Mercurial > repos > bgruening > sklearn_svm_classifier
changeset 0:7bee4014724a draft
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/sklearn commit 8cbb681224f23fa95783514f949c97d6c2c60966
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/README.rst Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,150 @@ +*************** +Galaxy wrapper for scikit-learn library +*************** + +Contents +======== +- `What is scikit-learn?`_ + - `Scikit-learn main package groups`_ + - `Tools offered by this wrapper`_ + +- `Machine learning workflows`_ + - `Supervised learning workflows`_ + - `Unsupervised learning workflows`_ + + +____________________________ + + +.. _What is scikit-learn? + +What is scikit-learn? +=========================== + +Scikit-learn is an open-source machine learning library for the Python programming language. It offers various algorithms for performing supervised and unsupervised learning as well as data preprocessing and transformation, model selection and evaluation, and dataset utilities. It is built upon SciPy (Scientific Python) library. + +Scikit-learn source code can be accessed at https://github.com/scikit-learn/scikit-learn. +Detailed installation instructions can be found at http://scikit-learn.org/stable/install.html + + +.. _Scikit-learn main package groups: + +====== +Scikit-learn main package groups +====== + +Scikit-learn provides the users with several main groups of related operations. +These are: + +- Classification + - Identifying to which category an object belongs. +- Regression + - Predicting a continuous-valued attribute associated with an object. +- Clustering + - Automatic grouping of similar objects into sets. +- Preprocessing + - Feature extraction and normalization. +- Model selection and evaluation + - Comparing, validating and choosing parameters and models. +- Dimensionality reduction + - Reducing the number of random variables to consider. + +Each group consists of a number of well-known algorithms from the category. For example, one can find hierarchical, spectral, kmeans, and other clustering methods in sklearn.cluster package. + + +.. _Tools offered by this wrapper: + +=================== +Available tools in the current wrapper +=================== + +The current release of the wrapper offers a subset of the packages from scikit-learn library. You can find: + +- A subset of classification metric functions +- Linear and quadratic discriminant classifiers +- Random forest and Ada boost classifiers and regressors +- All the clustering methods +- All support vector machine classifiers +- A subset of data preprocessing estimator classes +- Pairwise metric measurement functions + +In addition, several tools for performing matrix operations, generating problem-specific datasets, and encoding text and extracting features have been prepared to help the user with more advanced operations. + +.. _Machine learning workflows: + +Machine learning workflows +=============== + +Machine learning is about processes. No matter what machine learning algorithm we use, we can apply typical workflows and dataflows to produce more robust models and better predictions. +Here we discuss supervised and unsupervised learning workflows. + +.. _Supervised learning workflows: + +=================== +Supervised machine learning workflows +=================== + +**What is supervised learning?** + +In this machine learning task, given sample data which are labeled, the aim is to build a model which can predict the labels for new observations. +In practice, there are five steps which we can go through to start from raw input data and end up getting reasonable predictions for new samples: + +1. Preprocess the data:: + + * Change the collected data into the proper format and datatype. + * Adjust the data quality by filling the missing values, performing + required scaling and normalizations, etc. + * Extract features which are the most meaningfull for the learning task. + * Split the ready dataset into training and test samples. + +2. Choose an algorithm:: + + * These factors help one to choose a learning algorithm: + - Nature of the data (e.g. linear vs. nonlinear data) + - Structure of the predicted output (e.g. binary vs. multilabel classification) + - Memory and time usage of the training + - Predictive accuracy on new data + - Interpretability of the predictions + +3. Choose a validation method + + Every machine learning model should be evaluated before being put into practicical use. + There are numerous performance metrics to evaluate machine learning models. + For supervised learning, usually classification or regression metrics are used. + + A validation method helps to evaluate the performance metrics of a trained model in order + to optimize its performance or ultimately switch to a more efficient model. + Cross-validation is a known validation method. + +4. Fit a model + + Given the learning algorithm, validation method, and performance metric(s) + repeat the following steps:: + + * Train the model. + * Evaluate based on metrics. + * Optimize unitl satisfied. + +5. Use fitted model for prediction:: + + This is a final evaluation in which, the optimized model is used to make predictions + on unseen (here test) samples. After this, the model is put into production. + +.. _Unsupervised learning workflows: + +======================= +Unsupervised machine learning workflows +======================= + +**What is unsupervised learning?** + +Unlike supervised learning and more liklely in real life, here the initial data is not labeled. +The task is to extract the structure from the data and group the samples based on their similarities. +Clustering and dimensionality reduction are two famous examples of unsupervised learning tasks. + +In this case, the workflow is as follows:: + + * Preprocess the data (without splitting to train and test). + * Train a model. + * Evaluate and tune parameters. + * Analyse the model and test on real data.
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/main_macros.xml Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,1515 @@ +<macros> + <token name="@VERSION@">0.9</token> + + <token name="@COLUMNS_FUNCTION@"> +def read_columns(f, c=None, c_option='by_index_number', return_df=False, **args): + data = pandas.read_csv(f, **args) + if c_option == 'by_index_number': + cols = list(map(lambda x: x - 1, c)) + data = data.iloc[:,cols] + if c_option == 'all_but_by_index_number': + cols = list(map(lambda x: x - 1, c)) + data.drop(data.columns[cols], axis=1, inplace=True) + if c_option == 'by_header_name': + cols = [e.strip() for e in c.split(',')] + data = data[cols] + if c_option == 'all_but_by_header_name': + cols = [e.strip() for e in c.split(',')] + data.drop(cols, axis=1, inplace=True) + y = data.values + if return_df: + return y, data + else: + return y + return y + </token> + +## generate an instance for one of sklearn.feature_selection classes + <token name="@FEATURE_SELECTOR_FUNCTION@"> +def feature_selector(inputs): + selector = inputs["selected_algorithm"] + selector = getattr(sklearn.feature_selection, selector) + options = inputs["options"] + + if inputs['selected_algorithm'] == 'SelectFromModel': + if not options['threshold'] or options['threshold'] == 'None': + options['threshold'] = None + if inputs['model_inputter']['input_mode'] == 'prefitted': + model_file = inputs['model_inputter']['fitted_estimator'] + with open(model_file, 'rb') as model_handler: + fitted_estimator = pickle.load(model_handler) + new_selector = selector(fitted_estimator, prefit=True, **options) + else: + estimator_json = inputs['model_inputter']["estimator_selector"] + estimator = get_estimator(estimator_json) + new_selector = selector(estimator, **options) + + elif inputs['selected_algorithm'] in ['RFE', 'RFECV']: + if 'scoring' in options and (not options['scoring'] or options['scoring'] == 'None'): + options['scoring'] = None + estimator=get_estimator(inputs["estimator_selector"]) + new_selector = selector(estimator, **options) + + elif inputs['selected_algorithm'] == "VarianceThreshold": + new_selector = selector(**options) + + else: + score_func = inputs["score_func"] + score_func = getattr(sklearn.feature_selection, score_func) + new_selector = selector(score_func, **options) + + return new_selector + </token> + + <token name="@GET_X_y_FUNCTION@"> +def get_X_y(params, file1, file2): + input_type = params["selected_tasks"]["selected_algorithms"]["input_options"]["selected_input"] + if input_type=="tabular": + header = 'infer' if params["selected_tasks"]["selected_algorithms"]["input_options"]["header1"] else None + column_option = params["selected_tasks"]["selected_algorithms"]["input_options"]["column_selector_options_1"]["selected_column_selector_option"] + if column_option in ["by_index_number", "all_but_by_index_number", "by_header_name", "all_but_by_header_name"]: + c = params["selected_tasks"]["selected_algorithms"]["input_options"]["column_selector_options_1"]["col1"] + else: + c = None + X = read_columns( + file1, + c = c, + c_option = column_option, + sep='\t', + header=header, + parse_dates=True + ) + else: + X = mmread(file1) + + header = 'infer' if params["selected_tasks"]["selected_algorithms"]["input_options"]["header2"] else None + column_option = params["selected_tasks"]["selected_algorithms"]["input_options"]["column_selector_options_2"]["selected_column_selector_option2"] + if column_option in ["by_index_number", "all_but_by_index_number", "by_header_name", "all_but_by_header_name"]: + c = params["selected_tasks"]["selected_algorithms"]["input_options"]["column_selector_options_2"]["col2"] + else: + c = None + y = read_columns( + file2, + c = c, + c_option = column_option, + sep='\t', + header=header, + parse_dates=True + ) + y=y.ravel() + return X, y + </token> + + <token name="@GET_SEARCH_PARAMS_FUNCTION@"> +def get_search_params(params_builder): + search_params = {} + + def safe_eval(literal): + + FROM_SCIPY_STATS = [ 'bernoulli', 'binom', 'boltzmann', 'dlaplace', 'geom', 'hypergeom', + 'logser', 'nbinom', 'planck', 'poisson', 'randint', 'skellam', 'zipf' ] + + FROM_NUMPY_RANDOM = [ 'beta', 'binomial', 'bytes', 'chisquare', 'choice', 'dirichlet', 'division', + 'exponential', 'f', 'gamma', 'geometric', 'gumbel', 'hypergeometric', + 'laplace', 'logistic', 'lognormal', 'logseries', 'mtrand', 'multinomial', + 'multivariate_normal', 'negative_binomial', 'noncentral_chisquare', 'noncentral_f', + 'normal', 'pareto', 'permutation', 'poisson', 'power', 'rand', 'randint', + 'randn', 'random', 'random_integers', 'random_sample', 'ranf', 'rayleigh', + 'sample', 'seed', 'set_state', 'shuffle', 'standard_cauchy', 'standard_exponential', + 'standard_gamma', 'standard_normal', 'standard_t', 'triangular', 'uniform', + 'vonmises', 'wald', 'weibull', 'zipf' ] + + # File opening and other unneeded functions could be dropped + UNWANTED = ['open', 'type', 'dir', 'id', 'str', 'repr'] + + # Allowed symbol table. Add more if needed. + new_syms = { + 'np_arange': getattr(np, 'arange'), + 'ensemble_ExtraTreesClassifier': getattr(ensemble, 'ExtraTreesClassifier') + } + + syms = make_symbol_table(use_numpy=False, **new_syms) + + for method in FROM_SCIPY_STATS: + syms['scipy_stats_' + method] = getattr(scipy.stats, method) + + for func in FROM_NUMPY_RANDOM: + syms['np_random_' + func] = getattr(np.random, func) + + for key in UNWANTED: + syms.pop(key, None) + + aeval = Interpreter(symtable=syms, use_numpy=False, minimal=False, + no_if=True, no_for=True, no_while=True, no_try=True, + no_functiondef=True, no_ifexp=True, no_listcomp=False, + no_augassign=False, no_assert=True, no_delete=True, + no_raise=True, no_print=True) + + return aeval(literal) + + for p in params_builder['param_set']: + search_p = p['search_param_selector']['search_p'] + if search_p.strip() == '': + continue + param_type = p['search_param_selector']['selected_param_type'] + + lst = search_p.split(":") + assert (len(lst) == 2), "Error, make sure there is one and only one colon in search parameter input." + literal = lst[1].strip() + ev = safe_eval(literal) + if param_type == "final_estimator_p": + search_params["estimator__" + lst[0].strip()] = ev + else: + search_params["preprocessing_" + param_type[5:6] + "__" + lst[0].strip()] = ev + + return search_params + </token> + + <token name="@GET_ESTIMATOR_FUNCTION@"> +def get_estimator(estimator_json): + estimator_module = estimator_json['selected_module'] + estimator_cls = estimator_json['selected_estimator'] + + if estimator_module == "xgboost": + cls = getattr(xgboost, estimator_cls) + else: + module = getattr(sklearn, estimator_module) + cls = getattr(module, estimator_cls) + + estimator = cls() + + estimator_params = estimator_json['text_params'].strip() + if estimator_params != "": + try: + params = ast.literal_eval('{' + estimator_params + '}') + except ValueError: + sys.exit("Unsupported parameter input: `%s`" %estimator_params) + estimator.set_params(**params) + + return estimator + </token> + + <xml name="python_requirements"> + <requirements> + <requirement type="package" version="2.7">python</requirement> + <requirement type="package" version="0.19.1">scikit-learn</requirement> + <requirement type="package" version="0.22.0">pandas</requirement> + <requirement type="package" version="0.72.1">xgboost</requirement> + <yield /> + </requirements> + </xml> + + <xml name="macro_stdio"> + <stdio> + <exit_code range="1:" level="fatal" description="Error occurred. Please check Tool Standard Error"/> + </stdio> + </xml> + + + <!--Generic interface--> + + <xml name="sl_Conditional" token_train="tabular" token_data="tabular" token_model="txt"> + <conditional name="selected_tasks"> + <param name="selected_task" type="select" label="Select a Classification Task"> + <option value="train" selected="true">Train a model</option> + <option value="load">Load a model and predict</option> + </param> + <when value="load"> + <param name="infile_model" type="data" format="@MODEL@" label="Models" help="Select a model file."/> + <param name="infile_data" type="data" format="@DATA@" label="Data (tabular)" help="Select the dataset you want to classify."/> + <param name="header" type="boolean" optional="True" truevalue="booltrue" falsevalue="boolfalse" checked="False" label="Does the dataset contain header:" /> + <conditional name="prediction_options"> + <param name="prediction_option" type="select" label="Select the type of prediction"> + <option value="predict">Predict class labels</option> + <option value="advanced">Include advanced options</option> + </param> + <when value="predict"> + </when> + <when value="advanced"> + </when> + </conditional> + </when> + <when value="train"> + <conditional name="selected_algorithms"> + <yield /> + </conditional> + </when> + </conditional> + </xml> + + <xml name="advanced_section"> + <section name="options" title="Advanced Options" expanded="False"> + <yield /> + </section> + </xml> + + + <!--Generalized Linear Models--> + <xml name="loss" token_help=" " token_select="false"> + <param argument="loss" type="select" label="Loss function" help="@HELP@"> + <option value="squared_loss" selected="@SELECT@">squared loss</option> + <option value="huber">huber</option> + <option value="epsilon_insensitive">epsilon insensitive</option> + <option value="squared_epsilon_insensitive">squared epsilon insensitive</option> + <yield/> + </param> + </xml> + + <xml name="penalty" token_help=" "> + <param argument="penalty" type="select" label="Penalty (regularization term)" help="@HELP@"> + <option value="l2" selected="true">l2</option> + <option value="l1">l1</option> + <option value="elasticnet">elastic net</option> + <option value="none">none</option> + <yield/> + </param> + </xml> + + <xml name="l1_ratio" token_default_value="0.15" token_help=" "> + <param argument="l1_ratio" type="float" value="@DEFAULT_VALUE@" label="Elastic Net mixing parameter" help="@HELP@"/> + </xml> + + <xml name="epsilon" token_default_value="0.1" token_help="Used if loss is ‘huber’, ‘epsilon_insensitive’, or ‘squared_epsilon_insensitive’. "> + <param argument="epsilon" type="float" value="@DEFAULT_VALUE@" label="Epsilon (epsilon-sensitive loss functions only)" help="@HELP@"/> + </xml> + + <xml name="learning_rate_s" token_help=" " token_selected1="false" token_selected2="false"> + <param argument="learning_rate" type="select" optional="true" label="Learning rate schedule" help="@HELP@"> + <option value="optimal" selected="@SELECTED1@">optimal</option> + <option value="constant">constant</option> + <option value="invscaling" selected="@SELECTED2@">inverse scaling</option> + <yield/> + </param> + </xml> + + <xml name="eta0" token_default_value="0.0" token_help="Used with ‘constant’ or ‘invscaling’ schedules. "> + <param argument="eta0" type="float" value="@DEFAULT_VALUE@" label="Initial learning rate" help="@HELP@"/> + </xml> + + <xml name="power_t" token_default_value="0.5" token_help=" "> + <param argument="power_t" type="float" value="@DEFAULT_VALUE@" label="Exponent for inverse scaling learning rate" help="@HELP@"/> + </xml> + + <xml name="normalize" token_checked="false" token_help=" "> + <param argument="normalize" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolfalse" checked="@CHECKED@" label="Normalize samples before training" help=" "/> + </xml> + + <xml name="copy_X" token_checked="true" token_help=" "> + <param argument="copy_X" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolfalse" checked="@CHECKED@" label="Use a copy of samples" help="If false, samples would be overwritten. "/> + </xml> + + <xml name="ridge_params"> + <expand macro="normalize"/> + <expand macro="alpha" default_value="1.0"/> + <expand macro="fit_intercept"/> + <expand macro="max_iter" default_value=""/> + <expand macro="tol" default_value="0.001" help_text="Precision of the solution. "/> + <!--class_weight--> + <expand macro="copy_X"/> + <param argument="solver" type="select" value="" label="Solver to use in the computational routines" help=" "> + <option value="auto" selected="true">auto</option> + <option value="svd">svd</option> + <option value="cholesky">cholesky</option> + <option value="lsqr">lsqr</option> + <option value="sparse_cg">sparse_cg</option> + <option value="sag">sag</option> + </param> + <expand macro="random_state"/> + </xml> + + <!--Ensemble methods--> + <xml name="n_estimators" token_default_value="10" token_help=" "> + <param argument="n_estimators" type="integer" optional="true" value="@DEFAULT_VALUE@" label="Number of trees in the forest" help="@HELP@"/> + </xml> + + <xml name="max_depth" token_default_value="" token_help=" "> + <param argument="max_depth" type="integer" optional="true" value="@DEFAULT_VALUE@" label="Maximum depth of the tree" help="@HELP@"/> + </xml> + + <xml name="min_samples_split" token_type="integer" token_default_value="2" token_help=" "> + <param argument="min_samples_split" type="@TYPE@" optional="true" value="@DEFAULT_VALUE@" label="Minimum number of samples required to split an internal node" help="@HELP@"/> + </xml> + + <xml name="min_samples_leaf" token_type="integer" token_default_value="1" token_label="Minimum number of samples in newly created leaves" token_help=" "> + <param argument="min_samples_leaf" type="@TYPE@" optional="true" value="@DEFAULT_VALUE@" label="@LABEL@" help="@HELP@"/> + </xml> + + <xml name="min_weight_fraction_leaf" token_default_value="0.0" token_help=" "> + <param argument="min_weight_fraction_leaf" type="float" optional="true" value="@DEFAULT_VALUE@" label="Minimum weighted fraction of the input samples required to be at a leaf node" help="@HELP@"/> + </xml> + + <xml name="max_leaf_nodes" token_default_value="" token_help=" "> + <param argument="max_leaf_nodes" type="integer" optional="true" value="@DEFAULT_VALUE@" label="Maximum number of leaf nodes in best-first method" help="@HELP@"/> + </xml> + + <xml name="min_impurity_decrease" token_default_value="0" token_help=" "> + <param argument="min_impurity_decrease" type="float" value="@DEFAULT_VALUE@" optional="true" label="The threshold value of impurity for stopping node splitting" help="@HELP@"/> + </xml> + + <xml name="bootstrap" token_checked="true" token_help=" "> + <param argument="bootstrap" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolflase" checked="@CHECKED@" label="Use bootstrap samples for building trees." help="@HELP@"/> + </xml> + + <xml name="criterion" token_help=" "> + <param argument="criterion" type="select" label="Function to measure the quality of a split" help=" "> + <option value="gini" selected="true">Gini impurity</option> + <option value="entropy">Information gain</option> + <yield/> + </param> + </xml> + + <xml name="criterion2" token_help=""> + <param argument="criterion" type="select" label="Function to measure the quality of a split" > + <option value="mse">mse - mean squared error</option> + <option value="mae">mae - mean absolute error</option> + <yield/> + </param> + </xml> + + <xml name="oob_score" token_checked="false" token_help=" "> + <param argument="oob_score" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolfalse" checked="@CHECKED@" label="Use out-of-bag samples to estimate the generalization error" help="@HELP@"/> + </xml> + + <xml name="max_features"> + <conditional name="select_max_features"> + <param argument="max_features" type="select" label="max_features"> + <option value="auto" selected="true">auto - max_features=n_features</option> + <option value="sqrt">sqrt - max_features=sqrt(n_features)</option> + <option value="log2">log2 - max_features=log2(n_features)</option> + <option value="number_input">I want to type the number in or input None type</option> + </param> + <when value="auto"> + </when> + <when value="sqrt"> + </when> + <when value="log2"> + </when> + <when value="number_input"> + <param name="num_max_features" type="float" value="" optional="true" label="Input max_features number:" help="If int, consider the number of features at each split; If float, then max_features is a percentage and int(max_features * n_features) features are considered at each split."/> + </when> + </conditional> + </xml> + + <xml name="verbose" token_default_value="0" token_help="If 1 then it prints progress and performance once in a while. If greater than 1 then it prints progress and performance for every tree."> + <param argument="verbose" type="integer" value="@DEFAULT_VALUE@" optional="true" label="Enable verbose output" help="@HELP@"/> + </xml> + + <xml name="learning_rate" token_default_value="1.0" token_help=" "> + <param argument="learning_rate" type="float" optional="true" value="@DEFAULT_VALUE@" label="Learning rate" help="@HELP@"/> + </xml> + + <xml name="subsample" token_help=" "> + <param argument="subsample" type="float" value="1.0" optional="true" label="The fraction of samples to be used for fitting the individual base learners" help="@HELP@"/> + </xml> + + <xml name="presort"> + <param argument="presort" type="select" label="Whether to presort the data to speed up the finding of best splits in fitting" > + <option value="auto" selected="true">auto</option> + <option value="true">true</option> + <option value="false">false</option> + </param> + </xml> + + <!--Parameters--> + <xml name="tol" token_default_value="0.0" token_help_text="Early stopping heuristics based on the relative center changes. Set to default (0.0) to disable this convergence detection."> + <param argument="tol" type="float" optional="true" value="@DEFAULT_VALUE@" label="Tolerance" help="@HELP_TEXT@"/> + </xml> + + <xml name="n_clusters" token_default_value="8"> + <param argument="n_clusters" type="integer" optional="true" value="@DEFAULT_VALUE@" label="Number of clusters" help=" "/> + </xml> + + <xml name="fit_intercept" token_checked="true"> + <param argument="fit_intercept" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolfalse" checked="@CHECKED@" label="Estimate the intercept" help="If false, the data is assumed to be already centered."/> + </xml> + + <xml name="n_jobs" token_default_value="1" token_label="The number of jobs to run in parallel for both fit and predict"> + <param argument="n_jobs" type="integer" value="@DEFAULT_VALUE@" optional="true" label="@LABEL@" help="If -1, then the number of jobs is set to the number of cores"/> + </xml> + + <xml name="n_iter" token_default_value="5" token_help_text="The number of passes over the training data (aka epochs). "> + <param argument="n_iter" type="integer" optional="true" value="@DEFAULT_VALUE@" label="Number of iterations" help="@HELP_TEXT@"/> + </xml> + + <xml name="shuffle" token_checked="true" token_help_text=" " token_label="Shuffle data after each iteration"> + <param argument="shuffle" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolfalse" checked="@CHECKED@" label="@LABEL@" help="@HELP_TEXT@"/> + </xml> + + <xml name="random_state" token_default_value="" token_help_text="Integer number. The seed of the pseudo random number generator to use when shuffling the data. A fixed seed allows reproducible results."> + <param argument="random_state" type="integer" optional="true" value="@DEFAULT_VALUE@" label="Random seed number" help="@HELP_TEXT@"/> + </xml> + + <xml name="warm_start" token_checked="true" token_help_text="When set to True, reuse the solution of the previous call to fit as initialization,otherwise, just erase the previous solution."> + <param argument="warm_start" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolfalse" checked="@CHECKED@" label="Perform warm start" help="@HELP_TEXT@"/> + </xml> + + <xml name="C" token_default_value="1.0" token_help_text="Penalty parameter C of the error term."> + <param argument="C" type="float" optional="true" value="@DEFAULT_VALUE@" label="Penalty parameter" help="@HELP_TEXT@"/> + </xml> + + <!--xml name="class_weight" token_default_value="" token_help_text=""> + <param argument="class_weight" type="" optional="true" value="@DEFAULT_VALUE@" label="" help="@HELP_TEXT@"/> + </xml--> + + <xml name="alpha" token_default_value="0.0001" token_help_text="Constant that multiplies the regularization term if regularization is used. "> + <param argument="alpha" type="float" optional="true" value="@DEFAULT_VALUE@" label="Regularization coefficient" help="@HELP_TEXT@"/> + </xml> + + <xml name="n_samples" token_default_value="100" token_help_text="The total number of points equally divided among clusters."> + <param argument="n_samples" type="integer" optional="true" value="@DEFAULT_VALUE@" label="Number of samples" help="@HELP_TEXT@"/> + </xml> + + <xml name="n_features" token_default_value="2" token_help_text="Number of different numerical properties produced for each sample."> + <param argument="n_features" type="integer" optional="true" value="@DEFAULT_VALUE@" label="Number of features" help="@HELP_TEXT@"/> + </xml> + + <xml name="noise" token_default_value="0.0" token_help_text="Floating point number. "> + <param argument="noise" type="float" optional="true" value="@DEFAULT_VALUE@" label="Standard deviation of the Gaussian noise added to the data" help="@HELP_TEXT@"/> + </xml> + + <xml name="C" token_default_value="1.0" token_help_text="Penalty parameter C of the error term. "> + <param argument="C" type="float" optional="true" value="@DEFAULT_VALUE@" label="Penalty parameter" help="@HELP_TEXT@"/> + </xml> + + <xml name="max_iter" token_default_value="300" token_label="Maximum number of iterations per single run" token_help_text=" "> + <param argument="max_iter" type="integer" optional="true" value="@DEFAULT_VALUE@" label="@LABEL@" help="@HELP_TEXT@"/> + </xml> + + <xml name="n_init" token_default_value="10" > + <param argument="n_init" type="integer" optional="true" value="@DEFAULT_VALUE@" label="Number of runs with different centroid seeds" help=" "/> + </xml> + + <xml name="init"> + <param argument="init" type="select" label="Centroid initialization method" help="''k-means++'' selects initial cluster centers that speed up convergence. ''random'' chooses k observations (rows) at random from data as initial centroids."> + <option value="k-means++">k-means++</option> + <option value="random">random</option> + </param> + </xml> + + <xml name="gamma" token_default_value="1.0" token_label="Scaling parameter" token_help_text=" "> + <param argument="gamma" type="float" optional="true" value="@DEFAULT_VALUE@" label="@LABEL@" help="@HELP_TEXT@"/> + </xml> + + <xml name="degree" token_default_value="3" token_label="Degree of the polynomial" token_help_text=" "> + <param argument="degree" type="integer" optional="true" value="@DEFAULT_VALUE@" label="@LABEL@" help="@HELP_TEXT@"/> + </xml> + + <xml name="coef0" token_default_value="1" token_label="Zero coefficient" token_help_text=" "> + <param argument="coef0" type="integer" optional="true" value="@DEFAULT_VALUE@" label="@LABEL@" help="@HELP_TEXT@"/> + </xml> + + <xml name="pos_label" token_default_value=""> + <param argument="pos_label" type="integer" optional="true" value="@DEFAULT_VALUE@" label="Label of the positive class" help=" "/> + </xml> + + <xml name="average"> + <param argument="average" type="select" optional="true" label="Averaging type" help=" "> + <option value="micro">Calculate metrics globally by counting the total true positives, false negatives and false positives. (micro)</option> + <option value="samples">Calculate metrics for each instance, and find their average. Only meaningful for multilabel. (samples)</option> + <option value="macro">Calculate metrics for each label, and find their unweighted mean. This does not take label imbalance into account. (macro)</option> + <option value="weighted">Calculate metrics for each label, and find their average, weighted by support (the number of true instances for each label). This alters ‘macro’ to account for label imbalance; it can result in an F-score that is not between precision and recall. (weighted)</option> + <option value="None">None</option> + <yield/> + </param> + </xml> + + <xml name="beta"> + <param argument="beta" type="float" value="1.0" label="The strength of recall versus precision in the F-score" help=" "/> + </xml> + + + <!--Data interface--> + + <xml name="samples_tabular" token_multiple1="false" token_multiple2="false"> + <param name="infile1" type="data" format="tabular" label="Training samples dataset:"/> + <param name="header1" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolfalse" checked="False" label="Does the dataset contain header:" /> + <conditional name="column_selector_options_1"> + <expand macro="samples_column_selector_options" multiple="@MULTIPLE1@"/> + </conditional> + <param name="infile2" type="data" format="tabular" label="Dataset containing class labels:"/> + <param name="header2" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolfalse" checked="False" label="Does the dataset contain header:" /> + <conditional name="column_selector_options_2"> + <expand macro="samples_column_selector_options" column_option="selected_column_selector_option2" col_name="col2" multiple="@MULTIPLE2@" infile="infile2"/> + </conditional> + <yield/> + </xml> + + <xml name="samples_column_selector_options" token_column_option="selected_column_selector_option" token_col_name="col1" token_multiple="False" token_infile="infile1"> + <param name="@COLUMN_OPTION@" type="select" label="Choose how to select data by column:"> + <option value="by_index_number" selected="true">Select columns by column index number(s)</option> + <option value="by_header_name">Select columns by column header name(s)</option> + <option value="all_but_by_index_number">All columns but by column index number(s)</option> + <option value="all_but_by_header_name">All columns but by column header name(s)</option> + <option value="all_columns">All columns</option> + </param> + <when value="by_index_number"> + <param name="@COL_NAME@" multiple="@MULTIPLE@" type="data_column" data_ref="@INFILE@" label="Select target column(s):"/> + </when> + <when value="by_header_name"> + <param name="@COL_NAME@" type="text" value="" label="Type header name(s):" help="Comma-separated string. For example: target1,target2"/> + </when> + <when value="all_but_by_index_number"> + <param name="@COL_NAME@" multiple="@MULTIPLE@" type="data_column" data_ref="@INFILE@" label="Select target column(s):"/> + </when> + <when value="all_but_by_header_name"> + <param name="@COL_NAME@" type="text" value="" label="Type header name(s):" help="Comma-separated string. For example: target1,target2"/> + </when> + <when value="all_columns"> + </when> + </xml> + + <xml name="clf_inputs_extended" token_label1=" " token_label2=" " token_multiple="False"> + <conditional name="true_columns"> + <param name="selected_input1" type="select" label="Select the input type of true labels dataset:"> + <option value="tabular" selected="true">Tabular</option> + <option value="sparse">Sparse</option> + </param> + <when value="tabular"> + <param name="infile1" type="data" label="@LABEL1@"/> + <param name="col1" type="data_column" data_ref="infile1" label="Select the target column:"/> + </when> + <when value="sparse"> + <param name="infile1" type="data" format="txt" label="@LABEL1@"/> + </when> + </conditional> + <conditional name="predicted_columns"> + <param name="selected_input2" type="select" label="Select the input type of predicted labels dataset:"> + <option value="tabular" selected="true">Tabular</option> + <option value="sparse">Sparse</option> + </param> + <when value="tabular"> + <param name="infile2" type="data" label="@LABEL2@"/> + <param name="col2" multiple="@MULTIPLE@" type="data_column" data_ref="infile2" label="Select target column(s):"/> + </when> + <when value="sparse"> + <param name="infile2" type="data" format="txt" label="@LABEL1@"/> + </when> + </conditional> + </xml> + + <xml name="clf_inputs" token_label1="Dataset containing true labels (tabular):" token_label2="Dataset containing predicted values (tabular):" token_multiple1="False" token_multiple="False"> + <param name="infile1" type="data" format="tabular" label="@LABEL1@"/> + <param name="header1" type="boolean" optional="True" truevalue="booltrue" falsevalue="boolfalse" checked="False" label="Does the dataset contain header:" /> + <conditional name="column_selector_options_1"> + <expand macro="samples_column_selector_options" multiple="@MULTIPLE1@"/> + </conditional> + <param name="infile2" type="data" format="tabular" label="@LABEL2@"/> + <param name="header2" type="boolean" optional="True" truevalue="booltrue" falsevalue="boolfalse" checked="False" label="Does the dataset contain header:" /> + <conditional name="column_selector_options_2"> + <expand macro="samples_column_selector_options" column_option="selected_column_selector_option2" col_name="col2" multiple="@MULTIPLE@" infile="infile2"/> + </conditional> + </xml> + + <xml name="multiple_input" token_name="input_files" token_max_num="10" token_format="txt" token_label="Sparse matrix file (.mtx, .txt)" token_help_text="Specify a sparse matrix file in .txt format."> + <repeat name="@NAME@" min="1" max="@MAX_NUM@" title="Select input file(s):"> + <param name="input" type="data" format="@FORMAT@" label="@LABEL@" help="@HELP_TEXT@"/> + </repeat> + </xml> + + <xml name="sparse_target" token_label1="Select a sparse matrix:" token_label2="Select the tabular containing true labels:" token_multiple="False" token_format1="txt" token_format2="tabular" token_help1="" token_help2=""> + <param name="infile1" type="data" format="@FORMAT1@" label="@LABEL1@" help="@HELP1@"/> + <param name="infile2" type="data" format="@FORMAT2@" label="@LABEL2@" help="@HELP2@"/> + <param name="col2" multiple="@MULTIPLE@" type="data_column" data_ref="infile2" label="Select target column(s):"/> + </xml> + + <xml name="sl_mixed_input"> + <conditional name="input_options"> + <param name="selected_input" type="select" label="Select input type:"> + <option value="tabular" selected="true">tabular data</option> + <option value="sparse">sparse matrix</option> + </param> + <when value="tabular"> + <expand macro="samples_tabular" multiple1="true"/> + </when> + <when value="sparse"> + <expand macro="sparse_target"/> + </when> + </conditional> + </xml> + + <!--Advanced options--> + <xml name="nn_advanced_options"> + <section name="options" title="Advanced Options" expanded="False"> + <yield/> + <param argument="weights" type="select" label="Weight function" help="Used in prediction."> + <option value="uniform" selected="true">Uniform weights. All points in each neighborhood are weighted equally. (Uniform)</option> + <option value="distance">Weight points by the inverse of their distance. (Distance)</option> + </param> + <param argument="algorithm" type="select" label="Neighbor selection algorithm" help=" "> + <option value="auto" selected="true">Auto</option> + <option value="ball_tree">BallTree</option> + <option value="kd_tree">KDTree</option> + <option value="brute">Brute-force</option> + </param> + <param argument="leaf_size" type="integer" value="30" label="Leaf size" help="Used with BallTree and KDTree. Affects the time and memory usage of the constructed tree."/> + <!--param name="metric"--> + <!--param name="p"--> + <!--param name="metric_params"--> + </section> + </xml> + + <xml name="svc_advanced_options"> + <section name="options" title="Advanced Options" expanded="False"> + <yield/> + <param argument="kernel" type="select" optional="true" label="Kernel type" help="Kernel type to be used in the algorithm. If none is given, ‘rbf’ will be used."> + <option value="rbf" selected="true">rbf</option> + <option value="linear">linear</option> + <option value="poly">poly</option> + <option value="sigmoid">sigmoid</option> + <option value="precomputed">precomputed</option> + </param> + <param argument="degree" type="integer" optional="true" value="3" label="Degree of the polynomial (polynomial kernel only)" help="Ignored by other kernels. dafault : 3 "/> + <!--TODO: param argument="gamma" float, optional (default=’auto’) --> + <param argument="coef0" type="float" optional="true" value="0.0" label="Zero coefficient (polynomial and sigmoid kernels only)" + help="Independent term in kernel function. dafault: 0.0 "/> + <param argument="shrinking" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolfalse" checked="true" + label="Use the shrinking heuristic" help=" "/> + <param argument="probability" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolfalse" checked="false" + label="Enable probability estimates. " help="This must be enabled prior to calling fit, and will slow down that method."/> + <!-- param argument="cache_size"--> + <!--expand macro="class_weight"/--> + <expand macro="tol" default_value="0.001" help_text="Tolerance for stopping criterion. "/> + <expand macro="max_iter" default_value="-1" label="Solver maximum number of iterations" help_text="Hard limit on iterations within solver, or -1 for no limit."/> + <!--param argument="decision_function_shape"--> + <expand macro="random_state" help_text="Integer number. The seed of the pseudo random number generator to use when shuffling the data for probability estimation. A fixed seed allows reproducible results."/> + </section> + </xml> + + <xml name="spectral_clustering_advanced_options"> + <section name="options" title="Advanced Options" expanded="False"> + <expand macro="n_clusters"/> + <param argument="eigen_solver" type="select" value="" label="Eigen solver" help="The eigenvalue decomposition strategy to use."> + <option value="arpack" selected="true">arpack</option> + <option value="lobpcg">lobpcg</option> + <option value="amg">amg</option> + <!--None--> + </param> + <expand macro="random_state"/> + <expand macro="n_init"/> + <param argument="gamma" type="float" optional="true" value="1.0" label="Kernel scaling factor" help="Scaling factor of RBF, polynomial, exponential chi^2 and sigmoid affinity kernel. Ignored for affinity=''nearest_neighbors''."/> + <param argument="affinity" type="select" label="Affinity" help="Affinity kernel to use. "> + <option value="rbf" selected="true">RBF</option> + <option value="precomputed">precomputed</option> + <option value="nearest_neighbors">Nearset neighbors</option> + </param> + <param argument="n_neighbors" type="integer" optional="true" value="10" label="Number of neighbors" help="Number of neighbors to use when constructing the affinity matrix using the nearest neighbors method. Ignored for affinity=''rbf''"/> + <!--param argument="eigen_tol"--> + <param argument="assign_labels" type="select" label="Assign labels" help="The strategy to use to assign labels in the embedding space."> + <option value="kmeans" selected="true">kmeans</option> + <option value="discretize">discretize</option> + </param> + <param argument="degree" type="integer" optional="true" value="3" + label="Degree of the polynomial (polynomial kernel only)" help="Ignored by other kernels. dafault : 3 "/> + <param argument="coef0" type="integer" optional="true" value="1" + label="Zero coefficient (polynomial and sigmoid kernels only)" help="Ignored by other kernels. dafault : 1 "/> + <!--param argument="kernel_params"--> + </section> + </xml> + + <xml name="minibatch_kmeans_advanced_options"> + <section name="options" title="Advanced Options" expanded="False"> + <expand macro="n_clusters"/> + <expand macro="init"/> + <expand macro="n_init" default_value="3"/> + <expand macro="max_iter" default_value="100"/> + <expand macro="tol" help_text="Early stopping heuristics based on normalized center change. To disable set to 0.0 ."/> + <expand macro="random_state"/> + <param argument="batch_size" type="integer" optional="true" value="100" label="Batch size" help="Size of the mini batches."/> + <!--param argument="compute_labels"--> + <param argument="max_no_improvement" type="integer" optional="true" value="10" label="Maximum number of improvement attempts" help=" + Convergence detection based on inertia (the consecutive number of mini batches that doe not yield an improvement on the smoothed inertia). + To disable, set max_no_improvement to None. "/> + <param argument="init_size" type="integer" optional="true" value="" label="Number of random initialization samples" help="Number of samples to randomly sample for speeding up the initialization . ( default: 3 * batch_size )"/> + <param argument="reassignment_ratio" type="float" optional="true" value="0.01" label="Re-assignment ratio" help="Controls the fraction of the maximum number of counts for a center to be reassigned. Higher values yield better clustering results."/> + </section> + </xml> + + <xml name="kmeans_advanced_options"> + <section name="options" title="Advanced Options" expanded="False"> + <expand macro="n_clusters"/> + <expand macro="init"/> + <expand macro="n_init"/> + <expand macro="max_iter"/> + <expand macro="tol" default_value="0.0001" help_text="Relative tolerance with regards to inertia to declare convergence."/> + <!--param argument="precompute_distances"/--> + <expand macro="random_state"/> + <param argument="copy_x" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolfalse" checked="true" label="Use a copy of data for precomputing distances" help="Mofifying the original data introduces small numerical differences caused by subtracting and then adding the data mean."/> + </section> + </xml> + + <xml name="birch_advanced_options"> + <section name="options" title="Advanced Options" expanded="False"> + <param argument="threshold" type="float" optional="true" value="0.5" label="Subcluster radius threshold" help="The radius of the subcluster obtained by merging a new sample; the closest subcluster should be less than the threshold to avoid a new subcluster."/> + <param argument="branching_factor" type="integer" optional="true" value="50" label="Maximum number of subclusters per branch" help="Maximum number of CF subclusters in each node."/> + <expand macro="n_clusters" default_value="3"/> + <!--param argument="compute_labels"/--> + </section> + </xml> + + <xml name="dbscan_advanced_options"> + <section name="options" title="Advanced Options" expanded="False"> + <param argument="eps" type="float" optional="true" value="0.5" label="Maximum neighborhood distance" help="The maximum distance between two samples for them to be considered as in the same neighborhood."/> + <param argument="min_samples" type="integer" optional="true" value="5" label="Minimal core point density" help="The number of samples (or total weight) in a neighborhood for a point (including the point itself) to be considered as a core point."/> + <param argument="metric" type="text" optional="true" value="euclidean" label="Metric" help="The metric to use when calculating distance between instances in a feature array."/> + <param argument="algorithm" type="select" label="Pointwise distance computation algorithm" help="The algorithm to be used by the NearestNeighbors module to compute pointwise distances and find nearest neighbors."> + <option value="auto" selected="true">auto</option> + <option value="ball_tree">ball_tree</option> + <option value="kd_tree">kd_tree</option> + <option value="brute">brute</option> + </param> + <param argument="leaf_size" type="integer" optional="true" value="30" label="Leaf size" help="Leaf size passed to BallTree or cKDTree. Memory and time efficieny factor in tree constrution and querying."/> + </section> + </xml> + + <xml name="clustering_algorithms_options"> + <conditional name="algorithm_options"> + <param name="selected_algorithm" type="select" label="Clustering Algorithm"> + <option value="KMeans" selected="true">KMeans</option> + <option value="SpectralClustering">Spectral Clustering</option> + <option value="MiniBatchKMeans">Mini Batch KMeans</option> + <option value="DBSCAN">DBSCAN</option> + <option value="Birch">Birch</option> + </param> + <when value="KMeans"> + <expand macro="kmeans_advanced_options"/> + </when> + <when value="DBSCAN"> + <expand macro="dbscan_advanced_options"/> + </when> + <when value="Birch"> + <expand macro="birch_advanced_options"/> + </when> + <when value="SpectralClustering"> + <expand macro="spectral_clustering_advanced_options"/> + </when> + <when value="MiniBatchKMeans"> + <expand macro="minibatch_kmeans_advanced_options"/> + </when> + </conditional> + </xml> + + <xml name="distance_metrics"> + <param argument="metric" type="select" label="Distance metric" help=" "> + <option value="euclidean" selected="true">euclidean</option> + <option value="cityblock">cityblock</option> + <option value="cosine">cosine</option> + <option value="l1">l1</option> + <option value="l2">l2</option> + <option value="manhattan">manhattan</option> + <yield/> + </param> + </xml> + + <xml name="distance_nonsparse_metrics"> + <option value="braycurtis">braycurtis</option> + <option value="canberra">canberra</option> + <option value="chebyshev">chebyshev</option> + <option value="correlation">correlation</option> + <option value="dice">dice</option> + <option value="hamming">hamming</option> + <option value="jaccard">jaccard</option> + <option value="kulsinski">kulsinski</option> + <option value="mahalanobis">mahalanobis</option> + <option value="matching">matching</option> + <option value="minkowski">minkowski</option> + <option value="rogerstanimoto">rogerstanimoto</option> + <option value="russellrao">russellrao</option> + <option value="seuclidean">seuclidean</option> + <option value="sokalmichener">sokalmichener</option> + <option value="sokalsneath">sokalsneath</option> + <option value="sqeuclidean">sqeuclidean</option> + <option value="yule">yule</option> + </xml> + + <xml name="pairwise_kernel_metrics"> + <param argument="metric" type="select" label="Pirwise Kernel metric" help=" "> + <option value="rbf" selected="true">rbf</option> + <option value="sigmoid">sigmoid</option> + <option value="polynomial">polynomial</option> + <option value="linear" selected="true">linear</option> + <option value="chi2">chi2</option> + <option value="additive_chi2">additive_chi2</option> + </param> + </xml> + + <xml name="sparse_pairwise_metric_functions"> + <param name="selected_metric_function" type="select" label="Select the pairwise metric you want to compute:"> + <option value="euclidean_distances" selected="true">Euclidean distance matrix</option> + <option value="pairwise_distances">Distance matrix</option> + <option value="pairwise_distances_argmin">Minimum distances between one point and a set of points</option> + <yield/> + </param> + </xml> + + <xml name="pairwise_metric_functions"> + <option value="additive_chi2_kernel" >Additive chi-squared kernel</option> + <option value="chi2_kernel">Exponential chi-squared kernel</option> + <option value="linear_kernel">Linear kernel</option> + <option value="manhattan_distances">L1 distances</option> + <option value="pairwise_kernels">Kernel</option> + <option value="polynomial_kernel">Polynomial kernel</option> + <option value="rbf_kernel">Gaussian (rbf) kernel</option> + <option value="laplacian_kernel">Laplacian kernel</option> + </xml> + + <xml name="sparse_pairwise_condition"> + <when value="pairwise_distances"> + <section name="options" title="Advanced Options" expanded="False"> + <expand macro="distance_metrics"> + <yield/> + </expand> + </section> + </when> + <when value="euclidean_distances"> + <section name="options" title="Advanced Options" expanded="False"> + <param argument="squared" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolfalse" checked="false" + label="Return squared Euclidean distances" help=" "/> + </section> + </when> + </xml> + + <xml name="argmin_distance_condition"> + <when value="pairwise_distances_argmin"> + <section name="options" title="Advanced Options" expanded="False"> + <param argument="axis" type="integer" optional="true" value="1" label="Axis" help="Axis along which the argmin and distances are to be computed."/> + <expand macro="distance_metrics"> + <yield/> + </expand> + <param argument="batch_size" type="integer" optional="true" value="500" label="Batch size" help="Number of rows to be processed in each batch run."