACTTTCGTACCCCAAATGAGTACTCTGGCCATCTGCTCGTCAAATCTGACCCAGCAATCCAGACTCAAATCAACGACCAGATCGCCTACCGTTCACTACCCTCCATCAGCCTGCGTGGGTCGTATACTGTCATCAGCGGGTACGTCATCCTCCGTCTGTCCCATTACGGGAAGCGGGGGATAACTTCATTCCCGTCCGGCCAAAGCGACGGCACTCAGGGCAAGCCCTGCCCTTTCTGCATCAGCACATCATCTTCAGGCTCTTCGTGCTCGCGCCGGTTCGAGCAGCTCTGAAATGCGGGGCCAAACTTAGATCGAGGTGCTGGCACTGAGGCCGTATGCCTCGAAAATGCATATCCGACGATAAACATCATGAAAATAATGGATCTGTAAAGCGGTGCAGTCGGCATACTCCGTCATGAATCCCGGCAGCATGCACGCCAGTTCGGACCCCATCTCACGCGCCATTCAGGGCAAAACTCAGCTCACGTCGAACATTTTCCCGGCAGGAAACAGAGGCGCCTGCGGGCCCGGCTTCCTCTGTCGTTCAGGGGCATTATTCACTACAAACTCATACATACAGACAGCCGGTACACCACGATTTCAGCATGAGAATTAAGCGTGGCCAGGTGGTAAGCACTTCCTGCTCAATCTGTTTAACGGTGCTTCATGGACGCATCTGCGTCGTTCTTAAGATGGTTATGCCACAGGGACATCGCCACCGATAGAACGCTTTCCGTATGATGGCGTCTTCCACAGTAAACTTCCGGTTGCTTGGCCGCCTGTTCTGCCTGCCGCGTTTCATCAGGGCGAGATGCTCAATGCGCTGCAGGGTTAACAGTTCAGAGAAGCGTGACGGTCACACGCGTTACGTTCAAACTGATTCGGTTTTCAGGAAGCCCGACTCTCTCCGGGTTGTAACTGCGGTGACGTAATTTCTGCAACCGCAGAGCAAACGCCCATTACCGGATACAACCCGGAATGTTAACCTTGCCGTTGCAGCAACACGCGTTCAAGTGGGTCATACCAAATATGGCTAGTGGCTTTTATCCGCAGACACCGCGCCGCGAAGCTCTTGTCGGTTACTAGCCGGCCTGAAAGCGCCACGGTCATAATTAACCGCTTTCAGCGAAGGCCTGAGGAGGGATCCCATGCCTTAAGCGAGTGCTGTTATCCCGTCCTGCGATCTTCTGCCATCGACGGACGTCCCCACATTGGTGACTTTCACGTGCTGATCATTCCTTCGCTATACGCCTTACCGATACTGCTGATCTCCAGCCACGGAATAGCCATCAATAATTCATGTTCGACGGGAGCGGCTTTTACACCGGGTATCGCGTGCTTAAACGCCAGCACCTGCTTGCCCTGCTCTCCCTGAAACCGCCAGCGTGGAGCTGGTTTCCCGGCAGATTTCTGCTACGTCGGTCACGGATTTGCGGTCTGCATCTTCATCATCGAGATAGCTGTCGTCATAGATAAGCGTCAGTTCGCCGGGCGTTAGTCTTTAATATTTTTCAGACGCATACCGGTTGTGCAACGTCTGAAGGGATTCGGGGTGTAAGGGTCGCTCCGGTATAAACCCACAGGGTGTCCCGGCACCTTTCACCGGCATTGTAGGATTTGGTCACAGCATAGAGCGTCACATTTCATAGGTAATGACATAAGTCAGATCGGCTGGCCAACGCATCATCATCGTCGCACCATTAATCTAACATCAAAGCATGACTGATCGTAGGGTCGGGATATGGCTCATCGCACTAGTACCAAATCTGGGATATCGCCGAAGCAGGACGGCATCCAGCTGAGCAGGAAGAGTGGTTACGATATGCAGCTCCGCCAGCTGCCGACTCCTGTCCCTCTGCCCGTGTATTCAGCGCCGTAGAGACATACGGCACTTAGAAAATCGCTCATCAAAACTAGGGCGACCATCAAAAACGTCGCCCCGGTGTCAGCTGCCTTCCAGTGCATCCGATCGACGGTAAATGGGAGGCGTGCATGCGATGCTCCGTTATTGAACCTCAGTTGATGCGACGCTACTCGCAGCTCTTTCAGGAAGACGTTCACGCTGTATCCGCTCAATATTTTGAGTCTTTCCTCAGCGACGCCGTCCGGGGATTTCACACATCAATCGGCTACGTTTTTCCCAGCCGCTGCATGACATGCCGGCCTTTCAGTTGTTGAATAAACGCGCCGGGGATGCCAGCTTCTCACTAAGGGGACAGATCGACGTTTGCCCTAGGATGAACTCATCCCTTTTATAAAGGACAAGCGCACATAACCAAGGATCTCAGTGTACGTACGGCAAAATCCCGCGGTCTATATTTACTTCTGCCTGCCGGGTTTTGACTCGTGGCCGGTTGCGCCTCCGTTGGATCTCCCGAGTGTTACGGCGTACCCTTGTCTCACGGGCAACCTGTGACGCCGACTGCGATATCGCGGATGAAGCAACGCGGTTAATGGCCATTGCGGCGGCACCAGGCACCGTTTGCGGCTGATACGGCTGAGGTTTTCATAACGACGGCCTTAGCCACCTTTATGTATCCCCCTCCATCCGTTCGACCGGGCACCGTTATAACGAGAACGGCGTCCGACAAGCCCTCTTCCGCCATGGGTACGAGCATCTGAAGTCTCCAGAAATTTTCCTCACCGATGGTCTCACGTGTCTCCACGCATTGGCACCATCAGTCGCAGCTAACCGACGGCTGAGCCTTCAACGCGCACGCCGTGCGACCATCGCTCTTTCGGTCATCAAACACCACGTATCACCGGTAATGGTCTTAGCCCCTTGTATGGTGGCTGACGTTCCCATTACAGCGTATCGTTTCATCGAGCGGGCAATGGAGCAGGCATCGAACAGTATCGAAATCGCGCCCTCCCGTTACTGCACATTTGGCCAGGCCGCGCCTCCGTCATTTCGGCTGCCACCGGCAGGACGAAACGCGTTCCCCTCCCAGCACAAATGCTAGGGTTCATCCCGCCGTGTGGCGTGAAGTCGCATCCAGTATTCATGCAATGCCGTGCCCACTAACAGGGGACCAGTTGATATCCGTTCGACCGTATCCAGAATCACGGTATCCGCTCGGTGCTGATGCCTCAGTTTTCATGTCCGGTCAGCACATTTTCCCGTAAGGGTTAGCTTAGTGCGTCAGGCATTTCAATCGGTTCTATCAGCTCTGGTTTCAATGGTCACACCTCATCAGTTCTTCTTCTTTCACCGTTAGCCGTCCGGGACGGTAATACGTTCCGGTTCTTTCCATGGATCCCACAACAAGCTTGAAGTCTGCGTCATCTTTCGTCTGATGGATAATGACAGGCGCTGCTTGCGCCGTTGTTGCCCATTAATCAATCCTCCAAGCGGGGTATCTCGCTCGGTGCTGACTGAATCATCTGTGAACCTCCACGCGGCTCGTACGCCTTATCGAGTTTGGGGTAACGGGCAGAGGCGTTAGTCGTGGGTCGATTCACGTGCGTCCGCATCCTGAATGCAGCCATAGGTGGCAGACCCGTGCCTGAGTGTTCCCGGGAGGCCCATCGTGTTGTTAGCAGGAAAGTTCTTTTTGACGCCGTTTTCCACGTACTGTCCGCATCTAAGACATGGCCATCGCGGGCTTAGAACCACCGCTTTGCCCAGGTCTTTCGCCACTGTCTCCAGCTCGGAATTAGAGCCACGACGGGTATGCACTTCCTTGACGGTTTGAAGGAACGGAACAAGAGCCGCCTTTCAGATCCAGCCATCCTGTGACACACGGGCGTTCAGCGGGCTTCGATATCGTCGGTCGCTTATACAGATTGGTAAATGTCACTAGTTGCTCCAAAGCCGTGCCGCCGACTGTGCGTGATGTTATTCTCCACTGCGCTCCATATCCACCTCAACCGGATCGAAGGCTTCACCGGTCATGGTGGTTTGCATGCAGCACGGCAGACTGCCTGCATCTCTTCGACCTGAGCAAACCGCTCTTCGTCACGCATGTTCTGGCTGGCATGGTTGACCGACGGCGGCGGTAAGCGGGTCCGCCAGAAATTCTGCTTACAATCTTCATCCGGCATGGGGACGCAGGGTCAGCCCGGATGCTTCAGTGGATTCGAGTACACACTCCCGGCGTAATTCAGAGGGTGGAGCCGCCACGGGAACCGGATAACCTCGGAAACAATCCATCATCGTGAACACGCTGTTTTAAAACGAGTCCCGATTTGTGGAGAGCTATGTCTAATTATACGGGGACACTAGCCACGGAAAAGAGACGCAGAAACAGGTGATATCCAATTTCTGCTCACTTTGCCTGGCATTTGTACGGCCTCAATCCCGTACGATAGCGCTAAGCGTCGGTGAAGGGTAAATTGGCCTCCATTAATTGCCGTTCCGGCTGGGGATTCCGTTTCGTCGTCACTGGCAACGGACCTAAGAGCACATCCTCATAACGCTGGTTAGACTTGTGAACGTCAGCGTGGTGCTGGTCTGGTCAGGTAAGCAACCGGCAAGAATGCCAACGGCATTCCTTAGATGGGCTAACCGACGCTCGGCTCGAACTTCCAGCATCAGCGGGGTTGCAGAAGGCGCCTTTCGCACTCAAGCCTGATCCACGGGCGCGCTTTGCGCGGTATGAGCCGGGTTACTGTTACGTGCGGCCTGGTAATGGGTAAAGTTTCTTTGCTCGTCAGCTAAAACATGCGGTCACACTGGTGTTGCGCAAAATGGGTTAACGGCATCAGATGCCGTGGGTCTGCAGCCATGTCGAGCCTAGTCGCCGCCTGCATCAGACGATCCAGCGCAGTCACTGCGCGCCTGTGCACTCTGTGGTGCTTCCATCGAATGCGGCGGGCCGTTTTCACGGTCATCTCAAGGCGATTTCTGCCAGCGCGTGCCTGTTCTTCGCGTCCGTGAGCCTCCCCGTTACAGGATCCCCATAGTGCAAGCTGTTCTGCCCGCAACCGATGCGGTGATCTGCACGTTCGTCCAACCTGCACCGGGCGTTCTCGCTCAGCGTCGGCGCTCCGACGACGTCAGTAACGTCAGCCTGTGCGAAGCAGTGGGGCTGAAACAGTTGTTGATTGAGGTCTCTTTGGTCACTTCGCCCTCCTGAGAGACCGCTTCGACGTGCATCCAGTGCATCGCGCATGACGTGATGCGCATCGGTGCTGTTAACACAGTTCATCAGTCCGGCATGATACCTACCTGACATTACTGAGAGACGGTATGCGCCAACTATCATAGGCTTATGCCGACGTCGCAAACACTGGCGTGGTCCCGTCCATCCAGCTGGCGACTTTAACGAGCGTCGTGAGGAAGATGGCTGTAGGGTTGCATCCCACGTAGGCTGCCCCCGTAAATGCACATCCTTTACAAGATGTCTCCGACACAGCGTAAGTGCTTAGCCATGCCTGACGGATGCAACTGTCCGGGCGGTCTGCGTACAGACGGGAGGCGGCGCGCTCGGCAGCAACTGATCGTGCACTGCAAGTTCAGGTCGTTGGCACACCGGCTTTTGATCCGCTAGAGTGGAGATGGTTGAGGGCGTCAAATGCCCGCCACCATCCTAGGGGCGTGTCCATATCGAGCACGATGCCGTCCACCATCGGATCACTGAGACTGTTGTGCAAGCCTGAGATAATGCGTTGTAACCGGTCATCCCCGAGTACGGCTGCAGAGGCGCCCCCGTCCGGCTGATAGGCTCGTGCTTAGACACCGGCATAGAAATTAGATGCCGTTCAGTAACGTAATAACTGCGGGCCTGTCTTATGTTAGTCATCATCACCGGATAATGCCAGCGTGCGAGTGCCTCCTGGGCAGTCAGGCTGTCTCAGCAACACGCATATCCGTCAGGCTGCTGATCCCAAGCTGGCCTGCAAGGCACAAAGAAAACCCGCGCATAGTGGGGTTCAAGGCATCAGCTAAGCAACATGCCTACATGCTGGCAATATGCGGGGATTACGCAGCTCTGCTGTCACTCTTCCTCCTCTGTTGAATGTCGCAGCCCGAGCGGATCAGCAATGGACTCGAGGCCAGGCATCGTCGAAGTCCGGCCTCATCAAACAGGCGCACGGCCGGCCGTTTCACGTCAATATCATGGCAAAATTTCCAGATAGTAGTCGTCACCGCGTTTTGCGCACTCTTTCTCGTCCACTCAGTTCGGCTTCTATCACAGCATCACCGCTTCCTGATTCCGCTCAGGACCATACCGGCCGGTAGCCTATCCAGTCGCAGTTCCCCCAGGCACACCTGCGGGCTTCATGAAAACTGAAGCGCTTTCAACGTCACGCCCAACCAAGGACGATGGGCCTCTTCCAGCCAGCACAGAAACATCTGAGCCTGATGACGGGATGCGACGAATTTTGCCCGCCCCATAAACCACGACTCGTCACGACTCGCCGTGCTTTTGGGATAGCTCATCTGGCGTAATGCGTCGGGAAAGCCTGCTCATACTCGAGACGAGCCCCTCCGGCCGGGTCTACCGAGCAGTGACTGCCTCAAACACGGATAGCCGTTATCCGTTCCTGAGCCCGTCTGCAGGTTGGTTAGTGAGTCACCCGGCATCGACTTAGTCGTTGCGCCTCCCAGCCGGCTGGCGACGCTGCGGCGTAATACGAGGCGATTGCCCACGCGATCGCGACAGTCACCTCCCGGTTCACTCCTAGCGCTTAACCTGACTTTCGCCCGAATAAAATCCAATGACGGACTGCGTATCCAGCTCACTCATCTGCACTAGCATACATCGCCTTCCACAAACCGCTCTTGCATCATGCGTGTTCATGCATGTCGTGAGGCATCTTCATCTGCTCCATCATCACACGCTGTAAACACATTTGCATACCGCGAGTCCCGTCCTCCACGGGTCAGGACGTAGCGATGAACGAGGCGCGCCCGCCCGGATAACTCACGGGTATCCATTCCTATTTCTGCGGCATCCAGCCAGGATATACCCGTCCTCGCTGAACTATCCGCGCCGCACCTCATGTCATTAATCGTGAGCTAGGGCCGGCGTTTAGCTGTCAGCGCGTATTGTTCGGGTTACTCTGCGCGTCAGTACAATCTCATCTACAAATGTCCGCGACGACCCGGGGTATATCCCAAGTAGGCCTGACGAACAGAGTTCACCCGTTAAAGGCGTGCATGGCCACACCTTTTCCACGAATCATCATGGTAAACGTGCGTTGCTCAACGTCAATGCAGCAGCAGTCATCCTCGGCGACTCTTTCCATGCTTCAACCTCGCGGGGAAGCACCCGGGCTTCTTCCTCCCCGATGCCCAGATAGCGCCATGGAGGGGGTATCGACAGCCCGACGAAGAGGTAATCCTGATGCATATGATGGCGTTGGCGGCATAGCACGTTGATTGCGTACCAGATCGTCCCGGGCATTGCCACGGGTAAAGGTTGAGCAACAGGTAAGCATCCCTTCACTCGGTGGGTTTCCCCTACAAACTGCCTCCAATCCCTGCCTACCGCTGTGTAACCGGCCCATATTCGCAGAGCGATGTCATGCGTCCGTGCTACAGAAGGGTGGGAATGGTGGGCGTTTCATACATAAAATCCTGCAGGTCTCCGCTGCGTGGATGTCATGCCGGTCCGTGCACTCTGCAAGACCATTTTTCAGGTCAGACACGGAATGGCGCTTAAATTCCACCCCTTCGTCCTTTCTTATGTTGCCCCCGTTTACCTGTCATCAATCATGCAGTGCCGCGCCGGGCAGCGGCAAGTTCTTCATGTCGCGTCATTCATGCTCTCCGGCCCGGGCATCGTAACTTAGTGTAATGCCAGTGTTTTCTTGTTGGTGCTGCAGCATCCTCTTCCTGCATGAACGCCAGCAGCGCACTGAGATCCAGCTGCCGACGGGAAATACTGATGCGCAGCGCCGCCAGCCCATAAAACGAAGCAGTCGAGTGCCTCATTGCGTCGCTTTTGCTGTCCACAGTATTTTCCTGCCATCCCCATTTCCTCTGATGGGAATCCAGGCAGCCCAGTGCAGTGCGGCCAACCTGCTGTTTATGAAGTCAATCAAAAGAGACGGGGAGCGGTTCGTACACGGTCGGACGGCGTCAATCGACCAGCATTTATAAATCTGCTCTTTCGCGGTATCCGTACCGATTTCGGTACGGCGACCCGTTTTGTTTCGGATCACCGTGGCATGCTGGCCACCGGCTTTCCGTAGACGCATCCCCTTTGGCACGAACACAATCACGCATGTTTTCGAGCGTTTCGAACACAAACCGTCGGGTCAATCCCGGAGTATCCCAGCAGATGACTCGATATCGACATTTCTGCACCATTCCAGCGGTATAGTTTTATTACCGGCCTCATCCACGAGCAGCGTCTGTTCATCGTCGTGGCACTAGGTAATGCCGTCATAATCAGCCATAATCGTCCTGAACCCCATTAGAACTCGCGCGGTCATCCGTCCAGCTGGGAGTCGATACCGGCGGTCAGTAGCACCCGCGCCAAGTCAACGTGGGAGCATCGAACGATAATGCTCTTTCCGCTCTTGCCATCACTTCAGCATCCGACGTGTTCTCACAATTTTCGCCTCCCACGTCTCACCCGGCGTACTGTTCACGAGGTTTTACGTTTTCTCGTATCCCCGTTAATTCATGAATCTGGTCTCCGATGGGCACGAAGCGTGCATCAGTGGTAGAAACGTCCAGATGCAAAGGTCACCTGTCAGGTGGCTCAATCTCATTGCCGCATGGCAATGAGGAGAATGCCATCACGGGTCCCAATCCCGGTCTTTCGCAGGTTAACGGGCATCAGTAAAGTCGCCTCCTGCTGGATGACGCAGGCATTATGCTCAGCATAGAGATAAAACCCTGGGAGGGTCATCCCGGCGTCAGAGTCGGTTTTGCCAAAACGCGTCTCTTTGTCGCACAATTTAATACTGCTCCTCCGCAATGCGGCAGGCAACTGAAACGCATAAAATGCGGGGTTAACCTGCGCTCGTGACAGGTGCCTCATTTTGGCGTGGAGCCACGGATGACTTTGACAGGCGGCCTTCATCAATGTCGAAGAGACTTCGAGAGCTTCCTGTTCATATCATCATCAAAGCAGCAGTTCATCATGGCCACATCCACCGACTTTCACGGTAGTTTTGCCGCTTTACGCCCGGCAGCGAAGCGCATTAGTGAAACGCTTCATGGTGAGCGTGTTATCCGGTGCTTTGCGTGCCATACCACGGGGCCCGCCAGCAGCGACGGAATATCACCGAATAGTTAGCTCAACGTGGGTTTTCATAAAGTTCTGAGGGGCATGAGTCGGAAGGCGAGCACCGGTGGTGCGGGCTGCTGCTAGCGCGTAAAGTAGGCATAACGAGCAGCATTTTGGAATAACTTGACACGGGCAGACATCTTCACGATTTCACGGATGTAGTCGCTGCCCAATCGCATTCATGATGGCCCCTGAAAGGCAGTGTTTCCCATGCCCTTCCTGGTATGCGGATTCTTTCGGGGAGATAGTAATTAAGCTCGCCCATTCATGGGGCGTCTGCTCCGGCCTGAACAGTGAGCGAAGCCCGGCGCGGACAAAATGCCGCAGCTGGCCTGTCTGACGGTATGTTCGATATTGCTCTCAGCAACGAGTGGGGATCCAGCGGCTGCTTGTTCATGGCTTTGATGATATCCCGTTCAGGAAATCGCTCGTGGGTTTTCCAGTTCCGCAAACGCCGCTGCACGACAGGGGGAGCCCGTCGAATACTGGCAATTTCAGCTGCGATCCGCGACAGCACGAAAGTACATCGAATGCGGTTTCCACCACACTTCAGCGAGTCTCTGGCATTCTTCGGATTCCTCCTGTGCGTCAACATTGGTCAGCGCGTAGTCAATGAGGCGTTCGTACAGCCGTTGCTGGCTCGAGATGCCCTGGCCGAATTCGTCCCTCGCCGAGAAAGTCCGTTGGGGTTGCGCAACCCTTTCGAGCAGTTTATGAGTCAAGCACCTCGATCGCTTGCCACCGCCTCGCAGAACGGGCATTCCCTGTTCCTGCCAGTTCTGAATGATACGTATACTCAACTTATAGAAAATGTCAGCCGGCTGCTTTTGACTTCCATTGTTCATTCCACGATAACAAAACAAGAAGGAGAACGACAGAGGCCAAAGCTCGCTTTCAGCAGCATGTCGTTCCTTCCAGAGGGTATTTTTAAATAAAACATTAGTCAAGTTATGACGAAGACGAACGGAAACGCCTTAAAACCGGAAAATTTTCAGCTATAGCTGGGGTAC * tp:A:P cm:i:71 s1:i:631 s2:i:0 zd:i:2 NM:i:2023 ms:i:2824 AS:i:2824 nn:i:0 SA:Z:utg000001l,36658,+,36S1757M63D8693S,60,466;
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
113 103 2048 utg000001l 36658 60 36H7M1D11M1D11M3I1M1D9M3I3M1I3M3D8M1D10M1D3M2D8M1D3M1D11M2D12M1D5M3D11M2D4M1I5M1I9M1I10M1I14M1D33M1D4M1D35M1D4M1I9M1D6M1D8M1D1M2D1M1D19M1D11M1D36M2D8M4D4M2D5M1I1M3I6M1D1M1D10M1I5M3D5M1I7M1D11M1D4M1D3M1D11M3I20M1D10M2I4M1D3M1I14M4D9M1D6M1I17M1D3M2D1M3D2M2D11M1I5M1I8M3D20M7D3M1I4M1D18M1I6M2D1M2D11M1I1M1I10M1I11M1D13M1D13M1I3M1D5M1D8M1D5M1D9M1I4M3D39M1D16M1I4M2I5M4I1M1I8M2D15M1D35M1D33M1D4M2I1M4D10M1D1M2I30M1D3M1D9M1D11M1I3M1I18M1I11M2I2M3I5M2I4M2D13M2D23M3D2M2D18M2I10M2I16M1I1M2D4M1I15M1I14M4I13M1I6M1D17M1I12M2I5M1D8M1D8M4D9M2I9M1D16M1I12M1I2M2D4M2I9M1D3M1D6M1D4M2D25M4D19M1I3M1I4M2I14M4D15M1D5M1D8M3I3M1D27M1D1M3D6M1D6M1I10M2I9M1D1M1D2M1D1M1D44M2D12M3I1M1D2M2I7M2I10M1I1M1I14M2I12M1I6M2I14M2D2M1I14M1D4M3D9M3D5M1I9M3I4M2D4M1D15M1D6M1D14M2D4M1I10M3I34M1D3M1D5M1D10M3D6M1I7M1D8M8693H * 0 0 ATCGGCAGGGTGATCGCACGGCAAGCCGCGGACGAACATGGGGATGTGTGATGACCACGGAGTCTCTTCACTGCCCTGTTGAGCGGATCAGCCACTTTGCCCGCCAGTGCAAGCAATGGCTTCCGGTGGGACTGGTGCAGGCAGGCATACGCATCGGCGGCTTTATACTGCCCGACGGAAAATCCCGCTTTCTGTGCAGCCATGCCGTGCTCTCAGCGACTGTTCAACGACTGCCGCTGTTTAGCGCATCACTTTCGTACCCCAAATGAGTACTCTGGCCATCTGCTCGTCAAATCTGACCCAGCAATCCAGACTCAAATCAACGACCAGATCGCCTACCGTTCACTACCCTCCATCAGCCTGCGTGGGTCGTATACTGTCATCAGCGGGTACGTCATCCTCCGTCTGTCCCATTACGGGAAGCGGGGGATAACTTCATTCCCGTCCGGCCAAAGCGACGGCACTCAGGGCAAGCCCTGCCCTTTCTGCATCAGCACATCATCTTCAGGCTCTTCGTGCTCGCGCCGGTTCGAGCAGCTCTGAAATGCGGGGCCAAACTTAGATCGAGGTGCTGGCACTGAGGCCGTATGCCTCGAAAATGCATATCCGACGATAAACATCATGAAAATAATGGATCTGTAAAGCGGTGCAGTCGGCATACTCCGTCATGAATCCCGGCAGCATGCACGCCAGTTCGGACCCCATCTCACGCGCCATTCAGGGCAAAACTCAGCTCACGTCGAACATTTTCCCGGCAGGAAACAGAGGCGCCTGCGGGCCCGGCTTCCTCTGTCGTTCAGGGGCATTATTCACTACAAACTCATACATACAGACAGCCGGTACACCACGATTTCAGCATGAGAATTAAGCGTGGCCAGGTGGTAAGCACTTCCTGCTCAATCTGTTTAACGGTGCTTCATGGACGCATCTGCGTCGTTCTTAAGATGGTTATGCCACAGGGACATCGCCACCGATAGAACGCTTTCCGTATGATGGCGTCTTCCACAGTAAACTTCCGGTTGCTTGGCCGCCTGTTCTGCCTGCCGCGTTTCATCAGGGCGAGATGCTCAATGCGCTGCAGGGTTAACAGTTCAGAGAAGCGTGACGGTCACACGCGTTACGTTCAAACTGATTCGGTTTTCAGGAAGCCCGACTCTCTCCGGGTTGTAACTGCGGTGACGTAATTTCTGCAACCGCAGAGCAAACGCCCATTACCGGATACAACCCGGAATGTTAACCTTGCCGTTGCAGCAACACGCGTTCAAGTGGGTCATACCAAATATGGCTAGTGGCTTTTATCCGCAGACACCGCGCCGCGAAGCTCTTGTCGGTTACTAGCCGGCCTGAAAGCGCCACGGTCATAATTAACCGCTTTCAGCGAAGGCCTGAGGAGGGATCCCATGCCTTAAGCGAGTGCTGTTATCCCGTCCTGCGATCTTCTGCCATCGACGGACGTCCCCACATTGGTGACTTTCACGTGCTGATCATTCCTTCGCTATACGCCTTACCGATACTGCTGATCTCCAGCCACGGAATAGCCATCAATAATTCATGTTCGACGGGAGCGGCTTTTACACCGGGTATCGCGTGCTTAAACGCCAGCACCTGCTTGCCCTGCTCTCCCTGAAACCGCCAGCGTGGAGCTGGTTTCCCGGCAGATTTCTGCTACGTCGGTCACGGATTTGCGGTCTGCATCTTCATCATCGAGATAGCTGTCGTCATAGATAAGCGTCAGTTCGCCGGGCGTTAGTCTTTAA * tp:A:P cm:i:28 s1:i:249 s2:i:0 zd:i:1 NM:i:466 ms:i:928 AS:i:928 nn:i:0 SA:Z:utg000001l,40469,+,3654S6816M264D16S,60,2023;
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
114 104 16 utg000001l 9780 60 1267S9M1I4M1I37M1I1M3D2M1D4M1I13M1I29M1D4M3D22M1I11M1D5M1D14M1I8M1I2M1I17M2D2M2D13M1I3M1I7M1D7M1I11M1I22M1I14M2D4M1I3M1I3M1I5M2D8M1D4M1I8M2I5M4D1M1I13M2I6M1I2M5I6M4I1M1D9M1D5M1D10M2I12M2D3M1I7M4D5M1I9M2I1M2I1M4I2M1I3M2I6M1I5M1D11M2D24M3I4M1I1M1I12M4I10M1I7M1D2M2D10M11I9M4I19M1D2M2D1M1D7M1I10M3I6M1D4M3I1M1I7M1I24M2D3M2I1M1D5M1I29M1D6M1D8M3I9M1I4M13I3M3I6M1I3M3I4M6I31M1I7M1I1M1I6M2D5M2I3M1I13M3D12M41I20M1D8M1D12M1I11M4D5M1D6M4D4M4D14M1D4M1I7M1I4M3I7M2D6M3D11M2D3M1I6M6I1M1I3M1I8M2I12M2D5M2I3M1I8M1D2M6D10M3D5M1I10M3I5M1D2M3I6M1D7M2D2M4I3M1I24M1I6M6D26M4I1M1D13M1D10M1I12M1I9M2I8M1I3M6I8M1D2M3I1M2D12M1I12M1I9M2I12M1D9M2I16M1I4M3I22M1I2M1I4M2D10M3I27M2I14M1I22M1D1M2I3M1I14M1I1M1I10M2I18M2D18M1I5M1I18M2D4M1D12M1I8M1I1M1I5M2I8M2I27M3D4M1D1M1D6M2I16M1D8M4I36M1I6M2D5M1I3M1I3M1D4M1I2M1I17M5D5M1D3M6I21M1D5M1D1M2I2M4I4M1D1M2D19M2I5M1D9M1I7M1I11M2I4M2I3M2D17M1I15M2I8M1I7M3D7M2D2M2I26M2I3M1D24M3D7M1D2M2I9M2I1M1D3M1I16M1I16M1I15M5I10M8D2M7D1M3D7M2I13M2I2M4I19M1D4M5I2M4I1M2I10M1I3M3D2M1D11M5D5M2D1M1D4M5I3M1I8M1D11M3I7M3D3M1D4M1D5M2D3M2I4M4D3M1D1M1D10M2D17M2D2M1I2M2I9M6I6M3D4M1D6M2I15M1I7M1I22M3I3M1I4M1D4M1I17M2I20M1I4M3I2M1D6M10I7M2I1M2I10M1I5M1I8M1I4M1D9M1D9M5I3M2I1M2I4M6I12M5I3M1I3M1I10M4D4M1D6M1D3M1D3M1D17M1I12M13I1M1I2M8I4M1I15M3D4M1D6M2D4M2I7M1I5M1I8M2I6M3I9M2I14M1D6M1I9M2D5M4I5M2I3M1D7M2D6M4I3M1D8M2I2M1D6M2D12M1D7M1I15M4D1M1D9M2I11M1I2M1I7M2I6M2I11M1D1M1D8M1I17M2I1M1I18M2D17M3I23M3I4M1I10M2I8M1D1M1D2M1D11M3D5M2D1M3D10M2D13M1I7M1D10M1I9M1I2M1I5M1I8M4D6M2D6M1I9M3D4M3D2M2D21M1D3M1D7M2D5M1I4M3D9M3D9M2D2M1D18M1I2M1D5M4D10M1I7M1D19M2D13M1I18M2D9M1D3M3I1M4D4M1D2M2D2M1D9M1I6M1D1M3D3M1D5M4D3M2D4M4D7M6D12M2D6M1I6M1I5M3D5M2D1M1D12M1I2M1I4M2D6M1D8M1D5M1D2M1D4M3D25M1D18M1D7M2D7M2D8M2D10M1I12M1I13M2D2M1I9M2I17M1I11M1D7M1D8M1D20M2I3M1I4M3I8M1D1M1D7M3I6M4D14M2I6M2D1M1D2M1D41M2D6M1D7M4I3M1I6M2D9M7D6M1I6M2I6M2D23M4I5M1I5M2I6M4D6M1I4M3D9M2I9M1D6M1D3M2I13M3D16M8I17M1I1M2D7M1D10M1I1M1I13M3D5M2D9M1D4M1D15M4D8M2D11M3D5M3I1M1I3M1D10M2D6M3D3M1D29M1D16M1I4M2D7M2D12M1I16M5D5M3D4M1D21M1D12M2D14M1D11M1D4M1D3M1D6M1D8M1I6M2I29M1D6M2I6M2I2M1D21M1I15M2I2M1D17M4D19M1I7M2I7M6I5M3D5M2D14M1I8M1I15M2D4M2D1M1D3M1D18M4D4M1D8M2I2M1I4M1I5M2I5M1D19M2I4M1D7M3D5M1I6M4D10M1D4M1I16M4I7M1D16M2I3M2D4M1I11M7I2M4I9M1I1M1I2M2D3M1D8M2D6M1I17M2D5M1I4M1D10M1I30M2I4M1I3M4D10M3D6M5D29M2D2M1I18M5I19M1D2M6D7M1D25M4I18M2D3M2I4M1I3M1D12M732S * 0 0 