diff test-data/unknown.rnaz @ 0:e123d5c6f489 draft default tip

planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_team/rnaz commit d261ddb93500e1ea309845fa3989c87c6312583d-dirty
author bgruening
date Wed, 30 Jan 2019 04:12:06 -0500
parents
children
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/unknown.rnaz	Wed Jan 30 04:12:06 2019 -0500
@@ -0,0 +1,720 @@
+
+############################  RNAz 2.1  ##############################
+
+ Sequences: 6
+ Columns: 120
+ Reading direction: forward
+ Mean pairwise identity:  83.72
+ Shannon entropy: 0.30516
+ G+C content: 0.50000
+ Mean single sequence MFE: -36.97
+ Consensus MFE: -15.85
+ Energy contribution: -15.72
+ Covariance contribution:  -0.13
+ Combinations/Pair:   1.35
+ Mean z-score:  -0.44
+ Structure conservation index:   0.43
+ Background model: dinucleotide
+ Decision model: sequence based alignment quality
+ SVM decision value:  -4.76
+ SVM RNA-class probability: 0.000000
+ Prediction: OTHER
+
+######################################################################
+
+>hg17.chr1/0-120
+UACAGCAGCUGCUAUUGCUUAUGGCCUGGAUAAGAGGGAGGGGGAGAAGAACAUCCUGGUGUUUGACCUGGGUGGUGGAACCUUUGAUGUGUCUCUUCUCACCAUUGACAAUGGUGUCUU
+.....(((..(((((.....)))))))).......((..((((((((...(((((..((.((((.(((.....))).))))))..))))).))))))))..))...((((....)))).. ( -39.90, z-score =  -0.87, R)
+>canFam1.chr9/0-120
+UACAGCAGCUGCUAUUGCUUACGGCUUGGAUAAGAGGGAAGGGGAGAAGAAUAUCCUGGUGUUUGACCUGGGUGGUGGAACUUUUGAUGUGUCUCUUCUCACCAUUGACAAUGGUGUCUU
+..((((....((....)).....)).)).......((..((((((((...(((((.....((((.(((.....))).))))....))))).))))))))..))...((((....)))).. ( -34.00, z-score =  -0.16, R)
+>mm5.chr2/0-120
+UACAGCAGCUGCUAUUGCAUAUGGCCUGGAUAAGAGAGAGGGAGAGAAGAACAUCCUUGUGUUUGACCUGGGUGGCGGCACCUUCGAUGUGUCUCUUCUCACCAUUGACAAUGGUGUCUU
+.....(((..(((((.....)))))))).......((((((((((((...(((((...(((((.(.((.....))))))))....))))).))))))))((((((.....)))))))))) ( -34.60, z-score =   0.44, R)
+>galGal2.chr17/0-120
+AACUGCUGCUGCAAUUGCAUACGGAUUGGACAAGAGAGAGGGUGAAAAGAACAUCCUUGUAUUUGACCUGGGUGGUGGAACUUUUGAUGUCUCCCUCCUGACAAUUGACAACGGAGUCUU
+.(((.(((.((((((((((...(((..(((((.(((((((((((.......))))))....(((.(((.....))).))))))))..)))))...))))).)))))).)).))))))... ( -33.00, z-score =  -0.79, R)
+>fr1.chrUn/0-120
+AACCGCUGCUGCCAUUGCUUAUGGUCUGGACAAAAAGGACGGCGAGAAGAACAUCCUCGUGUUCGAUCUCGGUGGCGGCACCUUCGACGUGUCUCUGCUCACCAUUGACAACGGUGUGUU
+.((((((((..((...(((....((((.........)))))))((((.((((((....))))))..))))))..)))))..........((((..((.....))..))))..)))..... ( -39.10, z-score =  -0.61, R)
+>danRer1.chr11/0-120
+UACGGCGGCUGCCAUUGCAUACGGUCUGGACAAGAGGGACGGAGAGAAAAACAUCCUGGUGUUCGAUCUGGGUGGUGGCACCUUUGACGUGUCUCUGCUGACCAUCGAUAACGGCGUGUU
+((((.(((.((((((..(...(((..((((((...((((.(..........).))))..))))))..))).)..)))))))).((((.(.(((......)))).))))....).)))).. ( -41.20, z-score =  -0.64, R)
+>consensus
+UACAGCAGCUGCUAUUGCAUACGGCCUGGACAAGAGGGAGGGAGAGAAGAACAUCCUGGUGUUUGACCUGGGUGGUGGAACCUUUGAUGUGUCUCUUCUCACCAUUGACAACGGUGUCUU
+....(((.(..((((..(...(((..((((((...((((.(..........).))))..))))))..))).)..)))).....((((((((........))).)))))....).)))... (-15.85 = -15.72 +  -0.13) 
+
+############################  RNAz 2.1  ##############################
+
+ Sequences: 6
+ Columns: 120
+ Reading direction: reverse
+ Mean pairwise identity:  83.72
+ Shannon entropy: 0.30516
+ G+C content: 0.50000
+ Mean single sequence MFE: -30.48
+ Consensus MFE: -16.68
+ Energy contribution: -16.27
+ Covariance contribution:  -0.41
+ Combinations/Pair:   1.38
+ Mean z-score:  -0.85
+ Structure conservation index:   0.55
+ Background model: dinucleotide
+ Decision model: sequence based alignment quality
+ SVM decision value:  -2.64
+ SVM RNA-class probability: 0.005929
+ Prediction: OTHER
+
+######################################################################
+
+>hg17.chr1/0-120
+AAGACACCAUUGUCAAUGGUGAGAAGAGACACAUCAAAGGUUCCACCACCCAGGUCAAACACCAGGAUGUUCUUCUCCCCCUCCCUCUUAUCCAGGCCAUAAGCAAUAGCAGCUGCUGUA
+..((((....)))).((((((((((((...(((((....(((..(((.....)))..))).....)))))))))))).........((.....))))))).....(((((....))))). ( -29.50, z-score =  -1.08, R)
+>canFam1.chr9/0-120
+AAGACACCAUUGUCAAUGGUGAGAAGAGACACAUCAAAAGUUCCACCACCCAGGUCAAACACCAGGAUAUUCUUCUCCCCUUCCCUCUUAUCCAAGCCGUAAGCAAUAGCAGCUGCUGUA
+..((((....))))...((.((((((((....(((....(((..(((.....)))..))).....))).)))))))).))...............((.....)).(((((....))))). ( -24.60, z-score =  -1.16, R)
+>mm5.chr2/0-120
+AAGACACCAUUGUCAAUGGUGAGAAGAGACACAUCGAAGGUGCCGCCACCCAGGUCAAACACAAGGAUGUUCUUCUCUCCCUCUCUCUUAUCCAGGCCAUAUGCAAUAGCAGCUGCUGUA
+..((((....))))...((.((((..(((.(((((....(((..(((.....)))....)))...))))))))..)))))).............(((....(((....)))...)))... ( -29.50, z-score =   0.11, R)
+>galGal2.chr17/0-120
+AAGACUCCGUUGUCAAUUGUCAGGAGGGAGACAUCAAAAGUUCCACCACCCAGGUCAAAUACAAGGAUGUUCUUUUCACCCUCUCUCUUGUCCAAUCCGUAUGCAAUUGCAGCAGCAGUU
+..(((((.((((.((((((((((((((((((((((....(((..(((.....)))..))).....)))))..........))))))))))............))))))))))).).)))) ( -31.10, z-score =  -1.92, R)
+>fr1.chrUn/0-120
+AACACACCGUUGUCAAUGGUGAGCAGAGACACGUCGAAGGUGCCGCCACCGAGAUCGAACACGAGGAUGUUCUUCUCGCCGUCCUUUUUGUCCAGACCAUAAGCAAUGGCAGCAGCGGUU
+.....((((((((..((((((((..((((.(((((...((((....))))....(((....))).)))))))))))))))))............(.((((.....))))).)))))))). ( -37.70, z-score =  -0.90, R)
+>danRer1.chr11/0-120
+AACACGCCGUUAUCGAUGGUCAGCAGAGACACGUCAAAGGUGCCACCACCCAGAUCGAACACCAGGAUGUUUUUCUCUCCGUCCCUCUUGUCCAGACCGUAUGCAAUGGCAGCCGCCGUA
+.....((((((....((((((.((((((...((((...((((....))))..)).)).......(((((..........)))))))).)))...))))))....)))))).......... ( -30.50, z-score =  -0.16, R)
+>consensus
