view test-data/converter_result02.json @ 38:1bd039aca44f draft default tip

"planemo upload for repository commit d970dae980fbe349414fc0889f719d875d999c5b"
author bgruening
date Fri, 27 Aug 2021 09:58:48 +0000
parents e0067d9baffc
line wrap: on
line source

{"directed": false, "graph": {"info": "RNAshapes shape_type=2 energy_range=4 max_num=3", "id": "CP000097.1/1411351-1411410_[_[]_][[]_]", "structure": "....(((..((((((....))))))....)))...(((((((.........)).))))).", "sequence": "CAACGUUCACCUCACAUUUGUGAGGCGCAGACAACCCAGGCCAAGGAACGGGGACCUGGA"}, "nodes": [{"position": 0, "id": 0, "label": "C"}, {"position": 1, "id": 1, "label": "A"}, {"position": 2, "id": 2, "label": "A"}, {"position": 3, "id": 3, "label": "C"}, {"position": 4, "id": 4, "label": "G"}, {"position": 5, "id": 5, "label": "U"}, {"position": 6, "id": 6, "label": "U"}, {"position": 7, "id": 7, "label": "C"}, {"position": 8, "id": 8, "label": "A"}, {"position": 9, "id": 9, "label": "C"}, {"position": 10, "id": 10, "label": "C"}, {"position": 11, "id": 11, "label": "U"}, {"position": 12, "id": 12, "label": "C"}, {"position": 13, "id": 13, "label": "A"}, {"position": 14, "id": 14, "label": "C"}, {"position": 15, "id": 15, "label": "A"}, {"position": 16, "id": 16, "label": "U"}, {"position": 17, "id": 17, "label": "U"}, {"position": 18, "id": 18, "label": "U"}, {"position": 19, "id": 19, "label": "G"}, {"position": 20, "id": 20, "label": "U"}, {"position": 21, "id": 21, "label": "G"}, {"position": 22, "id": 22, "label": "A"}, {"position": 23, "id": 23, "label": "G"}, {"position": 24, "id": 24, "label": "G"}, {"position": 25, "id": 25, "label": "C"}, {"position": 26, "id": 26, "label": "G"}, {"position": 27, "id": 27, "label": "C"}, {"position": 28, "id": 28, "label": "A"}, {"position": 29, "id": 29, "label": "G"}, {"position": 30, "id": 30, "label": "A"}, {"position": 31, "id": 31, "label": "C"}, {"position": 32, "id": 32, "label": "A"}, {"position": 33, "id": 33, "label": "A"}, {"position": 34, "id": 34, "label": "C"}, {"position": 35, "id": 35, "label": "C"}, {"position": 36, "id": 36, "label": "C"}, {"position": 37, "id": 37, "label": "A"}, {"position": 38, "id": 38, "label": "G"}, {"position": 39, "id": 39, "label": "G"}, {"position": 40, "id": 40, "label": "C"}, {"position": 41, "id": 41, "label": "C"}, {"position": 42, "id": 42, "label": "A"}, {"position": 43, "id": 43, "label": "A"}, {"position": 44, "id": 44, "label": "G"}, {"position": 45, "id": 45, "label": "G"}, {"position": 46, "id": 46, "label": "A"}, {"position": 47, "id": 47, "label": "A"}, {"position": 48, "id": 48, "label": "C"}, {"position": 49, "id": 49, "label": "G"}, {"position": 50, "id": 50, "label": "G"}, {"position": 51, "id": 51, "label": "G"}, {"position": 52, "id": 52, "label": "G"}, {"position": 53, "id": 53, "label": "A"}, {"position": 54, "id": 54, "label": "C"}, {"position": 55, "id": 55, "label": "C"}, {"position": 56, "id": 56, "label": "U"}, {"position": 57, "id": 57, "label": "G"}, {"position": 58, "id": 58, "label": "G"}, {"position": 59, "id": 59, "label": "A"}], "links": [{"source": 0, "type": "backbone", "target": 1, "len": 1, "label": "-"}, {"source": 1, "type": "backbone", "target": 2, "len": 1, "label": "-"}, {"source": 2, "type": "backbone", "target": 3, "len": 1, "label": "-"}, {"source": 3, "type": "backbone", "target": 4, "len": 1, "label": "-"}, {"source": 4, "type": "backbone", "target": 5, "len": 1, "label": "-"}, {"source": 4, "type": "basepair", "target": 31, "len": 1, "label": "="}, {"source": 5, "type": "basepair", "target": 30, "len": 1, "label": "="}, {"source": 5, "type": "backbone", "target": 6, "len": 1, "label": "-"}, {"source": 6, "type": "basepair", "target": 29, "len": 1, "label": "="}, {"source": 6, "type": "backbone", "target": 7, "len": 1, "label": "-"}, {"source": 7, "type": "backbone", "target": 8, "len": 1, "label": "-"}, {"source": 8, "type": "backbone", "target": 9, "len": 1, "label": "-"}, {"source": 9, "type": "basepair", "target": 24, "len": 1, "label": "="}, {"source": 9, "type": "backbone", "target": 10, "len": 1, "label": "-"}, {"source": 10, "type": "backbone", "target": 11, "len": 1, "label": "-"}, {"source": 10, "type": "basepair", "target": 23, "len": 1, "label": "="}, {"source": 11, "type": "backbone", "target": 12, "len": 1, "label": "-"}, {"source": 