GATTGTTCCACTCATCGTGATCCTGTGTACCCCTCCTTGAAAACTTACATCTTAAAGGGCAGGGGTTCGATTTCCAGCCACCTTCGTCACTTCTGAGACTGTTTCATATTGTCTTGACGGTTTTCGCCGCGAAATACCGCCAGTAACCGGCTGAAACACCGTTAGTCACTTTCGGTAGTTCTGGTACCCTGCGGAGGCCGCGTGATCGTTCTTAAGCTAGCTTAGATTAACGGATGCTGAATTCGTCAAAGTTAACTTCCATCATTGTGTTGGCGAGTGTTTTTCAGCATCATCTTATAAAGCCATTCGTCAGCTTATACATTATTGAGTTGGAGCTGCTGTTAGATCGCCCCCGTTGCTAGGTTACGGTGGTCTACCGCGTTTGGTGTTGATTACTCGGCTTTATCGGGCTCATGTCCCAGTGCGTCCTTAAAGGTAAGCAAAGTTACCAAACCTTGGCGCGCATAATGCCCGAACAGCACACATGTCGCGGTGGTATCAGGTCACGTTCACGGATCAGCGGACTCGCTACCAGCAAATTCGGGTTCTGGCTGATGGTGCGATAGTCTTTCACCATGTCAACATCCTCACTTGCGGGCAGGTTTTCTTTCTTAATTCGTGCTGCCGCTCTCGAATCGCAGCAATCCATTCACACAAGAAATTATTTCTGGCTGTTGAGCAGGATTCAGAATTCTCTGACGAATAATCTTTTCTTCTTTGTACCTTTGTCCCCTGTTTGGGAGGGGATAGCAATCCCCAATTTGGGATGTTTTATCCTCGTTATTGGGCGACCTCCCTTGTCCGCTAGATGCACCATCGTATTATCTTATCTTATCAAACTTCATTCCATTCATGCTGCTCACCGCAAGTTCTACTCTTGACGGTTCTCTTCAACCGGTCATCCCATTGCACCGTTTGAACTATAATTTGTAATCTCTCGGCTTACGAGAATCGGTGATTGGTTTGGTTTATTCTACCCATAGGTTTTACGCAGAATGGCAAGCAGCAGGATTTGAACTGTTGCTGCCGGTCAGATCTGCTGCCCGAATAAGCCTCAAGCAGGTAATGTTAGTCTGGCGTAACCATCATCAGTGCGGATCTGCCATTACGTGCTCCCTGTCCGGCAAAGTTACCGCGGTAGTTGAGTATTTTGCTGTATTTTGTCATAATGACTCCTGTTGATAGATCCGGTAGTAATGACCTCAGAACTCCAGCCATTGGATTTGTTCCGAACGCTTCGGTTGCCGCCCCTGTTTTTGGCTTGGGCTGAGAATCGCCACCGACTTGTCGCGCCCCAATCGCTCCATGTCAACGATTCGATGCTTCACAGAACAGCATTCATTAATTGAGAACTTTGGAATCCAGTCCCTCTCCATGCTCACGGTGACTTATCAACGCCCACAGCTTCCGTCTTCTCATTCGACTAATCGCGGTTCGATTCAAGCAACGCACTCTTCACGGGGCTTCGTTGCGTTTGTTTGCACGACGATGTAATAATATTTCCTTAGATAACAATTGATTGAATGTATGCAAATAAATGCATAAGAGCTGTGGTTTTAATCCTGCCCTTCAGGGCTGGAATGTAATATCTGTTTATGCTGTTTATTTTTGTTACTCGGGAAGCGCTTTACCTCTTCCTCGCATAACGCTTCCAAGTAAGCGTTTATAAAATAAATCTTCATTCAATGAATGGCTGCGGTAGGGTGCTTTACAATCGCGCCCTTATACGCCGAGATTTAGCTGTCTTGGTTTGTGCCGACCGCATTGCATAATCTTTCAGGGATTATGCGTTGTTCCATACAAACCTCCTTAGTACATGCAATCACCCACCGCGTTATAAAATAGTCAACACGCACGGGTGTATTTATCCCTTGCGGTGATAGATTTATAACGTATGTGAGCACAAAAGAAACCATTAACACAAGAGCATGAGGACGCACGGTCGCCTTAAAGCAATTTATGAAAGAAAATCAAATGGCTTATCCCTCAGGAATCTGTCGCAGACAAGATGGGGGCCACTGGCGGATGCAACCGTTCCGTTGGTGCTTTATTTAATGGCATCAATGCATTAAATGCTTATAACGCCCCGCATTGCTGCCACAAAATTCTCAAAGTCGTTGAAGAATTTAGCCCCGGTAAATCGCCAGAGAAATCTACGAGTCTTATGAAGCGGTTAGTATGCAGCGGTACTTAGAATGAGGGCTGAGTGCCCGTTGGACTAGATAGCTGTTTACGGACTTTACCAAATGATGCGGAGAGATGGGGTACAAAGCACAACGAAATCGTTTGATTCTGCGATTCTGTGATGAGTCAAGGTTGAAGGTAATTCCATGACCGCACTAAGACAGGCTCCACGGTTTTCCTGACGGAATGTTAATTCTCGTTGACCCCGGCATGAGGGCTTTGAGCCGCTGATTTCTGCATAGCCATACTTGGGGGTGATGAGTTGGTTCAAGAAACTGATTAGGATAGCGGTCAGGGCGTTTTACAACTAACTAAACCCACAGTACCCAATGATCCCATGCAATGAGAGTGTTCGTAGTTGTTTGTGGTAAAAGCTTGTCAGTGTGGCCTCGAAGAGACGTTTGGCTGATCGGCAAGGGTTCTGGTCGGCGCATAGGACTGATAACAATTGAGCAAGAATTTTTCACTGAATTAGAAACCTTCATCTCCCTCAGAACATAAATACGTAAATGGATTGAATTATGAAGAATGGGTTTTATGCGACTTACAGCAGCAAAATAAATGAAAGATAAGTGCTCAATAAACCTGTCTGATATTTCCTGCATTCTCTGCTGGCTGATAATCATGCAGGTTTGTTCAATCAGCCGGAGTACTCATAAAATCGATGGAAACTTTCTCTTTACCAAAACAAATGACAAGAGTCTGGTTCAGAAGATAACTCTAAAGCTTCAGTCCAAGATAGAAACCTCGCAGATGACGAATCATTGGGTTCCCATCTTTGTTTGTTGAAGGCTAACACCATTGGTTTTGCCAGAACGTGGTCGCGACCAAGCGGATTGACAGATTTTAATCGGGAAAGGAATTAAGAGTGATGCAGGCGAGCGCGTTCAGATAGAGCCACTGTCATCTTGGAGGGAACCACTAAAAGACGGTGTTATGCATTGGATTTCACTCATCAGAAACAACGGTGAAGGCGAAGCCACTACCTGTATTTGGCGTCATATTAAAGGTCTTAGGGAGTAACAGGATATTAGCACGCATTAGCGACTCATTAGATTATACCTAGTGCAGGGAATTAAAAGGATAAAAGGTTGCCACGATTATTTTAACCCGTCATCTAACCTCAGACATTAGCCTGCGGCAAAAGATGAGGCCGGAGATATTTTAACAGAACAACATTATCTATCAAAAACGCTCATCTGGCCGGGTGCGAACATCAATGCTGAGATAGCTGAAGAGATGATATTGTAACAATATTGATAGCAAGAATAGAAAGTGATACTGGAATTAAAAGGCATTATGAAGTTAAGGATTGTTATCAGGAGTGATAATTATGCGGAACAGAATTGCCTGGAGGATGATTAATTCCTTAGTTATCGTAAGCATTTGCGCTGCTCTCCTTCTCATTAATTCCTATTCTTTCAGCTGATAGAGATGGTCTTGGGGGCGACATTGTCATCATATGCAGGAAGAGCCGGTCGCAATCGGCACTGCTGCCTTGACGTTTCTAATCGGAAGCAGAACGCGCTAACCGTAAGATTAGGGGTATATCGTATATGACATCGGCTATTGTCTTCGCTTAGTTTTGTTGTTGAGTTGGAGCTTTGTTTTTCTGCGGGTTATTGCTTCTTCCACGGCATCAAGCGGCTCATTAAGCTAAGCTCTCTACACTCGACTGCCTCTGCAATCGTTCATTCATATGCATCCTTTTGAGCTTTCCAACTGAATGGCTAACTTGAAGTTGAAAGTCAACGATCACCTCATGTTCTTTACTCCCTTTCTCCAATAACCCGGTAAACAAGCAAGCATGGGTCGTCGAAAATATAAATAGATACAATTTGTATTACGGACATAGACCCCATTCTCAGGCGTTCAAACACCGCCTCTAATGCAAATAATTGCCAGGACATACAGATAAATATTTGCGGTGATAATTATCTGGCGGGCAGAAGTACTTCCGTGATACTGAAGATAGGAGCAGAGGACGCCGACTAACCACCTAAGGCGACGGCTCTTAAAATTAAGCCTGCTTGAAGAAGCGCAGCATTCAAAGCAGAAGGCGTCTTGGGGTGTGATACGAAACGAATTATTGATTGCCGATTCCGGATCAGCGCTGCCAAGCGGGATCGCGGAGTTCGTCCAAGGACTGCCACACCACTAAAGCGACTGACGGAGAATCCAGGTTGGATGCGACGACAAGACACGCCGCGAACGTCGCAGGAGAAACAGGCAGCATGGAAAGCAGCAAATCCCCGTTGGTTGGGGTAAGCAAAGAGCAATCCCCCGCTTCTCGCTGAATCGCAACCGAAATCACGAGTAGAAAGCGCACTAAATCCGATAGACTTACAGTGCTGGCTGAATCACAAACAGATTGAAAGCAACCTGCAAATGATGAGCGCAAGATCTTTAACATGTAGAAGCCGCGCGGAACGCGTAAAGCCAACGGGAAAAGGTTAGAAAATCGATTCCTTATCGTGGGTAGCTTGGTTGGCTGTTTTATCTCAAGTACTTATGGATCATAGCTGGCACGGATCGTTATAAATATCCTCAATAGGGAATAATAGCCTCCTTCCATTCCATCGTAAAAGTCGCTCAACACCAAGCTCAATCAACTCATTTAATGTATGGGGAATTGTTTGGGTCGACCACATACTCTTCCTGCCTTCATTAATGCGATGCGCACAAACCATGATTGCTCTCTGTAAGGTTTTGAATTACTGTGATTCACCAGATTTATCGGTTTTGCATCTTCTTAATGCGTTTTCTTAGCCTTTAAATCCTTATCTGGCGCTGGCAATAGCTGATAATCGATGCACATTAATCGGGCGAAATGCAAGAGAGCAAAGACGAACAAGCCAAGGCGTCACCGATTCTCTCATTAACATATTCAGGCCGGTTATCTATCGGGCTTAAAAGCAGAAGTCACGATAACGAACTACGAGGTTCACTCTCCAGAGTTCACTTACTCTGAACACTCGTCGAGAATAACGGCCGGATCAGATTGTCCATTTCTATACTCATCAAACTGTAGGGTTGTAATGATGTTTATCCGATTTCTCCCTAGGGTAACTGAGACGAGTCCGATGGGGAAGACAGGCAATCTATCATGCAATGTGCTCACACCGGAGCTGATATGGAAGAAGAATTTGAGGAGTTCGAAGAGCATCCTCAGGATGTGATGGAACAATACTGACGTTGGCTGACTACGACCTATTGATAAAATCAATGGACTCAATGATGGACCTCATTCACACTGAATCGGAATGCAGCCAGCCTGAAGAAATGTTTCCTGTACGGACAGGGAAAGTGTCCATCAAATGGGCGCAATACGAACGACGGCAATGATTGCCAGTAACTTTGGGTAAAATCAAACAACAAAGCTGCCTGATGGTTGGCCTTTATTTTGGCATAAATAAATAACGGAATAATGCACTGTGTATTCATTCCAAACGAGTGCGAATACAACCGGCCGACGTGTCGCTCGTAACCTAACAGGGAGCTAACTTGTTCTGATTATTGAATCCTTGCCTCGAGTGTGTGAGCAGGGCTTGGGGAGAACGGCAACACTATCTACCACACTTACAAGCCTTCATTGATTAAAGGATGGAAAGCAGTACGAAATTGAAATCGACCTGACGGTAATGACAGAGGAAAAACCAACTTCACAGATTAATAATTTCTGGTCAATCCTTCTGAATACCGATCACGTACGGATTCAATAAACTATCGTATTATTAAATGCTGTATTTAATCATGCTGGCGCAATGCTGCTTATAGCAATTTCGAAGCGACTTAAATGCATCTGGTGTTGTGTGATTGAAGTTCGGAAACCGGTTGGAAATGGTCAGGAAGGATGGCCTCCAATGGATGGCTGAAGGAATAAGAATTACCTAGATGATATCGATACATCAGGAATATTGATTCAGATGATATGACTATCAAGGCCGCCTTCTCTCAGTGCGTTTGTTCTCACCATAAGAGACGCTTCACTCGAGGGGCTACTTGCGTCGTTACGAAGTAATGATTACTGCAAGAGCCTCGAATATGCGTATCTCACCGTCGTGGTGCCCATCGGAATAGCTGCCTCCTCGAAGCCTATTGAACGAATCAGCGAGGAATTACCGACGGATGGAACGATTCGCTCTATCGACATATCCAATCAGTTCTATCCAAAGAATCCAAGCATTCAATAATACCAATTCAAGTTCACGATCAACGGATTCACAGCAATAATTTCCACGACAAATTAATTCAAGGATTCAATAATTCAAGGATTAATTGAATAAGATCACGATCAATAATAACGATCACCACGATCAGCATACGATCACATGGATCAAGATCACATGCACCACGACCAATTTGATCACGATCAATGATCACGATCACGACCAAGCATAACTAATTTGCATTTGATCAATTTGATTCACGGAAGATCACGGCAGATCACGATCACGATCACGACTGACCACGATTGCAACATTTGCTCGCGCCAGGGATTGAACTCTCATTGAGCTCCCATCATTGAGTCTCTGTGAAATACTATCGTGACGAGGCTGGGAATATGAACTGAGGGTAAAATCCATTTATGTCACCACCGGAAACTGATACCACGCAAAAGCATTCTTAAGCATCCTTTCCTCGCGTCTCTGAATCATTCATCGGTAATCTCTAGTTGGACACAGGAGGTTCGGCTTAAGCCATGGGTCGAACGCCGCATGATACGGG * tp:A:P cm:i:33 s1:i:364 s2:i:0 NM:i:1574 ms:i:1464 AS:i:1485 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