+AAGACACCAUUGUCAAUGGUGAGAAGAGACACAUCAAAGGUGCCACCACCCAGGUCAAACACCAGGAUGUUCUUCUCCCCCUCCCUCUUAUCCAGGCCAUAAGCAAUAGCAGCUGCUGUA
+....(((((((...)))))))....((((.(((((....((...(((.....)))...)).....)))))...))))............................(((((....))))). (-16.68 = -16.27 +  -0.41) 
+
+############################  RNAz 2.1  ##############################
+
+ Sequences: 6
+ Columns: 120
+ Reading direction: forward
+ Mean pairwise identity:  83.72
+ Shannon entropy: 0.30516
+ G+C content: 0.50000
+ Mean single sequence MFE: -30.48
+ Consensus MFE: -16.68
+ Energy contribution: -16.27
+ Covariance contribution:  -0.41
+ Combinations/Pair:   1.38
+ Mean z-score:  -0.85
+ Structure conservation index:   0.55
+ Background model: dinucleotide
+ Decision model: sequence based alignment quality
+ SVM decision value:  -2.64
+ SVM RNA-class probability: 0.005929
+ Prediction: OTHER
+
+######################################################################
+
+>hg17.chr1_rev/0-120
+AAGACACCAUUGUCAAUGGUGAGAAGAGACACAUCAAAGGUUCCACCACCCAGGUCAAACACCAGGAUGUUCUUCUCCCCCUCCCUCUUAUCCAGGCCAUAAGCAAUAGCAGCUGCUGUA
+..((((....)))).((((((((((((...(((((....(((..(((.....)))..))).....)))))))))))).........((.....))))))).....(((((....))))). ( -29.50, z-score =  -1.08, R)
+>canFam1.chr9_rev/0-120
+AAGACACCAUUGUCAAUGGUGAGAAGAGACACAUCAAAAGUUCCACCACCCAGGUCAAACACCAGGAUAUUCUUCUCCCCUUCCCUCUUAUCCAAGCCGUAAGCAAUAGCAGCUGCUGUA
+..((((....))))...((.((((((((....(((....(((..(((.....)))..))).....))).)))))))).))...............((.....)).(((((....))))). ( -24.60, z-score =  -1.16, R)
+>mm5.chr2_rev/0-120
+AAGACACCAUUGUCAAUGGUGAGAAGAGACACAUCGAAGGUGCCGCCACCCAGGUCAAACACAAGGAUGUUCUUCUCUCCCUCUCUCUUAUCCAGGCCAUAUGCAAUAGCAGCUGCUGUA
+..((((....))))...((.((((..(((.(((((....(((..(((.....)))....)))...))))))))..)))))).............(((....(((....)))...)))... ( -29.50, z-score =   0.11, R)
+>galGal2.chr17_rev/0-120
+AAGACUCCGUUGUCAAUUGUCAGGAGGGAGACAUCAAAAGUUCCACCACCCAGGUCAAAUACAAGGAUGUUCUUUUCACCCUCUCUCUUGUCCAAUCCGUAUGCAAUUGCAGCAGCAGUU
+..(((((.((((.((((((((((((((((((((((....(((..(((.....)))..))).....)))))..........))))))))))............))))))))))).).)))) ( -31.10, z-score =  -1.92, R)
+>fr1.chrUn_rev/0-120
+AACACACCGUUGUCAAUGGUGAGCAGAGACACGUCGAAGGUGCCGCCACCGAGAUCGAACACGAGGAUGUUCUUCUCGCCGUCCUUUUUGUCCAGACCAUAAGCAAUGGCAGCAGCGGUU
+.....((((((((..((((((((..((((.(((((...((((....))))....(((....))).)))))))))))))))))............(.((((.....))))).)))))))). ( -37.70, z-score =  -0.90, R)
+>danRer1.chr11_rev/0-120
+AACACGCCGUUAUCGAUGGUCAGCAGAGACACGUCAAAGGUGCCACCACCCAGAUCGAACACCAGGAUGUUUUUCUCUCCGUCCCUCUUGUCCAGACCGUAUGCAAUGGCAGCCGCCGUA
+.....((((((....((((((.((((((...((((...((((....))))..)).)).......(((((..........)))))))).)))...))))))....)))))).......... ( -30.50, z-score =  -0.16, R)
+>consensus
+AAGACACCAUUGUCAAUGGUGAGAAGAGACACAUCAAAGGUGCCACCACCCAGGUCAAACACCAGGAUGUUCUUCUCCCCCUCCCUCUUAUCCAGGCCAUAAGCAAUAGCAGCUGCUGUA
+....(((((((...)))))))....((((.(((((....((...(((.....)))...)).....)))))...))))............................(((((....))))). (-16.68 = -16.27 +  -0.41) 
+
+############################  RNAz 2.1  ##############################
+
+ Sequences: 6
+ Columns: 120
+ Reading direction: reverse
+ Mean pairwise identity:  83.72
+ Shannon entropy: 0.30516
+ G+C content: 0.50000
+ Mean single sequence MFE: -36.97
+ Consensus MFE: -15.85
+ Energy contribution: -15.72
+ Covariance contribution:  -0.13
+ Combinations/Pair:   1.35
+ Mean z-score:  -0.44
+ Structure conservation index:   0.43
+ Background model: dinucleotide
+ Decision model: sequence based alignment quality
+ SVM decision value:  -4.76
+ SVM RNA-class probability: 0.000000
+ Prediction: OTHER
+
+######################################################################
+
+>hg17.chr1_rev/0-120
+UACAGCAGCUGCUAUUGCUUAUGGCCUGGAUAAGAGGGAGGGGGAGAAGAACAUCCUGGUGUUUGACCUGGGUGGUGGAACCUUUGAUGUGUCUCUUCUCACCAUUGACAAUGGUGUCUU
+.....(((..(((((.....)))))))).......((..((((((((...(((((..((.((((.(((.....))).))))))..))))).))))))))..))...((((....)))).. ( -39.90, z-score =  -0.87, R)
+>canFam1.chr9_rev/0-120
+UACAGCAGCUGCUAUUGCUUACGGCUUGGAUAAGAGGGAAGGGGAGAAGAAUAUCCUGGUGUUUGACCUGGGUGGUGGAACUUUUGAUGUGUCUCUUCUCACCAUUGACAAUGGUGUCUU
+..((((....((....)).....)).)).......((..((((((((...(((((.....((((.(((.....))).))))....))))).))))))))..))...((((....)))).. ( -34.00, z-score =  -0.16, R)
+>mm5.chr2_rev/0-120
+UACAGCAGCUGCUAUUGCAUAUGGCCUGGAUAAGAGAGAGGGAGAGAAGAACAUCCUUGUGUUUGACCUGGGUGGCGGCACCUUCGAUGUGUCUCUUCUCACCAUUGACAAUGGUGUCUU
+.....(((..(((((.....)))))))).......((((((((((((...(((((...(((((.(.((.....))))))))....))))).))))))))((((((.....)))))))))) ( -34.60, z-score =   0.44, R)
+>galGal2.chr17_rev/0-120
+AACUGCUGCUGCAAUUGCAUACGGAUUGGACAAGAGAGAGGGUGAAAAGAACAUCCUUGUAUUUGACCUGGGUGGUGGAACUUUUGAUGUCUCCCUCCUGACAAUUGACAACGGAGUCUU
+.(((.(((.((((((((((...(((..(((((.(((((((((((.......))))))....(((.(((.....))).))))))))..)))))...))))).)))))).)).))))))... ( -33.00, z-score =  -0.79, R)
+>fr1.chrUn_rev/0-120
+AACCGCUGCUGCCAUUGCUUAUGGUCUGGACAAAAAGGACGGCGAGAAGAACAUCCUCGUGUUCGAUCUCGGUGGCGGCACCUUCGACGUGUCUCUGCUCACCAUUGACAACGGUGUGUU
+.((((((((..((...(((....((((.........)))))))((((.((((((....))))))..))))))..)))))..........((((..((.....))..))))..)))..... ( -39.10, z-score =  -0.61, R)
+>danRer1.chr11_rev/0-120
+UACGGCGGCUGCCAUUGCAUACGGUCUGGACAAGAGGGACGGAGAGAAAAACAUCCUGGUGUUCGAUCUGGGUGGUGGCACCUUUGACGUGUCUCUGCUGACCAUCGAUAACGGCGUGUU
+((((.(((.((((((..(...(((..((((((...((((.(..........).))))..))))))..))).)..)))))))).((((.(.(((......)))).))))....).)))).. ( -41.20, z-score =  -0.64, R)
+>consensus