11, "type": "basepair", "target": 22, "len": 1, "label": "="}, {"source": 12, "type": "backbone", "target": 13, "len": 1, "label": "-"}, {"source": 12, "type": "basepair", "target": 21, "len": 1, "label": "="}, {"source": 13, "type": "basepair", "target": 20, "len": 1, "label": "="}, {"source": 13, "type": "backbone", "target": 14, "len": 1, "label": "-"}, {"source": 14, "type": "basepair", "target": 19, "len": 1, "label": "="}, {"source": 14, "type": "backbone", "target": 15, "len": 1, "label": "-"}, {"source": 15, "type": "backbone", "target": 16, "len": 1, "label": "-"}, {"source": 16, "type": "backbone", "target": 17, "len": 1, "label": "-"}, {"source": 17, "type": "backbone", "target": 18, "len": 1, "label": "-"}, {"source": 18, "type": "backbone", "target": 19, "len": 1, "label": "-"}, {"source": 19, "type": "backbone", "target": 20, "len": 1, "label": "-"}, {"source": 20, "type": "backbone", "target": 21, "len": 1, "label": "-"}, {"source": 21, "type": "backbone", "target": 22, "len": 1, "label": "-"}, {"source": 22, "type": "backbone", "target": 23, "len": 1, "label": "-"}, {"source": 23, "type": "backbone", "target": 24, "len": 1, "label": "-"}, {"source": 24, "type": "backbone", "target": 25, "len": 1, "label": "-"}, {"source": 25, "type": "backbone", "target": 26, "len": 1, "label": "-"}, {"source": 26, "type": "backbone", "target": 27, "len": 1, "label": "-"}, {"source": 27, "type": "backbone", "target": 28, "len": 1, "label": "-"}, {"source": 28, "type": "backbone", "target": 29, "len": 1, "label": "-"}, {"source": 29, "type": "backbone", "target": 30, "len": 1, "label": "-"}, {"source": 30, "type": "backbone", "target": 31, "len": 1, "label": "-"}, {"source": 31, "type": "backbone", "target": 32, "len": 1, "label": "-"}, {"source": 32, "type": "backbone", "target": 33, "len": 1, "label": "-"}, {"source": 33, "type": "backbone", "target": 34, "len": 1, "label": "-"}, {"source": 34, "type": "backbone", "target": 35, "len": 1, "label": "-"}, {"source": 35, "type": "backbone", "target": 36, "len": 1, "label": "-"}, {"source": 35, "type": "basepair", "target": 58, "len": 1, "label": "="}, {"source": 36, "type": "basepair", "target": 57, "len": 1, "label": "="}, {"source": 36, "type": "backbone", "target": 37, "len": 1, "label": "-"}, {"source": 37, "type": "basepair", "target": 56, "len": 1, "label": "="}, {"source": 37, "type": "backbone", "target": 38, "len": 1, "label": "-"}, {"source": 38, "type": "basepair", "target": 55, "len": 1, "label": "="}, {"source": 38, "type": "backbone", "target": 39, "len": 1, "label": "-"}, {"source": 39, "type": "backbone", "target": 40, "len": 1, "label": "-"}, {"source": 39, "type": "basepair", "target": 54, "len": 1, "label": "="}, {"source": 40, "type": "backbone", "target": 41, "len": 1, "label": "-"}, {"source": 40, "type": "basepair", "target": 52, "len": 1, "label": "="}, {"source": 41, "type": "backbone", "target": 42, "len": 1, "label": "-"}, {"source": 41, "type": "basepair", "target": 51, "len": 1, "label": "="}, {"source": 42, "type": "backbone", "target": 43, "len": 1, "label": "-"}, {"source": 43, "type": "backbone", "target": 44, "len": 1, "label": "-"}, {"source": 44, "type": "backbone", "target": 45, "len": 1, "label": "-"}, {"source": 45, "type": "backbone", "target": 46, "len": 1, "label": "-"}, {"source": 46, "type": "backbone", "target": 47, "len": 1, "label": "-"}, {"source": 47, "type": "backbone", "target": 48, "len": 1, "label": "-"}, {"source": 48, "type": "backbone", "target": 49, "len": 1, "label": "-"}, {"source": 49, "type": "backbone", "target": 50, "len": 1, "label": "-"}, {"source": 50, "type": "backbone", "target": 51, "len": 1, "label": "-"}, {"source": 51, "type": "backbone", "target": 52, "len": 1, "label": "-"}, {"source": 52, "type": "backbone", "target": 53, "len": 1, "label": "-"}, {"source": 53, "type": "backbone", "target": 54, "len": 1, "label": "-"}, {"source": 54, "type": "backbone", "target": 55, "len": 1, "label": "-"}, {"source": 55, "type": "backbone", "target": 56, "len": 1, "label": "-"}, {"source": 56, "type": "backbone", "target": 57, "len": 1, "label": "-"}, {"source": 57, "type": "backbone", "target": 58, "len": 1, "label": "-"}, {"source": 58, "type": "backbone", "target": 59, "len": 1, "label": "-"}], "multigraph": false}