115 105 4 * 0 0 * * 0 0 GGGAATAAGTGCTCCGCTACCATTTTAATGTCGTTTCATTTCGTGATAATTCCCTTGCATCGATAGTGGAAATCCTCTGAAAGAAACAGTAGGCGCTAGTTTCCTAGTTAGCCAAATGTATACGGTGGATTCAGAACTGGAACGGAATGCCCGTTCTGCAGGCGGTGGAAGGGTAATGGGAGGTACTGCCGTCAGCAACCCGGGATGCTGAAGTGCTTACTTGAGCAACGAAAGCTTAGGCAGTTGTAGATGAAGAAATGCGGCAAGCAGGGCAGATCTCGAGCAAGAAAGGTGCATGGCCGGATGAACGGATACGGACTGCTCCCGTGCACAGAGCCCGACGCACAGGAACTGAAGAATCCCACGGCCTGAAGTGGTGAAATCGAATTTACTGTGATTTCGTGCTCCTTCACGGGCCGCACGCAGGTGAAGTTGAACTTGCTACGGGCTCCACGTGCTTCCAGGCGTTGCGGAACTGGAAAACCGACACTATGTTGGGTTTCCTGAAACGGGGTAAAAGCATGGGGCACTCATGATGAGGTCTAACGGGCATACTCCGAACAGTTAAATCCCACGATGCTGCATTCCCTACGGATTCTAAGCCATCGTTTGAACGGAGCCAATACGCCGTTCAATCGGGCAGATGCTAATTACTATCCCAACGAATCGAATACCAGAGAAGGGCGCTCGTAGGAAACAATGCCCTTTCAGCGGGCTGACTCATCGAGGACGAATTCGAGGCGATGGGCGGCGACTAGAACCCGTGAGGTAGGCACGTATGCCCGGCTTATTCGAACCCCGTTTCGCCTTTACGTCGAGGTCATTAATAATTCCAATCCGACACCTTTAGCCGCACGCCCATAGAAGCCATTATCTGTGCTACGGGTATGCCGAGAATTTATGAAATACCCACGTTACGACTACTTCGTGGTTACTCCGTCTAGCCTTAGTAATGGCCCCGTGGTATCGAAAAGCTAAGCGGGACTAACAAGCCGATAGGCAACGCGTCAATGGGCGTGGCTTCTGGTGCCTGTGCATGTAAGCGGGGACAGCCGTCAGATTAGCTTACATTACATATTAAATGCTGCTTTTGATGATGATTGAACGAACAGGAGCCTCTCACGTTCCTGGGTGAAGCGTATTGAATTAATCGCTTTAAAGTCGATACGTGGCTCCAAGCCAAAAGTGGAACAGGTTCGATCGATTCAACGATGAATCCCCGGATTTTATCGTGAGCTTTCATGTTAATGCCCCGCATTGCGGGGAGGATGGTATTAATTTGGCGACAAAGAGACGGTCCCTCATGGCCTCAAATGGACGGCCCGGCTAATTTTGACCCTGCGAGCGGCTGATCCATCCGGTTAATCACCGGGCACGGAAACTGAGGTTAATGCCCGTTATCTGCGCACTCACGCACCCGTACTGGATCCCAATTCTCTGGTTTCGTCATCCAAAGTCAAGGGAGTCCAACATGACAGTGATTTTCACATCTGGACAATCCAAGCCCGTTCTACCTGGCTTAAGATTTGTCAACAGACTGGATGAAAACGAAAGGGGATACGGGAAAACGTAAAACCTTCGTAGACACCACGGCTTAGAGACGTGGGATGAAAATTAGAACGTCTCATTAGTGCTGAATGATGAAGAGCGGAAAGAGGATTGATTCTTGCTTGCACGGTTCCGTCCTGACCGTGTAGGTCTACGTGACCGCCGGTATCGACTCCCATAGGCAACAGGCTACGAAATGCGTATGGCGGTACTGGGGTACGGGGTAGGAAAGGTGGGGTTGACCGGCAGATTATTATGGGGCCGCCACGACGACCGTCGCTCGGTGAGTTGGATGAGGCCATCAATACAACCCAGCCGGAATGGTGCAGAAATGTCGATATCCCGTATCCGCTCTGGATGCTGGAGCGTGTACTAAATACATGGCGCTCATGAACTGTTTGAAAGTGCTGATCCCCATGCCCTAGAGGGGAATGGCCGTCGAATGGGAGACTAGA *
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
116 106 0 utg000001l 25823 60 263S13M2I17M1D17M5I6M2D9M1I1M6I2M2D19M4I13M1D4M1D4M1D14M1I5M1I11M1I3M2D9M1I2M1I3M1I7M6D6M1D16M1D11M1D3M1D2M2I5M1D9M2I1M1I20M1D14M3D6M1D4M1D47M1I4M1D4M1D8M1D2M1D2M1I10M1D1M2D1M1D4M1D35M2D18M1D16M1I2M1I16M1D4M2D4M2I7M2D6M1I1M2I16M2D9M2I20M1I6M2I4M3I9M2I15M2I6M1I23M2I10M3D16M3D6M4I1M1D11M2I3M2I11M2D5M3I7M2I10M2I7M1I13M2D2M3I2M2I4M1I6M1I1M2I16M2I3M1D5M1D8M1I30M1D7M4D12M3I3M1I10M1I2M2D10M3D7M1I3M2I7M1D3M1I3M2I8M1D2M3I15M3I5M3I3M2I4M2I8M4I1M3I13M1I5M1I32M4I18M1I1M2I11M1I1M2D8M14I6M3D4M2D6M2D10M2D9M3I1M1D4M1I11M2D22M1I10M1D20M4I16M1I5M1I4M2I6M6I12M3I2M1I3M2I16M2D4M2I22M1I27M2D17M1D2M1I2M1D15M7D23M1I21M10I1M2D1M1I8M2I16M1I5M1I4M1D11M1D4M2I24M2D14M3I11M3I25M1I4M1I17M1D11M1I7M3D8M1D21M1I4M2I1M1D8M1I3M2D7M4D20M1I7M1I1M1I4M1D10M2D11M2I14M2I1M1I2M4I7M1I2M1I34M1D7M1I3M1D11M5I1M2I8M3D7M1D18M4D45M2I11M1I2M2D8M3D11M1D41M4I16M1I3M1I47M2D3M2D24M1D8M1I12M3D22M3I6M1D8M3I2M1I18M2I6M1D23M1D17M3D12M1I2M1I11M1I51M1I3M1I1M4I1M1I5M2D17M1D23M1I8M2D18M1D19M3I32M1D10M1D28M3D54M1I8M1D14M2I26M2I3M2D5M1I24M1I5M1D22M1D10M2D9M1D1M1D5M1D11M2I18M1D13M1D1M3I3M2I3M2I5M1I9M2D7M3I15M1D16M3I7M4I4M2I2M1I2M1D4M1I18M1I14M1D5M1D2M1D5M1I12M3I2M1I5M2D3M2I12M6D9M1I6M2I5M1I6M1D3M2D28M1I2M2I2M1D8M1I1M2D10M1D21M1I29M2I7M1I8M1I18M1D5M1D3M4I3M2I5M1D8M2D2M1D4M1I5M1I12M1D17M2I28M1D2M1D3M2I4M2D12M2I4M1I4M1I4M1D20M2D2M1I29M1D4M2I1M1D19M3I24M2I9M1I8M1I3M2D6M1D2M1I2M1I10M3I8M5I4M1I3M1D1M1D33M1D14M1D8M1I9M1I2M2I24M1D6M6I4M1D5M1D9M1I14M3I2M2I1M1I17M1D3M4D1M1D3M2I24M1D7M1D6M1D9M2D13M1I4M1I2M2I7M1D3M1I6M1D5M3D2M1D16M1D10M1I1M1I6M1I8M3D10M3D13M1I8M2D2M1D10M1I11M4D16M1I14M3I10M4I4M2D4M4D9M3I1M1D16M3D2M2I3M2I1M1I6M2D18M1D15M1D5M3I8M2I2M1I8M2D5M1I15M2I16M2D12M2D4M1D11M1I27M1I26M1I13M2D6M1I5M1D6M2D4M1D17M1D5M1D3M3I7M1D9M1I21M1I31M3I7M2D5M1D12M1D4M1D17M2D5M5I5M1I2M2D6M1D3M1D2M2I11M1I2M1D1M1D26M1I3M1D8M1I4M1I7M1I3M1I5M1I25M1D1M1D11M1D9M1I9M4D4M1D4M1I5M3D20M1D11M1I6M2D13M1D3M6D10M1I10M1I32M1D4M1D2M1D4M1D6M1I21M2I3M1I10M1D19M2I6M1D11M1D8M1D13M1D8M2D14M1D27M1D3M1D9M2I26M3I1M1D6M1D15M1I18M1I1M1I2M1I5M1D5M1I3M1I8M1D2M1D3M1D5M3D30M1I3M1D7M1D6M1I6M1I5M3I5M2I3M2D2M1I4M2D19M1D9M1D4M2I9M1I5M2D7M5I9M1I11M1I22M3D9M1I2M3I2M1I2M1I2M1D1M2I4M1I11M1I4M2D11M1D7M1D6M2D1M1D13M3D13M1D48M2I3M2D23M1D31M1I15M1D3M1I23M2I5M1I11M2D4M1D2M1D4M1D9M3D7M3I2M1I6M1I7M2D1M2D1M2D15M2D10M2D7M2D1M2D4M1D2M1D3M2D7M2I7M1I5M2I14M1D19M2I3M1D3M1I21M2I3M2D6M4I10M1D6M1I3M2I18M1I38M1D3M1I4M6D7M4I6M3D4M1D7M1D20M1D9M2I1M1D11M2D12M1D7M1I2M4I3M2D2M3I9M1D3M2I1M1D2M1I8M3D6M1D2M2I3M1D11M1D10M1I5M1D12M1I9M4D3M2D14M1I7M2D14M4D12M2D3M1D12M1I16M1I11M1I2M2D9M1D2M2I22M1I5M1I1M3D1M1D3M2I3M2D7M1D21M1I13M3D1M1D12M2D5M1D6M2D13M1I6M2I23M3D7M2D4M1D3M2D4M6D3M1D3M1D3M1I3M1I6M2D4M1D1M2D19M1I3M2D7M1D8M1D5M2D6M1D1M2D20M1I3M1D2M1I4M2D5M2I18M1D3M2I1M1D13M3D8M2I15M1D13M2I7M2I2M1I9M1I4M1I4M1D2M4D6M1I17M1D12M1D1M3I8M1D5M1I10M1D13M2D1M1D11M2I14M1D1M2I1M2I14M1D6M1D5M1D12M1I1M2D12M2D8M3D7M1D8M1I5M2I31M2D25M1I4M4I6M1I4M1I19M2D12M1I4M1I20M3I12M2I4M3D2M1D4M2D32M1D15M1D11M1I21M1D17M1D8M1I3M1D3M2I3M1D22M1I5M2I12M1I5M1I5M1D9M1D3M1I9M1I14M1D1M4I12M1D9M2D8M1I11M9I2M1I11M1D8M1I9M2D4M1D2M1I2M2I2M1I9M2I3M1D6M1D21M3I12M2D15M1D6M3I5M1D7M1D12M1I19M11I11M2I4M1I7M4I10M3D1M1D4M1I9M2I2M2I14M1D8M2I3M1I13M1D3M1D31M1D2M1I7M2I10M1D2M3I3M1I7M1I2M3D1M1D20M1D12M2D14M3I13M2I5M2I3M1I2M1D39M1I2M2I8M2I7M2D13M1D8M1I34M3D28M1D17M1D11M1D11M2D2M2D7M1D10M1I15M4I3M3D6M3D40M2I29M4I3M1I3M2I9M4I5M6I2M1D5M2D10M1I8M1I4M4I6M2D14M4D6M1I3M2D6M1D10M1D8M2D3M1D10M1I19M3D5M1I13M2D2M1I2M43I16M1I5M2D4M1D3M1D8M1D8M3D6M1I1M2D2M1I8M1I3M1D8M1I6M1I10M1D4M2D20M4D4M2D8M1I7M2I8M1D11M1I4M2D6M1D2M2D8M4I8M1D13M1I7M1I17M2D1M2D6M3I4M1D5M1D9M2I5M1I11M2D2M2I11M1D3M1I1M3D5M1I5M4I7M2I7M3I1M1D8M1D1M1D1M2D3M1D8M2D1M1D2M1I19M2D10M1D8M1D1M3D5M1D3M1D4M2D4M1I3M1I1M3I9M1I7M1D5M4I2M1D7M4D4M1D7M3I2M1I9M2I11M3I2M2I8M1D4M2D9M2I4M1I1M1I7M2I8M1I7M6D3M1D16M2D9M1D9M2I4M5D5M2I10M1D8M2I6M1D4M1I14M1I9M1D9M2I5M1D11M2I28M1I6M1I6M2I23M1I13M1D12M2D3M2I2M1D5M3D4M2D8M1D2M1I4M1I1M1I6M1D7M1D13M2D1M1I13M1I17M1D3M1D3M3I18M1D3M1I11M2D8M5D2M2I12M1I3M1I3M1I4M1I9M2I4M2I4M1D4M1I13M1D5M1D13M1I15M1I1M2D11M6D1M2D6M1I5M2D11M3D9M1I9M1I6M3D4M1D11M1D3M4D16M1I1M1I12M1I14M3I3M1I3M4I4M1D20M3D4M3D4M1D5M1D7M1D13M1I3M1I2M1I15M1I3M1D8M3I2M1I10M3D6M3D1M1I13M1D7M1D7M1I16M1D3M1D8M1I6M3D1M1D2M1D3M2I25M5I3M3D4M1D7M2D3M2I9M2D2M1D6M1I11M1I13M2I3M2D45M1D4M1D5M1I7M1D6M1D19M2I6M2D2M1D9M2D3M1I3M2D13M2D1M1D5M4I2M2D2M1D5M3I8M3I10M1I16M2I10M1I1M1I9M1D10M1I5M1D3M1I9M1D3M1I4M1D2M1D5M1D7M1D12M1I14M2D2M3I27M1D4M1D11M1I2M2I1M1I27M2D4M3I3M1I13M2I7M3D3M1I4M1D4M2D7M3D5M2D2M1I5M2I17M1I3M1I1M1I3M1D5M1I7M2I6M1I14M2D6M1D10M2I9M1D4M4I17M2D3M3D3M1I14M1D9M4I10M1I12M1D20M2I9M3I1M2D8M4I3M3D21M1D7M1D2M2I4M3I1M1I12M1I9M1I6M1I8M2D22M1D6M1D7M1I3M2I7M1I5M1D7M1I7M3I13M227S * 0 0 AGGTCATTCCGTTAACGTCTGGTCGGCGAGATAATCGACGAGATTCACGTTCGAGCACTCCACTGTTGAATAGGCCACAAAGCGATAGCCAGGGAATATCTGGCGCGGTGCAATACGGTACTGTTTGCAGGGCAGACCGGTATGAGGCGGAATATATGCGTCATCTTCACCAATAAATTCATTAGTTCCGGCCAGCAGATTATAAATTTATGGTCCGTGGTTGTTCACTCATTCTGAATGCCATGCAAGCCCCAATATAGTTAAATGCAATGTTTTTGACGGTGTTTTCCCGTTACCGCAGCGTTAACGGTGATGGTGTGTCCGTGAACCAAGTGGAACAACAAAGAATGGGCATGAGCACAGCAGGTAACAACCGGATGCTGTGCCACCAATACCAACTGTATGTAGCGCATGTGCACGGCACTCACGCACCGTACCGTAGACAATGAGTGACTGTGGCTGCCTGACGTCCGTTCGATAAAGCTAAGCAAGCCCTGTGTGCTGGTTCCTTTAACTGTGATAAACTTCCTGTAATGGTTGGTCCTGATACTCCAGCCAGAACTGTTCATCCTTAAACCATTTGTCGGCATGAGCACCCGCGCTCCTGTTGAACGCTCCAGACTTGAGCATGAGCCCCGTGTTATTCGTCGATTTGATGCTGTAATCGAACTGCCTGTTGTTTTCGTCCCGTAATCAAACGACGATGTGCTTTCGTCCCCAAATGCGTGGCCGATGCACTGGCACTGTGGGTGTTAGACTTAATTCCATCCTGTTCCTGAGACAATACAGCACGACCGCCTGGCGGGTTTCCCCTTGATTGTCCCTCCGGCATATCAGGAAAGCACAGCCCGATGGATACGCGACAGCAAGTTTTGGGGCTGATTTGTCAAACGCCTGCCCCTGCATCAGGACGTAGCCAGACACGACGAACGATATTATGATGGCCACGGGATCGGCGCGCACCTGCCGGAAAGAGCTGAATTCTCACCGGCCCAAGCTTCAAGAACACTGACTGCAACGGAATTTTTGCCAGAATATCCTGCCAACCCTGAGTCAGTTCAGTCAGGCTGGCGGCATCATTTCCCAAATACGGTAATATTTATTTTTCGCCGTGGAAAGCCCTGCCACCGTCGATGTCAGGGGCACGCACTTCTTCGGTTGTTACCCGCAAGCGCGTTAGTCATGGTGGCTATAAAATCTGGATCTCATTCCCCGGAAGGCTGCGGCCAGTTCATTTCAGATGTATTCAGTGCGTCAGGTGACGCGTCAAACAACGCTCTGCAATCGCGGCCAGTACAAAAGCGTGTTCGCAATCTGGGTATTGTTTGTTCCCCTGAGCGCGGTCTGCTGTTGGCGTTCCGGTCAGTGCCGGACTGTCCAGTGGGCTTTTGGTCGTTTCATCCATTACCCTGTAACCGCCGTGCGTTGCAGCAGCGTTTCAGACGAACGTGCTGTTGGTGCACTGCTCAGCTGCACTATCCTCCCCTTCTTTCTCGTTGTGTCCGCATCCTCAAGCGCGACAGCTGAAGCTATATCTTCTGCACGTTTGCCGAATTTTTGCACGTATTGCCGCCGCTTCTGCCGCACTTTTGCTGTGCGGATGCTGATACCGCACTTCCCCGCAACCCTCTGTCGCCTTCGTGGGCTGCCGTTGACGCACTCCCGCCGCCGCCGTTGTTTGCGCGTCTGCCGCGGCAGGAGGTGGCGTTCCGGTATGTTTCAGATACCTTAAGCATTCGTCGACGCACGTTTTTGCCTGGCAGAATTTCTGATGCCGCCGTTGCCACCGAGGAAAGCTGCACGACCGGCACTTGATGGGTGCGTTCGTTTCTGATGATTTTGCTGCCTCTTTGAGGCCACACGCATCTCGTGCTGAAGTGGCGGCTCGGACGGCTTTCTCTGTCCGGTGGAGGCAGACGTGGCGGCTGATTGTTTTGTATCACTGCAGCATTCGTTCTGACGTTTCGCCGCACCGGCACTGGTAGCCGGCGCGCGTTGTAGAACTCTGCGGCTGCGGCACTTTTCCGCTTCAGTGGCTTTGCTGATGCGCTTCTGCGCCGGAGGACGCTTCCTGAGCTGACGATGCAGCCTGTCCGGCGGACGTGCTGGCGGCGCGTGCTGGATCAGTTGCATCAGTTACAAAGCCGCCGCGACCTGAAGGCTGATGCACTGGCATCGCAGGCTGATTTCTTCGCGTCTGCCGTACTCTGTGCCACCACGAGCTGACGCGTTACGCGCCACCCTCCTTCCACCATGAGTTTAAGACGACGCAGCACCTCCGGCCGGGCATCATCCTCCGTCATGGCACAGAGAAAATCATTCAGCGTCCCCGGTTGTGAATCTTCATACACGGTGATGGTCCCGGCGTGCGTACAGGGCTAGGGAAAACCGTCAACCTGCAGGTCAGGACAAGTACTGACCGTACTCCACATGCTGCTGTAACGCCCGGCCTTCATCCGGATTCCTCGGCCCACCGTGTTTCACCACCACCGTGGTGCTGTTACGTCTGGCTTTCAGCTGAATGGTGCAGTTCGTGCTTTATGTACCATTTTCCTGTGCGTCTTTCAGGACTCCTGAAATCTTTACTGCCATATTCACCCCACAAAGCCCACCGTCCATCCGGCTGTCATAACACTGTGTTACCTGGCTAATCAGAATTTATAACCGACCCAACGATGAATCCGTCAGTACGCCAGTCGCCACTGCCGGATGCTTCATAAGCAATATCAACAACGACGGACGCTGCCGGATTAATCTGTATACTGCACTCCACGCCACTGAGGTATATGCCGCATTGCACTTTCGTCCCTGGCAGTGGTCGTTCCTTTCATACCCGGGAGTGATTTCCGTCTTACGGTAATCCATTGTAATGCCGACCACCGACTGTGAGCCACTCCATGAGTGAGCATTAGGACCTGCTTACTGATTTGTAAACCGGTCACATCACACGGCCACATAACGTCCCACGCAGGCTCATAGTGAAACGTATCCTCCCCGGTCATCACTGTGCTGCTCTTCTTTTCTACTGACGCTCGAGCAATGAGAGGGAAGCCATCACCGCGCACACTGTCCGTCACTCATACGTATTGCACGTTAATCCCTGTTTACAGCTCTCCAACACCGGTATCCGACAACGACGGCAATGTATACCCGGTTTCATTGAATAGCCCACTTAAACGTACGATTTGAGCGTTCCGGCACGGGCTCAGTGACTGTCACGCAAGTGCGGCAAAGACAGCAACGGCAATACACATTACGCATCGTTCGCCTCTCACTGTTTTATAATAAAACGCCCGTTCCCGGACGAACCGTAACACACTCGAGACCACGCTGATGCCCAGCGCCTGTTTCTTAATCACCAGACCTGCACATCGCTGGCAAACGTTAACTGGGTGGAATATCTGCCGATCCGATTTGACATCGGGGCGTGAACGTCAGGATACCGTTTCCCCGACCCGCTGGCAGGTCAACAATACGGGAGAACACCTGTACCGCCTCGTTCAAGCGCCATCATAAATCACCGCAATACCGTTCATCAGTACTTTTACATAACACATCGAATACGTTGTCCTTGCTTTACATATCGACCCTTACTTCCGACACAAACGTCCACTAGGAAGCAGCAGCACTATCTGGCGATCAAAGGATGGTCATCGTCACGGTGACAGTCAAACTATATTGACGGCCAGTCCACACTGCTTTCACGCTGGGCGCGGACCGCCCCCTGGGCGCCGCCGCTTTACAATGTCCCCGACGATTTTTCCCTCAGCGTACCGTTTATTACGTACAGTTCGTCAGCTATCGTCACATTACTGAGCGTTGGAGTTGCATTCACACTGCCACTGATATCCGCATGTTAGCGGTCAGCTTTCCGTCCGGTGTTAGAAGACGCCGGAGGATTGCGACCCGCTGTCATCGTGGGGGCCGTCAGGCGCTTCAGGAACACGTCGTTCATGAATATCTGGTCCCTGCCACACAAACATCGGCGTTTCATTCCCGTTTGCCGGGTCAATAAATGCGATAATACGATTGGCGGCATGAATAGAGAAACTGGCTCAGTTTGCCTTCCTCCGTGTCCTCCAGTGCTGAGGCCATCACGCGACATAATGTTGCCGTCTTTGGTCTGCTCAATAATTTGACATAGCCCACATGGGCATTCCACTTATCACTGGCAGTTCCTTCCACTCTTTCCAAACTCCTCCAGTGCTGGCGTTATCCTCCGTCAGCTCGACTTTTCCAGCAGCTCCTTGCCGAGATGGGATTCATTTATCTTGCCCTTTGAAAATGCAGGTAACCTTCCCATCATCAAGCCGACCGACGCCTCCACGAATGCCGATTTGCCAACGCGTTCACACTGCGGATATAAAGTAATAATCTCTTGAGCGGTTTGATATTGATACTGGCGGCTATCCAGTACAGCCGTACCAAGATAACGCGTGCCTGGTTTCAACCTGTCTGATATCGTCGCAATCTGCTTTCCAGAACCAGAACTCAAACTGTACCGTCGGGTCATAAACGCAAGATGCGGCCGTGGCGGTTATTATGAAAATATCAGCGAGCGTCTACCTCAATCCTCGACGGTGCTGCCGGTGCGGCAATCCGGAACGATACCGACGGATGACATGCGCTCTGCCCGCATTTACCGCCGGACTGTTGCTCGTAGTTCCCAGCGCCAGTTGCGTGAAGGCTTATTGGTTTCCGTCGTCCGGTGGATTCATCTCAGCCGCTCACTGCCGTCGTCCCTGTTACGTCGACGGATACAGGAAATTCACGCCCTTCACTCCACCCTTCGGTGTCCCATCGCGCCAGCAGCTGATATTCCCCTGTCTGCAGTACTTCTGCGTCAGGTGCTGCACGCTGGCGGCGTGACAGGATGCCCGTGCCACTCTGTTCGCCGTCAAAGTGCGCCCGTTATCTAATGACAGCCTCTTTTCCGGCACATGCGAATTAGGGCGGGCTGGCATACGTGCCGTCGTCGTTCTCACGGATCTCACGCAGCGGAACAGTCGCCTGGCGCAGCGTCGAAGCTTCAGCTCCCATACGCTGTATTCAGCAACACGTTGGAGCAAGCTCATTTTACCTTTCACGTTGCTGTGACGGGACCTGAACCCTCCACGCTGACCGGATGCCACTTCCGTCGTAACCAGGCTGTATCAGCGGTACAGGGGAGGATGGCAGCGTGATTTCACGGTCGAGCGTCAGCGTCCGGGTCTGGCTGTTCACCACAGCGCACGCACGACCACCGGTGCTGATACCGGCACTAGTCATCATCGCAGATTCAATAACATCGCCCGGTACATGGCGAACCCTTCTGCGCCGACGCTGAAATCGCACGGTCTGCGTTTCCAGCAGTTCTGTTCTTAATCAGCCACAGCCCGGCTAGGGTCGCCTGCCCCGGCTGGTACAGCCAAAGGCATCCATCTTCGTAACAGTCGACCGTAACGGGCAATGGCCTGCGTATCTTCAACAGCTCTGTCGCCGTCTCCCAGCCGTTGTTCGTATAATCCAGCAGTTCACTCACAACGAACCGGCAGTCCTTCAGGGCGCTGAAGCTGTAGCGGAACGCGCCATCATCCAGGGCATCATACACAGCTTACTGCGGTTATAGTCCACGTCTTATCCGACGACGTCGTCTCTGCACGAACGTCAGCGTCTGGTGCCGTTCCATACCGGCATACAGCGCATCGCCGAGCAGAAATCGCTGAGCACATCCCACGCCTTACGCTGTGGTCAGGTACGCATTACAGGTGCGCGGCGCCGTGCAGCCAAAGCGTCCGGCACTGACTGTCGCAGTACTGGCCGATGAAGCCAGCGCGGCTTTATCCACATCCGCCGCACGACGTTTCCCGCAGGGCTGCTATCCGCGGATGGGTCAGCATATCCCACAGACAGGCCTGTCTTGTCCTGTATGCCGTTAAACGTTCCGTCCCATACCGCTGTATTGCCGCGTCTGCCTTATAGTTCGACGAGCACCTGCAGAATACGCCGGCATGATAATTACGGCTCAGCTGCTGGCTGCCGAACTGCTCCGAGTCCACCCTGCACGACCAGTGCCGTGTCGGGTAGCACTGTTCACATCGATGATTTCAGTGTATGACGACCAGAGCGTTTGTTCTGCAGCTGGGTCGTGGCTGTCCGGCGTCATCCTGCGCATCCATATTAAACGGGCGCGGCGGCAGGTTACCGAGCTCCACCGAGGCCAGATACTGCCAGGTGTTAGTCCTATCGTGTTTTTGCGTCACCGAGCCACCGTTACGTTGTATCTGAACCAGCATAGCGACTTCCGACCTATTCGGGTCGGTTTACGACTTCCACCAGTGCCTGTACACCGAAAGGCGCGCAGACGGTCGATGTTTGCATACGTAATGATGGTGCGGGTACTGCGTGTCATATTTCACTTCCGTACCAGCACCGTCTCCGGAGCCCGCTAGTCATTCAAATCCCCTCCGGCCATGCTCCGTGCTCACGACCCCGGAAAGCCACCGTGACACCGGATATGTTGTATTCCCCTCAGTGTCCAGCGCACCGGCGTACTGTTCAGCAGCACCGTTGCAGCCATCCACCGGACCTTCAATCGGCCTTCGCTGATGCATCGATCACACTCAGCAACTGCGTGACTTCAGGTCCTTCTTCGGTCGCGCGGGGCTCTGCTTACTGCTTCCTTTACCCATTCCTCACTCCATAAATGACAAAACCGCCGCAGGCGTCCAGCGCACATAAAACATTTGCATGAGCGACCAATCACAAGCTGACCACCGTCCCCCTTCGTCTGCCGTGCTGACAATCTCCTGAGAAGTTCTAGATGCCCGCGCATTCCCGTACAGAACAGGCAGAACATTGCCCTGGGCAACCATTTATCCAGTGAGGAGAAATAGGTGTTCTGCTTACCGTTATCCGTTGTCGTGACCGGGGAGTTCGGCCCTTTCGGTGCCAGCATCTGCGCCACACCACCGGGAGCACCATACTGGGCACTAGAGAAAACAGGATGCCGGTCATACCACCGGCCCCAATGACTCTAATCCCCCATGCTGCATGGCTCCGGCGGTAAACGAATGATTAAGCAGCTTAATATGGAGGCAGCCGCGGATAAACTGGAATACGCTAGTACTTGTATGCCCCCGGCGACTCCTGGGAACAATATGAATTACAGCGCCAGCACTAGGCAGAGTCTCATGTAACTGCGCCTTAACTGATAGGACGTGCTGACGTCCCGCCGCGGCAATGCGTACCTGATACCAGCCGTCGCTGAGTTTCTGACGAAACTCGCCGGGAGCTGTGCTTGGCCAGTGCCCGGGTTTCTTCAGCCTCGCCCGTTTTCACACGAAGTCGATGCGGGGCGACCAAATCGTTGTAATCCCGTAAAGGCAGATGCGCGCCATGCCCGGTACGCCAGAGAGGGAGTGTGCGTCGGTTCCATTTGTCGGCTGCCTCGTTTGCTCAGTTGTTCAGGAATATGGTGCCGCTAGCCGTCGCCGCAGAGTAAATGCGGCGTATTCTCGGCACTGATGAACCAAACAGCACAGCAGCACATCGCCGGCTCTGCCGGTAGGACAACGAGCTGATACATCCGTCGCCTCCAGATTATCCAGATAGAGATTCTGGCCGTTACGCCCAGTCATCCTCGATGAAAGTCCGGCATCTCAATCCCGCCATGAGCAGCATCCCGGACAGTGTATGAAGTCCGTCACAATTCAAAGCCGGCGCCGCGTACATGCGGCACACAGCGTAAACTGAATCGTCCCCCGGCAGACCAGCCACCACGGCAAATCACTCTGCACCTGCAGCCGCCGGTCGGCCTCACTCAGGCGGGATAGGCAGAAGAGACGGGGGTGGCCTGGTCCAAGCGAAGCGCCAATCTCACCGCTGCATTTCCTGCCTCACTGCAGAGGCTTCCGGCGACATACGGAAATACGCCTCCGGCTCACCGAGAGCTTCGCAGGGAAATATCTTTCCCCTCCGGCGTGCTTACGAAGCTCGCACGACTCCGCTGCACACATCACCCCGGGCCGGCGTGCAGCGAGAATCCCTGATTCTGTCTGTGTCATGGGATCTTTACTGCGAAGTTGTTAATGGAAGGAAGCCAAAGTTGCCGACGTTATTGCGGAACTTACAACCGACTCAGGCATTCATGCATTTATCCTTCGTCATCGGACGTTGCTGGTCATATTCATCCGCGACAGCCGACCGCTATAACCGCACTCGTCACCGCGATGGGTCCAGGTGCATATTAGAGCATACGTTTACACGAGGAACACCCGCCATCCGTTTCCGTTAGCGTGAGACAGATCAAGGAAGGATAACACCCACTGAGGAGGTTCGCTGCACTGGCTCAAACCCTCACAGCATAGATGATCATAGCGCTGTAACCCTATTATACAACTGGTTTCTCCGTTTACGGAAGTTCACGCATCCAAACGGGCGTAGACCTTACCGACCCGTTCTGAACAAGAGCGTGATAAAGACTCTGAAGATGGTCGCCCCATCCCATGTAACATACAATTAAGATCAGAAACCGTTAAGGCCGTGGGCTAGTTGGTACTGGTGCTTTAAGTCAGTCAAAACCGACTCGGAGTGAACCGGGGTAACTGATACTGTCGCCCTTACCATGACCGGCTCACCTTTTCGTTTAACATGTACAGAAAAATAACGTTCTCCACCGATAACTGTTTAAGTCAATTTCGGAGCACCACGCTGGCCGACTGCTCCGACGAGTGCATTCATTCAGAGTGTTTCCTTACCAGATATCCTGCATCAAGTTCACCCTGTTTAAAACTGCGCTGAACTCAACACGCAAGCATACTGACCCCGACGACCATTTTACAGGTCACCTTCTGACCCCCACTACAGGCATGGAGGCAAGAAAGATTTCCATGAGCGTTACTTCCGGAAACGACTCCAGTACCGTAGGCCTCCTACGGGAGGGACAGAAAGCGTCACGAGTCACGTTTCAAGTGGCATTCATGAAGCAGGCACTAACATGAGGAACACCACATCACAAAAGGGCACTACGTCTGTCAAGAAGGACCCGAACATCAAGCCAATTATTCACTTTCCATAGAAAGTTGCCGTTACACTCAGGAACAGCACCATCACGCATCTGTTGAATTTCACTGACGGGCACCCTTGCGTCAGTCATACACCGGTCAGAGCAGCCGTATAATACTTGCCCGTTCGTGCCGTTATTTGTTAATCACACACTGGTTATTCTTATAAAACGTCCGGACGCCTTGAAGCGTCGTCCGGATGCTGCCGGTGTACCGACATAACCGCCCCAGTGGCACACCCATCGACCTACGGTAAACAATTCCCCACGATCAGGTATGTTGCCTCCTTCTGCGGACAACTCACACGGTAAACAATCTAAGTAGTCATATTTGCCGCCGTTCCGTTAAATCCTCCGGTTTAAAAATGGGGAAACTTCTTTACTAAAGGAGCGAACGTAGATGTACCGCTGACGCGGATGCGCCTAGGATAAAAGCCCCACGATGGCTGCCGATACTCCCGACAATCCCCACCATTGCCTGCTTAGACCGATTTGGTCACTTAAGTAAGCACGGAACGGGTGAAGCTGCGCCGGAGTTCTGCTCACTGCCGTCACCCAACCCGCCGACTTCTGTGCAATACCAATAAATTATCTAGTCTGCTTAATTTTACTGCGACATACTGTCCGTGGCTAGCGCTCTTCCACGCCTCACTCCGACGACTTCAGGCTTGGATGAGAGTTCCCCGAGACCTATTGCAGCCAGGTCTTTCTTATGACACTGACGTTATTCAGCGCCATAGATTATCACATACTATTCCTTCAAGCATGTTTAGTTATCTCGTTAACTCCGTTCTTAGTCAGTCCGTTCATACCCCCGTAAGTTCGCATCAATACCAGCATGAGTTTTGCCGAGTCCTGCTGTGCGATTATCCGCCTTAGGTCCCCCACCCGTTCAGGCGGGTACACGTAATACGTAGTTGCCAATATGCAAGCCATAATGAGTTTACTCCATAGTTTAATGACTTTATATCCACCATAAAGGGATTTCTCCTGTGCACAGACAAGCTGGCGACGTTGCGCCGCCTCTGAGCAGTACCGCGAACTGACTCTCCGCTTCGACAAATCCCGGCGCTTAGTATAATTTTAAGGTTTGCTCTAAGCGGGCTTCTCCAGCGTTAGAGTCGCTGAAGGGTCAGCAGCAAGAGAAGCATGAGCACCTGTCTTCCGTGACGACTTACCCCCGACATAGTTGGACGCTGGACTGTTCGGCTTTTCACTAGTTAGCTTCATAAATCCTTTCGCCGCCATCGCATAAGTGTTGTAATCCGCTTACGGGATTTTCCGCGTCTTTCAGTGCTGTTTGAGTTTCTTCCTGACGGTAGGATACTTTCTAAGGCTAAGCGATTTATCAGAGCCGTTCTGCCACCTCCACTTTAGACGTCGGTACTGTTCAGGCTTGATTTAATATCAGATATGCTGCTATCAGCATTCTTTTGTTAGTGTTTCAATTAACCGTAGTTAACAGATCATTTCGGTAGAAACCTTCATGATCAC * tp:A:P cm:i:115 s1:i:1116 s2:i:0 NM:i:2766 ms:i:4674 AS:i:4697 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