+UACAGCAGCUGCUAUUGCAUACGGCCUGGACAAGAGGGAGGGAGAGAAGAACAUCCUGGUGUUUGACCUGGGUGGUGGAACCUUUGAUGUGUCUCUUCUCACCAUUGACAACGGUGUCUU
+....(((.(..((((..(...(((..((((((...((((.(..........).))))..))))))..))).)..)))).....((((((((........))).)))))....).)))... (-15.85 = -15.72 +  -0.13) 
+
+############################  RNAz 2.1  ##############################
+
+ Sequences: 6
+ Columns: 120
+ Reading direction: forward
+ Mean pairwise identity:  85.83
+ Shannon entropy: 0.26644
+ G+C content: 0.46111
+ Mean single sequence MFE: -29.08
+ Consensus MFE: -17.18
+ Energy contribution: -17.27
+ Covariance contribution:   0.09
+ Combinations/Pair:   1.38
+ Mean z-score:  -0.03
+ Structure conservation index:   0.59
+ Background model: dinucleotide
+ Decision model: sequence based alignment quality
+ SVM decision value:  -4.58
+ SVM RNA-class probability: 0.000000
+ Prediction: OTHER
+
+######################################################################
+
+>hg17.chr1/120-240
+CAAAGUUGUGGCCACUAAUGGAGAUACUUAUCUGGGUGGAGAAGACUUUGACCAGCGUGUCAUGGAACACUUCAUCAAACUGUACAAAAAGAAGACUGGCAAAGAUGUCAGGAAAGACAA
+(((((((....(((((...(((........))).)))))....))))))).......((((........((((.................)))).((((((....))))))....)))). ( -29.23, z-score =  -0.65, R)
+>panTro1.chr1/120-240
+CAAAGUUGUGGUCACUAAUGGAGAUACUCAUCUGGGUGGAAAAGACUUUGACCAGCAUGUCAUGGAACACUUCAUCAAACUGUACAAAAAGAAGACUGGCAAAGAUGUCGGGAAAGACAA
+(((((((....(((((....(((...))).....)))))....))))))).......((((........((((.................)))).((((((....))))))....)))). ( -26.53, z-score =  -0.03, R)
+>rn3.chr3/120-240
+UGAAGUGGUGGCCACUAAUGGAGACACUCAUCUGGGUGGGGAAGACUUUGAUCAGCGGGUCAUGGAGCACUUCAUCAAGCUGUACAAAAAGAAGACUGGGAAAGAUGUCAGAAAGGACAA
+(((((((((((((.....((....))(((((....))))).................))))))....)))))))(((..((...........))..)))......((((......)))). ( -26.70, z-score =   0.92, R)
+>galGal2.chr17/120-240
+UGAAGUUGUGGCUACAAAUGGUGACACACACCUGGGUGGAGAAGACUUUGACCAGCGUGUUAUGGAGCACUUCAUCAAACUCUACAAGAAGAAAACAGGAAAAGAUGUCAGGAAGGAUAA
+((((((.((..(((....((....)).((((((((..((((....))))..)))).))))..))).))))))))...............................((((......)))). ( -24.20, z-score =   0.87, R)
+>fr1.chrUn/120-240
+UGAAGUGGUGGCCACCAAUGGUGACACUCACCUUGGAGGUGAAGACUUUGAUCAGCGCGUCAUGGAACACUUCAUCAAGCUAUACAAGAAGAAGACUGGCAAAGACGUGCGCAAAGACAA
+.(((((..(.(((.((((.((((.....)))))))).))).)..))))).....((((((((((((....)))))...((((..(........)..))))...))))))).......... ( -36.70, z-score =  -1.77, R)
+>danRer1.chr11/120-240
+UGAAGUGGUGGCCACAAACGGAGACACUCACCUGGGCGGAGAAGACUUCGACCAGCGCGUCAUGGAGCACUUCAUCAAGCUGUACAAGAAGAAGACGGGCAAAGAUGUGCGCAAAGACAA
+....((((((.((......))...))).))).(((.(((((....))))).)))((((((((((((....)))))....((((.(........))))).....))))))).......... ( -31.10, z-score =   0.50, R)
+>consensus
+UGAAGUGGUGGCCACUAAUGGAGACACUCACCUGGGUGGAGAAGACUUUGACCAGCGUGUCAUGGAACACUUCAUCAAACUGUACAAAAAGAAGACUGGCAAAGAUGUCAGGAAAGACAA
+((((((..(..(((((...((.(.....).))..)))))..)..))))))....((.(((((((((....)))))....((........))..)))).)).....((((......)))). (-17.18 = -17.27 +   0.09) 
+
+############################  RNAz 2.1  ##############################
+
+ Sequences: 6
+ Columns: 120
+ Reading direction: reverse
+ Mean pairwise identity:  85.83
+ Shannon entropy: 0.26644
+ G+C content: 0.46111
+ Mean single sequence MFE: -23.40
+ Consensus MFE:  -9.31
+ Energy contribution:  -9.48
+ Covariance contribution:   0.17
+ Combinations/Pair:   1.36
+ Mean z-score:   0.40
+ Structure conservation index:   0.40
+ Background model: dinucleotide
+ Decision model: sequence based alignment quality
+ SVM decision value:  -7.30
+ SVM RNA-class probability: 0.000000
+ Prediction: OTHER
+
+######################################################################
+
+>hg17.chr1/120-240
+UUGUCUUUCCUGACAUCUUUGCCAGUCUUCUUUUUGUACAGUUUGAUGAAGUGUUCCAUGACACGCUGGUCAAAGUCUUCUCCACCCAGAUAAGUAUCUCCAUUAGUGGCCACAACUUUG
+.((((......)))).....((((((............((......))..(((((....)))))))))))((((((.....((((..((((....))))......)))).....)))))) ( -22.90, z-score =  -0.12, R)
+>panTro1.chr1/120-240
+UUGUCUUUCCCGACAUCUUUGCCAGUCUUCUUUUUGUACAGUUUGAUGAAGUGUUCCAUGACAUGCUGGUCAAAGUCUUUUCCACCCAGAUGAGUAUCUCCAUUAGUGACCACAACUUUG
+.((((......)))).((((((((((((((.................))))((((....)))).))))).))))).......(((...((((........)))).)))............ ( -18.53, z-score =   1.10, R)
+>rn3.chr3/120-240
+UUGUCCUUUCUGACAUCUUUCCCAGUCUUCUUUUUGUACAGCUUGAUGAAGUGCUCCAUGACCCGCUGAUCAAAGUCUUCCCCACCCAGAUGAGUGUCUCCAUUAGUGGCCACCACUUCA
+.((((......))))...............................(((((((..((((((..((((.(((.................))).))))..)).....))))....))))))) ( -19.43, z-score =   0.66, R)
+>galGal2.chr17/120-240
+UUAUCCUUCCUGACAUCUUUUCCUGUUUUCUUCUUGUAGAGUUUGAUGAAGUGCUCCAUAACACGCUGGUCAAAGUCUUCUCCACCCAGGUGUGUGUCACCAUUUGUAGCCACAACUUCA
+..........((((((.....((((............(((.((((((.(.(((........)))..).)))))).)))........))))...))))))....((((....))))..... ( -20.75, z-score =   0.35, R)
+>fr1.chrUn/120-240
+UUGUCUUUGCGCACGUCUUUGCCAGUCUUCUUCUUGUAUAGCUUGAUGAAGUGUUCCAUGACGCGCUGAUCAAAGUCUUCACCUCCAAGGUGAGUGUCACCAUUGGUGGCCACCACUUCA
+..(.(((((.((.((((..((.....((((.((..(.....)..)).)))).....)).)))).))....))))).).(((((.....)))))((((((((...))))).)))....... ( -31.40, z-score =  -0.65, R)
+>danRer1.chr11/120-240
+UUGUCUUUGCGCACAUCUUUGCCCGUCUUCUUCUUGUACAGCUUGAUGAAGUGCUCCAUGACGCGCUGGUCGAAGUCUUCUCCGCCCAGGUGAGUGUCUCCGUUUGUGGCCACCACUUCA
+..(((...(((((......)))..(((........).)).))..)))((((((..(((((((((.((((.((.((....)).)).))))....))))).......))))....)))))). ( -27.41, z-score =   1.03, R)
+>consensus
+UUGUCUUUCCUGACAUCUUUGCCAGUCUUCUUCUUGUACAGCUUGAUGAAGUGCUCCAUGACACGCUGGUCAAAGUCUUCUCCACCCAGAUGAGUGUCUCCAUUAGUGGCCACAACUUCA