{"directed": false, "graph": {"info": "RNAshapes shape_type=2 energy_range=4 max_num=3", "id": "ACNY01000002.1/278641-278580_[_[]_][[]_]", "structure": "....((...((((((.....)))))).)).......((((((((.........)).))))))", "sequence": "GAUCGUUCACUUCGCAUCGCGCGAAGCGCAGUUCGCCUCAGGCCAUGGAACGGGGACCUGAG"}, "nodes": [{"position": 0, "id": 0, "label": "G"}, {"position": 1, "id": 1, "label": "A"}, {"position": 2, "id": 2, "label": "U"}, {"position": 3, "id": 3, "label": "C"}, {"position": 4, "id": 4, "label": "G"}, {"position": 5, "id": 5, "label": "U"}, {"position": 6, "id": 6, "label": "U"}, {"position": 7, "id": 7, "label": "C"}, {"position": 8, "id": 8, "label": "A"}, {"position": 9, "id": 9, "label": "C"}, {"position": 10, "id": 10, "label": "U"}, {"position": 11, "id": 11, "label": "U"}, {"position": 12, "id": 12, "label": "C"}, {"position": 13, "id": 13, "label": "G"}, {"position": 14, "id": 14, "label": "C"}, {"position": 15, "id": 15, "label": "A"}, {"position": 16, "id": 16, "label": "U"}, {"position": 17, "id": 17, "label": "C"}, {"position": 18, "id": 18, "label": "G"}, {"position": 19, "id": 19, "label": "C"}, {"position": 20, "id": 20, "label": "G"}, {"position": 21, "id": 21, "label": "C"}, {"position": 22, "id": 22, "label": "G"}, {"position": 23, "id": 23, "label": "A"}, {"position": 24, "id": 24, "label": "A"}, {"position": 25, "id": 25, "label": "G"}, {"position": 26, "id": 26, "label": "C"}, {"position": 27, "id": 27, "label": "G"}, {"position": 28, "id": 28, "label": "C"}, {"position": 29, "id": 29, "label": "A"}, {"position": 30, "id": 30, "label": "G"}, {"position": 31, "id": 31, "label": "U"}, {"position": 32, "id": 32, "label": "U"}, {"position": 33, "id": 33, "label": "C"}, {"position": 34, "id": 34, "label": "G"}, {"position": 35, "id": 35, "label": "C"}, {"position": 36, "id": 36, "label": "C"}, {"position": 37, "id": 37, "label": "U"}, {"position": 38, "id": 38, "label": "C"}, {"position": 39, "id": 39, "label": "A"}, {"position": 40, "id": 40, "label": "G"}, {"position": 41, "id": 41, "label": "G"}, {"position": 42, "id": 42, "label": "C"}, {"position": 43, "id": 43, "label": "C"}, {"position": 44, "id": 44, "label": "A"}, {"position": 45, "id": 45, "label": "U"}, {"position": 46, "id": 46, "label": "G"}, {"position": 47, "id": 47, "label": "G"}, {"position": 48, "id": 48, "label": "A"}, {"position": 49, "id": 49, "label": "A"}, {"position": 50, "id": 50, "label": "C"}, {"position": 51, "id": 51, "label": "G"}, {"position": 52, "id": 52, "label": "G"}, {"position": 53, "id": 53, "label": "G"}, {"position": 54, "id": 54, "label": "G"}, {"position": 55, "id": 55, "label": "A"}, {"position": 56, "id": 56, "label": "C"}, {"position": 57, "id": 57, "label": "C"}, {"position": 58, "id": 58, "label": "U"}, {"position": 59, "id": 59, "label": "G"}, {"position": 60, "id": 60, "label": "A"}, {"position": 61, "id": 61, "label": "G"}], "links": [{"source": 0, "type": "backbone", "target": 1, "len": 1, "label": "-"}, {"source": 1, "type": "backbone", "target": 2, "len": 1, "label": "-"}, {"source": 2, "type": "backbone", "target": 3, "len": 1, "label": "-"}, {"source": 3, "type": "backbone", "target": 4, "len": 1, "label": "-"}, {"source": 4, "type": "basepair", "target": 28, "len": 1, "label": "="}, {"source": 4, "type": "backbone", "target": 5, "len": 1, "label": "-"}, {"source": 5, "type": "basepair", "target": 27, "len": 1, "label": "="}, {"source": 5, "type": "backbone", "target": 6, "len": 1, "label": "-"}, {"source": 6, "type": "backbone", "target": 7, "len": 1, "label": "-"}, {"source": 7, "type": "backbone", "target": 8, "len": 1, "label": "-"}, {"source": 8, "type": "backbone", "target": 9, "len": 1, "label": "-"}, {"source": 9, "type": "basepair", "target": 25, "len": 1, "label": "="}, {"source": 9, "type": "backbone", "target": 10, "len": 1, "label": "-"}, {"source": 10, "type": "basepair", "target": 24, "len": 1, "label": "="}, {"source": 10, "type": "backbone", "target": 11, "len": 1, "label": "-"}, {"source": 11, "type": "backbone", "target": 12, "len": 1, "label": "-"}, {"source": 11, "type": "basepair", "target": 23, "len": 1, "label": "="}, {"source": 12, "type": "backbone", "target": 13, "len": 1, "label": "-"}, {"source": 12, "type": "basepair", "target": 22, "len": 1, "label": "="}, {"source": 