/> + </section> + </when> + </xml> + + <xml name="sparse_preprocessors"> + <param name="selected_pre_processor" type="select" label="Select a preprocessor:"> + <option value="StandardScaler" selected="true">Standard Scaler (Standardizes features by removing the mean and scaling to unit variance)</option> + <option value="Binarizer">Binarizer (Binarizes data)</option> + <option value="Imputer">Imputer (Completes missing values)</option> + <option value="MaxAbsScaler">Max Abs Scaler (Scales features by their maximum absolute value)</option> + <option value="Normalizer">Normalizer (Normalizes samples individually to unit norm)</option> + <yield/> + </param> + </xml> + + <xml name="sparse_preprocessors_ext"> + <expand macro="sparse_preprocessors"> + <option value="KernelCenterer">Kernel Centerer (Centers a kernel matrix)</option> + <option value="MinMaxScaler">Minmax Scaler (Scales features to a range)</option> + <option value="PolynomialFeatures">Polynomial Features (Generates polynomial and interaction features)</option> + <option value="RobustScaler">Robust Scaler (Scales features using outlier-invariance statistics)</option> + </expand> + </xml> + + <xml name="sparse_preprocessor_options"> + <when value="Binarizer"> + <section name="options" title="Advanced Options" expanded="False"> + <param argument="copy" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolfalse" checked="true" + label="Use a copy of data for precomputing binarization" help=" "/> + <param argument="threshold" type="float" optional="true" value="0.0" + label="Threshold" + help="Feature values below or equal to this are replaced by 0, above it by 1. Threshold may not be less than 0 for operations on sparse matrices. "/> + </section> + </when> + <when value="Imputer"> + <section name="options" title="Advanced Options" expanded="False"> + <param argument="copy" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolfalse" checked="true" + label="Use a copy of data for precomputing imputation" help=" "/> + <param argument="strategy" type="select" optional="true" label="Imputation strategy" help=" "> + <option value="mean" selected="true">Replace missing values using the mean along the axis</option> + <option value="median">Replace missing values using the median along the axis</option> + <option value="most_frequent">Replace missing using the most frequent value along the axis</option> + </param> + <param argument="missing_values" type="text" optional="true" value="NaN" + label="Placeholder for missing values" help="For missing values encoded as numpy.nan, use the string value “NaN”"/> + <param argument="axis" type="boolean" optional="true" truevalue="1" falsevalue="0" + label="Impute along axis = 1" help="If fasle, axis = 0 is selected for imputation. "/> + <!--param argument="axis" type="select" optional="true" label="The axis along which to impute" help=" "> + <option value="0" selected="true">Impute along columns</option> + <option value="1">Impute along rows</option> + </param--> + </section> + </when> + <when value="StandardScaler"> + <section name="options" title="Advanced Options" expanded="False"> + <param argument="copy" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolfalse" checked="true" + label="Use a copy of data for performing inplace scaling" help=" "/> + <param argument="with_mean" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolfalse" checked="true" + label="Center the data before scaling" help=" "/> + <param argument="with_std" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolfalse" checked="true" + label="Scale the data to unit variance (or unit standard deviation)" help=" "/> + </section> + </when> + <when value="MaxAbsScaler"> + <section name="options" title="Advanced Options" expanded="False"> + <param argument="copy" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolfalse" checked="true" + label="Use a copy of data for precomputing scaling" help=" "/> + </section> + </when> + <when value="Normalizer"> + <section name="options" title="Advanced Options" expanded="False"> + <param argument="norm" type="select" optional="true" label="The norm to use to normalize non zero samples" help=" "> + <option value="l1" selected="true">l1</option> + <option value="l2">l2</option> + <option value="max">max</option> + </param> + <param argument="copy" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolfalse" checked="true" + label="Use a copy of data for precomputing row normalization" help=" "/> + </section> + </when> + <yield/> + </xml> + + <xml name="sparse_preprocessor_options_ext"> + <expand macro="sparse_preprocessor_options"> + <when value="KernelCenterer"> + <section name="options" title="Advanced Options" expanded="False"> + </section> + </when> + <when value="MinMaxScaler"> + <section name="options" title="Advanced Options" expanded="False"> + <!--feature_range--> + <param argument="copy" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolflase" checked="true" + label="Use a copy of data for precomputing normalization" help=" "/> + </section> + </when> + <when value="PolynomialFeatures"> + <section name="options" title="Advanced Options" expanded="False"> + <param argument="degree" type="integer" optional="true" value="2" label="The degree of the polynomial features " help=""/> + <param argument="interaction_only" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolflase" checked="false" label="Produce interaction features only" help="(Features that are products of at most degree distinct input features) "/> + <param argument="include_bias" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolflase" checked="true" label="Include a bias column" help="Feature in which all polynomial powers are zero "/> + </section> + </when> + <when value="RobustScaler"> + <section name="options" title="Advanced Options" expanded="False"> + <!--=True, =True, copy=True--> + <param argument="with_centering" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolflase" checked="true" + label="Center the data before scaling" help=" "/> + <param argument="with_scaling" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolflase" checked="true" + label="Scale the data to interquartile range" help=" "/> + <param argument="copy" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolflase" checked="true" + label="Use a copy of data for inplace scaling" help=" "/> + </section> + </when> + </expand> + </xml> + + <xml name="fs_selectfrommodel_prefitted"> + <param name="input_mode" type="select" label="Construct a new estimator from a selection list?" > + <option value="new" selected="true">Yes</option> + <option value="prefitted">No. Load a prefitted estimator</option> + </param> + <when value="new"> + <expand macro="estimator_selector_all"/> + </when> + <when value="prefitted"> + <param name="fitted_estimator" type="data" format='zip' label="Load a prefitted estimator" /> + </when> + </xml> + + <xml name="fs_selectfrommodel_no_prefitted"> + <param name="input_mode" type="select" label="Construct a new estimator from a selection list?" > + <option value="new" selected="true">Yes</option> + </param> + <when value="new"> + <expand macro="estimator_selector_all"/> + </when> + </xml> + + <xml name="feature_selection_all"> + <conditional name="fs_algorithm_selector"> + <param name="selected_algorithm" type="select" label="Select a feature selection algorithm"> + <option value="SelectKBest" selected="true">SelectKBest - Select features according to the k highest scores</option> + <option value="SelectFromModel">SelectFromModel - Meta-transformer for selecting features based on importance weights</option> + <option value="GenericUnivariateSelect">GenericUnivariateSelect - Univariate feature selector with configurable strategy</option> + <option value="SelectPercentile">SelectPercentile - Select features according to a percentile of the highest scores</option> + <option value="SelectFpr">SelectFpr - Filter: Select the p-values below alpha based on a FPR test</option> + <option value="SelectFdr">SelectFdr - Filter: Select the p-values for an estimated false discovery rate</option> + <option value="SelectFwe">SelectFwe - Filter: Select the p-values corresponding to Family-wise error rate</option> + <option value="RFE">RFE - Feature ranking with recursive feature elimination</option> + <option value="RFECV">RFECV - Feature ranking with recursive feature elimination and cross-validated selection of the best number of features</option> + <option value="VarianceThreshold">VarianceThreshold - Feature selector that removes all low-variance features</option> + </param> + <when value="SelectFromModel"> + <conditional name="model_inputter"> + <yield/> + </conditional> + <section name="options" title="Advanced Options" expanded="False"> + <param argument="threshold" type="text" value="" optional="true" label="threshold" help="The threshold value to use for feature selection. e.g. 'mean', 'median', '1.25*mean'." /> + <param argument="norm_order" type="integer" value="1" label="norm_order" help="Order of the norm used to filter the vectors of coefficients below threshold in the case where the coef_ attribute of the estimator is of dimension 2. " /> + </section> + </when> + <when value="GenericUnivariateSelect"> + <expand macro="feature_selection_score_function" /> + <section name="options" title="Advanced Options" expanded="False"> + <param argument="mode" type="select" label="Feature selection mode"> + <option value="percentile">percentile</option> + <option value="k_best">k_best</option> + <option value="fpr">fpr</option> + <option value="fdr">fdr</option> + <option value="fwe">fwe</option> + </param> + <param argument="param" type="float" value="" optional="true" label="Parameter of the corresponding mode" help="float or int depending on the feature selection mode" /> + </section> + </when> + <when value="SelectPercentile"> + <expand macro="feature_selection_score_function" /> + <section name="options" title="Advanced Options" expanded="False"> + <param argument="percentile" type="integer" value="10" optional="True" label="Percent of features to keep" /> + </section> + </when> + <when value="SelectKBest"> + <expand macro="feature_selection_score_function" /> + <section name="options" title="Advanced Options" expanded="False"> + <param argument="k" type="integer" value="10" optional="True" label="Number of top features to select" help="No 'all' option is supported." /> + </section> + </when> + <when value="SelectFpr"> + <expand macro="feature_selection_score_function" /> + <section name="options" title="Advanced Options" expanded="False"> + <param argument="alpha" type="float" value="" optional="True" label="Alpha" help="The highest p-value for features to be kept."/> + </section> + </when> + <when value="SelectFdr"> + <expand macro="feature_selection_score_function" /> + <section name="options" title="Advanced Options" expanded="False"> + <param argument="alpha" type="float" value="" optional="True" label="Alpha" help="The highest uncorrected p-value for features to keep."/> + </section> + </when> + <when value="SelectFwe"> + <expand macro="feature_selection_score_function" /> + <section name="options" title="Advanced Options" expanded="False"> + <param argument="alpha" type="float" value="" optional="True" label="Alpha" help="The highest uncorrected p-value for features to keep."/> + </section> + </when> + <when value="RFE"> + <expand macro="estimator_selector_all"/> + <section name="options" title="Advanced Options" expanded="False"> + <param argument="n_features_to_select" type="integer" value="" optional="true" label="n_features_to_select" help="The number of features to select. If None, half of the features are selected." /> + <param argument="step" type="float" value="1" label="step" optional="true" help="Default = 1. " /> + <param argument="verbose" type="integer" value="0" label="verbose" help="Controls verbosity of output." /> + </section> + </when> + <when value="RFECV"> + <expand macro="estimator_selector_all"/> + <section name="options" title="Advanced Options" expanded="False"> + <param argument="step" type="float" value="1" label="step" optional="true" help="Default = 1. " /> + <param argument="cv" type="integer" value="" optional="true" label="cv" help="Determines the cross-validation splitting strategy" /> + <param argument="scoring" type="text" value="" optional="true" label="scoring" help="A string (see model evaluation documentation) or a scorer callable object / function with signature scorer(estimator, X, y)."/> + <param argument="verbose" type="integer" value="0" label="verbose" help="Controls verbosity of output." /> + <param argument="n_jobs" type="integer" value="1" label="n_jobs" help="Number of cores to run in parallel while fitting across folds. Defaults to 1 core."/> + </section> + </when> + <when value="VarianceThreshold"> + <section name="options" title="Options" expanded="False"> + <param argument="threshold" type="float" value="" optional="True" label="Threshold" help="Features with a training-set variance lower than this threshold will be removed."/> + </section> + </when> + <!--when value="chi2"> + </when> + <when value="f_classif"> + </when> + <when value="f_regression"> + </when> + <when value="mutual_info_classif"> + </when> + <when value="mutual_info_regression"> + </when--> + </conditional> + </xml> + + <xml name="feature_selection_score_function"> + <param argument="score_func" type="select" label="Select a score function"> + <option value="chi2">chi2 - Compute chi-squared stats between each non-negative feature and class</option> + <option value="f_classif">f_classif - Compute the ANOVA F-value for the provided sample</option> + <option value="f_regression">f_regression - Univariate linear regression tests</option> + <option value="mutual_info_classif">mutual_info_classif - Estimate mutual information for a discrete target variable</option> + <option value="mutual_info_regression">mutual_info_regression - Estimate mutual information for a continuous target variable</option> + </param> + </xml> + + <xml name="feature_selection_output_mothods"> + <conditional name="output_method_selector"> + <param name="selected_method" type="select" label="Select an output method:"> + <option value="fit_transform">fit_transform - Fit to data, then transform it</option> + <option value="get_support">get_support - Get a mask, or integer index, of the features selected</option> + </param> + <when value="fit_transform"> + <!--**fit_params--> + </when> + <when value="get_support"> + <param name="indices" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolfalse" checked="false" label="Indices" help="If True, the return value will be an array of integers, rather than a boolean mask."/> + </when> + </conditional> + </xml> + + <xml name="model_validation_common_options"> + <param argument="cv" type="integer" value="" optional="true" label="cv" help="The number of folds in a (Stratified)KFold" /> + <expand macro="n_jobs"/> + <expand macro="verbose"/> + <yield/> + </xml> + + <xml name="scoring"> + <param argument="scoring" type="text" value="" optional="true" label="scoring" help="A metric used to evaluate the estimator"/> + </xml> + + <xml name="pre_dispatch" token_type="hidden" token_default_value="all" token_help="Number of predispatched jobs for parallel execution"> + <param argument="pre_dispatch" type="@TYPE@" value="@DEFAULT_VALUE@" optional="true" label="pre_dispatch" help="@HELP@"/> + </xml> + + <xml name="search_cv_estimator"> + <param name="infile_pipeline" type="data" format="zip" label="Choose the dataset containing pipeline object:"/> + <section name="search_params_builder" title="Search parameters Builder" expanded="true"> + <repeat name="param_set" min="1" max="20" title="Parameter setting for search:"> + <conditional name="search_param_selector"> + <param name="selected_param_type" type="select" label="Choose the transformation the parameter belongs to"> + <option value="final_estimator_p" selected="true">Final estimator</option> + <option value="prep_1_p">Pre-processing step #1</option> + <option value="prep_2_p">Pre-processing step #2</option> + <option value="prep_3_p">Pre-processing step #3</option> + <option value="prep_4_p">Pre-processing step #4</option> + <option value="prep_5_p">Pre-processing step #5</option> + </param> + <when value="final_estimator_p"> + <expand macro="search_param_input" /> + </when> + <when value="prep_1_p"> + <expand macro="search_param_input" label="Pre_processing component #1 parameter:" help="One parameter per box. For example: with_centering: [True, False]."/> + </when> + <when value="prep_2_p"> + <expand macro="search_param_input" label="Pre_processing component #2 parameter:" help="One parameter per box. For example: k: [3, 5, 7, 9]. See bottom for more examples"/> + </when> + <when value="prep_3_p"> + <expand macro="search_param_input" label="Pre_processing component #3 parameter:" help="One parameter per box. For example: n_components: [1, 10, 100, 1000]. See bottom for more examples"/> + </when> + <when value="prep_4_p"> + <expand macro="search_param_input" label="Pre_processing component #4 parameter:" help="One parameter per box. For example: n_components: [1, 10, 100, 1000]. See bottom for more examples"/> + </when> + <when value="prep_5_p"> + <expand macro="search_param_input" label="Pre_processing component #5 parameter:" help="One parameter per box. For example: affinity: ['euclidean', 'l1', 'l2', 'manhattan']. See bottom for more examples"/> + </when> + </conditional> + </repeat> + </section> + </xml> + + <xml name="search_param_input" token_label="Estimator parameter:" token_help="One parameter per box. For example: C: [1, 10, 100, 1000]. See bottom for more examples"> + <param name="search_p" type="text" value="" size="100" optional="true" label="@LABEL@" help="@HELP@"> + <sanitizer> + <valid initial="default"> + <add value="'"/> + <add value="""/> + <add value="["/> + <add value="]"/> + </valid> + </sanitizer> + </param> + </xml> + + <xml name="search_cv_options"> + <expand macro="scoring"/> + <expand macro="model_validation_common_options"/> + <expand macro="pre_dispatch" value="2*n_jobs" help="Controls the number of jobs that get dispatched during parallel execution"/> + <param argument="iid" type="boolean" truevalue="booltrue" falsevalue="boolfalse" checked="true" label="iid" help="If True, data is identically distributed across the folds"/> + <param argument="refit" type="boolean" truevalue="booltrue" falsevalue="boolfalse" checked="true" label="refit" help="Refit an estimator using the best found parameters on the whole dataset."/> + <!--error_score--> + <param argument="return_train_score" type="boolean" truevalue="booltrue" falsevalue="boolfalse" checked="false" label="return_train_score" help=""/> + </xml> + + <xml name="estimator_selector_all"> + <conditional name="estimator_selector"> + <param name="selected_module" type="select" label="Choose the module that contains target estimator:" > + <option value="svm" selected="true">sklearn.svm</option> + <option value="linear_model">sklearn.linear_model</option> + <option value="ensemble">sklearn.ensemble</option> + <option value="naive_bayes">sklearn.naive_bayes</option> + <option value="tree">sklearn.tree</option> + <option value="neighbors">sklearn.neighbors</option> + <option value="xgboost">xgboost</option> + <!--more--> + </param> + <when value="svm"> + <param name="selected_estimator" type="select" label="Choose estimator class:"> + <option value="LinearSVC" selected="true">LinearSVC</option> + <option value="LinearSVR">LinearSVR</option> + <option value="NuSVC">NuSVC</option> + <option value="NuSVR">NuSVR</option> + <option value="OneClassSVM">OneClassSVM</option> + <option value="SVC">SVC</option> + <option value="SVR">SVR</option> + </param> + <expand macro="estimator_params_text"/> + </when> + <when value="linear_model"> + <param name="selected_estimator" type="select" label="Choose estimator class:"> + <option value="ARDRegression" selected="true">ARDRegression</option> + <option value="BayesianRidge">BayesianRidge</option> + <option value="ElasticNet">ElasticNet</option> + <option value="ElasticNetCV">ElasticNetCV</option> + <option value="HuberRegressor">HuberRegressor</option> + <option value="Lars">Lars</option> + <option value="LarsCV">LarsCV</option> + <option value="Lasso">Lasso</option> + <option value="LassoCV">LassoCV</option> + <option value="LassoLars">LassoLars</option> + <option value="LassoLarsCV">LassoLarsCV</option> + <option value="LassoLarsIC">LassoLarsIC</option> + <option value="LinearRegression">LinearRegression</option> + <option value="LogisticRegression">LogisticRegression</option> + <option value="LogisticRegressionCV">LogisticRegressionCV</option> + <option value="MultiTaskLasso">MultiTaskLasso</option> + <option value="MultiTaskElasticNet">MultiTaskElasticNet</option> + <option value="MultiTaskLassoCV">MultiTaskLassoCV</option> + <option value="MultiTaskElasticNetCV">MultiTaskElasticNetCV</option> + <option value="OrthogonalMatchingPursuit">OrthogonalMatchingPursuit</option> + <option value="OrthogonalMatchingPursuitCV">OrthogonalMatchingPursuitCV</option> + <option value="PassiveAggressiveClassifier">PassiveAggressiveClassifier</option> + <option value="PassiveAggressiveRegressor">PassiveAggressiveRegressor</option> + <option value="Perceptron">Perceptron</option> + <option value="RANSACRegressor">RANSACRegressor</option> + <option value="Ridge">Ridge</option> + <option value="RidgeClassifier">RidgeClassifier</option> + <option value="RidgeClassifierCV">RidgeClassifierCV</option> + <option value="RidgeCV">RidgeCV</option> + <option value="SGDClassifier">SGDClassifier</option> + <option value="SGDRegressor">SGDRegressor</option> + <option value="TheilSenRegressor">TheilSenRegressor</option> + </param> + <expand macro="estimator_params_text"/> + </when> + <when value="ensemble"> + <param name="selected_estimator" type="select" label="Choose estimator class:"> + <option value="AdaBoostClassifier" selected="true">AdaBoostClassifier</option> + <option value="AdaBoostRegressor">AdaBoostRegressor</option> + <option value="BaggingClassifier">BaggingClassifier</option> + <option value="BaggingRegressor">BaggingRegressor</option> + <option value="ExtraTreesClassifier">ExtraTreesClassifier</option> + <option value="ExtraTreesRegressor">ExtraTreesRegressor</option> + <option value="GradientBoostingClassifier">GradientBoostingClassifier</option> + <option value="GradientBoostingRegressor">GradientBoostingRegressor</option> + <option value="IsolationForest">IsolationForest</option> + <option value="RandomForestClassifier">RandomForestClassifier</option> + <option value="RandomForestRegressor">RandomForestRegressor</option> + <option value="RandomTreesEmbedding">RandomTreesEmbedding</option> + <option value="VotingClassifier">VotingClassifier</option> + </param> + <expand macro="estimator_params_text"/> + </when> + <when value="naive_bayes"> + <param name="selected_estimator" type="select" label="Choose estimator class:"> + <option value="BernoulliNB" selected="true">BernoulliNB</option> + <option value="GaussianNB">GaussianNB</option> + <option value="MultinomialNB">MultinomialNB</option> + </param> + <expand macro="estimator_params_text"/> + </when> + <when value="tree"> + <param name="selected_estimator" type="select" label="Choose estimator class:"> + <option value="DecisionTreeClassifier" selected="true">DecisionTreeClassifier</option> + <option value="DecisionTreeRegressor">DecisionTreeRegressor</option> + <option value="ExtraTreeClassifier">ExtraTreeClassifier</option> + <option value="ExtraTreeRegressor">ExtraTreeRegressor</option> + </param> + <expand macro="estimator_params_text"/> + </when> + <when value="neighbors"> + <param name="selected_estimator" type="select" label="Choose estimator class:"> + <option value="BallTree" selected="true">BallTree</option> + <option value="DistanceMetric">DistanceMetric</option> + <option value="KDTree">KDTree</option> + <option value="KernelDensity">KernelDensity</option> + <option value="KNeighborsClassifier">KNeighborsClassifier</option> + <option value="KNeighborsRegressor">KNeighborsRegressor</option> + <option value="LocalOutlierFactor">LocalOutlierFactor</option> + <option value="RadiusNeighborsClassifier">RadiusNeighborsClassifier</option> + <option value="RadiusNeighborsRegressor">RadiusNeighborsRegressor</option> + <option value="NearestCentroid">NearestCentroid</option> + <option value="NearestNeighbors">NearestNeighbors</option> + </param> + <expand macro="estimator_params_text"/> + </when> + <when value="xgboost"> + <param name="selected_estimator" type="select" label="Choose estimator class:"> + <option value="XGBRegressor" selected="true">XGBRegressor</option> + <option value="XGBClassifier">XGBClassifier</option> + </param> + <expand macro="estimator_params_text"/> + </when> + </conditional> + </xml> + + <xml name="estimator_params_text" token_label="Type in estimator parameters:" + token_help="Parameters in dictionary without braces ('{}'), e.g., 'C': 1, 'kernel': 'linear'. No double quotes. Leave this box blank for default estimator."> + <param name="text_params" type="text" value="" size="50" optional="true" label="@LABEL@" help="@HELP@"> + <sanitizer> + <valid initial="default"> + <add value="'"/> + </valid> + </sanitizer> + </param> + </xml> + + <xml name="kernel_approximation_all"> + <conditional name="kernel_approximation_selector"> + <param name="select_algorithm" type="select" label="Choose a kernel approximation algorithm:"> + <option value="Nystroem" selected="true">Nystroem</option> + <option value="RBFSampler">RBFSampler</option> + <option value="AdditiveChi2Sampler">AdditiveChi2Sampler</option> + <option value="SkewedChi2Sampler">SkewedChi2Sampler</option> + </param> + <when value="Nystroem"> + <expand macro="estimator_params_text" label="Type in kernel approximater parameters:" + help="Parameters in dictionary without braces ('{}'), e.g., 'n_components': 100, 'kernel': 'rbf'. No double quotes. Leave this box blank for class default."/> + </when> + <when value="RBFSampler"> + <expand macro="estimator_params_text" label="Type in kernel approximater parameters:" + help="Parameters in dictionary without braces ('{}'), e.g., 'n_components': 100, 'gamma': 1.0. No double quotes. Leave this box blank for class default."/> + </when> + <when value="AdditiveChi2Sampler"> + <expand macro="estimator_params_text" label="Type in kernel approximater parameters:" + help="Parameters in dictionary without braces ('{}'), e.g., 'sample_steps': 2, 'sample_interval': None. No double quotes. Leave this box blank for class default."/> + </when> + <when value="SkewedChi2Sampler"> + <expand macro="estimator_params_text" label="Type in kernel approximater parameters:" + help="Parameters in dictionary without braces ('{}'), e.g., 'n_components': 100, 'skewedness': 1.0. No double quotes. Leave this box blank for class default."/> + </when> + </conditional> + </xml> + + <xml name="matrix_decomposition_all"> + <conditional name="matrix_decomposition_selector"> + <param name="select_algorithm" type="select" label="Choose a matrix decomposition algorithm:"> + <option value="DictionaryLearning" selected="true">DictionaryLearning</option> + <option value="FactorAnalysis">FactorAnalysis</option> + <option value="FastICA">FastICA</option> + <option value="IncrementalPCA">IncrementalPCA</option> + <option value="KernelPCA">KernelPCA</option> + <option value="LatentDirichletAllocation">LatentDirichletAllocation</option> + <option value="MiniBatchDictionaryLearning">MiniBatchDictionaryLearning</option> + <option value="MiniBatchSparsePCA">MiniBatchSparsePCA</option> + <option value="NMF">NMF</option> + <option value="PCA">PCA</option> + <option value="SparsePCA">SparsePCA</option> + <option value="SparseCoder">SparseCoder</option> + <option value="TruncatedSVD">TruncatedSVD</option> + </param> + <when value="DictionaryLearning"> + <expand macro="estimator_params_text" label="Type in maxtrix decomposition parameters:" + help="Parameters in dictionary without braces ('{}'), e.g., 'n_components': None, 'alpha': 1.0. No double quotes. Leave this box blank for class default."/> + </when> + <when value="FactorAnalysis"> + <expand macro="estimator_params_text" label="Type in maxtrix decomposition parameters:" + help="Parameters in dictionary without braces ('{}'), e.g., 'n_components': 100, 'random_state': 42. No double quotes. Leave this box blank for class default."/> + </when> + <when value="FastICA"> + <expand macro="estimator_params_text" label="Type in maxtrix decomposition parameters:" + help="Parameters in dictionary without braces ('{}'), e.g., 'n_components': 100, 'random_state': 42. No double quotes. Leave this box blank for class default."/> + </when> + <when value="IncrementalPCA"> + <expand macro="estimator_params_text" label="Type in maxtrix decomposition parameters:" + help="Parameters in dictionary without braces ('{}'), e.g., 'n_components': 100, 'whiten': False. No double quotes. Leave this box blank for class default."/> + </when> + <when value="KernelPCA"> + <expand macro="estimator_params_text" label="Type in maxtrix decomposition parameters:" + help="Parameters in dictionary without braces ('{}'), e.g., 'n_components': 100, 'random_state': 42. No double quotes. Leave this box blank for class default."/> + </when> + <when value="LatentDirichletAllocation"> + <expand macro="estimator_params_text" label="Type in maxtrix decomposition parameters:" + help="Parameters in dictionary without braces ('{}'), e.g., 'n_components': 100, 'random_state': 42. No double quotes. Leave this box blank for class default."/> + </when> + <when value="MiniBatchDictionaryLearning"> + <expand macro="estimator_params_text" label="Type in maxtrix decomposition parameters:" + help="Parameters in dictionary without braces ('{}'), e.g., 'n_components': 100, 'random_state': 42. No double quotes. Leave this box blank for class default."/> + </when> + <when value="MiniBatchSparsePCA"> + <expand macro="estimator_params_text" label="Type in maxtrix decomposition parameters:" + help="Parameters in dictionary without braces ('{}'), e.g., 'n_components': 100, 'random_state': 42. No double quotes. Leave this box blank for class default."/> + </when> + <when value="NMF"> + <expand macro="estimator_params_text" label="Type in maxtrix decomposition parameters:" + help="Parameters in dictionary without braces ('{}'), e.g., 'n_components': 100, 'init': 'random'. No double quotes. Leave this box blank for class default."/> + </when> + <when value="PCA"> + <expand macro="estimator_params_text" label="Type in maxtrix decomposition parameters:" + help="Parameters in dictionary without braces ('{}'), e.g., 'n_components': 100, 'random_state': 42. No double quotes. Leave this box blank for class default."/> + </when> + <when value="SparsePCA"> + <expand macro="estimator_params_text" label="Type in maxtrix decomposition parameters:" + help="Parameters in dictionary without braces ('{}'), e.g., 'n_components': 100, 'random_state': 42. No double quotes. Leave this box blank for class default."/> + </when> + <when value="SparseCoder"> + <expand macro="estimator_params_text" label="Type in maxtrix decomposition parameters:" + help="Parameters in dictionary without braces ('{}'), e.g., 'transform_algorithm': 'omp', 'transform_alpha': 1.0. No double quotes. Leave this box blank for class default."/> + </when> + <when value="TruncatedSVD"> + <expand macro="estimator_params_text" label="Type in maxtrix decomposition parameters:" + help="Parameters in dictionary without braces ('{}'), e.g., 'n_components': 2, 'algorithm': 'randomized'. No double quotes. Leave this box blank for default estimator."/> + </when> + </conditional> + </xml> + + <xml name="FeatureAgglomeration"> + <conditional name="FeatureAgglomeration_selector"> + <param name="select_algorithm" type="select" label="Choose the algorithm:"> + <option value="FeatureAgglomeration" selected="true">FeatureAgglomeration</option> + </param> + <when value="FeatureAgglomeration"> + <expand macro="estimator_params_text" label="Type in parameters:" + help="Parameters in dictionary without braces ('{}'), e.g., 'n_clusters': 2, 'affinity': 'euclidean'. No double quotes. Leave this box blank for class default."/> + </when> + </conditional> + </xml> + <!-- Outputs --> + + <xml name="output"> + <outputs> + <data format="tabular" name="outfile_predict"> + <filter>selected_tasks['selected_task'] == 'load'</filter> + </data> + <data format="zip" name="outfile_fit"> + <filter>selected_tasks['selected_task'] == 'train'</filter> + </data> + </outputs> + </xml> + + <!--Citations--> + <xml name="eden_citation"> + <citations> + <citation type="doi">10.5281/zenodo.15094</citation> + </citations> + </xml> + + <xml name="sklearn_citation"> + <citations> + <citation type="bibtex"> + @article{scikit-learn, + title={Scikit-learn: Machine Learning in {P}ython}, + author={Pedregosa, F. and Varoquaux, G. and Gramfort, A. and Michel, V. + and Thirion, B. and Grisel, O. and Blondel, M. and Prettenhofer, P. + and Weiss, R. and Dubourg, V. and Vanderplas, J. and Passos, A. and + Cournapeau, D. and Brucher, M. and Perrot, M. and Duchesnay, E.}, + journal={Journal of Machine Learning Research}, + volume={12}, + pages={2825--2830}, + year={2011} + url = {https://github.com/scikit-learn/scikit-learn} + } + </citation> + </citations> + </xml> + + <xml name="scipy_citation"> + <citations> + <citation type="bibtex"> + @Misc{, + author = {Eric Jones and Travis Oliphant and Pearu Peterson and others}, + title = {{SciPy}: Open source scientific tools for {Python}}, + year = {2001--}, + url = "http://www.scipy.org/", + note = {[Online; accessed 2016-04-09]} + } + </citation> + </citations> + </xml> + +</macros>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/svm.xml Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,201 @@ +<tool id="sklearn_svm_classifier" name="Support vector machines (SVMs)" version="@VERSION@"> + <description>for classification</description> + <macros> + <import>main_macros.xml</import> + <!-- macro name="class_weight" argument="class_weight"--> + </macros> + <expand macro="python_requirements"/> + <expand macro="macro_stdio"/> + <version_command>echo "@VERSION@"</version_command> + <command><![CDATA[ + python '$svc_script' '$inputs' +]]> + </command> + <configfiles> + <inputs name="inputs"/> + <configfile name="svc_script"> +<![CDATA[ +import sys +import json +import numpy as np +import sklearn.svm +import pandas +import pickle + +@COLUMNS_FUNCTION@ +@GET_X_y_FUNCTION@ + +input_json_path = sys.argv[1] +with open(input_json_path, "r") as param_handler: + params = json.load(param_handler) + +#if $selected_tasks.selected_task == "load": + +with open("$infile_model", 'rb') as model_handler: + classifier_object = pickle.load(model_handler) + +header = 'infer' if params["selected_tasks"]["header"] else None +data = pandas.read_csv("$selected_tasks.infile_data", sep='\t', header=header, index_col=None, parse_dates=True, encoding=None, tupleize_cols=False) +prediction = classifier_object.predict(data) +prediction_df = pandas.DataFrame(prediction) +res = pandas.concat([data, prediction_df], axis=1) +res.to_csv(path_or_buf = "$outfile_predict", sep="\t", index=False) + +#else: + +X, y = get_X_y(params, "$selected_tasks.selected_algorithms.input_options.infile1" ,"$selected_tasks.selected_algorithms.input_options.infile2") + +options = params["selected_tasks"]["selected_algorithms"]["options"] +selected_algorithm = params["selected_tasks"]["selected_algorithms"]["selected_algorithm"] + +if not(selected_algorithm=="LinearSVC"): + if options["kernel"]: + options["kernel"] = str(options["kernel"]) + +my_class = getattr(sklearn.svm, selected_algorithm) +classifier_object = my_class(**options) +classifier_object.fit(X, y) + +with open("$outfile_fit", 'wb') as out_handler: + pickle.dump(classifier_object, out_handler) + +#end if + +]]> + </configfile> + </configfiles> + <inputs> + <expand macro="sl_Conditional" model="zip"> + <param name="selected_algorithm" type="select" label="Classifier type"> + <option value="SVC">C-Support Vector Classification</option> + <option value="NuSVC">Nu-Support Vector Classification</option> + <option value="LinearSVC">Linear Support Vector Classification</option> + </param> + <when value="SVC"> + <expand macro="sl_mixed_input"/> + <expand macro="svc_advanced_options"> + <expand macro="C"/> + </expand> + </when> + <when value="NuSVC"> + <expand macro="sl_mixed_input"/> + <expand macro="svc_advanced_options"> + <param argument="nu" type="float" optional="true" value="0.5" label="Nu control parameter" help="Controls the number of support vectors. Should be in the interval (0, 1]. "/> + </expand> + </when> + <when value="LinearSVC"> + <expand macro="sl_mixed_input"/> + <section name="options" title="Advanced Options" expanded="False"> + <expand macro="C"/> + <expand macro="tol" default_value="0.001" help_text="Tolerance for stopping criterion. "/> + <expand macro="random_state" help_text="Integer number. The seed of the pseudo random number generator to use when shuffling the data for probability estimation. A fixed seed allows reproducible results."/> + <!--expand macro="class_weight"/--> + <param argument="max_iter" type="integer" optional="true" value="1000" label="Maximum number of iterations" help="The maximum number of iterations to be run."/> + <param argument="loss" type="select" label="Loss function" help="Specifies the loss function. ''squared_hinge'' is the square of the hinge loss."> + <option value="squared_hinge" selected="true">Squared hinge</option> + <option value="hinge">Hinge</option> + </param> + <param argument="penalty" type="select" label="Penalization norm" help=" "> + <option value="l1" >l1</option> + <option value="l2" selected="true">l2</option> + </param> + <param argument="dual" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolflase" checked="true" label="Use the shrinking heuristic" help="Select the algorithm to either solve the dual or primal optimization problem. Prefer dual=False when n_samples > n_features."/> + <param argument="multi_class" type="select" label="Multi-class strategy" help="Determines the multi-class strategy if y contains more than two classes."> + <option value="ovr" selected="true">ovr</option> + <option value="crammer_singer" >crammer_singer</option> + </param> + <param argument="fit_intercept" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolflase" checked="true" label="Calculate the intercept for this model" help="If set to false, data is expected to be already centered."/> + <param argument="intercept_scaling" type="float" optional="true" value="1" label="Add synthetic feature to the instance vector" help=" "/> + </section> + </when> + </expand> + </inputs> + + <expand macro="output"/> + + <tests> + <test> + <param name="infile1" value="train_set.tabular" ftype="tabular"/> + <param name="infile2" value="train_set.tabular" ftype="tabular"/> + <param name="header1" value="True"/> + <param name="header2" value="True"/> + <param name="col1" value="1,2,3,4"/> + <param name="col2" value="5"/> + <param name="selected_task" value="train"/> + <param name="selected_algorithm" value="SVC"/> + <param name="random_state" value="5"/> + <output name="outfile_fit" file="svc_model01.txt"/> + </test> + <test> + <param name="infile1" value="train_set.tabular" ftype="tabular"/> + <param name="infile2" value="train_set.tabular" ftype="tabular"/> + <param name="header1" value="True"/> + <param name="header2" value="True"/> + <param name="col1" value="1,2,3,4"/> + <param name="col2" value="5"/> + <param name="selected_task" value="train"/> + <param name="selected_algorithm" value="NuSVC"/> + <param name="random_state" value="5"/> + <output name="outfile_fit" file="svc_model02.txt"/> + </test> + <test> + <param name="infile1" value="train_set.tabular" ftype="tabular"/> + <param name="infile2" value="train_set.tabular" ftype="tabular"/> + <param name="header1" value="True"/> + <param name="header2" value="True"/> + <param name="col1" value="1,2,3,4"/> + <param name="col2" value="5"/> + <param name="selected_task" value="train"/> + <param name="selected_algorithm" value="LinearSVC"/> + <param name="random_state" value="5"/> + <output name="outfile_fit" file="svc_model03.txt"/> + </test> + <test> + <param name="infile_model" value="svc_model01.txt" ftype="txt"/> + <param name="infile_data" value="test_set.tabular" ftype="tabular"/> + <param name="header" value="True"/> + <param name="selected_task" value="load"/> + <output name="outfile_predict" file="svc_prediction_result01.tabular"/> + </test> + <test> + <param name="infile_model" value="svc_model02.txt" ftype="txt"/> + <param name="infile_data" value="test_set.tabular" ftype="tabular"/> + <param name="header" value="True"/> + <param name="selected_task" value="load"/> + <output name="outfile_predict" file="svc_prediction_result02.tabular"/> + </test> + <test> + <param name="infile_model" value="svc_model03.txt" ftype="txt"/> + <param name="infile_data" value="test_set.tabular" ftype="tabular"/> + <param name="header" value="True"/> + <param name="selected_task" value="load"/> + <output name="outfile_predict" file="svc_prediction_result03.tabular"/> + </test> + </tests> + <help><![CDATA[ +**What it does** +This module implements the Support Vector Machine (SVM) classification algorithms. +Support vector machines (SVMs) are a set of supervised learning methods used for classification, regression and outliers detection. + +**The advantages of support vector machines are:** + + 1- Effective in high dimensional spaces. + + 2- Still effective in cases where number of dimensions is greater than the number of samples. + + 3- Uses a subset of training points in the decision function (called support vectors), so it is also memory efficient. + + 4- Versatile: different Kernel functions can be specified for the decision function. Common kernels are provided, but it is also possible to specify custom kernels. + +**The disadvantages of support vector machines include:** + + 1- If the number of features is much greater than the number of samples, the method is likely to give poor performances. + + 2- SVMs do not directly provide probability estimates, these are calculated using an expensive five-fold cross-validation + +For more information check http://scikit-learn.org/stable/modules/neighbors.html + + ]]> + </help> + <expand macro="sklearn_citation"/> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/RF01704.fasta Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,4 @@ +>CP000097.1/1411351-1411410 +CAACGUUCACCUCACAUUUGUGAGGCGCAGACAACCCAGGCCAAGGAACGGGGACCUGGA +>ACNY01000002.1/278641-278580 +GAUCGUUCACUUCGCAUCGCGCGAAGCGCAGUUCGCCUCAGGCCAUGGAACGGGGACCUGAG
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/accuracy_score.txt Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,2 @@ +accuracy_score : +0.8461538461538461
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/auc.txt Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,2 @@ +auc : +2.5
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/average_precision_score.txt Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,2 @@ +average_precision_score : +1.0
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/blobs.txt Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,101 @@ +0 1 0 +0.3368184589673989 -3.402879612990731 0 +-9.48324265575857 -8.66266051536995 2 +-1.9333632849607592 5.709539081468901 1 +-10.031824059894126 -5.578343934583625 2 +0.5418607766170062 -4.3769362832693 0 +-8.129629290673781 -7.05554320549807 2 +-0.7308257856942714 7.323755516994815 1 +-1.8414253200701474 6.206304668308321 1 +0.4100718503166844 -3.997448810001185 0 +-8.735095893232405 -5.490905352087513 2 +1.8494196227705402 -3.918393456729695 0 +-9.152560688488569 -9.17805648051067 2 +-3.214299390778301 5.7592616395707115 1 +0.2845037854966439 -3.615765226438298 0 +-0.9290748492230643 5.79099955373578 1 +0.366925241944827 6.518619296229099 1 +1.5990991796541174 -3.0710561729787464 0 +-9.71270568435724 -7.917076514990086 2 +-10.080404430632045 -6.551353241086546 2 +1.1059434577429306 -4.419063749495465 0 +2.4870804964945683 -2.8910071236106702 0 +0.00587148930882897 -3.1831425553970982 0 +1.6185435973534872 -4.888559225592079 0 +-9.1585672210814 -7.138941148475106 2 +-3.0763357145957295 7.800496767864756 1 +0.11174653022487324 -3.6161582871047915 0 +-9.439323507823358 -7.298630345706627 2 +-1.6946622959144526 4.408371111175304 1 +1.0526175263832516 -3.495530097015125 0 +-10.505605921029415 -5.99245086001851 2 +1.5408196415289697 -4.537023441514705 0 +0.32228789680819747 6.898540080429289 1 +0.6162196966060958 -5.275048036375375 0 +-10.225453923298636 -8.716359184214301 2 +-10.610041075915571 -8.159992705422887 2 +-0.7454796670028672 -2.9618984315119485 0 +0.7884875899019093 -5.3223437793891115 0 +-10.420052767549333 -7.784677704340977 2 +-2.9066475299706225 5.798350661758252 1 +-10.321439212021199 -8.927120521097516 2 +-0.21338559861828132 7.847798272479965 1 +-0.07194732572545948 -5.260544662489948 0 +-7.606968935466872 -7.733827136978448 2 +-1.3772203838685648 6.917736574437465 1 +-3.215600190755509 7.26468660350508 1 +-10.361544895394568 -6.919444657083034 2 +-9.604573412392483 -9.253517546022897 2 +-2.7269023156583536 6.738257479022937 1 +-2.8060399921674897 6.990662089963528 1 +-0.8195267147926311 7.582412712536479 1 +-2.088474009808327 5.696071447204143 1 +-0.3199187614984107 -4.982358491659567 0 +-11.320665797033074 -8.209377507348288 2 +-7.962360612746552 -9.0160536966573 2 +2.1678469105746174 -6.165707921777358 0 +1.8950202752190992 -5.864802909183004 0 +-8.668714990990322 -7.798902262764823 2 +2.057721103848434 -6.123229124507681 0 +-9.31359960682017 -8.005681999989289 2 +-0.7674305635615133 -5.476822175833394 0 +-3.467729419225205 6.760721334408079 1 +1.0904984443746135 -5.875829293349414 0 +-0.11521126331032128 -4.075104544956712 0 +1.0892785050407092 -5.50265562869237 0 +-0.6150504792573254 7.65521576624828 1 +0.42996321311489133 -5.550930544379513 0 +-0.7591948546904975 5.588530307317255 1 +-9.125996572516852 -8.00673850068656 2 +-9.775374420827845 -6.619256719676729 2 +-3.017233345281725 7.003406777204688 1 +-0.9730894643674084 -4.066519071956773 0 +-0.488300213042004 -5.665046812039003 0 +-11.920811593303075 -7.6481581712718265 2 +-9.382625071659795 -7.584962987095203 2 +0.07652275340589654 7.588913304914662 1 +0.9769623036529882 -3.9248027076317573 0 +-7.830829708233982 -7.911915266520185 2 +-3.0073685661005083 5.7016366696061365 1 +-1.8751101776939656 5.624499605551414 1 +-9.6832320667351 -8.253539319584945 2 +-9.301199337591346 -8.475648001818415 2 +0.3236596741468444 -5.100784034937504 0 +-1.7483610543320183 5.466455747949784 1 +-0.5606434085120788 6.8761250604356094 1 +0.6786030049961334 -4.1776108538506955 0 +-8.201998888059842 -8.29076835439347 2 +-3.0502642095699524 8.942236614880212 1 +-8.811936226521826 -7.798135337577672 2 +-9.168627707162337 -7.132750331822805 2 +-4.482963659068224 6.928839924536938 1 +-10.522252247863742 -6.805433938277723 2 +-1.585671650741962 6.899480240385674 1 +-1.7585368520754465 6.445346211386424 1 +-9.914521539472657 -8.111815592744888 2 +-1.4007761951194242 6.923806281221148 1 +-1.1922802090762707 6.143108468673037 1 +0.8754133990482117 -5.04555103360224 0 +1.481137717506855 -3.6964070848002533 0 +0.5249593764875948 6.344808234483482 1 +-0.013699553663708786 -4.413973348636017 0
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/brier_score_loss.txt Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,2 @@ +brier_score_loss : +0.5641025641025641
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/circles.txt Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,101 @@ +0 1 0 +-0.06279051952931321 -0.9980267284282716 0 +0.05023241562345065 0.7984213827426173 1 +-0.9921147013144779 -0.12533323356430429 0 +0.4257792915650726 -0.9048270524660196 0 +-0.30901699437494756 -0.9510565162951535 0 +-1.0 -3.216245299353273e-16 0 +-0.18738131458572463 -0.9822872507286887 0 +-0.5358267949789963 -0.8443279255020153 0 +-0.7748665289029049 -0.19895190973188404 1 +-0.8763066800438636 0.4817536741017152 0 +-0.24721359549995806 -0.7608452130361228 1 +0.8 0.0 1 +0.42866143598319745 -0.675462340401612 1 +-0.5831749019371294 0.5476376847429508 1 +0.7010453440350909 -0.38540293928137226 1 +-0.743821188710601 -0.29449964214774266 1 +-0.7438211887106012 0.2944996421477422 1 +0.8090169943749475 0.5877852522924731 0 +0.30901699437494723 -0.9510565162951536 0 +0.18738131458572452 0.9822872507286887 0 +-0.8763066800438635 -0.4817536741017154 0 +-0.42866143598319706 -0.6754623404016122 1 +-0.5099391917989516 -0.6164105942206315 1 +0.63742398974869 -0.770513242775789 0 +-0.9297764858882512 -0.3681245526846783 0 +-0.9297764858882515 0.36812455268467775 0 +-0.9685831611286311 0.24868988716485482 0 +0.2472135954999578 -0.760845213036123 1 +-0.1499050516685797 -0.785829800582951 1 +-0.8090169943749473 0.5877852522924732 0 +-0.6374239897486895 -0.7705132427757894 0 +0.7289686274214116 0.6845471059286887 0 +0.9297764858882513 0.368124552684678 0 +0.0627905195293133 0.9980267284282716 0 +0.7936917610515823 0.1002665868514434 1 +-0.34062343325205774 -0.7238616419728159 1 +-0.7748665289029049 0.19895190973188387 1 +-0.14990505166857987 0.7858298005829509 1 +0.7010453440350909 0.38540293928137226 1 +-0.5099391917989519 0.6164105942206315 1 +-0.8 -2.572996239482619e-16 1 +-0.7936917610515823 0.10026658685144328 1 +0.5099391917989518 0.6164105942206315 1 +0.5358267949789968 -0.844327925502015 0 +-0.7936917610515823 -0.10026658685144343 1 +0.7936917610515823 -0.10026658685144303 1 +-0.5358267949789969 0.844327925502015 0 +0.509939191798952 -0.6164105942206313 1 +-0.050232415623450724 0.7984213827426173 1 +1.0 0.0 0 +-0.6374239897486897 0.7705132427757893 0 +0.7289686274214119 -0.6845471059286883 0 +0.06279051952931372 -0.9980267284282716 0 +0.8090169943749478 -0.5877852522924726 0 +0.18738131458572513 -0.9822872507286886 0 +-0.6472135954999579 0.4702282018339786 1 +0.5831749019371295 -0.5476376847429506 1 +-0.8090169943749472 -0.5877852522924734 0 +-0.7010453440350909 0.3854029392813722 1 +0.8763066800438636 -0.4817536741017153 0 +0.5831749019371293 0.547637684742951 1 +-0.6472135954999578 -0.47022820183397873 1 +0.3406234332520581 -0.7238616419728157 1 +0.05023241562345098 -0.7984213827426173 1 +-0.7289686274214117 0.6845471059286885 0 +-0.5831749019371293 -0.547637684742951 1 +0.647213595499958 0.4702282018339785 1 +0.14990505166858012 -0.7858298005829509 1 +0.14990505166857962 0.785829800582951 1 +-0.24721359549995806 0.7608452130361228 1 +0.9297764858882515 -0.36812455268467786 0 +0.9921147013144779 -0.1253332335643038 0 +0.6374239897486896 0.7705132427757893 0 +0.7438211887106012 -0.2944996421477423 1 +0.3406234332520581 0.7238616419728157 1 +0.6472135954999583 -0.47022820183397807 1 +-0.0627905195293134 0.9980267284282716 0 +0.9921147013144779 0.12533323356430426 0 +-0.7289686274214116 -0.6845471059286887 0 +0.8763066800438636 0.4817536741017153 0 +-0.9685831611286311 -0.24868988716485502 0 +0.9685831611286311 0.2486898871648548 0 +0.42577929156507266 0.9048270524660196 0 +-0.4257792915650727 0.9048270524660195 0 +0.4286614359831973 0.6754623404016121 1 +0.24721359549995797 0.7608452130361228 1 +-0.30901699437494756 0.9510565162951535 0 +0.774866528902905 -0.1989519097318836 1 +-0.42577929156507216 -0.9048270524660198 0 +-0.18738131458572482 0.9822872507286886 0 +-0.3406234332520582 0.7238616419728157 1 +0.7438211887106011 0.2944996421477424 1 +0.7748665289029049 0.19895190973188384 1 +0.30901699437494745 0.9510565162951535 0 +0.9685831611286312 -0.2486898871648545 0 +-0.7010453440350908 -0.3854029392813723 1 +-0.05023241562345057 -0.7984213827426173 1 +-0.4286614359831975 0.675462340401612 1 +-0.9921147013144779 0.1253332335643041 0 +0.5358267949789965 0.8443279255020151 0