+.((((......))))...........................(((((..(((((........))))).)))))(((.....((((...((((........)))).)))).....)))... ( -9.31 =  -9.48 +   0.17) 
+
+############################  RNAz 2.1  ##############################
+
+ Sequences: 6
+ Columns: 120
+ Reading direction: forward
+ Mean pairwise identity:  85.83
+ Shannon entropy: 0.26644
+ G+C content: 0.46111
+ Mean single sequence MFE: -23.40
+ Consensus MFE:  -9.31
+ Energy contribution:  -9.48
+ Covariance contribution:   0.17
+ Combinations/Pair:   1.36
+ Mean z-score:   0.40
+ Structure conservation index:   0.40
+ Background model: dinucleotide
+ Decision model: sequence based alignment quality
+ SVM decision value:  -7.30
+ SVM RNA-class probability: 0.000000
+ Prediction: OTHER
+
+######################################################################
+
+>hg17.chr1_rev/120-240
+UUGUCUUUCCUGACAUCUUUGCCAGUCUUCUUUUUGUACAGUUUGAUGAAGUGUUCCAUGACACGCUGGUCAAAGUCUUCUCCACCCAGAUAAGUAUCUCCAUUAGUGGCCACAACUUUG
+.((((......)))).....((((((............((......))..(((((....)))))))))))((((((.....((((..((((....))))......)))).....)))))) ( -22.90, z-score =  -0.12, R)
+>panTro1.chr1_rev/120-240
+UUGUCUUUCCCGACAUCUUUGCCAGUCUUCUUUUUGUACAGUUUGAUGAAGUGUUCCAUGACAUGCUGGUCAAAGUCUUUUCCACCCAGAUGAGUAUCUCCAUUAGUGACCACAACUUUG
+.((((......)))).((((((((((((((.................))))((((....)))).))))).))))).......(((...((((........)))).)))............ ( -18.53, z-score =   1.10, R)
+>rn3.chr3_rev/120-240
+UUGUCCUUUCUGACAUCUUUCCCAGUCUUCUUUUUGUACAGCUUGAUGAAGUGCUCCAUGACCCGCUGAUCAAAGUCUUCCCCACCCAGAUGAGUGUCUCCAUUAGUGGCCACCACUUCA
+.((((......))))...............................(((((((..((((((..((((.(((.................))).))))..)).....))))....))))))) ( -19.43, z-score =   0.66, R)
+>galGal2.chr17_rev/120-240
+UUAUCCUUCCUGACAUCUUUUCCUGUUUUCUUCUUGUAGAGUUUGAUGAAGUGCUCCAUAACACGCUGGUCAAAGUCUUCUCCACCCAGGUGUGUGUCACCAUUUGUAGCCACAACUUCA
+..........((((((.....((((............(((.((((((.(.(((........)))..).)))))).)))........))))...))))))....((((....))))..... ( -20.75, z-score =   0.35, R)
+>fr1.chrUn_rev/120-240
+UUGUCUUUGCGCACGUCUUUGCCAGUCUUCUUCUUGUAUAGCUUGAUGAAGUGUUCCAUGACGCGCUGAUCAAAGUCUUCACCUCCAAGGUGAGUGUCACCAUUGGUGGCCACCACUUCA
+..(.(((((.((.((((..((.....((((.((..(.....)..)).)))).....)).)))).))....))))).).(((((.....)))))((((((((...))))).)))....... ( -31.40, z-score =  -0.65, R)
+>danRer1.chr11_rev/120-240
+UUGUCUUUGCGCACAUCUUUGCCCGUCUUCUUCUUGUACAGCUUGAUGAAGUGCUCCAUGACGCGCUGGUCGAAGUCUUCUCCGCCCAGGUGAGUGUCUCCGUUUGUGGCCACCACUUCA
+..(((...(((((......)))..(((........).)).))..)))((((((..(((((((((.((((.((.((....)).)).))))....))))).......))))....)))))). ( -27.41, z-score =   1.03, R)
+>consensus
+UUGUCUUUCCUGACAUCUUUGCCAGUCUUCUUCUUGUACAGCUUGAUGAAGUGCUCCAUGACACGCUGGUCAAAGUCUUCUCCACCCAGAUGAGUGUCUCCAUUAGUGGCCACAACUUCA
+.((((......))))...........................(((((..(((((........))))).)))))(((.....((((...((((........)))).)))).....)))... ( -9.31 =  -9.48 +   0.17) 
+
+############################  RNAz 2.1  ##############################
+
+ Sequences: 6
+ Columns: 120
+ Reading direction: reverse
+ Mean pairwise identity:  85.83
+ Shannon entropy: 0.26644
+ G+C content: 0.46111
+ Mean single sequence MFE: -29.08
+ Consensus MFE: -17.18
+ Energy contribution: -17.27
+ Covariance contribution:   0.09
+ Combinations/Pair:   1.38
+ Mean z-score:  -0.03
+ Structure conservation index:   0.59
+ Background model: dinucleotide
+ Decision model: sequence based alignment quality
+ SVM decision value:  -4.58
+ SVM RNA-class probability: 0.000000
+ Prediction: OTHER
+
+######################################################################
+
+>hg17.chr1_rev/120-240
+CAAAGUUGUGGCCACUAAUGGAGAUACUUAUCUGGGUGGAGAAGACUUUGACCAGCGUGUCAUGGAACACUUCAUCAAACUGUACAAAAAGAAGACUGGCAAAGAUGUCAGGAAAGACAA
+(((((((....(((((...(((........))).)))))....))))))).......((((........((((.................)))).((((((....))))))....)))). ( -29.23, z-score =  -0.65, R)
+>panTro1.chr1_rev/120-240
+CAAAGUUGUGGUCACUAAUGGAGAUACUCAUCUGGGUGGAAAAGACUUUGACCAGCAUGUCAUGGAACACUUCAUCAAACUGUACAAAAAGAAGACUGGCAAAGAUGUCGGGAAAGACAA
+(((((((....(((((....(((...))).....)))))....))))))).......((((........((((.................)))).((((((....))))))....)))). ( -26.53, z-score =  -0.03, R)
+>rn3.chr3_rev/120-240
+UGAAGUGGUGGCCACUAAUGGAGACACUCAUCUGGGUGGGGAAGACUUUGAUCAGCGGGUCAUGGAGCACUUCAUCAAGCUGUACAAAAAGAAGACUGGGAAAGAUGUCAGAAAGGACAA
+(((((((((((((.....((....))(((((....))))).................))))))....)))))))(((..((...........))..)))......((((......)))). ( -26.70, z-score =   0.92, R)
+>galGal2.chr17_rev/120-240
+UGAAGUUGUGGCUACAAAUGGUGACACACACCUGGGUGGAGAAGACUUUGACCAGCGUGUUAUGGAGCACUUCAUCAAACUCUACAAGAAGAAAACAGGAAAAGAUGUCAGGAAGGAUAA
+((((((.((..(((....((....)).((((((((..((((....))))..)))).))))..))).))))))))...............................((((......)))). ( -24.20, z-score =   0.87, R)
+>fr1.chrUn_rev/120-240
+UGAAGUGGUGGCCACCAAUGGUGACACUCACCUUGGAGGUGAAGACUUUGAUCAGCGCGUCAUGGAACACUUCAUCAAGCUAUACAAGAAGAAGACUGGCAAAGACGUGCGCAAAGACAA
+.(((((..(.(((.((((.((((.....)))))))).))).)..))))).....((((((((((((....)))))...((((..(........)..))))...))))))).......... ( -36.70, z-score =  -1.77, R)
+>danRer1.chr11_rev/120-240
+UGAAGUGGUGGCCACAAACGGAGACACUCACCUGGGCGGAGAAGACUUCGACCAGCGCGUCAUGGAGCACUUCAUCAAGCUGUACAAGAAGAAGACGGGCAAAGAUGUGCGCAAAGACAA
+....((((((.((......))...))).))).(((.(((((....))))).)))((((((((((((....)))))....((((.(........))))).....))))))).......... ( -31.10, z-score =   0.50, R)
+>consensus
+UGAAGUGGUGGCCACUAAUGGAGACACUCACCUGGGUGGAGAAGACUUUGACCAGCGUGUCAUGGAACACUUCAUCAAACUGUACAAAAAGAAGACUGGCAAAGAUGUCAGGAAAGACAA