117 107 0 utg000001l 17 60 80S14M2D3M1D44M7I41M2D9M1D15M2D5M1I2M1I18M2D5M1I7M2D1M2D11M1D4M2I4M4D12M1I22M3I18M1D2M1I6M2I5M1I1M1I15M2I6M2I1M1I5M1I2M2D6M1D59M1D14M1I15M1D8M2D2M3D15M1D5M2I7M2I15M1I1M1I16M1D18M1D38M1I42M2I9M1I3M2I5M1D11M1D8M7I2M1D15M1D8M2D6M1D28M1D3M1I3M2I6M1D7M2I1M2I13M1D8M1I6M1I5M3D37M2D8M2D9M4D3M3I9M1I12M7D11M1I2M1I17M1I3M1D16M1D2M1D1M1D23M1I18M1I5M1D4M1I6M1I7M1I6M1D18M1I10M1D3M1I2M1I7M3I5M2D11M1D6M3I23M1I6M4I17M1D2M1D14M1I14M1I8M1D15M1I4M1D16M5I7M1I3M2D1M1D7M1D2M3D1M2D2M1D3M2D16M1I19M2I4M1D24M1I8M1D12M1I6M1I4M1D7M1I1M2I19M1D6M4D15M1D4M3D18M1D3M2D33M1D7M2I2M1D10M2D1M2D5M2I7M2D2M1I7M2D2M1I5M1I4M2I3M1I2M1I2M2D4M3D14M1I2M3D11M2D9M2D1M1D12M1I6M1D4M1I5M2I16M1I9M6I4M1I1M1I4M1D5M1D1M2I5M2D1M1I2M1I18M2I24M2D7M2I12M2D10M1I7M1I4M1D24M1D9M1I5M2I6M3I11M2I27M1I8M2I7M1I8M1I13M1I10M4D15M2D3M1I5M1I8M2D50M2I11M2I6M1D9M1D4M2D6M1I12M2I10M2D22M3I1M2D2M2I3M4D2M3D9M2I7M3I7M2D7M2I23M1I2M1I6M1D19M3D7M2I6M1I2M1D5M3D2M1D19M3I12M2I5M4D9M6I6M1D3M2I2M1I11M1I2M1D8M1D12M1I3M2D13M2D6M1I7M1I10M4D4M1D8M2D4M1D4M3D2M1I2M1D1M1D4M4D1M1D18M10I2M1I3M1I5M2I3M1I4M1D7M1I3M1I2M1I3M1I1M2D7M3D3M2I12M2I8M1D3M1D25M1I7M1D13M3D21M5D4M1D5M1D1M2I8M3I6M2I8M3I14M1I5M1I28M1I2M4I9M1D1M4D6M1I10M1I3M1I2M1D17M2D8M1D9M1I3M2I2M3I5M1I16M1D9M1D6M1I3M2I9M1I5M1I9M1D2M1D2M1D5M1I14M2D17M2I9M1I10M1I22M2D6M3I6M1I1M1I6M3D17M2I1M1I15M7D5M1I1M1I3M2I20M1D3M1D6M1I1M1I7M1I17M2I10M1I4M1I18M1D23M5D11M1D16M1D17M1D26M2I6M1I10M2I5M2I8M2I10M2D11M2D10M4D13M5D12M1D60M2I11M6D16M2I10M1D6M1D6M1D6M1I11M1I29M1I7M1D3M1I2M1I7M3D2M1I12M6I26M1D1M1D21M1I1M1I2M1I5M4D3M4I10M1I1M2D17M3D8M1I1M1I2M2D3M1I2M1I4M2I17M1D2M1I5M2D5M2D26M1I11M1I5M3I3M2I6M1I12M3I5M1I11M5D7M1I5M2D6M1I2M1I3M3D5M1D3M1I5M2I19M1D9M1D5M2D2M1D4M1D3M1D16M1D5M1D9M2I1M1I7M1I3M1I2M1I1M3I6M8I10M2I3M2I9M2D7M1D13M1D18M4D3M1D3M1I1M1I18M1I6M3D10M1D18M1D16M1D8M1I34M1I24M2I3M1I14M2I6M1I7M2I10M1I6M2D24M1D1M2I5M3D4M2I8M3I8M2D10M2I3M1D7M1D12M1D6M1D19M2D15M1I1M1I6M4I3M1D17M1D16M1I1M1I7M1D14M1D1M1D11M1I9M1D9M4I4M1I5M1D13M1D9M1I10M1I2M2D31M1I9M2I16M2I10M3I4M1I3M1I2M1I6M3D4M2I2M1I8M3I6M1D2M1I7M3I9M1I9M1I8M3D6M1D7M1D1M1D6M1I2M1D8M5I10M1I6M2D7M2D6M1D4M1D6M1D6M4D12M2D12M3I9M2D31M4I7M1D9M2I5M2D5M1D3M1D2M2D27M1D42M1D6M2D1M1I2M1I20M1D19M2D25M7D6M1I2M2D32M3I6M2I6M1D5M1D7M1D8M2I36M1I20M4D4M1I6M1I11M2I7M1I8M2I16M6D8M1I23M1D29M2I6M1I20M2I6M1I10M2D6M1I18M1D25M6D3M1D1M2D3M1I2M1D2M2I4M1I2M4I1M1I4M1D8M2D4M1I20M1I20M1I4M2D10M3D15M1I6M1D24M1D24M1D9M1I3M1D18M44S * 0 0 GAGTCCTTGATATTTCTTTAGCCGCGTATAAGGGCTGCTCTTAATGTCCGTACCGGAAAGGACCACCCGTAAAGTACTACTGATTATCATCTACATCACAACGGGCGTGGAGGCCATCAAACCACGTCAATGGATCAATTAGTACCTCTGACGCAGGTATCGTATTAATTGATCTGCATCAACTTAACGTAAAAACAATTCAGACAATACAAATCAGCGACATGAATACGGGGCAGCCTCGTCAACCGAAGAACAGAACCCGCAGACAACGCAACATCCGTTCTTCCTAACCAAATGATTGAACAAATTACGCTCCTGGTTGAGCAAAAGGGTCCGGGAAATTTCTCGACGCCTGGGTCATTGAAACGCCTGCCGTCGGAGACCTCGTCAGAAAGAGAGCATATACATCAATTAAAGTGATGAAGAATGAACATCCCGCGTTCTTCCCTCCGAACAGGACGATATTGTAAATTCACTTAATTACGAGGGCATTGCAGTAATTGAGTGCAGTTTTACCACTGTTTCCTGACAGTGACATATGACTGCGTGTTGGCTCTGTTACAGACTAAATAGTTGAATGATTAGCAGTTATGGTGACCAGTCAACCACCAGGGAATAATCCTTCATATTATTATCGTGCTTCACCAACGCTGCCTCAATTGCTCTGAATGTGCTTCCAGAGACATTATGTTCTATACCCTGCAGCAATTACAACATCAGGTAACTCAGAAATGGTGCTATTAAGCATATGTTTACGAATCGATCCACCTAGAGGATACATCAATGAATAGTTTGTTCTGTTGGATTTTGGTCGCTCCATGCCTTGCTCTTCATCTAGCGGTTAAAATATTACTTCAAATCTTTCTGGGCACATTTACGGCTTTACCCTTACATACATATGTCGGTTGTATTTCCTCTACCAGAATGCCAGCAGGACCGCACTTTGTTACGCAACCATCATTAAGTGAAAACATTCCTAATATTTGACATAAATCATCAACAAAACAAGGAGGTCAGACCAGATTGAAACGATAAAACGATAATGCAAACTAACGCGCCCTCGTATCACATGGAAGGTTTACCAATGGGGCTCAGGTTGCCGGTTTTTAAAGAAATATTCTAATCAATATTAGAAAAGAGAATTTAGACTGTGAATGTTTTATTCTGAACTAAAACGTCACAACGTCTCACATTACTTTACTATCTAGCCACAGATAATATTCACATCGTGTTAGAAAACGATAACACCGTGTTAAAGGACTTAAAGGTTGTAAATGTTAAATTCTCAAGAAACACGCATCTTATAGAAACGTCCTATGATAGGTTGAAGATCAAGAGAATCACGTCGCAGGCAATACAGGGAAAATCTGTGCTAAGCAGGAGTTTTCCGATGAGTACATCCATGAACATAAAATATTATAGCTTTGATAATTCATGCTTTACTGAGAGCATTCAGAACACTACACAAATCTTCCACGCTAAATCATAACGTCCGGTTTCCTTCCGTGTAGAGAGCAGGCAGCGTGCGGCTGATCGAACTGATACGTACGCGCTAAACCGCTTGTGCATCGTTTTAATTATTCCCGGACACTCCCGCCCGGAAGTTCCCCGTTACGGGGCTGTGGACATAGGTTAATCTGGCTAAAGGATACAATGACGATTCATCGGACATGACATACATTACAATATATTAACAATATGAAATTTCAACCGCTTGTTTAGGGTTTGTTTTAATTTTCTACATACGATTCCTGCGAATCTTCAAAAGCATCGGGAATAACACCATGAAAATGCCTACTCGCTACTGCGCTGGCCCTGCTTATTACCCATGTGCTCAACAAACGTTTACTGTTCCAAACAAACCGGCAGCAGGTAGCACCAAAGGAAACCATCACCCATCATTTCTTCGTTTCTGGAAATCCAGGAAGATAAACTGTCGATGCAGCCAAAGTTGTGAGGGCATAGAAAATGTTGTTAAACAGAAACCCATAGCAAACATTCGTAAATGGATTGCTCGGTTTAGCTTTAGGCATTTATACTCCGCTGGAAGCGCGTGTATTGCTCAATAATTGCATGAGTTGCCCATGTACATGGGCAATAATCTATGCACGGCACTTAAGCCTTAATACTTCTGGGTTCCTTCCAGTTAGTCTTTGCATAGTGATCAGCCTCTCTCTGGTGAAAGGCAATCCGCGTTCAGCGGTGCCAGTCGGGGGAGGCTGCAGCATTATCCACGCCGAGGCGTAGCTTCACGGACCTACACGAGCTGACAGACTGCTTTGATGTGCATAGGACTCGACGACCAGCGGCAACATCATCACGCAGCATCATTTCAGCTTTAGCATCAGCTAATCCTTCGTATTTGCATGGAGCGCAGCAACATCACGCTGACGCATCGGGATCCGTATGCCAGATGTCACTGCATATTGCGCGTTCGCCAGGCATTCAGTTCTCTGGCAGTTTTTGTCGCGCTGGGGGTTGTAGTAGGCGTTATCACGGTGATCATTAACACGCCCATGACAGGCAGACGATGATGCAGATAACCAGAAGGGATAATGCGGTACTCTGCTCATACAACCCAATCTCTCTGACCTACGTTCCGCCGCTTCTTTGAATTTTGCAATCAGGCTGTCAGCCTTATGCTCGAACCCACTGACCAGCGCCGGCAATTGAAGCCCATAGTATTGCTGCAACGGTCGATTCAGGCTGAACCCCCACAGGATTACATTGATAATCAGGTAAAGCGCCACGCTCCTTAATCTGCTGCAATGCCCCACAGCGTCCTGACTTTTCGGAGAAATCTTTCAGGCCAAGCTGCTTGCGTAGGCATCCCACCAACGGGGAAAGAAGCCTGGTAGCGTCCGGCGCCTGTTGATTTGAATTTGATTTAGACGCGTGATCAAGTTTGCGGGTGGGACCGTACCAAGGTAATAGCTCTCCGCCTACAATGACGTCAGTATAACCATGATTTCTGGTTTTAACGTTAGTCCAGTTCCTCTACAATCACGCCAGCAGCGACTGAGGAACCGCCTTACGTTGATTATTGATTTTACCATCTTCTACTCCAGCGTTAGCAGCGAAGCGTTGATAAGCGAACCAATCGAGTCAGTACCGATGACCCGATAACAACGCTCGTTATAAGCGGAGAGATGTGCTACTTAGTCTGGCCAACCGAAGTCGAGAGAAGGTCACGAATGAACTAGGCGATAATGGCGCACATCGTTGCGTCGATTACTGTTTGTAAACGCACCGCCATTATATCTGCCCGGAAGGTACGCCATTGCAACCGCAAGGATGCCCGATGCCTTGTTCCTTTGCCGCGAGAATGGCGGCCAACAGTCATGTTTTCTGGCATCTTTCATGTCTTACCCCCAATAAGGGGATTTGCTCTATTTAATGCCGGAATAGTCGACGTACTGATAGAACAAATCCAGGCTACCACTGTGTTAGTAATCAGATTTGTTCGTACGATATGCACGGGCAAAACGGCAGGAGGTTGTTGGAGACCTCCTGCCACTGAGCTTCACGAAGGTCATGTGTAAAGCGCAGCGTAACTATGTTACTAATAATGAATTTCAGGACAGACAGGCTAGCTCAGTTTGGGTTGTGCTGTTGCCTGGGCGGCGATGATCGCCTGTGGATCGGGATTTGGTAATCCGGTTCTGGTGGTTCCGGTATTCGCTTAATTCAGCACAACGGAAAGGAGGCACTGGCAGCTGAGGCAGCCGACTCTTCACGATTATCACTCAATGCTCTTATGTTGTCGATATATAAATCCCGAAACCGTTATGCAGGCTGACAACTACTAGCCTCGCAGTCTAACCGTACGAAATGTTTCGGGAGTGCGCATTTTTGCATACCTCTGCCTGCGATGGTCCGATTCCAGACGATACGTCGAACCACTCACGGCGGAATGCGTAGTAAGCGCCGCCTTTCATCTCACTACAACGAGCGAATTAAGCATCGTTGAGTCAAATTACCCAATTTTATTCAATAAGTCAATATCATGCCGTTAATATGGTTGCCATCCGTGGCAATCATGCTGCGCTAAACGTGACCGCATTCACAAATGTTGTCTGCGATTGACTCTTCTTTTGTGGCATTGCACCAGCGTCATACAGCGGCTTAACAGTTAGTACAGATTGATAGCTAGATAGATTTGGGATTAAGCATCGTCACAGGGCGATATGCTGCGCTTGCTGGCATCCTTGAATAGCCGACGCCTTTGCACTCCTTCCGCAGCACTCTTTCTCGGACAACTCTCCCCACAGCTCTGTTTCGAGGACTGTAACCGCACGGCCTGACATGGCAATCTCTGCATCTTGCCCCGGCGTGCTCCCTCTACGGCCAAGGGCAATAATCGCATAAGCGGAATGTTGCGAGCACTTGCAGTACTTTGCCTTAGGTTTCCTTCACACTCGTTGCCACACCACGGTATTTCCCCGATACCTTGTGTGCCAAATTGCAATACAGATAGATAGTTACTCGTTTGTTTATTTGGTTCTTAAGGGTTCGTCGTGCTTACCCACAGAATGGCAGCCATGAATCCGGCTTTACTTGCCTCATCGGAGAGCATCTAAGCCTTAAGAGTCACGAGGAATCACAGAAGGCGTACGCGTGTGAGTGCTCATCATCGGGCTTTTAGTGAAGAGTGAAATTTAGCTACGCTTTCGAGTCTCATGCCTACTTCCTCAACTTACCTGAATCAATGTTAGGTTTCCGCATACCTGCCGGTATCGATACTCATTTGGTTGGCAACTTGAGTGGTTTCACTGCTGGCGTATGACCACGGATGAACTGTCCCGCCTGTTATTTCTTTCACGATCCCGTTTGTGGATTGCTGATTCGTTCGAGTTCCAGATTATCTACCGCTGATGACTCGTTCCAAACTCGTATTCGTTAAAGGATAATCGGCGTGGCAGAGGTAATATTTTATGTTGCTCTGAGTTCGATATGATTAACGGAAGTTCATCTGCTTGTTGGGCAAGATCCGTTAGCCAGAATTTCTTTTAATGGCCATTAAAAGAACCAGCCACCGCCATGTAAGCAACCTCAGTGATTAACGTTTCCTGATAAGCCCATCAATCATCATTTGCTCATGGTTTCCACGTACAGCTCTGAACCCCGGAAACCGTGATGCACTTCCAGGCATTCAACGTTCTCTGCATAAAGGATGGAAGATCGCCCACTAGATAAGCAGGTCTTTTGTTGTCGAATCCAATCGTATCCAGGTTCTATCAGGTTCGTGTAGCATCCGTGCAGATCGCACTACCCAAATATTTCGGTATTTGCTTGCCATCAATTTTCGTAATAGGCGCATCTCTTTCACTCCATCCGCGATGACCGCTGAGAACGTCGTTGACGATGGCGTGCATTTCCCGTCTTTATCATCAACGTATTTTCTGACTCGTACCGCGACTAAGTTCAGTGCGTAGACCTTCTGTCTGATTTCCGTATGTTTAAGCCCGACCAG * tp:A:P cm:i:84 s1:i:797 s2:i:0 NM:i:1370 ms:i:3072 AS:i:3072 nn:i:0