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/class.txt Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,101 @@ +0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 0 +1.103931098477063 1.1137324694427062 2.929660893432376 0.8263678474871072 -0.5024439301629023 -0.9778311716440287 -0.6702242261982462 -0.3783418745400049 -1.9100911341304148 0.41080891898717925 1.6359138753477174 -0.3544401787737543 -0.7776883945882607 -0.711126068648103 -1.1632958763488586 2.881523323585383 -0.3331610016599995 1.0249635446624175 -1.204722529676112 0.9686027151980944 1 +-0.5270034201986623 -2.4370266994140035 -0.46398126201591683 0.6724964425333426 0.32128693891873533 -1.4561055975293318 0.9733737109300644 1.2635448363305384 -0.9655190314614323 -0.30440284592936967 0.2928325635717791 -0.642481126749871 -0.17778292517384178 -0.23575096986827987 0.770818433376395 1.002493460919832 0.44402946209787597 0.38673364020325446 -1.0909759530149077 0.4374172416803542 1 +0.6343790937890923 -0.7044557030990274 -1.5479925634100813 -1.1375423986557498 0.7574995244231507 -0.2586895904715146 1.2113185073849615 0.8255591814670258 1.0488550790559334 -0.013557918030451043 -0.36824556412752163 -1.8422341740345995 0.9791413360462421 -0.23658235285975457 0.3758968273279556 -0.7379662029189028 -0.9558490082424093 -0.45167227065102006 -0.13587675227718632 -0.43481791249648283 0 +-0.2749398078895973 -0.602759369823714 -0.34817063773317436 1.2165805903649096 0.08822993442548502 -0.9828118947823061 1.1255554529825982 -0.5951138391567017 1.359567367140958 1.14745743851399 -2.2691569946862655 0.9270532988002531 -1.28390481061431 0.702184505359777 1.1599689740750685 -0.7022781266128805 -1.5820069707072104 -0.1640254026760564 -0.6268539047283007 -0.5343960171949464 0 +-0.8451664655381013 0.9592831641658773 0.29032122469609184 1.4456183940991385 -2.2668849557948265 0.49356800079005453 0.9973927328851383 -1.7077448427289017 -1.525140006218017 -0.2628130337984583 -0.6987088119151889 0.12372879270054708 -0.37829745272534815 -0.0010588423370812654 3.1974829539733727 1.7610392441369824 0.461991697252764 -0.8707192095484595 0.4949902726326138 0.7113500316301005 1 +-0.6479921130452116 -0.9442706004373587 0.20181386383006028 -1.0034745347115275 -0.9369221110721804 -1.003380717730042 -0.7275212508545039 -0.1820208348243829 0.869148773329888 -0.7855214383236936 0.1360612935062583 2.0654861372867295 -1.2399203282859266 -0.44615385943239716 1.7347311831934773 -0.6314619246803259 -0.76518919295205 1.2707549044789055 -0.7323378102483927 -0.3626096934734513 0 +-0.06451309551365764 -0.7249330776348837 0.5963143554325262 -1.379225616134922 1.1667980284973485 -2.274070053731467 0.7411405179848544 -0.6631329812615014 -1.567155162052582 -0.09527290234272089 -0.7316650418582739 -1.0020134142607244 -0.6953396335230776 1.5807860908438993 0.3379535699933314 1.8800551896643136 0.37962716233848903 0.5363444440333102 0.1390867505544731 0.7390508093906831 1 +0.7576049876525334 0.8726631262318649 0.8478637181249223 0.30198299200599726 1.0101338828657191 -1.3836221562341127 1.0376123351490436 1.0937481979752155 1.3929535047023875 0.8760511854123076 -1.2981174812942935 0.3025477016355275 -0.14253519602584672 1.2887025562956078 2.1562199933480133 -1.0111580468681463 -1.2275056029861684 -0.2688763993683175 -2.2719054986176683 -0.5810422898079113 0 +2.5394320331114613 0.46034921066168377 0.8315330299051433 -0.9396024430587621 -0.37614736761593637 -0.17996331764913345 1.455421460737774 1.5223077678776793 1.1770030840483332 0.40359841542535574 -0.03766667059723912 0.2415068878754467 -0.44558826380657596 1.2774520318648948 -1.8848343873195796 -0.23434224565939143 -1.8735210102773319 2.299369468755593 0.11182257854217889 -0.41968753568332984 0 +-1.1654317335035704 -0.23406889069910192 -1.3485118844184532 0.7912949804001552 -0.19206908223922012 -2.752037662677927 -1.6014139415281856 -0.5108631934878929 1.4041570989659866 0.5382460975045578 0.012866884184724063 0.7910261496852212 -0.5285056361126661 -2.874968879865529 -0.8428605517089753 -1.4276668142409976 -0.6865704170544349 0.8660591728218054 1.176952513690748 -0.6326584957221068 0 +0.9050654404010442 1.5248626005482613 0.0537117476660896 0.10714253527293145 0.5436279322698345 -0.9162199391704404 1.1974173477959238 -1.6813868155498577 0.465763145265903 1.6525856413988107 -2.023763530020729 -1.2225052973966217 0.48905360189011937 -0.06340532135397717 -0.8428196875999223 0.9810796287807456 -2.1897236651211855 -0.5362903624231383 0.6151521853927577 -0.042643618877945336 1 +0.2854489945462638 0.3530051834614323 0.1332902420274303 -2.066453723784956 -0.2645836803644654 0.5245478462345327 0.2238241190906629 -0.48256531456153773 0.13249140142592644 0.9127282586749043 2.6474189892831026 -0.37219899010144253 -1.548077411041423 0.662893215100046 -0.8853951972314839 1.183629012690877 -1.8429271907244553 0.8100978673990902 -0.3284080793917298 0.09184768542206719 1 +-1.3227165003614927 -0.7799983027126963 0.18479275551351085 -0.14231230753550203 -1.3945327153213618 -0.0758997670485449 0.6986307702990094 1.6282076357873105 0.18237029611060487 -0.7109024225989671 -0.2724518087709634 0.4729134646484038 0.5454540297228883 -1.0722422723792842 -0.606184110109761 0.8021132176384902 -1.4211379561267314 -0.3389835320929106 -1.44904592785806 0.031348504552504486 1 +-2.197691926666584 -1.7077148903852681 -0.6449885420999844 -0.06865025280146782 0.4202392504617797 0.968886848221698 -0.005924072251181685 -0.6511305169582245 0.3998134505861388 0.892257884749868 1.3521367585609907 -0.7404970062580767 -0.46898715506363886 1.275597323305137 0.14386099595965895 -1.838491122688009 1.7359354044223765 -0.1551428089500599 -0.43232000255589664 -0.3447470104944261 0 +-0.2670710335696844 1.7812245781622742 -1.1329343313282814 -0.24423451883692596 0.7548220931778789 -1.8862883675077626 0.6526294599846313 -0.3676598535224105 -0.2448455084452909 -0.6772836861850628 0.5942014265411584 0.2375037940405147 -1.1168006401508905 2.6256144457846546 -0.6716078230151616 -0.2989663691054665 0.8587286854080793 0.4974278727895833 1.0406815179638391 0.047335395957696466 0 +-0.4829965988829622 -0.8664172853019196 0.010536697447195188 -0.24957125769621874 -0.5053469214826972 -0.5661823837482267 1.397031114430776 0.9362535725466031 0.8494481273008917 -2.3689801750315524 -0.11515634319648775 -0.8619219742938617 0.5524984188665393 1.5190033138842483 -0.9215808226333405 -2.2309955927486342 1.4288742583770047 -0.5196163599941902 2.2436594507282206 -0.5399023920325723 0 +0.988208848486463 -2.585767588999438 -0.009847287471481413 0.30217682520827216 -2.221510823700524 0.9425068791712249 0.6889213621579444 -1.0110351209554707 1.3983331823298473 0.017600206923097966 -0.49772668445684926 0.041274574202699865 0.39315819224910903 0.687759695794799 0.8198061540197786 -1.6938202943901621 -0.31675443490083666 -0.5176603237193814 0.7734409975442094 -0.6613095000652233 0 +-1.6500251948243565 -0.5881887751399346 -0.008457486200020091 -1.0255372547670172 2.883969251775838 0.6841194893268114 0.36522540717596585 -0.4063786899313203 -0.4597632229684979 0.6689473090641462 0.5824042646735971 0.3231095013887879 0.59519151467352 0.40271751266444333 0.2803223035037342 1.1596486152072958 -0.7088028618998904 -1.7236514338073596 0.5349275937487872 0.28671842601834485 1 +0.30430567959512733 -0.6926221975020497 -0.3586531509541748 0.11220827271785544 -0.6418145875587414 0.40043811487947506 -0.5627558800719191 1.5870889370740489 -1.1979020496525155 0.9287687328933728 -0.9429787966287079 -0.4694866980716366 0.5476098176306101 0.9911844589581342 -1.890064241013992 0.810682748482377 1.135044917480963 0.5813591730005884 1.5988127102205738 0.4929116267678903 1 +0.40492907257520244 -0.6514435841992149 1.8847060544535634 0.25069797962239826 0.2098594845826785 -0.8699566545276876 0.7644150970416564 -0.5372191508425196 0.8513726693635947 -1.6024845301638289 -0.23003580655162623 -1.0594997311547119 0.1503781049950916 -0.697530591149039 -0.06048301501585981 -1.225374349155504 0.06893531119317442 -0.5498117799824236 0.2629482684151777 -0.42494833533236415 0 +-0.6938752020747251 -0.16425303413718284 -0.786824522255031 1.7668617516726024 0.1351177762474505 -0.6769151658288148 1.099720527820615 -0.2108673539727271 -0.09240517052244847 1.9753281712575461 1.0326537546555192 -0.5857366554551754 2.527070920782692 -1.1314983848532563 -1.2203869916654786 0.5386023310337225 -0.5545516579065658 1.617741961423047 0.026714277801613007 0.09274673011429316 1 +-1.2855738604138573 0.9527052435093047 -0.5393910228200474 0.1406950564673274 0.6278876784461687 2.2921936458109897 -0.8296277386100398 -0.8276017374999237 -0.5691114767876203 -0.7804341795136254 -0.3115251054922687 1.1604663708722944 -0.45823039827601697 0.096940343318409 -0.4661721263852442 0.7914638179665774 -0.008781526693367847 0.540432755366913 1.2382624131362387 0.2808835720014097 1 +0.01971106661270503 0.022725782621203446 -0.7171971284211488 -0.844608668797061 0.17759075527122256 0.32351256640857523 1.1092738552242762 0.8459134704189475 -1.0092620261375949 0.3312851879047735 0.8493202690407095 0.7463122829548583 2.2751079842809023 -0.365800592740796 1.392872207641418 0.2672220726832053 1.5171222642682722 0.6271956315522539 0.12548690045124972 0.3674941717644202 1 +-0.9272485993677742 -0.3992846345441018 1.0312821968019672 -1.0164811121806232 -0.5788411209471953 0.1621555997620361 1.4878944321336367 -2.305258151983712 1.0526886159889823 -1.1927713830291693 0.35643089395408944 -0.35781685235193555 0.24420707079596798 -0.7032369510661453 1.3748594175398903 -0.265531361494145 -1.6001897901099145 1.5225430928104695 1.1284147518659724 -0.38179068502908986 0 +0.8466872377493828 0.21453403707113433 0.6877174913431068 -0.4470343315836607 -0.9060867789442381 0.22357751470350606 -1.4313384494982322 0.7146958272683516 1.2868876187481681 0.6108180939736211 1.6680351279664263 -2.2704132021611114 -0.5699517962545901 -0.5390686415774785 -0.6652888855585158 -1.9249041040915857 0.2022499134735356 1.4692083028521956 0.9692133398427439 -0.650684739883086 0 +-0.601702497867707 0.03192366589002642 -1.0154893571166628 1.2277054932407083 -0.17345609362160444 1.3508013650170736 -0.8603704762851204 0.7158372997438407 0.609842377909055 0.26686482080895313 -0.21636159151507584 1.4178789398571483 0.07902571896854252 1.6204683987456092 -1.0280706824933712 -1.405364977188804 0.7610249189649491 -0.7259753124258116 -1.1264854630318841 -0.3650429101933015 0 +0.2407422845881994 2.8857517953922764 -0.023980761898605114 -0.45619206614093344 0.6177594707762792 -0.08768373982573438 1.7598211003608997 -0.031028697570925873 -0.49143266590475054 -0.05864391264016893 -2.2134606073911924 1.0913309075290665 0.9117965623133085 -0.12278570026442888 -0.8739999199474732 1.1171072920808645 -0.5925089707550872 1.2372535126873845 2.124745399513117 0.2923959583087956 1 +0.17584571165005292 -0.8511320881692872 -2.2051034645754948 -0.6116310759188245 -1.2047158798971238 0.66839521890313 0.8991245292770655 0.4741248277718854 0.1760900687774567 -0.6307555906525206 0.9535866516994639 0.9371915337062796 -1.4228495469631228 0.16029074988453906 1.8555455403701624 -1.869116730286061 2.1934384645923486 -2.281305792694086 2.8097011435732293 -0.2736139860084672 0 +0.5242236519537231 -0.06307879670506915 -1.3294456177962388 0.8242892015046335 -1.081258571215189 1.3449502719441988 -0.50356048600791 -0.38621990548929036 -0.05314119332051215 -0.45271329511708064 0.087257980752205 -2.050905763049373 1.1197161016785873 0.9167469515279244 0.687592786751324 0.8579972616602627 -1.0583875221093613 0.7563768879274201 0.37967322200031345 0.11635935179374274 1 +0.558346902284024 -0.9309696527726209 -2.0842708835548924 0.030877752980638058 1.0396388948858852 -0.3022844248616988 -1.277629080640249 -0.6294458606293386 1.238756470825371 0.13639753659343484 -0.3188074229604005 -0.9443200259389776 -0.41149095236240474 -1.337165050885127 -0.33733841113672913 -1.0953021286821771 -0.8271589650497895 1.2703115446925113 0.6531758521433048 -0.5392612125425414 0 +-0.7379887070817857 -1.2626042854762183 0.17912390469970796 0.32669169909966733 -0.5343938353030584 -0.8617991799058063 -1.0231988412194268 -2.38861407368411 -0.15825189124877934 1.3263448403293359 1.7165027742351253 0.5384660112416041 1.3283330921381156 0.21309224825039347 0.9270035239969678 0.9968859637509941 -1.0501783925356227 -0.4559683500449692 0.6819648840132921 0.16739862639293818 1 +1.4476040528943543 -0.6314322515594253 0.14853198602056514 0.1396675784886334 0.016672373423269438 0.16564178605539887 -1.0040158066788205 -0.5327923727826095 1.147051857581131 -1.1417786944082575 0.44682624679647864 -1.3120985315266447 0.7869814652437135 -0.46902780374760905 0.7464021537026985 -1.153959736241712 -0.5774434779881016 1.8363081603106133 -1.7651938506826501 -0.5154033311511862 0 +-0.694949123737318 1.4480014208760492 1.114733892631557 1.3552725615328403 0.32870245607283527 2.182275910834502 -0.43728724254382445 -0.32108899071015246 1.7059375939854156 -1.0144720406973653 -1.1268282836571295 0.9114744851303214 0.2876311214263635 -0.9194792276680201 0.8712160137184647 -1.6822107044034538 -0.9046542625496667 -1.2265674316518074 -0.08885766708388806 -0.7626183729066613 0 +-0.4951739548431622 3.075573893432424 0.7125389403746353 0.7127480011897636 3.85793967348964 -1.380114296433079 0.830819563694863 1.6659047027918155 1.692437606180482 0.132962280436304 0.13986220576101485 -0.8782681675417305 0.692696057131838 0.21421904746683115 -0.08289852500467178 -1.697739157869832 -0.8585956144545324 0.3596237434172795 1.0687856807518747 -0.7598986082131621 0 +-0.24659729953406678 0.48028838228527204 -0.021175774300496716 -0.3664962494470602 0.01003713940839754 -0.25227004044698087 -1.9569675522430627 -0.22013056376799153 1.0072449553370086 1.490533097267343 -1.163235822180662 -0.564484658307677 -0.6542808538079327 0.3252062923168107 -0.39939137701024663 -0.4953677656109705 -1.2056522392978473 0.33107168261445835 0.8604754069049109 -0.3930464701607799 0 +1.0901528926431487 -0.9453346120985947 -0.4729131940164531 1.443087583454784 -1.4130407277334363 0.24204583536789437 1.5221528599715186 -1.4925201736211136 -0.750070599045198 1.0925633619786013 -0.6563789851711918 2.000672024084738 1.9550554438780816 0.8237126081224749 -0.32415019818829954 0.3320842417897454 0.947459986817773 1.746256318275166 -0.9194491847633625 0.28846144012404507 0 +0.8621689184981023 0.07355255089438108 -0.8847286012386693 0.4796962084572591 0.5677535540962639 -2.5289475108846857 0.7483241867237762 2.288635291333243 -0.4638726726966315 -1.4726571262457677 1.2522315626273022 0.9146566431112833 1.3432368831212602 -0.1516899652786653 0.6523101983645719 0.8002795439355803 -0.2164492931029829 1.175609480746336 -0.5899674340661235 0.2467801870809084 1 +1.8327334301292564 2.7250208073497655 0.8850898918686639 2.02577923393804 1.1993328107538388 -0.6080810819389247 0.45076298555579936 -0.8695507065224324 1.4966446042512176 0.9689045577333327 -0.040195475275759104 -0.8394777244112416 1.3016102245353771 0.7079943796338916 0.170770931967963 -1.9468700714932357 -0.1583369501288343 1.5860651416439473 1.5303010308595233 -0.7232027745913409 0 +0.45675680055100876 1.6862402750755072 -0.3339099307005731 0.9727972485358709 1.5405555309799355 0.5095493726194038 -1.1769248912579864 0.14688445026802582 -1.8923413151325892 -0.3597035854371358 0.034288605346101064 -0.1895277822930986 -1.5451347924726995 1.2116386663488123 -0.8476549112820619 2.8325772842721397 -0.3001639683766244 -0.38212536558313037 0.30867526144867835 0.9570534912074047 1 +0.6675880922360743 0.061607686265927775 -0.5240201725381137 -0.2997158513385201 0.43035789354356024 0.36247267480026046 -2.8186530025073595 0.05633894424120396 -1.4240630471371363 0.9417552666999109 0.8621190134296215 0.827177562356735 1.276247945989341 2.297885578997527 -0.646962111575448 1.4674788351942492 0.6699042159445734 0.5558064722220939 -0.8570825503940438 0.6438772343953656 1 +-0.7230597875372071 0.7389509974901849 -1.93022327109422 -0.07844206283832174 -1.8155995691953226 0.4605439023890654 0.33409134205811086 0.27987375745446136 -2.1891803361957525 0.814324613537393 0.33687080618689497 -1.1366259127066474 0.38265856161425904 -1.6119503393696952 1.2140595171215174 3.690453997873541 -0.9050341895489411 0.9404548194318197 -0.6885408976578092 1.1547176268987822 1 +-0.20429550994058496 -0.7742446220627313 0.9314007484353164 2.565917360177608 -1.93736462781153 0.5384714676400842 0.9863681649066736 1.483178916134393 -0.9316097044806316 -0.5277830403219427 -1.328483968518206 1.1375377820834534 0.41535786515366985 -0.18726676450257188 -0.05624642393738156 0.046686315886620644 1.6701180226287295 0.4152987016284749 1.3110909185719273 0.31623204667724564 1 +-0.26759192177397656 1.2033205926353625 0.049037461548016935 -0.26722530141904327 0.9561499786482655 0.5229173631509835 -0.9762315218209106 -0.10777619396316224 1.6028516387787055 -0.4694062226879811 0.35280658284312694 -0.0751525704189141 1.3547691398570894 0.8054921061469411 -1.4257562814463445 -1.922437446100354 -0.38886964310660965 1.2860174671016282 1.3242380220962733 -0.7558340808429282 0 +-0.7430459223148423 -0.345025274037323 -0.6836501416815086 1.1810021618172988 0.4137586484133794 -1.0717355675879099 1.2401898182121198 0.7045354278052993 -0.9063430103781079 -0.8859252495127169 -2.1418516144035475 0.10342901781618742 -0.30175139488690217 0.527387687628702 -0.49581833514279516 1.0261169886240376 0.302080558087638 -1.1807980275906318 -1.0660552581621128 0.4203865372286456 1 +-0.8856978941958283 -0.5611773427197669 0.23925986087456783 0.0915712442891479 0.9195436457578192 -0.3182853136155345 -0.4101120092081721 -0.07936631605575531 0.5178580879150084 -1.645607964622266 -0.09891912036094928 0.06812570823584903 -0.07149411774529733 -0.1378586963310319 0.16979751913292426 0.9737023906726753 -2.2766864166854184 -1.2674959941594357 -0.16935301763051838 -0.06087500479564888 1 +-0.8347002345785401 -0.5852677365383244 -0.22290652406605962 -1.998282087632246 0.27650295204355396 -0.006598203487616498 2.2812721074024944 -0.7372621615773305 -0.5524691100306179 -0.8106258122291109 1.2972505366193468 1.1535198870555938 -0.9294976841312648 -0.2885403301648238 0.10382736210532115 -0.023326105815496323 1.059228248788412 0.34421346303858386 0.5515401814060694 0.1816700680401573 0 +-0.59892262579212 -1.6376756241371526 -0.378736298456714 -1.0418743710911664 2.5492856987737014 -0.6615569434901911 0.006317661817300752 -1.7976375781681988 0.046863996948282666 -0.3823403780460225 -0.13210003839031914 0.5417126512741955 -0.823533424001803 -1.3644765720109107 -0.9859808115749349 0.7527993867760319 -1.102540208655706 1.9406228046678644 -0.28559377932836866 0.07089647899954139 1 +1.3925260779906183 1.0778035873134737 0.07530237581078959 -1.6645104329617095 -0.05818985492234962 0.563949339433897 0.6791380636681086 0.5219979705833208 -0.6360766994468067 0.16841451395907342 -0.10405164557505987 0.49256225202705956 -0.5383113936858084 -0.30229931902300344 -0.3925687758796 -0.8161226282106238 2.2840703234313273 -0.38465598282466923 0.39058426076124503 0.11843675039187236 1 +1.1352016674683758 0.5648569127221107 2.397073067233959 -0.20268282272443056 -1.0917976649357448 -0.6601392708428152 -1.9445402822954807 -0.29178644639701495 0.2751710745518691 1.0097935422904265 1.5387536595031532 0.26393122365044175 -0.46273031364217426 -2.2292589330885986 -0.9134206948382958 0.8401731701415269 -1.645111014559415 1.5562083709832442 -0.1089062616381093 0.004757145532405901 1 +1.098875986566869 -0.4022899215971822 1.5175361283542563 -0.4806321621688906 -0.2984356710923274 0.6355011681954533 -0.5366404268123247 -1.2703180389254833 1.516758047371705 -2.132910373907718 0.025191903274544 0.8231244016664833 0.4804114112715212 -0.2851808701227014 0.7592043314019562 -1.6607300610426388 -0.5816933219806619 0.3696111506737348 1.0423327430213356 -0.6970225369060598 0 +0.8101916422542774 -0.6863958655184795 -0.5296495025503906 -2.593049387823186 1.3099523237532418 -0.5560681594651091 -1.1332472710708152 0.4487887875734142 1.3556075253585955 0.10193764725371153 1.0604911834109119 -0.16433173228337156 -0.24321111498677203 -0.5777727170864493 -0.2805096318513892 -2.591494319646014 0.9734907223316764 -0.4208166097429164 0.28768107786745795 -0.7502402390626048 0 +0.12340670941539608 -0.5283333516589073 -0.8105601159173703 -0.790472710889662 -0.4072015719616529 0.2499136810467275 0.7000452723146847 -0.7368148416525208 1.3152294000156877 -0.14471976544476078 -0.09180805144899466 0.07455981071053643 -1.7390992728519505 0.031047952046710476 0.06339992712334852 -2.68682916947328 1.1771921941427486 1.9998578404574014 1.2720349278692757 -0.7477253587693696 0 +-1.8463416145538356 0.9877470273404159 0.6090995914299342 -0.05454962931514019 1.5957629012804186 -0.7274708346047783 -0.4881110169164618 -0.10746411474278562 -0.22966924089385501 -0.41243382161399256 -0.4533996984310992 0.6296948056302356 -1.1360989745400003 -1.3017565892197434 -0.41546602951164513 1.0106305929502466 -0.9358580686121462 -0.8522489506584864 1.0907946273414781 0.1928095681182362 1 +-1.153885792720572 0.9710150739398405 1.2485130631114325 -0.922849593193101 0.40944806598520256 -1.2377573117811096 0.055893360103507414 -0.180323324487924 -0.9518528082448592 0.49790841207097386 -0.7935082792305357 -0.13442562190597213 0.6807164316349167 -0.7735959733304064 -2.338273386722357 0.09862297814391718 1.6377256011208965 -1.1446482896282357 -1.5573740255791648 0.32895701815399 1 +0.38416436496131556 -1.4737655176136435 0.09207904862564406 0.8282908984570213 -0.2281547965833843 -0.6788102101595077 -0.8116419957449114 -1.1963099714035128 -1.5560108513806363 0.7831220308214599 0.11250426233136833 -0.093173526942104 -0.22085148462505744 0.5748209312636592 -0.028677866459869465 1.8567762034490851 0.3902933933742653 -1.3867146526153864 0.009430420454783334 0.7326561834289222 1 +0.5333662646860791 1.2619572530223984 0.06886762106070753 0.8686502617410066 0.6091057104482803 -0.863695134710848 1.2455241795966359 -0.41089883250021403 -0.7780948095240008 0.2657401234141504 0.2092762944699149 -0.6045175428606584 1.1907316086258812 -0.6255334005329436 0.5106942988951843 -0.41078796254386396 2.001562705082795 0.920622863636502 0.11248681150043587 0.21241951185988145 1 +1.5038046653372112 -0.5482813446368637 -0.3641863572992026 -1.1327291781835451 -0.15806847832806897 -0.7192061272862257 -0.6950098823438737 -0.47009316461768835 -1.9377149832346678 -0.35779084437972 0.8451070985370979 -0.5080798628815741 0.5485566605075846 0.9761767931804848 0.43925107369417943 2.957596999924257 -0.3843783591548495 0.10415185780639113 0.9951843831205078 0.9865650926014994 1 +-1.9728640480783795 -0.584889332459948 -1.7115830531175702 2.1324867288289617 -0.5256451948154732 -0.13207671471324264 -0.9292471979014248 0.3506928143980163 1.3092760133267836 0.5398129189913056 -1.3559078555972999 0.39841641960968166 1.2537261342634507 0.9637445310773097 0.5431731800991407 -0.796177135299726 -1.3618004012670868 0.15859859636139104 2.7213336098665635 -0.5284081777192728 0 +0.41614597578860496 -0.1679131727874871 -0.18337459189215918 0.6847631554909649 1.4671555504106528 -1.0600082591583286 0.7597959068113311 -0.6926816136990898 0.5399648494662486 0.1429569524514458 -0.0482216355946755 -0.2086217318530937 0.6610574334671373 -0.31480674559033817 -0.06162756634039431 -0.7644973510153209 0.026631685382698556 1.2830307747086311 0.5078271760432795 -0.2680579423040609 0 +-0.012045236853271031 1.6925906279849425 -0.43238636618530835 -1.6847064151587414 2.2803112732391826 0.4504456177691022 0.8841718182048186 -1.1106346720321985 0.49231132027988483 -0.29108659019024025 -0.37667434221349183 -0.5384799446573829 0.2080936834521666 0.7315635547473112 0.5624562546330725 -1.0760533706627082 0.5355018164707845 1.580659829411814 2.135839579661295 -0.28797000142125845 0 +1.49961056170431 0.17185882517030615 -1.1299710458171193 -1.0986042355701349 0.2380742569517034 1.3281321131436516 1.1167682468088798 0.35564438892659067 -0.8928006143434813 0.14614254213307512 1.2829097566144694 -0.013688855208146944 -0.45706533906364627 -0.3062063943698761 1.9034164161920542 1.0929212167523317 0.1867834374796813 0.7587214440890531 -0.3029040483924579 0.42354677628115955 1 +-2.6545414330136725 1.8356854615940046 -0.5457976028267867 -0.9275320032879893 -1.3283248730961463 0.6232216740312264 0.596469164632437 -0.7210278452213854 -0.9118316286209408 -0.24928762363265858 0.952868090977543 1.11694972800202 0.5416161166668478 0.20604165648494577 -2.533714900686942 -0.016083961019089266 1.717987671558801 0.5450784715193229 0.5568882027647745 0.30241692371509693 1 +0.6668801993571806 -2.3053224234261527 0.48468627798385755 1.3546263068343696 0.11873192576862872 0.547052797574943 0.719991138685963 -0.524434980542717 -0.46901795027526905 -1.0137197024379423 1.3569787876682777 -1.2845045596199125 -1.5523887064375035 0.2108731700382351 0.19659506908435523 -0.953106011799891 2.1580484593930747 -0.2561154143302568 2.0759505803869307 0.04694527263670476 0 +1.1311811909202247 -0.6933878511104847 -1.265057694018798 0.5183435151558969 -0.07684033970519674 1.1988239385167685 -0.9469760525902353 0.5391724452767099 -0.23426383767301404 -0.1090739625676252 0.21359010083019977 -2.268619962246101 -0.7529456042925735 -0.8425159924738271 -0.05816611715256052 1.0977895592955997 -1.0448686711150859 0.9636968648987307 0.5900261263151266 0.2043616532143112 1 +0.3136974470241752 -0.8291825633597693 -1.0372415290485972 0.586065961267128 0.12771181052702799 -0.7640402478085184 -0.5004744114139862 1.6608354030583428 -1.5278423539544295 0.5708166717972424 1.5345529929213104 0.6876259510533493 -2.091922245950683 -0.3022998396168013 0.9114872277854996 1.766640084108124 0.4594646315912676 -1.1409669611458368 -0.7203819922636215 0.7128955852536363 1 +-0.0843840216296024 -1.3820347260227162 0.6397705674189378 1.0854940115848073 -0.8750993854125558 -0.5369047713298828 -2.6192806035910072 0.6701565503321437 -1.84641452901824 -0.10678367894303217 -0.7624907593835051 0.5861653271698655 -0.17704463664703687 0.7085263301324782 -0.8713026470236783 2.69143441504066 -0.19523201436527637 2.1560252861535147 -1.5795988238989795 0.9255039639597403 1 +0.6790203045104227 0.04209531864771717 -0.9611185195569437 -0.3493805390110045 0.3752751708285271 -0.28824269480756903 -0.0899568402734146 -0.7077880082031884 0.4219096981099068 -0.4093739891492758 -0.2055219060653654 1.3144282945889445 1.3487878682901 0.4293192866086668 -0.35331772809174306 -2.2826706845081164 2.29392855287745 -0.8770797047105753 0.6595634650916563 -0.4031787064662481 0 +0.6325447969724978 -1.5376848226493998 2.135545601595113 -0.7169675793179096 0.7929518975841817 -1.9315293250980572 1.3897142939008622 0.24930998597507595 -1.6440687479969183 -0.3704887551777182 -1.23787039502056 1.1836559269554183 -1.0938410824485512 -0.9895111468738925 -1.9260882651788052 2.109489705785208 0.21325468197813358 -0.1667210430129357 -0.4438538195629017 0.7910893416120955 1 +1.385783766454507 0.6443593624326104 -0.696350741910387 -0.823087860995007 -2.674354948547689 -0.49104596911569837 -0.14505356097389743 0.08649405653783686 0.32769430695483825 0.5845207431072055 -0.24481231922778438 0.8116910518786606 1.1430734254415746 0.32847783781427603 -0.24814981566368804 -2.8145262786887635 3.1865533860467052 0.44909883424446956 -0.402495596969506 -0.4328771627918769 0 +3.2529008023011587 -0.27166980167059496 -0.10473605798933078 -0.6534723222613076 -0.47729389928282157 0.19299500589830051 -0.24751855177125084 1.0219251961145952 -1.3171347334030596 -0.32230874972038603 -0.8110222905403106 -1.1322412716856916 -0.4661557022161254 -0.9471392661729446 -1.5958813690320397 1.160984081252255 0.8843769178013272 -0.035928362941471184 -0.8154578692172377 0.5729651158375776 1 +-0.9552158838227957 -0.3785028025591672 0.23351936921649144 -1.365343241823016 -0.6359698186412605 0.2872129861981349 0.01632286834064877 0.9912188508026412 -0.4305595490234799 -0.2605126207976518 0.3214442712943701 -0.20958795245614859 -1.4526406739111428 0.03730765585464991 -1.3274909827312888 1.1647254348024332 -0.769978389629172 1.0149522887472011 0.27653105409089324 0.27755713923924 1 +0.6551705283348923 -0.5615847942521986 -0.49519737438896855 0.23737629933432333 -0.4143994932544478 0.5167863504871545 0.3437170326220349 -0.7014811472600427 -1.6077015111257857 0.09451199914284816 0.5398998770150264 1.7475220863842662 -0.7767689612363475 -0.2216084475817371 1.183412573203491 2.0036214776598777 0.2883927875098986 0.46301689909689936 -0.5918632272605117 0.766784528636304 1 +-0.3361436284769567 0.1823427274870421 3.334203517597432 1.0128962309550167 -1.8811146489414055 -0.958168335581346 -0.5484922802752095 0.11760845626656423 1.1468147240921671 0.49875048880422795 3.1733905239619795 -0.0526349697724523 0.08652484860757291 0.5769340599430341 -1.0778260770671824 -0.8829578732735933 -0.9425233847712056 1.6033719963489919 1.8445232062556762 -0.48417251502812303 0 +0.9050528629328798 -0.012035767922212968 0.21306591909620448 1.0094897718684082 1.8398709351830922 -0.20939878024355807 1.544249561568332 -0.5558744255462802 -0.14830157676341127 -0.9129893226159165 -0.9052536407792096 -2.185153803257982 -0.7555250892846609 1.0407174952822522 -0.45036832301510676 0.8342667153934721 -0.849352027222355 -0.9657156624472774 -1.0122112207459872 0.1453852453196201 1 +1.178239159200306 -1.0652461548210312 0.32928250529485964 0.16713678370411497 0.12495397935004156 2.745117964775073 0.6030536979033265 -0.5722638992074314 0.9615416437730038 -0.44340798605665754 -1.5164304957203023 -1.0614676369216434 -0.08605564337254189 -0.15484845483449294 0.7389539007599524 0.7502907577776994 -2.800745114653922 -1.9836209428041778 -0.1788939995187421 -0.23460734202135813 0 +-0.022012467048051917 -0.2980589001770356 -0.9287657608462492 0.2022550669003972 1.3583611934492914 -0.3473542636872249 -0.08008290659022492 -1.094868489559057 0.3797735402439996 -1.9003696914644261 1.3733264119781319 0.49468129909971936 -0.5266982026448499 0.21506804700839205 -1.0239364192571805 0.08708817019212689 -0.8239609000108052 -1.0562806080043665 -0.6782509079000207 -0.11671445720024777 0 +-0.05535106725613376 1.897495684900051 -1.2961422703619865 -2.2362527882016288 0.6062782036825521 2.4944056179800698 -0.3652339819814644 -0.4307541449118705 -0.5320017432805376 0.42491286095294456 0.8968935558620045 -0.3501200079640903 -0.9035207258064066 -0.20458977846842988 0.6228215147539629 0.36595471824159787 0.4960995217769678 -0.7661022207718267 0.046327557310846944 0.21958825180654357 0 +0.4892337648335795 -0.887961134764646 -0.6575191404509574 -0.9041652092433549 -0.1504880604676619 -0.14829295739477777 0.28675094725200034 -0.5695736471796179 0.15975525591910827 -2.267876921091358 0.3074302518646544 0.2859729425182367 -0.12518243894874598 0.5923394212109696 -1.4363920287788075 -0.9059221277254496 0.9246917409852377 -0.1251848370827014 0.07971000908831376 -0.15744397774867594 0 +-1.7231933239653434 -0.24801134827199994 -1.9898222399382914 0.7656954261085819 -0.05483023725936617 1.6169399021897064 -0.3967249498631411 1.0323459107790158 0.9731895081194355 1.0303924263130786 1.0329180459160618 -0.033547027338664666 -1.0624411368884286 -0.9342158375564429 0.05971477069293665 0.25789653038454863 -2.1582838562759 -0.2780337171101295 0.7441495680026682 -0.2950948350858021 0 +0.16933309281863 -1.3713232471471188 -0.28145821900384405 -1.1300262257452833 0.5588657879489666 0.18393634027606567 -0.33064387147695085 -0.2728913561712938 -1.5796081028817355 -0.059698139612798386 -0.5305183143587244 0.4522332723500524 -0.35850443734187276 -0.6618912758728542 1.105836446597426 -0.8045286988938815 4.02369826067075 -0.6441278738693271 -1.1617665339422667 0.43461303247631455 0 +-1.8460295965152045 -0.255975214092637 1.0540424748134019 1.3190200056340993 -0.9984660716843727 0.1252126858419551 1.479116981117545 -0.07780687825586112 0.1755389386980704 -0.7247573669263252 -0.18580560212243427 0.4759463602670577 -1.079448951686073 0.5844426958957524 -0.013805770284701622 -1.7460392281016928 2.0284596495593634 -0.7858761582110539 -0.17228886477186073 -0.2592823117499626 0 +1.8771428706377922 1.954430088902813 -1.1616019467282765 0.5673334205644196 -0.08799540550164092 0.06644430233106957 0.5679433816499357 0.42441824827810354 0.1518278594250636 0.4306132751340653 0.0692509618345264 -0.1016379743818435 -0.5693165703158743 0.2262121311410064 -1.190784254860191 0.9589244192715091 -1.5758227297795224 0.32702615652721884 0.9015922583874204 0.05956556043266634 1 +0.15323002771333824 -0.3966186853856485 0.8421724903224964 -1.317627725338646 -0.33858048238968697 -0.4090657931046078 -1.4582418462866669 -0.6594840624629351 -0.4004108226455998 -0.7863950304118423 -0.7665729756746352 -0.010906592167949567 0.453194204359973 0.004008795533567026 1.3681052191345213 0.8285147180193451 -0.37259127080818166 0.7918792014178204 0.013153036557870796 0.22884946912013177 1 +-1.0926888646283135 0.7474034182399546 0.5070475019762871 -0.8560620219978579 2.019086116729861 2.7090019473659184 -0.5897085867477189 0.46800068820276425 1.1973925923016058 0.7580424981657605 -0.17689686434453186 -0.8134248245767957 -0.8757308415987771 0.1763704781550424 -1.199439969467994 -0.8989032076979058 -1.0151074498008397 -0.2667781642372559 1.5593148568891022 -0.5028825773221669 0 +-0.0696156591485477 -0.3955656348590421 -1.790003919076157 -3.209955381978046 1.7551741656764832 0.11653331605849324 -0.9325834567618385 -1.9081847831366037 1.5011366872997127 1.3655901991926498 0.714532047991697 -0.6735645547992268 2.4009183113212806 0.2753934759411781 -0.5586953357167566 -2.4248580602515304 0.4780055133333252 0.22430285295477725 1.5235848315795288 -0.779646482652198 0 +0.2383846452550063 -0.3130077315757537 1.0033975572213907 0.08864979057352633 1.6717911886146681 1.3347307577271426 0.12355262918532725 0.38378884838187516 1.0545758256277624 1.1966614601200112 -0.10788917679723521 1.5477291028255866 0.2484946248806814 -1.1366727112923867 -0.46484257027188 -0.6665072856921015 -1.062873534624194 0.8876717808262652 -1.3245780959402302 -0.4285126387910002 0 +-2.008942616762241 -0.8234988716333305 -0.15859132011071364 -0.5779462669917929 0.05687216122626013 -0.711741585516688 0.30663585257868975 -0.7322607097367665 -0.27918196650116295 0.23889598302964352 -2.89224040536514 -1.8338737352874381 -0.03502705018890768 -0.04826170379593097 -0.5084528851522548 1.0144555813357954 -0.8489078616442869 -1.5316018230959503 -1.9059055368464786 0.20977097201525036 1 +-0.1704564684096478 0.18971879197958597 -1.1844114274105708 -0.8546727892795731 0.09277642496734965 -0.1366293792823912 -2.048671922604096 -0.3357568385230854 1.4483592899951359 -1.0696662666401626 -0.2329845615794952 0.7837860781804775 0.41841523883774684 -0.8676594983663888 0.22583874577075078 -1.695720544464892 -0.4072557367301234 -0.1977972902611956 0.02359749586524577 -0.6782209637144826 0 +0.3239072506712229 0.7771447267055485 0.7529184295240164 -0.809273033397095 -0.5856061645692245 -0.6334300503835257 -0.7685061144460843 1.0110108162654712 -0.6307900736125656 1.0720688438114894 0.7375706675328788 -1.2970277152025405 -1.0622293344492408 0.12369973790391253 0.08645024003597679 -0.8294853204395023 2.2922588248961673 -2.306182941147614 -0.23693404546697278 0.11513663282079874 1 +-0.12031642840440407 -0.055598926892828825 0.29442208903978195 -0.08405908275243704 2.5707645107660437 -2.2724393778493805 -0.7091400944632673 -0.01527361681359736 -1.2630992116666893 -0.29672975912512006 -1.1604505895963486 -0.7448891733298583 -0.7216707082208504 1.6347076109296752 0.2543420370586476 0.9986464179201701 1.0028111182919377 -1.0099153635800724 0.6364125215344348 0.5362734706812686 1 +1.0759409181533681 0.6338708137850724 1.059455516811933 0.2736075032324234 -1.1004879462237114 0.8983820725024066 -0.9152704846639929 -0.8347039847535137 -1.3994538124984017 0.06937008395653746 -0.4322117530530746 -1.297471755359271 -0.9256383920977915 -1.5287869947378168 0.46665199638203264 1.3984163949968078 0.7172731124783118 -2.1595920504682318 0.2178924553288528 0.627726734926914 1 +1.1631257343736865 0.7161109143496656 1.165181781246556 -0.0970197604214342 1.770668260834617 0.09786380091576943 -0.25203469271235573 -0.07117035012372852 1.2621614052889216 -2.204226920077547 -0.833481645415412 1.668179441254334 0.6299876168291397 -0.4391047192362273 -0.12336287720355432 -2.4752753514344055 0.9905764766530935 0.16824138572933983 -1.108371640458861 -0.7056991628790823 0 +-0.4653767839296524 0.5706552646301977 -1.2510825198094822 -0.38542737502404606 0.5418393251037328 0.8696564647003973 -0.2677426807372017 1.3874400614164746 -1.6989225614176242 -0.8543980754353178 -0.7126300388983264 0.39242735549607893 0.7427861661062981 0.23731164772086588 0.17840259925316965 2.264950231927068 0.10561848543619334 1.7893962060023398 -0.33937719999794 0.8272635120183163 1 +1.0658262297925543 0.2245144207327693 1.9979515177687335 -1.3687162010707115 -1.1274591498928925 0.6453464430821444 0.10571095020938731 -0.04489492214522473 0.4070092579150457 -1.6549967992364703 -0.1861816445428681 -1.0013467840435817 0.13042091725382485 -0.9328609421342365 1.4771353822876396 1.0854915441340736 -2.221251309417225 0.5725567515972323 -1.1577200461261594 -0.011036089287608658 1 +-1.0583794427218747 2.576977679031155 -0.5895820679190702 0.13438281144361666 0.36102541634537905 1.5183620699261768 1.5873212424728582 -0.7273069057149364 0.4522026560345715 -0.02860552628379647 -0.018212347104613166 0.687677616154882 0.5422573331869172 0.10659762229930982 -1.2522775141080984 0.7277335248049872 -1.8227895144219035 -0.7301662802248373 0.9715535632493052 -0.0672408254641321 1 +-0.1099953959208559 1.6635363107373078 0.3272453529764515 -1.4246555886796946 1.2410820871966046 -0.15951736500333072 -0.661937714925914 0.4234572818376501 1.1246881843788494 0.9529594279919252 0.39143861927191975 3.465227148479317 -0.24134874955198468 -1.0945571896156956 -0.9833626436429376 -1.480187693017323 -0.09583127396217472 -0.31134706056867467 -0.6248721853412322 -0.5454408106982881 0 +0.9291001132966914 -0.1708304076874391 0.5364439368681257 0.2630766894332881 -0.1295965590136687 0.9929416493373554 0.7904280904722739 -0.01912275129904966 1.5057113544481104 -1.9314128569290476 -0.40508326392063543 1.0918159072154612 0.1881369570559398 -1.213691539345214 0.02421534060406341 -1.96631401509566 -0.14897841915958698 -2.1313146599852018 -1.2710579854942345 -0.7284633084773273 0 +0.6336131127287113 2.0333233170635046 -0.022356711144941453 -0.22007309599774338 0.9282123550423084 -0.787901129200937 0.5812629099886915 0.377426024051308 0.15067520175237897 -2.340925516401822 0.07371157701560777 1.560723423781778 -0.38910754054643126 1.0173191686261756 -0.4198460795464502 -0.4257545472403689 0.2939445657648525 0.6855820937261274 -2.068890495355913 -0.09921878204870066 0 +2.049778771444076 1.3048378295965286 1.563792608618236 -0.7047392202425459 0.5499305970570395 -0.04884518704139992 0.5223109585785488 -1.4893434370374596 1.3606389947395752 0.3899429971033616 0.055686488142052015 0.8438100462780511 1.6850310129308619 1.2652993760910154 -0.2279594058376745 -1.9365760629271713 0.0807919955941725 -0.6380407350109051 -1.0466273798176675 -0.6766362607223333 0 +0.630742979769623 -0.12660063112597814 -1.1219892377344292 -0.24320231504242704 -0.11846930012185257 0.35618373486097415 -0.35432027228237667 0.6830976831702715 -1.2988376519016114 -0.12917328933680922 0.4878147649765918 1.6226344780340827 0.46020710543895615 -0.9537377215409267 0.8308526010187456 1.1069055404414496 0.9232784698807094 -1.2718116679596179 -0.5666412777157238 0.5606432963172591 1
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/classification_report.txt Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,9 @@ +classification_report : + precision recall f1-score support + + 0 1.00 1.00 1.00 14 + 1 1.00 0.62 0.77 16 + 2 0.60 1.00 0.75 9 + +avg / total 0.91 0.85 0.85 39 +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/cluster_result01.txt Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,48 @@ +0 44 64 -76 0 +0 51 48 -73 0 +0 58 65 -49 0 +0 43 61 -49 0 +0 45 43 -79 0 +0 42 60 -98 0 +0 50 55 -59 0 +0 53 53 -56 0 +0 45 44 -61 0 +0 43 65 -84 0 +0 35 52 -75 0 +0 56 56 -70 0 +1 -61 86 43 2 +1 -67 93 15 2 +1 -59 94 36 2 +1 -50 92 62 2 +1 -78 91 70 2 +1 -35 87 47 2 +1 -56 91 52 2 +1 -61 81 46 2 +1 -83 78 34 2 +1 -50 87 45 2 +1 -67 73 50 2 +1 -50 97 45 2 +1 -61 111 45 2 +2 -109 23 -92 1 +2 -94 20 -96 1 +2 -85 26 -88 1 +2 -90 33 -114 1 +2 -63 9 -106 1 +2 -79 9 -93 1 +2 -99 26 -108 1 +2 -81 19 -110 1 +2 -108 21 -108 1 +2 -92 27 -106 1 +2 -88 2 -106 1 +2 -88 15 -103 1 +3 54 -74 4 3 +3 42 -92 31 3 +3 39 -99 -7 3 +3 48 -115 -5 3 +3 39 -96 2 3 +3 31 -109 9 3 +3 33 -96 -8 3 +3 23 -102 4 3 +3 38 -90 21 3 +3 34 -107 1 3 +3 35 -78 18 3
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/cluster_result02.txt Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,48 @@ +0 44 64 -76 3 +0 51 48 -73 3 +0 58 65 -49 3 +0 43 61 -49 3 +0 45 43 -79 3 +0 42 60 -98 3 +0 50 55 -59 3 +0 53 53 -56 3 +0 45 44 -61 3 +0 43 65 -84 3 +0 35 52 -75 3 +0 56 56 -70 3 +1 -61 86 43 2 +1 -67 93 15 2 +1 -59 94 36 2 +1 -50 92 62 2 +1 -78 91 70 2 +1 -35 87 47 2 +1 -56 91 52 2 +1 -61 81 46 2 +1 -83 78 34 2 +1 -50 87 45 2 +1 -67 73 50 2 +1 -50 97 45 2 +1 -61 111 45 2 +2 -109 23 -92 0 +2 -94 20 -96 0 +2 -85 26 -88 0 +2 -90 33 -114 0 +2 -63 9 -106 0 +2 -79 9 -93 0 +2 -99 26 -108 0 +2 -81 19 -110 0 +2 -108 21 -108 0 +2 -92 27 -106 0 +2 -88 2 -106 0 +2 -88 15 -103 0 +3 54 -74 4 1 +3 42 -92 31 1 +3 39 -99 -7 1 +3 48 -115 -5 1 +3 39 -96 2 1 +3 31 -109 9 1 +3 33 -96 -8 1 +3 23 -102 4 1 +3 38 -90 21 1 +3 34 -107 1 1 +3 35 -78 18 1
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/cluster_result03.txt Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,48 @@ +0 44 64 -76 -1 +0 51 48 -73 -1 +0 58 65 -49 -1 +0 43 61 -49 -1 +0 45 43 -79 -1 +0 42 60 -98 -1 +0 50 55 -59 -1 +0 53 53 -56 -1 +0 45 44 -61 -1 +0 43 65 -84 -1 +0 35 52 -75 -1 +0 56 56 -70 -1 +1 -61 86 43 -1 +1 -67 93 15 -1 +1 -59 94 36 -1 +1 -50 92 62 -1 +1 -78 91 70 -1 +1 -35 87 47 -1 +1 -56 91 52 -1 +1 -61 81 46 -1 +1 -83 78 34 -1 +1 -50 87 45 -1 +1 -67 73 50 -1 +1 -50 97 45 -1 +1 -61 111 45 -1 +2 -109 23 -92 -1 +2 -94 20 -96 -1 +2 -85 26 -88 -1 +2 -90 33 -114 -1 +2 -63 9 -106 -1 +2 -79 9 -93 -1 +2 -99 26 -108 -1 +2 -81 19 -110 -1 +2 -108 21 -108 -1 +2 -92 27 -106 -1 +2 -88 2 -106 -1 +2 -88 15 -103 -1 +3 54 -74 4 -1 +3 42 -92 31 -1 +3 39 -99 -7 -1 +3 48 -115 -5 -1 +3 39 -96 2 -1 +3 31 -109 9 -1 +3 33 -96 -8 -1 +3 23 -102 4 -1 +3 38 -90 21 -1 +3 34 -107 1 -1 +3 35 -78 18 -1
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/cluster_result04.txt Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,48 @@ +0 44 64 -76 1 +0 51 48 -73 1 +0 58 65 -49 1 +0 43 61 -49 1 +0 45 43 -79 1 +0 42 60 -98 1 +0 50 55 -59 1 +0 53 53 -56 1 +0 45 44 -61 1 +0 43 65 -84 1 +0 35 52 -75 1 +0 56 56 -70 1 +1 -61 86 43 2 +1 -67 93 15 2 +1 -59 94 36 2 +1 -50 92 62 2 +1 -78 91 70 2 +1 -35 87 47 2 +1 -56 91 52 2 +1 -61 81 46 2 +1 -83 78 34 2 +1 -50 87 45 2 +1 -67 73 50 2 +1 -50 97 45 2 +1 -61 111 45 2 +2 -109 23 -92 3 +2 -94 20 -96 3 +2 -85 26 -88 3 +2 -90 33 -114 3 +2 -63 9 -106 3 +2 -79 9 -93 3 +2 -99 26 -108 3 +2 -81 19 -110 3 +2 -108 21 -108 3 +2 -92 27 -106 3 +2 -88 2 -106 3 +2 -88 15 -103 3 +3 54 -74 4 0 +3 42 -92 31 0 +3 39 -99 -7 0 +3 48 -115 -5 0 +3 39 -96 2 0 +3 31 -109 9 0 +3 33 -96 -8 0 +3 23 -102 4 0 +3 38 -90 21 0 +3 34 -107 1 0 +3 35 -78 18 0
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/cluster_result05.txt Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,48 @@ +0 44 64 -76 0 +0 51 48 -73 0 +0 58 65 -49 0 +0 43 61 -49 0 +0 45 43 -79 0 +0 42 60 -98 0 +0 50 55 -59 0 +0 53 53 -56 0 +0 45 44 -61 0 +0 43 65 -84 0 +0 35 52 -75 0 +0 56 56 -70 0 +1 -61 86 43 2 +1 -67 93 15 2 +1 -59 94 36 2 +1 -50 92 62 2 +1 -78 91 70 2 +1 -35 87 47 2 +1 -56 91 52 2 +1 -61 81 46 2 +1 -83 78 34 2 +1 -50 87 45 2 +1 -67 73 50 2 +1 -50 97 45 2 +1 -61 111 45 2 +2 -109 23 -92 0 +2 -94 20 -96 0 +2 -85 26 -88 0 +2 -90 33 -114 0 +2 -63 9 -106 0 +2 -79 9 -93 0 +2 -99 26 -108 0 +2 -81 19 -110 0 +2 -108 21 -108 0 +2 -92 27 -106 0 +2 -88 2 -106 0 +2 -88 15 -103 0 +3 54 -74 4 1 +3 42 -92 31 1 +3 39 -99 -7 1 +3 48 -115 -5 1 +3 39 -96 2 1 +3 31 -109 9 1 +3 33 -96 -8 1 +3 23 -102 4 1 +3 38 -90 21 1 +3 34 -107 1 1 +3 35 -78 18 1
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/cluster_result06.txt Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,48 @@ +0 44 64 -76 0 +0 51 48 -73 0 +0 58 65 -49 0 +0 43 61 -49 0 +0 45 43 -79 0 +0 42 60 -98 0 +0 50 55 -59 0 +0 53 53 -56 0 +0 45 44 -61 0 +0 43 65 -84 0 +0 35 52 -75 0 +0 56 56 -70 0 +1 -61 86 43 1 +1 -67 93 15 1 +1 -59 94 36 1 +1 -50 92 62 1 +1 -78 91 70 1 +1 -35 87 47 1 +1 -56 91 52 1 +1 -61 81 46 1 +1 -83 78 34 1 +1 -50 87 45 1 +1 -67 73 50 1 +1 -50 97 45 1 +1 -61 111 45 1 +2 -109 23 -92 2 +2 -94 20 -96 2 +2 -85 26 -88 2 +2 -90 33 -114 2 +2 -63 9 -106 2 +2 -79 9 -93 2 +2 -99 26 -108 2 +2 -81 19 -110 2 +2 -108 21 -108 2 +2 -92 27 -106 2 +2 -88 2 -106 2 +2 -88 15 -103 2 +3 54 -74 4 3 +3 42 -92 31 3 +3 39 -99 -7 3 +3 48 -115 -5 3 +3 39 -96 2 3 +3 31 -109 9 3 +3 33 -96 -8 3 +3 23 -102 4 3 +3 38 -90 21 3 +3 34 -107 1 3 +3 35 -78 18 3
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/cluster_result07.txt Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,48 @@ +0 44 64 -76 0 +0 51 48 -73 0 +0 58 65 -49 0 +0 43 61 -49 0 +0 45 43 -79 0 +0 42 60 -98 0 +0 50 55 -59 0 +0 53 53 -56 0 +0 45 44 -61 0 +0 43 65 -84 0 +0 35 52 -75 0 +0 56 56 -70 0 +1 -61 86 43 1 +1 -67 93 15 1 +1 -59 94 36 1 +1 -50 92 62 1 +1 -78 91 70 1 +1 -35 87 47 1 +1 -56 91 52 1 +1 -61 81 46 1 +1 -83 78 34 1 +1 -50 87 45 1 +1 -67 73 50 1 +1 -50 97 45 1 +1 -61 111 45 1 +2 -109 23 -92 2 +2 -94 20 -96 2 +2 -85 26 -88 2 +2 -90 33 -114 2 +2 -63 9 -106 2 +2 -79 9 -93 2 +2 -99 26 -108 2 +2 -81 19 -110 2 +2 -108 21 -108 2 +2 -92 27 -106 2 +2 -88 2 -106 2 +2 -88 15 -103 2 +3 54 -74 4 3 +3 42 -92 31 3 +3 39 -99 -7 3 +3 48 -115 -5 3 +3 39 -96 2 3 +3 31 -109 9 3 +3 33 -96 -8 3 +3 23 -102 4 3 +3 38 -90 21 3 +3 34 -107 1 3 +3 35 -78 18 3
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/cluster_result08.txt Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,48 @@ +0 44 64 -76 0 +0 51 48 -73 0 +0 58 65 -49 0 +0 43 61 -49 0 +0 45 43 -79 0 +0 42 60 -98 0 +0 50 55 -59 0 +0 53 53 -56 0 +0 45 44 -61 0 +0 43 65 -84 0 +0 35 52 -75 0 +0 56 56 -70 0 +1 -61 86 43 0 +1 -67 93 15 0 +1 -59 94 36 0 +1 -50 92 62 0 +1 -78 91 70 0 +1 -35 87 47 0 +1 -56 91 52 0 +1 -61 81 46 0 +1 -83 78 34 0 +1 -50 87 45 0 +1 -67 73 50 0 +1 -50 97 45 0 +1 -61 111 45 0 +2 -109 23 -92 0 +2 -94 20 -96 0 +2 -85 26 -88 0 +2 -90 33 -114 0 +2 -63 9 -106 0 +2 -79 9 -93 0 +2 -99 26 -108 0 +2 -81 19 -110 0 +2 -108 21 -108 0 +2 -92 27 -106 0 +2 -88 2 -106 0 +2 -88 15 -103 0 +3 54 -74 4 1 +3 42 -92 31 1 +3 39 -99 -7 1 +3 48 -115 -5 1 +3 39 -96 2 1 +3 31 -109 9 1 +3 33 -96 -8 1 +3 23 -102 4 1 +3 38 -90 21 1 +3 34 -107 1 1 +3 35 -78 18 1
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/cluster_result09.txt Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,48 @@ +0 44 64 -76 0 +0 51 48 -73 0 +0 58 65 -49 0 +0 43 61 -49 0 +0 45 43 -79 0 +0 42 60 -98 0 +0 50 55 -59 0 +0 53 53 -56 0 +0 45 44 -61 0 +0 43 65 -84 0 +0 35 52 -75 0 +0 56 56 -70 0 +1 -61 86 43 0 +1 -67 93 15 0 +1 -59 94 36 0 +1 -50 92 62 0 +1 -78 91 70 0 +1 -35 87 47 0 +1 -56 91 52 0 +1 -61 81 46 0 +1 -83 78 34 0 +1 -50 87 45 0 +1 -67 73 50 0 +1 -50 97 45 0 +1 -61 111 45 0 +2 -109 23 -92 0 +2 -94 20 -96 0 +2 -85 26 -88 0 +2 -90 33 -114 0 +2 -63 9 -106 0 +2 -79 9 -93 0 +2 -99 26 -108 0 +2 -81 19 -110 0 +2 -108 21 -108 0 +2 -92 27 -106 0 +2 -88 2 -106 0 +2 -88 15 -103 0 +3 54 -74 4 1 +3 42 -92 31 1 +3 39 -99 -7 1 +3 48 -115 -5 1 +3 39 -96 2 1 +3 31 -109 9 1 +3 33 -96 -8 1 +3 23 -102 4 1 +3 38 -90 21 1 +3 34 -107 1 1 +3 35 -78 18 1
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/cluster_result10.txt Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,48 @@ +0 44 64 -76 3 +0 51 48 -73 3 +0 58 65 -49 3 +0 43 61 -49 3 +0 45 43 -79 3 +0 42 60 -98 3 +0 50 55 -59 3 +0 53 53 -56 3 +0 45 44 -61 3 +0 43 65 -84 3 +0 35 52 -75 3 +0 56 56 -70 3 +1 -61 86 43 0 +1 -67 93 15 0 +1 -59 94 36 0 +1 -50 92 62 0 +1 -78 91 70 0 +1 -35 87 47 0 +1 -56 91 52 0 +1 -61 81 46 0 +1 -83 78 34 0 +1 -50 87 45 0 +1 -67 73 50 0 +1 -50 97 45 0 +1 -61 111 45 0 +2 -109 23 -92 2 +2 -94 20 -96 2 +2 -85 26 -88 2 +2 -90 33 -114 2 +2 -63 9 -106 2 +2 -79 9 -93 2 +2 -99 26 -108 2 +2 -81 19 -110 2 +2 -108 21 -108 2 +2 -92 27 -106 2 +2 -88 2 -106 2 +2 -88 15 -103 2 +3 54 -74 4 1 +3 42 -92 31 1 +3 39 -99 -7 1 +3 48 -115 -5 1 +3 39 -96 2 1 +3 31 -109 9 1 +3 33 -96 -8 1 +3 23 -102 4 1 +3 38 -90 21 1 +3 34 -107 1 1 +3 35 -78 18 1
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/cluster_result11.txt Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,48 @@ +0 44 64 -76 2 +0 51 48 -73 2 +0 58 65 -49 2 +0 43 61 -49 2 +0 45 43 -79 2 +0 42 60 -98 2 +0 50 55 -59 2 +0 53 53 -56 2 +0 45 44 -61 2 +0 43 65 -84 2 +0 35 52 -75 2 +0 56 56 -70 2 +1 -61 86 43 0 +1 -67 93 15 0 +1 -59 94 36 0 +1 -50 92 62 0 +1 -78 91 70 0 +1 -35 87 47 0 +1 -56 91 52 0 +1 -61 81 46 0 +1 -83 78 34 0 +1 -50 87 45 0 +1 -67 73 50 0 +1 -50 97 45 0 +1 -61 111 45 0 +2 -109 23 -92 1 +2 -94 20 -96 1 +2 -85 26 -88 1 +2 -90 33 -114 1 +2 -63 9 -106 1 +2 -79 9 -93 1 +2 -99 26 -108 1 +2 -81 19 -110 1 +2 -108 21 -108 1 +2 -92 27 -106 1 +2 -88 2 -106 1 +2 -88 15 -103 1 +3 54 -74 4 3 +3 42 -92 31 3 +3 39 -99 -7 3 +3 48 -115 -5 3 +3 39 -96 2 3 +3 31 -109 9 3 +3 33 -96 -8 3 +3 23 -102 4 3 +3 38 -90 21 3 +3 34 -107 1 3 +3 35 -78 18 3