+((((((..(..(((((...((.(.....).))..)))))..)..))))))....((.(((((((((....)))))....((........))..)))).)).....((((......)))). (-17.18 = -17.27 +   0.09) 
+
+############################  RNAz 2.1  ##############################
+
+ Sequences: 6
+ Columns: 120
+ Reading direction: forward
+ Mean pairwise identity:  80.00
+ Shannon entropy: 0.37687
+ G+C content: 0.50603
+ Mean single sequence MFE: -34.52
+ Consensus MFE: -15.70
+ Energy contribution: -14.52
+ Covariance contribution:  -1.19
+ Combinations/Pair:   1.43
+ Mean z-score:   0.11
+ Structure conservation index:   0.45
+ Background model: dinucleotide
+ Decision model: sequence based alignment quality
+ SVM decision value:  -4.92
+ SVM RNA-class probability: 0.000000
+ Prediction: OTHER
+
+######################################################################
+
+>hg17.chr1/240-360
+UAGAGCUGUGCAGAAACUCUGGCGCAAGGUAGAAAAGGCCAAACGGGCCCUGUCUUCUCAACAUCAAGCAAGCAGUAAUUGAAAUUGAGUCCUUCUAUGAAGGAGAAGACUUUUCUGAGA
+..........((((((.((((.(....).))))...((((.....))))..((((((((((..((((((.....))..))))..)))).((((((...)))))))))))).))))))... ( -35.40, z-score =  -1.05, R)
+>mm5.chr2/240-360
+CAGAGCUGUGCAGAAACUCCGGCGUGAGGUAGAAAAGGCUAAGAGAGCCUUGUCUUCUCAGCAUCAAGCAAG----GAUUGAAAUUGAGUCCUUCUUCGAAGGAGAAGACUUCUCAGAGA
+.....((.((.((((.((((.((.(((((.(((.((((((.....)))))).)))))))))).(((((.(((----((((.......)))))))))).)).)))).....)))))).)). ( -37.30, z-score =  -0.73, R)
+>rn3.chr3/240-360
+CAGAGCUGUGCAGAAACUCCGGCGUGAGGUAGAAAAGGCCAAGAGAGCCCUGUCUUCUCAGCAUCAAGCGAG----GAUUGAAAUUGAGUCCUUCUUCGAAGGAGAAGACUUCUCAGAGA
+.....((.((.((((.(((.(((.(..........).)))..)))......((((((((....(((((.(((----((((.......)))))))))).))..)))))))))))))).)). ( -32.50, z-score =   0.75, R)
+>galGal2.chr17/240-360
+CAGAGCUGUACAGAAACUAAGACGGGAAGUAGAGAAAGCGAAGCGGGCCCUGUCAUCCCAGCACCAAGCUAG----AAUUGAAAUAGAAUCCUUUUUUGAAGGAGAGGAUUUCUCUGAGA
+(((((((((..............((((.((((.(...((...))...).))).).))))(((.....)))..----.......))))((((((((((....)))))))))).)))))... ( -27.10, z-score =   0.14, R)
+>fr1.chrUn/240-360
+CCGUGCUGUCCAGAAGCUGCGUCGUGAGGUUGAGAAGGCAAAGAGGGCCCUGUCUGCCCAGCACCAGGCCCG----CAUUGAGAUCGAGUCUUUCUUUGAGGGAGAAGAUUUCUCCGAGA
+..((((.........(((...(((......)))...))).....(((((.((..(((...))).))))))))----))).((((((...(((..(.....)..))).))))))....... ( -32.90, z-score =   1.69, R)
+>danRer1.chr11/240-360
+CCGCGCCGUGCAGAAGCUGCGCAGAGAGGUGGAGAAGGCUAAGAGAGCCCUGUCUGCCCAGCAUCAGGCCCG----CAUCGAGAUCGAGUCCUUCUUUGAGGGAGAAGAUUUCUCUGAGA
+.((.(((((((((...))))))...(.((..((.(.((((.....)))).).))..))).......))).))----((..((((((...((((((...))))))...))))))..))... ( -41.90, z-score =  -0.14, R)
+>consensus
+CAGAGCUGUGCAGAAACUCCGGCGUGAGGUAGAAAAGGCCAAGAGAGCCCUGUCUUCCCAGCAUCAAGCAAG____AAUUGAAAUUGAGUCCUUCUUUGAAGGAGAAGACUUCUCUGAGA
+....(((((((....(((.(.....).))).((.(.(((.......))).).))......))))..)))...........(((.((...((((((...))))))...)).)))....... (-15.70 = -14.52 +  -1.19) 
+
+############################  RNAz 2.1  ##############################
+
+ Sequences: 6
+ Columns: 120
+ Reading direction: reverse
+ Mean pairwise identity:  80.00
+ Shannon entropy: 0.37687
+ G+C content: 0.50603
+ Mean single sequence MFE: -31.38
+ Consensus MFE: -17.15
+ Energy contribution: -16.27
+ Covariance contribution:  -0.88
+ Combinations/Pair:   1.50
+ Mean z-score:   0.17
+ Structure conservation index:   0.55
+ Background model: dinucleotide
+ Decision model: sequence based alignment quality
+ SVM decision value:  -4.07
+ SVM RNA-class probability: 0.000000
+ Prediction: OTHER
+
+######################################################################
+
+>hg17.chr1/240-360
+UCUCAGAAAAGUCUUCUCCUUCAUAGAAGGACUCAAUUUCAAUUACUGCUUGCUUGAUGUUGAGAAGACAGGGCCCGUUUGGCCUUUUCUACCUUGCGCCAGAGUUUCUGCACAGCUCUA
+....((((((((((((((((((...)))))).(((((.((((.((.....)).)))).)))))))))))..((((.....))))))))))..........((((((.......)))))). ( -33.30, z-score =  -1.00, R)
+>mm5.chr2/240-360
+UCUCUGAGAAGUCUUCUCCUUCGAAGAAGGACUCAAUUUCAAUC----CUUGCUUGAUGCUGAGAAGACAAGGCUCUCUUAGCCUUUUCUACCUCACGCCGGAGUUUCUGCACAGCUCUG
+....((((..((((((((..((((..(((((...........))----)))..))))....))))))))((((((.....))))))......))))...(((((((.......))))))) ( -33.90, z-score =  -1.12, R)
+>rn3.chr3/240-360
+UCUCUGAGAAGUCUUCUCCUUCGAAGAAGGACUCAAUUUCAAUC----CUCGCUUGAUGCUGAGAAGACAGGGCUCUCUUGGCCUUUUCUACCUCACGCCGGAGUUUCUGCACAGCUCUG
+....((((..((((((((..((((.((.(((...........))----)))..))))....))))))))((((((.....))))))......))))...(((((((.......))))))) ( -31.90, z-score =   0.19, R)
+>galGal2.chr17/240-360
+UCUCAGAGAAAUCCUCUCCUUCAAAAAAGGAUUCUAUUUCAAUU----CUAGCUUGGUGCUGGGAUGACAGGGCCCGCUUCGCUUUCUCUACUUCCCGUCUUAGUUUCUGUACAGCUCUG
+.......(((((....(((((.....)))))....))))).(((----(((((.....))))))))..((((((..((...(((....(........)....)))....))...)))))) ( -23.50, z-score =   0.63, R)
+>fr1.chrUn/240-360
+UCUCGGAGAAAUCUUCUCCCUCAAAGAAAGACUCGAUCUCAAUG----CGGGCCUGGUGCUGGGCAGACAGGGCCCUCUUUGCCUUCUCAACCUCACGACGCAGCUUCUGGACAGCACGG
+....(((((.....))))).........((.((((.........----)))).)).((((((((((((.((....)).)))))).................(((...)))..)))))).. ( -29.50, z-score =   1.62, R)
+>danRer1.chr11/240-360
+UCUCAGAGAAAUCUUCUCCCUCAAAGAAGGACUCGAUCUCGAUG----CGGGCCUGAUGCUGGGCAGACAGGGCUCUCUUAGCCUUCUCCACCUCUCUGCGCAGCUUCUGCACGGCGCGG
+.....(((...((((((.......)))))).))).....((.((----(.(((..((.((((.(((((.((((((.....)))))).........))))).)))).)).)).).))))). ( -36.20, z-score =   0.69, R)
+>consensus
+UCUCAGAGAAAUCUUCUCCUUCAAAGAAGGACUCAAUUUCAAUC____CUGGCUUGAUGCUGAGAAGACAGGGCCCUCUUAGCCUUCUCUACCUCACGCCGGAGUUUCUGCACAGCUCUG
+.....((((((((((((.......)).))))))...))))..................((((....((.((((((.....)))))).))..............((....)).)))).... (-17.15 = -16.27 +  -0.88) 