13, "type": "basepair", "target": 21, "len": 1, "label": "="}, {"source": 13, "type": "backbone", "target": 14, "len": 1, "label": "-"}, {"source": 14, "type": "basepair", "target": 20, "len": 1, "label": "="}, {"source": 14, "type": "backbone", "target": 15, "len": 1, "label": "-"}, {"source": 15, "type": "backbone", "target": 16, "len": 1, "label": "-"}, {"source": 16, "type": "backbone", "target": 17, "len": 1, "label": "-"}, {"source": 17, "type": "backbone", "target": 18, "len": 1, "label": "-"}, {"source": 18, "type": "backbone", "target": 19, "len": 1, "label": "-"}, {"source": 19, "type": "backbone", "target": 20, "len": 1, "label": "-"}, {"source": 20, "type": "backbone", "target": 21, "len": 1, "label": "-"}, {"source": 21, "type": "backbone", "target": 22, "len": 1, "label": "-"}, {"source": 22, "type": "backbone", "target": 23, "len": 1, "label": "-"}, {"source": 23, "type": "backbone", "target": 24, "len": 1, "label": "-"}, {"source": 24, "type": "backbone", "target": 25, "len": 1, "label": "-"}, {"source": 25, "type": "backbone", "target": 26, "len": 1, "label": "-"}, {"source": 26, "type": "backbone", "target": 27, "len": 1, "label": "-"}, {"source": 27, "type": "backbone", "target": 28, "len": 1, "label": "-"}, {"source": 28, "type": "backbone", "target": 29, "len": 1, "label": "-"}, {"source": 29, "type": "backbone", "target": 30, "len": 1, "label": "-"}, {"source": 30, "type": "backbone", "target": 31, "len": 1, "label": "-"}, {"source": 31, "type": "backbone", "target": 32, "len": 1, "label": "-"}, {"source": 32, "type": "backbone", "target": 33, "len": 1, "label": "-"}, {"source": 33, "type": "backbone", "target": 34, "len": 1, "label": "-"}, {"source": 34, "type": "backbone", "target": 35, "len": 1, "label": "-"}, {"source": 35, "type": "backbone", "target": 36, "len": 1, "label": "-"}, {"source": 36, "type": "backbone", "target": 37, "len": 1, "label": "-"}, {"source": 36, "type": "basepair", "target": 61, "len": 1, "label": "="}, {"source": 37, "type": "basepair", "target": 60, "len": 1, "label": "="}, {"source": 37, "type": "backbone", "target": 38, "len": 1, "label": "-"}, {"source": 38, "type": "basepair", "target": 59, "len": 1, "label": "="}, {"source": 38, "type": "backbone", "target": 39, "len": 1, "label": "-"}, {"source": 39, "type": "backbone", "target": 40, "len": 1, "label": "-"}, {"source": 39, "type": "basepair", "target": 58, "len": 1, "label": "="}, {"source": 40, "type": "backbone", "target": 41, "len": 1, "label": "-"}, {"source": 40, "type": "basepair", "target": 57, "len": 1, "label": "="}, {"source": 41, "type": "basepair", "target": 56, "len": 1, "label": "="}, {"source": 41, "type": "backbone", "target": 42, "len": 1, "label": "-"}, {"source": 42, "type": "backbone", "target": 43, "len": 1, "label": "-"}, {"source": 42, "type": "basepair", "target": 54, "len": 1, "label": "="}, {"source": 43, "type": "backbone", "target": 44, "len": 1, "label": "-"}, {"source": 43, "type": "basepair", "target": 53, "len": 1, "label": "="}, {"source": 44, "type": "backbone", "target": 45, "len": 1, "label": "-"}, {"source": 45, "type": "backbone", "target": 46, "len": 1, "label": "-"}, {"source": 46, "type": "backbone", "target": 47, "len": 1, "label": "-"}, {"source": 47, "type": "backbone", "target": 48, "len": 1, "label": "-"}, {"source": 48, "type": "backbone", "target": 49, "len": 1, "label": "-"}, {"source": 49, "type": "backbone", "target": 50, "len": 1, "label": "-"}, {"source": 50, "type": "backbone", "target": 51, "len": 1, "label": "-"}, {"source": 51, "type": "backbone", "target": 52, "len": 1, "label": "-"}, {"source": 52, "type": "backbone", "target": 53, "len": 1, "label": "-"}, {"source": 53, "type": "backbone", "target": 54, "len": 1, "label": "-"}, {"source": 54, "type": "backbone", "target": 55, "len": 1, "label": "-"}, {"source": 55, "type": "backbone", "target": 56, "len": 1, "label": "-"}, {"source": 56, "type": "backbone", "target": 57, "len": 1, "label": "-"}, {"source": 57, "type": "backbone", "target": 58, "len": 1, "label": "-"}, {"source": 58, "type": "backbone", "target": 59, "len": 1, "label": "-"}, {"source": 59, "type": "backbone", "target": 60, "len": 1, "label": "-"}, {"source": 60, "type": "backbone", "target": 61, "len": 1, "label": "-"}], "multigraph": false}