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/cluster_result12 Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,48 @@ +0 44 64 -76 3 +0 51 48 -73 3 +0 58 65 -49 3 +0 43 61 -49 1 +0 45 43 -79 3 +0 42 60 -98 0 +0 50 55 -59 2 +0 53 53 -56 2 +0 45 44 -61 2 +0 43 65 -84 3 +0 35 52 -75 1 +0 56 56 -70 3 +1 -61 86 43 0 +1 -67 93 15 3 +1 -59 94 36 0 +1 -50 92 62 2 +1 -78 91 70 2 +1 -35 87 47 3 +1 -56 91 52 2 +1 -61 81 46 0 +1 -83 78 34 2 +1 -50 87 45 2 +1 -67 73 50 2 +1 -50 97 45 2 +1 -61 111 45 0 +2 -109 23 -92 0 +2 -94 20 -96 0 +2 -85 26 -88 0 +2 -90 33 -114 0 +2 -63 9 -106 2 +2 -79 9 -93 2 +2 -99 26 -108 0 +2 -81 19 -110 0 +2 -108 21 -108 0 +2 -92 27 -106 0 +2 -88 2 -106 0 +2 -88 15 -103 0 +3 54 -74 4 1 +3 42 -92 31 0 +3 39 -99 -7 2 +3 48 -115 -5 2 +3 39 -96 2 2 +3 31 -109 9 1 +3 33 -96 -8 2 +3 23 -102 4 1 +3 38 -90 21 0 +3 34 -107 1 1 +3 35 -78 18 0
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/cluster_result12.txt Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,48 @@ +0 44 64 -76 1 +0 51 48 -73 1 +0 58 65 -49 1 +0 43 61 -49 0 +0 45 43 -79 1 +0 42 60 -98 1 +0 50 55 -59 1 +0 53 53 -56 1 +0 45 44 -61 0 +0 43 65 -84 1 +0 35 52 -75 1 +0 56 56 -70 1 +1 -61 86 43 2 +1 -67 93 15 1 +1 -59 94 36 1 +1 -50 92 62 0 +1 -78 91 70 1 +1 -35 87 47 1 +1 -56 91 52 0 +1 -61 81 46 2 +1 -83 78 34 1 +1 -50 87 45 0 +1 -67 73 50 1 +1 -50 97 45 0 +1 -61 111 45 1 +2 -109 23 -92 0 +2 -94 20 -96 3 +2 -85 26 -88 3 +2 -90 33 -114 3 +2 -63 9 -106 0 +2 -79 9 -93 1 +2 -99 26 -108 3 +2 -81 19 -110 3 +2 -108 21 -108 3 +2 -92 27 -106 3 +2 -88 2 -106 0 +2 -88 15 -103 3 +3 54 -74 4 1 +3 42 -92 31 3 +3 39 -99 -7 3 +3 48 -115 -5 1 +3 39 -96 2 3 +3 31 -109 9 3 +3 33 -96 -8 3 +3 23 -102 4 3 +3 38 -90 21 3 +3 34 -107 1 3 +3 35 -78 18 3
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/cluster_result13.txt Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,48 @@ +0 44 64 -76 4 +0 51 48 -73 0 +0 58 65 -49 0 +0 43 61 -49 1 +0 45 43 -79 0 +0 42 60 -98 0 +0 50 55 -59 2 +0 53 53 -56 2 +0 45 44 -61 0 +0 43 65 -84 4 +0 35 52 -75 1 +0 56 56 -70 0 +1 -61 86 43 0 +1 -67 93 15 0 +1 -59 94 36 0 +1 -50 92 62 0 +1 -78 91 70 1 +1 -35 87 47 0 +1 -56 91 52 0 +1 -61 81 46 0 +1 -83 78 34 0 +1 -50 87 45 0 +1 -67 73 50 1 +1 -50 97 45 0 +1 -61 111 45 0 +2 -109 23 -92 0 +2 -94 20 -96 0 +2 -85 26 -88 0 +2 -90 33 -114 1 +2 -63 9 -106 0 +2 -79 9 -93 1 +2 -99 26 -108 3 +2 -81 19 -110 0 +2 -108 21 -108 0 +2 -92 27 -106 3 +2 -88 2 -106 1 +2 -88 15 -103 0 +3 54 -74 4 0 +3 42 -92 31 1 +3 39 -99 -7 1 +3 48 -115 -5 1 +3 39 -96 2 1 +3 31 -109 9 1 +3 33 -96 -8 1 +3 23 -102 4 0 +3 38 -90 21 1 +3 34 -107 1 1 +3 35 -78 18 1
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/cluster_result14.txt Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,48 @@ +0 44 64 -76 2 +0 51 48 -73 2 +0 58 65 -49 5 +0 43 61 -49 5 +0 45 43 -79 2 +0 42 60 -98 2 +0 50 55 -59 5 +0 53 53 -56 5 +0 45 44 -61 2 +0 43 65 -84 2 +0 35 52 -75 2 +0 56 56 -70 2 +1 -61 86 43 1 +1 -67 93 15 1 +1 -59 94 36 1 +1 -50 92 62 1 +1 -78 91 70 7 +1 -35 87 47 1 +1 -56 91 52 1 +1 -61 81 46 7 +1 -83 78 34 7 +1 -50 87 45 1 +1 -67 73 50 7 +1 -50 97 45 1 +1 -61 111 45 1 +2 -109 23 -92 6 +2 -94 20 -96 6 +2 -85 26 -88 6 +2 -90 33 -114 6 +2 -63 9 -106 3 +2 -79 9 -93 3 +2 -99 26 -108 6 +2 -81 19 -110 6 +2 -108 21 -108 6 +2 -92 27 -106 6 +2 -88 2 -106 3 +2 -88 15 -103 6 +3 54 -74 4 4 +3 42 -92 31 4 +3 39 -99 -7 0 +3 48 -115 -5 0 +3 39 -96 2 0 +3 31 -109 9 0 +3 33 -96 -8 0 +3 23 -102 4 0 +3 38 -90 21 4 +3 34 -107 1 0 +3 35 -78 18 4
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/cluster_result15.txt Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,48 @@ +0 44 64 -76 1 +0 51 48 -73 1 +0 58 65 -49 1 +0 43 61 -49 1 +0 45 43 -79 1 +0 42 60 -98 1 +0 50 55 -59 1 +0 53 53 -56 1 +0 45 44 -61 1 +0 43 65 -84 1 +0 35 52 -75 1 +0 56 56 -70 1 +1 -61 86 43 2 +1 -67 93 15 2 +1 -59 94 36 2 +1 -50 92 62 2 +1 -78 91 70 2 +1 -35 87 47 2 +1 -56 91 52 2 +1 -61 81 46 2 +1 -83 78 34 2 +1 -50 87 45 2 +1 -67 73 50 2 +1 -50 97 45 2 +1 -61 111 45 2 +2 -109 23 -92 3 +2 -94 20 -96 3 +2 -85 26 -88 3 +2 -90 33 -114 3 +2 -63 9 -106 3 +2 -79 9 -93 3 +2 -99 26 -108 3 +2 -81 19 -110 3 +2 -108 21 -108 3 +2 -92 27 -106 3 +2 -88 2 -106 3 +2 -88 15 -103 3 +3 54 -74 4 0 +3 42 -92 31 0 +3 39 -99 -7 0 +3 48 -115 -5 0 +3 39 -96 2 0 +3 31 -109 9 0 +3 33 -96 -8 0 +3 23 -102 4 0 +3 38 -90 21 0 +3 34 -107 1 0 +3 35 -78 18 0
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/cluster_result16.txt Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,48 @@ +0 44 64 -76 0 +0 51 48 -73 0 +0 58 65 -49 0 +0 43 61 -49 0 +0 45 43 -79 0 +0 42 60 -98 0 +0 50 55 -59 0 +0 53 53 -56 0 +0 45 44 -61 0 +0 43 65 -84 0 +0 35 52 -75 0 +0 56 56 -70 0 +1 -61 86 43 2 +1 -67 93 15 2 +1 -59 94 36 2 +1 -50 92 62 2 +1 -78 91 70 2 +1 -35 87 47 2 +1 -56 91 52 2 +1 -61 81 46 2 +1 -83 78 34 2 +1 -50 87 45 2 +1 -67 73 50 2 +1 -50 97 45 2 +1 -61 111 45 2 +2 -109 23 -92 3 +2 -94 20 -96 3 +2 -85 26 -88 3 +2 -90 33 -114 3 +2 -63 9 -106 3 +2 -79 9 -93 3 +2 -99 26 -108 3 +2 -81 19 -110 3 +2 -108 21 -108 3 +2 -92 27 -106 3 +2 -88 2 -106 3 +2 -88 15 -103 3 +3 54 -74 4 1 +3 42 -92 31 1 +3 39 -99 -7 1 +3 48 -115 -5 1 +3 39 -96 2 1 +3 31 -109 9 1 +3 33 -96 -8 1 +3 23 -102 4 1 +3 38 -90 21 1 +3 34 -107 1 1 +3 35 -78 18 1
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/cluster_result17.txt Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,4 @@ +0 +1 +0 +0
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/cluster_result18.txt Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,4 @@ +-1 +-1 +-1 +-1
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/cluster_result19.txt Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,4 @@ +0 +1 +0 +0
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/cluster_result20.txt Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,4 @@ +0 +1 +0 +0
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/cluster_result21.txt Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,4 @@ +0 +1 +0 +0
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/confusion_matrix.txt Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,4 @@ +confusion_matrix : +[[14 0 0] + [ 0 10 6] + [ 0 0 9]]
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/converter_result01.json Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,2 @@ +{"directed": false, "graph": {"info": "RNAfold", "id": "CP000097.1/1411351-1411410", "structure": "....((((.((((((....)))))).)..)))...(((((((..(...)..)).))))).", "sequence": "CAACGUUCACCUCACAUUUGUGAGGCGCAGACAACCCAGGCCAAGGAACGGGGACCUGGA"}, "nodes": [{"position": 0, "id": 0, "label": "C"}, {"position": 1, "id": 1, "label": "A"}, {"position": 2, "id": 2, "label": "A"}, {"position": 3, "id": 3, "label": "C"}, {"position": 4, "id": 4, "label": "G"}, {"position": 5, "id": 5, "label": "U"}, {"position": 6, "id": 6, "label": "U"}, {"position": 7, "id": 7, "label": "C"}, {"position": 8, "id": 8, "label": "A"}, {"position": 9, "id": 9, "label": "C"}, {"position": 10, "id": 10, "label": "C"}, {"position": 11, "id": 11, "label": "U"}, {"position": 12, "id": 12, "label": "C"}, {"position": 13, "id": 13, "label": "A"}, {"position": 14, "id": 14, "label": "C"}, {"position": 15, "id": 15, "label": "A"}, {"position": 16, "id": 16, "label": "U"}, {"position": 17, "id": 17, "label": "U"}, {"position": 18, "id": 18, "label": "U"}, {"position": 19, "id": 19, "label": "G"}, {"position": 20, "id": 20, "label": "U"}, {"position": 21, "id": 21, "label": "G"}, {"position": 22, "id": 22, "label": "A"}, {"position": 23, "id": 23, "label": "G"}, {"position": 24, "id": 24, "label": "G"}, {"position": 25, "id": 25, "label": "C"}, {"position": 26, "id": 26, "label": "G"}, {"position": 27, "id": 27, "label": "C"}, {"position": 28, "id": 28, "label": "A"}, {"position": 29, "id": 29, "label": "G"}, {"position": 30, "id": 30, "label": "A"}, {"position": 31, "id": 31, "label": "C"}, {"position": 32, "id": 32, "label": "A"}, {"position": 33, "id": 33, "label": "A"}, {"position": 34, "id": 34, "label": "C"}, {"position": 35, "id": 35, "label": "C"}, {"position": 36, "id": 36, "label": "C"}, {"position": 37, "id": 37, "label": "A"}, {"position": 38, "id": 38, "label": "G"}, {"position": 39, "id": 39, "label": "G"}, {"position": 40, "id": 40, "label": "C"}, {"position": 41, "id": 41, "label": "C"}, {"position": 42, "id": 42, "label": "A"}, {"position": 43, "id": 43, "label": "A"}, {"position": 44, "id": 44, "label": "G"}, {"position": 45, "id": 45, "label": "G"}, {"position": 46, "id": 46, "label": "A"}, {"position": 47, "id": 47, "label": "A"}, {"position": 48, "id": 48, "label": "C"}, {"position": 49, "id": 49, "label": "G"}, {"position": 50, "id": 50, "label": "G"}, {"position": 51, "id": 51, "label": "G"}, {"position": 52, "id": 52, "label": "G"}, {"position": 53, "id": 53, "label": "A"}, {"position": 54, "id": 54, "label": "C"}, {"position": 55, "id": 55, "label": "C"}, {"position": 56, "id": 56, "label": "U"}, {"position": 57, "id": 57, "label": "G"}, {"position": 58, "id": 58, "label": "G"}, {"position": 59, "id": 59, "label": "A"}], "links": [{"source": 0, "type": "backbone", "target": 1, "len": 1, "label": "-"}, {"source": 1, "type": "backbone", "target": 2, "len": 1, "label": "-"}, {"source": 2, "type": "backbone", "target": 3, "len": 1, "label": "-"}, {"source": 3, "type": "backbone", "target": 4, "len": 1, "label": "-"}, {"source": 4, "type": "backbone", "target": 5, "len": 1, "label": "-"}, {"source": 4, "type": "basepair", "target": 31, "len": 1, "label": "="}, {"source": 5, "type": "basepair", "target": 30, "len": 1, "label": "="}, {"source": 5, "type": "backbone", "target": 6, "len": 1, "label": "-"}, {"source": 6, "type": "basepair", "target": 29, "len": 1, "label": "="}, {"source": 6, "type": "backbone", "target": 7, "len": 1, "label": "-"}, {"source": 7, "type": "backbone", "target": 8, "len": 1, "label": "-"}, {"source": 7, "type": "basepair", "target": 26, "len": 1, "label": "="}, {"source": 8, "type": "backbone", "target": 9, "len": 1, "label": "-"}, {"source": 9, "type": "basepair", "target": 24, "len": 1, "label": "="}, {"source": 9, "type": "backbone", "target": 10, "len": 1, "label": "-"}, {"source": 10, "type": "backbone", "target": 11, "len": 1, "label": "-"}, {"source": 10, "type": "basepair", "target": 23, "len": 1, "label": "="}, {"source": 11, "type": "backbone", "target": 12, "len": 1, "label": "-"}, {"source": 11, "type": "basepair", "target": 22, "len": 1, "label": "="}, {"source": 12, "type": "backbone", "target": 13, "len": 1, "label": "-"}, {"source": 12, "type": "basepair", "target": 21, "len": 1, "label": "="}, {"source": 13, "type": "basepair", "target": 20, "len": 1, "label": "="}, {"source": 13, "type": "backbone", "target": 14, "len": 1, "label": "-"}, {"source": 14, "type": "basepair", "target": 19, "len": 1, "label": "="}, {"source": 14, "type": "backbone", "target": 15, "len": 1, "label": "-"}, {"source": 15, "type": "backbone", "target": 16, "len": 1, "label": "-"}, {"source": 16, "type": "backbone", "target": 17, "len": 1, "label": "-"}, {"source": 17, "type": "backbone", "target": 18, "len": 1, "label": "-"}, {"source": 18, "type": "backbone", "target": 19, "len": 1, "label": "-"}, {"source": 19, "type": "backbone", "target": 20, "len": 1, "label": "-"}, {"source": 20, "type": "backbone", "target": 21, "len": 1, "label": "-"}, {"source": 21, "type": "backbone", "target": 22, "len": 1, "label": "-"}, {"source": 22, "type": "backbone", "target": 23, "len": 1, "label": "-"}, {"source": 23, "type": "backbone", "target": 24, "len": 1, "label": "-"}, {"source": 24, "type": "backbone", "target": 25, "len": 1, "label": "-"}, {"source": 25, "type": "backbone", "target": 26, "len": 1, "label": "-"}, {"source": 26, "type": "backbone", "target": 27, "len": 1, "label": "-"}, {"source": 27, "type": "backbone", "target": 28, "len": 1, "label": "-"}, {"source": 28, "type": "backbone", "target": 29, "len": 1, "label": "-"}, {"source": 29, "type": "backbone", "target": 30, "len": 1, "label": "-"}, {"source": 30, "type": "backbone", "target": 31, "len": 1, "label": "-"}, {"source": 31, "type": "backbone", "target": 32, "len": 1, "label": "-"}, {"source": 32, "type": "backbone", "target": 33, "len": 1, "label": "-"}, {"source": 33, "type": "backbone", "target": 34, "len": 1, "label": "-"}, {"source": 34, "type": "backbone", "target": 35, "len": 1, "label": "-"}, {"source": 35, "type": "backbone", "target": 36, "len": 1, "label": "-"}, {"source": 35, "type": "basepair", "target": 58, "len": 1, "label": "="}, {"source": 36, "type": "basepair", "target": 57, "len": 1, "label": "="}, {"source": 36, "type": "backbone", "target": 37, "len": 1, "label": "-"}, {"source": 37, "type": "basepair", "target": 56, "len": 1, "label": "="}, {"source": 37, "type": "backbone", "target": 38, "len": 1, "label": "-"}, {"source": 38, "type": "basepair", "target": 55, "len": 1, "label": "="}, {"source": 38, "type": "backbone", "target": 39, "len": 1, "label": "-"}, {"source": 39, "type": "backbone", "target": 40, "len": 1, "label": "-"}, {"source": 39, "type": "basepair", "target": 54, "len": 1, "label": "="}, {"source": 40, "type": "backbone", "target": 41, "len": 1, "label": "-"}, {"source": 40, "type": "basepair", "target": 52, "len": 1, "label": "="}, {"source": 41, "type": "backbone", "target": 42, "len": 1, "label": "-"}, {"source": 41, "type": "basepair", "target": 51, "len": 1, "label": "="}, {"source": 42, "type": "backbone", "target": 43, "len": 1, "label": "-"}, {"source": 43, "type": "backbone", "target": 44, "len": 1, "label": "-"}, {"source": 44, "type": "basepair", "target": 48, "len": 1, "label": "="}, {"source": 44, "type": "backbone", "target": 45, "len": 1, "label": "-"}, {"source": 45, "type": "backbone", "target": 46, "len": 1, "label": "-"}, {"source": 46, "type": "backbone", "target": 47, "len": 1, "label": "-"}, {"source": 47, "type": "backbone", "target": 48, "len": 1, "label": "-"}, {"source": 48, "type": "backbone", "target": 49, "len": 1, "label": "-"}, {"source": 49, "type": "backbone", "target": 50, "len": 1, "label": "-"}, {"source": 50, "type": "backbone", "target": 51, "len": 1, "label": "-"}, {"source": 51, "type": "backbone", "target": 52, "len": 1, "label": "-"}, {"source": 52, "type": "backbone", "target": 53, "len": 1, "label": "-"}, {"source": 53, "type": "backbone", "target": 54, "len": 1, "label": "-"}, {"source": 54, "type": "backbone", "target": 55, "len": 1, "label": "-"}, {"source": 55, "type": "backbone", "target": 56, "len": 1, "label": "-"}, {"source": 56, "type": "backbone", "target": 57, "len": 1, "label": "-"}, {"source": 57, "type": "backbone", "target": 58, "len": 1, "label": "-"}, {"source": 58, "type": "backbone", "target": 59, "len": 1, "label": "-"}], "multigraph": false} +{"directed": false, "graph": {"info": "RNAfold", "id": "ACNY01000002.1/278641-278580", "structure": "((.(...(.((((((.....)))))).)..).))..((((((((.........)).))))))", "sequence": "GAUCGUUCACUUCGCAUCGCGCGAAGCGCAGUUCGCCUCAGGCCAUGGAACGGGGACCUGAG"}, "nodes": [{"position": 0, "id": 0, "label": "G"}, {"position": 1, "id": 1, "label": "A"}, {"position": 2, "id": 2, "label": "U"}, {"position": 3, "id": 3, "label": "C"}, {"position": 4, "id": 4, "label": "G"}, {"position": 5, "id": 5, "label": "U"}, {"position": 6, "id": 6, "label": "U"}, {"position": 7, "id": 7, "label": "C"}, {"position": 8, "id": 8, "label": "A"}, {"position": 9, "id": 9, "label": "C"}, {"position": 10, "id": 10, "label": "U"}, {"position": 11, "id": 11, "label": "U"}, {"position": 12, "id": 12, "label": "C"}, {"position": 13, "id": 13, "label": "G"}, {"position": 14, "id": 14, "label": "C"}, {"position": 15, "id": 15, "label": "A"}, {"position": 16, "id": 16, "label": "U"}, {"position": 17, "id": 17, "label": "C"}, {"position": 18, "id": 18, "label": "G"}, {"position": 19, "id": 19, "label": "C"}, {"position": 20, "id": 20, "label": "G"}, {"position": 21, "id": 21, "label": "C"}, {"position": 22, "id": 22, "label": "G"}, {"position": 23, "id": 23, "label": "A"}, {"position": 24, "id": 24, "label": "A"}, {"position": 25, "id": 25, "label": "G"}, {"position": 26, "id": 26, "label": "C"}, {"position": 27, "id": 27, "label": "G"}, {"position": 28, "id": 28, "label": "C"}, {"position": 29, "id": 29, "label": "A"}, {"position": 30, "id": 30, "label": "G"}, {"position": 31, "id": 31, "label": "U"}, {"position": 32, "id": 32, "label": "U"}, {"position": 33, "id": 33, "label": "C"}, {"position": 34, "id": 34, "label": "G"}, {"position": 35, "id": 35, "label": "C"}, {"position": 36, "id": 36, "label": "C"}, {"position": 37, "id": 37, "label": "U"}, {"position": 38, "id": 38, "label": "C"}, {"position": 39, "id": 39, "label": "A"}, {"position": 40, "id": 40, "label": "G"}, {"position": 41, "id": 41, "label": "G"}, {"position": 42, "id": 42, "label": "C"}, {"position": 43, "id": 43, "label": "C"}, {"position": 44, "id": 44, "label": "A"}, {"position": 45, "id": 45, "label": "U"}, {"position": 46, "id": 46, "label": "G"}, {"position": 47, "id": 47, "label": "G"}, {"position": 48, "id": 48, "label": "A"}, {"position": 49, "id": 49, "label": "A"}, {"position": 50, "id": 50, "label": "C"}, {"position": 51, "id": 51, "label": "G"}, {"position": 52, "id": 52, "label": "G"}, {"position": 53, "id": 53, "label": "G"}, {"position": 54, "id": 54, "label": "G"}, {"position": 55, "id": 55, "label": "A"}, {"position": 56, "id": 56, "label": "C"}, {"position": 57, "id": 57, "label": "C"}, {"position": 58, "id": 58, "label": "U"}, {"position": 59, "id": 59, "label": "G"}, {"position": 60, "id": 60, "label": "A"}, {"position": 61, "id": 61, "label": "G"}], "links": [{"source": 0, "type": "backbone", "target": 1, "len": 1, "label": "-"}, {"source": 0, "type": "basepair", "target": 33, "len": 1, "label": "="}, {"source": 1, "type": "basepair", "target": 32, "len": 1, "label": "="}, {"source": 1, "type": "backbone", "target": 2, "len": 1, "label": "-"}, {"source": 2, "type": "backbone", "target": 3, "len": 1, "label": "-"}, {"source": 3, "type": "backbone", "target": 4, "len": 1, "label": "-"}, {"source": 3, "type": "basepair", "target": 30, "len": 1, "label": "="}, {"source": 4, "type": "backbone", "target": 5, "len": 1, "label": "-"}, {"source": 5, "type": "backbone", "target": 6, "len": 1, "label": "-"}, {"source": 6, "type": "backbone", "target": 7, "len": 1, "label": "-"}, {"source": 7, "type": "backbone", "target": 8, "len": 1, "label": "-"}, {"source": 7, "type": "basepair", "target": 27, "len": 1, "label": "="}, {"source": 8, "type": "backbone", "target": 9, "len": 1, "label": "-"}, {"source": 9, "type": "basepair", "target": 25, "len": 1, "label": "="}, {"source": 9, "type": "backbone", "target": 10, "len": 1, "label": "-"}, {"source": 10, "type": "basepair", "target": 24, "len": 1, "label": "="}, {"source": 10, "type": "backbone", "target": 11, "len": 1, "label": "-"}, {"source": 11, "type": "backbone", "target": 12, "len": 1, "label": "-"}, {"source": 11, "type": "basepair", "target": 23, "len": 1, "label": "="}, {"source": 12, "type": "backbone", "target": 13, "len": 1, "label": "-"}, {"source": 12, "type": "basepair", "target": 22, "len": 1, "label": "="}, {"source": 13, "type": "basepair", "target": 21, "len": 1, "label": "="}, {"source": 13, "type": "backbone", "target": 14, "len": 1, "label": "-"}, {"source": 14, "type": "basepair", "target": 20, "len": 1, "label": "="}, {"source": 14, "type": "backbone", "target": 15, "len": 1, "label": "-"}, {"source": 15, "type": "backbone", "target": 16, "len": 1, "label": "-"}, {"source": 16, "type": "backbone", "target": 17, "len": 1, "label": "-"}, {"source": 17, "type": "backbone", "target": 18, "len": 1, "label": "-"}, {"source": 18, "type": "backbone", "target": 19, "len": 1, "label": "-"}, {"source": 19, "type": "backbone", "target": 20, "len": 1, "label": "-"}, {"source": 20, "type": "backbone", "target": 21, "len": 1, "label": "-"}, {"source": 21, "type": "backbone", "target": 22, "len": 1, "label": "-"}, {"source": 22, "type": "backbone", "target": 23, "len": 1, "label": "-"}, {"source": 23, "type": "backbone", "target": 24, "len": 1, "label": "-"}, {"source": 24, "type": "backbone", "target": 25, "len": 1, "label": "-"}, {"source": 25, "type": "backbone", "target": 26, "len": 1, "label": "-"}, {"source": 26, "type": "backbone", "target": 27, "len": 1, "label": "-"}, {"source": 27, "type": "backbone", "target": 28, "len": 1, "label": "-"}, {"source": 28, "type": "backbone", "target": 29, "len": 1, "label": "-"}, {"source": 29, "type": "backbone", "target": 30, "len": 1, "label": "-"}, {"source": 30, "type": "backbone", "target": 31, "len": 1, "label": "-"}, {"source": 31, "type": "backbone", "target": 32, "len": 1, "label": "-"}, {"source": 32, "type": "backbone", "target": 33, "len": 1, "label": "-"}, {"source": 33, "type": "backbone", "target": 34, "len": 1, "label": "-"}, {"source": 34, "type": "backbone", "target": 35, "len": 1, "label": "-"}, {"source": 35, "type": "backbone", "target": 36, "len": 1, "label": "-"}, {"source": 36, "type": "backbone", "target": 37, "len": 1, "label": "-"}, {"source": 36, "type": "basepair", "target": 61, "len": 1, "label": "="}, {"source": 37, "type": "basepair", "target": 60, "len": 1, "label": "="}, {"source": 37, "type": "backbone", "target": 38, "len": 1, "label": "-"}, {"source": 38, "type": "basepair", "target": 59, "len": 1, "label": "="}, {"source": 38, "type": "backbone", "target": 39, "len": 1, "label": "-"}, {"source": 39, "type": "backbone", "target": 40, "len": 1, "label": "-"}, {"source": 39, "type": "basepair", "target": 58, "len": 1, "label": "="}, {"source": 40, "type": "backbone", "target": 41, "len": 1, "label": "-"}, {"source": 40, "type": "basepair", "target": 57, "len": 1, "label": "="}, {"source": 41, "type": "basepair", "target": 56, "len": 1, "label": "="}, {"source": 41, "type": "backbone", "target": 42, "len": 1, "label": "-"}, {"source": 42, "type": "backbone", "target": 43, "len": 1, "label": "-"}, {"source": 42, "type": "basepair", "target": 54, "len": 1, "label": "="}, {"source": 43, "type": "backbone", "target": 44, "len": 1, "label": "-"}, {"source": 43, "type": "basepair", "target": 53, "len": 1, "label": "="}, {"source": 44, "type": "backbone", "target": 45, "len": 1, "label": "-"}, {"source": 45, "type": "backbone", "target": 46, "len": 1, "label": "-"}, {"source": 46, "type": "backbone", "target": 47, "len": 1, "label": "-"}, {"source": 47, "type": "backbone", "target": 48, "len": 1, "label": "-"}, {"source": 48, "type": "backbone", "target": 49, "len": 1, "label": "-"}, {"source": 49, "type": "backbone", "target": 50, "len": 1, "label": "-"}, {"source": 50, "type": "backbone", "target": 51, "len": 1, "label": "-"}, {"source": 51, "type": "backbone", "target": 52, "len": 1, "label": "-"}, {"source": 52, "type": "backbone", "target": 53, "len": 1, "label": "-"}, {"source": 53, "type": "backbone", "target": 54, "len": 1, "label": "-"}, {"source": 54, "type": "backbone", "target": 55, "len": 1, "label": "-"}, {"source": 55, "type": "backbone", "target": 56, "len": 1, "label": "-"}, {"source": 56, "type": "backbone", "target": 57, "len": 1, "label": "-"}, {"source": 57, "type": "backbone", "target": 58, "len": 1, "label": "-"}, {"source": 58, "type": "backbone", "target": 59, "len": 1, "label": "-"}, {"source": 59, "type": "backbone", "target": 60, "len": 1, "label": "-"}, {"source": 60, "type": "backbone", "target": 61, "len": 1, "label": "-"}], "multigraph": false}
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/converter_result02.json Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,4 @@ +{"directed": false, "graph": {"info": "RNAshapes shape_type=2 energy_range=4 max_num=3", "id": "CP000097.1/1411351-1411410_[_[]_][[]_]", "structure": "....(((..((((((....))))))....)))...(((((((.........)).))))).", "sequence": "CAACGUUCACCUCACAUUUGUGAGGCGCAGACAACCCAGGCCAAGGAACGGGGACCUGGA"}, "nodes": [{"position": 0, "id": 0, "label": "C"}, {"position": 1, "id": 1, "label": "A"}, {"position": 2, "id": 2, "label": "A"}, {"position": 3, "id": 3, "label": "C"}, {"position": 4, "id": 4, "label": "G"}, {"position": 5, "id": 5, "label": "U"}, {"position": 6, "id": 6, "label": "U"}, {"position": 7, "id": 7, "label": "C"}, {"position": 8, "id": 8, "label": "A"}, {"position": 9, "id": 9, "label": "C"}, {"position": 10, "id": 10, "label": "C"}, {"position": 11, "id": 11, "label": "U"}, {"position": 12, "id": 12, "label": "C"}, {"position": 13, "id": 13, "label": "A"}, {"position": 14, "id": 14, "label": "C"}, {"position": 15, "id": 15, "label": "A"}, {"position": 16, "id": 16, "label": "U"}, {"position": 17, "id": 17, "label": "U"}, {"position": 18, "id": 18, "label": "U"}, {"position": 19, "id": 19, "label": "G"}, {"position": 20, "id": 20, "label": "U"}, {"position": 21, "id": 21, "label": "G"}, {"position": 22, "id": 22, "label": "A"}, {"position": 23, "id": 23, "label": "G"}, {"position": 24, "id": 24, "label": "G"}, {"position": 25, "id": 25, "label": "C"}, {"position": 26, "id": 26, "label": "G"}, {"position": 27, "id": 27, "label": "C"}, {"position": 28, "id": 28, "label": "A"}, {"position": 29, "id": 29, "label": "G"}, {"position": 30, "id": 30, "label": "A"}, {"position": 31, "id": 31, "label": "C"}, {"position": 32, "id": 32, "label": "A"}, {"position": 33, "id": 33, "label": "A"}, {"position": 34, "id": 34, "label": "C"}, {"position": 35, "id": 35, "label": "C"}, {"position": 36, "id": 36, "label": "C"}, {"position": 37, "id": 37, "label": "A"}, {"position": 38, "id": 38, "label": "G"}, {"position": 39, "id": 39, "label": "G"}, {"position": 40, "id": 40, "label": "C"}, {"position": 41, "id": 41, "label": "C"}, {"position": 42, "id": 42, "label": "A"}, {"position": 43, "id": 43, "label": "A"}, {"position": 44, "id": 44, "label": "G"}, {"position": 45, "id": 45, "label": "G"}, {"position": 46, "id": 46, "label": "A"}, {"position": 47, "id": 47, "label": "A"}, {"position": 48, "id": 48, "label": "C"}, {"position": 49, "id": 49, "label": "G"}, {"position": 50, "id": 50, "label": "G"}, {"position": 51, "id": 51, "label": "G"}, {"position": 52, "id": 52, "label": "G"}, {"position": 53, "id": 53, "label": "A"}, {"position": 54, "id": 54, "label": "C"}, {"position": 55, "id": 55, "label": "C"}, {"position": 56, "id": 56, "label": "U"}, {"position": 57, "id": 57, "label": "G"}, {"position": 58, "id": 58, "label": "G"}, {"position": 59, "id": 59, "label": "A"}], "links": [{"source": 0, "type": "backbone", "target": 1, "len": 1, "label": "-"}, {"source": 1, "type": "backbone", "target": 2, "len": 1, "label": "-"}, {"source": 2, "type": "backbone", "target": 3, "len": 1, "label": "-"}, {"source": 3, "type": "backbone", "target": 4, "len": 1, "label": "-"}, {"source": 4, "type": "backbone", "target": 5, "len": 1, "label": "-"}, {"source": 4, "type": "basepair", "target": 31, "len": 1, "label": "="}, {"source": 5, "type": "basepair", "target": 30, "len": 1, "label": "="}, {"source": 5, "type": "backbone", "target": 6, "len": 1, "label": "-"}, {"source": 6, "type": "basepair", "target": 29, "len": 1, "label": "="}, {"source": 6, "type": "backbone", "target": 7, "len": 1, "label": "-"}, {"source": 7, "type": "backbone", "target": 8, "len": 1, "label": "-"}, {"source": 8, "type": "backbone", "target": 9, "len": 1, "label": "-"}, {"source": 9, "type": "basepair", "target": 24, "len": 1, "label": "="}, {"source": 9, "type": "backbone", "target": 10, "len": 1, "label": "-"}, {"source": 10, "type": "backbone", "target": 11, "len": 1, "label": "-"}, {"source": 10, "type": "basepair", "target": 23, "len": 1, "label": "="}, {"source": 11, "type": "backbone", "target": 12, "len": 1, "label": "-"}, {"source": 11, "type": "basepair", "target": 22, "len": 1, "label": "="}, {"source": 12, "type": "backbone", "target": 13, "len": 1, "label": "-"}, {"source": 12, "type": "basepair", "target": 21, "len": 1, "label": "="}, {"source": 13, "type": "basepair", "target": 20, "len": 1, "label": "="}, {"source": 13, "type": "backbone", "target": 14, "len": 1, "label": "-"}, {"source": 14, "type": "basepair", "target": 19, "len": 1, "label": "="}, {"source": 14, "type": "backbone", "target": 15, "len": 1, "label": "-"}, {"source": 15, "type": "backbone", "target": 16, "len": 1, "label": "-"}, {"source": 16, "type": "backbone", "target": 17, "len": 1, "label": "-"}, {"source": 17, "type": "backbone", "target": 18, "len": 1, "label": "-"}, {"source": 18, "type": "backbone", "target": 19, "len": 1, "label": "-"}, {"source": 19, "type": "backbone", "target": 20, "len": 1, "label": "-"}, {"source": 20, "type": "backbone", "target": 21, "len": 1, "label": "-"}, {"source": 21, "type": "backbone", "target": 22, "len": 1, "label": "-"}, {"source": 22, "type": "backbone", "target": 23, "len": 1, "label": "-"}, {"source": 23, "type": "backbone", "target": 24, "len": 1, "label": "-"}, {"source": 24, "type": "backbone", "target": 25, "len": 1, "label": "-"}, {"source": 25, "type": "backbone", "target": 26, "len": 1, "label": "-"}, {"source": 26, "type": "backbone", "target": 27, "len": 1, "label": "-"}, {"source": 27, "type": "backbone", "target": 28, "len": 1, "label": "-"}, {"source": 28, "type": "backbone", "target": 29, "len": 1, "label": "-"}, {"source": 29, "type": "backbone", "target": 30, "len": 1, "label": "-"}, {"source": 30, "type": "backbone", "target": 31, "len": 1, "label": "-"}, {"source": 31, "type": "backbone", "target": 32, "len": 1, "label": "-"}, {"source": 32, "type": "backbone", "target": 33, "len": 1, "label": "-"}, {"source": 33, "type": "backbone", "target": 34, "len": 1, "label": "-"}, {"source": 34, "type": "backbone", "target": 35, "len": 1, "label": "-"}, {"source": 35, "type": "backbone", "target": 36, "len": 1, "label": "-"}, {"source": 35, "type": "basepair", "target": 58, "len": 1, "label": "="}, {"source": 36, "type": "basepair", "target": 57, "len": 1, "label": "="}, {"source": 36, "type": "backbone", "target": 37, "len": 1, "label": "-"}, {"source": 37, "type": "basepair", "target": 56, "len": 1, "label": "="}, {"source": 37, "type": "backbone", "target": 38, "len": 1, "label": "-"}, {"source": 38, "type": "basepair", "target": 55, "len": 1, "label": "="}, {"source": 38, "type": "backbone", "target": 39, "len": 1, "label": "-"}, {"source": 39, "type": "backbone", "target": 40, "len": 1, "label": "-"}, {"source": 39, "type": "basepair", "target": 54, "len": 1, "label": "="}, {"source": 40, "type": "backbone", "target": 41, "len": 1, "label": "-"}, {"source": 40, "type": "basepair", "target": 52, "len": 1, "label": "="}, {"source": 41, "type": "backbone", "target": 42, "len": 1, "label": "-"}, {"source": 41, "type": "basepair", "target": 51, "len": 1, "label": "="}, {"source": 42, "type": "backbone", "target": 43, "len": 1, "label": "-"}, {"source": 43, "type": "backbone", "target": 44, "len": 1, "label": "-"}, {"source": 44, "type": "backbone", "target": 45, "len": 1, "label": "-"}, {"source": 45, "type": "backbone", "target": 46, "len": 1, "label": "-"}, {"source": 46, "type": "backbone", "target": 47, "len": 1, "label": "-"}, {"source": 47, "type": "backbone", "target": 48, "len": 1, "label": "-"}, {"source": 48, "type": "backbone", "target": 49, "len": 1, "label": "-"}, {"source": 49, "type": "backbone", "target": 50, "len": 1, "label": "-"}, {"source": 50, "type": "backbone", "target": 51, "len": 1, "label": "-"}, {"source": 51, "type": "backbone", "target": 52, "len": 1, "label": "-"}, {"source": 52, "type": "backbone", "target": 53, "len": 1, "label": "-"}, {"source": 53, "type": "backbone", "target": 54, "len": 1, "label": "-"}, {"source": 54, "type": "backbone", "target": 55, "len": 1, "label": "-"}, {"source": 55, "type": "backbone", "target": 56, "len": 1, "label": "-"}, {"source": 56, "type": "backbone", "target": 57, "len": 1, "label": "-"}, {"source": 57, "type": "backbone", "target": 58, "len": 1, "label": "-"}, {"source": 58, "type": "backbone", "target": 59, "len": 1, "label": "-"}], "multigraph": false} +{"directed": false, "graph": {"info": "RNAshapes shape_type=2 energy_range=4 max_num=3", "id": "ACNY01000002.1/278641-278580_[_[]_][[]_]", "structure": "....((...((((((.....)))))).)).......((((((((.........)).))))))", "sequence": "GAUCGUUCACUUCGCAUCGCGCGAAGCGCAGUUCGCCUCAGGCCAUGGAACGGGGACCUGAG"}, "nodes": [{"position": 0, "id": 0, "label": "G"}, {"position": 1, "id": 1, "label": "A"}, {"position": 2, "id": 2, "label": "U"}, {"position": 3, "id": 3, "label": "C"}, {"position": 4, "id": 4, "label": "G"}, {"position": 5, "id": 5, "label": "U"}, {"position": 6, "id": 6, "label": "U"}, {"position": 7, "id": 7, "label": "C"}, {"position": 8, "id": 8, "label": "A"}, {"position": 9, "id": 9, "label": "C"}, {"position": 10, "id": 10, "label": "U"}, {"position": 11, "id": 11, "label": "U"}, {"position": 12, "id": 12, "label": "C"}, {"position": 13, "id": 13, "label": "G"}, {"position": 14, "id": 14, "label": "C"}, {"position": 15, "id": 15, "label": "A"}, {"position": 16, "id": 16, "label": "U"}, {"position": 17, "id": 17, "label": "C"}, {"position": 18, "id": 18, "label": "G"}, {"position": 19, "id": 19, "label": "C"}, {"position": 20, "id": 20, "label": "G"}, {"position": 21, "id": 21, "label": "C"}, {"position": 22, "id": 22, "label": "G"}, {"position": 23, "id": 23, "label": "A"}, {"position": 24, "id": 24, "label": "A"}, {"position": 25, "id": 25, "label": "G"}, {"position": 26, "id": 26, "label": "C"}, {"position": 27, "id": 27, "label": "G"}, {"position": 28, "id": 28, "label": "C"}, {"position": 29, "id": 29, "label": "A"}, {"position": 30, "id": 30, "label": "G"}, {"position": 31, "id": 31, "label": "U"}, {"position": 32, "id": 32, "label": "U"}, {"position": 33, "id": 33, "label": "C"}, {"position": 34, "id": 34, "label": "G"}, {"position": 35, "id": 35, "label": "C"}, {"position": 36, "id": 36, "label": "C"}, {"position": 37, "id": 37, "label": "U"}, {"position": 38, "id": 38, "label": "C"}, {"position": 39, "id": 39, "label": "A"}, {"position": 40, "id": 40, "label": "G"}, {"position": 41, "id": 41, "label": "G"}, {"position": 42, "id": 42, "label": "C"}, {"position": 43, "id": 43, "label": "C"}, {"position": 44, "id": 44, "label": "A"}, {"position": 45, "id": 45, "label": "U"}, {"position": 46, "id": 46, "label": "G"}, {"position": 47, "id": 47, "label": "G"}, {"position": 48, "id": 48, "label": "A"}, {"position": 49, "id": 49, "label": "A"}, {"position": 50, "id": 50, "label": "C"}, {"position": 51, "id": 51, "label": "G"}, {"position": 52, "id": 52, "label": "G"}, {"position": 53, "id": 53, "label": "G"}, {"position": 54, "id": 54, "label": "G"}, {"position": 55, "id": 55, "label": "A"}, {"position": 56, "id": 56, "label": "C"}, {"position": 57, "id": 57, "label": "C"}, {"position": 58, "id": 58, "label": "U"}, {"position": 59, "id": 59, "label": "G"}, {"position": 60, "id": 60, "label": "A"}, {"position": 61, "id": 61, "label": "G"}], "links": [{"source": 0, "type": "backbone", "target": 1, "len": 1, "label": "-"}, {"source": 1, "type": "backbone", "target": 2, "len": 1, "label": "-"}, {"source": 2, "type": "backbone", "target": 3, "len": 1, "label": "-"}, {"source": 3, "type": "backbone", "target": 4, "len": 1, "label": "-"}, {"source": 4, "type": "basepair", "target": 28, "len": 1, "label": "="}, {"source": 4, "type": "backbone", "target": 5, "len": 1, "label": "-"}, {"source": 5, "type": "basepair", "target": 27, "len": 1, "label": "="}, {"source": 5, "type": "backbone", "target": 6, "len": 1, "label": "-"}, {"source": 6, "type": "backbone", "target": 7, "len": 1, "label": "-"}, {"source": 7, "type": "backbone", "target": 8, "len": 1, "label": "-"}, {"source": 8, "type": "backbone", "target": 9, "len": 1, "label": "-"}, {"source": 9, "type": "basepair", "target": 25, "len": 1, "label": "="}, {"source": 9, "type": "backbone", "target": 10, "len": 1, "label": "-"}, {"source": 10, "type": "basepair", "target": 24, "len": 1, "label": "="}, {"source": 10, "type": "backbone", "target": 11, "len": 1, "label": "-"}, {"source": 11, "type": "backbone", "target": 12, "len": 1, "label": "-"}, {"source": 11, "type": "basepair", "target": 23, "len": 1, "label": "="}, {"source": 12, "type": "backbone", "target": 13, "len": 1, "label": "-"}, {"source": 12, "type": "basepair", "target": 22, "len": 1, "label": "="}, {"source": 13, "type": "basepair", "target": 21, "len": 1, "label": "="}, {"source": 13, "type": "backbone", "target": 14, "len": 1, "label": "-"}, {"source": 14, "type": "basepair", "target": 20, "len": 1, "label": "="}, {"source": 14, "type": "backbone", "target": 15, "len": 1, "label": "-"}, {"source": 15, "type": "backbone", "target": 16, "len": 1, "label": "-"}, {"source": 16, "type": "backbone", "target": 17, "len": 1, "label": "-"}, {"source": 17, "type": "backbone", "target": 18, "len": 1, "label": "-"}, {"source": 18, "type": "backbone", "target": 19, "len": 1, "label": "-"}, {"source": 19, "type": "backbone", "target": 20, "len": 1, "label": "-"}, {"source": 20, "type": "backbone", "target": 21, "len": 1, "label": "-"}, {"source": 21, "type": "backbone", "target": 22, "len": 1, "label": "-"}, {"source": 22, "type": "backbone", "target": 23, "len": 1, "label": "-"}, {"source": 23, "type": "backbone", "target": 24, "len": 1, "label": "-"}, {"source": 24, "type": "backbone", "target": 25, "len": 1, "label": "-"}, {"source": 25, "type": "backbone", "target": 26, "len": 1, "label": "-"}, {"source": 26, "type": "backbone", "target": 27, "len": 1, "label": "-"}, {"source": 27, "type": "backbone", "target": 28, "len": 1, "label": "-"}, {"source": 28, "type": "backbone", "target": 29, "len": 1, "label": "-"}, {"source": 29, "type": "backbone", "target": 30, "len": 1, "label": "-"}, {"source": 30, "type": "backbone", "target": 31, "len": 1, "label": "-"}, {"source": 31, "type": "backbone", "target": 32, "len": 1, "label": "-"}, {"source": 32, "type": "backbone", "target": 33, "len": 1, "label": "-"}, {"source": 33, "type": "backbone", "target": 34, "len": 1, "label": "-"}, {"source": 34, "type": "backbone", "target": 35, "len": 1, "label": "-"}, {"source": 35, "type": "backbone", "target": 36, "len": 1, "label": "-"}, {"source": 36, "type": "backbone", "target": 37, "len": 1, "label": "-"}, {"source": 36, "type": "basepair", "target": 61, "len": 1, "label": "="}, {"source": 37, "type": "basepair", "target": 60, "len": 1, "label": "="}, {"source": 37, "type": "backbone", "target": 38, "len": 1, "label": "-"}, {"source": 38, "type": "basepair", "target": 59, "len": 1, "label": "="}, {"source": 38, "type": "backbone", "target": 39, "len": 1, "label": "-"}, {"source": 39, "type": "backbone", "target": 40, "len": 1, "label": "-"}, {"source": 39, "type": "basepair", "target": 58, "len": 1, "label": "="}, {"source": 40, "type": "backbone", "target": 41, "len": 1, "label": "-"}, {"source": 40, "type": "basepair", "target": 57, "len": 1, "label": "="}, {"source": 41, "type": "basepair", "target": 56, "len": 1, "label": "="}, {"source": 41, "type": "backbone", "target": 42, "len": 1, "label": "-"}, {"source": 42, "type": "backbone", "target": 43, "len": 1, "label": "-"}, {"source": 42, "type": "basepair", "target": 54, "len": 1, "label": "="}, {"source": 43, "type": "backbone", "target": 44, "len": 1, "label": "-"}, {"source": 43, "type": "basepair", "target": 53, "len": 1, "label": "="}, {"source": 44, "type": "backbone", "target": 45, "len": 1, "label": "-"}, {"source": 45, "type": "backbone", "target": 46, "len": 1, "label": "-"}, {"source": 46, "type": "backbone", "target": 47, "len": 1, "label": "-"}, {"source": 47, "type": "backbone", "target": 48, "len": 1, "label": "-"}, {"source": 48, "type": "backbone", "target": 49, "len": 1, "label": "-"}, {"source": 49, "type": "backbone", "target": 50, "len": 1, "label": "-"}, {"source": 50, "type": "backbone", "target": 51, "len": 1, "label": "-"}, {"source": 51, "type": "backbone", "target": 52, "len": 1, "label": "-"}, {"source": 52, "type": "backbone", "target": 53, "len": 1, "label": "-"}, {"source": 53, "type": "backbone", "target": 54, "len": 1, "label": "-"}, {"source": 54, "type": "backbone", "target": 55, "len": 1, "label": "-"}, {"source": 55, "type": "backbone", "target": 56, "len": 1, "label": "-"}, {"source": 56, "type": "backbone", "target": 57, "len": 1, "label": "-"}, {"source": 57, "type": "backbone", "target": 58, "len": 1, "label": "-"}, {"source": 58, "type": "backbone", "target": 59, "len": 1, "label": "-"}, {"source": 59, "type": "backbone", "target": 60, "len": 1, "label": "-"}, {"source": 60, "type": "backbone", "target": 61, "len": 1, "label": "-"}], "multigraph": false} +{"directed": false, "graph": {"info": "RNAshapes shape_type=2 energy_range=4 max_num=3", "id": "ACNY01000002.1/278641-278580_[_[_[]_]_][[]_]", "structure": "((..((...((((((.....)))))).))...))..((((((((.........)).))))))", "sequence": "GAUCGUUCACUUCGCAUCGCGCGAAGCGCAGUUCGCCUCAGGCCAUGGAACGGGGACCUGAG"}, "nodes": [{"position": 0, "id": 0, "label": "G"}, {"position": 1, "id": 1, "label": "A"}, {"position": 2, "id": 2, "label": "U"}, {"position": 3, "id": 3, "label": "C"}, {"position": 4, "id": 4, "label": "G"}, {"position": 5, "id": 5, "label": "U"}, {"position": 6, "id": 6, "label": "U"}, {"position": 7, "id": 7, "label": "C"}, {"position": 8, "id": 8, "label": "A"}, {"position": 9, "id": 9, "label": "C"}, {"position": 10, "id": 10, "label": "U"}, {"position": 11, "id": 11, "label": "U"}, {"position": 12, "id": 12, "label": "C"}, {"position": 13, "id": 13, "label": "G"}, {"position": 14, "id": 14, "label": "C"}, {"position": 15, "id": 15, "label": "A"}, {"position": 16, "id": 16, "label": "U"}, {"position": 17, "id": 17, "label": "C"}, {"position": 18, "id": 18, "label": "G"}, {"position": 19, "id": 19, "label": "C"}, {"position": 20, "id": 20, "label": "G"}, {"position": 21, "id": 21, "label": "C"}, {"position": 22, "id": 22, "label": "G"}, {"position": 23, "id": 23, "label": "A"}, {"position": 24, "id": 24, "label": "A"}, {"position": 25, "id": 25, "label": "G"}, {"position": 26, "id": 26, "label": "C"}, {"position": 27, "id": 27, "label": "G"}, {"position": 28, "id": 28, "label": "C"}, {"position": 29, "id": 29, "label": "A"}, {"position": 30, "id": 30, "label": "G"}, {"position": 31, "id": 31, "label": "U"}, {"position": 32, "id": 32, "label": "U"}, {"position": 33, "id": 33, "label": "C"}, {"position": 34, "id": 34, "label": "G"}, {"position": 35, "id": 35, "label": "C"}, {"position": 36, "id": 36, "label": "C"}, {"position": 37, "id": 37, "label": "U"}, {"position": 38, "id": 38, "label": "C"}, {"position": 39, "id": 39, "label": "A"}, {"position": 40, "id": 40, "label": "G"}, {"position": 41, "id": 41, "label": "G"}, {"position": 42, "id": 42, "label": "C"}, {"position": 43, "id": 43, "label": "C"}, {"position": 44, "id": 44, "label": "A"}, {"position": 45, "id": 45, "label": "U"}, {"position": 46, "id": 46, "label": "G"}, {"position": 47, "id": 47, "label": "G"}, {"position": 48, "id": 48, "label": "A"}, {"position": 49, "id": 49, "label": "A"}, {"position": 50, "id": 50, "label": "C"}, {"position": 51, "id": 51, "label": "G"}, {"position": 52, "id": 52, "label": "G"}, {"position": 53, "id": 53, "label": "G"}, {"position": 54, "id": 54, "label": "G"}, {"position": 55, "id": 55, "label": "A"}, {"position": 56, "id": 56, "label": "C"}, {"position": 57, "id": 57, "label": "C"}, {"position": 58, "id": 58, "label": "U"}, {"position": 59, "id": 59, "label": "G"}, {"position": 60, "id": 60, "label": "A"}, {"position": 61, "id": 61, "label": "G"}], "links": [{"source": 0, "type": "backbone", "target": 1, "len": 1, "label": "-"}, {"source": 0, "type": "basepair", "target": 33, "len": 1, "label": "="}, {"source": 1, "type": "basepair", "target": 32, "len": 1, "label": "="}, {"source": 1, "type": "backbone", "target": 2, "len": 1, "label": "-"}, {"source": 2, "type": "backbone", "target": 3, "len": 1, "label": "-"}, {"source": 3, "type": "backbone", "target": 4, "len": 1, "label": "-"}, {"source": 4, "type": "basepair", "target": 28, "len": 1, "label": "="}, {"source": 4, "type": "backbone", "target": 5, "len": 1, "label": "-"}, {"source": 5, "type": "basepair", "target": 27, "len": 1, "label": "="}, {"source": 5, "type": "backbone", "target": 6, "len": 1, "label": "-"}, {"source": 6, "type": "backbone", "target": 7, "len": 1, "label": "-"}, {"source": 7, "type": "backbone", "target": 8, "len": 1, "label": "-"}, {"source": 8, "type": "backbone", "target": 9, "len": 1, "label": "-"}, {"source": 9, "type": "basepair", "target": 25, "len": 1, "label": "="}, {"source": 9, "type": "backbone", "target": 10, "len": 1, "label": "-"}, {"source": 10, "type": "basepair", "target": 24, "len": 1, "label": "="}, {"source": 10, "type": "backbone", "target": 11, "len": 1, "label": "-"}, {"source": 11, "type": "backbone", "target": 12, "len": 1, "label": "-"}, {"source": 11, "type": "basepair", "target": 23, "len": 1, "label": "="}, {"source": 12, "type": "backbone", "target": 13, "len": 1, "label": "-"}, {"source": 12, "type": "basepair", "target": 22, "len": 1, "label": "="}, {"source": 13, "type": "basepair", "target": 21, "len": 1, "label": "="}, {"source": 13, "type": "backbone", "target": 14, "len": 1, "label": "-"}, {"source": 14, "type": "basepair", "target": 20, "len": 1, "label": "="}, {"source": 14, "type": "backbone", "target": 15, "len": 1, "label": "-"}, {"source": 15, "type": "backbone", "target": 16, "len": 1, "label": "-"}, {"source": 16, "type": "backbone", "target": 17, "len": 1, "label": "-"}, {"source": 17, "type": "backbone", "target": 18, "len": 1, "label": "-"}, {"source": 18, "type": "backbone", "target": 19, "len": 1, "label": "-"}, {"source": 19, "type": "backbone", "target": 20, "len": 1, "label": "-"}, {"source": 20, "type": "backbone", "target": 21, "len": 1, "label": "-"}, {"source": 21, "type": "backbone", "target": 22, "len": 1, "label": "-"}, {"source": 22, "type": "backbone", "target": 23, "len": 1, "label": "-"}, {"source": 23, "type": "backbone", "target": 24, "len": 1, "label": "-"}, {"source": 24, "type": "backbone", "target": 25, "len": 1, "label": "-"}, {"source": 25, "type": "backbone", "target": 26, "len": 1, "label": "-"}, {"source": 26, "type": "backbone", "target": 27, "len": 1, "label": "-"}, {"source": 27, "type": "backbone", "target": 28, "len": 1, "label": "-"}, {"source": 28, "type": "backbone", "target": 29, "len": 1, "label": "-"}, {"source": 29, "type": "backbone", "target": 30, "len": 1, "label": "-"}, {"source": 30, "type": "backbone", "target": 31, "len": 1, "label": "-"}, {"source": 31, "type": "backbone", "target": 32, "len": 1, "label": "-"}, {"source": 32, "type": "backbone", "target": 33, "len": 1, "label": "-"}, {"source": 33, "type": "backbone", "target": 34, "len": 1, "label": "-"}, {"source": 34, "type": "backbone", "target": 35, "len": 1, "label": "-"}, {"source": 35, "type": "backbone", "target": 36, "len": 1, "label": "-"}, {"source": 36, "type": "backbone", "target": 37, "len": 1, "label": "-"}, {"source": 36, "type": "basepair", "target": 61, "len": 1, "label": "="}, {"source": 37, "type": "basepair", "target": 60, "len": 1, "label": "="}, {"source": 37, "type": "backbone", "target": 38, "len": 1, "label": "-"}, {"source": 38, "type": "basepair", "target": 59, "len": 1, "label": "="}, {"source": 38, "type": "backbone", "target": 39, "len": 1, "label": "-"}, {"source": 39, "type": "backbone", "target": 40, "len": 1, "label": "-"}, {"source": 39, "type": "basepair", "target": 58, "len": 1, "label": "="}, {"source": 40, "type": "backbone", "target": 41, "len": 1, "label": "-"}, {"source": 40, "type": "basepair", "target": 57, "len": 1, "label": "="}, {"source": 41, "type": "basepair", "target": 56, "len": 1, "label": "="}, {"source": 41, "type": "backbone", "target": 42, "len": 1, "label": "-"}, {"source": 42, "type": "backbone", "target": 43, "len": 1, "label": "-"}, {"source": 42, "type": "basepair", "target": 54, "len": 1, "label": "="}, {"source": 43, "type": "backbone", "target": 44, "len": 1, "label": "-"}, {"source": 43, "type": "basepair", "target": 53, "len": 1, "label": "="}, {"source": 44, "type": "backbone", "target": 45, "len": 1, "label": "-"}, {"source": 45, "type": "backbone", "target": 46, "len": 1, "label": "-"}, {"source": 46, "type": "backbone", "target": 47, "len": 1, "label": "-"}, {"source": 47, "type": "backbone", "target": 48, "len": 1, "label": "-"}, {"source": 48, "type": "backbone", "target": 49, "len": 1, "label": "-"}, {"source": 49, "type": "backbone", "target": 50, "len": 1, "label": "-"}, {"source": 50, "type": "backbone", "target": 51, "len": 1, "label": "-"}, {"source": 51, "type": "backbone", "target": 52, "len": 1, "label": "-"}, {"source": 52, "type": "backbone", "target": 53, "len": 1, "label": "-"}, {"source": 53, "type": "backbone", "target": 54, "len": 1, "label": "-"}, {"source": 54, "type": "backbone", "target": 55, "len": 1, "label": "-"}, {"source": 55, "type": "backbone", "target": 56, "len": 1, "label": "-"}, {"source": 56, "type": "backbone", "target": 57, "len": 1, "label": "-"}, {"source": 57, "type": "backbone", "target": 58, "len": 1, "label": "-"}, {"source": 58, "type": "backbone", "target": 59, "len": 1, "label": "-"}, {"source": 59, "type": "backbone", "target": 60, "len": 1, "label": "-"}, {"source": 60, "type": "backbone", "target": 61, "len": 1, "label": "-"}], "multigraph": false} +{"directed": false, "graph": {"info": "RNAshapes shape_type=2 energy_range=4 max_num=3", "id": "ACNY01000002.1/278641-278580_[][[]_]", "structure": ".........((((((.....))))))..........((((((((.........)).))))))", "sequence": "GAUCGUUCACUUCGCAUCGCGCGAAGCGCAGUUCGCCUCAGGCCAUGGAACGGGGACCUGAG"}, "nodes": [{"position": 0, "id": 0, "label": "G"}, {"position": 1, "id": 1, "label": "A"}, {"position": 2, "id": 2, "label": "U"}, {"position": 3, "id": 3, "label": "C"}, {"position": 4, "id": 4, "label": "G"}, {"position": 5, "id": 5, "label": "U"}, {"position": 6, "id": 6, "label": "U"}, {"position": 7, "id": 7, "label": "C"}, {"position": 8, "id": 8, "label": "A"}, {"position": 9, "id": 9, "label": "C"}, {"position": 10, "id": 10, "label": "U"}, {"position": 11, "id": 11, "label": "U"}, {"position": 12, "id": 12, "label": "C"}, {"position": 13, "id": 13, "label": "G"}, {"position": 14, "id": 14, "label": "C"}, {"position": 15, "id": 15, "label": "A"}, {"position": 16, "id": 16, "label": "U"}, {"position": 17, "id": 17, "label": "C"}, {"position": 18, "id": 18, "label": "G"}, {"position": 19, "id": 19, "label": "C"}, {"position": 20, "id": 20, "label": "G"}, {"position": 21, "id": 21, "label": "C"}, {"position": 22, "id": 22, "label": "G"}, {"position": 23, "id": 23, "label": "A"}, {"position": 24, "id": 24, "label": "A"}, {"position": 25, "id": 25, "label": "G"}, {"position": 26, "id": 26, "label": "C"}, {"position": 27, "id": 27, "label": "G"}, {"position": 28, "id": 28, "label": "C"}, {"position": 29, "id": 29, "label": "A"}, {"position": 30, "id": 30, "label": "G"}, {"position": 31, "id": 31, "label": "U"}, {"position": 32, "id": 32, "label": "U"}, {"position": 33, "id": 33, "label": "C"}, {"position": 34, "id": 34, "label": "G"}, {"position": 35, "id": 35, "label": "C"}, {"position": 36, "id": 36, "label": "C"}, {"position": 37, "id": 37, "label": "U"}, {"position": 38, "id": 38, "label": "C"}, {"position": 39, "id": 39, "label": "A"}, {"position": 40, "id": 40, "label": "G"}, {"position": 41, "id": 41, "label": "G"}, {"position": 42, "id": 42, "label": "C"}, {"position": 43, "id": 43, "label": "C"}, {"position": 44, "id": 44, "label": "A"}, {"position": 45, "id": 45, "label": "U"}, {"position": 46, "id": 46, "label": "G"}, {"position": 47, "id": 47, "label": "G"}, {"position": 48, "id": 48, "label": "A"}, {"position": 49, "id": 49, "label": "A"}, {"position": 50, "id": 50, "label": "C"}, {"position": 51, "id": 51, "label": "G"}, {"position": 52, "id": 52, "label": "G"}, {"position": 53, "id": 53, "label": "G"}, {"position": 54, "id": 54, "label": "G"}, {"position": 55, "id": 55, "label": "A"}, {"position": 56, "id": 56, "label": "C"}, {"position": 57, "id": 57, "label": "C"}, {"position": 58, "id": 58, "label": "U"}, {"position": 59, "id": 59, "label": "G"}, {"position": 60, "id": 60, "label": "A"}, {"position": 61, "id": 61, "label": "G"}], "links": [{"source": 0, "type": "backbone", "target": 1, "len": 1, "label": "-"}, {"source": 1, "type": "backbone", "target": 2, "len": 1, "label": "-"}, {"source": 2, "type": "backbone", "target": 3, "len": 1, "label": "-"}, {"source": 3, "type": "backbone", "target": 4, "len": 1, "label": "-"}, {"source": 4, "type": "backbone", "target": 5, "len": 1, "label": "-"}, {"source": 5, "type": "backbone", "target": 6, "len": 1, "label": "-"}, {"source": 6, "type": "backbone", "target": 7, "len": 1, "label": "-"}, {"source": 7, "type": "backbone", "target": 8, "len": 1, "label": "-"}, {"source": 8, "type": "backbone", "target": 9, "len": 1, "label": "-"}, {"source": 9, "type": "basepair", "target": 25, "len": 1, "label": "="}, {"source": 9, "type": "backbone", "target": 10, "len": 1, "label": "-"}, {"source": 10, "type": "basepair", "target": 24, "len": 1, "label": "="}, {"source": 10, "type": "backbone", "target": 11, "len": 1, "label": "-"}, {"source": 11, "type": "backbone", "target": 12, "len": 1, "label": "-"}, {"source": 11, "type": "basepair", "target": 23, "len": 1, "label": "="}, {"source": 12, "type": "backbone", "target": 13, "len": 1, "label": "-"}, {"source": 12, "type": "basepair", "target": 22, "len": 1, "label": "="}, {"source": 13, "type": "basepair", "target": 21, "len": 1, "label": "="}, {"source": 13, "type": "backbone", "target": 14, "len": 1, "label": "-"}, {"source": 14, "type": "basepair", "target": 20, "len": 1, "label": "="}, {"source": 14, "type": "backbone", "target": 15, "len": 1, "label": "-"}, {"source": 15, "type": "backbone", "target": 16, "len": 1, "label": "-"}, {"source": 16, "type": "backbone", "target": 17, "len": 1, "label": "-"}, {"source": 17, "type": "backbone", "target": 18, "len": 1, "label": "-"}, {"source": 18, "type": "backbone", "target": 19, "len": 1, "label": "-"}, {"source": 19, "type": "backbone", "target": 20, "len": 1, "label": "-"}, {"source": 20, "type": "backbone", "target": 21, "len": 1, "label": "-"}, {"source": 21, "type": "backbone", "target": 22, "len": 1, "label": "-"}, {"source": 22, "type": "backbone", "target": 23, "len": 1, "label": "-"}, {"source": 23, "type": "backbone", "target": 24, "len": 1, "label": "-"}, {"source": 24, "type": "backbone", "target": 25, "len": 1, "label": "-"}, {"source": 25, "type": "backbone", "target": 26, "len": 1, "label": "-"}, {"source": 26, "type": "backbone", "target": 27, "len": 1, "label": "-"}, {"source": 27, "type": "backbone", "target": 28, "len": 1, "label": "-"}, {"source": 28, "type": "backbone", "target": 29, "len": 1, "label": "-"}, {"source": 29, "type": "backbone", "target": 30, "len": 1, "label": "-"}, {"source": 30, "type": "backbone", "target": 31, "len": 1, "label": "-"}, {"source": 31, "type": "backbone", "target": 32, "len": 1, "label": "-"}, {"source": 32, "type": "backbone", "target": 33, "len": 1, "label": "-"}, {"source": 33, "type": "backbone", "target": 34, "len": 1, "label": "-"}, {"source": 34, "type": "backbone", "target": 35, "len": 1, "label": "-"}, {"source": 35, "type": "backbone", "target": 36, "len": 1, "label": "-"}, {"source": 36, "type": "backbone", "target": 37, "len": 1, "label": "-"}, {"source": 36, "type": "basepair", "target": 61, "len": 1, "label": "="}, {"source": 37, "type": "basepair", "target": 60, "len": 1, "label": "="}, {"source": 37, "type": "backbone", "target": 38, "len": 1, "label": "-"}, {"source": 38, "type": "basepair", "target": 59, "len": 1, "label": "="}, {"source": 38, "type": "backbone", "target": 39, "len": 1, "label": "-"}, {"source": 39, "type": "backbone", "target": 40, "len": 1, "label": "-"}, {"source": 39, "type": "basepair", "target": 58, "len": 1, "label": "="}, {"source": 40, "type": "backbone", "target": 41, "len": 1, "label": "-"}, {"source": 40, "type": "basepair", "target": 57, "len": 1, "label": "="}, {"source": 41, "type": "basepair", "target": 56, "len": 1, "label": "="}, {"source": 41, "type": "backbone", "target": 42, "len": 1, "label": "-"}, {"source": 42, "type": "backbone", "target": 43, "len": 1, "label": "-"}, {"source": 42, "type": "basepair", "target": 54, "len": 1, "label": "="}, {"source": 43, "type": "backbone", "target": 44, "len": 1, "label": "-"}, {"source": 43, "type": "basepair", "target": 53, "len": 1, "label": "="}, {"source": 44, "type": "backbone", "target": 45, "len": 1, "label": "-"}, {"source": 45, "type": "backbone", "target": 46, "len": 1, "label": "-"}, {"source": 46, "type": "backbone", "target": 47, "len": 1, "label": "-"}, {"source": 47, "type": "backbone", "target": 48, "len": 1, "label": "-"}, {"source": 48, "type": "backbone", "target": 49, "len": 1, "label": "-"}, {"source": 49, "type": "backbone", "target": 50, "len": 1, "label": "-"}, {"source": 50, "type": "backbone", "target": 51, "len": 1, "label": "-"}, {"source": 51, "type": "backbone", "target": 52, "len": 1, "label": "-"}, {"source": 52, "type": "backbone", "target": 53, "len": 1, "label": "-"}, {"source": 53, "type": "backbone", "target": 54, "len": 1, "label": "-"}, {"source": 54, "type": "backbone", "target": 55, "len": 1, "label": "-"}, {"source": 55, "type": "backbone", "target": 56, "len": 1, "label": "-"}, {"source": 56, "type": "backbone", "target": 57, "len": 1, "label": "-"}, {"source": 57, "type": "backbone", "target": 58, "len": 1, "label": "-"}, {"source": 58, "type": "backbone", "target": 59, "len": 1, "label": "-"}, {"source": 59, "type": "backbone", "target": 60, "len": 1, "label": "-"}, {"source": 60, "type": "backbone", "target": 61, "len": 1, "label": "-"}], "multigraph": false}