+
+############################  RNAz 2.1  ##############################
+
+ Sequences: 6
+ Columns: 120
+ Reading direction: forward
+ Mean pairwise identity:  80.00
+ Shannon entropy: 0.37687
+ G+C content: 0.50603
+ Mean single sequence MFE: -31.38
+ Consensus MFE: -17.15
+ Energy contribution: -16.27
+ Covariance contribution:  -0.88
+ Combinations/Pair:   1.50
+ Mean z-score:   0.17
+ Structure conservation index:   0.55
+ Background model: dinucleotide
+ Decision model: sequence based alignment quality
+ SVM decision value:  -4.07
+ SVM RNA-class probability: 0.000000
+ Prediction: OTHER
+
+######################################################################
+
+>hg17.chr1_rev/240-360
+UCUCAGAAAAGUCUUCUCCUUCAUAGAAGGACUCAAUUUCAAUUACUGCUUGCUUGAUGUUGAGAAGACAGGGCCCGUUUGGCCUUUUCUACCUUGCGCCAGAGUUUCUGCACAGCUCUA
+....((((((((((((((((((...)))))).(((((.((((.((.....)).)))).)))))))))))..((((.....))))))))))..........((((((.......)))))). ( -33.30, z-score =  -1.00, R)
+>mm5.chr2_rev/240-360
+UCUCUGAGAAGUCUUCUCCUUCGAAGAAGGACUCAAUUUCAAUC----CUUGCUUGAUGCUGAGAAGACAAGGCUCUCUUAGCCUUUUCUACCUCACGCCGGAGUUUCUGCACAGCUCUG
+....((((..((((((((..((((..(((((...........))----)))..))))....))))))))((((((.....))))))......))))...(((((((.......))))))) ( -33.90, z-score =  -1.12, R)
+>rn3.chr3_rev/240-360
+UCUCUGAGAAGUCUUCUCCUUCGAAGAAGGACUCAAUUUCAAUC----CUCGCUUGAUGCUGAGAAGACAGGGCUCUCUUGGCCUUUUCUACCUCACGCCGGAGUUUCUGCACAGCUCUG
+....((((..((((((((..((((.((.(((...........))----)))..))))....))))))))((((((.....))))))......))))...(((((((.......))))))) ( -31.90, z-score =   0.19, R)
+>galGal2.chr17_rev/240-360
+UCUCAGAGAAAUCCUCUCCUUCAAAAAAGGAUUCUAUUUCAAUU----CUAGCUUGGUGCUGGGAUGACAGGGCCCGCUUCGCUUUCUCUACUUCCCGUCUUAGUUUCUGUACAGCUCUG
+.......(((((....(((((.....)))))....))))).(((----(((((.....))))))))..((((((..((...(((....(........)....)))....))...)))))) ( -23.50, z-score =   0.63, R)
+>fr1.chrUn_rev/240-360
+UCUCGGAGAAAUCUUCUCCCUCAAAGAAAGACUCGAUCUCAAUG----CGGGCCUGGUGCUGGGCAGACAGGGCCCUCUUUGCCUUCUCAACCUCACGACGCAGCUUCUGGACAGCACGG
+....(((((.....))))).........((.((((.........----)))).)).((((((((((((.((....)).)))))).................(((...)))..)))))).. ( -29.50, z-score =   1.62, R)
+>danRer1.chr11_rev/240-360
+UCUCAGAGAAAUCUUCUCCCUCAAAGAAGGACUCGAUCUCGAUG----CGGGCCUGAUGCUGGGCAGACAGGGCUCUCUUAGCCUUCUCCACCUCUCUGCGCAGCUUCUGCACGGCGCGG
+.....(((...((((((.......)))))).))).....((.((----(.(((..((.((((.(((((.((((((.....)))))).........))))).)))).)).)).).))))). ( -36.20, z-score =   0.69, R)
+>consensus
+UCUCAGAGAAAUCUUCUCCUUCAAAGAAGGACUCAAUUUCAAUC____CUGGCUUGAUGCUGAGAAGACAGGGCCCUCUUAGCCUUCUCUACCUCACGCCGGAGUUUCUGCACAGCUCUG
+.....((((((((((((.......)).))))))...))))..................((((....((.((((((.....)))))).))..............((....)).)))).... (-17.15 = -16.27 +  -0.88) 
+
+############################  RNAz 2.1  ##############################
+
+ Sequences: 6
+ Columns: 120
+ Reading direction: reverse
+ Mean pairwise identity:  80.00
+ Shannon entropy: 0.37687
+ G+C content: 0.50603
+ Mean single sequence MFE: -34.52
+ Consensus MFE: -15.70
+ Energy contribution: -14.52
+ Covariance contribution:  -1.19
+ Combinations/Pair:   1.43
+ Mean z-score:   0.11
+ Structure conservation index:   0.45
+ Background model: dinucleotide
+ Decision model: sequence based alignment quality
+ SVM decision value:  -4.92
+ SVM RNA-class probability: 0.000000
+ Prediction: OTHER
+
+######################################################################
+
+>hg17.chr1_rev/240-360
+UAGAGCUGUGCAGAAACUCUGGCGCAAGGUAGAAAAGGCCAAACGGGCCCUGUCUUCUCAACAUCAAGCAAGCAGUAAUUGAAAUUGAGUCCUUCUAUGAAGGAGAAGACUUUUCUGAGA
+..........((((((.((((.(....).))))...((((.....))))..((((((((((..((((((.....))..))))..)))).((((((...)))))))))))).))))))... ( -35.40, z-score =  -1.05, R)
+>mm5.chr2_rev/240-360
+CAGAGCUGUGCAGAAACUCCGGCGUGAGGUAGAAAAGGCUAAGAGAGCCUUGUCUUCUCAGCAUCAAGCAAG----GAUUGAAAUUGAGUCCUUCUUCGAAGGAGAAGACUUCUCAGAGA
+.....((.((.((((.((((.((.(((((.(((.((((((.....)))))).)))))))))).(((((.(((----((((.......)))))))))).)).)))).....)))))).)). ( -37.30, z-score =  -0.73, R)
+>rn3.chr3_rev/240-360
+CAGAGCUGUGCAGAAACUCCGGCGUGAGGUAGAAAAGGCCAAGAGAGCCCUGUCUUCUCAGCAUCAAGCGAG----GAUUGAAAUUGAGUCCUUCUUCGAAGGAGAAGACUUCUCAGAGA
+.....((.((.((((.(((.(((.(..........).)))..)))......((((((((....(((((.(((----((((.......)))))))))).))..)))))))))))))).)). ( -32.50, z-score =   0.75, R)
+>galGal2.chr17_rev/240-360
+CAGAGCUGUACAGAAACUAAGACGGGAAGUAGAGAAAGCGAAGCGGGCCCUGUCAUCCCAGCACCAAGCUAG----AAUUGAAAUAGAAUCCUUUUUUGAAGGAGAGGAUUUCUCUGAGA
+(((((((((..............((((.((((.(...((...))...).))).).))))(((.....)))..----.......))))((((((((((....)))))))))).)))))... ( -27.10, z-score =   0.14, R)
+>fr1.chrUn_rev/240-360
+CCGUGCUGUCCAGAAGCUGCGUCGUGAGGUUGAGAAGGCAAAGAGGGCCCUGUCUGCCCAGCACCAGGCCCG----CAUUGAGAUCGAGUCUUUCUUUGAGGGAGAAGAUUUCUCCGAGA
+..((((.........(((...(((......)))...))).....(((((.((..(((...))).))))))))----))).((((((...(((..(.....)..))).))))))....... ( -32.90, z-score =   1.69, R)
+>danRer1.chr11_rev/240-360
+CCGCGCCGUGCAGAAGCUGCGCAGAGAGGUGGAGAAGGCUAAGAGAGCCCUGUCUGCCCAGCAUCAGGCCCG----CAUCGAGAUCGAGUCCUUCUUUGAGGGAGAAGAUUUCUCUGAGA
+.((.(((((((((...))))))...(.((..((.(.((((.....)))).).))..))).......))).))----((..((((((...((((((...))))))...))))))..))... ( -41.90, z-score =  -0.14, R)
+>consensus
+CAGAGCUGUGCAGAAACUCCGGCGUGAGGUAGAAAAGGCCAAGAGAGCCCUGUCUUCCCAGCAUCAAGCAAG____AAUUGAAAUUGAGUCCUUCUUUGAAGGAGAAGACUUCUCUGAGA
+....(((((((....(((.(.....).))).((.(.(((.......))).).))......))))..)))...........(((.((...((((((...))))))...)).)))....... (-15.70 = -14.52 +  -1.19) 
+