{"directed": false, "graph": {"info": "RNAshapes shape_type=2 energy_range=4 max_num=3", "id": "ACNY01000002.1/278641-278580_[_[_[]_]_][[]_]", "structure": "((..((...((((((.....)))))).))...))..((((((((.........)).))))))", "sequence": "GAUCGUUCACUUCGCAUCGCGCGAAGCGCAGUUCGCCUCAGGCCAUGGAACGGGGACCUGAG"}, "nodes": [{"position": 0, "id": 0, "label": "G"}, {"position": 1, "id": 1, "label": "A"}, {"position": 2, "id": 2, "label": "U"}, {"position": 3, "id": 3, "label": "C"}, {"position": 4, "id": 4, "label": "G"}, {"position": 5, "id": 5, "label": "U"}, {"position": 6, "id": 6, "label": "U"}, {"position": 7, "id": 7, "label": "C"}, {"position": 8, "id": 8, "label": "A"}, {"position": 9, "id": 9, "label": "C"}, {"position": 10, "id": 10, "label": "U"}, {"position": 11, "id": 11, "label": "U"}, {"position": 12, "id": 12, "label": "C"}, {"position": 13, "id": 13, "label": "G"}, {"position": 14, "id": 14, "label": "C"}, {"position": 15, "id": 15, "label": "A"}, {"position": 16, "id": 16, "label": "U"}, {"position": 17, "id": 17, "label": "C"}, {"position": 18, "id": 18, "label": "G"}, {"position": 19, "id": 19, "label": "C"}, {"position": 20, "id": 20, "label": "G"}, {"position": 21, "id": 21, "label": "C"}, {"position": 22, "id": 22, "label": "G"}, {"position": 23, "id": 23, "label": "A"}, {"position": 24, "id": 24, "label": "A"}, {"position": 25, "id": 25, "label": "G"}, {"position": 26, "id": 26, "label": "C"}, {"position": 27, "id": 27, "label": "G"}, {"position": 28, "id": 28, "label": "C"}, {"position": 29, "id": 29, "label": "A"}, {"position": 30, "id": 30, "label": "G"}, {"position": 31, "id": 31, "label": "U"}, {"position": 32, "id": 32, "label": "U"}, {"position": 33, "id": 33, "label": "C"}, {"position": 34, "id": 34, "label": "G"}, {"position": 35, "id": 35, "label": "C"}, {"position": 36, "id": 36, "label": "C"}, {"position": 37, "id": 37, "label": "U"}, {"position": 38, "id": 38, "label": "C"}, {"position": 39, "id": 39, "label": "A"}, {"position": 40, "id": 40, "label": "G"}, {"position": 41, "id": 41, "label": "G"}, {"position": 42, "id": 42, "label": "C"}, {"position": 43, "id": 43, "label": "C"}, {"position": 44, "id": 44, "label": "A"}, {"position": 45, "id": 45, "label": "U"}, {"position": 46, "id": 46, "label": "G"}, {"position": 47, "id": 47, "label": "G"}, {"position": 48, "id": 48, "label": "A"}, {"position": 49, "id": 49, "label": "A"}, {"position": 50, "id": 50, "label": "C"}, {"position": 51, "id": 51, "label": "G"}, {"position": 52, "id": 52, "label": "G"}, {"position": 53, "id": 53, "label": "G"}, {"position": 54, "id": 54, "label": "G"}, {"position": 55, "id": 55, "label": "A"}, {"position": 56, "id": 56, "label": "C"}, {"position": 57, "id": 57, "label": "C"}, {"position": 58, "id": 58, "label": "U"}, {"position": 59, "id": 59, "label": "G"}, {"position": 60, "id": 60, "label": "A"}, {"position": 61, "id": 61, "label": "G"}], "links": [{"source": 0, "type": "backbone", "target": 1, "len": 1, "label": "-"}, {"source": 0, "type": "basepair", "target": 33, "len": 1, "label": "="}, {"source": 1, "type": "basepair", "target": 32, "len": 1, "label": "="}, {"source": 1, "type": "backbone", "target": 2, "len": 1, "label": "-"}, {"source": 2, "type": "backbone", "target": 3, "len": 1, "label": "-"}, {"source": 3, "type": "backbone", "target": 4, "len": 1, "label": "-"}, {"source": 4, "type": "basepair", "target": 28, "len": 1, "label": "="}, {"source": 4, "type": "backbone", "target": 5, "len": 1, "label": "-"}, {"source": 5, "type": "basepair", "target": 27, "len": 1, "label": "="}, {"source": 5, "type": "backbone", "target": 6, "len": 1, "label": "-"}, {"source": 6, "type": "backbone", "target": 7, "len": 1, "label": "-"}, {"source": 7, "type": "backbone", "target": 8, "len": 1, "label": "-"}, {"source": 8, "type": "backbone", "target": 9, "len": 1, "label": "-"}, {"source": 9, "type": "basepair", "target": 25, "len": 1, "label": "="}, {"source": 9, "type": "backbone", "target": 10, "len": 1, "label": "-"}, {"source": 10, "type": "basepair", "target": 24, "len": 1, "label": "="}, {"source": 10, "type": "backbone", "target": 11, "len": 1, "label": "-"}, {"source": 11, "type": "backbone", "target": 12, "len": 1, "label": "-"}, {"source": 11, "type": "basepair", "target": 23, "len": 1, "label": "="}, {"source": 