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/csc_sparse1.mtx Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,9 @@ +%%MatrixMarket matrix coordinate integer general +% +3 3 6 +1 1 1 +3 1 2 +3 2 3 +1 3 4 +2 3 5 +3 3 6
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/csc_sparse2.mtx Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,9 @@ +%%MatrixMarket matrix coordinate real general +% +3 3 6 +1 1 1.5 +3 1 -2 +3 2 0.3 +1 3 41 +2 3 0.1235 +3 3 6
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/csc_stack_result01.mtx Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,15 @@ +%%MatrixMarket matrix coordinate real general +% +3 6 12 +1 1 1.000000000000000e+00 +3 1 2.000000000000000e+00 +3 2 3.000000000000000e+00 +1 3 4.000000000000000e+00 +2 3 5.000000000000000e+00 +3 3 6.000000000000000e+00 +1 4 1.500000000000000e+00 +3 4 -2.000000000000000e+00 +3 5 3.000000000000000e-01 +1 6 4.100000000000000e+01 +2 6 1.235000000000000e-01 +3 6 6.000000000000000e+00
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/csr_sparse1.mtx Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,9 @@ +%%MatrixMarket matrix coordinate integer general +% +3 3 6 +1 1 1 +1 3 2 +2 3 3 +3 1 4 +3 2 5 +3 3 6
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/csr_sparse2.mtx Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,9 @@ +%%MatrixMarket matrix coordinate real general +% +3 3 6 +1 1 1 +1 3 -0.2 +2 3 11 +3 1 0.04 +3 2 -5 +3 3 2.6
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/csr_stack_result01.mtx Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,15 @@ +%%MatrixMarket matrix coordinate real general +% +6 3 12 +1 1 1.000000000000000e+00 +1 3 2.000000000000000e+00 +2 3 3.000000000000000e+00 +3 1 4.000000000000000e+00 +3 2 5.000000000000000e+00 +3 3 6.000000000000000e+00 +4 1 1.000000000000000e+00 +4 3 -2.000000000000000e-01 +5 3 1.100000000000000e+01 +6 1 4.000000000000000e-02 +6 2 -5.000000000000000e+00 +6 3 2.600000000000000e+00
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/empty_file.txt Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,48 @@ +0 44 64 -76 4 +0 51 48 -73 0 +0 58 65 -49 0 +0 43 61 -49 1 +0 45 43 -79 0 +0 42 60 -98 0 +0 50 55 -59 2 +0 53 53 -56 2 +0 45 44 -61 0 +0 43 65 -84 4 +0 35 52 -75 1 +0 56 56 -70 0 +1 -61 86 43 0 +1 -67 93 15 0 +1 -59 94 36 0 +1 -50 92 62 0 +1 -78 91 70 1 +1 -35 87 47 0 +1 -56 91 52 0 +1 -61 81 46 0 +1 -83 78 34 0 +1 -50 87 45 0 +1 -67 73 50 1 +1 -50 97 45 0 +1 -61 111 45 0 +2 -109 23 -92 0 +2 -94 20 -96 0 +2 -85 26 -88 0 +2 -90 33 -114 1 +2 -63 9 -106 0 +2 -79 9 -93 1 +2 -99 26 -108 3 +2 -81 19 -110 0 +2 -108 21 -108 0 +2 -92 27 -106 3 +2 -88 2 -106 1 +2 -88 15 -103 0 +3 54 -74 4 0 +3 42 -92 31 1 +3 39 -99 -7 1 +3 48 -115 -5 1 +3 39 -96 2 1 +3 31 -109 9 1 +3 33 -96 -8 1 +3 23 -102 4 0 +3 38 -90 21 1 +3 34 -107 1 1 +3 35 -78 18 1
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/f1_score.txt Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,2 @@ +f1_score : +0.8461538461538461
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/fbeta_score.txt Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,2 @@ +fbeta_score : +0.8461538461538461
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/feature_selection_result01 Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,11 @@ +0 1 +143.762620712 -1.1796457192799998 +-88.5787166225 -2.5710918402200003 +-82.8452345578 -0.168636324107 +72.4951388149 0.991068834926 +11.805182128 -0.7096855607860001 +-63.9354970901 0.9841122108220001 +126.32584079600001 0.35353444883900004 +23.0341392692 1.03188231893 +67.6714937696 -0.8214378651719999 +47.39275848810001 -0.0942409319417
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/feature_selection_result02 Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,262 @@ +temp_2 temp_1 forecast_noaa friend +68.0 69.0 65.0 88.0 +60.0 59.0 57.0 66.0 +85.0 88.0 75.0 70.0 +82.0 65.0 63.0 58.0 +54.0 50.0 44.0 58.0 +48.0 51.0 45.0 63.0 +49.0 52.0 45.0 41.0 +73.0 78.0 75.0 66.0 +39.0 35.0 43.0 38.0 +42.0 40.0 45.0 36.0 +42.0 47.0 41.0 58.0 +76.0 72.0 76.0 88.0 +69.0 76.0 73.0 72.0 +40.0 39.0 45.0 46.0 +71.0 78.0 70.0 84.0 +64.0 71.0 63.0 85.0 +54.0 48.0 44.0 61.0 +73.0 72.0 77.0 68.0 +56.0 57.0 50.0 70.0 +45.0 40.0 44.0 39.0 +50.0 54.0 47.0 53.0 +65.0 58.0 52.0 71.0 +60.0 68.0 58.0 54.0 +60.0 65.0 55.0 65.0 +48.0 47.0 46.0 51.0 +44.0 44.0 43.0 42.0 +64.0 64.0 64.0 69.0 +59.0 62.0 57.0 67.0 +68.0 66.0 64.0 74.0 +77.0 70.0 67.0 90.0 +59.0 57.0 54.0 70.0 +55.0 50.0 46.0 57.0 +58.0 55.0 49.0 71.0 +57.0 55.0 46.0 67.0 +42.0 42.0 41.0 47.0 +64.0 65.0 57.0 41.0 +64.0 63.0 63.0 73.0 +49.0 48.0 45.0 28.0 +40.0 42.0 44.0 62.0 +44.0 51.0 45.0 38.0 +67.0 64.0 65.0 64.0 +79.0 75.0 74.0 63.0 +50.0 52.0 42.0 39.0 +85.0 67.0 66.0 80.0 +67.0 68.0 65.0 56.0 +53.0 54.0 53.0 42.0 +62.0 62.0 52.0 70.0 +77.0 76.0 76.0 61.0 +74.0 73.0 71.0 93.0 +50.0 52.0 50.0 35.0 +75.0 70.0 71.0 68.0 +73.0 77.0 75.0 62.0 +69.0 60.0 52.0 72.0 +55.0 52.0 50.0 54.0 +81.0 79.0 71.0 85.0 +77.0 76.0 53.0 74.0 +66.0 66.0 64.0 85.0 +68.0 57.0 58.0 62.0 +76.0 66.0 57.0 60.0 +60.0 61.0 58.0 41.0 +56.0 55.0 52.0 65.0 +57.0 48.0 46.0 54.0 +53.0 49.0 46.0 63.0 +66.0 65.0 64.0 73.0 +74.0 60.0 58.0 56.0 +55.0 56.0 53.0 36.0 +62.0 59.0 56.0 44.0 +36.0 44.0 41.0 35.0 +77.0 82.0 62.0 83.0 +64.0 64.0 65.0 76.0 +44.0 43.0 41.0 46.0 +56.0 64.0 51.0 57.0 +61.0 63.0 49.0 49.0 +65.0 70.0 67.0 79.0 +63.0 71.0 48.0 42.0 +76.0 76.0 69.0 85.0 +64.0 68.0 58.0 55.0 +39.0 39.0 44.0 39.0 +79.0 71.0 70.0 52.0 +68.0 69.0 68.0 89.0 +70.0 74.0 71.0 82.0 +75.0 81.0 62.0 81.0 +49.0 51.0 49.0 34.0 +52.0 45.0 44.0 61.0 +80.0 87.0 73.0 73.0 +76.0 71.0 71.0 86.0 +65.0 55.0 56.0 77.0 +76.0 80.0 72.0 81.0 +71.0 67.0 65.0 76.0 +64.0 61.0 60.0 78.0 +49.0 46.0 43.0 65.0 +35.0 39.0 42.0 51.0 +68.0 67.0 67.0 61.0 +48.0 52.0 43.0 50.0 +60.0 67.0 68.0 87.0 +74.0 75.0 67.0 77.0 +68.0 68.0 73.0 79.0 +81.0 92.0 65.0 71.0 +68.0 67.0 69.0 56.0 +45.0 44.0 43.0 56.0 +60.0 61.0 56.0 73.0 +65.0 65.0 49.0 41.0 +68.0 68.0 72.0 70.0 +77.0 87.0 62.0 69.0 +65.0 117.0 51.0 62.0 +72.0 80.0 75.0 66.0 +55.0 57.0 47.0 46.0 +63.0 67.0 61.0 68.0 +53.0 58.0 51.0 56.0 +61.0 65.0 53.0 41.0 +56.0 52.0 45.0 47.0 +57.0 59.0 52.0 39.0 +57.0 57.0 53.0 35.0 +89.0 81.0 56.0 66.0 +71.0 75.0 76.0 75.0 +88.0 76.0 76.0 95.0 +65.0 57.0 61.0 53.0 +68.0 69.0 72.0 86.0 +76.0 77.0 66.0 64.0 +58.0 55.0 47.0 55.0 +50.0 49.0 45.0 53.0 +53.0 54.0 48.0 57.0 +59.0 55.0 49.0 42.0 +51.0 56.0 53.0 45.0 +76.0 68.0 72.0 77.0 +52.0 54.0 49.0 44.0 +65.0 67.0 69.0 87.0 +45.0 49.0 45.0 33.0 +49.0 49.0 47.0 45.0 +57.0 56.0 48.0 49.0 +76.0 73.0 66.0 78.0 +65.0 66.0 65.0 60.0 +77.0 69.0 66.0 62.0 +77.0 82.0 64.0 65.0 +87.0 90.0 75.0 65.0 +51.0 51.0 49.0 43.0 +68.0 77.0 57.0 41.0 +57.0 60.0 58.0 58.0 +79.0 74.0 71.0 87.0 +80.0 85.0 73.0 74.0 +60.0 68.0 61.0 64.0 +62.0 56.0 46.0 37.0 +73.0 71.0 55.0 45.0 +60.0 62.0 57.0 40.0 +79.0 83.0 76.0 76.0 +71.0 64.0 62.0 56.0 +54.0 56.0 45.0 54.0 +40.0 41.0 42.0 31.0 +66.0 65.0 66.0 67.0 +57.0 65.0 49.0 38.0 +41.0 40.0 46.0 41.0 +45.0 45.0 43.0 29.0 +52.0 52.0 48.0 58.0 +64.0 63.0 50.0 63.0 +52.0 52.0 47.0 44.0 +58.0 60.0 55.0 77.0 +84.0 81.0 73.0 89.0 +77.0 75.0 74.0 77.0 +63.0 59.0 48.0 64.0 +72.0 73.0 77.0 94.0 +73.0 75.0 73.0 66.0 +59.0 60.0 56.0 59.0 +73.0 75.0 68.0 56.0 +66.0 59.0 56.0 40.0 +49.0 53.0 47.0 56.0 +80.0 79.0 76.0 60.0 +59.0 57.0 49.0 46.0 +79.0 75.0 64.0 77.0 +69.0 71.0 67.0 81.0 +57.0 53.0 50.0 42.0 +47.0 46.0 48.0 56.0 +82.0 81.0 72.0 70.0 +54.0 49.0 47.0 29.0 +56.0 57.0 44.0 34.0 +60.0 60.0 54.0 53.0 +70.0 67.0 72.0 64.0 +65.0 61.0 62.0 60.0 +70.0 66.0 66.0 85.0 +65.0 64.0 50.0 55.0 +63.0 66.0 62.0 49.0 +57.0 64.0 52.0 49.0 +60.0 71.0 61.0 56.0 +67.0 75.0 62.0 60.0 +45.0 48.0 46.0 47.0 +60.0 53.0 48.0 70.0 +55.0 49.0 46.0 65.0 +86.0 85.0 67.0 81.0 +57.0 62.0 48.0 30.0 +46.0 50.0 42.0 58.0 +65.0 58.0 51.0 39.0 +79.0 72.0 74.0 95.0 +57.0 55.0 50.0 34.0 +72.0 74.0 70.0 91.0 +83.0 85.0 77.0 77.0 +77.0 73.0 77.0 93.0 +52.0 52.0 44.0 39.0 +64.0 67.0 64.0 62.0 +49.0 45.0 45.0 35.0 +52.0 46.0 46.0 41.0 +62.0 66.0 60.0 57.0 +81.0 71.0 75.0 86.0 +65.0 70.0 66.0 79.0 +55.0 58.0 46.0 53.0 +72.0 72.0 76.0 65.0 +74.0 74.0 74.0 71.0 +63.0 65.0 63.0 49.0 +68.0 77.0 55.0 39.0 +60.0 59.0 49.0 35.0 +44.0 45.0 41.0 61.0 +51.0 53.0 49.0 46.0 +57.0 53.0 54.0 72.0 +85.0 79.0 73.0 79.0 +51.0 49.0 44.0 44.0 +66.0 63.0 62.0 78.0 +63.0 69.0 54.0 45.0 +51.0 60.0 47.0 46.0 +63.0 64.0 60.0 73.0 +75.0 79.0 66.0 64.0 +49.0 55.0 43.0 58.0 +68.0 73.0 54.0 41.0 +62.0 60.0 57.0 62.0 +71.0 67.0 67.0 77.0 +41.0 42.0 45.0 58.0 +57.0 60.0 62.0 55.0 +55.0 57.0 47.0 30.0 +35.0 35.0 44.0 36.0 +71.0 75.0 66.0 84.0 +59.0 61.0 48.0 65.0 +53.0 51.0 46.0 59.0 +69.0 71.0 67.0 70.0 +71.0 74.0 74.0 71.0 +48.0 48.0 44.0 42.0 +68.0 74.0 70.0 60.0 +70.0 76.0 68.0 57.0 +54.0 58.0 47.0 37.0 +53.0 51.0 48.0 43.0 +67.0 72.0 68.0 78.0 +67.0 76.0 64.0 74.0 +52.0 52.0 47.0 60.0 +52.0 53.0 48.0 53.0 +67.0 65.0 65.0 83.0 +61.0 58.0 58.0 43.0 +74.0 77.0 74.0 56.0 +58.0 61.0 51.0 35.0 +66.0 67.0 64.0 54.0 +55.0 54.0 46.0 58.0 +71.0 79.0 65.0 58.0 +81.0 77.0 63.0 67.0 +75.0 71.0 64.0 55.0 +59.0 58.0 54.0 61.0 +64.0 68.0 55.0 56.0 +43.0 40.0 45.0 49.0 +75.0 80.0 75.0 71.0 +87.0 74.0 59.0 61.0 +48.0 57.0 42.0 57.0 +48.0 52.0 43.0 57.0 +74.0 71.0 71.0 95.0 +54.0 49.0 49.0 70.0 +77.0 89.0 59.0 61.0 +66.0 60.0 56.0 78.0 +59.0 59.0 58.0 40.0
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/feature_selection_result03 Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,262 @@ +temp_1 friend +69.0 88.0 +59.0 66.0 +88.0 70.0 +65.0 58.0 +50.0 58.0 +51.0 63.0 +52.0 41.0 +78.0 66.0 +35.0 38.0 +40.0 36.0 +47.0 58.0 +72.0 88.0 +76.0 72.0 +39.0 46.0 +78.0 84.0 +71.0 85.0 +48.0 61.0 +72.0 68.0 +57.0 70.0 +40.0 39.0 +54.0 53.0 +58.0 71.0 +68.0 54.0 +65.0 65.0 +47.0 51.0 +44.0 42.0 +64.0 69.0 +62.0 67.0 +66.0 74.0 +70.0 90.0 +57.0 70.0 +50.0 57.0 +55.0 71.0 +55.0 67.0 +42.0 47.0 +65.0 41.0 +63.0 73.0 +48.0 28.0 +42.0 62.0 +51.0 38.0 +64.0 64.0 +75.0 63.0 +52.0 39.0 +67.0 80.0 +68.0 56.0 +54.0 42.0 +62.0 70.0 +76.0 61.0 +73.0 93.0 +52.0 35.0 +70.0 68.0 +77.0 62.0 +60.0 72.0 +52.0 54.0 +79.0 85.0 +76.0 74.0 +66.0 85.0 +57.0 62.0 +66.0 60.0 +61.0 41.0 +55.0 65.0 +48.0 54.0 +49.0 63.0 +65.0 73.0 +60.0 56.0 +56.0 36.0 +59.0 44.0 +44.0 35.0 +82.0 83.0 +64.0 76.0 +43.0 46.0 +64.0 57.0 +63.0 49.0 +70.0 79.0 +71.0 42.0 +76.0 85.0 +68.0 55.0 +39.0 39.0 +71.0 52.0 +69.0 89.0 +74.0 82.0 +81.0 81.0 +51.0 34.0 +45.0 61.0 +87.0 73.0 +71.0 86.0 +55.0 77.0 +80.0 81.0 +67.0 76.0 +61.0 78.0 +46.0 65.0 +39.0 51.0 +67.0 61.0 +52.0 50.0 +67.0 87.0 +75.0 77.0 +68.0 79.0 +92.0 71.0 +67.0 56.0 +44.0 56.0 +61.0 73.0 +65.0 41.0 +68.0 70.0 +87.0 69.0 +117.0 62.0 +80.0 66.0 +57.0 46.0 +67.0 68.0 +58.0 56.0 +65.0 41.0 +52.0 47.0 +59.0 39.0 +57.0 35.0 +81.0 66.0 +75.0 75.0 +76.0 95.0 +57.0 53.0 +69.0 86.0 +77.0 64.0 +55.0 55.0 +49.0 53.0 +54.0 57.0 +55.0 42.0 +56.0 45.0 +68.0 77.0 +54.0 44.0 +67.0 87.0 +49.0 33.0 +49.0 45.0 +56.0 49.0 +73.0 78.0 +66.0 60.0 +69.0 62.0 +82.0 65.0 +90.0 65.0 +51.0 43.0 +77.0 41.0 +60.0 58.0 +74.0 87.0 +85.0 74.0 +68.0 64.0 +56.0 37.0 +71.0 45.0 +62.0 40.0 +83.0 76.0 +64.0 56.0 +56.0 54.0 +41.0 31.0 +65.0 67.0 +65.0 38.0 +40.0 41.0 +45.0 29.0 +52.0 58.0 +63.0 63.0 +52.0 44.0 +60.0 77.0 +81.0 89.0 +75.0 77.0 +59.0 64.0 +73.0 94.0 +75.0 66.0 +60.0 59.0 +75.0 56.0 +59.0 40.0 +53.0 56.0 +79.0 60.0 +57.0 46.0 +75.0 77.0 +71.0 81.0 +53.0 42.0 +46.0 56.0 +81.0 70.0 +49.0 29.0 +57.0 34.0 +60.0 53.0 +67.0 64.0 +61.0 60.0 +66.0 85.0 +64.0 55.0 +66.0 49.0 +64.0 49.0 +71.0 56.0 +75.0 60.0 +48.0 47.0 +53.0 70.0 +49.0 65.0 +85.0 81.0 +62.0 30.0 +50.0 58.0 +58.0 39.0 +72.0 95.0 +55.0 34.0 +74.0 91.0 +85.0 77.0 +73.0 93.0 +52.0 39.0 +67.0 62.0 +45.0 35.0 +46.0 41.0 +66.0 57.0 +71.0 86.0 +70.0 79.0 +58.0 53.0 +72.0 65.0 +74.0 71.0 +65.0 49.0 +77.0 39.0 +59.0 35.0 +45.0 61.0 +53.0 46.0 +53.0 72.0 +79.0 79.0 +49.0 44.0 +63.0 78.0 +69.0 45.0 +60.0 46.0 +64.0 73.0 +79.0 64.0 +55.0 58.0 +73.0 41.0 +60.0 62.0 +67.0 77.0 +42.0 58.0 +60.0 55.0 +57.0 30.0 +35.0 36.0 +75.0 84.0 +61.0 65.0 +51.0 59.0 +71.0 70.0 +74.0 71.0 +48.0 42.0 +74.0 60.0 +76.0 57.0 +58.0 37.0 +51.0 43.0 +72.0 78.0 +76.0 74.0 +52.0 60.0 +53.0 53.0 +65.0 83.0 +58.0 43.0 +77.0 56.0 +61.0 35.0 +67.0 54.0 +54.0 58.0 +79.0 58.0 +77.0 67.0 +71.0 55.0 +58.0 61.0 +68.0 56.0 +40.0 49.0 +80.0 71.0 +74.0 61.0 +57.0 57.0 +52.0 57.0 +71.0 95.0 +49.0 70.0 +89.0 61.0 +60.0 78.0 +59.0 40.0
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/feature_selection_result04 Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,262 @@ +month day temp_2 temp_1 average forecast_noaa forecast_acc forecast_under friend week_Mon +9.0 19.0 68.0 69.0 69.7 65.0 74.0 71.0 88.0 1.0 +4.0 14.0 60.0 59.0 58.1 57.0 63.0 58.0 66.0 0.0 +7.0 30.0 85.0 88.0 77.3 75.0 79.0 77.0 70.0 0.0 +5.0 15.0 82.0 65.0 64.7 63.0 69.0 64.0 58.0 0.0 +1.0 18.0 54.0 50.0 47.5 44.0 48.0 49.0 58.0 1.0 +1.0 25.0 48.0 51.0 48.2 45.0 51.0 49.0 63.0 1.0 +11.0 25.0 49.0 52.0 48.6 45.0 52.0 47.0 41.0 0.0 +7.0 20.0 73.0 78.0 76.7 75.0 78.0 77.0 66.0 0.0 +12.0 17.0 39.0 35.0 45.2 43.0 47.0 46.0 38.0 0.0 +12.0 8.0 42.0 40.0 46.1 45.0 51.0 47.0 36.0 0.0 +12.0 28.0 42.0 47.0 45.3 41.0 49.0 44.0 58.0 0.0 +7.0 17.0 76.0 72.0 76.3 76.0 78.0 77.0 88.0 0.0 +7.0 7.0 69.0 76.0 74.4 73.0 77.0 74.0 72.0 0.0 +12.0 15.0 40.0 39.0 45.3 45.0 49.0 47.0 46.0 0.0 +6.0 27.0 71.0 78.0 72.2 70.0 74.0 72.0 84.0 1.0 +5.0 31.0 64.0 71.0 67.3 63.0 72.0 68.0 85.0 0.0 +1.0 20.0 54.0 48.0 47.7 44.0 52.0 49.0 61.0 0.0 +8.0 10.0 73.0 72.0 77.0 77.0 78.0 77.0 68.0 0.0 +3.0 23.0 56.0 57.0 54.7 50.0 58.0 55.0 70.0 0.0 +12.0 24.0 45.0 40.0 45.1 44.0 47.0 46.0 39.0 0.0 +1.0 19.0 50.0 54.0 47.6 47.0 49.0 48.0 53.0 0.0 +11.0 6.0 65.0 58.0 53.2 52.0 57.0 55.0 71.0 0.0 +4.0 17.0 60.0 68.0 58.6 58.0 62.0 59.0 54.0 0.0 +10.0 29.0 60.0 65.0 55.3 55.0 59.0 55.0 65.0 0.0 +2.0 1.0 48.0 47.0 48.8 46.0 49.0 49.0 51.0 1.0 +12.0 12.0 44.0 44.0 45.6 43.0 50.0 45.0 42.0 1.0 +5.0 30.0 64.0 64.0 67.1 64.0 70.0 66.0 69.0 1.0 +10.0 23.0 59.0 62.0 57.1 57.0 58.0 59.0 67.0 0.0 +9.0 30.0 68.0 66.0 65.7 64.0 67.0 65.0 74.0 0.0 +9.0 12.0 77.0 70.0 71.8 67.0 73.0 73.0 90.0 1.0 +11.0 2.0 59.0 57.0 54.2 54.0 58.0 55.0 70.0 0.0 +11.0 17.0 55.0 50.0 50.5 46.0 51.0 50.0 57.0 0.0 +3.0 3.0 58.0 55.0 51.8 49.0 54.0 50.0 71.0 0.0 +11.0 21.0 57.0 55.0 49.5 46.0 51.0 49.0 67.0 1.0 +12.0 27.0 42.0 42.0 45.2 41.0 50.0 47.0 47.0 0.0 +4.0 24.0 64.0 65.0 60.1 57.0 61.0 60.0 41.0 0.0 +5.0 20.0 64.0 63.0 65.6 63.0 70.0 64.0 73.0 0.0 +1.0 16.0 49.0 48.0 47.3 45.0 52.0 46.0 28.0 0.0 +12.0 7.0 40.0 42.0 46.3 44.0 51.0 46.0 62.0 0.0 +1.0 7.0 44.0 51.0 46.2 45.0 49.0 46.0 38.0 0.0 +9.0 24.0 67.0 64.0 68.0 65.0 71.0 66.0 64.0 0.0 +8.0 30.0 79.0 75.0 74.6 74.0 76.0 75.0 63.0 0.0 +1.0 11.0 50.0 52.0 46.7 42.0 48.0 48.0 39.0 1.0 +6.0 9.0 85.0 67.0 68.6 66.0 73.0 69.0 80.0 0.0 +9.0 22.0 67.0 68.0 68.7 65.0 70.0 69.0 56.0 0.0 +3.0 25.0 53.0 54.0 55.0 53.0 57.0 57.0 42.0 0.0 +10.0 24.0 62.0 62.0 56.8 52.0 61.0 57.0 70.0 1.0 +7.0 16.0 77.0 76.0 76.1 76.0 78.0 75.0 61.0 0.0 +7.0 1.0 74.0 73.0 73.1 71.0 75.0 72.0 93.0 0.0 +11.0 18.0 50.0 52.0 50.3 50.0 53.0 50.0 35.0 0.0 +9.0 3.0 75.0 70.0 73.9 71.0 75.0 73.0 68.0 0.0 +8.0 2.0 73.0 77.0 77.4 75.0 80.0 79.0 62.0 0.0 +4.0 5.0 69.0 60.0 56.6 52.0 58.0 56.0 72.0 0.0 +3.0 13.0 55.0 52.0 53.3 50.0 55.0 53.0 54.0 0.0 +8.0 28.0 81.0 79.0 75.0 71.0 77.0 76.0 85.0 0.0 +4.0 9.0 77.0 76.0 57.2 53.0 61.0 57.0 74.0 0.0 +5.0 26.0 66.0 66.0 66.5 64.0 70.0 65.0 85.0 0.0 +10.0 10.0 68.0 57.0 61.8 58.0 64.0 61.0 62.0 1.0 +4.0 10.0 76.0 66.0 57.4 57.0 60.0 57.0 60.0 0.0 +10.0 19.0 60.0 61.0 58.4 58.0 60.0 57.0 41.0 0.0 +3.0 12.0 56.0 55.0 53.1 52.0 58.0 53.0 65.0 0.0 +1.0 24.0 57.0 48.0 48.1 46.0 50.0 48.0 54.0 0.0 +2.0 7.0 53.0 49.0 49.2 46.0 51.0 48.0 63.0 0.0 +5.0 27.0 66.0 65.0 66.7 64.0 67.0 68.0 73.0 0.0 +5.0 5.0 74.0 60.0 62.5 58.0 66.0 62.0 56.0 0.0 +3.0 11.0 55.0 56.0 53.0 53.0 53.0 51.0 36.0 0.0 +10.0 22.0 62.0 59.0 57.4 56.0 59.0 58.0 44.0 0.0 +12.0 11.0 36.0 44.0 45.7 41.0 46.0 47.0 35.0 0.0 +5.0 8.0 77.0 82.0 63.2 62.0 65.0 63.0 83.0 0.0 +5.0 29.0 64.0 64.0 67.0 65.0 71.0 65.0 76.0 0.0 +12.0 13.0 44.0 43.0 45.5 41.0 47.0 46.0 46.0 0.0 +3.0 30.0 56.0 64.0 55.7 51.0 57.0 56.0 57.0 0.0 +11.0 8.0 61.0 63.0 52.7 49.0 57.0 52.0 49.0 0.0 +6.0 20.0 65.0 70.0 70.6 67.0 71.0 70.0 79.0 1.0 +11.0 9.0 63.0 71.0 52.4 48.0 56.0 52.0 42.0 0.0 +7.0 3.0 76.0 76.0 73.5 69.0 76.0 75.0 85.0 0.0 +10.0 9.0 64.0 68.0 62.1 58.0 65.0 63.0 55.0 0.0 +12.0 16.0 39.0 39.0 45.3 44.0 49.0 44.0 39.0 0.0 +9.0 16.0 79.0 71.0 70.7 70.0 74.0 71.0 52.0 0.0 +6.0 25.0 68.0 69.0 71.7 68.0 73.0 73.0 89.0 0.0 +9.0 13.0 70.0 74.0 71.5 71.0 75.0 70.0 82.0 0.0 +5.0 12.0 75.0 81.0 64.1 62.0 67.0 63.0 81.0 0.0 +2.0 8.0 49.0 51.0 49.3 49.0 52.0 50.0 34.0 1.0 +1.0 12.0 52.0 45.0 46.8 44.0 50.0 45.0 61.0 0.0 +8.0 13.0 80.0 87.0 76.8 73.0 79.0 78.0 73.0 0.0 +7.0 4.0 76.0 71.0 73.8 71.0 76.0 73.0 86.0 1.0 +4.0 25.0 65.0 55.0 60.3 56.0 64.0 61.0 77.0 1.0 +8.0 12.0 76.0 80.0 76.9 72.0 79.0 77.0 81.0 0.0 +9.0 21.0 71.0 67.0 69.0 65.0 70.0 70.0 76.0 0.0 +4.0 30.0 64.0 61.0 61.4 60.0 65.0 62.0 78.0 0.0 +12.0 5.0 49.0 46.0 46.6 43.0 50.0 45.0 65.0 1.0 +12.0 19.0 35.0 39.0 45.1 42.0 46.0 45.0 51.0 1.0 +9.0 23.0 68.0 67.0 68.3 67.0 69.0 67.0 61.0 0.0 +11.0 29.0 48.0 52.0 47.8 43.0 48.0 47.0 50.0 0.0 +6.0 16.0 60.0 67.0 69.8 68.0 72.0 71.0 87.0 0.0 +9.0 14.0 74.0 75.0 71.2 67.0 75.0 73.0 77.0 0.0 +9.0 6.0 68.0 68.0 73.3 73.0 76.0 75.0 79.0 0.0 +6.0 6.0 81.0 92.0 68.2 65.0 70.0 67.0 71.0 1.0 +9.0 8.0 68.0 67.0 72.8 69.0 77.0 73.0 56.0 0.0 +1.0 3.0 45.0 44.0 45.8 43.0 46.0 47.0 56.0 0.0 +4.0 28.0 60.0 61.0 61.0 56.0 65.0 62.0 73.0 0.0 +11.0 5.0 65.0 65.0 53.4 49.0 58.0 52.0 41.0 0.0 +9.0 7.0 68.0 68.0 73.0 72.0 78.0 71.0 70.0 0.0 +5.0 3.0 77.0 87.0 62.1 62.0 66.0 64.0 69.0 0.0 +10.0 31.0 65.0 117.0 54.8 51.0 59.0 56.0 62.0 1.0 +7.0 18.0 72.0 80.0 76.4 75.0 77.0 75.0 66.0 1.0 +11.0 15.0 55.0 57.0 51.0 47.0 54.0 51.0 46.0 0.0 +5.0 10.0 63.0 67.0 63.6 61.0 66.0 64.0 68.0 0.0 +3.0 18.0 53.0 58.0 54.0 51.0 57.0 54.0 56.0 0.0 +10.0 26.0 61.0 65.0 56.2 53.0 57.0 57.0 41.0 0.0 +1.0 30.0 56.0 52.0 48.6 45.0 51.0 48.0 47.0 0.0 +3.0 27.0 57.0 59.0 55.3 52.0 58.0 55.0 39.0 0.0 +11.0 3.0 57.0 57.0 53.9 53.0 54.0 54.0 35.0 0.0 +4.0 20.0 89.0 81.0 59.2 56.0 63.0 61.0 66.0 0.0 +7.0 24.0 71.0 75.0 77.1 76.0 78.0 78.0 75.0 0.0 +7.0 31.0 88.0 76.0 77.4 76.0 78.0 79.0 95.0 0.0 +5.0 16.0 65.0 57.0 64.8 61.0 65.0 65.0 53.0 1.0 +7.0 6.0 68.0 69.0 74.2 72.0 76.0 75.0 86.0 0.0 +9.0 27.0 76.0 77.0 66.8 66.0 67.0 68.0 64.0 0.0 +2.0 16.0 58.0 55.0 49.9 47.0 54.0 51.0 55.0 0.0 +12.0 4.0 50.0 49.0 46.8 45.0 47.0 47.0 53.0 0.0 +3.0 9.0 53.0 54.0 52.7 48.0 56.0 54.0 57.0 0.0 +11.0 14.0 59.0 55.0 51.2 49.0 53.0 53.0 42.0 1.0 +3.0 29.0 51.0 56.0 55.6 53.0 59.0 54.0 45.0 0.0 +7.0 8.0 76.0 68.0 74.6 72.0 79.0 75.0 77.0 0.0 +3.0 14.0 52.0 54.0 53.4 49.0 58.0 55.0 44.0 1.0 +6.0 11.0 65.0 67.0 69.0 69.0 72.0 71.0 87.0 0.0 +1.0 13.0 45.0 49.0 46.9 45.0 51.0 46.0 33.0 0.0 +2.0 5.0 49.0 49.0 49.1 47.0 50.0 49.0 45.0 0.0 +1.0 29.0 57.0 56.0 48.5 48.0 52.0 47.0 49.0 0.0 +6.0 22.0 76.0 73.0 71.0 66.0 71.0 72.0 78.0 0.0 +5.0 25.0 65.0 66.0 66.4 65.0 67.0 66.0 60.0 0.0 +9.0 28.0 77.0 69.0 66.5 66.0 68.0 66.0 62.0 0.0 +5.0 14.0 77.0 82.0 64.5 64.0 66.0 66.0 65.0 0.0 +8.0 14.0 87.0 90.0 76.7 75.0 78.0 78.0 65.0 0.0 +2.0 23.0 51.0 51.0 50.7 49.0 53.0 51.0 43.0 0.0 +4.0 8.0 68.0 77.0 57.1 57.0 61.0 57.0 41.0 0.0 +10.0 11.0 57.0 60.0 61.4 58.0 66.0 61.0 58.0 0.0 +6.0 30.0 79.0 74.0 72.8 71.0 76.0 72.0 87.0 0.0 +7.0 26.0 80.0 85.0 77.2 73.0 79.0 76.0 74.0 0.0 +5.0 6.0 60.0 68.0 62.8 61.0 64.0 61.0 64.0 0.0 +2.0 11.0 62.0 56.0 49.5 46.0 53.0 50.0 37.0 0.0 +4.0 2.0 73.0 71.0 56.2 55.0 58.0 58.0 45.0 0.0 +10.0 16.0 60.0 62.0 59.5 57.0 60.0 59.0 40.0 0.0 +7.0 28.0 79.0 83.0 77.3 76.0 80.0 78.0 76.0 0.0 +5.0 19.0 71.0 64.0 65.4 62.0 68.0 67.0 56.0 0.0 +1.0 27.0 54.0 56.0 48.4 45.0 51.0 49.0 54.0 0.0 +12.0 25.0 40.0 41.0 45.1 42.0 49.0 44.0 31.0 0.0 +5.0 24.0 66.0 65.0 66.2 66.0 71.0 66.0 67.0 0.0 +11.0 4.0 57.0 65.0 53.7 49.0 55.0 54.0 38.0 0.0 +1.0 5.0 41.0 40.0 46.0 46.0 46.0 46.0 41.0 0.0 +1.0 1.0 45.0 45.0 45.6 43.0 50.0 44.0 29.0 0.0 +11.0 26.0 52.0 52.0 48.4 48.0 50.0 47.0 58.0 0.0 +11.0 12.0 64.0 63.0 51.7 50.0 52.0 52.0 63.0 0.0 +11.0 30.0 52.0 52.0 47.6 47.0 52.0 49.0 44.0 0.0 +4.0 13.0 58.0 60.0 57.9 55.0 62.0 56.0 77.0 0.0 +8.0 23.0 84.0 81.0 75.7 73.0 78.0 77.0 89.0 0.0 +7.0 14.0 77.0 75.0 75.8 74.0 76.0 77.0 77.0 0.0 +11.0 13.0 63.0 59.0 51.4 48.0 56.0 50.0 64.0 0.0 +8.0 9.0 72.0 73.0 77.1 77.0 80.0 79.0 94.0 0.0 +8.0 4.0 73.0 75.0 77.3 73.0 79.0 78.0 66.0 0.0 +4.0 16.0 59.0 60.0 58.5 56.0 60.0 59.0 59.0 0.0 +6.0 23.0 73.0 75.0 71.3 68.0 72.0 71.0 56.0 0.0 +4.0 11.0 66.0 59.0 57.6 56.0 60.0 58.0 40.0 1.0 +2.0 6.0 49.0 53.0 49.1 47.0 53.0 49.0 56.0 0.0 +8.0 6.0 80.0 79.0 77.2 76.0 81.0 79.0 60.0 0.0 +3.0 5.0 59.0 57.0 52.1 49.0 53.0 51.0 46.0 0.0 +6.0 2.0 79.0 75.0 67.6 64.0 71.0 67.0 77.0 0.0 +9.0 20.0 69.0 71.0 69.4 67.0 73.0 69.0 81.0 0.0 +2.0 19.0 57.0 53.0 50.2 50.0 52.0 51.0 42.0 0.0 +2.0 2.0 47.0 46.0 48.8 48.0 50.0 50.0 56.0 0.0 +7.0 22.0 82.0 81.0 76.9 72.0 77.0 76.0 70.0 0.0 +11.0 24.0 54.0 49.0 48.9 47.0 53.0 48.0 29.0 0.0 +1.0 28.0 56.0 57.0 48.4 44.0 52.0 48.0 34.0 0.0 +10.0 18.0 60.0 60.0 58.8 54.0 60.0 57.0 53.0 0.0 +9.0 4.0 70.0 67.0 73.7 72.0 77.0 75.0 64.0 0.0 +10.0 4.0 65.0 61.0 64.1 62.0 69.0 65.0 60.0 0.0 +6.0 14.0 70.0 66.0 69.5 66.0 71.0 69.0 85.0 0.0 +11.0 11.0 65.0 64.0 51.9 50.0 53.0 52.0 55.0 0.0 +5.0 21.0 63.0 66.0 65.7 62.0 67.0 65.0 49.0 0.0 +3.0 6.0 57.0 64.0 52.2 52.0 53.0 51.0 49.0 0.0 +5.0 18.0 60.0 71.0 65.2 61.0 68.0 65.0 56.0 0.0 +5.0 11.0 67.0 75.0 63.8 62.0 68.0 63.0 60.0 0.0 +1.0 9.0 45.0 48.0 46.4 46.0 50.0 45.0 47.0 0.0 +3.0 8.0 60.0 53.0 52.5 48.0 56.0 51.0 70.0 0.0 +1.0 15.0 55.0 49.0 47.1 46.0 51.0 46.0 65.0 0.0 +6.0 8.0 86.0 85.0 68.5 67.0 70.0 69.0 81.0 0.0 +2.0 10.0 57.0 62.0 49.4 48.0 50.0 49.0 30.0 0.0 +12.0 3.0 46.0 50.0 47.0 42.0 52.0 47.0 58.0 0.0 +10.0 27.0 65.0 58.0 55.9 51.0 60.0 55.0 39.0 0.0 +8.0 7.0 79.0 72.0 77.2 74.0 78.0 77.0 95.0 0.0 +11.0 16.0 57.0 55.0 50.7 50.0 51.0 49.0 34.0 0.0 +9.0 10.0 72.0 74.0 72.3 70.0 77.0 74.0 91.0 0.0 +7.0 29.0 83.0 85.0 77.3 77.0 80.0 79.0 77.0 0.0 +8.0 3.0 77.0 73.0 77.3 77.0 81.0 77.0 93.0 0.0 +12.0 1.0 52.0 52.0 47.4 44.0 48.0 49.0 39.0 0.0 +9.0 25.0 64.0 67.0 67.6 64.0 72.0 67.0 62.0 0.0 +12.0 23.0 49.0 45.0 45.1 45.0 49.0 44.0 35.0 0.0 +12.0 2.0 52.0 46.0 47.2 46.0 51.0 49.0 41.0 0.0 +10.0 13.0 62.0 66.0 60.6 60.0 62.0 60.0 57.0 0.0 +7.0 23.0 81.0 71.0 77.0 75.0 81.0 76.0 86.0 0.0 +6.0 13.0 65.0 70.0 69.3 66.0 72.0 69.0 79.0 1.0 +2.0 15.0 55.0 58.0 49.9 46.0 52.0 49.0 53.0 1.0 +8.0 8.0 72.0 72.0 77.1 76.0 78.0 77.0 65.0 1.0 +7.0 12.0 74.0 74.0 75.4 74.0 77.0 77.0 71.0 0.0 +10.0 3.0 63.0 65.0 64.5 63.0 68.0 65.0 49.0 1.0 +4.0 18.0 68.0 77.0 58.8 55.0 59.0 57.0 39.0 1.0 +2.0 25.0 60.0 59.0 50.9 49.0 51.0 49.0 35.0 0.0 +1.0 2.0 44.0 45.0 45.7 41.0 50.0 44.0 61.0 0.0 +2.0 21.0 51.0 53.0 50.5 49.0 54.0 52.0 46.0 0.0 +3.0 24.0 57.0 53.0 54.9 54.0 56.0 56.0 72.0 0.0 +7.0 27.0 85.0 79.0 77.3 73.0 78.0 79.0 79.0 0.0 +2.0 4.0 51.0 49.0 49.0 44.0 54.0 51.0 44.0 0.0 +10.0 7.0 66.0 63.0 62.9 62.0 67.0 64.0 78.0 0.0 +4.0 4.0 63.0 69.0 56.5 54.0 59.0 56.0 45.0 1.0 +2.0 24.0 51.0 60.0 50.8 47.0 53.0 50.0 46.0 0.0 +10.0 8.0 63.0 64.0 62.5 60.0 65.0 61.0 73.0 0.0 +9.0 15.0 75.0 79.0 71.0 66.0 76.0 69.0 64.0 0.0 +1.0 14.0 49.0 55.0 47.0 43.0 47.0 46.0 58.0 0.0 +4.0 1.0 68.0 73.0 56.0 54.0 59.0 55.0 41.0 0.0 +10.0 17.0 62.0 60.0 59.1 57.0 63.0 59.0 62.0 1.0 +6.0 18.0 71.0 67.0 70.2 67.0 75.0 69.0 77.0 0.0 +12.0 26.0 41.0 42.0 45.2 45.0 48.0 46.0 58.0 1.0 +5.0 17.0 57.0 60.0 65.0 62.0 65.0 65.0 55.0 0.0 +11.0 20.0 55.0 57.0 49.8 47.0 54.0 48.0 30.0 0.0 +12.0 18.0 35.0 35.0 45.2 44.0 46.0 46.0 36.0 0.0 +9.0 17.0 71.0 75.0 70.3 66.0 73.0 70.0 84.0 0.0 +2.0 26.0 59.0 61.0 51.1 48.0 56.0 53.0 65.0 0.0 +2.0 22.0 53.0 51.0 50.6 46.0 51.0 50.0 59.0 1.0 +6.0 26.0 69.0 71.0 71.9 67.0 74.0 72.0 70.0 0.0 +7.0 11.0 71.0 74.0 75.3 74.0 79.0 75.0 71.0 1.0 +12.0 30.0 48.0 48.0 45.4 44.0 46.0 44.0 42.0 0.0 +7.0 9.0 68.0 74.0 74.9 70.0 79.0 76.0 60.0 0.0 +6.0 21.0 70.0 76.0 70.8 68.0 75.0 71.0 57.0 0.0 +3.0 2.0 54.0 58.0 51.6 47.0 54.0 52.0 37.0 0.0 +2.0 20.0 53.0 51.0 50.4 48.0 55.0 51.0 43.0 0.0 +9.0 9.0 67.0 72.0 72.6 68.0 77.0 71.0 78.0 0.0 +9.0 26.0 67.0 76.0 67.2 64.0 69.0 69.0 74.0 1.0 +1.0 22.0 52.0 52.0 47.9 47.0 48.0 48.0 60.0 0.0 +11.0 27.0 52.0 53.0 48.2 48.0 49.0 49.0 53.0 0.0 +6.0 12.0 67.0 65.0 69.1 65.0 73.0 70.0 83.0 0.0 +10.0 20.0 61.0 58.0 58.1 58.0 59.0 58.0 43.0 0.0 +7.0 13.0 74.0 77.0 75.6 74.0 78.0 76.0 56.0 0.0 +11.0 7.0 58.0 61.0 52.9 51.0 56.0 51.0 35.0 1.0 +10.0 1.0 66.0 67.0 65.3 64.0 70.0 64.0 54.0 0.0 +11.0 22.0 55.0 54.0 49.3 46.0 54.0 49.0 58.0 0.0 +6.0 1.0 71.0 79.0 67.4 65.0 69.0 66.0 58.0 0.0 +5.0 13.0 81.0 77.0 64.3 63.0 67.0 66.0 67.0 0.0 +6.0 3.0 75.0 71.0 67.7 64.0 71.0 66.0 55.0 0.0 +4.0 12.0 59.0 58.0 57.7 54.0 59.0 57.0 61.0 0.0 +3.0 31.0 64.0 68.0 55.9 55.0 59.0 56.0 56.0 0.0 +12.0 14.0 43.0 40.0 45.4 45.0 48.0 45.0 49.0 0.0 +8.0 5.0 75.0 80.0 77.3 75.0 81.0 78.0 71.0 0.0 +5.0 4.0 87.0 74.0 62.3 59.0 65.0 64.0 61.0 0.0 +12.0 31.0 48.0 57.0 45.5 42.0 48.0 47.0 57.0 0.0 +1.0 21.0 48.0 52.0 47.8 43.0 51.0 46.0 57.0 0.0 +7.0 10.0 74.0 71.0 75.1 71.0 77.0 76.0 95.0 0.0 +3.0 15.0 54.0 49.0 53.6 49.0 58.0 52.0 70.0 0.0 +4.0 19.0 77.0 89.0 59.0 59.0 63.0 59.0 61.0 0.0 +10.0 14.0 66.0 60.0 60.2 56.0 64.0 60.0 78.0 0.0 +4.0 15.0 59.0 59.0 58.3 58.0 61.0 60.0 40.0 0.0
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/feature_selection_result05 Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,262 @@ +month day temp_2 temp_1 average forecast_noaa forecast_acc forecast_under friend +9.0 19.0 68.0 69.0 69.7 65.0 74.0 71.0 88.0 +4.0 14.0 60.0 59.0 58.1 57.0 63.0 58.0 66.0 +7.0 30.0 85.0 88.0 77.3 75.0 79.0 77.0 70.0 +5.0 15.0 82.0 65.0 64.7 63.0 69.0 64.0 58.0 +1.0 18.0 54.0 50.0 47.5 44.0 48.0 49.0 58.0 +1.0 25.0 48.0 51.0 48.2 45.0 51.0 49.0 63.0 +11.0 25.0 49.0 52.0 48.6 45.0 52.0 47.0 41.0 +7.0 20.0 73.0 78.0 76.7 75.0 78.0 77.0 66.0 +12.0 17.0 39.0 35.0 45.2 43.0 47.0 46.0 38.0 +12.0 8.0 42.0 40.0 46.1 45.0 51.0 47.0 36.0 +12.0 28.0 42.0 47.0 45.3 41.0 49.0 44.0 58.0 +7.0 17.0 76.0 72.0 76.3 76.0 78.0 77.0 88.0 +7.0 7.0 69.0 76.0 74.4 73.0 77.0 74.0 72.0 +12.0 15.0 40.0 39.0 45.3 45.0 49.0 47.0 46.0 +6.0 27.0 71.0 78.0 72.2 70.0 74.0 72.0 84.0 +5.0 31.0 64.0 71.0 67.3 63.0 72.0 68.0 85.0 +1.0 20.0 54.0 48.0 47.7 44.0 52.0 49.0 61.0 +8.0 10.0 73.0 72.0 77.0 77.0 78.0 77.0 68.0 +3.0 23.0 56.0 57.0 54.7 50.0 58.0 55.0 70.0 +12.0 24.0 45.0 40.0 45.1 44.0 47.0 46.0 39.0 +1.0 19.0 50.0 54.0 47.6 47.0 49.0 48.0 53.0 +11.0 6.0 65.0 58.0 53.2 52.0 57.0 55.0 71.0 +4.0 17.0 60.0 68.0 58.6 58.0 62.0 59.0 54.0 +10.0 29.0 60.0 65.0 55.3 55.0 59.0 55.0 65.0 +2.0 1.0 48.0 47.0 48.8 46.0 49.0 49.0 51.0 +12.0 12.0 44.0 44.0 45.6 43.0 50.0 45.0 42.0 +5.0 30.0 64.0 64.0 67.1 64.0 70.0 66.0 69.0 +10.0 23.0 59.0 62.0 57.1 57.0 58.0 59.0 67.0 +9.0 30.0 68.0 66.0 65.7 64.0 67.0 65.0 74.0 +9.0 12.0 77.0 70.0 71.8 67.0 73.0 73.0 90.0 +11.0 2.0 59.0 57.0 54.2 54.0 58.0 55.0 70.0 +11.0 17.0 55.0 50.0 50.5 46.0 51.0 50.0 57.0 +3.0 3.0 58.0 55.0 51.8 49.0 54.0 50.0 71.0 +11.0 21.0 57.0 55.0 49.5 46.0 51.0 49.0 67.0 +12.0 27.0 42.0 42.0 45.2 41.0 50.0 47.0 47.0 +4.0 24.0 64.0 65.0 60.1 57.0 61.0 60.0 41.0 +5.0 20.0 64.0 63.0 65.6 63.0 70.0 64.0 73.0 +1.0 16.0 49.0 48.0 47.3 45.0 52.0 46.0 28.0 +12.0 7.0 40.0 42.0 46.3 44.0 51.0 46.0 62.0 +1.0 7.0 44.0 51.0 46.2 45.0 49.0 46.0 38.0 +9.0 24.0 67.0 64.0 68.0 65.0 71.0 66.0 64.0 +8.0 30.0 79.0 75.0 74.6 74.0 76.0 75.0 63.0 +1.0 11.0 50.0 52.0 46.7 42.0 48.0 48.0 39.0 +6.0 9.0 85.0 67.0 68.6 66.0 73.0 69.0 80.0 +9.0 22.0 67.0 68.0 68.7 65.0 70.0 69.0 56.0 +3.0 25.0 53.0 54.0 55.0 53.0 57.0 57.0 42.0 +10.0 24.0 62.0 62.0 56.8 52.0 61.0 57.0 70.0 +7.0 16.0 77.0 76.0 76.1 76.0 78.0 75.0 61.0 +7.0 1.0 74.0 73.0 73.1 71.0 75.0 72.0 93.0 +11.0 18.0 50.0 52.0 50.3 50.0 53.0 50.0 35.0 +9.0 3.0 75.0 70.0 73.9 71.0 75.0 73.0 68.0 +8.0 2.0 73.0 77.0 77.4 75.0 80.0 79.0 62.0 +4.0 5.0 69.0 60.0 56.6 52.0 58.0 56.0 72.0 +3.0 13.0 55.0 52.0 53.3 50.0 55.0 53.0 54.0 +8.0 28.0 81.0 79.0 75.0 71.0 77.0 76.0 85.0 +4.0 9.0 77.0 76.0 57.2 53.0 61.0 57.0 74.0 +5.0 26.0 66.0 66.0 66.5 64.0 70.0 65.0 85.0 +10.0 10.0 68.0 57.0 61.8 58.0 64.0 61.0 62.0 +4.0 10.0 76.0 66.0 57.4 57.0 60.0 57.0 60.0 +10.0 19.0 60.0 61.0 58.4 58.0 60.0 57.0 41.0 +3.0 12.0 56.0 55.0 53.1 52.0 58.0 53.0 65.0 +1.0 24.0 57.0 48.0 48.1 46.0 50.0 48.0 54.0 +2.0 7.0 53.0 49.0 49.2 46.0 51.0 48.0 63.0 +5.0 27.0 66.0 65.0 66.7 64.0 67.0 68.0 73.0 +5.0 5.0 74.0 60.0 62.5 58.0 66.0 62.0 56.0 +3.0 11.0 55.0 56.0 53.0 53.0 53.0 51.0 36.0 +10.0 22.0 62.0 59.0 57.4 56.0 59.0 58.0 44.0 +12.0 11.0 36.0 44.0 45.7 41.0 46.0 47.0 35.0 +5.0 8.0 77.0 82.0 63.2 62.0 65.0 63.0 83.0 +5.0 29.0 64.0 64.0 67.0 65.0 71.0 65.0 76.0 +12.0 13.0 44.0 43.0 45.5 41.0 47.0 46.0 46.0 +3.0 30.0 56.0 64.0 55.7 51.0 57.0 56.0 57.0 +11.0 8.0 61.0 63.0 52.7 49.0 57.0 52.0 49.0 +6.0 20.0 65.0 70.0 70.6 67.0 71.0 70.0 79.0 +11.0 9.0 63.0 71.0 52.4 48.0 56.0 52.0 42.0 +7.0 3.0 76.0 76.0 73.5 69.0 76.0 75.0 85.0 +10.0 9.0 64.0 68.0 62.1 58.0 65.0 63.0 55.0 +12.0 16.0 39.0 39.0 45.3 44.0 49.0 44.0 39.0 +9.0 16.0 79.0 71.0 70.7 70.0 74.0 71.0 52.0 +6.0 25.0 68.0 69.0 71.7 68.0 73.0 73.0 89.0 +9.0 13.0 70.0 74.0 71.5 71.0 75.0 70.0 82.0 +5.0 12.0 75.0 81.0 64.1 62.0 67.0 63.0 81.0 +2.0 8.0 49.0 51.0 49.3 49.0 52.0 50.0 34.0 +1.0 12.0 52.0 45.0 46.8 44.0 50.0 45.0 61.0 +8.0 13.0 80.0 87.0 76.8 73.0 79.0 78.0 73.0 +7.0 4.0 76.0 71.0 73.8 71.0 76.0 73.0 86.0 +4.0 25.0 65.0 55.0 60.3 56.0 64.0 61.0 77.0 +8.0 12.0 76.0 80.0 76.9 72.0 79.0 77.0 81.0 +9.0 21.0 71.0 67.0 69.0 65.0 70.0 70.0 76.0 +4.0 30.0 64.0 61.0 61.4 60.0 65.0 62.0 78.0 +12.0 5.0 49.0 46.0 46.6 43.0 50.0 45.0 65.0 +12.0 19.0 35.0 39.0 45.1 42.0 46.0 45.0 51.0 +9.0 23.0 68.0 67.0 68.3 67.0 69.0 67.0 61.0 +11.0 29.0 48.0 52.0 47.8 43.0 48.0 47.0 50.0 +6.0 16.0 60.0 67.0 69.8 68.0 72.0 71.0 87.0 +9.0 14.0 74.0 75.0 71.2 67.0 75.0 73.0 77.0 +9.0 6.0 68.0 68.0 73.3 73.0 76.0 75.0 79.0 +6.0 6.0 81.0 92.0 68.2 65.0 70.0 67.0 71.0 +9.0 8.0 68.0 67.0 72.8 69.0 77.0 73.0 56.0 +1.0 3.0 45.0 44.0 45.8 43.0 46.0 47.0 56.0 +4.0 28.0 60.0 61.0 61.0 56.0 65.0 62.0 73.0 +11.0 5.0 65.0 65.0 53.4 49.0 58.0 52.0 41.0 +9.0 7.0 68.0 68.0 73.0 72.0 78.0 71.0 70.0 +5.0 3.0 77.0 87.0 62.1 62.0 66.0 64.0 69.0 +10.0 31.0 65.0 117.0 54.8 51.0 59.0 56.0 62.0 +7.0 18.0 72.0 80.0 76.4 75.0 77.0 75.0 66.0 +11.0 15.0 55.0 57.0 51.0 47.0 54.0 51.0 46.0 +5.0 10.0 63.0 67.0 63.6 61.0 66.0 64.0 68.0 +3.0 18.0 53.0 58.0 54.0 51.0 57.0 54.0 56.0 +10.0 26.0 61.0 65.0 56.2 53.0 57.0 57.0 41.0 +1.0 30.0 56.0 52.0 48.6 45.0 51.0 48.0 47.0 +3.0 27.0 57.0 59.0 55.3 52.0 58.0 55.0 39.0 +11.0 3.0 57.0 57.0 53.9 53.0 54.0 54.0 35.0 +4.0 20.0 89.0 81.0 59.2 56.0 63.0 61.0 66.0 +7.0 24.0 71.0 75.0 77.1 76.0 78.0 78.0 75.0 +7.0 31.0 88.0 76.0 77.4 76.0 78.0 79.0 95.0 +5.0 16.0 65.0 57.0 64.8 61.0 65.0 65.0 53.0 +7.0 6.0 68.0 69.0 74.2 72.0 76.0 75.0 86.0 +9.0 27.0 76.0 77.0 66.8 66.0 67.0 68.0 64.0 +2.0 16.0 58.0 55.0 49.9 47.0 54.0 51.0 55.0 +12.0 4.0 50.0 49.0 46.8 45.0 47.0 47.0 53.0 +3.0 9.0 53.0 54.0 52.7 48.0 56.0 54.0 57.0 +11.0 14.0 59.0 55.0 51.2 49.0 53.0 53.0 42.0 +3.0 29.0 51.0 56.0 55.6 53.0 59.0 54.0 45.0 +7.0 8.0 76.0 68.0 74.6 72.0 79.0 75.0 77.0 +3.0 14.0 52.0 54.0 53.4 49.0 58.0 55.0 44.0 +6.0 11.0 65.0 67.0 69.0 69.0 72.0 71.0 87.0 +1.0 13.0 45.0 49.0 46.9 45.0 51.0 46.0 33.0 +2.0 5.0 49.0 49.0 49.1 47.0 50.0 49.0 45.0 +1.0 29.0 57.0 56.0 48.5 48.0 52.0 47.0 49.0 +6.0 22.0 76.0 73.0 71.0 66.0 71.0 72.0 78.0 +5.0 25.0 65.0 66.0 66.4 65.0 67.0 66.0 60.0 +9.0 28.0 77.0 69.0 66.5 66.0 68.0 66.0 62.0 +5.0 14.0 77.0 82.0 64.5 64.0 66.0 66.0 65.0 +8.0 14.0 87.0 90.0 76.7 75.0 78.0 78.0 65.0 +2.0 23.0 51.0 51.0 50.7 49.0 53.0 51.0 43.0 +4.0 8.0 68.0 77.0 57.1 57.0 61.0 57.0 41.0 +10.0 11.0 57.0 60.0 61.4 58.0 66.0 61.0 58.0 +6.0 30.0 79.0 74.0 72.8 71.0 76.0 72.0 87.0 +7.0 26.0 80.0 85.0 77.2 73.0 79.0 76.0 74.0 +5.0 6.0 60.0 68.0 62.8 61.0 64.0 61.0 64.0 +2.0 11.0 62.0 56.0 49.5 46.0 53.0 50.0 37.0 +4.0 2.0 73.0 71.0 56.2 55.0 58.0 58.0 45.0 +10.0 16.0 60.0 62.0 59.5 57.0 60.0 59.0 40.0 +7.0 28.0 79.0 83.0 77.3 76.0 80.0 78.0 76.0 +5.0 19.0 71.0 64.0 65.4 62.0 68.0 67.0 56.0 +1.0 27.0 54.0 56.0 48.4 45.0 51.0 49.0 54.0 +12.0 25.0 40.0 41.0 45.1 42.0 49.0 44.0 31.0 +5.0 24.0 66.0 65.0 66.2 66.0 71.0 66.0 67.0 +11.0 4.0 57.0 65.0 53.7 49.0 55.0 54.0 38.0 +1.0 5.0 41.0 40.0 46.0 46.0 46.0 46.0 41.0 +1.0 1.0 45.0 45.0 45.6 43.0 50.0 44.0 29.0 +11.0 26.0 52.0 52.0 48.4 48.0 50.0 47.0 58.0 +11.0 12.0 64.0 63.0 51.7 50.0 52.0 52.0 63.0 +11.0 30.0 52.0 52.0 47.6 47.0 52.0 49.0 44.0 +4.0 13.0 58.0 60.0 57.9 55.0 62.0 56.0 77.0 +8.0 23.0 84.0 81.0 75.7 73.0 78.0 77.0 89.0 +7.0 14.0 77.0 75.0 75.8 74.0 76.0 77.0 77.0 +11.0 13.0 63.0 59.0 51.4 48.0 56.0 50.0 64.0 +8.0 9.0 72.0 73.0 77.1 77.0 80.0 79.0 94.0 +8.0 4.0 73.0 75.0 77.3 73.0 79.0 78.0 66.0 +4.0 16.0 59.0 60.0 58.5 56.0 60.0 59.0 59.0 +6.0 23.0 73.0 75.0 71.3 68.0 72.0 71.0 56.0 +4.0 11.0 66.0 59.0 57.6 56.0 60.0 58.0 40.0 +2.0 6.0 49.0 53.0 49.1 47.0 53.0 49.0 56.0 +8.0 6.0 80.0 79.0 77.2 76.0 81.0 79.0 60.0 +3.0 5.0 59.0 57.0 52.1 49.0 53.0 51.0 46.0 +6.0 2.0 79.0 75.0 67.6 64.0 71.0 67.0 77.0 +9.0 20.0 69.0 71.0 69.4 67.0 73.0 69.0 81.0 +2.0 19.0 57.0 53.0 50.2 50.0 52.0 51.0 42.0 +2.0 2.0 47.0 46.0 48.8 48.0 50.0 50.0 56.0 +7.0 22.0 82.0 81.0 76.9 72.0 77.0 76.0 70.0 +11.0 24.0 54.0 49.0 48.9 47.0 53.0 48.0 29.0 +1.0 28.0 56.0 57.0 48.4 44.0 52.0 48.0 34.0 +10.0 18.0 60.0 60.0 58.8 54.0 60.0 57.0 53.0 +9.0 4.0 70.0 67.0 73.7 72.0 77.0 75.0 64.0 +10.0 4.0 65.0 61.0 64.1 62.0 69.0 65.0 60.0 +6.0 14.0 70.0 66.0 69.5 66.0 71.0 69.0 85.0 +11.0 11.0 65.0 64.0 51.9 50.0 53.0 52.0 55.0 +5.0 21.0 63.0 66.0 65.7 62.0 67.0 65.0 49.0 +3.0 6.0 57.0 64.0 52.2 52.0 53.0 51.0 49.0 +5.0 18.0 60.0 71.0 65.2 61.0 68.0 65.0 56.0 +5.0 11.0 67.0 75.0 63.8 62.0 68.0 63.0 60.0 +1.0 9.0 45.0 48.0 46.4 46.0 50.0 45.0 47.0 +3.0 8.0 60.0 53.0 52.5 48.0 56.0 51.0 70.0 +1.0 15.0 55.0 49.0 47.1 46.0 51.0 46.0 65.0 +6.0 8.0 86.0 85.0 68.5 67.0 70.0 69.0 81.0 +2.0 10.0 57.0 62.0 49.4 48.0 50.0 49.0 30.0 +12.0 3.0 46.0 50.0 47.0 42.0 52.0 47.0 58.0 +10.0 27.0 65.0 58.0 55.9 51.0 60.0 55.0 39.0 +8.0 7.0 79.0 72.0 77.2 74.0 78.0 77.0 95.0 +11.0 16.0 57.0 55.0 50.7 50.0 51.0 49.0 34.0 +9.0 10.0 72.0 74.0 72.3 70.0 77.0 74.0 91.0 +7.0 29.0 83.0 85.0 77.3 77.0 80.0 79.0 77.0 +8.0 3.0 77.0 73.0 77.3 77.0 81.0 77.0 93.0 +12.0 1.0 52.0 52.0 47.4 44.0 48.0 49.0 39.0 +9.0 25.0 64.0 67.0 67.6 64.0 72.0 67.0 62.0 +12.0 23.0 49.0 45.0 45.1 45.0 49.0 44.0 35.0 +12.0 2.0 52.0 46.0 47.2 46.0 51.0 49.0 41.0 +10.0 13.0 62.0 66.0 60.6 60.0 62.0 60.0 57.0 +7.0 23.0 81.0 71.0 77.0 75.0 81.0 76.0 86.0 +6.0 13.0 65.0 70.0 69.3 66.0 72.0 69.0 79.0 +2.0 15.0 55.0 58.0 49.9 46.0 52.0 49.0 53.0 +8.0 8.0 72.0 72.0 77.1 76.0 78.0 77.0 65.0 +7.0 12.0 74.0 74.0 75.4 74.0 77.0 77.0 71.0 +10.0 3.0 63.0 65.0 64.5 63.0 68.0 65.0 49.0 +4.0 18.0 68.0 77.0 58.8 55.0 59.0 57.0 39.0 +2.0 25.0 60.0 59.0 50.9 49.0 51.0 49.0 35.0 +1.0 2.0 44.0 45.0 45.7 41.0 50.0 44.0 61.0 +2.0 21.0 51.0 53.0 50.5 49.0 54.0 52.0 46.0 +3.0 24.0 57.0 53.0 54.9 54.0 56.0 56.0 72.0 +7.0 27.0 85.0 79.0 77.3 73.0 78.0 79.0 79.0 +2.0 4.0 51.0 49.0 49.0 44.0 54.0 51.0 44.0 +10.0 7.0 66.0 63.0 62.9 62.0 67.0 64.0 78.0 +4.0 4.0 63.0 69.0 56.5 54.0 59.0 56.0 45.0 +2.0 24.0 51.0 60.0 50.8 47.0 53.0 50.0 46.0 +10.0 8.0 63.0 64.0 62.5 60.0 65.0 61.0 73.0 +9.0 15.0 75.0 79.0 71.0 66.0 76.0 69.0 64.0 +1.0 14.0 49.0 55.0 47.0 43.0 47.0 46.0 58.0 +4.0 1.0 68.0 73.0 56.0 54.0 59.0 55.0 41.0 +10.0 17.0 62.0 60.0 59.1 57.0 63.0 59.0 62.0 +6.0 18.0 71.0 67.0 70.2 67.0 75.0 69.0 77.0 +12.0 26.0 41.0 42.0 45.2 45.0 48.0 46.0 58.0 +5.0 17.0 57.0 60.0 65.0 62.0 65.0 65.0 55.0 +11.0 20.0 55.0 57.0 49.8 47.0 54.0 48.0 30.0 +12.0 18.0 35.0 35.0 45.2 44.0 46.0 46.0 36.0 +9.0 17.0 71.0 75.0 70.3 66.0 73.0 70.0 84.0 +2.0 26.0 59.0 61.0 51.1 48.0 56.0 53.0 65.0 +2.0 22.0 53.0 51.0 50.6 46.0 51.0 50.0 59.0 +6.0 26.0 69.0 71.0 71.9 67.0 74.0 72.0 70.0 +7.0 11.0 71.0 74.0 75.3 74.0 79.0 75.0 71.0 +12.0 30.0 48.0 48.0 45.4 44.0 46.0 44.0 42.0 +7.0 9.0 68.0 74.0 74.9 70.0 79.0 76.0 60.0 +6.0 21.0 70.0 76.0 70.8 68.0 75.0 71.0 57.0 +3.0 2.0 54.0 58.0 51.6 47.0 54.0 52.0 37.0 +2.0 20.0 53.0 51.0 50.4 48.0 55.0 51.0 43.0 +9.0 9.0 67.0 72.0 72.6 68.0 77.0 71.0 78.0 +9.0 26.0 67.0 76.0 67.2 64.0 69.0 69.0 74.0 +1.0 22.0 52.0 52.0 47.9 47.0 48.0 48.0 60.0 +11.0 27.0 52.0 53.0 48.2 48.0 49.0 49.0 53.0 +6.0 12.0 67.0 65.0 69.1 65.0 73.0 70.0 83.0 +10.0 20.0 61.0 58.0 58.1 58.0 59.0 58.0 43.0 +7.0 13.0 74.0 77.0 75.6 74.0 78.0 76.0 56.0 +11.0 7.0 58.0 61.0 52.9 51.0 56.0 51.0 35.0 +10.0 1.0 66.0 67.0 65.3 64.0 70.0 64.0 54.0 +11.0 22.0 55.0 54.0 49.3 46.0 54.0 49.0 58.0 +6.0 1.0 71.0 79.0 67.4 65.0 69.0 66.0 58.0 +5.0 13.0 81.0 77.0 64.3 63.0 67.0 66.0 67.0 +6.0 3.0 75.0 71.0 67.7 64.0 71.0 66.0 55.0 +4.0 12.0 59.0 58.0 57.7 54.0 59.0 57.0 61.0 +3.0 31.0 64.0 68.0 55.9 55.0 59.0 56.0 56.0 +12.0 14.0 43.0 40.0 45.4 45.0 48.0 45.0 49.0 +8.0 5.0 75.0 80.0 77.3 75.0 81.0 78.0 71.0 +5.0 4.0 87.0 74.0 62.3 59.0 65.0 64.0 61.0 +12.0 31.0 48.0 57.0 45.5 42.0 48.0 47.0 57.0 +1.0 21.0 48.0 52.0 47.8 43.0 51.0 46.0 57.0 +7.0 10.0 74.0 71.0 75.1 71.0 77.0 76.0 95.0 +3.0 15.0 54.0 49.0 53.6 49.0 58.0 52.0 70.0 +4.0 19.0 77.0 89.0 59.0 59.0 63.0 59.0 61.0 +10.0 14.0 66.0 60.0 60.2 56.0 64.0 60.0 78.0 +4.0 15.0 59.0 59.0 58.3 58.0 61.0 60.0 40.0