+############################  RNAz 2.1  ##############################
+
+ Sequences: 6
+ Columns: 120
+ Reading direction: forward
+ Mean pairwise identity:  82.22
+ Shannon entropy: 0.33146
+ G+C content: 0.47735
+ Mean single sequence MFE: -32.55
+ Consensus MFE: -18.57
+ Energy contribution: -18.10
+ Covariance contribution:  -0.47
+ Combinations/Pair:   1.42
+ Mean z-score:  -0.11
+ Structure conservation index:   0.57
+ Background model: dinucleotide
+ Decision model: sequence based alignment quality
+ SVM decision value:  -3.82
+ SVM RNA-class probability: 0.000001
+ Prediction: OTHER
+
+######################################################################
+
+>hg17.chr1/271-391
+GAAAAGGCCAAACGGGCCCUGUCUUCUCAACAUCAAGCAAGCAGUAAUUGAAAUUGAGUCCUUCUAUGAAGGAGAAGACUUUUCUGAGACCCUGACUCAGGCCAAAUUUGAAGAGCUCAA
+(((((((((.....))))..((((((((((..((((((.....))..))))..)))).((((((...)))))))))))))))))((((..((((...)))).((....)).....)))). ( -30.50, z-score =  -0.31, R)
+>mm5.chr2/271-391
+GAAAAGGCUAAGAGAGCCUUGUCUUCUCAGCAUCAAGCAAG----GAUUGAAAUUGAGUCCUUCUUCGAAGGAGAAGACUUCUCAGAGACCCUUACUCGGGCCAAAUUUGAAGAGCUGAA
+((.((((((.....)))))).))...(((((........((----((((.......))))))((((((((.((((.....))))...(.(((......))).)...))))))))))))). ( -36.20, z-score =  -0.98, R)
+>rn3.chr3/271-391
+GAAAAGGCCAAGAGAGCCCUGUCUUCUCAGCAUCAAGCGAG----GAUUGAAAUUGAGUCCUUCUUCGAAGGAGAAGACUUCUCAGAGACCCUUACUCGGGCCAAAUUUGAAGAGCUGAA
+.....((((..(((((....((((((((....(((((.(((----((((.......)))))))))).))..))))))))))))).(((.......))).))))................. ( -35.10, z-score =  -0.51, R)
+>galGal2.chr17/271-391
+GAGAAAGCGAAGCGGGCCCUGUCAUCCCAGCACCAAGCUAG----AAUUGAAAUAGAAUCCUUUUUUGAAGGAGAGGAUUUCUCUGAGACGCUUACUCGUGCCAAAUUUGAAGAACUGAA
+(((.(((((.(((.((..(((......)))..))..)))..----..........(((((((((((....)))))))))))........))))).)))...................... ( -27.00, z-score =   0.10, R)
+>fr1.chrUn/271-391
+GAGAAGGCAAAGAGGGCCCUGUCUGCCCAGCACCAGGCCCG----CAUUGAGAUCGAGUCUUUCUUUGAGGGAGAAGAUUUCUCCGAGACACUGACCCGUGCCAAAUUUGAAGAGCUUAA
+.....((((....((((..((((((((........))).((----....((((((...(((..(.....)..))).))))))..)))))))..).))).))))................. ( -33.20, z-score =  -0.02, R)
+>danRer1.chr11/271-391
+GAGAAGGCUAAGAGAGCCCUGUCUGCCCAGCAUCAGGCCCG----CAUCGAGAUCGAGUCCUUCUUUGAGGGAGAAGAUUUCUCUGAGACUCUCACCAGAGCCAAGUUUGAAGAGCUCAA
+((((.((((.....))))..(((((((........)))...----((..((((((...((((((...))))))...))))))..))))))))))....(((((.........).)))).. ( -33.30, z-score =   1.06, R)
+>consensus
+GAAAAGGCCAAGAGAGCCCUGUCUUCCCAGCAUCAAGCAAG____AAUUGAAAUUGAGUCCUUCUUUGAAGGAGAAGACUUCUCUGAGACCCUUACUCGGGCCAAAUUUGAAGAGCUGAA
+.....((((....(((....((((((...((.....))....................((((((...))))))))))))..))).(((.......))).))))................. (-18.57 = -18.10 +  -0.47) 
+
+############################  RNAz 2.1  ##############################
+
+ Sequences: 6
+ Columns: 120
+ Reading direction: reverse
+ Mean pairwise identity:  82.22
+ Shannon entropy: 0.33146
+ G+C content: 0.47735
+ Mean single sequence MFE: -33.18
+ Consensus MFE: -22.01
+ Energy contribution: -20.72
+ Covariance contribution:  -1.30
+ Combinations/Pair:   1.48
+ Mean z-score:   0.17
+ Structure conservation index:   0.66
+ Background model: dinucleotide
+ Decision model: sequence based alignment quality
+ SVM decision value:  -3.58
+ SVM RNA-class probability: 0.000003
+ Prediction: OTHER
+
+######################################################################
+
+>hg17.chr1/271-391
+UUGAGCUCUUCAAAUUUGGCCUGAGUCAGGGUCUCAGAAAAGUCUUCUCCUUCAUAGAAGGACUCAAUUUCAAUUACUGCUUGCUUGAUGUUGAGAAGACAGGGCCCGUUUGGCCUUUUC
+((((((((((((.........)))...)))).)))))....((((((((((((...)))))).(((((.((((.((.....)).)))).)))))))))))((((((.....))))))... ( -34.00, z-score =  -0.30, R)
+>mm5.chr2/271-391
+UUCAGCUCUUCAAAUUUGGCCCGAGUAAGGGUCUCUGAGAAGUCUUCUCCUUCGAAGAAGGACUCAAUUUCAAUC----CUUGCUUGAUGCUGAGAAGACAAGGCUCUCUUAGCCUUUUC
+....(.(((((....(..((.(((((((((((...((((...(((((......)))))....))))......)))----))))))))..))..)))))))((((((.....))))))... ( -35.10, z-score =  -0.81, R)
+>rn3.chr3/271-391
+UUCAGCUCUUCAAAUUUGGCCCGAGUAAGGGUCUCUGAGAAGUCUUCUCCUUCGAAGAAGGACUCAAUUUCAAUC----CUCGCUUGAUGCUGAGAAGACAGGGCUCUCUUGGCCUUUUC
+((((((...((((....(((((......))))).....(((((....((((((...))))))....)))))....----.....)))).))))))..((.((((((.....)))))).)) ( -34.40, z-score =   0.10, R)
+>galGal2.chr17/271-391
+UUCAGUUCUUCAAAUUUGGCACGAGUAAGCGUCUCAGAGAAAUCCUCUCCUUCAAAAAAGGAUUCUAUUUCAAUU----CUAGCUUGGUGCUGGGAUGACAGGGCCCGCUUCGCUUUCUC
+....((.((........)).))(((((((((.(((...(((((....(((((.....)))))....))))).(((----(((((.....))))))))....)))..))))).)))).... ( -27.00, z-score =   0.33, R)
+>fr1.chrUn/271-391
+UUAAGCUCUUCAAAUUUGGCACGGGUCAGUGUCUCGGAGAAAUCUUCUCCCUCAAAGAAAGACUCGAUCUCAAUG----CGGGCCUGGUGCUGGGCAGACAGGGCCCUCUUUGCCUUCUC
+.................((((((((((....(((.(((((.....))))).....)))..)))))).........----.((((((.((.((....)))).))))))....))))..... ( -34.20, z-score =   0.29, R)
+>danRer1.chr11/271-391
+UUGAGCUCUUCAAACUUGGCUCUGGUGAGAGUCUCAGAGAAAUCUUCUCCCUCAAAGAAGGACUCGAUCUCGAUG----CGGGCCUGAUGCUGGGCAGACAGGGCUCUCUUAGCCUUCUC
+..(((((..........))))).(((((((((((.(((....)))((((((....(..(((.((((((....)).----)))))))..)...))).)))..))))))))...)))..... ( -34.40, z-score =   1.40, R)
+>consensus
+UUCAGCUCUUCAAAUUUGGCCCGAGUAAGGGUCUCAGAGAAAUCUUCUCCUUCAAAGAAGGACUCAAUUUCAAUC____CUGGCUUGAUGCUGAGAAGACAGGGCCCUCUUAGCCUUCUC
+...(((...(((.....(((((......)))))...((((((((((((.......)).))))))...))))..............))).))).....((.((((((.....)))))).)) (-22.01 = -20.72 +  -1.30) 
+
+############################  RNAz 2.1  ##############################
+
+ Sequences: 6
+ Columns: 120
