view test-data/RF01704.fasta @ 35:eeaf989f1024 draft

"planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/sklearn commit e2a5eade6d0e5ddf3a47630381a0ad90d80e8a04"
author bgruening
date Tue, 13 Apr 2021 18:09:01 +0000
parents e0067d9baffc
children
line wrap: on
line source

>CP000097.1/1411351-1411410
CAACGUUCACCUCACAUUUGUGAGGCGCAGACAACCCAGGCCAAGGAACGGGGACCUGGA
>ACNY01000002.1/278641-278580
GAUCGUUCACUUCGCAUCGCGCGAAGCGCAGUUCGCCUCAGGCCAUGGAACGGGGACCUGAG