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/feature_selection_result06 Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,262 @@ +month day temp_2 temp_1 average forecast_noaa forecast_acc forecast_under friend +9.0 19.0 68.0 69.0 69.7 65.0 74.0 71.0 88.0 +4.0 14.0 60.0 59.0 58.1 57.0 63.0 58.0 66.0 +7.0 30.0 85.0 88.0 77.3 75.0 79.0 77.0 70.0 +5.0 15.0 82.0 65.0 64.7 63.0 69.0 64.0 58.0 +1.0 18.0 54.0 50.0 47.5 44.0 48.0 49.0 58.0 +1.0 25.0 48.0 51.0 48.2 45.0 51.0 49.0 63.0 +11.0 25.0 49.0 52.0 48.6 45.0 52.0 47.0 41.0 +7.0 20.0 73.0 78.0 76.7 75.0 78.0 77.0 66.0 +12.0 17.0 39.0 35.0 45.2 43.0 47.0 46.0 38.0 +12.0 8.0 42.0 40.0 46.1 45.0 51.0 47.0 36.0 +12.0 28.0 42.0 47.0 45.3 41.0 49.0 44.0 58.0 +7.0 17.0 76.0 72.0 76.3 76.0 78.0 77.0 88.0 +7.0 7.0 69.0 76.0 74.4 73.0 77.0 74.0 72.0 +12.0 15.0 40.0 39.0 45.3 45.0 49.0 47.0 46.0 +6.0 27.0 71.0 78.0 72.2 70.0 74.0 72.0 84.0 +5.0 31.0 64.0 71.0 67.3 63.0 72.0 68.0 85.0 +1.0 20.0 54.0 48.0 47.7 44.0 52.0 49.0 61.0 +8.0 10.0 73.0 72.0 77.0 77.0 78.0 77.0 68.0 +3.0 23.0 56.0 57.0 54.7 50.0 58.0 55.0 70.0 +12.0 24.0 45.0 40.0 45.1 44.0 47.0 46.0 39.0 +1.0 19.0 50.0 54.0 47.6 47.0 49.0 48.0 53.0 +11.0 6.0 65.0 58.0 53.2 52.0 57.0 55.0 71.0 +4.0 17.0 60.0 68.0 58.6 58.0 62.0 59.0 54.0 +10.0 29.0 60.0 65.0 55.3 55.0 59.0 55.0 65.0 +2.0 1.0 48.0 47.0 48.8 46.0 49.0 49.0 51.0 +12.0 12.0 44.0 44.0 45.6 43.0 50.0 45.0 42.0 +5.0 30.0 64.0 64.0 67.1 64.0 70.0 66.0 69.0 +10.0 23.0 59.0 62.0 57.1 57.0 58.0 59.0 67.0 +9.0 30.0 68.0 66.0 65.7 64.0 67.0 65.0 74.0 +9.0 12.0 77.0 70.0 71.8 67.0 73.0 73.0 90.0 +11.0 2.0 59.0 57.0 54.2 54.0 58.0 55.0 70.0 +11.0 17.0 55.0 50.0 50.5 46.0 51.0 50.0 57.0 +3.0 3.0 58.0 55.0 51.8 49.0 54.0 50.0 71.0 +11.0 21.0 57.0 55.0 49.5 46.0 51.0 49.0 67.0 +12.0 27.0 42.0 42.0 45.2 41.0 50.0 47.0 47.0 +4.0 24.0 64.0 65.0 60.1 57.0 61.0 60.0 41.0 +5.0 20.0 64.0 63.0 65.6 63.0 70.0 64.0 73.0 +1.0 16.0 49.0 48.0 47.3 45.0 52.0 46.0 28.0 +12.0 7.0 40.0 42.0 46.3 44.0 51.0 46.0 62.0 +1.0 7.0 44.0 51.0 46.2 45.0 49.0 46.0 38.0 +9.0 24.0 67.0 64.0 68.0 65.0 71.0 66.0 64.0 +8.0 30.0 79.0 75.0 74.6 74.0 76.0 75.0 63.0 +1.0 11.0 50.0 52.0 46.7 42.0 48.0 48.0 39.0 +6.0 9.0 85.0 67.0 68.6 66.0 73.0 69.0 80.0 +9.0 22.0 67.0 68.0 68.7 65.0 70.0 69.0 56.0 +3.0 25.0 53.0 54.0 55.0 53.0 57.0 57.0 42.0 +10.0 24.0 62.0 62.0 56.8 52.0 61.0 57.0 70.0 +7.0 16.0 77.0 76.0 76.1 76.0 78.0 75.0 61.0 +7.0 1.0 74.0 73.0 73.1 71.0 75.0 72.0 93.0 +11.0 18.0 50.0 52.0 50.3 50.0 53.0 50.0 35.0 +9.0 3.0 75.0 70.0 73.9 71.0 75.0 73.0 68.0 +8.0 2.0 73.0 77.0 77.4 75.0 80.0 79.0 62.0 +4.0 5.0 69.0 60.0 56.6 52.0 58.0 56.0 72.0 +3.0 13.0 55.0 52.0 53.3 50.0 55.0 53.0 54.0 +8.0 28.0 81.0 79.0 75.0 71.0 77.0 76.0 85.0 +4.0 9.0 77.0 76.0 57.2 53.0 61.0 57.0 74.0 +5.0 26.0 66.0 66.0 66.5 64.0 70.0 65.0 85.0 +10.0 10.0 68.0 57.0 61.8 58.0 64.0 61.0 62.0 +4.0 10.0 76.0 66.0 57.4 57.0 60.0 57.0 60.0 +10.0 19.0 60.0 61.0 58.4 58.0 60.0 57.0 41.0 +3.0 12.0 56.0 55.0 53.1 52.0 58.0 53.0 65.0 +1.0 24.0 57.0 48.0 48.1 46.0 50.0 48.0 54.0 +2.0 7.0 53.0 49.0 49.2 46.0 51.0 48.0 63.0 +5.0 27.0 66.0 65.0 66.7 64.0 67.0 68.0 73.0 +5.0 5.0 74.0 60.0 62.5 58.0 66.0 62.0 56.0 +3.0 11.0 55.0 56.0 53.0 53.0 53.0 51.0 36.0 +10.0 22.0 62.0 59.0 57.4 56.0 59.0 58.0 44.0 +12.0 11.0 36.0 44.0 45.7 41.0 46.0 47.0 35.0 +5.0 8.0 77.0 82.0 63.2 62.0 65.0 63.0 83.0 +5.0 29.0 64.0 64.0 67.0 65.0 71.0 65.0 76.0 +12.0 13.0 44.0 43.0 45.5 41.0 47.0 46.0 46.0 +3.0 30.0 56.0 64.0 55.7 51.0 57.0 56.0 57.0 +11.0 8.0 61.0 63.0 52.7 49.0 57.0 52.0 49.0 +6.0 20.0 65.0 70.0 70.6 67.0 71.0 70.0 79.0 +11.0 9.0 63.0 71.0 52.4 48.0 56.0 52.0 42.0 +7.0 3.0 76.0 76.0 73.5 69.0 76.0 75.0 85.0 +10.0 9.0 64.0 68.0 62.1 58.0 65.0 63.0 55.0 +12.0 16.0 39.0 39.0 45.3 44.0 49.0 44.0 39.0 +9.0 16.0 79.0 71.0 70.7 70.0 74.0 71.0 52.0 +6.0 25.0 68.0 69.0 71.7 68.0 73.0 73.0 89.0 +9.0 13.0 70.0 74.0 71.5 71.0 75.0 70.0 82.0 +5.0 12.0 75.0 81.0 64.1 62.0 67.0 63.0 81.0 +2.0 8.0 49.0 51.0 49.3 49.0 52.0 50.0 34.0 +1.0 12.0 52.0 45.0 46.8 44.0 50.0 45.0 61.0 +8.0 13.0 80.0 87.0 76.8 73.0 79.0 78.0 73.0 +7.0 4.0 76.0 71.0 73.8 71.0 76.0 73.0 86.0 +4.0 25.0 65.0 55.0 60.3 56.0 64.0 61.0 77.0 +8.0 12.0 76.0 80.0 76.9 72.0 79.0 77.0 81.0 +9.0 21.0 71.0 67.0 69.0 65.0 70.0 70.0 76.0 +4.0 30.0 64.0 61.0 61.4 60.0 65.0 62.0 78.0 +12.0 5.0 49.0 46.0 46.6 43.0 50.0 45.0 65.0 +12.0 19.0 35.0 39.0 45.1 42.0 46.0 45.0 51.0 +9.0 23.0 68.0 67.0 68.3 67.0 69.0 67.0 61.0 +11.0 29.0 48.0 52.0 47.8 43.0 48.0 47.0 50.0 +6.0 16.0 60.0 67.0 69.8 68.0 72.0 71.0 87.0 +9.0 14.0 74.0 75.0 71.2 67.0 75.0 73.0 77.0 +9.0 6.0 68.0 68.0 73.3 73.0 76.0 75.0 79.0 +6.0 6.0 81.0 92.0 68.2 65.0 70.0 67.0 71.0 +9.0 8.0 68.0 67.0 72.8 69.0 77.0 73.0 56.0 +1.0 3.0 45.0 44.0 45.8 43.0 46.0 47.0 56.0 +4.0 28.0 60.0 61.0 61.0 56.0 65.0 62.0 73.0 +11.0 5.0 65.0 65.0 53.4 49.0 58.0 52.0 41.0 +9.0 7.0 68.0 68.0 73.0 72.0 78.0 71.0 70.0 +5.0 3.0 77.0 87.0 62.1 62.0 66.0 64.0 69.0 +10.0 31.0 65.0 117.0 54.8 51.0 59.0 56.0 62.0 +7.0 18.0 72.0 80.0 76.4 75.0 77.0 75.0 66.0 +11.0 15.0 55.0 57.0 51.0 47.0 54.0 51.0 46.0 +5.0 10.0 63.0 67.0 63.6 61.0 66.0 64.0 68.0 +3.0 18.0 53.0 58.0 54.0 51.0 57.0 54.0 56.0 +10.0 26.0 61.0 65.0 56.2 53.0 57.0 57.0 41.0 +1.0 30.0 56.0 52.0 48.6 45.0 51.0 48.0 47.0 +3.0 27.0 57.0 59.0 55.3 52.0 58.0 55.0 39.0 +11.0 3.0 57.0 57.0 53.9 53.0 54.0 54.0 35.0 +4.0 20.0 89.0 81.0 59.2 56.0 63.0 61.0 66.0 +7.0 24.0 71.0 75.0 77.1 76.0 78.0 78.0 75.0 +7.0 31.0 88.0 76.0 77.4 76.0 78.0 79.0 95.0 +5.0 16.0 65.0 57.0 64.8 61.0 65.0 65.0 53.0 +7.0 6.0 68.0 69.0 74.2 72.0 76.0 75.0 86.0 +9.0 27.0 76.0 77.0 66.8 66.0 67.0 68.0 64.0 +2.0 16.0 58.0 55.0 49.9 47.0 54.0 51.0 55.0 +12.0 4.0 50.0 49.0 46.8 45.0 47.0 47.0 53.0 +3.0 9.0 53.0 54.0 52.7 48.0 56.0 54.0 57.0 +11.0 14.0 59.0 55.0 51.2 49.0 53.0 53.0 42.0 +3.0 29.0 51.0 56.0 55.6 53.0 59.0 54.0 45.0 +7.0 8.0 76.0 68.0 74.6 72.0 79.0 75.0 77.0 +3.0 14.0 52.0 54.0 53.4 49.0 58.0 55.0 44.0 +6.0 11.0 65.0 67.0 69.0 69.0 72.0 71.0 87.0 +1.0 13.0 45.0 49.0 46.9 45.0 51.0 46.0 33.0 +2.0 5.0 49.0 49.0 49.1 47.0 50.0 49.0 45.0 +1.0 29.0 57.0 56.0 48.5 48.0 52.0 47.0 49.0 +6.0 22.0 76.0 73.0 71.0 66.0 71.0 72.0 78.0 +5.0 25.0 65.0 66.0 66.4 65.0 67.0 66.0 60.0 +9.0 28.0 77.0 69.0 66.5 66.0 68.0 66.0 62.0 +5.0 14.0 77.0 82.0 64.5 64.0 66.0 66.0 65.0 +8.0 14.0 87.0 90.0 76.7 75.0 78.0 78.0 65.0 +2.0 23.0 51.0 51.0 50.7 49.0 53.0 51.0 43.0 +4.0 8.0 68.0 77.0 57.1 57.0 61.0 57.0 41.0 +10.0 11.0 57.0 60.0 61.4 58.0 66.0 61.0 58.0 +6.0 30.0 79.0 74.0 72.8 71.0 76.0 72.0 87.0 +7.0 26.0 80.0 85.0 77.2 73.0 79.0 76.0 74.0 +5.0 6.0 60.0 68.0 62.8 61.0 64.0 61.0 64.0 +2.0 11.0 62.0 56.0 49.5 46.0 53.0 50.0 37.0 +4.0 2.0 73.0 71.0 56.2 55.0 58.0 58.0 45.0 +10.0 16.0 60.0 62.0 59.5 57.0 60.0 59.0 40.0 +7.0 28.0 79.0 83.0 77.3 76.0 80.0 78.0 76.0 +5.0 19.0 71.0 64.0 65.4 62.0 68.0 67.0 56.0 +1.0 27.0 54.0 56.0 48.4 45.0 51.0 49.0 54.0 +12.0 25.0 40.0 41.0 45.1 42.0 49.0 44.0 31.0 +5.0 24.0 66.0 65.0 66.2 66.0 71.0 66.0 67.0 +11.0 4.0 57.0 65.0 53.7 49.0 55.0 54.0 38.0 +1.0 5.0 41.0 40.0 46.0 46.0 46.0 46.0 41.0 +1.0 1.0 45.0 45.0 45.6 43.0 50.0 44.0 29.0 +11.0 26.0 52.0 52.0 48.4 48.0 50.0 47.0 58.0 +11.0 12.0 64.0 63.0 51.7 50.0 52.0 52.0 63.0 +11.0 30.0 52.0 52.0 47.6 47.0 52.0 49.0 44.0 +4.0 13.0 58.0 60.0 57.9 55.0 62.0 56.0 77.0 +8.0 23.0 84.0 81.0 75.7 73.0 78.0 77.0 89.0 +7.0 14.0 77.0 75.0 75.8 74.0 76.0 77.0 77.0 +11.0 13.0 63.0 59.0 51.4 48.0 56.0 50.0 64.0 +8.0 9.0 72.0 73.0 77.1 77.0 80.0 79.0 94.0 +8.0 4.0 73.0 75.0 77.3 73.0 79.0 78.0 66.0 +4.0 16.0 59.0 60.0 58.5 56.0 60.0 59.0 59.0 +6.0 23.0 73.0 75.0 71.3 68.0 72.0 71.0 56.0 +4.0 11.0 66.0 59.0 57.6 56.0 60.0 58.0 40.0 +2.0 6.0 49.0 53.0 49.1 47.0 53.0 49.0 56.0 +8.0 6.0 80.0 79.0 77.2 76.0 81.0 79.0 60.0 +3.0 5.0 59.0 57.0 52.1 49.0 53.0 51.0 46.0 +6.0 2.0 79.0 75.0 67.6 64.0 71.0 67.0 77.0 +9.0 20.0 69.0 71.0 69.4 67.0 73.0 69.0 81.0 +2.0 19.0 57.0 53.0 50.2 50.0 52.0 51.0 42.0 +2.0 2.0 47.0 46.0 48.8 48.0 50.0 50.0 56.0 +7.0 22.0 82.0 81.0 76.9 72.0 77.0 76.0 70.0 +11.0 24.0 54.0 49.0 48.9 47.0 53.0 48.0 29.0 +1.0 28.0 56.0 57.0 48.4 44.0 52.0 48.0 34.0 +10.0 18.0 60.0 60.0 58.8 54.0 60.0 57.0 53.0 +9.0 4.0 70.0 67.0 73.7 72.0 77.0 75.0 64.0 +10.0 4.0 65.0 61.0 64.1 62.0 69.0 65.0 60.0 +6.0 14.0 70.0 66.0 69.5 66.0 71.0 69.0 85.0 +11.0 11.0 65.0 64.0 51.9 50.0 53.0 52.0 55.0 +5.0 21.0 63.0 66.0 65.7 62.0 67.0 65.0 49.0 +3.0 6.0 57.0 64.0 52.2 52.0 53.0 51.0 49.0 +5.0 18.0 60.0 71.0 65.2 61.0 68.0 65.0 56.0 +5.0 11.0 67.0 75.0 63.8 62.0 68.0 63.0 60.0 +1.0 9.0 45.0 48.0 46.4 46.0 50.0 45.0 47.0 +3.0 8.0 60.0 53.0 52.5 48.0 56.0 51.0 70.0 +1.0 15.0 55.0 49.0 47.1 46.0 51.0 46.0 65.0 +6.0 8.0 86.0 85.0 68.5 67.0 70.0 69.0 81.0 +2.0 10.0 57.0 62.0 49.4 48.0 50.0 49.0 30.0 +12.0 3.0 46.0 50.0 47.0 42.0 52.0 47.0 58.0 +10.0 27.0 65.0 58.0 55.9 51.0 60.0 55.0 39.0 +8.0 7.0 79.0 72.0 77.2 74.0 78.0 77.0 95.0 +11.0 16.0 57.0 55.0 50.7 50.0 51.0 49.0 34.0 +9.0 10.0 72.0 74.0 72.3 70.0 77.0 74.0 91.0 +7.0 29.0 83.0 85.0 77.3 77.0 80.0 79.0 77.0 +8.0 3.0 77.0 73.0 77.3 77.0 81.0 77.0 93.0 +12.0 1.0 52.0 52.0 47.4 44.0 48.0 49.0 39.0 +9.0 25.0 64.0 67.0 67.6 64.0 72.0 67.0 62.0 +12.0 23.0 49.0 45.0 45.1 45.0 49.0 44.0 35.0 +12.0 2.0 52.0 46.0 47.2 46.0 51.0 49.0 41.0 +10.0 13.0 62.0 66.0 60.6 60.0 62.0 60.0 57.0 +7.0 23.0 81.0 71.0 77.0 75.0 81.0 76.0 86.0 +6.0 13.0 65.0 70.0 69.3 66.0 72.0 69.0 79.0 +2.0 15.0 55.0 58.0 49.9 46.0 52.0 49.0 53.0 +8.0 8.0 72.0 72.0 77.1 76.0 78.0 77.0 65.0 +7.0 12.0 74.0 74.0 75.4 74.0 77.0 77.0 71.0 +10.0 3.0 63.0 65.0 64.5 63.0 68.0 65.0 49.0 +4.0 18.0 68.0 77.0 58.8 55.0 59.0 57.0 39.0 +2.0 25.0 60.0 59.0 50.9 49.0 51.0 49.0 35.0 +1.0 2.0 44.0 45.0 45.7 41.0 50.0 44.0 61.0 +2.0 21.0 51.0 53.0 50.5 49.0 54.0 52.0 46.0 +3.0 24.0 57.0 53.0 54.9 54.0 56.0 56.0 72.0 +7.0 27.0 85.0 79.0 77.3 73.0 78.0 79.0 79.0 +2.0 4.0 51.0 49.0 49.0 44.0 54.0 51.0 44.0 +10.0 7.0 66.0 63.0 62.9 62.0 67.0 64.0 78.0 +4.0 4.0 63.0 69.0 56.5 54.0 59.0 56.0 45.0 +2.0 24.0 51.0 60.0 50.8 47.0 53.0 50.0 46.0 +10.0 8.0 63.0 64.0 62.5 60.0 65.0 61.0 73.0 +9.0 15.0 75.0 79.0 71.0 66.0 76.0 69.0 64.0 +1.0 14.0 49.0 55.0 47.0 43.0 47.0 46.0 58.0 +4.0 1.0 68.0 73.0 56.0 54.0 59.0 55.0 41.0 +10.0 17.0 62.0 60.0 59.1 57.0 63.0 59.0 62.0 +6.0 18.0 71.0 67.0 70.2 67.0 75.0 69.0 77.0 +12.0 26.0 41.0 42.0 45.2 45.0 48.0 46.0 58.0 +5.0 17.0 57.0 60.0 65.0 62.0 65.0 65.0 55.0 +11.0 20.0 55.0 57.0 49.8 47.0 54.0 48.0 30.0 +12.0 18.0 35.0 35.0 45.2 44.0 46.0 46.0 36.0 +9.0 17.0 71.0 75.0 70.3 66.0 73.0 70.0 84.0 +2.0 26.0 59.0 61.0 51.1 48.0 56.0 53.0 65.0 +2.0 22.0 53.0 51.0 50.6 46.0 51.0 50.0 59.0 +6.0 26.0 69.0 71.0 71.9 67.0 74.0 72.0 70.0 +7.0 11.0 71.0 74.0 75.3 74.0 79.0 75.0 71.0 +12.0 30.0 48.0 48.0 45.4 44.0 46.0 44.0 42.0 +7.0 9.0 68.0 74.0 74.9 70.0 79.0 76.0 60.0 +6.0 21.0 70.0 76.0 70.8 68.0 75.0 71.0 57.0 +3.0 2.0 54.0 58.0 51.6 47.0 54.0 52.0 37.0 +2.0 20.0 53.0 51.0 50.4 48.0 55.0 51.0 43.0 +9.0 9.0 67.0 72.0 72.6 68.0 77.0 71.0 78.0 +9.0 26.0 67.0 76.0 67.2 64.0 69.0 69.0 74.0 +1.0 22.0 52.0 52.0 47.9 47.0 48.0 48.0 60.0 +11.0 27.0 52.0 53.0 48.2 48.0 49.0 49.0 53.0 +6.0 12.0 67.0 65.0 69.1 65.0 73.0 70.0 83.0 +10.0 20.0 61.0 58.0 58.1 58.0 59.0 58.0 43.0 +7.0 13.0 74.0 77.0 75.6 74.0 78.0 76.0 56.0 +11.0 7.0 58.0 61.0 52.9 51.0 56.0 51.0 35.0 +10.0 1.0 66.0 67.0 65.3 64.0 70.0 64.0 54.0 +11.0 22.0 55.0 54.0 49.3 46.0 54.0 49.0 58.0 +6.0 1.0 71.0 79.0 67.4 65.0 69.0 66.0 58.0 +5.0 13.0 81.0 77.0 64.3 63.0 67.0 66.0 67.0 +6.0 3.0 75.0 71.0 67.7 64.0 71.0 66.0 55.0 +4.0 12.0 59.0 58.0 57.7 54.0 59.0 57.0 61.0 +3.0 31.0 64.0 68.0 55.9 55.0 59.0 56.0 56.0 +12.0 14.0 43.0 40.0 45.4 45.0 48.0 45.0 49.0 +8.0 5.0 75.0 80.0 77.3 75.0 81.0 78.0 71.0 +5.0 4.0 87.0 74.0 62.3 59.0 65.0 64.0 61.0 +12.0 31.0 48.0 57.0 45.5 42.0 48.0 47.0 57.0 +1.0 21.0 48.0 52.0 47.8 43.0 51.0 46.0 57.0 +7.0 10.0 74.0 71.0 75.1 71.0 77.0 76.0 95.0 +3.0 15.0 54.0 49.0 53.6 49.0 58.0 52.0 70.0 +4.0 19.0 77.0 89.0 59.0 59.0 63.0 59.0 61.0 +10.0 14.0 66.0 60.0 60.2 56.0 64.0 60.0 78.0 +4.0 15.0 59.0 59.0 58.3 58.0 61.0 60.0 40.0
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/feature_selection_result07 Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,262 @@ +month day temp_2 temp_1 average forecast_noaa forecast_acc forecast_under friend +9.0 19.0 68.0 69.0 69.7 65.0 74.0 71.0 88.0 +4.0 14.0 60.0 59.0 58.1 57.0 63.0 58.0 66.0 +7.0 30.0 85.0 88.0 77.3 75.0 79.0 77.0 70.0 +5.0 15.0 82.0 65.0 64.7 63.0 69.0 64.0 58.0 +1.0 18.0 54.0 50.0 47.5 44.0 48.0 49.0 58.0 +1.0 25.0 48.0 51.0 48.2 45.0 51.0 49.0 63.0 +11.0 25.0 49.0 52.0 48.6 45.0 52.0 47.0 41.0 +7.0 20.0 73.0 78.0 76.7 75.0 78.0 77.0 66.0 +12.0 17.0 39.0 35.0 45.2 43.0 47.0 46.0 38.0 +12.0 8.0 42.0 40.0 46.1 45.0 51.0 47.0 36.0 +12.0 28.0 42.0 47.0 45.3 41.0 49.0 44.0 58.0 +7.0 17.0 76.0 72.0 76.3 76.0 78.0 77.0 88.0 +7.0 7.0 69.0 76.0 74.4 73.0 77.0 74.0 72.0 +12.0 15.0 40.0 39.0 45.3 45.0 49.0 47.0 46.0 +6.0 27.0 71.0 78.0 72.2 70.0 74.0 72.0 84.0 +5.0 31.0 64.0 71.0 67.3 63.0 72.0 68.0 85.0 +1.0 20.0 54.0 48.0 47.7 44.0 52.0 49.0 61.0 +8.0 10.0 73.0 72.0 77.0 77.0 78.0 77.0 68.0 +3.0 23.0 56.0 57.0 54.7 50.0 58.0 55.0 70.0 +12.0 24.0 45.0 40.0 45.1 44.0 47.0 46.0 39.0 +1.0 19.0 50.0 54.0 47.6 47.0 49.0 48.0 53.0 +11.0 6.0 65.0 58.0 53.2 52.0 57.0 55.0 71.0 +4.0 17.0 60.0 68.0 58.6 58.0 62.0 59.0 54.0 +10.0 29.0 60.0 65.0 55.3 55.0 59.0 55.0 65.0 +2.0 1.0 48.0 47.0 48.8 46.0 49.0 49.0 51.0 +12.0 12.0 44.0 44.0 45.6 43.0 50.0 45.0 42.0 +5.0 30.0 64.0 64.0 67.1 64.0 70.0 66.0 69.0 +10.0 23.0 59.0 62.0 57.1 57.0 58.0 59.0 67.0 +9.0 30.0 68.0 66.0 65.7 64.0 67.0 65.0 74.0 +9.0 12.0 77.0 70.0 71.8 67.0 73.0 73.0 90.0 +11.0 2.0 59.0 57.0 54.2 54.0 58.0 55.0 70.0 +11.0 17.0 55.0 50.0 50.5 46.0 51.0 50.0 57.0 +3.0 3.0 58.0 55.0 51.8 49.0 54.0 50.0 71.0 +11.0 21.0 57.0 55.0 49.5 46.0 51.0 49.0 67.0 +12.0 27.0 42.0 42.0 45.2 41.0 50.0 47.0 47.0 +4.0 24.0 64.0 65.0 60.1 57.0 61.0 60.0 41.0 +5.0 20.0 64.0 63.0 65.6 63.0 70.0 64.0 73.0 +1.0 16.0 49.0 48.0 47.3 45.0 52.0 46.0 28.0 +12.0 7.0 40.0 42.0 46.3 44.0 51.0 46.0 62.0 +1.0 7.0 44.0 51.0 46.2 45.0 49.0 46.0 38.0 +9.0 24.0 67.0 64.0 68.0 65.0 71.0 66.0 64.0 +8.0 30.0 79.0 75.0 74.6 74.0 76.0 75.0 63.0 +1.0 11.0 50.0 52.0 46.7 42.0 48.0 48.0 39.0 +6.0 9.0 85.0 67.0 68.6 66.0 73.0 69.0 80.0 +9.0 22.0 67.0 68.0 68.7 65.0 70.0 69.0 56.0 +3.0 25.0 53.0 54.0 55.0 53.0 57.0 57.0 42.0 +10.0 24.0 62.0 62.0 56.8 52.0 61.0 57.0 70.0 +7.0 16.0 77.0 76.0 76.1 76.0 78.0 75.0 61.0 +7.0 1.0 74.0 73.0 73.1 71.0 75.0 72.0 93.0 +11.0 18.0 50.0 52.0 50.3 50.0 53.0 50.0 35.0 +9.0 3.0 75.0 70.0 73.9 71.0 75.0 73.0 68.0 +8.0 2.0 73.0 77.0 77.4 75.0 80.0 79.0 62.0 +4.0 5.0 69.0 60.0 56.6 52.0 58.0 56.0 72.0 +3.0 13.0 55.0 52.0 53.3 50.0 55.0 53.0 54.0 +8.0 28.0 81.0 79.0 75.0 71.0 77.0 76.0 85.0 +4.0 9.0 77.0 76.0 57.2 53.0 61.0 57.0 74.0 +5.0 26.0 66.0 66.0 66.5 64.0 70.0 65.0 85.0 +10.0 10.0 68.0 57.0 61.8 58.0 64.0 61.0 62.0 +4.0 10.0 76.0 66.0 57.4 57.0 60.0 57.0 60.0 +10.0 19.0 60.0 61.0 58.4 58.0 60.0 57.0 41.0 +3.0 12.0 56.0 55.0 53.1 52.0 58.0 53.0 65.0 +1.0 24.0 57.0 48.0 48.1 46.0 50.0 48.0 54.0 +2.0 7.0 53.0 49.0 49.2 46.0 51.0 48.0 63.0 +5.0 27.0 66.0 65.0 66.7 64.0 67.0 68.0 73.0 +5.0 5.0 74.0 60.0 62.5 58.0 66.0 62.0 56.0 +3.0 11.0 55.0 56.0 53.0 53.0 53.0 51.0 36.0 +10.0 22.0 62.0 59.0 57.4 56.0 59.0 58.0 44.0 +12.0 11.0 36.0 44.0 45.7 41.0 46.0 47.0 35.0 +5.0 8.0 77.0 82.0 63.2 62.0 65.0 63.0 83.0 +5.0 29.0 64.0 64.0 67.0 65.0 71.0 65.0 76.0 +12.0 13.0 44.0 43.0 45.5 41.0 47.0 46.0 46.0 +3.0 30.0 56.0 64.0 55.7 51.0 57.0 56.0 57.0 +11.0 8.0 61.0 63.0 52.7 49.0 57.0 52.0 49.0 +6.0 20.0 65.0 70.0 70.6 67.0 71.0 70.0 79.0 +11.0 9.0 63.0 71.0 52.4 48.0 56.0 52.0 42.0 +7.0 3.0 76.0 76.0 73.5 69.0 76.0 75.0 85.0 +10.0 9.0 64.0 68.0 62.1 58.0 65.0 63.0 55.0 +12.0 16.0 39.0 39.0 45.3 44.0 49.0 44.0 39.0 +9.0 16.0 79.0 71.0 70.7 70.0 74.0 71.0 52.0 +6.0 25.0 68.0 69.0 71.7 68.0 73.0 73.0 89.0 +9.0 13.0 70.0 74.0 71.5 71.0 75.0 70.0 82.0 +5.0 12.0 75.0 81.0 64.1 62.0 67.0 63.0 81.0 +2.0 8.0 49.0 51.0 49.3 49.0 52.0 50.0 34.0 +1.0 12.0 52.0 45.0 46.8 44.0 50.0 45.0 61.0 +8.0 13.0 80.0 87.0 76.8 73.0 79.0 78.0 73.0 +7.0 4.0 76.0 71.0 73.8 71.0 76.0 73.0 86.0 +4.0 25.0 65.0 55.0 60.3 56.0 64.0 61.0 77.0 +8.0 12.0 76.0 80.0 76.9 72.0 79.0 77.0 81.0 +9.0 21.0 71.0 67.0 69.0 65.0 70.0 70.0 76.0 +4.0 30.0 64.0 61.0 61.4 60.0 65.0 62.0 78.0 +12.0 5.0 49.0 46.0 46.6 43.0 50.0 45.0 65.0 +12.0 19.0 35.0 39.0 45.1 42.0 46.0 45.0 51.0 +9.0 23.0 68.0 67.0 68.3 67.0 69.0 67.0 61.0 +11.0 29.0 48.0 52.0 47.8 43.0 48.0 47.0 50.0 +6.0 16.0 60.0 67.0 69.8 68.0 72.0 71.0 87.0 +9.0 14.0 74.0 75.0 71.2 67.0 75.0 73.0 77.0 +9.0 6.0 68.0 68.0 73.3 73.0 76.0 75.0 79.0 +6.0 6.0 81.0 92.0 68.2 65.0 70.0 67.0 71.0 +9.0 8.0 68.0 67.0 72.8 69.0 77.0 73.0 56.0 +1.0 3.0 45.0 44.0 45.8 43.0 46.0 47.0 56.0 +4.0 28.0 60.0 61.0 61.0 56.0 65.0 62.0 73.0 +11.0 5.0 65.0 65.0 53.4 49.0 58.0 52.0 41.0 +9.0 7.0 68.0 68.0 73.0 72.0 78.0 71.0 70.0 +5.0 3.0 77.0 87.0 62.1 62.0 66.0 64.0 69.0 +10.0 31.0 65.0 117.0 54.8 51.0 59.0 56.0 62.0 +7.0 18.0 72.0 80.0 76.4 75.0 77.0 75.0 66.0 +11.0 15.0 55.0 57.0 51.0 47.0 54.0 51.0 46.0 +5.0 10.0 63.0 67.0 63.6 61.0 66.0 64.0 68.0 +3.0 18.0 53.0 58.0 54.0 51.0 57.0 54.0 56.0 +10.0 26.0 61.0 65.0 56.2 53.0 57.0 57.0 41.0 +1.0 30.0 56.0 52.0 48.6 45.0 51.0 48.0 47.0 +3.0 27.0 57.0 59.0 55.3 52.0 58.0 55.0 39.0 +11.0 3.0 57.0 57.0 53.9 53.0 54.0 54.0 35.0 +4.0 20.0 89.0 81.0 59.2 56.0 63.0 61.0 66.0 +7.0 24.0 71.0 75.0 77.1 76.0 78.0 78.0 75.0 +7.0 31.0 88.0 76.0 77.4 76.0 78.0 79.0 95.0 +5.0 16.0 65.0 57.0 64.8 61.0 65.0 65.0 53.0 +7.0 6.0 68.0 69.0 74.2 72.0 76.0 75.0 86.0 +9.0 27.0 76.0 77.0 66.8 66.0 67.0 68.0 64.0 +2.0 16.0 58.0 55.0 49.9 47.0 54.0 51.0 55.0 +12.0 4.0 50.0 49.0 46.8 45.0 47.0 47.0 53.0 +3.0 9.0 53.0 54.0 52.7 48.0 56.0 54.0 57.0 +11.0 14.0 59.0 55.0 51.2 49.0 53.0 53.0 42.0 +3.0 29.0 51.0 56.0 55.6 53.0 59.0 54.0 45.0 +7.0 8.0 76.0 68.0 74.6 72.0 79.0 75.0 77.0 +3.0 14.0 52.0 54.0 53.4 49.0 58.0 55.0 44.0 +6.0 11.0 65.0 67.0 69.0 69.0 72.0 71.0 87.0 +1.0 13.0 45.0 49.0 46.9 45.0 51.0 46.0 33.0 +2.0 5.0 49.0 49.0 49.1 47.0 50.0 49.0 45.0 +1.0 29.0 57.0 56.0 48.5 48.0 52.0 47.0 49.0 +6.0 22.0 76.0 73.0 71.0 66.0 71.0 72.0 78.0 +5.0 25.0 65.0 66.0 66.4 65.0 67.0 66.0 60.0 +9.0 28.0 77.0 69.0 66.5 66.0 68.0 66.0 62.0 +5.0 14.0 77.0 82.0 64.5 64.0 66.0 66.0 65.0 +8.0 14.0 87.0 90.0 76.7 75.0 78.0 78.0 65.0 +2.0 23.0 51.0 51.0 50.7 49.0 53.0 51.0 43.0 +4.0 8.0 68.0 77.0 57.1 57.0 61.0 57.0 41.0 +10.0 11.0 57.0 60.0 61.4 58.0 66.0 61.0 58.0 +6.0 30.0 79.0 74.0 72.8 71.0 76.0 72.0 87.0 +7.0 26.0 80.0 85.0 77.2 73.0 79.0 76.0 74.0 +5.0 6.0 60.0 68.0 62.8 61.0 64.0 61.0 64.0 +2.0 11.0 62.0 56.0 49.5 46.0 53.0 50.0 37.0 +4.0 2.0 73.0 71.0 56.2 55.0 58.0 58.0 45.0 +10.0 16.0 60.0 62.0 59.5 57.0 60.0 59.0 40.0 +7.0 28.0 79.0 83.0 77.3 76.0 80.0 78.0 76.0 +5.0 19.0 71.0 64.0 65.4 62.0 68.0 67.0 56.0 +1.0 27.0 54.0 56.0 48.4 45.0 51.0 49.0 54.0 +12.0 25.0 40.0 41.0 45.1 42.0 49.0 44.0 31.0 +5.0 24.0 66.0 65.0 66.2 66.0 71.0 66.0 67.0 +11.0 4.0 57.0 65.0 53.7 49.0 55.0 54.0 38.0 +1.0 5.0 41.0 40.0 46.0 46.0 46.0 46.0 41.0 +1.0 1.0 45.0 45.0 45.6 43.0 50.0 44.0 29.0 +11.0 26.0 52.0 52.0 48.4 48.0 50.0 47.0 58.0 +11.0 12.0 64.0 63.0 51.7 50.0 52.0 52.0 63.0 +11.0 30.0 52.0 52.0 47.6 47.0 52.0 49.0 44.0 +4.0 13.0 58.0 60.0 57.9 55.0 62.0 56.0 77.0 +8.0 23.0 84.0 81.0 75.7 73.0 78.0 77.0 89.0 +7.0 14.0 77.0 75.0 75.8 74.0 76.0 77.0 77.0 +11.0 13.0 63.0 59.0 51.4 48.0 56.0 50.0 64.0 +8.0 9.0 72.0 73.0 77.1 77.0 80.0 79.0 94.0 +8.0 4.0 73.0 75.0 77.3 73.0 79.0 78.0 66.0 +4.0 16.0 59.0 60.0 58.5 56.0 60.0 59.0 59.0 +6.0 23.0 73.0 75.0 71.3 68.0 72.0 71.0 56.0 +4.0 11.0 66.0 59.0 57.6 56.0 60.0 58.0 40.0 +2.0 6.0 49.0 53.0 49.1 47.0 53.0 49.0 56.0 +8.0 6.0 80.0 79.0 77.2 76.0 81.0 79.0 60.0 +3.0 5.0 59.0 57.0 52.1 49.0 53.0 51.0 46.0 +6.0 2.0 79.0 75.0 67.6 64.0 71.0 67.0 77.0 +9.0 20.0 69.0 71.0 69.4 67.0 73.0 69.0 81.0 +2.0 19.0 57.0 53.0 50.2 50.0 52.0 51.0 42.0 +2.0 2.0 47.0 46.0 48.8 48.0 50.0 50.0 56.0 +7.0 22.0 82.0 81.0 76.9 72.0 77.0 76.0 70.0 +11.0 24.0 54.0 49.0 48.9 47.0 53.0 48.0 29.0 +1.0 28.0 56.0 57.0 48.4 44.0 52.0 48.0 34.0 +10.0 18.0 60.0 60.0 58.8 54.0 60.0 57.0 53.0 +9.0 4.0 70.0 67.0 73.7 72.0 77.0 75.0 64.0 +10.0 4.0 65.0 61.0 64.1 62.0 69.0 65.0 60.0 +6.0 14.0 70.0 66.0 69.5 66.0 71.0 69.0 85.0 +11.0 11.0 65.0 64.0 51.9 50.0 53.0 52.0 55.0 +5.0 21.0 63.0 66.0 65.7 62.0 67.0 65.0 49.0 +3.0 6.0 57.0 64.0 52.2 52.0 53.0 51.0 49.0 +5.0 18.0 60.0 71.0 65.2 61.0 68.0 65.0 56.0 +5.0 11.0 67.0 75.0 63.8 62.0 68.0 63.0 60.0 +1.0 9.0 45.0 48.0 46.4 46.0 50.0 45.0 47.0 +3.0 8.0 60.0 53.0 52.5 48.0 56.0 51.0 70.0 +1.0 15.0 55.0 49.0 47.1 46.0 51.0 46.0 65.0 +6.0 8.0 86.0 85.0 68.5 67.0 70.0 69.0 81.0 +2.0 10.0 57.0 62.0 49.4 48.0 50.0 49.0 30.0 +12.0 3.0 46.0 50.0 47.0 42.0 52.0 47.0 58.0 +10.0 27.0 65.0 58.0 55.9 51.0 60.0 55.0 39.0 +8.0 7.0 79.0 72.0 77.2 74.0 78.0 77.0 95.0 +11.0 16.0 57.0 55.0 50.7 50.0 51.0 49.0 34.0 +9.0 10.0 72.0 74.0 72.3 70.0 77.0 74.0 91.0 +7.0 29.0 83.0 85.0 77.3 77.0 80.0 79.0 77.0 +8.0 3.0 77.0 73.0 77.3 77.0 81.0 77.0 93.0 +12.0 1.0 52.0 52.0 47.4 44.0 48.0 49.0 39.0 +9.0 25.0 64.0 67.0 67.6 64.0 72.0 67.0 62.0 +12.0 23.0 49.0 45.0 45.1 45.0 49.0 44.0 35.0 +12.0 2.0 52.0 46.0 47.2 46.0 51.0 49.0 41.0 +10.0 13.0 62.0 66.0 60.6 60.0 62.0 60.0 57.0 +7.0 23.0 81.0 71.0 77.0 75.0 81.0 76.0 86.0 +6.0 13.0 65.0 70.0 69.3 66.0 72.0 69.0 79.0 +2.0 15.0 55.0 58.0 49.9 46.0 52.0 49.0 53.0 +8.0 8.0 72.0 72.0 77.1 76.0 78.0 77.0 65.0 +7.0 12.0 74.0 74.0 75.4 74.0 77.0 77.0 71.0 +10.0 3.0 63.0 65.0 64.5 63.0 68.0 65.0 49.0 +4.0 18.0 68.0 77.0 58.8 55.0 59.0 57.0 39.0 +2.0 25.0 60.0 59.0 50.9 49.0 51.0 49.0 35.0 +1.0 2.0 44.0 45.0 45.7 41.0 50.0 44.0 61.0 +2.0 21.0 51.0 53.0 50.5 49.0 54.0 52.0 46.0 +3.0 24.0 57.0 53.0 54.9 54.0 56.0 56.0 72.0 +7.0 27.0 85.0 79.0 77.3 73.0 78.0 79.0 79.0 +2.0 4.0 51.0 49.0 49.0 44.0 54.0 51.0 44.0 +10.0 7.0 66.0 63.0 62.9 62.0 67.0 64.0 78.0 +4.0 4.0 63.0 69.0 56.5 54.0 59.0 56.0 45.0 +2.0 24.0 51.0 60.0 50.8 47.0 53.0 50.0 46.0 +10.0 8.0 63.0 64.0 62.5 60.0 65.0 61.0 73.0 +9.0 15.0 75.0 79.0 71.0 66.0 76.0 69.0 64.0 +1.0 14.0 49.0 55.0 47.0 43.0 47.0 46.0 58.0 +4.0 1.0 68.0 73.0 56.0 54.0 59.0 55.0 41.0 +10.0 17.0 62.0 60.0 59.1 57.0 63.0 59.0 62.0 +6.0 18.0 71.0 67.0 70.2 67.0 75.0 69.0 77.0 +12.0 26.0 41.0 42.0 45.2 45.0 48.0 46.0 58.0 +5.0 17.0 57.0 60.0 65.0 62.0 65.0 65.0 55.0 +11.0 20.0 55.0 57.0 49.8 47.0 54.0 48.0 30.0 +12.0 18.0 35.0 35.0 45.2 44.0 46.0 46.0 36.0 +9.0 17.0 71.0 75.0 70.3 66.0 73.0 70.0 84.0 +2.0 26.0 59.0 61.0 51.1 48.0 56.0 53.0 65.0 +2.0 22.0 53.0 51.0 50.6 46.0 51.0 50.0 59.0 +6.0 26.0 69.0 71.0 71.9 67.0 74.0 72.0 70.0 +7.0 11.0 71.0 74.0 75.3 74.0 79.0 75.0 71.0 +12.0 30.0 48.0 48.0 45.4 44.0 46.0 44.0 42.0 +7.0 9.0 68.0 74.0 74.9 70.0 79.0 76.0 60.0 +6.0 21.0 70.0 76.0 70.8 68.0 75.0 71.0 57.0 +3.0 2.0 54.0 58.0 51.6 47.0 54.0 52.0 37.0 +2.0 20.0 53.0 51.0 50.4 48.0 55.0 51.0 43.0 +9.0 9.0 67.0 72.0 72.6 68.0 77.0 71.0 78.0 +9.0 26.0 67.0 76.0 67.2 64.0 69.0 69.0 74.0 +1.0 22.0 52.0 52.0 47.9 47.0 48.0 48.0 60.0 +11.0 27.0 52.0 53.0 48.2 48.0 49.0 49.0 53.0 +6.0 12.0 67.0 65.0 69.1 65.0 73.0 70.0 83.0 +10.0 20.0 61.0 58.0 58.1 58.0 59.0 58.0 43.0 +7.0 13.0 74.0 77.0 75.6 74.0 78.0 76.0 56.0 +11.0 7.0 58.0 61.0 52.9 51.0 56.0 51.0 35.0 +10.0 1.0 66.0 67.0 65.3 64.0 70.0 64.0 54.0 +11.0 22.0 55.0 54.0 49.3 46.0 54.0 49.0 58.0 +6.0 1.0 71.0 79.0 67.4 65.0 69.0 66.0 58.0 +5.0 13.0 81.0 77.0 64.3 63.0 67.0 66.0 67.0 +6.0 3.0 75.0 71.0 67.7 64.0 71.0 66.0 55.0 +4.0 12.0 59.0 58.0 57.7 54.0 59.0 57.0 61.0 +3.0 31.0 64.0 68.0 55.9 55.0 59.0 56.0 56.0 +12.0 14.0 43.0 40.0 45.4 45.0 48.0 45.0 49.0 +8.0 5.0 75.0 80.0 77.3 75.0 81.0 78.0 71.0 +5.0 4.0 87.0 74.0 62.3 59.0 65.0 64.0 61.0 +12.0 31.0 48.0 57.0 45.5 42.0 48.0 47.0 57.0 +1.0 21.0 48.0 52.0 47.8 43.0 51.0 46.0 57.0 +7.0 10.0 74.0 71.0 75.1 71.0 77.0 76.0 95.0 +3.0 15.0 54.0 49.0 53.6 49.0 58.0 52.0 70.0 +4.0 19.0 77.0 89.0 59.0 59.0 63.0 59.0 61.0 +10.0 14.0 66.0 60.0 60.2 56.0 64.0 60.0 78.0 +4.0 15.0 59.0 59.0 58.3 58.0 61.0 60.0 40.0
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/feature_selection_result08 Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,11 @@ +0 1 +143.762620712 -0.330941870584 +-88.5787166225 1.08055532812 +-82.8452345578 0.272541389247 +72.4951388149 -0.26868660527800003 +11.805182128 1.0360467096600001 +-63.9354970901 -0.101485840571 +126.32584079600001 -0.35999834017899995 +23.0341392692 0.5185404651359999 +67.6714937696 -0.115688051547 +47.39275848810001 -0.7850965413680001
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/feature_selection_result09 Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,11 @@ +0 +143.762620712 +-88.5787166225 +-82.8452345578 +72.4951388149 +11.805182128 +-63.9354970901 +126.32584079600001 +23.0341392692 +67.6714937696 +47.39275848810001
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/feature_selection_result10 Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,262 @@ +month day temp_2 temp_1 average forecast_noaa forecast_acc forecast_under friend week_Fri week_Mon week_Sat week_Sun week_Thurs week_Tues week_Wed +9.0 19.0 68.0 69.0 69.7 65.0 74.0 71.0 88.0 0.0 1.0 0.0 0.0 0.0 0.0 0.0 +4.0 14.0 60.0 59.0 58.1 57.0 63.0 58.0 66.0 0.0 0.0 0.0 0.0 1.0 0.0 0.0 +7.0 30.0 85.0 88.0 77.3 75.0 79.0 77.0 70.0 0.0 0.0 1.0 0.0 0.0 0.0 0.0 +5.0 15.0 82.0 65.0 64.7 63.0 69.0 64.0 58.0 0.0 0.0 0.0 1.0 0.0 0.0 0.0 +1.0 18.0 54.0 50.0 47.5 44.0 48.0 49.0 58.0 0.0 1.0 0.0 0.0 0.0 0.0 0.0 +1.0 25.0 48.0 51.0 48.2 45.0 51.0 49.0 63.0 0.0 1.0 0.0 0.0 0.0 0.0 0.0 +11.0 25.0 49.0 52.0 48.6 45.0 52.0 47.0 41.0 1.0 0.0 0.0 0.0 0.0 0.0 0.0 +7.0 20.0 73.0 78.0 76.7 75.0 78.0 77.0 66.0 0.0 0.0 0.0 0.0 0.0 0.0 1.0 +12.0 17.0 39.0 35.0 45.2 43.0 47.0 46.0 38.0 0.0 0.0 1.0 0.0 0.0 0.0 0.0 +12.0 8.0 42.0 40.0 46.1 45.0 51.0 47.0 36.0 0.0 0.0 0.0 0.0 1.0 0.0 0.0 +12.0 28.0 42.0 47.0 45.3 41.0 49.0 44.0 58.0 0.0 0.0 0.0 0.0 0.0 0.0 1.0 +7.0 17.0 76.0 72.0 76.3 76.0 78.0 77.0 88.0 0.0 0.0 0.0 1.0 0.0 0.0 0.0 +7.0 7.0 69.0 76.0 74.4 73.0 77.0 74.0 72.0 0.0 0.0 0.0 0.0 1.0 0.0 0.0 +12.0 15.0 40.0 39.0 45.3 45.0 49.0 47.0 46.0 0.0 0.0 0.0 0.0 1.0 0.0 0.0 +6.0 27.0 71.0 78.0 72.2 70.0 74.0 72.0 84.0 0.0 1.0 0.0 0.0 0.0 0.0 0.0 +5.0 31.0 64.0 71.0 67.3 63.0 72.0 68.0 85.0 0.0 0.0 0.0 0.0 0.0 1.0 0.0 +1.0 20.0 54.0 48.0 47.7 44.0 52.0 49.0 61.0 0.0 0.0 0.0 0.0 0.0 0.0 1.0 +8.0 10.0 73.0 72.0 77.0 77.0 78.0 77.0 68.0 0.0 0.0 0.0 0.0 0.0 0.0 1.0 +3.0 23.0 56.0 57.0 54.7 50.0 58.0 55.0 70.0 0.0 0.0 0.0 0.0 0.0 0.0 1.0 +12.0 24.0 45.0 40.0 45.1 44.0 47.0 46.0 39.0 0.0 0.0 1.0 0.0 0.0 0.0 0.0 +1.0 19.0 50.0 54.0 47.6 47.0 49.0 48.0 53.0 0.0 0.0 0.0 0.0 0.0 1.0 0.0 +11.0 6.0 65.0 58.0 53.2 52.0 57.0 55.0 71.0 0.0 0.0 0.0 1.0 0.0 0.0 0.0 +4.0 17.0 60.0 68.0 58.6 58.0 62.0 59.0 54.0 0.0 0.0 0.0 1.0 0.0 0.0 0.0 +10.0 29.0 60.0 65.0 55.3 55.0 59.0 55.0 65.0 0.0 0.0 1.0 0.0 0.0 0.0 0.0 +2.0 1.0 48.0 47.0 48.8 46.0 49.0 49.0 51.0 0.0 1.0 0.0 0.0 0.0 0.0 0.0 +12.0 12.0 44.0 44.0 45.6 43.0 50.0 45.0 42.0 0.0 1.0 0.0 0.0 0.0 0.0 0.0 +5.0 30.0 64.0 64.0 67.1 64.0 70.0 66.0 69.0 0.0 1.0 0.0 0.0 0.0 0.0 0.0 +10.0 23.0 59.0 62.0 57.1 57.0 58.0 59.0 67.0 0.0 0.0 0.0 1.0 0.0 0.0 0.0 +9.0 30.0 68.0 66.0 65.7 64.0 67.0 65.0 74.0 1.0 0.0 0.0 0.0 0.0 0.0 0.0 +9.0 12.0 77.0 70.0 71.8 67.0 73.0 73.0 90.0 0.0 1.0 0.0 0.0 0.0 0.0 0.0 +11.0 2.0 59.0 57.0 54.2 54.0 58.0 55.0 70.0 0.0 0.0 0.0 0.0 0.0 0.0 1.0 +11.0 17.0 55.0 50.0 50.5 46.0 51.0 50.0 57.0 0.0 0.0 0.0 0.0 1.0 0.0 0.0 +3.0 3.0 58.0 55.0 51.8 49.0 54.0 50.0 71.0 0.0 0.0 0.0 0.0 1.0 0.0 0.0 +11.0 21.0 57.0 55.0 49.5 46.0 51.0 49.0 67.0 0.0 1.0 0.0 0.0 0.0 0.0 0.0 +12.0 27.0 42.0 42.0 45.2 41.0 50.0 47.0 47.0 0.0 0.0 0.0 0.0 0.0 1.0 0.0 +4.0 24.0 64.0 65.0 60.1 57.0 61.0 60.0 41.0 0.0 0.0 0.0 1.0 0.0 0.0 0.0 +5.0 20.0 64.0 63.0 65.6 63.0 70.0 64.0 73.0 1.0 0.0 0.0 0.0 0.0 0.0 0.0 +1.0 16.0 49.0 48.0 47.3 45.0 52.0 46.0 28.0 0.0 0.0 1.0 0.0 0.0 0.0 0.0 +12.0 7.0 40.0 42.0 46.3 44.0 51.0 46.0 62.0 0.0 0.0 0.0 0.0 0.0 0.0 1.0 +1.0 7.0 44.0 51.0 46.2 45.0 49.0 46.0 38.0 0.0 0.0 0.0 0.0 1.0 0.0 0.0 +9.0 24.0 67.0 64.0 68.0 65.0 71.0 66.0 64.0 0.0 0.0 1.0 0.0 0.0 0.0 0.0 +8.0 30.0 79.0 75.0 74.6 74.0 76.0 75.0 63.0 0.0 0.0 0.0 0.0 0.0 1.0 0.0 +1.0 11.0 50.0 52.0 46.7 42.0 48.0 48.0 39.0 0.0 1.0 0.0 0.0 0.0 0.0 0.0 +6.0 9.0 85.0 67.0 68.6 66.0 73.0 69.0 80.0 0.0 0.0 0.0 0.0 1.0 0.0 0.0 +9.0 22.0 67.0 68.0 68.7 65.0 70.0 69.0 56.0 0.0 0.0 0.0 0.0 1.0 0.0 0.0 +3.0 25.0 53.0 54.0 55.0 53.0 57.0 57.0 42.0 1.0 0.0 0.0 0.0 0.0 0.0 0.0 +10.0 24.0 62.0 62.0 56.8 52.0 61.0 57.0 70.0 0.0 1.0 0.0 0.0 0.0 0.0 0.0 +7.0 16.0 77.0 76.0 76.1 76.0 78.0 75.0 61.0 0.0 0.0 1.0 0.0 0.0 0.0 0.0 +7.0 1.0 74.0 73.0 73.1 71.0 75.0 72.0 93.0 1.0 0.0 0.0 0.0 0.0 0.0 0.0 +11.0 18.0 50.0 52.0 50.3 50.0 53.0 50.0 35.0 1.0 0.0 0.0 0.0 0.0 0.0 0.0 +9.0 3.0 75.0 70.0 73.9 71.0 75.0 73.0 68.0 0.0 0.0 1.0 0.0 0.0 0.0 0.0 +8.0 2.0 73.0 77.0 77.4 75.0 80.0 79.0 62.0 0.0 0.0 0.0 0.0 0.0 1.0 0.0 +4.0 5.0 69.0 60.0 56.6 52.0 58.0 56.0 72.0 0.0 0.0 0.0 0.0 0.0 1.0 0.0 +3.0 13.0 55.0 52.0 53.3 50.0 55.0 53.0 54.0 0.0 0.0 0.0 1.0 0.0 0.0 0.0 +8.0 28.0 81.0 79.0 75.0 71.0 77.0 76.0 85.0 0.0 0.0 0.0 1.0 0.0 0.0 0.0 +4.0 9.0 77.0 76.0 57.2 53.0 61.0 57.0 74.0 0.0 0.0 1.0 0.0 0.0 0.0 0.0 +5.0 26.0 66.0 66.0 66.5 64.0 70.0 65.0 85.0 0.0 0.0 0.0 0.0 1.0 0.0 0.0 +10.0 10.0 68.0 57.0 61.8 58.0 64.0 61.0 62.0 0.0 1.0 0.0 0.0 0.0 0.0 0.0 +4.0 10.0 76.0 66.0 57.4 57.0 60.0 57.0 60.0 0.0 0.0 0.0 1.0 0.0 0.0 0.0 +10.0 19.0 60.0 61.0 58.4 58.0 60.0 57.0 41.0 0.0 0.0 0.0 0.0 0.0 0.0 1.0 +3.0 12.0 56.0 55.0 53.1 52.0 58.0 53.0 65.0 0.0 0.0 1.0 0.0 0.0 0.0 0.0 +1.0 24.0 57.0 48.0 48.1 46.0 50.0 48.0 54.0 0.0 0.0 0.0 1.0 0.0 0.0 0.0 +2.0 7.0 53.0 49.0 49.2 46.0 51.0 48.0 63.0 0.0 0.0 0.0 1.0 0.0 0.0 0.0 +5.0 27.0 66.0 65.0 66.7 64.0 67.0 68.0 73.0 1.0 0.0 0.0 0.0 0.0 0.0 0.0 +5.0 5.0 74.0 60.0 62.5 58.0 66.0 62.0 56.0 0.0 0.0 0.0 0.0 1.0 0.0 0.0 +3.0 11.0 55.0 56.0 53.0 53.0 53.0 51.0 36.0 1.0 0.0 0.0 0.0 0.0 0.0 0.0 +10.0 22.0 62.0 59.0 57.4 56.0 59.0 58.0 44.0 0.0 0.0 1.0 0.0 0.0 0.0 0.0 +12.0 11.0 36.0 44.0 45.7 41.0 46.0 47.0 35.0 0.0 0.0 0.0 1.0 0.0 0.0 0.0 +5.0 8.0 77.0 82.0 63.2 62.0 65.0 63.0 83.0 0.0 0.0 0.0 1.0 0.0 0.0 0.0 +5.0 29.0 64.0 64.0 67.0 65.0 71.0 65.0 76.0 0.0 0.0 0.0 1.0 0.0 0.0 0.0 +12.0 13.0 44.0 43.0 45.5 41.0 47.0 46.0 46.0 0.0 0.0 0.0 0.0 0.0 1.0 0.0 +3.0 30.0 56.0 64.0 55.7 51.0 57.0 56.0 57.0 0.0 0.0 0.0 0.0 0.0 0.0 1.0 +11.0 8.0 61.0 63.0 52.7 49.0 57.0 52.0 49.0 0.0 0.0 0.0 0.0 0.0 1.0 0.0 +6.0 20.0 65.0 70.0 70.6 67.0 71.0 70.0 79.0 0.0 1.0 0.0 0.0 0.0 0.0 0.0 +11.0 9.0 63.0 71.0 52.4 48.0 56.0 52.0 42.0 0.0 0.0 0.0 0.0 0.0 0.0 1.0 +7.0 3.0 76.0 76.0 73.5 69.0 76.0 75.0 85.0 0.0 0.0 0.0 1.0 0.0 0.0 0.0 +10.0 9.0 64.0 68.0 62.1 58.0 65.0 63.0 55.0 0.0 0.0 0.0 1.0 0.0 0.0 0.0 +12.0 16.0 39.0 39.0 45.3 44.0 49.0 44.0 39.0 1.0 0.0 0.0 0.0 0.0 0.0 0.0 +9.0 16.0 79.0 71.0 70.7 70.0 74.0 71.0 52.0 1.0 0.0 0.0 0.0 0.0 0.0 0.0 +6.0 25.0 68.0 69.0 71.7 68.0 73.0 73.0 89.0 0.0 0.0 1.0 0.0 0.0 0.0 0.0 +9.0 13.0 70.0 74.0 71.5 71.0 75.0 70.0 82.0 0.0 0.0 0.0 0.0 0.0 1.0 0.0 +5.0 12.0 75.0 81.0 64.1 62.0 67.0 63.0 81.0 0.0 0.0 0.0 0.0 1.0 0.0 0.0 +2.0 8.0 49.0 51.0 49.3 49.0 52.0 50.0 34.0 0.0 1.0 0.0 0.0 0.0 0.0 0.0 +1.0 12.0 52.0 45.0 46.8 44.0 50.0 45.0 61.0 0.0 0.0 0.0 0.0 0.0 1.0 0.0 +8.0 13.0 80.0 87.0 76.8 73.0 79.0 78.0 73.0 0.0 0.0 1.0 0.0 0.0 0.0 0.0 +7.0 4.0 76.0 71.0 73.8 71.0 76.0 73.0 86.0 0.0 1.0 0.0 0.0 0.0 0.0 0.0 +4.0 25.0 65.0 55.0 60.3 56.0 64.0 61.0 77.0 0.0 1.0 0.0 0.0 0.0 0.0 0.0 +8.0 12.0 76.0 80.0 76.9 72.0 79.0 77.0 81.0 1.0 0.0 0.0 0.0 0.0 0.0 0.0 +9.0 21.0 71.0 67.0 69.0 65.0 70.0 70.0 76.0 0.0 0.0 0.0 0.0 0.0 0.0 1.0 +4.0 30.0 64.0 61.0 61.4 60.0 65.0 62.0 78.0 0.0 0.0 1.0 0.0 0.0 0.0 0.0 +12.0 5.0 49.0 46.0 46.6 43.0 50.0 45.0 65.0 0.0 1.0 0.0 0.0 0.0 0.0 0.0 +12.0 19.0 35.0 39.0 45.1 42.0 46.0 45.0 51.0 0.0 1.0 0.0 0.0 0.0 0.0 0.0 +9.0 23.0 68.0 67.0 68.3 67.0 69.0 67.0 61.0 1.0 0.0 0.0 0.0 0.0 0.0 0.0 +11.0 29.0 48.0 52.0 47.8 43.0 48.0 47.0 50.0 0.0 0.0 0.0 0.0 0.0 1.0 0.0 +6.0 16.0 60.0 67.0 69.8 68.0 72.0 71.0 87.0 0.0 0.0 0.0 0.0 1.0 0.0 0.0 +9.0 14.0 74.0 75.0 71.2 67.0 75.0 73.0 77.0 0.0 0.0 0.0 0.0 0.0 0.0 1.0 +9.0 6.0 68.0 68.0 73.3 73.0 76.0 75.0 79.0 0.0 0.0 0.0 0.0 0.0 1.0 0.0 +6.0 6.0 81.0 92.0 68.2 65.0 70.0 67.0 71.0 0.0 1.0 0.0 0.0 0.0 0.0 0.0 +9.0 8.0 68.0 67.0 72.8 69.0 77.0 73.0 56.0 0.0 0.0 0.0 0.0 1.0 0.0 0.0 +1.0 3.0 45.0 44.0 45.8 43.0 46.0 47.0 56.0 0.0 0.0 0.0 1.0 0.0 0.0 0.0 +4.0 28.0 60.0 61.0 61.0 56.0 65.0 62.0 73.0 0.0 0.0 0.0 0.0 1.0 0.0 0.0 +11.0 5.0 65.0 65.0 53.4 49.0 58.0 52.0 41.0 0.0 0.0 1.0 0.0 0.0 0.0 0.0 +9.0 7.0 68.0 68.0 73.0 72.0 78.0 71.0 70.0 0.0 0.0 0.0 0.0 0.0 0.0 1.0 +5.0 3.0 77.0 87.0 62.1 62.0 66.0 64.0 69.0 0.0 0.0 0.0 0.0 0.0 1.0 0.0 +10.0 31.0 65.0 117.0 54.8 51.0 59.0 56.0 62.0 0.0 1.0 0.0 0.0 0.0 0.0 0.0 +7.0 18.0 72.0 80.0 76.4 75.0 77.0 75.0 66.0 0.0 1.0 0.0 0.0 0.0 0.0 0.0 +11.0 15.0 55.0 57.0 51.0 47.0 54.0 51.0 46.0 0.0 0.0 0.0 0.0 0.0 1.0 0.0 +5.0 10.0 63.0 67.0 63.6 61.0 66.0 64.0 68.0 0.0 0.0 0.0 0.0 0.0 1.0 0.0 +3.0 18.0 53.0 58.0 54.0 51.0 57.0 54.0 56.0 1.0 0.0 0.0 0.0 0.0 0.0 0.0 +10.0 26.0 61.0 65.0 56.2 53.0 57.0 57.0 41.0 0.0 0.0 0.0 0.0 0.0 0.0 1.0 +1.0 30.0 56.0 52.0 48.6 45.0 51.0 48.0 47.0 0.0 0.0 1.0 0.0 0.0 0.0 0.0 +3.0 27.0 57.0 59.0 55.3 52.0 58.0 55.0 39.0 0.0 0.0 0.0 1.0 0.0 0.0 0.0 +11.0 3.0 57.0 57.0 53.9 53.0 54.0 54.0 35.0 0.0 0.0 0.0 0.0 1.0 0.0 0.0 +4.0 20.0 89.0 81.0 59.2 56.0 63.0 61.0 66.0 0.0 0.0 0.0 0.0 0.0 0.0 1.0 +7.0 24.0 71.0 75.0 77.1 76.0 78.0 78.0 75.0 0.0 0.0 0.0 1.0 0.0 0.0 0.0 +7.0 31.0 88.0 76.0 77.4 76.0 78.0 79.0 95.0 0.0 0.0 0.0 1.0 0.0 0.0 0.0 +5.0 16.0 65.0 57.0 64.8 61.0 65.0 65.0 53.0 0.0 1.0 0.0 0.0 0.0 0.0 0.0 +7.0 6.0 68.0 69.0 74.2 72.0 76.0 75.0 86.0 0.0 0.0 0.0 0.0 0.0 0.0 1.0 +9.0 27.0 76.0 77.0 66.8 66.0 67.0 68.0 64.0 0.0 0.0 0.0 0.0 0.0 1.0 0.0 +2.0 16.0 58.0 55.0 49.9 47.0 54.0 51.0 55.0 0.0 0.0 0.0 0.0 0.0 1.0 0.0 +12.0 4.0 50.0 49.0 46.8 45.0 47.0 47.0 53.0 0.0 0.0 0.0 1.0 0.0 0.0 0.0 +3.0 9.0 53.0 54.0 52.7 48.0 56.0 54.0 57.0 0.0 0.0 0.0 0.0 0.0 0.0 1.0 +11.0 14.0 59.0 55.0 51.2 49.0 53.0 53.0 42.0 0.0 1.0 0.0 0.0 0.0 0.0 0.0 +3.0 29.0 51.0 56.0 55.6 53.0 59.0 54.0 45.0 0.0 0.0 0.0 0.0 0.0 1.0 0.0 +7.0 8.0 76.0 68.0 74.6 72.0 79.0 75.0 77.0 1.0 0.0 0.0 0.0 0.0 0.0 0.0 +3.0 14.0 52.0 54.0 53.4 49.0 58.0 55.0 44.0 0.0 1.0 0.0 0.0 0.0 0.0 0.0 +6.0 11.0 65.0 67.0 69.0 69.0 72.0 71.0 87.0 0.0 0.0 1.0 0.0 0.0 0.0 0.0 +1.0 13.0 45.0 49.0 46.9 45.0 51.0 46.0 33.0 0.0 0.0 0.0 0.0 0.0 0.0 1.0 +2.0 5.0 49.0 49.0 49.1 47.0 50.0 49.0 45.0 1.0 0.0 0.0 0.0 0.0 0.0 0.0 +1.0 29.0 57.0 56.0 48.5 48.0 52.0 47.0 49.0 1.0 0.0 0.0 0.0 0.0 0.0 0.0 +6.0 22.0 76.0 73.0 71.0 66.0 71.0 72.0 78.0 0.0 0.0 0.0 0.0 0.0 0.0 1.0 +5.0 25.0 65.0 66.0 66.4 65.0 67.0 66.0 60.0 0.0 0.0 0.0 0.0 0.0 0.0 1.0 +9.0 28.0 77.0 69.0 66.5 66.0 68.0 66.0 62.0 0.0 0.0 0.0 0.0 0.0 0.0 1.0 +5.0 14.0 77.0 82.0 64.5 64.0 66.0 66.0 65.0 0.0 0.0 1.0 0.0 0.0 0.0 0.0 +8.0 14.0 87.0 90.0 76.7 75.0 78.0 78.0 65.0 0.0 0.0 0.0 1.0 0.0 0.0 0.0 +2.0 23.0 51.0 51.0 50.7 49.0 53.0 51.0 43.0 0.0 0.0 0.0 0.0 0.0 1.0 0.0 +4.0 8.0 68.0 77.0 57.1 57.0 61.0 57.0 41.0 1.0 0.0 0.0 0.0 0.0 0.0 0.0 +10.0 11.0 57.0 60.0 61.4 58.0 66.0 61.0 58.0 0.0 0.0 0.0 0.0 0.0 1.0 0.0 +6.0 30.0 79.0 74.0 72.8 71.0 76.0 72.0 87.0 0.0 0.0 0.0 0.0 1.0 0.0 0.0 +7.0 26.0 80.0 85.0 77.2 73.0 79.0 76.0 74.0 0.0 0.0 0.0 0.0 0.0 1.0 0.0 +5.0 6.0 60.0 68.0 62.8 61.0 64.0 61.0 64.0 1.0 0.0 0.0 0.0 0.0 0.0 0.0 +2.0 11.0 62.0 56.0 49.5 46.0 53.0 50.0 37.0 0.0 0.0 0.0 0.0 1.0 0.0 0.0 +4.0 2.0 73.0 71.0 56.2 55.0 58.0 58.0 45.0 0.0 0.0 1.0 0.0 0.0 0.0 0.0 +10.0 16.0 60.0 62.0 59.5 57.0 60.0 59.0 40.0 0.0 0.0 0.0 1.0 0.0 0.0 0.0 +7.0 28.0 79.0 83.0 77.3 76.0 80.0 78.0 76.0 0.0 0.0 0.0 0.0 1.0 0.0 0.0 +5.0 19.0 71.0 64.0 65.4 62.0 68.0 67.0 56.0 0.0 0.0 0.0 0.0 1.0 0.0 0.0 +1.0 27.0 54.0 56.0 48.4 45.0 51.0 49.0 54.0 0.0 0.0 0.0 0.0 0.0 0.0 1.0 +12.0 25.0 40.0 41.0 45.1 42.0 49.0 44.0 31.0 0.0 0.0 0.0 1.0 0.0 0.0 0.0 +5.0 24.0 66.0 65.0 66.2 66.0 71.0 66.0 67.0 0.0 0.0 0.0 0.0 0.0 1.0 0.0 +11.0 4.0 57.0 65.0 53.7 49.0 55.0 54.0 38.0 1.0 0.0 0.0 0.0 0.0 0.0 0.0 +1.0 5.0 41.0 40.0 46.0 46.0 46.0 46.0 41.0 0.0 0.0 0.0 0.0 0.0 1.0 0.0 +1.0 1.0 45.0 45.0 45.6 43.0 50.0 44.0 29.0 1.0 0.0 0.0 0.0 0.0 0.0 0.0 +11.0 26.0 52.0 52.0 48.4 48.0 50.0 47.0 58.0 0.0 0.0 1.0 0.0 0.0 0.0 0.0 +11.0 12.0 64.0 63.0 51.7 50.0 52.0 52.0 63.0 0.0 0.0 1.0 0.0 0.0 0.0 0.0 +11.0 30.0 52.0 52.0 47.6 47.0 52.0 49.0 44.0 0.0 0.0 0.0 0.0 0.0 0.0 1.0 +4.0 13.0 58.0 60.0 57.9 55.0 62.0 56.0 77.0 0.0 0.0 0.0 0.0 0.0 0.0 1.0 +8.0 23.0 84.0 81.0 75.7 73.0 78.0 77.0 89.0 0.0 0.0 0.0 0.0 0.0 1.0 0.0 +7.0 14.0 77.0 75.0 75.8 74.0 76.0 77.0 77.0 0.0 0.0 0.0 0.0 1.0 0.0 0.0 +11.0 13.0 63.0 59.0 51.4 48.0 56.0 50.0 64.0 0.0 0.0 0.0 1.0 0.0 0.0 0.0 +8.0 9.0 72.0 73.0 77.1 77.0 80.0 79.0 94.0 0.0 0.0 0.0 0.0 0.0 1.0 0.0 +8.0 4.0 73.0 75.0 77.3 73.0 79.0 78.0 66.0 0.0 0.0 0.0 0.0 1.0 0.0 0.0 +4.0 16.0 59.0 60.0 58.5 56.0 60.0 59.0 59.0 0.0 0.0 1.0 0.0 0.0 0.0 0.0 +6.0 23.0 73.0 75.0 71.3 68.0 72.0 71.0 56.0 0.0 0.0 0.0 0.0 1.0 0.0 0.0 +4.0 11.0 66.0 59.0 57.6 56.0 60.0 58.0 40.0 0.0 1.0 0.0 0.0 0.0 0.0 0.0 +2.0 6.0 49.0 53.0 49.1 47.0 53.0 49.0 56.0 0.0 0.0 1.0 0.0 0.0 0.0 0.0 +8.0 6.0 80.0 79.0 77.2 76.0 81.0 79.0 60.0 0.0 0.0 1.0 0.0 0.0 0.0 0.0 +3.0 5.0 59.0 57.0 52.1 49.0 53.0 51.0 46.0 0.0 0.0 1.0 0.0 0.0 0.0 0.0 +6.0 2.0 79.0 75.0 67.6 64.0 71.0 67.0 77.0 0.0 0.0 0.0 0.0 1.0 0.0 0.0 +9.0 20.0 69.0 71.0 69.4 67.0 73.0 69.0 81.0 0.0 0.0 0.0 0.0 0.0 1.0 0.0 +2.0 19.0 57.0 53.0 50.2 50.0 52.0 51.0 42.0 1.0 0.0 0.0 0.0 0.0 0.0 0.0 +2.0 2.0 47.0 46.0 48.8 48.0 50.0 50.0 56.0 0.0 0.0 0.0 0.0 0.0 1.0 0.0 +7.0 22.0 82.0 81.0 76.9 72.0 77.0 76.0 70.0 1.0 0.0 0.0 0.0 0.0 0.0 0.0 +11.0 24.0 54.0 49.0 48.9 47.0 53.0 48.0 29.0 0.0 0.0 0.0 0.0 1.0 0.0 0.0 +1.0 28.0 56.0 57.0 48.4 44.0 52.0 48.0 34.0 0.0 0.0 0.0 0.0 1.0 0.0 0.0 +10.0 18.0 60.0 60.0 58.8 54.0 60.0 57.0 53.0 0.0 0.0 0.0 0.0 0.0 1.0 0.0 +9.0 4.0 70.0 67.0 73.7 72.0 77.0 75.0 64.0 0.0 0.0 0.0 1.0 0.0 0.0 0.0 +10.0 4.0 65.0 61.0 64.1 62.0 69.0 65.0 60.0 0.0 0.0 0.0 0.0 0.0 1.0 0.0 +6.0 14.0 70.0 66.0 69.5 66.0 71.0 69.0 85.0 0.0 0.0 0.0 0.0 0.0 1.0 0.0 +11.0 11.0 65.0 64.0 51.9 50.0 53.0 52.0 55.0 1.0 0.0 0.0 0.0 0.0 0.0 0.0 +5.0 21.0 63.0 66.0 65.7 62.0 67.0 65.0 49.0 0.0 0.0 1.0 0.0 0.0 0.0 0.0 +3.0 6.0 57.0 64.0 52.2 52.0 53.0 51.0 49.0 0.0 0.0 0.0 1.0 0.0 0.0 0.0 +5.0 18.0 60.0 71.0 65.2 61.0 68.0 65.0 56.0 0.0 0.0 0.0 0.0 0.0 0.0 1.0 +5.0 11.0 67.0 75.0 63.8 62.0 68.0 63.0 60.0 0.0 0.0 0.0 0.0 0.0 0.0 1.0 +1.0 9.0 45.0 48.0 46.4 46.0 50.0 45.0 47.0 0.0 0.0 1.0 0.0 0.0 0.0 0.0 +3.0 8.0 60.0 53.0 52.5 48.0 56.0 51.0 70.0 0.0 0.0 0.0 0.0 0.0 1.0 0.0 +1.0 15.0 55.0 49.0 47.1 46.0 51.0 46.0 65.0 1.0 0.0 0.0 0.0 0.0 0.0 0.0 +6.0 8.0 86.0 85.0 68.5 67.0 70.0 69.0 81.0 0.0 0.0 0.0 0.0 0.0 0.0 1.0 +2.0 10.0 57.0 62.0 49.4 48.0 50.0 49.0 30.0 0.0 0.0 0.0 0.0 0.0 0.0 1.0 +12.0 3.0 46.0 50.0 47.0 42.0 52.0 47.0 58.0 0.0 0.0 1.0 0.0 0.0 0.0 0.0 +10.0 27.0 65.0 58.0 55.9 51.0 60.0 55.0 39.0 0.0 0.0 0.0 0.0 1.0 0.0 0.0 +8.0 7.0 79.0 72.0 77.2 74.0 78.0 77.0 95.0 0.0 0.0 0.0 1.0 0.0 0.0 0.0 +11.0 16.0 57.0 55.0 50.7 50.0 51.0 49.0 34.0 0.0 0.0 0.0 0.0 0.0 0.0 1.0 +9.0 10.0 72.0 74.0 72.3 70.0 77.0 74.0 91.0 0.0 0.0 1.0 0.0 0.0 0.0 0.0 +7.0 29.0 83.0 85.0 77.3 77.0 80.0 79.0 77.0 1.0 0.0 0.0 0.0 0.0 0.0 0.0 +8.0 3.0 77.0 73.0 77.3 77.0 81.0 77.0 93.0 0.0 0.0 0.0 0.0 0.0 0.0 1.0 +12.0 1.0 52.0 52.0 47.4 44.0 48.0 49.0 39.0 0.0 0.0 0.0 0.0 1.0 0.0 0.0 +9.0 25.0 64.0 67.0 67.6 64.0 72.0 67.0 62.0 0.0 0.0 0.0 1.0 0.0 0.0 0.0 +12.0 23.0 49.0 45.0 45.1 45.0 49.0 44.0 35.0 1.0 0.0 0.0 0.0 0.0 0.0 0.0 +12.0 2.0 52.0 46.0 47.2 46.0 51.0 49.0 41.0 1.0 0.0 0.0 0.0 0.0 0.0 0.0 +10.0 13.0 62.0 66.0 60.6 60.0 62.0 60.0 57.0 0.0 0.0 0.0 0.0 1.0 0.0 0.0 +7.0 23.0 81.0 71.0 77.0 75.0 81.0 76.0 86.0 0.0 0.0 1.0 0.0 0.0 0.0 0.0 +6.0 13.0 65.0 70.0 69.3 66.0 72.0 69.0 79.0 0.0 1.0 0.0 0.0 0.0 0.0 0.0 +2.0 15.0 55.0 58.0 49.9 46.0 52.0 49.0 53.0 0.0 1.0 0.0 0.0 0.0 0.0 0.0 +8.0 8.0 72.0 72.0 77.1 76.0 78.0 77.0 65.0 0.0 1.0 0.0 0.0 0.0 0.0 0.0 +7.0 12.0 74.0 74.0 75.4 74.0 77.0 77.0 71.0 0.0 0.0 0.0 0.0 0.0 1.0 0.0 +10.0 3.0 63.0 65.0 64.5 63.0 68.0 65.0 49.0 0.0 1.0 0.0 0.0 0.0 0.0 0.0 +4.0 18.0 68.0 77.0 58.8 55.0 59.0 57.0 39.0 0.0 1.0 0.0 0.0 0.0 0.0 0.0 +2.0 25.0 60.0 59.0 50.9 49.0 51.0 49.0 35.0 0.0 0.0 0.0 0.0 1.0 0.0 0.0 +1.0 2.0 44.0 45.0 45.7 41.0 50.0 44.0 61.0 0.0 0.0 1.0 0.0 0.0 0.0 0.0 +2.0 21.0 51.0 53.0 50.5 49.0 54.0 52.0 46.0 0.0 0.0 0.0 1.0 0.0 0.0 0.0 +3.0 24.0 57.0 53.0 54.9 54.0 56.0 56.0 72.0 0.0 0.0 0.0 0.0 1.0 0.0 0.0 +7.0 27.0 85.0 79.0 77.3 73.0 78.0 79.0 79.0 0.0 0.0 0.0 0.0 0.0 0.0 1.0 +2.0 4.0 51.0 49.0 49.0 44.0 54.0 51.0 44.0 0.0 0.0 0.0 0.0 1.0 0.0 0.0 +10.0 7.0 66.0 63.0 62.9 62.0 67.0 64.0 78.0 1.0 0.0 0.0 0.0 0.0 0.0 0.0 +4.0 4.0 63.0 69.0 56.5 54.0 59.0 56.0 45.0 0.0 1.0 0.0 0.0 0.0 0.0 0.0 +2.0 24.0 51.0 60.0 50.8 47.0 53.0 50.0 46.0 0.0 0.0 0.0 0.0 0.0 0.0 1.0 +10.0 8.0 63.0 64.0 62.5 60.0 65.0 61.0 73.0 0.0 0.0 1.0 0.0 0.0 0.0 0.0 +9.0 15.0 75.0 79.0 71.0 66.0 76.0 69.0 64.0 0.0 0.0 0.0 0.0 1.0 0.0 0.0 +1.0 14.0 49.0 55.0 47.0 43.0 47.0 46.0 58.0 0.0 0.0 0.0 0.0 1.0 0.0 0.0 +4.0 1.0 68.0 73.0 56.0 54.0 59.0 55.0 41.0 1.0 0.0 0.0 0.0 0.0 0.0 0.0 +10.0 17.0 62.0 60.0 59.1 57.0 63.0 59.0 62.0 0.0 1.0 0.0 0.0 0.0 0.0 0.0 +6.0 18.0 71.0 67.0 70.2 67.0 75.0 69.0 77.0 0.0 0.0 1.0 0.0 0.0 0.0 0.0 +12.0 26.0 41.0 42.0 45.2 45.0 48.0 46.0 58.0 0.0 1.0 0.0 0.0 0.0 0.0 0.0 +5.0 17.0 57.0 60.0 65.0 62.0 65.0 65.0 55.0 0.0 0.0 0.0 0.0 0.0 1.0 0.0 +11.0 20.0 55.0 57.0 49.8 47.0 54.0 48.0 30.0 0.0 0.0 0.0 1.0 0.0 0.0 0.0 +12.0 18.0 35.0 35.0 45.2 44.0 46.0 46.0 36.0 0.0 0.0 0.0 1.0 0.0 0.0 0.0 +9.0 17.0 71.0 75.0 70.3 66.0 73.0 70.0 84.0 0.0 0.0 1.0 0.0 0.0 0.0 0.0 +2.0 26.0 59.0 61.0 51.1 48.0 56.0 53.0 65.0 1.0 0.0 0.0 0.0 0.0 0.0 0.0 +2.0 22.0 53.0 51.0 50.6 46.0 51.0 50.0 59.0 0.0 1.0 0.0 0.0 0.0 0.0 0.0 +6.0 26.0 69.0 71.0 71.9 67.0 74.0 72.0 70.0 0.0 0.0 0.0 1.0 0.0 0.0 0.0 +7.0 11.0 71.0 74.0 75.3 74.0 79.0 75.0 71.0 0.0 1.0 0.0 0.0 0.0 0.0 0.0 +12.0 30.0 48.0 48.0 45.4 44.0 46.0 44.0 42.0 1.0 0.0 0.0 0.0 0.0 0.0 0.0 +7.0 9.0 68.0 74.0 74.9 70.0 79.0 76.0 60.0 0.0 0.0 1.0 0.0 0.0 0.0 0.0 +6.0 21.0 70.0 76.0 70.8 68.0 75.0 71.0 57.0 0.0 0.0 0.0 0.0 0.0 1.0 0.0 +3.0 2.0 54.0 58.0 51.6 47.0 54.0 52.0 37.0 0.0 0.0 0.0 0.0 0.0 0.0 1.0 +2.0 20.0 53.0 51.0 50.4 48.0 55.0 51.0 43.0 0.0 0.0 1.0 0.0 0.0 0.0 0.0 +9.0 9.0 67.0 72.0 72.6 68.0 77.0 71.0 78.0 1.0 0.0 0.0 0.0 0.0 0.0 0.0 +9.0 26.0 67.0 76.0 67.2 64.0 69.0 69.0 74.0 0.0 1.0 0.0 0.0 0.0 0.0 0.0 +1.0 22.0 52.0 52.0 47.9 47.0 48.0 48.0 60.0 1.0 0.0 0.0 0.0 0.0 0.0 0.0 +11.0 27.0 52.0 53.0 48.2 48.0 49.0 49.0 53.0 0.0 0.0 0.0 1.0 0.0 0.0 0.0 +6.0 12.0 67.0 65.0 69.1 65.0 73.0 70.0 83.0 0.0 0.0 0.0 1.0 0.0 0.0 0.0 +10.0 20.0 61.0 58.0 58.1 58.0 59.0 58.0 43.0 0.0 0.0 0.0 0.0 1.0 0.0 0.0 +7.0 13.0 74.0 77.0 75.6 74.0 78.0 76.0 56.0 0.0 0.0 0.0 0.0 0.0 0.0 1.0 +11.0 7.0 58.0 61.0 52.9 51.0 56.0 51.0 35.0 0.0 1.0 0.0 0.0 0.0 0.0 0.0 +10.0 1.0 66.0 67.0 65.3 64.0 70.0 64.0 54.0 0.0 0.0 1.0 0.0 0.0 0.0 0.0 +11.0 22.0 55.0 54.0 49.3 46.0 54.0 49.0 58.0 0.0 0.0 0.0 0.0 0.0 1.0 0.0 +6.0 1.0 71.0 79.0 67.4 65.0 69.0 66.0 58.0 0.0 0.0 0.0 0.0 0.0 0.0 1.0 +5.0 13.0 81.0 77.0 64.3 63.0 67.0 66.0 67.0 1.0 0.0 0.0 0.0 0.0 0.0 0.0 +6.0 3.0 75.0 71.0 67.7 64.0 71.0 66.0 55.0 1.0 0.0 0.0 0.0 0.0 0.0 0.0 +4.0 12.0 59.0 58.0 57.7 54.0 59.0 57.0 61.0 0.0 0.0 0.0 0.0 0.0 1.0 0.0 +3.0 31.0 64.0 68.0 55.9 55.0 59.0 56.0 56.0 0.0 0.0 0.0 0.0 1.0 0.0 0.0 +12.0 14.0 43.0 40.0 45.4 45.0 48.0 45.0 49.0 0.0 0.0 0.0 0.0 0.0 0.0 1.0 +8.0 5.0 75.0 80.0 77.3 75.0 81.0 78.0 71.0 1.0 0.0 0.0 0.0 0.0 0.0 0.0 +5.0 4.0 87.0 74.0 62.3 59.0 65.0 64.0 61.0 0.0 0.0 0.0 0.0 0.0 0.0 1.0 +12.0 31.0 48.0 57.0 45.5 42.0 48.0 47.0 57.0 0.0 0.0 1.0 0.0 0.0 0.0 0.0 +1.0 21.0 48.0 52.0 47.8 43.0 51.0 46.0 57.0 0.0 0.0 0.0 0.0 1.0 0.0 0.0 +7.0 10.0 74.0 71.0 75.1 71.0 77.0 76.0 95.0 0.0 0.0 0.0 1.0 0.0 0.0 0.0 +3.0 15.0 54.0 49.0 53.6 49.0 58.0 52.0 70.0 0.0 0.0 0.0 0.0 0.0 1.0 0.0 +4.0 19.0 77.0 89.0 59.0 59.0 63.0 59.0 61.0 0.0 0.0 0.0 0.0 0.0 1.0 0.0 +10.0 14.0 66.0 60.0 60.2 56.0 64.0 60.0 78.0 1.0 0.0 0.0 0.0 0.0 0.0 0.0 +4.0 15.0 59.0 59.0 58.3 58.0 61.0 60.0 40.0 1.0 0.0 0.0 0.0 0.0 0.0 0.0
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/feature_selection_result11 Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,51 @@ +Race AIDS Total +4.0 2555.0 14443382.0 +4.0 55300.0 14704293.0 +4.0 82334.0 16641977.0 +4.0 38006.0 13888285.0 +4.0 16068.0 21845911.0 +2.0 2489.0 2367256.0 +2.0 34204.0 2410019.0 +2.0 51776.0 2727604.0 +2.0 23896.0 2276276.0 +2.0 10169.0 3580523.0 +3.0 1363.0 1542563.0 +3.0 20712.0 1570428.0 +3.0 27200.0 1777374.0 +3.0 11251.0 1483278.0 +3.0 4674.0 2333158.0 +1.0 38.0 699627.0 +1.0 731.0 712265.0 +1.0 1162.0 806125.0 +1.0 560.0 672738.0 +1.0 258.0 1058200.0 +0.0 26.0 169115.0 +0.0 390.0 172170.0 +0.0 417.0 194858.0 +0.0 140.0 162616.0 +0.0 48.0 255790.0 +4.0 490.0 14999423.0 +4.0 4788.0 15270378.0 +4.0 5377.0 17282659.0 +4.0 2152.0 14422956.0 +4.0 1790.0 22686934.0 +2.0 1490.0 2458391.0 +2.0 12280.0 2502800.0 +2.0 15713.0 2832611.0 +2.0 5788.0 2363908.0 +2.0 2534.0 3718366.0 +3.0 493.0 1601948.0 +3.0 4660.0 1630887.0 +3.0 5153.0 1845800.0 +3.0 1944.0 1540381.0 +3.0 910.0 2422980.0 +1.0 6.0 726561.0 +1.0 83.0 739686.0 +1.0 106.0 837159.0 +1.0 69.0 698637.0 +1.0 55.0 1098938.0 +0.0 3.0 175626.0 +0.0 78.0 178798.0 +0.0 77.0 202360.0 +0.0 31.0 168876.0 +0.0 14.0 265637.0
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/feature_selection_result12 Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,11 @@ +0 1 +143.762620712 -1.1796457192799998 +-88.5787166225 -2.5710918402200003 +-82.8452345578 -0.168636324107 +72.4951388149 0.991068834926 +11.805182128 -0.7096855607860001 +-63.9354970901 0.9841122108220001 +126.32584079600001 0.35353444883900004 +23.0341392692 1.03188231893 +67.6714937696 -0.8214378651719999 +47.39275848810001 -0.0942409319417
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/friedman1.txt Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,101 @@ +0 1 2 3 4 5 6 7 8 9 0 +0.5434049417909654 0.27836938509379616 0.4245175907491331 0.8447761323199037 0.004718856190972565 0.12156912078311422 0.6707490847267786 0.8258527551050476 0.13670658968495297 0.57509332942725 13.160650397398078 +0.891321954312264 0.20920212211718958 0.18532821955007506 0.10837689046425514 0.21969749262499216 0.9786237847073697 0.8116831490893233 0.1719410127325942 0.8162247487258399 0.2740737470416992 9.691298137658498 +0.4317041836631217 0.9400298196223746 0.8176493787767274 0.3361119501208987 0.17541045374233666 0.37283204628992317 0.005688507352573424 0.25242635344484043 0.7956625084732873 0.01525497124633901 15.821619961828777 +0.5988433769284929 0.6038045390428536 0.10514768541205632 0.38194344494311006 0.03647605659256892 0.8904115634420757 0.9809208570123115 0.05994198881803725 0.8905459447285041 0.5769014994000329 16.18933274618261 +0.7424796890979773 0.6301839364753761 0.5818421923987779 0.020439132026923157 0.2100265776728606 0.5446848781786475 0.7691151711056516 0.2506952291383959 0.2858956904068647 0.8523950878413064 11.33767760089345 +0.9750064936065875 0.8848532934911055 0.35950784393690227 0.5988589458757472 0.3547956116572998 0.34019021537064575 0.17808098950580487 0.23769420862405044 0.04486228246077528 0.5054314296357892 12.337142824178603 +0.376252454297363 0.5928054009758866 0.6299418755874974 0.14260031444628352 0.933841299466419 0.9463798808091013 0.6022966577308656 0.38776628032663074 0.3631880041093498 0.20434527686864423 12.880550712301464 +0.27676506139633517 0.24653588120354963 0.17360800174020508 0.9666096944873236 0.9570126003527981 0.5979736843289207 0.7313007530599226 0.3403852228374361 0.09205560337723862 0.4634980189371477 18.709003936604173 +0.508698893238194 0.08846017300289077 0.5280352233180474 0.9921580365105283 0.3950359317582296 0.3355964417185683 0.8054505373292797 0.7543489945823536 0.3130664415885097 0.6340366829622751 13.321479131556272 +0.5404045753007164 0.2967937508800147 0.11078790118244575 0.3126402978757431 0.4569791300492658 0.6589400702261969 0.2542575178177181 0.6411012587007017 0.20012360721840317 0.6576248055289837 13.269253863108887 +0.7782892154498485 0.7795983986107496 0.6103281532093938 0.30900034852440217 0.697734907512956 0.8596182957290651 0.6253237577568076 0.9824078296095496 0.9765001270158553 0.16669413119885812 16.264995170787344 +0.02317813647840361 0.16074454850708164 0.9234968252590874 0.953549849879534 0.21097841871844636 0.3605252508146082 0.5493752616276721 0.2718308491769721 0.46060162107485014 0.6961615648233853 14.294427313499119 +0.500355896674865 0.7160709905643361 0.525955936229779 0.0013990231190438296 0.3947002866898355 0.49216696990114994 0.40288033137914214 0.3542983001063206 0.5006143194429532 0.4451766288311383 11.026237192296225 +0.09043278819643585 0.27356292002744065 0.9434770977427269 0.026544641333941965 0.039998689640650786 0.28314035971981955 0.5823441702167689 0.9908928029248271 0.9926422374029681 0.9931173724810448 5.175296804362765 +0.11004833096656297 0.6644814459639401 0.5239868344883128 0.17314990980873102 0.9429602449150257 0.2418600859762523 0.998932268843212 0.5826938151498987 0.18327900063057578 0.38684542191779026 8.73494610704017 +0.1896735289121496 0.41077067302531 0.5946800689017054 0.7165860931283399 0.4868914823691235 0.3095898177667046 0.5774413728278474 0.44170781956874294 0.35967810260053623 0.3213319320088136 12.202924702612343 +0.20820724019602266 0.45125862406183437 0.4918429102640539 0.8990763147937112 0.7293604610294412 0.7700897729196955 0.3754392475619882 0.34373953523538436 0.6550352059993224 0.7110379932104975 15.547914734580145 +0.11353757521867625 0.13302868937357504 0.45603905760612395 0.15973623015851013 0.9616419037746458 0.8376157448618098 0.5201606870379233 0.2182722577281544 0.13491872253239878 0.9790703454838688 6.918543527074358 +0.7070434956891432 0.8599755569456631 0.38717262782863904 0.2508340198317248 0.29943801894470223 0.8568955284050157 0.47298399056822105 0.6632770470161282 0.8057286074367852 0.2529805046497241 13.689616365480411 +0.07957343897032487 0.7327606050157152 0.9613974775036055 0.9538047341676628 0.49049905188389964 0.6321920644327551 0.7329950198379923 0.9024095032479662 0.16224691874820008 0.40588132236756125 18.06987664088426 +0.41709073558366083 0.6955910282920739 0.4248472379248316 0.8581142260514297 0.846932479609419 0.07019911390868883 0.3017524134841485 0.9796236810301702 0.035626996553034807 0.4923926469985821 20.83271160119166 +0.9523768530135464 0.8105737585294711 0.2943304412963712 0.5962335185183412 0.43117785229972994 0.5923975029889863 0.893752104720206 0.5540211897717062 0.4928665073452738 0.3192704571895012 15.530752257310834 +0.263365783050724 0.5422806135357958 0.08226452393202399 0.6356367098253985 0.7964052251862078 0.9547475054308089 0.6846242716927129 0.48829316680509927 0.4854143101843673 0.9666929205829677 18.166185696459205 +0.21134788749712163 0.41164813817783297 0.9896655767792834 0.02841185671325175 0.7013265140935161 0.0251715638848119 0.3208817260865362 0.07352706186557412 0.06088456434663547 0.11140631670405321 11.285510796612236 +0.16926890814543094 0.627686279501054 0.43839309463984333 0.8309037646039747 0.23979218956447224 0.19005270791973705 0.7118996585829157 0.8582949253267775 0.5590558855960195 0.7044204082888571 12.860142449687132 +0.605112035518179 0.5592172832680401 0.8603941909075867 0.9197553591500698 0.8496073257589813 0.2544665354944545 0.8775555422867709 0.43513019009222575 0.729494343964508 0.4126407675387943 24.78184394518976 +0.1908360458112225 0.7060195199561622 0.24063282092985294 0.8513244268329954 0.8241022892585868 0.5252117866139705 0.3863407943061684 0.5908807907349247 0.13752361490782572 0.8082704078916083 18.086707510047084 +0.965825815244485 0.7797958042329348 0.23933508209581977 0.8672604131084306 0.8081150128937004 0.06368112422046845 0.231228304048803 0.5896854487035268 0.13748694797777417 0.6784407043714858 21.072919626578763 +0.9921906895152471 0.28575198481557174 0.7609127595588501 0.046527167666138625 0.33253590652220666 0.9445527910270574 0.6365170412547786 0.6018486061318925 0.9281846814636464 0.18167941079661343 11.264618441952907 +0.017823184026521055 0.1900721761341725 0.5218717978245897 0.49582198590367044 0.8004912055691525 0.8594363114449111 0.21295603224034498 0.43726884144766365 0.42161750906258955 0.0547173770819418 9.076668851874988 +0.009933693670982957 0.7897656793360066 0.27531321879489834 0.7177400045433364 0.4213559217565558 0.14333587216899957 0.19252168025197935 0.3138152333176353 0.8051701673672972 0.012625830357479995 10.540304759459294 +0.0491059726975559 0.5660003849850935 0.686810696154396 0.7268109050517068 0.47969376130167696 0.3676567217785285 0.8399700992017514 0.45416355245100537 0.3213658387821987 0.09271986717104153 11.236607686992008 +0.06043793213558557 0.09095116720087482 0.6827064564283071 0.6807357672306377 0.24317416588742535 0.6404614421560298 0.06913918311155143 0.8729199617462652 0.10960694983251273 0.16905576511943454 8.863543124398952 +0.46737799144534753 0.7759492194033726 0.8544445157050565 0.21038644476715873 0.07664186926890304 0.788914797103218 0.5475000011493021 0.7862548628154125 0.9200470428587104 0.4809727659278811 14.08324795108047 +0.459553670010184 0.5989791554809532 0.5993187807242845 0.5043734512337575 0.30687852974345065 0.5413529803491126 0.9249269434027916 0.9705508020302188 0.39579460989699644 0.7987452725553391 14.384836026928141 +0.6350881477509265 0.2299691652490331 0.05120709286293723 0.028463806171351802 0.1228477519037694 0.2202125178336386 0.8290227537008228 0.28549182770003945 0.7810640826310915 0.5046658125966791 9.356188456069104 +0.1384489237765847 0.778036552333978 0.9213317935208427 0.9430186320361914 0.7044357972639433 0.6939164454759088 0.546551813367495 0.36921722973788307 0.982467574726993 0.0656092254275048 19.82262440529854 +0.8976783107422656 0.26393098909487067 0.5744758420233385 0.5128662680937877 0.554476808071934 0.6471673318283991 0.1854741590544805 0.27197820430902153 0.14843865774278353 0.030304170594405044 14.786714087609445 +0.9392555841521393 0.34675413017620393 0.10956460430560977 0.3783269956614701 0.38407945904141416 0.6654236879194613 0.24449092930615968 0.661480973773685 0.09849288379186216 0.5808627476668515 17.29018333220705 +0.10686550466855071 0.5482545074639875 0.5197517077112073 0.2962341178657576 0.45572905099809846 0.03866652012956684 0.5990030248885009 0.0004867594752598903 0.5018135936855311 0.5017261216916143 7.079056484266911 +0.06066969591495719 0.9498369391498449 0.6086590451398208 0.6720026837921436 0.4627735236945656 0.7042730952349673 0.18106714116610723 0.6475821773323257 0.5681087348454958 0.9541383145344952 11.07054139657063 +0.7966902388813616 0.5853103927119501 0.4553549670732038 0.7384515305314945 0.8122362779627881 0.9272911735521501 0.8263756067215121 0.029956597665086293 0.7728028218089087 0.5217773936163203 21.42960531525592 +0.885387332241226 0.45856166708365387 0.5407225761596202 0.9077649982654136 0.5563100402768733 0.18711472229064618 0.6811113675419537 0.013846685418091642 0.38009165785093446 0.8086844901333918 21.459530154181827 +0.5761254124118753 0.15178450453000336 0.32985476037950434 0.9517731461483258 0.0303847229992098 0.7781735271559485 0.1813838598387736 0.21365686845063014 0.6525962229220905 0.14409194606082942 12.961442345162663 +0.3810072706070531 0.4057345325726489 0.6589654345726036 0.5118226737134436 0.4825851038502419 0.5240217982839889 0.8062858732427213 0.8043910806692938 0.14770043610250894 0.9934535770806974 12.704402405651866 +0.067767735751191 0.9958158069623947 0.12344969265330885 0.06192919793340079 0.7040354417782194 0.9609796529778833 0.712150947902339 0.6630813223207347 0.13367496222456432 0.1803451692283481 9.079503671616516 +0.15671586892228329 0.0904734812788307 0.9718661482450326 0.5098611302849001 0.4508774763010518 0.3297009784972129 0.49351204204947463 0.14360098508058272 0.1509202908404773 0.8153385794598776 12.251439442464823 +0.2112818837963617 0.08654232235729176 0.38725741753121723 0.8934034140221164 0.4286432979428625 0.7663040121802115 0.9952654020174069 0.020062850895111617 0.10819822866909212 0.69474267149362 11.905587280344058 +0.8906640504565513 0.4924763237765829 0.07026799039549492 0.08843736434987892 