12, "type": "backbone", "target": 13, "len": 1, "label": "-"}, {"source": 12, "type": "basepair", "target": 22, "len": 1, "label": "="}, {"source": 13, "type": "basepair", "target": 21, "len": 1, "label": "="}, {"source": 13, "type": "backbone", "target": 14, "len": 1, "label": "-"}, {"source": 14, "type": "basepair", "target": 20, "len": 1, "label": "="}, {"source": 14, "type": "backbone", "target": 15, "len": 1, "label": "-"}, {"source": 15, "type": "backbone", "target": 16, "len": 1, "label": "-"}, {"source": 16, "type": "backbone", "target": 17, "len": 1, "label": "-"}, {"source": 17, "type": "backbone", "target": 18, "len": 1, "label": "-"}, {"source": 18, "type": "backbone", "target": 19, "len": 1, "label": "-"}, {"source": 19, "type": "backbone", "target": 20, "len": 1, "label": "-"}, {"source": 20, "type": "backbone", "target": 21, "len": 1, "label": "-"}, {"source": 21, "type": "backbone", "target": 22, "len": 1, "label": "-"}, {"source": 22, "type": "backbone", "target": 23, "len": 1, "label": "-"}, {"source": 23, "type": "backbone", "target": 24, "len": 1, "label": "-"}, {"source": 24, "type": "backbone", "target": 25, "len": 1, "label": "-"}, {"source": 25, "type": "backbone", "target": 26, "len": 1, "label": "-"}, {"source": 26, "type": "backbone", "target": 27, "len": 1, "label": "-"}, {"source": 27, "type": "backbone", "target": 28, "len": 1, "label": "-"}, {"source": 28, "type": "backbone", "target": 29, "len": 1, "label": "-"}, {"source": 29, "type": "backbone", "target": 30, "len": 1, "label": "-"}, {"source": 30, "type": "backbone", "target": 31, "len": 1, "label": "-"}, {"source": 31, "type": "backbone", "target": 32, "len": 1, "label": "-"}, {"source": 32, "type": "backbone", "target": 33, "len": 1, "label": "-"}, {"source": 33, "type": "backbone", "target": 34, "len": 1, "label": "-"}, {"source": 34, "type": "backbone", "target": 35, "len": 1, "label": "-"}, {"source": 35, "type": "backbone", "target": 36, "len": 1, "label": "-"}, {"source": 36, "type": "backbone", "target": 37, "len": 1, "label": "-"}, {"source": 36, "type": "basepair", "target": 61, "len": 1, "label": "="}, {"source": 37, "type": "basepair", "target": 60, "len": 1, "label": "="}, {"source": 37, "type": "backbone", "target": 38, "len": 1, "label": "-"}, {"source": 38, "type": "basepair", "target": 59, "len": 1, "label": "="}, {"source": 38, "type": "backbone", "target": 39, "len": 1, "label": "-"}, {"source": 39, "type": "backbone", "target": 40, "len": 1, "label": "-"}, {"source": 39, "type": "basepair", "target": 58, "len": 1, "label": "="}, {"source": 40, "type": "backbone", "target": 41, "len": 1, "label": "-"}, {"source": 40, "type": "basepair", "target": 57, "len": 1, "label": "="}, {"source": 41, "type": "basepair", "target": 56, "len": 1, "label": "="}, {"source": 41, "type": "backbone", "target": 42, "len": 1, "label": "-"}, {"source": 42, "type": "backbone", "target": 43, "len": 1, "label": "-"}, {"source": 42, "type": "basepair", "target": 54, "len": 1, "label": "="}, {"source": 43, "type": "backbone", "target": 44, "len": 1, "label": "-"}, {"source": 43, "type": "basepair", "target": 53, "len": 1, "label": "="}, {"source": 44, "type": "backbone", "target": 45, "len": 1, "label": "-"}, {"source": 45, "type": "backbone", "target": 46, "len": 1, "label": "-"}, {"source": 46, "type": "backbone", "target": 47, "len": 1, "label": "-"}, {"source": 47, "type": "backbone", "target": 48, "len": 1, "label": "-"}, {"source": 48, "type": "backbone", "target": 49, "len": 1, "label": "-"}, {"source": 49, "type": "backbone", "target": 50, "len": 1, "label": "-"}, {"source": 50, "type": "backbone", "target": 51, "len": 1, "label": "-"}, {"source": 51, "type": "backbone", "target": 52, "len": 1, "label": "-"}, {"source": 52, "type": "backbone", "target": 53, "len": 1, "label": "-"}, {"source": 53, "type": "backbone", "target": 54, "len": 1, "label": "-"}, {"source": 54, "type": "backbone", "target": 55, "len": 1, "label": "-"}, {"source": 55, "type": "backbone", "target": 56, "len": 1, "label": "-"}, {"source": 56, "type": "backbone", "target": 57, "len": 1, "label": "-"}, {"source": 57, "type": "backbone", "target": 58, "len": 1, "label": "-"}, {"source": 58, "type": "backbone", "target": 59, "len": 1, "label": "-"}, {"source": 59, "type": "backbone", "target": 60, "len": 1, "label": "-"}, {"source": 60, "type": "backbone", "target": 61, "len": 1, "label": "-"}], "multigraph": false}