+ Reading direction: forward
+ Mean pairwise identity:  82.22
+ Shannon entropy: 0.33146
+ G+C content: 0.47735
+ Mean single sequence MFE: -33.18
+ Consensus MFE: -22.01
+ Energy contribution: -20.72
+ Covariance contribution:  -1.30
+ Combinations/Pair:   1.48
+ Mean z-score:   0.17
+ Structure conservation index:   0.66
+ Background model: dinucleotide
+ Decision model: sequence based alignment quality
+ SVM decision value:  -3.58
+ SVM RNA-class probability: 0.000003
+ Prediction: OTHER
+
+######################################################################
+
+>hg17.chr1_rev/271-391
+UUGAGCUCUUCAAAUUUGGCCUGAGUCAGGGUCUCAGAAAAGUCUUCUCCUUCAUAGAAGGACUCAAUUUCAAUUACUGCUUGCUUGAUGUUGAGAAGACAGGGCCCGUUUGGCCUUUUC
+((((((((((((.........)))...)))).)))))....((((((((((((...)))))).(((((.((((.((.....)).)))).)))))))))))((((((.....))))))... ( -34.00, z-score =  -0.30, R)
+>mm5.chr2_rev/271-391
+UUCAGCUCUUCAAAUUUGGCCCGAGUAAGGGUCUCUGAGAAGUCUUCUCCUUCGAAGAAGGACUCAAUUUCAAUC----CUUGCUUGAUGCUGAGAAGACAAGGCUCUCUUAGCCUUUUC
+....(.(((((....(..((.(((((((((((...((((...(((((......)))))....))))......)))----))))))))..))..)))))))((((((.....))))))... ( -35.10, z-score =  -0.81, R)
+>rn3.chr3_rev/271-391
+UUCAGCUCUUCAAAUUUGGCCCGAGUAAGGGUCUCUGAGAAGUCUUCUCCUUCGAAGAAGGACUCAAUUUCAAUC----CUCGCUUGAUGCUGAGAAGACAGGGCUCUCUUGGCCUUUUC
+((((((...((((....(((((......))))).....(((((....((((((...))))))....)))))....----.....)))).))))))..((.((((((.....)))))).)) ( -34.40, z-score =   0.10, R)
+>galGal2.chr17_rev/271-391
+UUCAGUUCUUCAAAUUUGGCACGAGUAAGCGUCUCAGAGAAAUCCUCUCCUUCAAAAAAGGAUUCUAUUUCAAUU----CUAGCUUGGUGCUGGGAUGACAGGGCCCGCUUCGCUUUCUC
+....((.((........)).))(((((((((.(((...(((((....(((((.....)))))....))))).(((----(((((.....))))))))....)))..))))).)))).... ( -27.00, z-score =   0.33, R)
+>fr1.chrUn_rev/271-391
+UUAAGCUCUUCAAAUUUGGCACGGGUCAGUGUCUCGGAGAAAUCUUCUCCCUCAAAGAAAGACUCGAUCUCAAUG----CGGGCCUGGUGCUGGGCAGACAGGGCCCUCUUUGCCUUCUC
+.................((((((((((....(((.(((((.....))))).....)))..)))))).........----.((((((.((.((....)))).))))))....))))..... ( -34.20, z-score =   0.29, R)
+>danRer1.chr11_rev/271-391
+UUGAGCUCUUCAAACUUGGCUCUGGUGAGAGUCUCAGAGAAAUCUUCUCCCUCAAAGAAGGACUCGAUCUCGAUG----CGGGCCUGAUGCUGGGCAGACAGGGCUCUCUUAGCCUUCUC
+..(((((..........))))).(((((((((((.(((....)))((((((....(..(((.((((((....)).----)))))))..)...))).)))..))))))))...)))..... ( -34.40, z-score =   1.40, R)
+>consensus
+UUCAGCUCUUCAAAUUUGGCCCGAGUAAGGGUCUCAGAGAAAUCUUCUCCUUCAAAGAAGGACUCAAUUUCAAUC____CUGGCUUGAUGCUGAGAAGACAGGGCCCUCUUAGCCUUCUC
+...(((...(((.....(((((......)))))...((((((((((((.......)).))))))...))))..............))).))).....((.((((((.....)))))).)) (-22.01 = -20.72 +  -1.30) 
+
+############################  RNAz 2.1  ##############################
+
+ Sequences: 6
+ Columns: 120
+ Reading direction: reverse
+ Mean pairwise identity:  82.22
+ Shannon entropy: 0.33146
+ G+C content: 0.47735
+ Mean single sequence MFE: -32.55
+ Consensus MFE: -18.57
+ Energy contribution: -18.10
+ Covariance contribution:  -0.47
+ Combinations/Pair:   1.42
+ Mean z-score:  -0.11
+ Structure conservation index:   0.57
+ Background model: dinucleotide
+ Decision model: sequence based alignment quality
+ SVM decision value:  -3.82
+ SVM RNA-class probability: 0.000001
+ Prediction: OTHER
+
+######################################################################
+
+>hg17.chr1_rev/271-391
+GAAAAGGCCAAACGGGCCCUGUCUUCUCAACAUCAAGCAAGCAGUAAUUGAAAUUGAGUCCUUCUAUGAAGGAGAAGACUUUUCUGAGACCCUGACUCAGGCCAAAUUUGAAGAGCUCAA
+(((((((((.....))))..((((((((((..((((((.....))..))))..)))).((((((...)))))))))))))))))((((..((((...)))).((....)).....)))). ( -30.50, z-score =  -0.31, R)
+>mm5.chr2_rev/271-391
+GAAAAGGCUAAGAGAGCCUUGUCUUCUCAGCAUCAAGCAAG----GAUUGAAAUUGAGUCCUUCUUCGAAGGAGAAGACUUCUCAGAGACCCUUACUCGGGCCAAAUUUGAAGAGCUGAA
+((.((((((.....)))))).))...(((((........((----((((.......))))))((((((((.((((.....))))...(.(((......))).)...))))))))))))). ( -36.20, z-score =  -0.98, R)
+>rn3.chr3_rev/271-391
+GAAAAGGCCAAGAGAGCCCUGUCUUCUCAGCAUCAAGCGAG----GAUUGAAAUUGAGUCCUUCUUCGAAGGAGAAGACUUCUCAGAGACCCUUACUCGGGCCAAAUUUGAAGAGCUGAA
+.....((((..(((((....((((((((....(((((.(((----((((.......)))))))))).))..))))))))))))).(((.......))).))))................. ( -35.10, z-score =  -0.51, R)
+>galGal2.chr17_rev/271-391
+GAGAAAGCGAAGCGGGCCCUGUCAUCCCAGCACCAAGCUAG----AAUUGAAAUAGAAUCCUUUUUUGAAGGAGAGGAUUUCUCUGAGACGCUUACUCGUGCCAAAUUUGAAGAACUGAA
+(((.(((((.(((.((..(((......)))..))..)))..----..........(((((((((((....)))))))))))........))))).)))...................... ( -27.00, z-score =   0.10, R)
+>fr1.chrUn_rev/271-391
+GAGAAGGCAAAGAGGGCCCUGUCUGCCCAGCACCAGGCCCG----CAUUGAGAUCGAGUCUUUCUUUGAGGGAGAAGAUUUCUCCGAGACACUGACCCGUGCCAAAUUUGAAGAGCUUAA
+.....((((....((((..((((((((........))).((----....((((((...(((..(.....)..))).))))))..)))))))..).))).))))................. ( -33.20, z-score =  -0.02, R)
+>danRer1.chr11_rev/271-391
+GAGAAGGCUAAGAGAGCCCUGUCUGCCCAGCAUCAGGCCCG----CAUCGAGAUCGAGUCCUUCUUUGAGGGAGAAGAUUUCUCUGAGACUCUCACCAGAGCCAAGUUUGAAGAGCUCAA
+((((.((((.....))))..(((((((........)))...----((..((((((...((((((...))))))...))))))..))))))))))....(((((.........).)))).. ( -33.30, z-score =   1.06, R)
+>consensus
+GAAAAGGCCAAGAGAGCCCUGUCUUCCCAGCAUCAAGCAAG____AAUUGAAAUUGAGUCCUUCUUUGAAGGAGAAGACUUCUCUGAGACCCUUACUCGGGCCAAAUUUGAAGAGCUGAA
+.....((((....(((....((((((...((.....))....................((((((...))))))))))))..))).(((.......))).))))................. (-18.57 = -18.10 +  -0.47) 
M]MHQ}%L+aP>Pl6QiDol!?AP-tBJE( .**D*7.h1MVv='h;3}{{\O>ɺ\E]+c>/8ӟ!2ZcJרIXǔSH}۬;NinwWX+{^z?z= 6΅%c۫ԮsC"9B^G![5\9z\Qbm [fF̽nicg3ݱxΊy =xތ|/Oag3Жi=5ל<yFRi#/iD3Uێ{߈