0.10620815853048937 0.20125887824678435 0.8773640053306407 0.9432225022019286 0.13563613798031937 0.8587269726838475 14.92352889377353 +0.7571582824355558 0.6861716144556532 0.8563933901602275 0.23087775291356172 0.5193379792114721 0.3433334451764454 0.6587729293586823 0.28279025386662415 0.502466433756727 0.30327751955275506 17.426955660751474 +0.5525294234343233 0.16112709705428085 0.568548964618283 0.4857098681067773 0.12751954351366868 0.5436921692300374 0.20049060873265778 0.6701608599998026 0.5581122170361856 0.2323783174916082 8.349233666783295 +0.5155884856098234 0.3149919734186799 0.8465925489214037 0.44737628027740306 0.10008522439470402 0.9015920853941103 0.8560882485516653 0.2863298739118133 0.25901477045356636 0.06637137355819867 12.26035889088531 +0.3176316716278835 0.05184299524331337 0.9441883178319019 0.7172173020432209 0.553659200161456 0.35974476987985604 0.15918230108432907 0.43295804116479997 0.2793621769098912 0.9610376321653145 14.40362888425922 +0.09813215580838908 0.40699555242514285 0.008376446001807092 0.5680589295963213 0.5766097683672401 0.1371442613273378 0.6722185660414206 0.1428737274580416 0.5092314972536864 0.36876195253012645 14.64895450617728 +0.2491073893585356 0.13628212203334145 0.11929113212325759 0.05238812645692448 0.4348993146930489 0.7707053805867863 0.8509141823068277 0.6212826674295909 0.37988768839810483 0.6799110364172396 6.661677492887992 +0.3137655042597186 0.726637982999317 0.9144831910873826 0.094895480739556 0.6649769518322519 0.35687279405119077 0.7622909202623359 0.9450056911510231 0.22374220285139934 0.05725321925421012 14.275479679694111 +0.6428018502331379 0.0887771085528527 0.6679384149986543 0.6072213851311274 0.01959981977284353 0.3937933443577386 0.4595073026861176 0.021136011560755397 0.37369090134501737 0.5655671369760998 8.51747510592055 +0.00887517698156215 0.16284534638833636 0.8981317369729009 0.35543331858117866 0.3097535151674734 0.5821566782631048 0.5221646219283154 0.8824557693517251 0.2723444648400082 0.2998200567828857 8.318683055535784 +0.3083867067948075 0.10100427170620596 0.29502169857893545 0.7289047920416258 0.34187889271524396 0.2860681555183966 0.9563476061071962 0.9994791511322937 0.3373519213932864 0.4751215567999363 10.81575853973493 +0.8296496599906129 0.09940514628180974 0.50811464169943 0.8338365663554891 0.7701229934134927 0.8160003497549749 0.051549976415450005 0.6813237878724938 0.9632936328077967 0.7009474565722479 14.7523242052166 +0.4098464718143954 0.2070405888350909 0.9560226669224692 0.40601117716635504 0.716880130904611 0.6723314084399745 0.8421371025537246 0.940740392297392 0.4698011067009591 0.10771652388871167 14.437977850974152 +0.5666853987413368 0.9797770299024345 0.4339147015301905 0.8180344364829785 0.43724959672412667 0.8105342992752003 0.22960846580858452 0.4109781451687913 0.7309511398181268 0.6373144062380719 20.303811360434118 +0.7691426808213709 0.9562240422458972 0.3760066618461234 0.8957014217970638 0.20848049565757376 0.06319643998308144 0.2394216729185552 0.7801992488254825 0.3760754415175315 0.5814837295524542 17.693211514972546 +0.2417021356737692 0.4385545867531734 0.18045227317063817 0.37312046783579444 0.8639333907383302 0.8559936753056242 0.940079549566491 0.4057399896621089 0.9823102135057693 0.4826039437830758 13.361954459981405 +0.8771207824694917 0.4088792202469834 0.31977322627438365 0.6424685981654128 0.7093654458159975 0.7423468167300954 0.604514627149687 0.8584415473916255 0.6499068382880037 0.270485889197416 19.651095541242153 +0.8584748656310555 0.1808249680067895 0.5377051151480724 0.38692991753348105 0.6195852092738365 0.5485863059731005 0.46389401201881464 0.8264448382313554 0.40099782742517387 0.6195032797683993 11.681443862998442 +0.5007091183337946 0.5008895041536758 0.6089031038167406 0.9953652409958986 0.24794951921663877 0.7384334058920138 0.9300439181805716 0.5844120756954285 0.8806471520789401 0.6920591198056676 18.519413433986806 +0.35141827940417747 0.8206994508517493 0.2370849611913043 0.9216936684824427 0.9188489045540845 0.6295307118357462 0.5122231170341107 0.29985152129987824 0.4510620990884934 0.7171435833472242 23.064480246814917 +0.2897107697174295 0.20884415472966478 0.31653691874943835 0.5732346168518381 0.46252622730189574 0.5026185641627156 0.4872415437421902 0.779227269647643 0.39013589036969454 0.7685351778741765 10.607527674342451 +0.8614682627614487 0.15345044177087064 0.6153544991431779 0.5132315524167129 0.9892656389217689 0.08282528798350319 0.7114699262161587 0.27315441706016785 0.9949414263945612 0.35472791394445913 14.379380861585393 +0.0886254141339946 0.9832503769165538 0.479242981871837 0.4821670204872105 0.5265454160436102 0.9430743268241158 0.4907038517169977 0.030130396160569006 0.9354703428207063 0.7472800008826406 10.166561408472493 +0.7304114921128106 0.10528115445790953 0.7656025630259959 0.7078790446085943 0.9225381437161363 0.5090713624505511 0.7121099683829537 0.8710483215307725 0.43066181495719147 0.48712869117962754 15.494784545703714 +0.12223180018508994 0.1900160836371645 0.5997405304143875 0.2980776286541513 0.18268336777640204 0.5030276903035737 0.9506696371583517 0.2325800919586698 0.7390820442705245 0.7616713142711553 4.822175852305057 +0.7660564796818717 0.9244958016032567 0.3228087260890464 0.6789428837728861 0.1718199895762833 0.7095739437934471 0.4893233847660068 0.441921269249274 0.6465757977985269 0.4784335817739622 16.21224059173453 +0.7809835653732088 0.5637844595472824 0.8491603722968005 0.3324874926307865 0.6876383457298232 0.31032585761982945 0.6607954615137971 0.35447467775251196 0.061312486142167555 0.44390848519873516 19.0259976096665 +0.7083258497660975 0.2574186578134675 0.6183630278806319 0.12162527851495386 0.6373243081047304 0.05829174691838146 0.04762410122741678 0.511944559203932 0.29931499088474944 0.34643613534056983 10.103164404071599 +0.6492174346036962 0.9488882701086157 0.5162418791778752 0.7135434407602232 0.5861612487888144 0.39493583813539335 0.671816525290099 0.23717057627672355 0.8482091462350475 0.2924731670105124 19.414416242542014 +0.12065632604964383 0.4311841945956453 0.2719515607303118 0.2737262760819733 0.6422025693611261 0.44991232849801055 0.9084847728691557 0.7753971680607056 0.33911251996550873 0.7037406503612524 8.615547132563627 +0.23911862145194263 0.20516107579979725 0.6839686008379533 0.41669528896656205 0.19521144746509556 0.3903295752782401 0.09852342315710272 0.32254437988658846 0.8894781356759724 0.9422719149629099 7.355002272760527 +0.6574707574441057 0.1956287488018773 0.5256787607410369 0.3108091040925598 0.5553483943313786 0.5355298073676616 0.4651129288983915 0.7678645943333149 0.8869469716865482 0.8298093684181447 9.829679628165866 +0.9588430789564042 0.9110639960968554 0.1196747838441613 0.11446859495951 0.9969650063282696 0.04000832595810755 0.8595637445186795 0.46550503372369256 0.2889983273891915 0.7332639578005105 12.890832144541104 +0.47219244963377505 0.36603378202458836 0.07374308587639289 0.8212053023334988 0.48801691478932074 0.7570620648656129 0.37107807260930714 0.2695048247626399 0.7345946354267014 0.8465645262987437 19.45300037464767 +0.7731597126964512 0.09726311997082848 0.3128848054042207 0.054297371248047455 0.9964178644970716 0.177698734352288 0.37123100482185356 0.3589325920964376 0.23918094189867656 0.19412444639857296 8.565865450206013 +0.7221568697894736 0.9963498623999889 0.6578810615587287 0.18964066816521796 0.7960500133787225 0.6331488340440541 0.05997465943644009 0.45123696414113945 0.3981555798526656 0.4574877112189486 14.089903184543674 +0.17329540858703296 0.5551602246692062 0.675575702816968 0.8264278406303862 0.753975346409477 0.03806626488278475 0.795113651901603 0.6539318070808459 0.6049933023598654 0.00079912648846725 15.627307991786289 +0.013114781463635872 0.14710484933761359 0.26562391867980684 0.06049450827851821 0.2578656308496723 0.22906133301836384 0.8240837710969812 0.20185448655187266 0.881092325628702 0.21436450568575982 3.053524927766419 +0.09124750057287223 0.7458057935231055 0.5043400350526346 0.5862020432833676 0.36415611319487795 0.5532539595411161 0.8128446991062696 0.14007325741439247 0.26762510211969903 0.7395485502578282 9.804873358542737 +0.273796078111771 0.5968614644069085 0.33862246805035456 0.07160379461501021 0.49859687569685474 0.7144913096107074 0.9906342627731619 0.30616421419444173 0.43181899369392907 0.5481835598658806 8.641240148791484 +0.5922789121550232 0.10793438223331675 0.7218030237835277 0.28781493382595613 0.7101954909298428 0.26491733998837474 0.32929177720525493 0.15393928318285965 0.30573627751887034 0.767593568436209 9.407918967360633 +0.5738480440000739 0.9717102350944524 0.6918493680668857 0.49136225796249566 0.4189538130977012 0.9528784220570516 0.14422252170336136 0.5212103058543409 0.8891494541942766 0.7243161529127102 17.58115736412586 +0.6524273028079878 0.5732108771943734 0.18508275660219697 0.6138808688662424 0.07695021292315907 0.6680945170106404 0.23147976471742693 0.2237384718444413 0.07931564343308894 0.5290531406613654 17.733483205030982 +0.292207224946918 0.5347443302731564 0.4966394675328142 0.43871374689137466 0.40966714178368036 0.2606110148444858 0.08937483777810629 0.8066866320537381 0.15657531573242267 0.9139261452578302 11.149836991525426 +0.44666536992172634 0.44940086096850873 0.08179437299051329 0.6964934161855384 0.20657215375013938 0.09570310018074724 0.7220107222790408 0.3936551862994325 0.5911130758518441 0.5127646181849301 17.392150320937144 +0.024792440847191677 0.7627946139093299 0.26576180603378574 0.9788268401766658 0.9486860068478548 0.7256699734894949 0.7255050205514576 0.050824790816173304 0.5940661143252837 0.7171266563833804 16.222823164393663 +0.04187295085349507 0.4858483334364002 0.9868242589438908 0.04782633490074317 0.5788519741372516 0.07155939791943544 0.28014174429830796 0.7018218260054466 0.16232193959804986 0.49228648720154566 8.751167952614102 +0.9545457112974848 0.5893551623652425 0.6066268202107414 0.8679865440385066 0.9365479368445849 0.14416045993162074 0.2770071902007831 0.12532193725528784 0.884720788157515 0.8267377704644704 23.39743606740882 +0.9953588810927804 0.8138696157910104 0.11914570059659024 0.9315367835142864 0.006986692731106969 0.5383962494524664 0.7825015421974374 0.8888692517279119 0.30537562757152403 0.6446775039355818 17.869735208455047 +0.12491934664885951 0.608584300362758 0.18949843940084687 0.4390658193797916 0.9704126030213763 0.06809275523457425 0.2051728622611535 0.5075719409410157 0.14050011761810988 0.9337383557266488 13.53666671909896 +0.6065454317067481 0.46153152916886886 0.8015021709095485 0.6987073120764528 0.7445573429189948 0.32516377858166023 0.17845078715926477 0.014351502625561174 0.10704972728076023 0.2730517009310389 20.2318585989548 +0.6165217754396433 0.9475792237640892 0.9064723688429247 0.965094028213592 0.33762107364119875 0.6564030876691848 0.291455780992926 0.15086922353097754 0.036932063464012566 0.5979637425112644 24.295590457548577
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/friedman2.txt Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,101 @@ +0 1 2 3 0 +54.340494179096545 580.4157780449804 0.4245175907491331 9.447761323199037 252.3175321312284 +0.47188561909725646 324.2624476565047 0.6707490847267786 9.258527551050477 217.49891878908315 +13.670658968495298 1065.1523751493062 0.891321954312264 3.092021221171896 949.4918123086619 +18.532821955007506 302.71124845232475 0.21969749262499216 10.786237847073696 69.0385890614886 +81.16831490893233 406.55138981837536 0.8162247487258399 3.740737470416992 341.61946168251893 +43.17041836631217 1661.3229093937068 0.8176493787767274 4.361119501208987 1359.065329368987 +17.541045374233665 734.7326433201733 0.005688507352573424 3.524263534448404 18.032014110410582 +79.56625084732873 150.58465705466725 0.5988433769284929 7.038045390428536 120.2598923821887 +10.514768541205633 749.6172809180189 0.03647605659256892 9.904115634420757 29.295002042749065 +98.09208570123114 223.58662823399155 0.8905459447285041 6.769014994000329 221.96451266962563 +74.24796890979773 1155.1499432690875 0.5818421923987779 1.2043913202692316 676.202880083338 +21.00265776728606 1015.4762722834868 0.7691151711056516 3.5069522913839593 781.3002704061951 +28.58956904068647 1518.1603420210945 0.9750064936065875 9.848532934911056 1480.4921951648091 +35.95078439369023 1103.9765558914746 0.3547956116572998 4.401902153706457 393.33223818275417 +17.808098950580487 513.9676635429531 0.04486228246077528 6.054314296357893 29.13372581378542 +37.625245429736296 1094.087314354974 0.6299418755874974 2.426003144462835 690.2372882885904 +93.3841299466419 1671.6965482922212 0.6022966577308656 4.877662803266308 1011.1784501808802 +36.31880041093498 459.48790885887036 0.27676506139633517 3.4653588120354963 132.2541308347294 +17.360800174020508 1704.7445419904177 0.9570126003527981 6.979736843289207 1631.554290748974 +73.13007530599226 681.726598181031 0.09205560337723862 5.634980189371477 96.36589298307057 +50.86988932381939 270.1747375569969 0.5280352233180474 10.921580365105282 151.45967058029146 +39.50359317582296 673.903510398035 0.8054505373292797 8.543489945823536 544.2313687666258 +31.306644158850972 1161.4438984999683 0.5404045753007164 3.967937508800147 628.4296697532741 +11.078790118244575 636.4017069153224 0.4569791300492658 7.589400702261969 291.03303662060034 +25.42575178177181 1172.9847885050644 0.20012360721840317 7.576248055289837 236.1147978147717 +77.82892154498485 1399.2376190930588 0.6103281532093938 4.090003485244022 857.5330814879569 +69.7734907512956 1529.9603779755726 0.6253237577568076 10.824078296095497 959.2614236165756 +97.65001270158552 397.9799362884419 0.02317813647840361 2.6074454850708166 98.08464391759719 +92.34968252590873 1683.4096118144525 0.21097841871844636 4.605252508146082 366.97302133435386 +54.93752616276721 569.734241516186 0.46060162107485014 7.961615648233853 268.10919955478056 +50.035589667486505 1295.4574551145477 0.525955936229779 1.0139902311904383 683.18750535065 +39.470028668983545 929.6815373737124 0.40288033137914214 4.542983001063206 376.6240995010018 +50.06143194429532 852.9167920201943 0.09043278819643585 3.7356292002744063 91.95318916050276 +94.34770977427269 169.0277802511735 0.039998689640650786 3.8314035971981957 94.5895295076982 +58.23441702167689 1744.4141122286821 0.9926422374029681 10.931173724810447 1732.5580336252374 +11.004833096656297 1211.179321268851 0.5239868344883128 2.73149909808731 634.7371222778227 +94.29602449150258 520.7731581793785 0.998932268843212 6.826938151498987 528.693948971785 +18.327900063057577 757.625288640914 0.1896735289121496 5.1077067302531 144.86527485195924 +59.46800689017054 1296.2989411786257 0.4868914823691235 4.095898177667046 633.9520920433132 +57.744137282784735 847.2500474585627 0.35967810260053623 4.213319320088136 310.15968510981907 +20.820724019602267 862.8525108188742 0.4918429102640539 9.990763147937113 424.8982058212394 +72.93604610294412 1383.7040602123484 0.3754392475619882 4.437395352353843 524.5916835666012 +65.50352059993224 1287.2354088081224 0.11353757521867625 2.3302868937357504 160.1571589449888 +45.60390576061239 386.6133130762057 0.9616419037746458 9.376157448618098 374.56979106026796 +52.01606870379233 482.23941725143015 0.13491872253239878 10.790703454838688 83.29980059287064 +70.70434956891431 1530.5440099665805 0.38717262782863904 3.5083401983172484 596.7877059177458 +29.943801894470223 1525.5123885477851 0.47298399056822105 7.632770470161282 722.1639132185364 +80.57286074367852 538.9397874962779 0.07957343897032487 8.32760605015715 91.27494219348714 +96.13974775036056 1683.825997970145 0.49049905188389964 7.321920644327551 831.4916692830858 +73.29950198379923 1599.8653004289727 0.16224691874820008 5.058813223675612 269.7239459214427 +41.709073558366086 1262.0008116239733 0.4248472379248316 9.581142260514298 537.7773575456935 +84.6932479609419 240.34295682649764 0.3017524134841485 10.796236810301702 111.50170710135895 +3.5626996553034807 930.0502098396282 0.9523768530135464 9.105737585294712 885.7653388336638 +29.43304412963712 1099.6875837762232 0.43117785229972994 6.9239750298898635 475.0734339263449 +89.37521047202061 1030.7283339979235 0.4928665073452738 4.192704571895012 515.8132906927318 +26.3365783050724 1011.5485978110671 0.08226452393202399 7.356367098253985 87.28262499048417 +79.64052251862078 1685.366135672789 0.6846242716927129 5.882931668050992 1156.58767097945 +48.54143101843673 1704.8805024855624 0.21134788749712163 5.11648138177833 363.57774253644357 +98.96655767792834 172.07811591269444 0.7013265140935161 1.251715638848119 156.06931868323713 +32.08817260865362 245.77958638999525 0.06088456434663547 2.1140631670405323 35.40508437542623 +16.926890814543093 1151.0697004521946 0.43839309463984333 9.309037646039748 504.9047309043652 +23.979218956447223 436.1391654612479 0.7118996585829157 9.582949253267776 311.4116762435596 +55.90558855960195 1276.4247355974696 0.605112035518179 6.592172832680401 774.4004579134555 +86.03941909075867 1628.201979434556 0.8496073257589813 3.544665354944545 1386.0052800129015 +87.75555422867708 836.5046465890024 0.729494343964508 5.126407675387943 616.502880557919 +19.08360458112225 1279.0370894799328 0.24063282092985294 9.513244268329954 308.3692869277446 +82.41022892585868 983.664481154306 0.3863407943061684 6.908807907349248 388.86234039746984 +13.752361490782572 1446.0770214276688 0.965825815244485 8.797958042329348 1396.7261450068233 +23.933508209581976 1542.444756280353 0.8081150128937004 1.6368112422046845 1246.7021204183736 +23.1228304048803 1088.990472403008 0.13748694797777417 7.784407043714858 151.49686527332432 +99.21906895152472 592.4762009911489 0.7609127595588501 1.4652716766613862 461.6107590254396 +33.253590652220666 1668.7117629371276 0.6365170412547786 7.018486061318925 1062.6838031691402 +92.81846814636464 422.4603113225164 0.017823184026521055 2.9007217613417247 93.12330768632674 +52.18717978245897 935.6524745132937 0.8004912055691525 9.594363114449111 750.7974014518164 +21.295603224034497 839.9984077101558 0.42161750906258955 1.547173770819418 354.7969452507752 +0.9933693670982957 1415.847175398454 0.27531321879489834 8.177400045433364 389.8026225581974 +42.13559217565558 359.8212261046394 0.19252168025197935 4.138152333176353 81.08093014555008 +80.51701673672972 146.2896184097874 0.0491059726975559 6.660003849850935 80.83675338792878 +68.68106961543961 1313.0024820704748 0.47969376130167696 4.676567217785285 633.5725491887692 +83.99700992017513 867.5980836959187 0.3213658387821987 1.9271986717104153 291.1936489907113 +6.043793213558557 274.244095874708 0.6827064564283071 7.8073576723063765 187.3252705855037 +24.317416588742535 1171.9395661677436 0.06913918311155143 9.729199617462651 84.5972117336421 +10.960694983251273 401.83796801162464 0.46737799144534753 8.759492194033726 188.12950260375516 +85.44445157050565 469.3569309771897 0.07664186926890304 8.88914797103218 92.70787499286608 +54.75000011493021 1410.11180659607 0.9200470428587104 5.809727659278811 1298.5238084377568 +45.9553670010184 1104.1729336900296 0.5993187807242845 6.043734512337576 663.345193848069 +30.687852974345063 1010.0331900967218 0.9249269434027916 10.705508020302188 934.7107170433636 +39.57946098969964 1430.5164919252954 0.6350881477509265 3.2996916524903313 909.3655989305239 +5.120709286293723 172.1629820113755 0.1228477519037694 3.202125178336386 21.759146841336335 +82.90227537008228 592.0512009960225 0.7810640826310915 6.046658125966791 469.80205128257876 +13.844892377658468 1396.6861430027047 0.9213317935208427 10.430186320361914 1286.885757399791 +70.44357972639433 1259.2651659459655 0.546551813367495 4.69217229737883 691.8490914986029 +98.2467574726993 232.84478566118992 0.8976783107422656 3.6393098909487067 230.95708002350815 +57.44758420233384 963.4964942046691 0.554476808071934 7.471673318283991 537.3161754923093 +18.54741590544805 569.9749650123499 0.14843865774278353 1.3030417059440504 86.61413266611218 +93.92555841521393 692.1310246846019 0.10956460430560977 4.783269956614701 120.71709895964038 +38.407945904141414 1212.7185942796432 0.24449092930615968 7.6148097377368495 298.97589013891826 +9.849288379186216 1074.5774593669562 0.10686550466855071 6.482545074639875 115.25672659315927 +51.97517077112073 609.6001089270445 0.45572905099809846 1.3866652012956684 282.63144665101163 +59.90030248885009 126.4588901391934 0.5018135936855311 6.017261216916143 87.26338001352038
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/friedman3.txt Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,101 @@ +0 1 2 3 0 +54.340494179096545 580.4157780449804 0.4245175907491331 9.447761323199037 1.3537302182704163 +0.47188561909725646 324.2624476565047 0.6707490847267786 9.258527551050477 1.5686267252541977 +13.670658968495298 1065.1523751493062 0.891321954312264 3.092021221171896 1.5563979600543916 +18.532821955007506 302.71124845232475 0.21969749262499216 10.786237847073696 1.2990215504772198 +81.16831490893233 406.55138981837536 0.8162247487258399 3.740737470416992 1.330903394043473 +43.17041836631217 1661.3229093937068 0.8176493787767274 4.361119501208987 1.5390261973034576 +17.541045374233665 734.7326433201733 0.005688507352573424 3.524263534448404 0.23388919220067908 +79.56625084732873 150.58465705466725 0.5988433769284929 7.038045390428536 0.8478202561730687 +10.514768541205633 749.6172809180189 0.03647605659256892 9.904115634420757 1.2036782417865977 +98.09208570123114 223.58662823399155 0.8905459447285041 6.769014994000329 1.113050765386626 +74.24796890979773 1155.1499432690875 0.5818421923987779 1.2043913202692316 1.4607731674987232 +21.00265776728606 1015.4762722834868 0.7691151711056516 3.5069522913839593 1.5439114159725646 +28.58956904068647 1518.1603420210945 0.9750064936065875 9.848532934911056 1.5514842721164925 +35.95078439369023 1103.9765558914746 0.3547956116572998 4.401902153706457 1.4792680312252677 +17.808098950580487 513.9676635429531 0.04486228246077528 6.054314296357893 0.9131525635743539 +37.625245429736296 1094.087314354974 0.6299418755874974 2.426003144462835 1.5162586999022116 +93.3841299466419 1671.6965482922212 0.6022966577308656 4.877662803266308 1.478312764448359 +36.31880041093498 459.48790885887036 0.27676506139633517 3.4653588120354963 1.292608359663051 +17.360800174020508 1704.7445419904177 0.9570126003527981 6.979736843289207 1.5601554747573891 +73.13007530599226 681.726598181031 0.09205560337723862 5.634980189371477 0.7092059328226685 +50.86988932381939 270.1747375569969 0.5280352233180474 10.921580365105282 1.228273691878848 +39.50359317582296 673.903510398035 0.8054505373292797 8.543489945823536 1.4981464081771367 +31.306644158850972 1161.4438984999683 0.5404045753007164 3.967937508800147 1.520958438151283 +11.078790118244575 636.4017069153224 0.4569791300492658 7.589400702261969 1.532720004888662 +25.42575178177181 1172.9847885050644 0.20012360721840317 7.576248055289837 1.4629032640882886 +77.82892154498485 1399.2376190930588 0.6103281532093938 4.090003485244022 1.4799121730128941 +69.7734907512956 1529.9603779755726 0.6253237577568076 10.824078296095497 1.4979953570128628 +97.65001270158552 397.9799362884419 0.02317813647840361 2.6074454850708166 0.09417496029834331 +92.34968252590873 1683.4096118144525 0.21097841871844636 4.605252508146082 1.316408987919193 +54.93752616276721 569.734241516186 0.46060162107485014 7.961615648233853 1.3644273530320843 +50.035589667486505 1295.4574551145477 0.525955936229779 1.0139902311904383 1.4974922509449833 +39.470028668983545 929.6815373737124 0.40288033137914214 4.542983001063206 1.465804007778235 +50.06143194429532 852.9167920201943 0.09043278819643585 3.7356292002744063 0.9950952334037717 +94.34770977427269 169.0277802511735 0.039998689640650786 3.8314035971981957 0.07152072382161595 +58.23441702167689 1744.4141122286821 0.9926422374029681 10.931173724810447 1.537178181507009 +11.004833096656297 1211.179321268851 0.5239868344883128 2.73149909808731 1.553457834819853 +94.29602449150258 520.7731581793785 0.998932268843212 6.826938151498987 1.3914803680125012 +18.327900063057577 757.625288640914 0.1896735289121496 5.1077067302531 1.4439394940411856 +59.46800689017054 1296.2989411786257 0.4868914823691235 4.095898177667046 1.4768530008487357 +57.744137282784735 847.2500474585627 0.35967810260053623 4.213319320088136 1.3835281729272806 +20.820724019602267 862.8525108188742 0.4918429102640539 9.990763147937113 1.5217750198560809 +72.93604610294412 1383.7040602123484 0.3754392475619882 4.437395352353843 1.4313105187399757 +65.50352059993224 1287.2354088081224 0.11353757521867625 2.3302868937357504 1.1494435656372273 +45.60390576061239 386.6133130762057 0.9616419037746458 9.376157448618098 1.4487434272797226 +52.01606870379233 482.23941725143015 0.13491872253239878 10.790703454838688 0.8963767176774797 +70.70434956891431 1530.5440099665805 0.38717262782863904 3.5083401983172484 1.4520425271394557 +29.943801894470223 1525.5123885477851 0.47298399056822105 7.632770470161282 1.5293204399456315 +80.57286074367852 538.9397874962779 0.07957343897032487 8.32760605015715 0.48911511072271613 +96.13974775036056 1683.825997970145 0.49049905188389964 7.321920644327551 1.4549139176354322 +73.29950198379923 1599.8653004289727 0.16224691874820008 5.058813223675612 1.2955775487583667 +41.709073558366086 1262.0008116239733 0.4248472379248316 9.581142260514298 1.4931601045151275 +84.6932479609419 240.34295682649764 0.3017524134841485 10.796236810301702 0.7081460027584869 +3.5626996553034807 930.0502098396282 0.9523768530135464 9.105737585294712 1.5667741449535897 +29.43304412963712 1099.6875837762232 0.43117785229972994 6.9239750298898635 1.508801898429284 +89.37521047202061 1030.7283339979235 0.4928665073452738 4.192704571895012 1.3966469247041897 +26.3365783050724 1011.5485978110671 0.08226452393202399 7.356367098253985 1.2642801056018358 +79.64052251862078 1685.366135672789 0.6846242716927129 5.882931668050992 1.5018836153535167 +48.54143101843673 1704.8805024855624 0.21134788749712163 5.11648138177833 1.4368860145584557 +98.96655767792834 172.07811591269444 0.7013265140935161 1.251715638848119 0.8839273983451799 +32.08817260865362 245.77958638999525 0.06088456434663547 2.1140631670405323 0.4363143388850777 +16.926890814543093 1151.0697004521946 0.43839309463984333 9.309037646039748 1.537265123522342 +23.979218956447223 436.1391654612479 0.7118996585829157 9.582949253267776 1.4937183598137929 +55.90558855960195 1276.4247355974696 0.605112035518179 6.592172832680401 1.4985413807429304 +86.03941909075867 1628.201979434556 0.8496073257589813 3.544665354944545 1.5086791210059998 +87.75555422867708 836.5046465890024 0.729494343964508 5.126407675387943 1.4279670872972425 +19.08360458112225 1279.0370894799328 0.24063282092985294 9.513244268329954 1.5088712014128396 +82.41022892585868 983.664481154306 0.3863407943061684 6.908807907349248 1.3572505259832122 +13.752361490782572 1446.0770214276688 0.965825815244485 8.797958042329348 1.5609500274635577 +23.933508209581976 1542.444756280353 0.8081150128937004 1.6368112422046845 1.551597692135967 +23.1228304048803 1088.990472403008 0.13748694797777417 7.784407043714858 1.4175683268390444 +99.21906895152472 592.4762009911489 0.7609127595588501 1.4652716766613862 1.3541649297787708 +33.253590652220666 1668.7117629371276 0.6365170412547786 7.018486061318925 1.5394991338751214 +92.81846814636464 422.4603113225164 0.017823184026521055 2.9007217613417247 0.08093567500779064 +52.18717978245897 935.6524745132937 0.8004912055691525 9.594363114449111 1.5012312283366778 +21.295603224034497 839.9984077101558 0.42161750906258955 1.547173770819418 1.5107382823434816 +0.9933693670982957 1415.847175398454 0.27531321879489834 8.177400045433364 1.5682479333649404 +42.13559217565558 359.8212261046394 0.19252168025197935 4.138152333176353 1.0243278438907364 +80.51701673672972 146.2896184097874 0.0491059726975559 6.660003849850935 0.08897131915549368 +68.68106961543961 1313.0024820704748 0.47969376130167696 4.676567217785285 1.4621800366126962 +83.99700992017513 867.5980836959187 0.3213658387821987 1.9271986717104153 1.278180794940832 +6.043793213558557 274.244095874708 0.6827064564283071 7.8073576723063765 1.5385270967777893 +24.317416588742535 1171.9395661677436 0.06913918311155143 9.729199617462651 1.279233560839038 +10.960694983251273 401.83796801162464 0.46737799144534753 8.759492194033726 1.5125018799191523 +85.44445157050565 469.3569309771897 0.07664186926890304 8.88914797103218 0.39847812418012996 +54.75000011493021 1410.11180659607 0.9200470428587104 5.809727659278811 1.5286205617962407 +45.9553670010184 1104.1729336900296 0.5993187807242845 6.043734512337576 1.5014625812811586 +30.687852974345063 1010.0331900967218 0.9249269434027916 10.705508020302188 1.5379590348236802 +39.57946098969964 1430.5164919252954 0.6350881477509265 3.2996916524903313 1.5272583174422345 +5.120709286293723 172.1629820113755 0.1228477519037694 3.202125178336386 1.3332321248119827 +82.90227537008228 592.0512009960225 0.7810640826310915 6.046658125966791 1.3934053052318693 +13.844892377658468 1396.6861430027047 0.9213317935208427 10.430186320361914 1.5600376721205496 +70.44357972639433 1259.2651659459655 0.546551813367495 4.69217229737883 1.4688002865000722 +98.2467574726993 232.84478566118992 0.8976783107422656 3.6393098909487067 1.1314039082633651 +57.44758420233384 963.4964942046691 0.554476808071934 7.471673318283991 1.463675788141726 +18.54741590544805 569.9749650123499 0.14843865774278353 1.3030417059440504 1.3549865945559618 +93.92555841521393 692.1310246846019 0.10956460430560977 4.783269956614701 0.67921924302924 +38.407945904141414 1212.7185942796432 0.24449092930615968 7.6148097377368495 1.4419753005453402 +9.849288379186216 1074.5774593669562 0.10686550466855071 6.482545074639875 1.485236760818887 +51.97517077112073 609.6001089270445 0.45572905099809846 1.3866652012956684 1.3858463757729043 +59.90030248885009 126.4588901391934 0.5018135936855311 6.017261216916143 0.8142264061570644
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gaus.txt Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,101 @@ +0 1 0 +1.1705269829481435 2.0777122322502035 1 +2.0346075615049335 -0.5507144119145928 1 +-0.07602346572462335 0.003957593987599105 0 +-0.18949583082317534 0.25500144427338167 0 +1.299748074755309 -1.733095623653281 1 +1.943262263433996 -1.4474361123195851 1 +1.1896222680291255 -1.690616826383604 1 +-0.5788258247909884 -1.1994511991939312 1 +0.7310003438348087 1.361556125145331 1 +-0.5144298913687853 -0.21606012000326133 0 +0.1088634678336795 0.50780959049232 0 +-0.12620118371357705 1.9902736497540905 1 +-0.7044181997350232 -0.591375121085172 0 +-1.5075851602643862 0.10788413080661359 1 +-0.4580269855026243 0.43516348812289213 0 +1.0936866496587212 -0.2295177532399562 0 +-0.9400461615447682 -0.8279323643658708 1 +0.46629936835718944 0.26998723863108903 0 +-0.32623805920230253 0.055676014854776905 0 +0.6901214702247076 0.6868900661384048 0 +1.5861709384232352 0.6933906585165882 1 +0.672720805709661 -0.10441114339062771 0 +-0.5999830448488669 1.5761667243192063 1 +2.0747931679465657 -0.34329768218246975 1 +-0.5444391616724643 -0.6681717368134277 0 +0.5229978045207515 -0.016345402757487165 0 +-2.9733154740508856 0.03331727813886288 1 +-0.008898663292110321 -0.5431980084071721 0 +-1.2963918071501508 0.095139443565453 1 +-1.4977203810831696 -1.193885976791938 1 +-0.251879139213213 -0.8424357382512976 0 +-0.07961124591739943 -0.8897314812650339 0 +0.8945977057600133 0.7596931198502055 0 +-0.23871286931467955 -1.429066898448291 1 +0.22117966922140045 -1.0700433305682933 0 +-0.3198310471180883 -1.1477415998765863 0 +-0.42371509994342044 -1.185983564929173 1 +0.9813207869512316 0.5142188413943821 0 +0.7504447615341785 -0.4559469274680022 0 +1.2962625863990573 0.9522756260818906 1 +-1.7497654730546974 0.34268040332750216 1 +0.7369951690182122 0.4358672525149101 0 +0.6130388816875463 0.7362052133238238 0 +-1.415042920852526 -0.6407599230105716 1 +0.22239080944544862 -0.6849217352472302 0 +1.6189816606752596 1.5416051745134067 1 +1.8765734269621657 -0.37690335016897475 1 +0.007314563228903049 -0.6129387354781626 0 +0.7470556550991475 0.4296764358626096 0 +0.10887198989791452 0.028283634823073247 0 +-0.43813562270441736 -1.1183182462554362 0 +0.30104946378806546 -1.6848999616851803 1 +-1.3969993449532836 -1.0971719846398227 1 +-0.24888866705810792 -0.45017643501165083 0 +-1.635529399380822 -1.044209877709317 1 +-0.17478155445149818 1.0172643432511694 0 +-0.5835950503226648 0.816847071685779 0 +-1.9580812342078666 -0.13480131198999493 1 +0.4223802204219781 -1.094042931032235 0 +-0.98331009912963 0.3575077531673654 0 +-1.566687529578391 0.9049741214666812 1 +0.9490047765052598 -0.019397585962465276 0 +-0.5312803768519098 1.0297326851333461 0 +0.7530621876919789 -1.6094388961729544 1 +0.13024845535270219 0.9493608646609868 0 +-0.3317771350528086 -0.6892179780897532 0 +1.703623988120705 -0.7221507700557533 1 +-1.841188300186717 0.36609322616730366 1 +-0.365461992676627 -1.271023040846661 1 +-0.8817983894830175 0.01863894948806016 0 +-1.7059520057381703 0.3691639571070058 1 +-0.8622273465104797 1.249469742726979 1 +-1.1880175973177194 -0.5497461935354897 1 +-1.7046512057609624 -1.1362610068273629 1 +-0.18501411089711395 -2.4871515352227695 1 +-0.45592201921402026 0.6491729272546821 0 +0.22239960855530486 -1.4432169952253369 1 +0.7504533303268411 -1.3069923390808191 1 +0.13242780114877378 0.022213928039390988 0 +1.8319360818255361 0.003017434031214063 1 +-0.41581633584065 -1.3585029367597998 1 +-1.3563990488613127 -1.2324345139149262 1 +-1.5406160245526137 2.0467139684821385 1 +-1.2172541306410147 -0.15726516737513793 0 +1.0269214393997905 -1.4321906110589266 1 +1.153035802563644 -0.25243603652138985 0 +0.5805733357942744 -1.1045230926622938 1 +1.7759935855067666 0.5130743788396454 1 +-0.7563523055944354 0.8164540110192858 0 +1.2369078851902253 -0.23028467842710793 1 +0.31736797594106797 -0.7524141777250374 0 +0.18451869056394285 0.9370822011089522 0 +-0.6166293716831945 0.7631836460599923 0 +0.7796263036636958 -0.43812091634884287 0 +0.2378446219236218 0.013548548628612411 0 +2.2986539407136757 -0.16520955264073184 1 +0.19291719182330652 -0.3484589306523706 0 +-1.6135785028221759 1.4707138666121289 1 +-2.0151887171225265 -0.07954058693411101 1 +0.7788223993230673 0.4282328705967407 0
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gbc_result01 Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,6 @@ +0 1 2 3 predicted +3.68258022948 2.82110345641 -3.990140724 -1.9523364774 1 +0.015942057224 -0.711958594347 0.125502976978 -0.972218263337 0 +2.08690768825 0.929399321468 -2.12924084484 -1.99714022188 1 +1.41321052084 0.523750660422 -1.4210539291 -1.49298569451 1 +0.76831404394 1.38267855169 -0.989045048734 0.649504257894 1
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gbr_prediction_result01.tabular Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,88 @@ +year month day temp_2 temp_1 average forecast_noaa forecast_acc forecast_under friend week_Fri week_Mon week_Sat week_Sun week_Thurs week_Tues week_Wed 0 +2016 9 29 69 68 66.1 63 71 68 57 0 0 0 0 1 0 0 69.8047715468 +2016 4 27 59 60 60.7 59 65 60 50 0 0 0 0 0 0 1 62.3940847433 +2016 11 28 53 48 48.0 46 48 49 44 0 1 0 0 0 0 0 51.1656331745 +2016 10 12 60 62 61.0 60 63 63 52 0 0 0 0 0 0 1 60.7602326565 +2016 6 19 67 65 70.4 69 73 70 58 0 0 0 1 0 0 0 66.2416657667 +2016 5 7 68 77 63.0 61 65 63 83 0 0 1 0 0 0 0 71.7162060939 +2016 7 25 75 80 77.1 75 82 76 81 0 1 0 0 0 0 0 78.6168727393 +2016 8 15 90 83 76.6 76 79 75 70 0 1 0 0 0 0 0 77.9015583717 +2016 10 28 58 60 55.6 52 56 55 52 1 0 0 0 0 0 0 61.4191796096 +2016 6 5 80 81 68.0 64 70 66 54 0 0 0 1 0 0 0 74.4136969328 +2016 3 19 58 63 54.2 54 59 54 62 0 0 1 0 0 0 0 60.9589968112 +2016 6 7 92 86 68.3 67 69 70 58 0 0 0 0 0 1 0 75.5031094008 +2016 12 10 41 36 45.9 44 48 44 65 0 0 1 0 0 0 0 38.5555100028 +2016 4 23 73 64 59.9 56 63 59 57 0 0 1 0 0 0 0 64.0035135524 +2016 6 24 75 68 71.5 67 73 73 65 1 0 0 0 0 0 0 74.5305649268 +2016 2 9 51 57 49.4 45 52 49 57 0 0 0 0 0 1 0 57.0110982119 +2016 11 10 71 65 52.2 52 54 51 38 0 0 0 0 1 0 0 61.876179905 +2016 3 21 61 55 54.5 52 56 55 52 0 1 0 0 0 0 0 56.0732986026 +2016 2 28 60 57 51.3 48 56 53 66 0 0 0 1 0 0 0 56.9672058242 +2016 6 28 78 85 72.4 72 76 74 67 0 0 0 0 0 1 0 78.4438620045 +2016 10 6 63 66 63.3 62 67 63 55 0 0 0 0 1 0 0 63.9639842609 +2016 2 17 55 56 50.0 45 51 49 46 0 0 0 0 0 0 1 54.149464399 +2016 6 15 66 60 69.7 65 73 71 69 0 0 0 0 0 0 1 66.1043951877 +2016 10 15 60 60 59.9 59 62 59 46 0 0 1 0 0 0 0 61.6791270097 +2016 3 26 54 57 55.2 53 57 55 54 0 0 1 0 0 0 0 60.2367595132 +2016 1 26 51 54 48.3 44 53 50 61 0 0 0 0 0 1 0 52.9547372573 +2016 5 23 59 66 66.1 63 68 68 66 0 1 0 0 0 0 0 64.6813560623 +2016 1 10 48 50 46.5 45 48 48 49 0 0 0 1 0 0 0 45.1415524342 +2016 5 22 66 59 65.9 62 66 65 80 0 0 0 1 0 0 0 59.8874932366 +2016 7 15 75 77 76.0 74 80 78 75 1 0 0 0 0 0 0 82.9044308458 +2016 4 22 81 73 59.7 59 64 60 59 1 0 0 0 0 0 0 74.8537745899 +2016 4 29 61 64 61.2 61 65 61 49 1 0 0 0 0 0 0 65.3872817114 +2016 1 23 52 57 48.0 45 49 50 37 0 0 1 0 0 0 0 51.8565179701 +2016 8 16 83 84 76.5 72 78 78 90 0 0 0 0 0 1 0 83.6982049493 +2016 8 1 76 73 77.4 76 78 79 65 0 1 0 0 0 0 0 72.4140203449 +2016 2 27 61 60 51.2 51 53 53 61 0 0 1 0 0 0 0 60.839700499 +2016 2 12 56 55 49.6 49 52 48 33 1 0 0 0 0 0 0 54.9702164699 +2016 1 31 52 48 48.7 47 52 49 61 0 0 0 1 0 0 0 49.8435633428 +2016 9 5 67 68 73.5 71 75 73 54 0 1 0 0 0 0 0 69.325684558 +2016 12 20 39 46 45.1 45 49 45 62 0 0 0 0 0 1 0 43.4575487159 +2016 5 1 61 68 61.6 60 65 60 75 0 0 0 1 0 0 0 65.0535826144 +2016 3 28 59 51 55.5 55 57 55 47 0 1 0 0 0 0 0 57.5541221212 +2016 4 21 81 81 59.4 55 61 59 55 0 0 0 0 1 0 0 76.9948007001 +2016 1 6 40 44 46.1 43 49 48 40 0 0 0 0 0 0 1 41.3862075834 +2016 10 21 58 62 57.8 56 60 59 44 1 0 0 0 0 0 0 61.0523769432 +2016 5 2 68 77 61.9 60 66 61 59 0 1 0 0 0 0 0 74.2435105222 +2016 3 1 53 54 51.5 48 56 50 53 0 0 0 0 0 1 0 54.3306325137 +2016 7 21 78 82 76.8 73 81 78 84 0 0 0 0 1 0 0 81.2097724662 +2016 3 17 51 53 53.9 49 58 52 62 0 0 0 0 1 0 0 52.1836048796 +2016 12 6 46 40 46.4 44 50 45 56 0 0 0 0 0 1 0 42.2019357209 +2016 12 21 46 51 45.1 44 50 46 39 0 0 0 0 0 0 1 45.9011800782 +2016 1 4 44 41 45.9 44 48 46 53 0 1 0 0 0 0 0 41.1820761074 +2016 10 2 67 63 64.9 62 69 66 82 0 0 0 1 0 0 0 61.3727414202 +2016 5 28 65 64 66.8 64 69 65 64 0 0 1 0 0 0 0 65.5895934942 +2016 9 11 74 77 72.1 69 75 71 70 0 0 0 1 0 0 0 74.3381013887 +2016 10 25 62 61 56.5 53 60 55 70 0 0 0 0 0 1 0 61.2657495686 +2016 2 18 56 57 50.1 47 55 49 34 0 0 0 0 1 0 0 55.5571516621 +2016 11 1 117 59 54.5 51 59 55 61 0 0 0 0 0 1 0 60.8285501381 +2016 3 16 49 51 53.7 52 54 55 65 0 0 0 0 0 0 1 54.4944109202 +2016 4 26 55 59 60.5 56 61 62 75 0 0 0 0 0 1 0 61.8372077373 +2016 6 10 67 65 68.8 67 71 67 73 1 0 0 0 0 0 0 63.9222528587 +2016 2 3 46 51 48.9 48 49 50 40 0 0 0 0 0 0 1 48.8811572638 +2016 3 7 64 60 52.4 49 57 53 71 0 1 0 0 0 0 0 62.8822601273 +2016 9 18 75 68 70.0 66 73 71 90 0 0 0 1 0 0 0 71.4706106408 +2016 3 20 63 61 54.3 51 56 55 50 0 0 0 1 0 0 0 59.7324860951 +2016 4 6 60 57 56.8 53 59 57 64 0 0 0 0 0 0 1 58.9890626595 +2016 7 2 73 76 73.3 70 77 73 84 0 0 1 0 0 0 0 71.2799971324 +2016 7 5 71 68 74.0 72 77 74 62 0 0 0 0 0 1 0 68.9560415136 +2016 7 19 80 73 76.6 76 78 77 90 0 0 0 0 0 1 0 77.0157028161 +2016 12 9 40 41 46.0 43 51 44 54 1 0 0 0 0 0 0 42.1221149466 +2016 6 29 85 79 72.6 68 76 74 81 0 0 0 0 0 0 1 74.3021609896 +2016 3 22 55 56 54.6 51 55 54 64 0 0 0 0 0 1 0 57.100481947 +2016 4 3 71 63 56.3 54 61 56 64 0 0 0 1 0 0 0 60.29402298 +2016 1 17 48 54 47.4 45 51 46 47 0 0 0 1 0 0 0 50.2034551756 +2016 3 10 54 55 52.8 49 55 53 50 0 0 0 0 1 0 0 55.1100177804 +2016 5 9 82 63 63.4 59 66 62 64 0 1 0 0 0 0 0 61.9408775418 +2016 1 8 51 45 46.3 43 47 46 34 1 0 0 0 0 0 0 45.3158658848 +2016 8 11 72 76 76.9 74 81 75 80 0 0 0 0 1 0 0 74.2995087324 +2016 12 29 47 48 45.3 43 50 45 65 0 0 0 0 1 0 0 47.8575821187 +2016 11 23 54 54 49.1 48 52 49 38 0 0 0 0 0 0 1 51.5257711552 +2016 11 19 52 55 50.0 50 54 49 56 0 0 1 0 0 0 0 53.6344142464 +2016 4 7 57 68 56.9 52 61 55 38 0 0 0 0 1 0 0 66.7238759737 +2016 6 4 71 80 67.9 63 72 66 76 0 0 1 0 0 0 0 72.7073855763 +2016 6 17 67 71 70.0 66 74 69 54 1 0 0 0 0 0 0 73.4041601901 +2016 10 5 61 63 63.7 61 66 65 48 0 0 0 0 0 0 1 63.9616628787 +2016 3 4 55 59 51.9 47 56 53 45 1 0 0 0 0 0 0 58.3547591361 +2016 12 22 51 49 45.1 42 47 46 38 0 0 0 0 1 0 0 44.7834274452
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/glm_result01 Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,5 @@ +86.97021227350001 1.00532111569 -1.01739601979 -0.613139481654 0.641846874331 3703215242836.872 +91.2021798817 -0.6215229712070001 1.11914889596 0.390012184498 1.28956938152 3875943636708.156 +-47.4101632272 -0.638416457964 -0.7327774684530001 -0.8640261049779999 -1.06109770116 -2071574726112.0168 +61.712804630200004 -1.0999480057700002 -0.739679672932 0.585657963012 1.4890682753600002 2642119730255.405 +-206.998295124 0.130238853011 0.70574123041 1.3320656526399999 -1.3322092373799999 -8851040854159.11
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/glm_result02 Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,5 @@ +3.68258022948 2.82110345641 -3.9901407239999998 -1.9523364774 1 +0.015942057224 -0.7119585943469999 0.125502976978 -0.972218263337 0 +2.0869076882499997 0.929399321468 -2.1292408448400004 -1.9971402218799998 0 +1.4132105208399999 0.523750660422 -1.4210539291 -1.49298569451 0 +0.7683140439399999 1.38267855169 -0.989045048734 0.649504257894 1
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/glm_result03 Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,5 @@ +3.68258022948 2.82110345641 -3.9901407239999998 -1.9523364774 1 +0.015942057224 -0.7119585943469999 0.125502976978 -0.972218263337 0 +2.0869076882499997 0.929399321468 -2.1292408448400004 -1.9971402218799998 0 +1.4132105208399999 0.523750660422 -1.4210539291 -1.49298569451 0 +0.7683140439399999 1.38267855169 -0.989045048734 0.649504257894 1
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/glm_result04 Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,5 @@ +86.97021227350001 1.00532111569 -1.01739601979 -0.613139481654 0.641846874331 0.5282637592226301 +91.2021798817 -0.6215229712070001 1.11914889596 0.390012184498 1.28956938152 0.5180352211818147 +-47.4101632272 -0.638416457964 -0.7327774684530001 -0.8640261049779999 -1.06109770116 0.012682414140451959 +61.712804630200004 -1.0999480057700002 -0.739679672932 0.585657963012 1.4890682753600002 0.1869842234155321 +-206.998295124 0.130238853011 0.70574123041 1.3320656526399999 -1.3322092373799999 -1.6599360904302456
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/glm_result05 Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,5 @@ +3.68258022948 2.82110345641 -3.9901407239999998 -1.9523364774 1 +0.015942057224 -0.7119585943469999 0.125502976978 -0.972218263337 0 +2.0869076882499997 0.929399321468 -2.1292408448400004 -1.9971402218799998 1 +1.4132105208399999 0.523750660422 -1.4210539291 -1.49298569451 1 +0.7683140439399999 1.38267855169 -0.989045048734 0.649504257894 1
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/glm_result06 Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,5 @@ +3.68258022948 2.82110345641 -3.9901407239999998 -1.9523364774 1 +0.015942057224 -0.7119585943469999 0.125502976978 -0.972218263337 0 +2.0869076882499997 0.929399321468 -2.1292408448400004 -1.9971402218799998 1 +1.4132105208399999 0.523750660422 -1.4210539291 -1.49298569451 1 +0.7683140439399999 1.38267855169 -0.989045048734 0.649504257894 1
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/glm_result07 Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,5 @@ +86.97021227350001 1.00532111569 -1.01739601979 -0.613139481654 0.641846874331 0.6093152833692663 +91.2021798817 -0.6215229712070001 1.11914889596 0.390012184498 1.28956938152 0.5963828164943974 +-47.4101632272 -0.638416457964 -0.7327774684530001 -0.8640261049779999 -1.06109770116 -0.07927429227257943 +61.712804630200004 -1.0999480057700002 -0.739679672932 0.585657963012 1.4890682753600002 0.2621440442022235 +-206.998295124 0.130238853011 0.70574123041 1.3320656526399999 -1.3322092373799999 -1.7330414645145749
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/glm_result08 Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,5 @@ +3.68258022948 2.82110345641 -3.9901407239999998 -1.9523364774 1 +0.015942057224 -0.7119585943469999 0.125502976978 -0.972218263337 0 +2.0869076882499997 0.929399321468 -2.1292408448400004 -1.9971402218799998 1 +1.4132105208399999 0.523750660422 -1.4210539291 -1.49298569451 1 +0.7683140439399999 1.38267855169 -0.989045048734 0.649504257894 1
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/hamming_loss.txt Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,2 @@ +hamming_loss : +0.15384615384615385