{"directed": false, "graph": {"info": "RNAshapes shape_type=2 energy_range=4 max_num=3", "id": "ACNY01000002.1/278641-278580_[][[]_]", "structure": ".........((((((.....))))))..........((((((((.........)).))))))", "sequence": "GAUCGUUCACUUCGCAUCGCGCGAAGCGCAGUUCGCCUCAGGCCAUGGAACGGGGACCUGAG"}, "nodes": [{"position": 0, "id": 0, "label": "G"}, {"position": 1, "id": 1, "label": "A"}, {"position": 2, "id": 2, "label": "U"}, {"position": 3, "id": 3, "label": "C"}, {"position": 4, "id": 4, "label": "G"}, {"position": 5, "id": 5, "label": "U"}, {"position": 6, "id": 6, "label": "U"}, {"position": 7, "id": 7, "label": "C"}, {"position": 8, "id": 8, "label": "A"}, {"position": 9, "id": 9, "label": "C"}, {"position": 10, "id": 10, "label": "U"}, {"position": 11, "id": 11, "label": "U"}, {"position": 12, "id": 12, "label": "C"}, {"position": 13, "id": 13, "label": "G"}, {"position": 14, "id": 14, "label": "C"}, {"position": 15, "id": 15, "label": "A"}, {"position": 16, "id": 16, "label": "U"}, {"position": 17, "id": 17, "label": "C"}, {"position": 18, "id": 18, "label": "G"}, {"position": 19, "id": 19, "label": "C"}, {"position": 20, "id": 20, "label": "G"}, {"position": 21, "id": 21, "label": "C"}, {"position": 22, "id": 22, "label": "G"}, {"position": 23, "id": 23, "label": "A"}, {"position": 24, "id": 24, "label": "A"}, {"position": 25, "id": 25, "label": "G"}, {"position": 26, "id": 26, "label": "C"}, {"position": 27, "id": 27, "label": "G"}, {"position": 28, "id": 28, "label": "C"}, {"position": 29, "id": 29, "label": "A"}, {"position": 30, "id": 30, "label": "G"}, {"position": 31, "id": 31, "label": "U"}, {"position": 32, "id": 32, "label": "U"}, {"position": 33, "id": 33, "label": "C"}, {"position": 34, "id": 34, "label": "G"}, {"position": 35, "id": 35, "label": "C"}, {"position": 36, "id": 36, "label": "C"}, {"position": 37, "id": 37, "label": "U"}, {"position": 38, "id": 38, "label": "C"}, {"position": 39, "id": 39, "label": "A"}, {"position": 40, "id": 40, "label": "G"}, {"position": 41, "id": 41, "label": "G"}, {"position": 42, "id": 42, "label": "C"}, {"position": 43, "id": 43, "label": "C"}, {"position": 44, "id": 44, "label": "A"}, {"position": 45, "id": 45, "label": "U"}, {"position": 46, "id": 46, "label": "G"}, {"position": 47, "id": 47, "label": "G"}, {"position": 48, "id": 48, "label": "A"}, {"position": 49, "id": 49, "label": "A"}, {"position": 50, "id": 50, "label": "C"}, {"position": 51, "id": 51, "label": "G"}, {"position": 52, "id": 52, "label": "G"}, {"position": 53, "id": 53, "label": "G"}, {"position": 54, "id": 54, "label": "G"}, {"position": 55, "id": 55, "label": "A"}, {"position": 56, "id": 56, "label": "C"}, {"position": 57, "id": 57, "label": "C"}, {"position": 58, "id": 58, "label": "U"}, {"position": 59, "id": 59, "label": "G"}, {"position": 60, "id": 60, "label": "A"}, {"position": 61, "id": 61, "label": "G"}], "links": [{"source": 0, "type": "backbone", "target": 1, "len": 1, "label": "-"}, {"source": 1, "type": "backbone", "target": 2, "len": 1, "label": "-"}, {"source": 2, "type": "backbone", "target": 3, "len": 1, "label": "-"}, {"source": 3, "type": "backbone", "target": 4, "len": 1, "label": "-"}, {"source": 4, "type": "backbone", "target": 5, "len": 1, "label": "-"}, {"source": 5, "type": "backbone", "target": 6, "len": 1, "label": "-"}, {"source": 6, "type": "backbone", "target": 7, "len": 1, "label": "-"}, {"source": 7, "type": "backbone", "target": 8, "len": 1, "label": "-"}, {"source": 8, "type": "backbone", "target": 9, "len": 1, "label": "-"}, {"source": 9, "type": "basepair", "target": 25, "len": 1, "label": "="}, {"source": 9, "type": "backbone", "target": 10, "len": 1, "label": "-"}, {"source": 10, "type": "basepair", "target": 24, "len": 1, "label": "="}, {"source": 10, "type": "backbone", "target": 11, "len": 1, "label": "-"}, {"source": 11, "type": "backbone", "target": 12, "len": 1, "label": "-"}, {"source": 11, "type": "basepair", "target": 23, "len": 1, "label": "="}, {"source": 12, "type": "backbone", "target": 13, "len": 1, "label": "-"}, {"source": 12, "type": "basepair", "target": 22, "len": 1, "label": "="}, {"source": 