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
118 108 4 * 0 0 * * 0 0 AAGTCTTTAAATCCTTCTCCATTGCATGGAGTGGGGCTCCCCGTTGCGGCTGCTGTTCGTAGTTAATCTAATGACCTCAGTCTATTAAACCCCCGGACGACGCAAACTTTCGACGTTTGAAAGGGCCGTATCCGGCCTCTTTTGTTAGACGCCAATTGGCTTTAGCATAGCGGACAGGAACATCGACAGTTCAACAAACGCCAAGTACGTGACGACATTTTCCCTAGTATAAGTGGAGTCATATTAAGCACCATTTTCAGTTGACGGCATTAAACAGCGGGAATGCCAGGGCTTTGGCTAGGGACTATAAGCGGGTGCGCCTACCTTTCAGAGTCGATCGCTCCGTTACATAAAACCGGTATGCGCCGAAAGGGTACCCTAAAGAATCTGAGACGAAAGTCTATCCTGAGGTCGAGCCGCGGTTATCAGTCGGTCAACGGGCAGGATTAGCATCTCCAGCGAGTTGCAAAACGGTCCTTTGACAGAACGTTTCCATCGATCCTTCTTCTCCTGAAATCCTGTGACGCGCTCGAATCGCAGATGGAGCAACTCGCATTCGACCTCATTGCCAACGCGGCTGAGGCACACGTTTTGTCGAACCGCATCGGGGGTTTTCGGCCTGGCCTATGGGCACTCATTTTATACAACGGGTCGCCAGGTTTCGACCGGGCATAGTCTCTCTATAGCAGGCGGTGCAGGGGCTTTCTTAAACGGAAACCTATGACAGGTACTCCCCGAACGCGATCATACCAAAGCGATGAAATTTTAACAAAGCCATCCGTCGCTGTCTCCGCTACGAATCCGCCATCCGGCTCCGTCTGAGTAGCTAGCCGACAGTTTGAACAGTCAGCGGTTACGGACAGGGCTCGCGCACCTGTCCGGCGGCGCTGCTCTGGTGTTTCGACGGATGGTAAGCCTAATCGTATCTACAGACGCGTCTATCGACCGCGCTGTAATGGTACGTAGCTTTCCCGAAAGAATCTCACGATGACCTTTTCTGAACACTCCCCGGGCATGGGAGCATCGACCGCGATGGGCAGGATTAAGGGGGCGAAGAGGCGCTACGAAGTTATTGCATTTATGGCCGACCTCCAAAAATGCTTCCTTTCGGCTGCCTCGCGGCGCCAGGGAGCCGTTCCCAAGCAGCCCGCTCTGCCGCCGACGGATCCATCCCCCGTGAGACGTGAGGTTGAAAACCCACGTATGCAGCTTCACGAGTGCCTAGAGCCGGATTCTTATGCTGCTGTGGCCGCGTTCACAACGTAGTATGGACGAAAAAGGACTTAAGACAATCCACTAACTGTAGTCTGGGCCTAACGATTTCATGTCCTTTAGGCTTTCCGCTCGGGCGCGGCTGTCAACCGGCAAAAGGATTTGAAAATACCCTGTCATCTAGCTCTGTTTATGATCGACAGCCGCGTTGGTACTTTCGTCCCATTTGAACAGTAAAGCTCCCTTTCAAAGTGTTCCTGGGAGCAAGGGCCGAAGGCCCTGCAGTGCGTTACTGTCGTCAAATAGTACCTCCCTAGGGGATCCAATACGCCAAAAGGCTGATCTAGAGTTACGAGCGACTCATGAATCCCGCATTAGCTGGTCGCGCAGCATCCCCGCCACTGCATTGCTCCTCTGGGAGGTTAAGTATACCCTAGGACAGCGGATCAAAGAGACCTGTAGGAGTGCTGGGCACGCGACGCCGGGGTTAATGCCTTCCATGTGCGTCCGCATCCTGGGCGTGGAGCCATAATGCCCGGCCAGTTCGGGTGTTCCCCAGCGCATCGTGTTGCCCGGGAGTTTCTTTTATCTCCGTTCCGTACTTTGCGAAAACCGCCTAATCTAGGACCCCCTCCGATGCCGGTACGCCCCTGTTACAGGTCTTTCTACGCGTCTCCAACAGAGATTAAGCTACCCTAACAGGTGACCTTCTATCTCACGTTGGGACAGCGAGTAAGAGCGCCCCAGCCACCTGCCGTACGAGCCAAATGGACTTCACGAACAGGACGGCGTACACCGTAAACGTAAAATCGTTGGGGTCAACAGATCTATTCTACGTGAGACTAGGTACCCGTTAAAACTGCGTGAACGTTATCTGGTCACCTGCATGAATGGAGCGTAAGAGATGCGAACGAATCACATTGATATGTATTTGTTCCCTTAGGGCGGCGGGACTGCTGCGGCCCTGCGCCGAGCCCGACGACCGTGCCGGAGATGTACTCCCAGTGGACTGTTACGAAAGCGGCGGGCTGGGCCATCGTGGAGCGGGCGTTATGCGAGTGTCAAACCCGGCAGGCAGACGCGCGCAGATCTAGCTGAGCTGATGGTCAACCATTTGAAAGACGTGCTGCTTCGGCGTACCTATGTACCCAATAAACCTATTCTAGGATGGAACGCCGCAGAACAGGAGCCACTGATAGGGATGCTCGTACTGGCGCATCGTACACCTAAAGTTTTTCGCGTGCCAATTCTGCGCAAGCCTCTTTCTCCAGGGTCTTAGGCGACCTCCCATTAAAGGGGCAAGCCTAAGATCGACTTAAAATTTCTGCTCGCTTTGCGCCAGCAGTCGCATTTGTACCCGAAACAAAAATCCCATTACCTAACAGGCTGAAATCGGTCAATTACATGTGAAAGAGCAGATAGGTCAAACGATGCCTGATTGACGCCGTTTAAAGCGGGTATACGAAGTTTCCGTTTTCGTCCGTCGCTCAGCCACTCCATCGACAAAGATTATAACAGCTCTAATTCGACTTGAACCTTCTACCGTACGTAGTGACCCGCAGGAAGAGGACCAGGAAATGGGGATGGCAGGAAAAGAGAATCGGTGCTAAACCGCAAAACCGACGAATCCACCCACGCTGACCGCTATCCCATCAGCGGGGTTGGGTGCGGCGCTTTCGCACTCAGATCTCCCGCCCCGGGCAGGCTTTGCATGACCCTCTAAACCTGTTGCCCTGCGGCTCTGATAAATGAGGTTTCTTTAACGTCACACGTACGAAACCACTGGTGTTCGACCAAATCGTCCTGGGGCTTAGAGGTGCCGTACCTGCAAGCCGACGGAGTCAAATTGACGACAACGACGCCGCTGCATCATCCTCGGATGCACGCCCAGTCGCCTTACGGGGCCAACTCTTTCAACATATGTACAGAAATCAACGGACGAATGCTGAGGCCAGTAGGAGTTCACCATTGATAAAGCGCCCATTTCTGCTAGCACCGTCGAAAAGTTTCTTCGCGTTAGTCAGCCTCACCCGTGCAGGAAGCGTACCGACAATGCATGGATTTCCCAACCGGATGCAAGATCTGCACGTTCACGTCCGGCTGAACGCCACCATTCCCATCGTTCTCGCTTCCAACGGCATGGCAGCAATGCCGCGAAGAGGCCGGTTGAGCACCCCTTAGAGACCGGTGGATAGGGGCTTTGTTGATTACAGTCTCTTTACGTGGACTAATGTTATAAAATAGGCGGCTTACGCCCGTCCATCCGATTGCCCAACTGTAGCGCAACCTTATCCCATCCTTGATTTAACGATTTCGGTACGCAATAAACCGGCCCTCATCTCAACCTGGTACTAGTTATGCATTAAGAGAGCCCCGGTGGCCAGCGCGGACCTGCGCGGGGCCGTATATGCCACCTTCCTGCCCAAGCTGGCGCTTAGTACAATGCGTTGGAATCAGACTGAACCCTGTTATCTCCCGGTGGTTGAATGACTAGAAAGTGATGCCGTACCCATTCTCTGCCAATGGCCCCTGCTCCGTAAATGCATCGGTATGGAGCGTGATTTCGACAAATGTTTCTTTACTCCGCACGCCTAAACGTGAATCGGCTCTAAGCCTACCCCTTACAGTAGATCGTCGGGCGCTTTGCGTGTAAACAGACGGATGATGGAAGCGCATCAGCAACCCGTGAAAATATGCACTGCAGTTCACGTCGTTGGCAGAACCGCCCTCCATTTTATGTACGCACGAGAATGAAGAAGGCCTGTCGGGATTACGTCAGGGGGAAATCGCTATCCTAGGGGCCATCCCGCCGCAGAACCGTGCGACCCCAGCCGATTACCCCGTCCCATCAGGTGCTGGCGGGTGGCCTGTTGCGACGGGCAAGCCGGCTTTTGACAACCTAGTCAAACCCCAAGACTCGGGTGCACCGCGTCCGATTAGCGTGATGGAGCAGTTTGAAGATGGCTCGACGCGCTTCACGAACACGCAGGCGATGCAGTTTCATACTCTGACTGCGGGCCTATTCTTCTGTTGCTTCCATCACCATTAGAGCGTCGCAGATTAATAGCCTGGCAGTCAAGCATTTAAGGCCGAATCACATTCCAGCTGAATCATATTAAGAACGACCCTGAAGCGCTAAGCCAGGAGGAAAACCACCATACGACGACTTCACAAACAACCGGCTCACTGCCCCCTGCCTCTGAAAACTGCGGGAGTCCCGAGCTCATTATGATCCTCATTCTCTGCTCTGTTGATTGTCTGAAGCCGGATCCCTGTGAGTGCAGCCACAAGCAGTGCAGTTCCAGCCGGCTGCAGCGCCTACTCTA *
51fd3136069d planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
bgruening
parents:
diff changeset
119 109 0 utg000001l 12519 60 66S9M2D15M3I15M1I13M7I2M3I1M2I5164M12D12M5D5M1I9M3I10M2I13M4D3M1I3M3D2M1D4M1I14M5D2M1I6M1I1M1I9M2D17M2D1M3I2M1I12M4I4M1D9M2I5M3D3M2D10M3I11M1I2M4I7M2D16M2I1M1I2M5I2M1I2M1I10M1I2M1I4M3D4M1I1M2I2M1I3M2I7M1D2M1D1M4I7M1I2M1I7M6D21M3I4M3I4M1I27M2I6M1D5M1D8M1D9M2D4M1I5M1I12M1I11M1I2M1I2M1I3M3I6M1D4M4I1M1I4M1D6M1I6M1I4M2I10M1D4M2I5M2I1M1D9M2D1M8D3M3D4M6D20M1D14M5I1M1I2M1I13M1I1M1I10M2I5M4I15M1I5M3I3M3I11M1I1M1I18M2I8M1I3M2D5M3D4M1D7M1I2M2I4M2I18M2I3M2I4M6D6M1D3M2D3M2I18M2D23M1D2M1D14M1I14M2I3M1D2M1I13M2D3M2I2M1D3M1I7M1D6M1D1M3I18M3I26M4I9M3I11M1I23M2I2M7I3M3I2M2I3M1D4M3I1M1D10M1I3M2I3M5I3M2I1M1I9M1I2M1I1M1I5M2I2M1I6M1D13M2I8M1I2M1I14M1I14M7I1M2I3M1D11M1D9M1D15M5I1M1I9M1I1M3I3M1D3M1I6M1I3M1I14M3I8M1I7M1I2M2I12M5I9M4I5M1I1M2I15M1I9M1I1M2I4M1I25M1D5M3I4M1I9M3I5M3I5M2D3M1D4M2I5M2I10M1D19M3I4M1I6M1I10M2I7M1D7M2D3M3I4M1I5M1D7M1I6M1I16M1I8M2I14M1I10M1I11M1I19M1D5M3D17M1I1M3I8M1I10M2D4M2D20M1D14M1D3M1D6M2I5M1D11M1D1M2I2M1I2M2D7M1I1M2D8M1D5M2I8M1I5M1I3M2D16M1I8M4D6M4D5M1D11M2I7M1I3M3I5M5I5M1D4M2D2M1D4M2D19M2I3M5I17M2I3M3D15M1I10M2I5M1I3M3I7M1I13M2I19M1D2M1I2M1I5M1D15M1I6M2I1M2I7M1D12M4I4M1I9M1D8M1I6M2I4M1I21M2I2M2I5M1D7M1I3M4I2M1I25M1I3M2I1M1I9M1I1M3I13M1I1M2I1M1I14M3I2M1I2M2I9M5D11M1I1M2D10M2I7M4I1M1D5M1I3M1I5M1I2M1I2M1I4M4I12M1D5M1I14M1I2M1D26M1I2M1I12M1I12M2D12M4I3M1D6M1I4M1I7M5I11M3I3M1D7M1I9M3D6M2I9M4I8M1I13M1I8M1I3M1I13M3D4M3D1M1D10M1D11M1I12M1I5M4I21M3I1M2I3M2I11M3I1M1I10M6D3M2D6M1I2M1D4M2I9M3I10M1I1M1I1M1I5M2I19M2I4M5I12M1I24M1D7M3I20M3I6M2I9M6D9M1D13M1I3M1I17M3I5M1D5M1I17M1I2M1I7M1D1M1D5M5I15M4D3M1D8M1D3M3D11M9I1M2I17M1I11M2I7M3I3M2D6M6I11M1D2M1D7M1D19M3D7M2I3M2I4M1I6M1I6M5I5M3D7M2D6M1I5M1I1M1I12M4I2M4I7M1I16M2D5M2D3M3D7M1D6M5I5M1I8M1D7M2I2M2I8M1I17M3I36M1I19M1I10M1D5M2I10M1D2M3I3M1I3M3I5M4D10M1I6M1I2M1I17M1I15M3I3M2I6M3I8M5I1M1D17M1D20M2D11M2I2M1D11M2D3M1I20M1I11M1D7M2I2M1D2M1I28M5I2M1D5M2I2M1I4M5I20M1I14M4I9M2D12M1I17M2I40M1D4M2D14M2I28M4D6M1D10M4I12M2I29M1I14M1I10M1D11M1I22M1D7M1D5M1D1M2I10M2D2M2D9M3I12M1D11M1D18M1D9M1D7M2I2M5I12M1D25M1I52M2D21M1D7M2D10M2D1M3I18M1D12M3I8M2I20M2D6M3I7M3I17M1D7M1I21M3I3M3I8M1D10M2I5M1D3M1D9M3I8M3D6M2D10M2D16M2D11M3D4M1D6M1D21M1D22M1I2M1I7M1I17M1I11M1D5M2I10M1I13M1D7M1I9M1I5M1I5M5I5M2I2M1D8M2D5M1I9M2D10M1I8M2D16M2D1M1I2M2D9M1I14M1D13M1I7M4D2M2D3M1D2M1I10M1I13M1I10M1D2M4I1M1D8M2I15M2D19M2I5M1I6M1I6M3I13M1D2M2I1M2I5M1D5M3D21M1I2M1I13M3I2M1D6M1I17M1D4M1D12M1D6M1I23M1D13M1D1M1D3M1D18M2D10M3D8M2D4M1I18M1I6M1D3M2D3M1I19M1D6M10D2M10D2M1D21M4I9M1I5M1I21M1I12M1I2M2I5M1I8M8I2M1I2M2I5M2I4M1I10M1D1M2I12M2I6M1D18M5D1M1D21M1I10M1I23M1D7M1I5M2I5M1I4M1D12M2I6M2D6M3D1M1D11M2D31M1I18M1I1M2D10M2I8M2I1M6I2M2D1M1I4M1D20M1D11M1I9M1I7M1D8M2D3M1I9M1I13M5I1M1I8M6D3M1I4M1D2M2I2M2I1M3I4M1I2M7I8M4I2M2I1M1I9M3I8M4I7M2I1M2I7M1I7M1D4M3I6M2I2M1D5M1I10M2I1M2I11M2I8M2I6M1I2M3I2M1I4M1I2M4I8M1I6M1D9M1D16M1D11M9I2M1D3M2I16M2I2M3I5M1I13M1D5M8I1M1I3M2I10M4I5M2D12M2I3M5I16M7I2M4I13M4I5M4I2M1I13M1I7M2I7M1I1M1I8M3I19M1I2M3I20M1D5M1I8M1D3M1D24M1I3M5I11M3I4M2I4M1I3M1D7M1I1M1I1M1I5M2I1M1D5M4D2M1I8M3D3M4D5M2D2M3I20M1I5M3I15M1I2M1I16M3I4M3I7M3I3M2I3M1I8M1D6M2D3M5I8M1I1M1I10M1D3M2D5M4I4M1D4M1I7M2I7M1D4M1I14M1I6M1I3M2D13M1I5M1D3M1I10M2I2M1I5M1D3M1D14M2D11M131S * 0 0 GGGTGTCCTCCCCTGAAGGTGACTCGTCAGGCCTCAAATCCAGGACGCCTCCGACGCATGGACGCCGCAGCATTCAAAGCAGAAGGCGTCGGGGTGTGTGATACGAAACCGAAGCATTGGCCTGATCAAGTGCGATTCCGGATTAGCTGCCAATGTCGAGGACCCCGGGGGTTTTCGTTGCTAACTACAACTGCCACACACCACAATAGGACTGACAGGCGAATCCAGATGGATGCACAAAAGCCCGCCGCCTAAGAACGTCGCGCAGGGAAACAGGCTCAAGCATCGTGAAGAAAGCAGCAAATCCCTGTTGTATTCGGCGTAAGCGCAAAACCAGTTAACCACCGCCTATTCTCGCTGCAAATTCGCAACTGAAATCACGATATGAAAGCGCACGCACTAAATCGATAGACCTTACAGTGCTGGCTGAATACCACAAACAGATTGAAGCAACCTGCAACGTATTGGAGCGCAAGAATCAGCGCACATGGTACAGCAAGCCTGGCGAACGCAGCAATAACATGCAGTGGACGCAGAAAATCTAATGTTAATAAGGGAAAATCGATTCCTCTTATCTAGTTACTTAGATATTGGCCTTGGCTTTATCTCAATATTATACGCATTACTATCTGGCAACTAATTCAGTTAGAGTAAATATCCTCAATAGGGAATAATATGCCGCTTTCCATTCCATCGGGAAAAGTTTTGTTCAACACACCAAGCACTCAATCGACCTACTAATGTATGGGAATTGTTTTGATGTAACCACATACTTCCTGCCTTCATTAAGGGCTGCGCACAAAACCATAGATTGCTCTTCTGTAAGGTTTTGAATTACTGATCGCATTTATCGCGTTTTTGCATCTTAATGCGTGCGTTTTCTTAGCTTAAATGACGGTCTATCTGGCGCTGGCAATAGCTGATAATCGATGCACATTAATTGCTAGCGAAAATGCAAGCAAGACGAAAACATGCCACCACATGAGGAATACCGATTCTCATTATAACATATTCAGGCCAGTTATCTGGCTTAAAGCAAGTTAATACCAATAAGATCATATACATGGTTCTCTCCAGAGGTTCTCATTACTGAACGCTCGTCCTACAGAATAACGAGTGGATCCATTTCTATACTCATATCAACTGTAGGGGTTGTAATAGTTTATCCGATTTCTGCTCGCTGTAGGGTAACACGAGAACGAGCCTGATGTGGTTAAAAGACAGGCACAATCTTTACTACCGCAATCCACTATTTAAGGTGATATATGGTCAAAGAAAGAATTTGAAGAGTTCGAAGAGCATCCTACAGGATGTGATGGAACATACCAGGACTATCCGTATGACTACGACTATTAACTAAATCAATGGTGTGGACAATTCAAGCGATGCAATGGATGCAAGCTGCAATCGGAATGCATGGTTAAGCTGAAGAAGATGTTTCCTGTAATGGAAGATGGGAAATATGTCGATAAATGGGCAATACGAACGACGGCAATGATTGCCAGAGAACTTGGTAAACAGAACAACAAAGCTGCCTGATAGTGGCCTTTATTTTTGTAGCATAAATAACAGAATAAACACTGCACTGTGTATTCATTCCAACGAGTGAATACACGATGCAATGTCGCACTCGTAACTAAACAGGAGCTAAATGTTCTGATTATTGGAAATCTTCTTTGCCCTCCAGTGTGAGGGCAGTTTTATCTGTGAGGATATGAACAGATGTCAAACATCAAAATACATCATTACGTACGACTGGAAAGCATCAATAGAAATTGGACGAAATCGACCATGACTTAATGACAGAGGAAAAACTTCACCAGATTAATAATTTCTTCAGTAGACTCTGAATACCGACTCAATAAACACGGCTCTGTATTAAATGCGCTGTATTAATCATGCTGGCGCAACATGCTCTCAGTAGCAATTTCAAGCGACTTAAATGCATATGGTGTTGTGTGTGGATTCGACTGGAATGATGTGAATGGAAAACCTTTAGTCAGGAAGGATGGCCTCCAATGGATGTAGCGAAGGAATAAGAATTACCGATATCGATACATCAGGAATTACTTTCTTTGATTCAAGATGATATGACTATCAAGGCCGCCCTGAGTGCGGTTTTACGCATACCAATAACGCCTTCACTCGAGGCGTTTTCGTTATGTATAAATAAGGAGCACACCCATGCAATATGCCATTGCAGGGTGGATCGTCGCTGGCTGCCTTCCGAATCTTCTACTTGAACGAATCACCCGTAAATTACGTGACGGATGGAACGCCTTATCGACAACTACTTAGATCACGGCCAGGAGTCCCAAAGAATGATGGATCAAACACTTATGGCTATCCAGACTAAATTCACTATCGCCACTTTTATTGGCGATGAAAGATGTTTCGTGAAGCCGTCGACGCTTATAAATGGATATTAATACTGAAATATCGAGCAGATTACAACAAAGCATTCACTAACCCCCTTTCCTGTTTCCTAATCAGCCCGGCATTTCGCGGGCGATGATTTCACAGCTATTTCAGGAGATTCAGCCATGAACGGTGCCATTCAGGATCGTCTTGAGGCTCAGAGCTGGGCGCGTCAGCAGCAGCTCGCATTCATGGTGCAAAGAGAAAGAGGCAGAACTGGCAGGACGACTGAAAAGGCCGCCTGCCCCAGGCTACCTGTTGAATGCTATGCATCGATCATTTGCAACGCCACGCGCCGGAGCAAAAGAACCATTACCCGTGCGTTTGATGACGGGCCGGATGTTGAGTTTCAGGAGGAGCGCCGCATGGCGAACGGAACATCCATCCTGGTCGAAACCATTGCTCACCACCAGGTTGATATTATTGATTCAGAGGTATCAAACGAATGGCTGACTGCATACCGCAACGCCCTGGCTGGGAAGCTGGCTGAACGTGCATGGATTCTGTCGACCCACGAAGGAACTGATCATCACCACTCTTCGCCAGACGCATTTAAAGGTGATGCCAGCGATGCGCATTTCATCTTCGCATTACTGATCGTTGCCAACCAGTACGGCCTTAATCCCTAAGGTCAACGAAAGAAATTACTACGCCTTTCCTGATACCGGAAGAATGGCATCGTTCCGGTGGCGTTGATGGCTGGTCCCGCATCAGGTTAATGAAAACCAGCAGTTTGATGGACGCATGGACTTTGAGCAAGGACAATGAATCCTGTACATGCCGGATTTGGTCACCGCAAGGACCGTAATCATCCAGATCTGCGTTACCGAATGGATGGGATGAATGCCGCCGCGAACCCATTCAAACTCGCGCCGAAGGCAGAGAAATCACGCTGTGCAGTCGCATCCCAAACGCTCCATTGTTGTTACGTCATAAAGCCATGATTCAGTGTGCCCGTCTGGCCTTCGATTTGCTGGTATATCTATGACAAGGATGAAGCCGAGCGCCGCATTGTCGAAAATACTGCATACACTGCATGAACGTCAGCCTGAACGCGACATCACTCCGGTTAACGATGATGAAACCATGCAGGAGATTAACACTCTGCTGATCTGCCTCCGGATAAAACATGGGATGACGACTTATTGCCGCCGCTCTGTTCCCCAGATATTTCGCCGCCCGACATTCGAATGTGACGTTGCACATGACAGGCACGAGCAGTAAAAGCGCCTGATCGCTTCCTGAAACAGAAAGCCGCAGAGCAGAAGGTGGCAGCAGCATGACACCGGACATTATCCTGCAGCGTACCGGGATCGATGTGGAGCCCTGTCGAACAGGGATGATGCGTCGAACAAATTACGGCTCGGCGTCACTCCACGCCCGCTTCGAAGTCCACAACGTGGCACCCGAAAACCCCGACTCAGAAAGAAGTGGCCTGACATGGAACAACTTTAACCTTCCACACCGCTGCCGTTGCTGAGGTTTTGCACCGGTGTGGCTCTGAAGTTAACGCTAAAGCAACTCGTCCGGGGAAAACAGTACGCAGAACGACGCCAAAGCCTGTTTGACGATTCACTTCTAGCGTGAATGTTACTGAATCCCCAATCATCTATCGCCGCGACGCAAACTACTGCGTACCGCCTGCTCTCCCGATGGTTGGCTTATGCATGACGCAACGGCCTGAATCGAACTGAAATGCCCGTTTACCTCCCGCCTGGATTTCATGAAGTTCTATCAGGCTCGGTGGTTTCGGGTGGGTCAGAGACAAAGTCAGCTGGATGATAGCCCCTGACCCAGGTGCAGTACAGCGGGCATGTGACTCGACGCGAAAAAGATCGCCTGGTGATTTGCCAACTAACCTGACGTGCGTATGAAATCCAAATGCGTGAAGGCCTGCACGCATTATGTCGTTATTGAGCGCTACCCTGAACGAAAAAGTACATGGGGGTTTTGACGACGAGATTGATCGTGCCGGAGTTCATCGAAAAATGGAAGGGATCGAGCATGAAATTGGTTTTTGTATTTGGGGGAGCATCGATGACGCATCCTCACCACGCACCTCGGCCTAAGTAGGCCGCAATCACCTTTCACGTCTACTCCTAGTCGTATACAAAGCGAGGCTGGGTATTTCCCGGCCTTTCTGTTATCCGAAATCCACTGAAGCACTAAGCACTGGCTCGGAGGGTAGATAATCAATAAACGCTGTTATCTCATGCAACAAAGCATCTTCTGTTGAGTTAAGAACGAGTATCGGCCAGATGGCACACTCATGCTCAAATTGGAATCAGGTTTGTGCCCAATATGAAAGAGAACCGCAACGACCCTCCAGGATTTTAGCCGTTATAGCCGCATCCGTTCACAAAGGCTGGAAAACCGATGGTGCGAAAGGCAGAAGCAGATGAGAAACCAGGATATGACAACCACGGAATGCATTTTCTGGCAGCGGGCTTCATATTCTGTGTGCTTATGCTTGCCGACATGGGACTTGTTTAATGACACCTCATGCAGGAAAGCCCTCGATTCACAGCATTGCCGTCAGGCTAATTCTGAAATCAAAAGCCAGACATAGCAAGTTTCCGGATAAAACGTCGATGACATTTGCCGTAGCGGGTCGATACTGAAGAAGCACCGCGAAACGGTAACGCCCTGATGGGATTCACACACGACTCGATTTAAGCCACTAATGCAATCGGCAGCCTGTTAAACGATGTCTTTAAGGAACGATGAACATGAAAAGCAAAATCATCAGGGAGCAGCTCCTTTTATTATTCGCATTCACCTCAAGCGGCGTATTAACCAACAGTTCAGGGATTAATGAAAGATGGCAGACATCATTGATTCAGCATCAGAAATAGTACGGAATTACGGACGCAACACAGCACTAAATGCGCCGCCTGAAACCACCAGGCTATCTGCCAGCTCCATTGTTGAGTGTGGAGTTACATCCGATAGATGAACGAAGACGCCTGGTCGTTCAGGGTCTTGTTAATGTGCAAGTGCCAGGAGGGATCTGAGAACTTATCAGTAAACATAGAGAGGATTTGCTGAAGTGAGCGAAATTAACTCAGGCAACTGCGTGAAGGCAAGCAGAGCAGGCAATGATGCAATCAATGACGACCTGGGGATTTGACGCAGACCTTTCCACTGAATTGGTAACACCATCGATTGTGCTCTGGAACTGCTGGATGAACGGGAAAGAAACCAGCAATACGATACATTAAAGCCGCGACCAGGAGAACGCTGAGGATATTGCGCCTATAACAGTAGGAAGAAACTGCGTGTTGAGCTTGAAACAGCAAAAATCAAACTCAACGAGCAGCGTGAGTGAGTACGAAGCTGTTATCTCGGATGGGAGTAAGCGTATTGCTAAACTGGAAAGCAACGAAGTCCGTGAAGACGGAAACCAGTTTCTTGTTGTTCGCCATCCTGGGAAGACTCCTGTTATCAAGCACGGCACTGCACTGGTGATTATGGAAGAGGTTTCTGCCAAGCAGTTAATCGAACACAGACCTAGCGTTAGTAACTATCGACATCATTACGCATCGCTATTACGGGGTTGGGAGGTCAATGGGTTCAGGATGCAGAACCAACGGCTATCTGCATATGATGTCCTGAACTGGCATTCGCATCAAAGGAGAGTGAGATCGGTTTGTAAAAGATAACGCTTGTGAAATGCTGAGACTTCGCGTCGTCTTTCACAGCGATGCCAGAGTCTGGTAGTGTCAGATGGACCGGTCTCAAACATCGGGTTGAGTATTATCTTACTGTTTCTTTATTCCATAAACATTGCTGATACCGTTTTACTGAATGAAACGACATACATTGCAAGGAGTTTATAAATGAGTATCAATGAGTCCCGCCTATAAGAGTCTGAGCAAAGATTGGGCGCGTTATCAATGTTGCAGATCCTTGTCTTGTCTCCATGCAGACATCACGAAGGTGTTTATGTGATGAAGGTATAGATATAGAGTCGGCATACAAATATTCCATGAAGGTTTATAAGTCTAATGAAGAAGACAAATCCCCATTTGCAATGTGCGAAATGACTGATACCGTTGGATGCAAAGAGCGCTCTTATCACGGGTACGGTGCGGAACGATACTTGCCCTCTCTGTACAAAACATATCATCTGATTAAACCCAATATTACATAACAATCCCCACTCGCGGGGGATTTATTTTATCTGAACTCGCTACGGCGGGTT