13, "type": "basepair", "target": 21, "len": 1, "label": "="}, {"source": 13, "type": "backbone", "target": 14, "len": 1, "label": "-"}, {"source": 14, "type": "basepair", "target": 20, "len": 1, "label": "="}, {"source": 14, "type": "backbone", "target": 15, "len": 1, "label": "-"}, {"source": 15, "type": "backbone", "target": 16, "len": 1, "label": "-"}, {"source": 16, "type": "backbone", "target": 17, "len": 1, "label": "-"}, {"source": 17, "type": "backbone", "target": 18, "len": 1, "label": "-"}, {"source": 18, "type": "backbone", "target": 19, "len": 1, "label": "-"}, {"source": 19, "type": "backbone", "target": 20, "len": 1, "label": "-"}, {"source": 20, "type": "backbone", "target": 21, "len": 1, "label": "-"}, {"source": 21, "type": "backbone", "target": 22, "len": 1, "label": "-"}, {"source": 22, "type": "backbone", "target": 23, "len": 1, "label": "-"}, {"source": 23, "type": "backbone", "target": 24, "len": 1, "label": "-"}, {"source": 24, "type": "backbone", "target": 25, "len": 1, "label": "-"}, {"source": 25, "type": "backbone", "target": 26, "len": 1, "label": "-"}, {"source": 26, "type": "backbone", "target": 27, "len": 1, "label": "-"}, {"source": 27, "type": "backbone", "target": 28, "len": 1, "label": "-"}, {"source": 28, "type": "backbone", "target": 29, "len": 1, "label": "-"}, {"source": 29, "type": "backbone", "target": 30, "len": 1, "label": "-"}, {"source": 30, "type": "backbone", "target": 31, "len": 1, "label": "-"}, {"source": 31, "type": "backbone", "target": 32, "len": 1, "label": "-"}, {"source": 32, "type": "backbone", "target": 33, "len": 1, "label": "-"}, {"source": 33, "type": "backbone", "target": 34, "len": 1, "label": "-"}, {"source": 34, "type": "backbone", "target": 35, "len": 1, "label": "-"}, {"source": 35, "type": "backbone", "target": 36, "len": 1, "label": "-"}, {"source": 36, "type": "backbone", "target": 37, "len": 1, "label": "-"}, {"source": 36, "type": "basepair", "target": 61, "len": 1, "label": "="}, {"source": 37, "type": "basepair", "target": 60, "len": 1, "label": "="}, {"source": 37, "type": "backbone", "target": 38, "len": 1, "label": "-"}, {"source": 38, "type": "basepair", "target": 59, "len": 1, "label": "="}, {"source": 38, "type": "backbone", "target": 39, "len": 1, "label": "-"}, {"source": 39, "type": "backbone", "target": 40, "len": 1, "label": "-"}, {"source": 39, "type": "basepair", "target": 58, "len": 1, "label": "="}, {"source": 40, "type": "backbone", "target": 41, "len": 1, "label": "-"}, {"source": 40, "type": "basepair", "target": 57, "len": 1, "label": "="}, {"source": 41, "type": "basepair", "target": 56, "len": 1, "label": "="}, {"source": 41, "type": "backbone", "target": 42, "len": 1, "label": "-"}, {"source": 42, "type": "backbone", "target": 43, "len": 1, "label": "-"}, {"source": 42, "type": "basepair", "target": 54, "len": 1, "label": "="}, {"source": 43, "type": "backbone", "target": 44, "len": 1, "label": "-"}, {"source": 43, "type": "basepair", "target": 53, "len": 1, "label": "="}, {"source": 44, "type": "backbone", "target": 45, "len": 1, "label": "-"}, {"source": 45, "type": "backbone", "target": 46, "len": 1, "label": "-"}, {"source": 46, "type": "backbone", "target": 47, "len": 1, "label": "-"}, {"source": 47, "type": "backbone", "target": 48, "len": 1, "label": "-"}, {"source": 48, "type": "backbone", "target": 49, "len": 1, "label": "-"}, {"source": 49, "type": "backbone", "target": 50, "len": 1, "label": "-"}, {"source": 50, "type": "backbone", "target": 51, "len": 1, "label": "-"}, {"source": 51, "type": "backbone", "target": 52, "len": 1, "label": "-"}, {"source": 52, "type": "backbone", "target": 53, "len": 1, "label": "-"}, {"source": 53, "type": "backbone", "target": 54, "len": 1, "label": "-"}, {"source": 54, "type": "backbone", "target": 55, "len": 1, "label": "-"}, {"source": 55, "type": "backbone", "target": 56, "len": 1, "label": "-"}, {"source": 56, "type": "backbone", "target": 57, "len": 1, "label": "-"}, {"source": 57, "type": "backbone", "target": 58, "len": 1, "label": "-"}, {"source": 58, "type": "backbone", "target": 59, "len": 1, "label": "-"}, {"source": 59, "type": "backbone", "target": 60, "len": 1, "label": "-"}, {"source": 60, "type": "backbone", "target": 61, "len": 1, "label": "-"}], "multigraph": false}