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/hastie.txt Sat Aug 04 12:46:28 2018 -0400 @@ -0,0 +1,12001 @@ +0 1 2 3 4 5 6 7 8 9 0 +-1.7497654730546974 0.34268040332750216 1.153035802563644 -0.25243603652138985 0.9813207869512316 0.5142188413943821 0.22117966922140045 -1.0700433305682933 -0.18949583082317534 0.25500144427338167 -1.0 +-0.4580269855026243 0.43516348812289213 -0.5835950503226648 0.816847071685779 0.672720805709661 -0.10441114339062771 -0.5312803768519098 1.0297326851333461 -0.43813562270441736 -1.1183182462554362 -1.0 +1.6189816606752596 1.5416051745134067 -0.251879139213213 -0.8424357382512976 0.18451869056394285 0.9370822011089522 0.7310003438348087 1.361556125145331 -0.32623805920230253 0.055676014854776905 -1.0 +0.22239960855530486 -1.4432169952253369 -0.7563523055944354 0.8164540110192858 0.7504447615341785 -0.4559469274680022 1.1896222680291255 -1.690616826383604 -1.3563990488613127 -1.2324345139149262 1.0 +-0.5444391616724643 -0.6681717368134277 0.007314563228903049 -0.6129387354781626 1.299748074755309 -1.733095623653281 -0.98331009912963 0.3575077531673654 -1.6135785028221759 1.4707138666121289 1.0 +-1.1880175973177194 -0.5497461935354897 -0.9400461615447682 -0.8279323643658708 0.1088634678336795 0.50780959049232 -0.8622273465104797 1.249469742726979 -0.07961124591739943 -0.8897314812650339 -1.0 +-0.8817983894830175 0.01863894948806016 0.2378446219236218 0.013548548628612411 -1.635529399380822 -1.044209877709317 0.6130388816875463 0.7362052133238238 1.0269214393997905 -1.4321906110589266 -1.0 +-1.841188300186717 0.36609322616730366 -0.3317771350528086 -0.6892179780897532 2.0346075615049335 -0.5507144119145928 0.7504533303268411 -1.3069923390808191 0.5805733357942744 -1.1045230926622938 1.0 +0.6901214702247076 0.6868900661384048 -1.566687529578391 0.9049741214666812 0.7788223993230673 0.4282328705967407 0.10887198989791452 0.028283634823073247 -0.5788258247909884 -1.1994511991939312 -1.0 +-1.7059520057381703 0.3691639571070058 1.8765734269621657 -0.37690335016897475 1.8319360818255361 0.003017434031214063 -0.07602346572462335 0.003957593987599105 -0.18501411089711395 -2.4871515352227695 1.0 +-1.7046512057609624 -1.1362610068273629 -2.9733154740508856 0.03331727813886288 -0.24888866705810792 -0.45017643501165083 0.13242780114877378 0.022213928039390988 0.31736797594106797 -0.7524141777250374 1.0 +-1.2963918071501508 0.095139443565453 -0.42371509994342044 -1.185983564929173 -0.365461992676627 -1.271023040846661 1.5861709384232352 0.6933906585165882 -1.9580812342078666 -0.13480131198999493 1.0 +-1.5406160245526137 2.0467139684821385 -1.3969993449532836 -1.0971719846398227 -0.23871286931467955 -1.429066898448291 0.9490047765052598 -0.019397585962465276 0.8945977057600133 0.7596931198502055 1.0 +-1.4977203810831696 -1.193885976791938 1.2962625863990573 0.9522756260818906 -1.2172541306410147 -0.15726516737513793 -1.5075851602643862 0.10788413080661359 0.7470556550991475 0.4296764358626096 1.0 +-1.415042920852526 -0.6407599230105716 0.7796263036636958 -0.43812091634884287 2.0747931679465657 -0.34329768218246975 -0.6166293716831945 0.7631836460599923 0.19291719182330652 -0.3484589306523706 -1.0 +2.2986539407136757 -0.16520955264073184 0.46629936835718944 0.26998723863108903 -0.3198310471180883 -1.1477415998765863 1.703623988120705 -0.7221507700557533 1.0936866496587212 -0.2295177532399562 1.0 +-0.008898663292110321 -0.5431980084071721 0.7530621876919789 -1.6094388961729544 1.943262263433996 -1.4474361123195851 0.13024845535270219 0.9493608646609868 -2.0151887171225265 -0.07954058693411101 1.0 +0.30104946378806546 -1.6848999616851803 0.22239080944544862 -0.6849217352472302 -0.12620118371357705 1.9902736497540905 0.5229978045207515 -0.016345402757487165 -0.41581633584065 -1.3585029367597998 1.0 +-0.5144298913687853 -0.21606012000326133 0.4223802204219781 -1.094042931032235 1.2369078851902253 -0.23028467842710793 -0.7044181997350232 -0.591375121085172 0.7369951690182122 0.4358672525149101 -1.0 +1.7759935855067666 0.5130743788396454 1.1705269829481435 2.0777122322502035 -0.45592201921402026 0.6491729272546821 -0.17478155445149818 1.0172643432511694 -0.5999830448488669 1.5761667243192063 1.0 +0.6044235385892025 -0.9070304174806991 0.5920232693603779 -0.4370644156515733 0.10177577296931657 1.3083468266441474 1.3876018114085524 -1.7353911473330734 0.28837742022732415 -0.33908543327636353 -1.0 +0.5273691328244136 -0.3743028837477471 0.47709229741768444 -1.4297626622362145 0.4077065249765084 -0.828280392745567 0.4234572818376501 -0.15951736500333072 1.2410820871966046 1.6635363107373078 -1.0 +-0.661937714925914 3.465227148479317 0.39143861927191975 0.3272453529764515 -0.31134706056867467 -1.4246555886796946 -0.6248721853412322 -0.1099953959208559 0.9529594279919252 -0.9833626436429376 1.0 +-1.0945571896156956 -0.24134874955198468 -0.5951138391567017 -0.9828118947823061 0.08822993442548502 -0.602759369823714 1.1255554529825982 0.9270532988002531 -2.2691569946862655 -0.34817063773317436 1.0 +-0.1640254026760564 1.2165805903649096 -0.6268539047283007 -0.2749398078895973 1.14745743851399 1.1599689740750685 0.702184505359777 -1.28390481061431 1.5223077678776793 -0.17996331764913345 -1.0 +-0.37614736761593637 0.46034921066168377 1.455421460737774 0.2415068878754467 -0.03766667059723912 0.8315330299051433 2.299369468755593 -0.9396024430587621 0.11182257854217889 2.5394320331114613 1.0 +0.40359841542535574 -1.8848343873195796 1.2774520318648948 -0.44558826380657596 -1.2703180389254833 0.6355011681954533 -0.2984356710923274 -0.4022899215971822 -0.5366404268123247 0.8231244016664833 -1.0 +0.025191903274544 1.5175361283542563 0.3696111506737348 -0.4806321621688906 1.0423327430213356 1.098875986566869 -2.132910373907718 0.7592043314019562 -0.2851808701227014 0.4804114112715212 1.0 +0.46800068820276425 2.7090019473659184 2.019086116729861 0.7474034182399546 -0.5897085867477189 -0.8134248245767957 -0.17689686434453186 0.5070475019762871 -0.2667781642372559 -0.8560620219978579 1.0 +1.5593148568891022 -1.0926888646283135 0.7580424981657605 -1.199439969467994 0.1763704781550424 -0.8757308415987771 0.11760845626656423 -0.958168335581346 -1.8811146489414055 0.1823427274870421 1.0 +-0.5484922802752095 -0.0526349697724523 3.1733905239619795 3.334203517597432 1.6033719963489919 1.0128962309550167 1.8445232062556762 -0.3361436284769567 0.49875048880422795 -1.0778260770671824 1.0 +0.5769340599430341 0.08652484860757291 0.38378884838187516 1.3347307577271426 1.6717911886146681 -0.3130077315757537 0.12355262918532725 1.5477291028255866 -0.10788917679723521 1.0033975572213907 -1.0 +0.8876717808262652 0.08864979057352633 -1.3245780959402302 0.2383846452550063 1.1966614601200112 -0.46484257027188 -1.1366727112923867 0.2484946248806814 0.3506928143980163 -0.13207671471324264 -1.0 +-0.5256451948154732 -0.584889332459948 -0.9292471979014248 0.39841641960968166 -1.3559078555972999 -1.7115830531175702 0.15859859636139104 2.1324867288289617 2.7213336098665635 -1.9728640480783795 1.0 +0.5398129189913056 0.5431731800991407 0.9637445310773097 1.2537261342634507 -0.22013056376799153 -0.25227004044698087 0.01003713940839754 0.48028838228527204 -1.9569675522430627 -0.564484658307677 -1.0 +-1.163235822180662 -0.021175774300496716 0.33107168261445835 -0.3664962494470602 0.8604754069049109 -0.24659729953406678 1.490533097267343 -0.39939137701024663 0.3252062923168107 -0.6542808538079327 -1.0 +-0.01912275129904966 0.9929416493373554 -0.1295965590136687 -0.1708304076874391 0.7904280904722739 1.0918159072154612 -0.40508326392063543 0.5364439368681257 -2.1313146599852018 0.2630766894332881 -1.0 +-1.2710579854942345 0.9291001132966914 -1.9314128569290476 0.02421534060406341 -1.213691539345214 0.1881369570559398 -0.5722638992074314 2.745117964775073 0.12495397935004156 -1.0652461548210312 1.0 +0.6030536979033265 -1.0614676369216434 -1.5164304957203023 0.32928250529485964 -1.9836209428041778 0.16713678370411497 -0.1788939995187421 1.178239159200306 -0.44340798605665754 0.7389539007599524 1.0 +-0.15484845483449294 -0.08605564337254189 -0.3357568385230854 -0.1366293792823912 0.09277642496734965 0.18971879197958597 -2.048671922604096 0.7837860781804775 -0.2329845615794952 -1.1844114274105708 -1.0 +-0.1977972902611956 -0.8546727892795731 0.02359749586524577 -0.1704564684096478 -1.0696662666401626 0.22583874577075078 -0.8676594983663888 0.41841523883774684 -2.305258151983712 0.1621555997620361 -1.0 +-0.5788411209471953 -0.3992846345441018 1.4878944321336367 -0.35781685235193555 0.35643089395408944 1.0312821968019672 1.5225430928104695 -1.0164811121806232 1.1284147518659724 -0.9272485993677742 1.0 +-1.1927713830291693 1.3748594175398903 -0.7032369510661453 0.24420707079596798 1.0323459107790158 1.6169399021897064 -0.05483023725936617 -0.24801134827199994 -0.3967249498631411 -0.033547027338664666 -1.0 +1.0329180459160618 -1.9898222399382914 -0.2780337171101295 0.7656954261085819 0.7441495680026682 -1.7231933239653434 1.0303924263130786 0.05971477069293665 -0.9342158375564429 -1.0624411368884286 1.0 +-0.6294458606293386 -0.3022844248616988 1.0396388948858852 -0.9309696527726209 -1.277629080640249 -0.9443200259389776 -0.3188074229604005 -2.0842708835548924 1.2703115446925113 0.030877752980638058 1.0 +0.6531758521433048 0.558346902284024 0.13639753659343484 -0.33733841113672913 -1.337165050885127 -0.41149095236240474 -0.10777619396316224 0.5229173631509835 0.9561499786482655 1.2033205926353625 -1.0 +-0.9762315218209106 -0.0751525704189141 0.35280658284312694 0.049037461548016935 1.2860174671016282 -0.26722530141904327 1.3242380220962733 -0.26759192177397656 -0.4694062226879811 -1.4257562814463445 -1.0 +0.8054921061469411 1.3547691398570894 0.8255591814670258 -0.2586895904715146 0.7574995244231507 -0.7044557030990274 1.2113185073849615 -1.8422341740345995 -0.36824556412752163 -1.5479925634100813 1.0 +-0.45167227065102006 -1.1375423986557498 -0.13587675227718632 0.6343790937890923 -0.013557918030451043 0.3758968273279556 -0.23658235285975457 0.9791413360462421 1.0937481979752155 -1.3836221562341127 -1.0 +1.0101338828657191 0.8726631262318649 1.0376123351490436 0.3025477016355275 -1.2981174812942935 0.8478637181249223 -0.2688763993683175 0.30198299200599726 -2.2719054986176683 0.7576049876525334 1.0 +0.8760511854123076 2.1562199933480133 1.2887025562956078 -0.14253519602584672 1.6659047027918155 -1.380114296433079 3.85793967348964 3.075573893432424 0.830819563694863 -0.8782681675417305 1.0 +0.13986220576101485 0.7125389403746353 0.3596237434172795 0.7127480011897636 1.0687856807518747 -0.4951739548431622 0.132962280436304 -0.08289852500467178 0.21421904746683115 0.692696057131838 -1.0 +-1.9081847831366037 0.11653331605849324 1.7551741656764832 -0.3955656348590421 -0.9325834567618385 -0.6735645547992268 0.714532047991697 -1.790003919076157 0.22430285295477725 -3.209955381978046 1.0 +1.5235848315795288 -0.0696156591485477 1.3655901991926498 -0.5586953357167566 0.2753934759411781 2.4009183113212806 -1.0110351209554707 0.9425068791712249 -2.221510823700524 -2.585767588999438 1.0 +0.6889213621579444 0.041274574202699865 -0.49772668445684926 -0.009847287471481413 -0.5176603237193814 0.30217682520827216 0.7734409975442094 0.988208848486463 0.017600206923097966 0.8198061540197786 -1.0 +0.687759695794799 0.39315819224910903 -0.5108631934878929 -2.752037662677927 -0.19206908223922012 -0.23406889069910192 -1.6014139415281856 0.7910261496852212 0.012866884184724063 -1.3485118844184532 1.0 +0.8660591728218054 0.7912949804001552 1.176952513690748 -1.1654317335035704 0.5382460975045578 -0.8428605517089753 -2.874968879865529 -0.5285056361126661 -0.32108899071015246 2.182275910834502 1.0 +0.32870245607283527 1.4480014208760492 -0.43728724254382445 0.9114744851303214 -1.1268282836571295 1.114733892631557 -1.2265674316518074 1.3552725615328403 -0.08885766708388806 -0.694949123737318 1.0 +-1.0144720406973653 0.8712160137184647 -0.9194792276680201 0.2876311214263635 -0.5327923727826095 0.16564178605539887 0.016672373423269438 -0.6314322515594253 -1.0040158066788205 -1.3120985315266447 -1.0 +0.44682624679647864 0.14853198602056514 1.8363081603106133 0.1396675784886334 -1.7651938506826501 1.4476040528943543 -1.1417786944082575 0.7464021537026985 -0.46902780374760905 0.7869814652437135 1.0 +-0.1820208348243829 -1.003380717730042 -0.9369221110721804 -0.9442706004373587 -0.7275212508545039 2.0654861372867295 0.1360612935062583 0.20181386383006028 1.2707549044789055 -1.0034745347115275 1.0 +-0.7323378102483927 -0.6479921130452116 -0.7855214383236936 1.7347311831934773 -0.44615385943239716 -1.2399203282859266 -0.29178644639701495 -0.6601392708428152 -1.0917976649357448 0.5648569127221107 -1.0 +-1.9445402822954807 0.26393122365044175 1.5387536595031532 2.397073067233959 1.5562083709832442 -0.20268282272443056 -0.1089062616381093 1.1352016674683758 1.0097935422904265 -0.9134206948382958 1.0 +-2.2292589330885986 -0.46273031364217426 1.6282076357873105 -0.0758997670485449 -1.3945327153213618 -0.7799983027126963 0.6986307702990094 0.4729134646484038 -0.2724518087709634 0.18479275551351085 1.0 +-0.3389835320929106 -0.14231230753550203 -1.44904592785806 -1.3227165003614927 -0.7109024225989671 -0.606184110109761 -1.0722422723792842 0.5454540297228883 0.5391724452767099 1.1988239385167685 -1.0 +-0.07684033970519674 -0.6933878511104847 -0.9469760525902353 -2.268619962246101 0.21359010083019977 -1.265057694018798 0.9636968648987307 0.5183435151558969 0.5900261263151266 1.1311811909202247 1.0 +-0.1090739625676252 -0.05816611715256052 -0.8425159924738271 -0.7529456042925735 -0.48256531456153773 0.5245478462345327 -0.2645836803644654 0.3530051834614323 0.2238241190906629 -0.37219899010144253 -1.0 +2.6474189892831026 0.1332902420274303 0.8100978673990902 -2.066453723784956 -0.3284080793917298 0.2854489945462638 0.9127282586749043 -0.8853951972314839 0.662893215100046 -1.548077411041423 1.0 +-0.5558744255462802 -0.20939878024355807 1.8398709351830922 -0.012035767922212968 1.544249561568332 -2.185153803257982 -0.9052536407792096 0.21306591909620448 -0.9657156624472774 1.0094897718684082 1.0 +-1.0122112207459872 0.9050528629328798 -0.9129893226159165 -0.45036832301510676 1.0407174952822522 -0.7555250892846609 0.42441824827810354 0.06644430233106957 -0.08799540550164092 1.954430088902813 -1.0 +0.5679433816499357 -0.1016379743818435 0.0692509618345264 -1.1616019467282765 0.32702615652721884 0.5673334205644196 0.9015922583874204 1.8771428706377922 0.4306132751340653 -1.190784254860191 -1.0 +0.2262121311410064 -0.5693165703158743 -0.7322607097367665 -0.711741585516688 0.05687216122626013 -0.8234988716333305 0.30663585257868975 -1.8338737352874381 -2.89224040536514 -0.15859132011071364 1.0 +-1.5316018230959503 -0.5779462669917929 -1.9059055368464786 -2.008942616762241 0.23889598302964352 -0.5084528851522548 -0.04826170379593097 -0.03502705018890768 -0.7273069057149364 1.5183620699261768 1.0 +0.36102541634537905 2.576977679031155 1.5873212424728582 0.687677616154882 -0.018212347104613166 -0.5895820679190702 -0.7301662802248373 0.13438281144361666 0.9715535632493052 -1.0583794427218747 1.0 +-0.02860552628379647 -1.2522775141080984 0.10659762229930982 0.5422573331869172 0.9912188508026412 0.2872129861981349 -0.6359698186412605 -0.3785028025591672 0.01632286834064877 -0.20958795245614859 -1.0 +0.3214442712943701 0.23351936921649144 1.0149522887472011 -1.365343241823016 0.27653105409089324 -0.9552158838227957 -0.2605126207976518 -1.3274909827312888 0.03730765585464991 -1.4526406739111428 -1.0 +-0.8276017374999237 2.2921936458109897 0.6278876784461687 0.9527052435093047 -0.8296277386100398 1.1604663708722944 -0.3115251054922687 -0.5393910228200474 0.540432755366913 0.1406950564673274 1.0 +1.2382624131362387 -1.2855738604138573 -0.7804341795136254 -0.4661721263852442 0.096940343318409 -0.45823039827601697 -0.07936631605575531 -0.3182853136155345 0.9195436457578192 -0.5611773427197669 -1.0 +-0.4101120092081721 0.06812570823584903 -0.09891912036094928 0.23925986087456783 -1.2674959941594357 0.0915712442891479 -0.16935301763051838 -0.8856978941958283 -1.645607964622266 0.16979751913292426 -1.0 +-0.1378586963310319 -0.07149411774529733 -0.38621990548929036 1.3449502719441988 -1.081258571215189 -0.06307879670506915 -0.50356048600791 -2.050905763049373 0.087257980752205 -1.3294456177962388 1.0 +0.7563768879274201 0.8242892015046335 0.37967322200031345 0.5242236519537231 -0.45271329511708064 0.687592786751324 0.9167469515279244 1.1197161016785873 1.2635448363305384 -1.4561055975293318 -1.0 +0.32128693891873533 -2.4370266994140035 0.9733737109300644 -0.642481126749871 0.2928325635717791 -0.46398126201591683 0.38673364020325446 0.6724964425333426 -1.0909759530149077 -0.5270034201986623 1.0 +-0.30440284592936967 0.770818433376395 -0.23575096986827987 -0.17778292517384178 2.288635291333243 -2.5289475108846857 0.5677535540962639 0.07355255089438108 0.7483241867237762 0.9146566431112833 1.0 +1.2522315626273022 -0.8847286012386693 1.175609480746336 0.4796962084572591 -0.5899674340661235 0.8621689184981023 -1.4726571262457677 0.6523101983645719 -0.1516899652786653 1.3432368831212602 1.0 +-0.6594840624629351 -0.4090657931046078 -0.33858048238968697 -0.3966186853856485 -1.4582418462866669 -0.010906592167949567 -0.7665729756746352 0.8421724903224964 0.7918792014178204 -1.317627725338646 -1.0 +0.013153036557870796 0.15323002771333824 -0.7863950304118423 1.3681052191345213 0.004008795533567026 0.453194204359973 -0.4063786899313203 0.6841194893268114 2.883969251775838 -0.5881887751399346 1.0 +0.36522540717596585 0.3231095013887879 0.5824042646735971 -0.008457486200020091 -1.7236514338073596 -1.0255372547670172 0.5349275937487872 -1.6500251948243565 0.6689473090641462 0.2803223035037342 -1.0 +0.40271751266444333 0.59519151467352 -0.04489492214522473 0.6453464430821444 -1.1274591498928925 0.2245144207327693 0.10571095020938731 -1.0013467840435817 -0.1861816445428681 1.9979515177687335 -1.0 +0.5725567515972323 -1.3687162010707115 -1.1577200461261594 1.0658262297925543 -1.6549967992364703 1.4771353822876396 -0.9328609421342365 0.13042091725382485 -0.031028697570925873 -0.08768373982573438 1.0 +0.6177594707762792 2.8857517953922764 1.7598211003608997 1.0913309075290665 -2.2134606073911924 -0.023980761898605114 1.2372535126873845 -0.45619206614093344 2.124745399513117 0.2407422845881994 1.0 +-0.05864391264016893 -0.8739999199474732 -0.12278570026442888 0.9117965623133085 -0.10746411474278562 -0.7274708346047783 1.5957629012804186 0.9877470273404159 -0.4881110169164618 0.6296948056302356 -1.0 +-0.4533996984310992 0.6090995914299342 -0.8522489506584864 -0.05454962931514019 1.0907946273414781 -1.8463416145538356 -0.41243382161399256 -0.41546602951164513 -1.3017565892197434 -1.1360989745400003 -1.0 +-1.7976375781681988 -0.6615569434901911 2.5492856987737014 -1.6376756241371526 0.006317661817300752 0.5417126512741955 -0.13210003839031914 -0.378736298456714 1.9406228046678644 -1.0418743710911664 1.0 +-0.28559377932836866 -0.59892262579212 -0.3823403780460225 -0.9859808115749349 -1.3644765720109107 -0.823533424001803 -1.6813868155498577 -0.9162199391704404 0.5436279322698345 1.5248626005482613 1.0 +1.1974173477959238 -1.2225052973966217 -2.023763530020729 0.0537117476660896 -0.5362903624231383 0.10714253527293145 0.6151521853927577 0.9050654404010442 1.6525856413988107 -0.8428196875999223 1.0 +-0.06340532135397717 0.48905360189011937 0.7045354278052993 -1.0717355675879099 0.4137586484133794 -0.345025274037323 1.2401898182121198 0.10342901781618742 -2.1418516144035475 -0.6836501416815086 -1.0 +-1.1807980275906318 1.1810021618172988 -1.0660552581621128 -0.7430459223148423 -0.8859252495127169 -0.49581833514279516 0.527387687628702 -0.30175139488690217 0.35564438892659067 1.3281321131436516 -1.0 +0.2380742569517034 0.17185882517030615 1.1167682468088798 -0.013688855208146944 1.2829097566144694 -1.1299710458171193 0.7587214440890531 -1.0986042355701349 -0.3029040483924579 1.49961056170431 -1.0 +0.14614254213307512 1.9034164161920542 -0.3062063943698761 -0.45706533906364627 -2.38861407368411 -0.8617991799058063 -0.5343938353030584 -1.2626042854762183 -1.0231988412194268 0.5384660112416041 1.0 +1.7165027742351253 0.17912390469970796 -0.4559683500449692 0.32669169909966733 0.6819648840132921 -0.7379887070817857 1.3263448403293359 0.9270035239969678 0.21309224825039347 1.3283330921381156 -1.0 +-0.2108673539727271 -0.6769151658288148 0.1351177762474505 -0.16425303413718284 1.099720527820615 -0.5857366554551754 1.0326537546555192 -0.786824522255031 1.617741961423047 1.7668617516726024 1.0 +0.026714277801613007 -0.6938752020747251 1.9753281712575461 -1.2203869916654786 -1.1314983848532563 2.527070920782692 -0.7368148416525208 0.2499136810467275 -0.4072015719616529 -0.5283333516589073 1.0 +0.7000452723146847 0.07455981071053643 -0.09180805144899466 -0.8105601159173703 1.9998578404574014 -0.790472710889662 1.2720349278692757 0.12340670941539608 -0.14471976544476078 0.06339992712334852 -1.0 +0.031047952046710476 -1.7390992728519505 0.08649405653783686 -0.49104596911569837 -2.674354948547689 0.6443593624326104 -0.14505356097389743 0.8116910518786606 -0.24481231922778438 -0.696350741910387 1.0 +0.44909883424446956 -0.823087860995007 -0.402495596969506 1.385783766454507 0.5845207431072055 -0.24814981566368804 0.32847783781427603 1.1430734254415746 0.7158372997438407 1.3508013650170736 -1.0 +-0.17345609362160444 0.03192366589002642 -0.8603704762851204 1.4178789398571483 -0.21636159151507584 -1.0154893571166628 -0.7259753124258116 1.2277054932407083 -1.1264854630318841 -0.601702497867707 -1.0 +0.26686482080895313 -1.0280706824933712 1.6204683987456092 0.07902571896854252 -0.5695736471796179 -0.14829295739477777 -0.1504880604676619 -0.887961134764646 0.28675094725200034 0.2859729425182367 -1.0 +0.3074302518646544 -0.6575191404509574 -0.1251848370827014 -0.9041652092433549 0.07971000908831376 0.4892337648335795 -2.267876921091358 -1.4363920287788075 0.5923394212109696 -0.12518243894874598 -1.0 +-0.5372191508425196 -0.8699566545276876 0.2098594845826785 -0.6514435841992149 0.7644150970416564 -1.0594997311547119 -0.23003580655162623 1.8847060544535634 -0.5498117799824236 0.25069797962239826 -1.0 +0.2629482684151777 0.40492907257520244 -1.6024845301638289 -0.06048301501585981 -0.697530591149039 0.1503781049950916 -0.07780687825586112 0.1252126858419551 -0.9984660716843727 -0.255975214092637 -1.0 +1.479116981117545 0.4759463602670577 -0.18580560212243427 1.0540424748134019 -0.7858761582110539 1.3190200056340993 -0.17228886477186073 -1.8460295965152045 -0.7247573669263252 -0.013805770284701622 1.0 +0.5844426958957524 -1.079448951686073 0.7146958272683516 0.22357751470350606 -0.9060867789442381 0.21453403707113433 -1.4313384494982322 -2.2704132021611114 1.6680351279664263 0.6877174913431068 1.0 +1.4692083028521956 -0.4470343315836607 0.9692133398427439 0.8466872377493828 0.6108180939736211 -0.6652888855585158 -0.5390686415774785 -0.5699517962545901 -1.4893434370374596 -0.04884518704139992 -1.0 +0.5499305970570395 1.3048378295965286 0.5223109585785488 0.8438100462780511 0.055686488142052015 1.563792608618236 -0.6380407350109051 -0.7047392202425459 -1.0466273798176675 2.049778771444076 1.0 +0.3899429971033616 -0.2279594058376745 1.2652993760910154 1.6850310129308619 -0.4307541449118705 2.4944056179800698 0.6062782036825521 1.897495684900051 -0.3652339819814644 -0.3501200079640903 1.0 +0.8968935558620045 -1.2961422703619865 -0.7661022207718267 -2.2362527882016288 0.046327557310846944 -0.05535106725613376 0.42491286095294456 0.6228215147539629 -0.20458977846842988 -0.9035207258064066 1.0 +-0.7077880082031884 -0.28824269480756903 0.3752751708285271 0.04209531864771717 -0.0899568402734146 1.3144282945889445 -0.2055219060653654 -0.9611185195569437 -0.8770797047105753 -0.3493805390110045 -1.0 +0.6595634650916563 0.6790203045104227 -0.4093739891492758 -0.35331772809174306 0.4293192866086668 1.3487878682901 -0.2728913561712938 0.18393634027606567 0.5588657879489666 -1.3713232471471188 -1.0 +-0.33064387147695085 0.4522332723500524 -0.5305183143587244 -0.28145821900384405 -0.6441278738693271 -1.1300262257452833 -1.1617665339422667 0.16933309281863 -0.059698139612798386 1.105836446597426 -1.0 +-0.6618912758728542 -0.35850443734187276 -0.07117035012372852 0.09786380091576943 1.770668260834617 0.7161109143496656 -0.25203469271235573 1.668179441254334 -0.833481645415412 1.165181781246556 -1.0 +0.16824138572933983 -0.0970197604214342 -1.108371640458861 1.1631257343736865 -2.204226920077547 -0.12336287720355432 -0.4391047192362273 0.6299876168291397 -0.8695507065224324 -0.6080810819389247 -1.0 +1.1993328107538388 2.7250208073497655 0.45076298555579936 -0.8394777244112416 -0.040195475275759104 0.8850898918686639 1.5860651416439473 2.02577923393804 1.5303010308595233 1.8327334301292564 1.0 +0.9689045577333327 0.170770931967963 0.7079943796338916 1.3016102245353771 0.377426024051308 -0.787901129200937 0.9282123550423084 2.0333233170635046 0.5812629099886915 1.560723423781778 1.0 +0.07371157701560777 -0.022356711144941453 0.6855820937261274 -0.22007309599774338 -2.068890495355913 0.6336131127287113 -2.340925516401822 -0.4198460795464502 1.0173191686261756 -0.38910754054643126 1.0 +-0.7372621615773305 -0.006598203487616498 0.27650295204355396 -0.5852677365383244 2.2812721074024944 1.1535198870555938 1.2972505366193468 -0.22290652406605962 0.34421346303858386 -1.998282087632246 1.0 +0.5515401814060694 -0.8347002345785401 -0.8106258122291109 0.10382736210532115 -0.2885403301648238 -0.9294976841312648 0.4487887875734142 -0.5560681594651091 1.3099523237532418 -0.6863958655184795 -1.0 +-1.1332472710708152 -0.16433173228337156 1.0604911834109119 -0.5296495025503906 -0.4208166097429164 -2.593049387823186 0.28768107786745795 0.8101916422542774 0.10193764725371153 -0.2805096318513892 1.0 +-0.5777727170864493 -0.24321111498677203 -1.4925201736211136 0.24204583536789437 -1.4130407277334363 -0.9453346120985947 1.5221528599715186 2.000672024084738 -0.6563789851711918 -0.4729131940164531 1.0 +1.746256318275166 1.443087583454784 -0.9194491847633625 1.0901528926431487 1.0925633619786013 -0.32415019818829954 0.8237126081224749 1.9550554438780816 -0.6511305169582245 0.968886848221698 1.0 +0.4202392504617797 -1.7077148903852681 -0.005924072251181685 -0.7404970062580767 1.3521367585609907 -0.6449885420999844 -0.1551428089500599 -0.06865025280146782 -0.43232000255589664 -2.197691926666584 1.0 +0.892257884749868 0.14386099595965895 1.275597323305137 -0.46898715506363886 0.4741248277718854 0.66839521890313 -1.2047158798971238 -0.8511320881692872 0.8991245292770655 0.9371915337062796 -1.0 +0.9535866516994639 -2.2051034645754948 -2.281305792694086 -0.6116310759188245 2.8097011435732293 0.17584571165005292 -0.6307555906525206 1.8555455403701624 0.16029074988453906 -1.4228495469631228 1.0 +-0.3676598535224105 -1.8862883675077626 0.7548220931778789 1.7812245781622742 0.6526294599846313 0.2375037940405147 0.5942014265411584 -1.1329343313282814 0.4974278727895833 -0.24423451883692596 1.0 +1.0406815179638391 -0.2670710335696844 -0.6772836861850628 -0.6716078230151616 2.6256144457846546 -1.1168006401508905 0.9362535725466031 -0.5661823837482267 -0.5053469214826972 -0.8664172853019196 1.0 +1.397031114430776 -0.8619219742938617 -0.11515634319648775 0.010536697447195188 -0.5196163599941902 -0.24957125769621874 2.2436594507282206 -0.4829965988829622 -2.3689801750315524 -0.9215808226333405 1.0 +1.5190033138842483 0.5524984188665393 -0.6926816136990898 -1.0600082591583286 1.4671555504106528 -0.1679131727874871 0.7597959068113311 -0.2086217318530937 -0.0482216355946755 -0.18337459189215918 -1.0 +1.2830307747086311 0.6847631554909649 0.5078271760432795 0.41614597578860496 0.1429569524514458 -0.06162756634039431 -0.31480674559033817 0.6610574334671373 -1.094868489559057 -0.3473542636872249 -1.0 +1.3583611934492914 -0.2980589001770356 -0.08008290659022492 0.49468129909971936 1.3733264119781319 -0.9287657608462492 -1.0562806080043665 0.2022550669003972 -0.6782509079000207 -0.022012467048051917 -1.0 +-1.9003696914644261 -1.0239364192571805 0.21506804700839205 -0.5266982026448499 -0.524434980542717 0.547052797574943 0.11873192576862872 -2.3053224234261527 0.719991138685963 -1.2845045596199125 1.0 +1.3569787876682777 0.48468627798385755 -0.2561154143302568 1.3546263068343696 2.0759505803869307 0.6668801993571806 -1.0137197024379423 0.19659506908435523 0.2108731700382351 -1.5523887064375035 1.0 +-1.1106346720321985 0.4504456177691022 2.2803112732391826 1.6925906279849425 0.8841718182048186 -0.5384799446573829 -0.37667434221349183 -0.43238636618530835 1.580659829411814 -1.6847064151587414 1.0 +2.135839579661295 -0.012045236853271031 -0.29108659019024025 0.5624562546330725 0.7315635547473112 0.2080936834521666 0.14688445026802582 0.5095493726194038 1.5405555309799355 1.6862402750755072 1.0 +-1.1769248912579864 -0.1895277822930986 0.034288605346101064 -0.3339099307005731 -0.38212536558313037 0.9727972485358709 0.30867526144867835 0.45675680055100876 -0.3597035854371358 -0.8476549112820619 -1.0 +1.2116386663488123 -1.5451347924726995 0.6830976831702715 0.35618373486097415 -0.11846930012185257 -0.12660063112597814 -0.35432027228237667 1.6226344780340827 0.4878147649765918 -1.1219892377344292 -1.0 +-1.2718116679596179 -0.24320231504242704 -0.5666412777157238 0.630742979769623 -0.12917328933680922 0.8308526010187456 -0.9537377215409267 0.46020710543895615 1.6608354030583428 -0.7640402478085184 -1.0 +0.12771181052702799 -0.8291825633597693 -0.5004744114139862 0.6876259510533493 1.5345529929213104 -1.0372415290485972 -1.1409669611458368 0.586065961267128 -0.7203819922636215 0.3136974470241752 -1.0 +0.5708166717972424 0.9114872277854996 -0.3022998396168013 -2.091922245950683 -0.3783418745400049 -0.9778311716440287 -0.5024439301629023 1.1137324694427062 -0.6702242261982462 -0.3544401787737543 -1.0 +1.6359138753477174 2.929660893432376 1.0249635446624175 0.8263678474871072 -1.204722529676112 1.103931098477063 0.41080891898717925 -1.1632958763488586 -0.711126068648103 -0.7776883945882607 1.0 +-0.7014811472600427 0.5167863504871545 -0.4143994932544478 -0.5615847942521986 0.3437170326220349 1.7475220863842662 0.5398998770150264 -0.49519737438896855 0.46301689909689936 0.23737629933432333 -1.0 +-0.5918632272605117 0.6551705283348923 0.09451199914284816 1.183412573203491 -0.2216084475817371 -0.7767689612363475 0.05633894424120396 0.36247267480026046 0.43035789354356024 0.061607686265927775 -1.0 +-2.8186530025073595 0.827177562356735 0.8621190134296215 -0.5240201725381137 0.5558064722220939 -0.2997158513385201 -0.8570825503940438 0.6675880922360743 0.9417552666999109 -0.646962111575448 1.0 +2.297885578997527 1.276247945989341 -0.47009316461768835 -0.7192061272862257 -0.15806847832806897 -0.5482813446368637 -0.6950098823438737 -0.5080798628815741 0.8451070985370979 -0.3641863572992026 1.0 +0.10415185780639113 -1.1327291781835451 0.9951843831205078 1.5038046653372112 -0.35779084437972 0.43925107369417943 0.9761767931804848 0.5485566605075846 0.27987375745446136 0.4605439023890654 -1.0 +-1.8155995691953226 0.7389509974901849 0.33409134205811086 -1.1366259127066474 0.33687080618689497 -1.93022327109422 0.9404548194318197 -0.07844206283832174 -0.6885408976578092 -0.7230597875372071 1.0 +0.814324613537393 1.2140595171215174 -1.6119503393696952 0.38265856161425904 0.8459134704189475 0.32351256640857523 0.17759075527122256 0.022725782621203446 1.1092738552242762 0.7463122829548583 -1.0 +0.8493202690407095 -0.7171971284211488 0.6271956315522539 -0.844608668797061 0.12548690045124972 0.01971106661270503 0.3312851879047735 1.392872207641418 -0.365800592740796 2.2751079842809023 1.0 +-0.41089883250021403 -0.863695134710848 0.6091057104482803 1.2619572530223984 1.2455241795966359 -0.6045175428606584 0.2092762944699149 0.06886762106070753 0.920622863636502 0.8686502617410066 -1.0 +0.11248681150043587 0.5333662646860791 0.2657401234141504 0.5106942988951843 -0.6255334005329436 1.1907316086258812 0.6701565503321437 -0.5369047713298828 -0.8750993854125558 -1.3820347260227162 -1.0 +-2.6192806035910072 0.5861653271698655 -0.7624907593835051 0.6397705674189378 2.1560252861535147 1.0854940115848073 -1.5795988238989795 -0.0843840216296024 -0.10678367894303217 -0.8713026470236783 1.0 +0.7085263301324782 -0.17704463664703687 -1.7077448427289017 0.49356800079005453 -2.2668849557948265 0.9592831641658773 0.9973927328851383 0.12372879270054708 -0.6987088119151889 0.29032122469609184 1.0 +-0.8707192095484595 1.4456183940991385 0.4949902726326138 -0.8451664655381013 -0.2628130337984583 3.1974829539733727 -0.0010588423370812654 -0.37829745272534815 1.0110108162654712 -0.6334300503835257 1.0 +-0.5856061645692245 0.7771447267055485 -0.7685061144460843 -1.2970277152025405 0.7375706675328788 0.7529184295240164 -2.306182941147614 -0.809273033397095 -0.23693404546697278 0.3239072506712229 1.0 +1.0720688438114894 0.08645024003597679 0.12369973790391253 -1.0622293344492408 -0.8347039847535137 0.8983820725024066 -1.1004879462237114 0.6338708137850724 -0.9152704846639929 -1.297471755359271 -1.0 +-0.4322117530530746 1.059455516811933 -2.1595920504682318 0.2736075032324234 0.2178924553288528 1.0759409181533681 0.06937008395653746 0.46665199638203264 -1.5287869947378168 -0.9256383920977915 1.0 +-0.6631329812615014 -2.274070053731467 1.1667980284973485 -0.7249330776348837 0.7411405179848544 -1.0020134142607244 -0.7316650418582739 0.5963143554325262 0.5363444440333102 -1.379225616134922 1.0 +0.1390867505544731 -0.06451309551365764 -0.09527290234272089 0.3379535699933314 1.5807860908438993 -0.6953396335230776 1.5870889370740489 0.40043811487947506 -0.6418145875587414 -0.6926221975020497 -1.0 +-0.5627558800719191 -0.4694866980716366 -0.9429787966287079 -0.3586531509541748 0.5813591730005884 0.11220827271785544 1.5988127102205738 0.30430567959512733 0.9287687328933728 -1.890064241013992 -1.0 +0.9911844589581342 0.5476098176306101 1.3874400614164746 0.8696564647003973 0.5418393251037328 0.5706552646301977 -0.2677426807372017 0.39242735549607893 -0.7126300388983264 -1.2510825198094822 -1.0 +1.7893962060023398 -0.38542737502404606 -0.33937719999794 -0.4653767839296524 -0.8543980754353178 0.17840259925316965 0.23731164772086588 0.7427861661062981 0.24930998597507595 -1.9315293250980572 -1.0 +0.7929518975841817 -1.5376848226493998 1.3897142939008622 1.1836559269554183 -1.23787039502056 2.135545601595113 -0.1667210430129357 -0.7169675793179096 -0.4438538195629017 0.6325447969724978 1.0 +-0.3704887551777182 -1.9260882651788052 -0.9895111468738925 -1.0938410824485512 -0.01527361681359736 -2.2724393778493805 2.5707645107660437 -0.055598926892828825 -0.7091400944632673 -0.7448891733298583 1.0 +-1.1604505895963486 0.29442208903978195 -1.0099153635800724 -0.08405908275243704 0.6364125215344348 -0.12031642840440407 -0.29672975912512006 0.2543420370586476 1.6347076109296752 -0.7216707082208504 -1.0 +1.0219251961145952 0.19299500589830051 -0.47729389928282157 -0.27166980167059496 -0.24751855177125084 -1.1322412716856916 -0.8110222905403106 -0.10473605798933078 -0.035928362941471184 -0.6534723222613076 -1.0 +-0.8154578692172377 3.2529008023011587 -0.32230874972038603 -1.5958813690320397 -0.9471392661729446 -0.4661557022161254 -1.1963099714035128 -0.6788102101595077 -0.2281547965833843 -1.4737655176136435 1.0 +-0.8116419957449114 -0.093173526942104 0.11250426233136833 0.09207904862564406 -1.3867146526153864 0.8282908984570213 0.009430420454783334 0.38416436496131556 0.7831220308214599 -0.028677866459869465 -1.0 +0.5748209312636592 -0.22085148462505744 1.483178916134393 0.5384714676400842 -1.93736462781153 -0.7742446220627313 0.9863681649066736 1.1375377820834534 -1.328483968518206 0.9314007484353164 1.0 +0.4152987016284749 2.565917360177608 1.3110909185719273 -0.20429550994058496 -0.5277830403219427 -0.05624642393738156 -0.18726676450257188 0.41535786515366985 -0.180323324487924 -1.2377573117811096 1.0 +0.40944806598520256 0.9710150739398405 0.055893360103507414 -0.13442562190597213 -0.7935082792305357 1.2485130631114325 -1.1446482896282357 -0.922849593193101 -1.5573740255791648 -1.153885792720572 -1.0 +0.49790841207097386 -2.338273386722357 -0.7735959733304064 0.6807164316349167 -0.7210278452213854 0.6232216740312264 -1.3283248730961463 1.8356854615940046 0.596469164632437 1.11694972800202 1.0 +0.952868090977543 -0.5457976028267867 0.5450784715193229 -0.9275320032879893 0.5568882027647745 -2.6545414330136725 -0.24928762363265858 -2.533714900686942 0.20604165648494577 0.5416161166668478 1.0 +0.5219979705833208 0.563949339433897 -0.05818985492234962 1.0778035873134737 0.6791380636681086 0.49256225202705956 -0.10405164557505987 0.07530237581078959 -0.38465598282466923 -1.6645104329617095 -1.0 +0.39058426076124503 1.3925260779906183 0.16841451395907342 -0.3925687758796 -0.30229931902300344 -0.5383113936858084 -0.40544947525878355 2.308417411264717 -1.161481950236712 0.365229811440301 1.0 +-0.3876465197231077 -0.32107571525219936 0.14753580887585138 0.32032143845469147 2.4540699865725952 1.48165499306989 1.3912563489889982 0.6065672606903332 -1.3270484988969211 -0.3071043136579491 1.0 +-0.9436975883785224 -0.7878701909688464 -1.041432014546035 -0.9819405159147886 0.850917690412449 -0.03764483160530487 -0.10897822398419477 0.2702901295410002 0.23171425886031422 -1.5288911390500588 -1.0 +1.4864063190360182 -1.6282177718096182 0.8515169424047723 1.5754546206896403 -1.751877375915603 -0.6674561400646665 0.6228160705098441 -1.37673177011338 2.257105652325047 0.36492588017405486 1.0 +-1.2768418032135684 -1.4794523507233939 -0.1685525212259554 -1.0534077869037715 0.44210387411914803 1.9197425585151304 0.9729328493326022 -0.1293144508869995 0.6322480767243195 0.6500211894577178 1.0 +-1.0413287186178035 -1.8994347398217741 -2.2513351691435166 -0.5091252178684762 -0.4773688571263915 0.8826732417762103 0.2220474489058974 0.9023035325256057 0.5047301964557872 1.27770675903322 1.0 +-1.91867051463498 1.2395346950463286 0.13276628757162603 -0.934163742863351 -0.6753613928234674 -1.1173468591748723 -0.9193386835215931 -1.6450597503739999 0.49964503885837985 -0.14793977663719407 1.0 +0.8010132025641555 -0.6561683914188803 -0.7303432134669876 1.052612213798156 0.20588204620130146 -0.7089437447106754 -0.27750871888408135 0.5253208656130269 -0.10263740350804132 -1.4718024022204228 -1.0 +-0.1720016407720518 -0.03485269020051633 -1.1259395963309522 0.11353638062792963 -1.8022338122384196 0.07794539839355762 -1.6455630924194975 -1.0832724606105695 0.27391970907521396 -0.22261666691449442 -1.0 +-0.6712985654658538 -0.4248872082482339 -0.23156601234163043 -0.25204009950055384 -0.03998527731893999 0.08845019567417375 0.7332010817000086 -1.7952223314367777 -0.8608340520871763 -0.3592844573981156 -1.0 +1.8615079791293867 0.07567969491410388 0.31671759658978915 -0.14088196706510941 -0.7959490828613497 -0.1957764631453973 0.3164135992879402 -0.8404959717607442 0.6950459152988785 2.5743774170572635 1.0 +-0.03850183629652526 -0.8831810933826825 -0.13261465381720608 1.245927327198678 -0.029215350616095467 -1.2447555297812523 0.7090071647807351 1.0932651544462924 -2.1179586882142183 0.5546032137785528 1.0 +0.373804500701193 -0.9447523971864591 0.6579063466555688 1.6907271573797713 0.19795807338872481 0.46313191383624364 0.16805519074751002 0.1433734811754914 -2.102572569565361 -1.5345185879811143 1.0 +0.5422009876544758 0.021137383803465484 -0.3913427396826717 1.1754220486327704 -0.1624128633612627 -0.32967599007509585 -0.6698999135505094 0.7957538616832794 -2.065460023750255 1.6479521897098153 1.0 +0.7916568619310699 0.026047949725217002 0.11980403894989199 0.4003349452088214 -0.532841258887561 0.5515228283280346 -0.04328498355773543 0.8360216198318237 -1.1019079628019965 1.8392396126142838 -1.0 +-0.8392787196734521 -0.9032612795228153 -1.0360155745433912 0.3584184300730976 1.6113278152934578 -1.1228714088538807 -0.00573629616464749 0.6785975071445123 0.7355141369648618 -1.1163298319323551 -1.0 +-0.42149791592154057 -0.8111909845152905 0.5133516206804658 0.5596049961465585 1.2372073277017173 -0.029767490708398948 0.6416766584030617 0.9613836526151365 0.021426850029034692 -0.26229033898779025 -1.0 +-0.8915907659902134 -1.0470853844510801 0.7256572920466966 0.8819141124077602 -0.24574077501449448 -0.6757986185783482 1.2732961690694489 -1.6422409059255298 0.11342576959257727 -0.7695159796932176 -1.0 +-0.9805822175698738 1.1710835036186504 -1.022439014153252 0.6323801688030679 -0.05879930999668546 -0.9621286662467072 0.8865990603268918 1.2650377385436393 1.9715212116479575 -2.194508803044697 1.0 +-0.057433473373490536 -0.5245170611148295 0.38976152676692705 -1.8915231712948801 -1.422653305437163 -1.2208600182797968 1.0533466475472533 0.42840060230529514 -0.49295571686581857 -0.8806309088471742 1.0 +0.5922088885647733 0.29682919133623076 -0.16467980281744263 0.2809370647501584 1.555888799783944 0.7458685849761907 -0.13393665804209826 -0.22214270831377508 0.43052180752145397 0.4102475225820112 -1.0 +1.457891544806671 -1.2523484066972168 1.3078130817146612 0.5956840523360536 -1.8473075659892315 0.05745400435124221 -0.4187251839163349 -0.7501323680171557 -0.35339746345380346 -0.5447691136683901 1.0 +-0.6908757450709337 3.6952997783501327 0.2540683382751721 -0.6497124569242408 0.585573607109268 -0.26597152644485383 -0.0788291979323768 0.7279390358755751 1.366949742955891 -1.6668805022599866 1.0 +0.3378011936961394 0.2079153346487379 -1.4988550541024916 0.9240925660100396 1.10919976721021 -0.8273725927527698 -0.8323621287038554 0.6853887592652913 2.0545326852812407 1.3910864838548966 1.0 +-0.2809232061201644 -0.48057596253157536 -0.24394028298366904 0.15383110884472104 1.9209391740285784 -2.471385542282654 0.1798731371545325 -0.5795073006729192 -0.8735195279560218 0.16597253072044424 1.0 +0.12864079034853612 0.004739821932777124 -0.14454495683807528 -0.9552885645951718 1.4737155224727905 -1.6829282968038337 0.7205167404505212 0.25820545739708217 0.7295539837812798 -0.49036321851585124 -1.0 +0.15571555789835304 0.1447498147110094 -0.5560116328869547 2.035112955294972 0.6657168027518681 -1.1608780143872193 -0.2272470773680726 -1.1455605077655542 -0.09382341620634098 -0.38713935944426353 -1.0 +-0.7917222269620469 0.801759770989161 0.141568200123504 0.11944449842230251 -0.5947131506390755 -0.9110894569987914 -0.21406430482932137 1.0320175821509128 1.0826263769551498 -0.6898432731353442 -1.0 +0.10189135481818157 -0.7470853046062996 1.7887899813212826 -0.6998980011621436 1.0263267172366544 1.1820482266236412 -0.6398412692249618 0.6930439757683763 -0.7353984733490649 1.4324451728810224 1.0 +0.002039989312795594 -0.05242307406751564 -1.4916482971486642 0.3503493253178818 -1.4304583513209488 0.5636399400377983 0.13284630812697834 0.6400652771209987 -0.024541300619146538 -0.038054654908441364 -1.0 +1.6540693588717 1.0077215829577184 -1.7790052198085884 -0.014624478743989654 0.6762497993725941 0.21076381406530026 -1.8618023512041566 0.2773460749128965 0.11957236699383392 0.09230308711426082 1.0 +1.0209239802272385 -0.5123607632950907 -0.04100745586155637 -0.33997777557902475 0.57406693541952 2.6628271918309028 -1.3683019563925773 -0.5927440624976305 -0.4985029881803607 -1.4491328383391289 1.0 +1.0479255394356404 -0.7097112074705344 1.1101865526683756 1.7212311976518058 1.6427267909939458 0.42604107028869614 1.8922403900043392 2.2255099612336893 -0.8836138953907986 1.0286079931145995 1.0 +0.5872594680978843 -0.45186439475168905 0.4742240303458316 -0.09572608603916524 0.36767347630475355 -0.2759071848328467 0.7257751086155199 1.3525883572448814 -1.7155404770963167 0.6894265106536129 -1.0 +-0.7172101122622849 -0.6258061948132327 -0.04862094515232531 -0.2835219064516102 0.020754117929975585 -0.6006192810888252 -1.1833638011279208 0.9812209106546904 1.0562356622512707 -1.3510974100758113 -1.0 +-1.1927082123484898 0.9059064556897761 -0.11033751258126516 -0.9668870356169144 1.5697333822572919 1.094534222872464 0.962437095583402 0.906700812097106 1.7602727182818783 1.0176284959132584 1.0 +1.6418534367248823 0.9787815967593494 0.45187539696617784 0.7517268573418665 0.4596208416025718 1.2175215926968426 0.41889930681094917 -1.0340715190019967 1.6461506538132258 -1.194368281479641 1.0 +-0.24434612500459743 0.8905795299551568 -0.5866455215458722 0.030531942351904175 1.5141044751068355 0.9293797179956591 0.5915653121373462 0.1407303175871868 -1.5214526807706006 1.021842667698157 -1.0 +-1.5822767860023326 0.5095145953119626 -0.3568770116156504 -2.2175685002493553 -0.5916821178781952 -1.2565064162970065 0.670571381059279 0.09924302883049717 1.5947769886550391 -0.9412733772954048 1.0 +-0.7385535329801526 0.19762742151241033 1.3557367974480028 0.5383065810535187 0.03551647259451544 -0.867003744799122 2.1780893391993934 -0.15880038306288738 -1.2309562517581967 0.2753602396027737 1.0 +-0.7688810631336986 -0.9792940772146265 1.1373522391416644 0.7008739180657806 0.5920515593160753 1.2598793765169944 0.1322846980257473 -1.2663524708219718 0.21908701821238732 -0.011800144206460887 -1.0 +-0.9253439813451969 -1.2524149439011607 1.4930226357142633 0.7854764528549868 -0.9027164538332099 -0.9333172012444224 0.5045797654704761 -0.036368833910613865 0.856155556836564 -0.051342912704208085 -1.0 +-0.3295430326335301 0.4548291714968719 -0.1594703264438506 -0.674331185486303 0.5601231610303146 0.9889128942913799 -0.446148032803478 -0.42788233263563014 -0.6510789642920245 -0.9385192820557556 -1.0 +0.38117292894343124 0.9364639460195264 -1.5928398829912223 -2.113494174527808 -1.7825335343918676 1.4449448654579424 0.365744491258538 0.8446652659045594 -0.590898304466056 0.983494902139982 1.0 +0.5759844406328872 -0.42120753173040376 -2.1752608562496487 0.8790187243834333 -0.6224258458551829 0.2749149959814443 0.19290973969550157 0.8322105519422051 0.6142851481201329 0.8851025149493374 -1.0 +0.48843220829071704 -0.47756825940893144 0.3764827219613796 0.2545873339241572 -0.2690378414815943 0.1273419395036818 0.6865082699832734 -0.3027387373729808 1.0800426342444311 1.532265249006984 -1.0 +0.6914348836708955 0.4049321078802233 -0.6241068764943583 -0.427783729987251 -0.5969293929158517 1.2246640552123897 -0.19278078851350763 -0.44838400048471444 -1.005297599943295 0.20618061071078814 -1.0 +1.4362901237563246 0.9729826951781718 1.3742180951336622 -1.2577357193446648 0.44267472266842484 -1.1052352429148984 0.751514201601818 1.0575306323740594 -0.5007833154550767 0.45993715118448286 1.0 +0.6560105088937781 0.005411040577460287 -0.737470633061621 1.1188902572116768 -1.0883669920250287 1.1835867409108132 0.3747819439333432 -1.0219953285263044 -0.20161303094544727 0.5008709554970783 -1.0 +-0.08454378176961004 0.06581590910791382 0.010182301205252762 1.7798243766533453 0.09721144394744807 0.2745242951730754 0.6114749324736095 0.3445533288016556 2.2414953786592435 -2.084639132454187 1.0 +0.29278037857569916 -0.32718066974612353 1.2374525408589556 1.0699691016892268 1.6795083582836285 2.6116720650317333 -0.3840869293209991 0.40445166836461177 -1.24677147070361 -1.2863441677084697 1.0 +0.1680772018666437 -1.362046957534967 0.5090308956583095 0.36586657398015354 -1.0101818427081926 1.3308530886738394 -0.7610443564264088 1.2702174634982397 -1.8420765927960854 0.4955700482049656 1.0 +0.6277206416217667 -0.28759791546421387 -1.0585617060817396 -2.20224147187092 -0.5300397580425709 0.6639947087477739 0.6903518195188416 -0.16525156924899576 -1.4238739032547831 1.7508021778248384 1.0 +0.6101809585146623 0.021983403711540825 0.05052246940084612 1.068809358298806 -0.5306282317454503 -1.577757912047736 -1.220352388121859 2.1045309968729025 -0.37333697669245425 -1.256736509931358 1.0 +0.67702986849365 -0.06329423876550211 -0.7854454500269243 -0.6596664669852498 -0.9920219309311785 -1.3480593072410196 -0.5218516926866221 2.4473464215266993 0.12593047317490033 -0.7734723290170594 1.0 +-1.6255296971778601 -0.8496028332724122 0.9854634218314932 0.35213740144334865 1.9025139205319999 -0.382032524538817 -0.48685100067278825 0.027027199178539327 0.36588164236314136 -0.16602861813409478 -1.0 +0.5404022758199989 -0.22359822709110108 0.2617010365210662 -0.8788256991222697 0.22338152449598941 0.2759418990779069 0.06464925530843595 0.25129617537815985 -0.23892745611740313 -1.2588940133861541 -1.0 +-2.5055621691037677 -0.33917079652490056 0.48349270599591304 -0.3323784630878313 0.7942499554780703 0.06333222100800502 0.5545025154210302 -0.7619025738249727 -1.0742220300731438 -1.2499063145267277 1.0 +0.9028676909648012 -0.40831520780284386 -0.33375727444634623 -1.0860944718884409 1.079404273274736 -0.8339293547395862 -0.9066933774116075 0.47914430143706177 0.42444351582043344 0.9966835305932787 -1.0 +-0.4585623717703027 0.08476026448906594 -0.7517887703057032 -1.0602489433219269 0.6105405603036862 0.40627103433728035 0.06945486058985327 1.9247295220379417 1.4539247011274994 2.0862381838376853 1.0 +-0.33901502980395704 -0.9472427030108499 -0.10187157236010007 -0.5649699251726251 -0.2805354315283516 -0.33665621874795576 -1.094112401850779 -0.5350047996610439 0.05140356784039861 -0.46015395801657283 -1.0 +-3.019478289127564 -0.8034789084221933 1.0155312441539965 -0.8423798812727651 0.6029855042946175 -0.021126861661468852 1.0596196518981214 0.5935863876326577 0.8621616676795987 0.3015015601554714 1.0 +-0.48152007909040123 0.12213336537981243 0.4667625263465448 0.29207422144612344 1.1905032745203572 -1.1644960047852317 -1.9118384764938943 0.5767659350881928 0.3129448076130652 -1.3664558272112886 -1.0 +-0.32094617970991796 -0.03218742948789234 0.9242571884155808 -0.10530188835403416 -0.1471363794092325 0.7639739519567249 -1.7750661246399277 0.5439800733216288 0.16920718894614695 -0.9260164082022244 -1.0 +-0.023876597295284383 1.285165082287723 0.36501060120400836 1.957147485251539 -1.5246206669302385 -0.5226247989378464 -0.8027494032332249 -0.5154219727994211 -0.5622819737026037 -0.6457140460803893 1.0 +0.5944669002646673 -1.1489963195247355 -0.8191788097193523 0.1834038489640686 1.9331494051476352 0.06339719161509598 -0.13231336136075628 -0.613147286313191 -1.5652686351165574 -0.97217252028459 1.0 +-0.17271456198533477 0.3318117528760616 0.7176342868325969 0.9238046790574793 0.7087684072732814 0.6326611553098112 -1.661077645229176 0.031528885502400274 1.6090347711218371 0.47177761480283514 -1.0 +2.0468956858442504 1.2229795703374287 0.6293960998434666 -0.9902737266289515 0.7855210421731049 0.744750904240967 0.6048503597711237 0.9479135293583886 0.02919824227611224 -0.1532949994121978 1.0 +-0.808253278056905 0.7148458150529693 0.03837002381133596 1.0886277258418602 -1.4201810549223448 0.19773612678223465 -0.10630799215816454 0.01777062822279798 0.35644111212353585 -0.14474255579499676 -1.0 +-1.2525300719713104 0.17099173202803972 2.7763254588000312 -1.2200783739047856 -0.34153074332485567 0.45476536272575707 0.23842571206455815 -0.11660753330508225 -0.48053705721973694 -0.1414497929074891 1.0 +0.7461143573591915 -0.2324492035301729 0.8550308458376977 -0.08217955576858212 1.227917194888763 -1.014912045053364 0.5826351796035163 -0.5605490108921727 1.5188709127713413 0.47973453921572196 -1.0 +-0.4848700259763014 0.18552322332850749 -0.6475897026924888 1.7643068907799073 -0.7623451772061194 0.1583505914466949 0.9389037772943867 0.6290985070965912 -0.32383251498638105 0.9517123999002982 -1.0 +0.2018708184922912 -1.1791149052826604 -1.1102859959976457 1.1454614336543856 -1.6270171962609803 -1.016235867126816 1.6557042382271825 0.4480092560521237 0.6324830961433667 -0.3293872870576077 1.0 +1.7609482909501006 -0.2731028334753048 0.926485195456782 -1.078985711212504 -0.580865395477609 -2.729044357089719 1.1020000973238673 -0.484610482060817 1.143988351254438 0.5991729916158207 1.0 +1.1171287573337647 1.6302750092650247 1.757352397931975 0.19216480176474013 0.6628117661526611 -2.0629441646040836 0.4435442534411382 -0.9662136543845258 0.18686589206270993 0.43966891204060843 1.0 +-0.1846462299060448 1.3034169184403073 1.0139442850591336 1.1956678167282278 0.9050264189533831 0.5604533970480537 -0.8770332527050415 1.538379851802693 1.7335413254921535 0.33781442919692056 1.0 +-0.24077939121999706 -1.3836466853338705 0.2762461940304474 0.16775394441283006 0.5209334119987634 1.6719726008266134 -1.1365518925887945 -0.6796747635067687 0.8957657547250679 0.9382279927349255 -1.0 +0.7930605524518372 -0.042382357726280115 -0.05705869182666073 0.031216052991360762 -1.3208173667695051 -0.21899848103126462 -0.42039445805125514 0.3100086777490648 2.180496319638774 0.6696772854660646 -1.0 +1.2990494852142003 0.7779730855208029 -0.5369847731644571 -0.18085904537193154 0.6254161731374436 -1.4107230271446614 -1.7136969019583213 -0.20792927144826429 -0.4432442621231197 0.21044802246357056 -1.0 +1.3371703539009159 0.8499909381531157 0.6554100699036137 0.5179461774231867 0.22641983526200565 -0.5240694201011481 2.7347220680651043 -0.34408047191205804 0.5732667698824925 0.1918011993362733 1.0 +0.5338752201638095 0.14259804246315522 -0.8295259483463495 0.24350121915887402 -1.214230449042842 2.140719635848265 1.3568188596698891 0.5146796450521871 0.3248884222147333 0.7496886609970755 1.0 +-0.5426344721669722 -0.9077853251360676 -1.8344258214845997 -2.189700557749177 0.8300700962365736 2.114972180111325 -0.36828110384225976 1.9408210391643 -0.8419015179841862 1.689279695660335 1.0 +-0.35241187715519434 -0.12169176759295995 -0.15487598945340703 2.4725130171322265 0.3679205193485643 -0.40139670771987895 -1.2854017963577087 1.624561836467517 -0.06673601881932618 0.32899969445642957 1.0 +-0.28519943718191715 1.0150680787154869 -0.600344327643504 -0.22476104884445314 -1.5619454906072574 0.5183963822937636 0.17884920877518767 -0.45540169600100905 0.29544075938586684 0.5438110446247724 -1.0 +0.24107892253465105 -1.4415215016608294 0.2502178683621191 0.5222957480920298 -0.6034812400286401 -1.590448585076191 -0.33384317523740825 -0.12214358859249375 -1.1820949222971797 0.5486006434913371 -1.0 +0.20734902788956122 -0.40800572079704767 -0.9847091574385742 -0.05325385960763708 -0.542557289278743 0.09498250661407558 1.8399714829058864 0.29505979145211914 -2.042499754030473 0.17774789041522038 -1.0 +-0.9811605302559214 0.5794306891279211 1.0475864823232 0.35384034605852205 1.7583556507338916 1.3239304992040541 1.7223972327686636 -1.6114291773243108 0.7811876559567983 -1.943568898471209 1.0 +1.7975728050475188 -0.2874425533098609 -0.01667833844315343 -1.6125403234856799 0.5182024680825486 0.8290558829961522 0.7413309178765323 -1.5378931704299477 -0.362006277249694 -1.103255160475914 1.0 +-0.43432765000649476 -1.0682041983192245 -1.8433302877699238 -0.27274824801804165 0.3488053490863389 -0.8600943494291856 -0.34606254157301014 0.1419471025452551 0.09826733603966904 0.13537551720562466 -1.0 +-0.21823473396034013 0.3807530101111061 0.2387255314389622 0.13454766011679728 1.6397105994939052 -0.614485139414611 -1.3590305596230507 -0.5872785126160613 -1.9435556958049454 -0.21788449197404788 1.0 +-0.9752585589861398 0.1843759532156277 0.11425073663180842 0.8443467794344975 -0.17082205638355702 -0.30948092562896473 0.4542808191914004 0.3060751549116735 0.6761459549434247 0.8564699279454369 -1.0 +-0.20909371912166236 0.665785498633312 0.3217034422101787 0.4943824186678361 -0.5947936852906712 -1.1187462934276506 -1.0976119097046964 -0.27444347957018306 -1.4599709537448777 -0.07670617897725707 -1.0 +0.5397480768896284 0.39088606986927693 -0.8810036123482284 -0.5130851371053993 -1.2452219420652897 -1.3947611590235895 1.5806695869774903 -0.0006720379849098784 -0.08369416433756069 1.3675180294726665 1.0 +-1.5820542590986817 -0.18275779202562703 2.9492855374096734 0.9639575319355081 0.1574353015012195 -0.7690873631719648 -1.1812334748461104 0.3535715383323811 0.956346932713027 -1.5133217667667775 1.0 +0.7881870169027756 1.04824906045827 1.5746553894223603 1.0170253989547804 1.9496533307886716 0.37024531375609704 1.0010282763901057 -0.14302139975791656 -0.044862191434083064 1.0771401217547978 1.0 +-1.3833498058301037 0.0025279239646442556 0.5763136382397881 1.433803197924469 0.8030227398150132 -0.10702764324001715 0.2507251848199401 -0.7448139907375828 1.4801376315014358 -0.521249070582926 -1.0 +1.9355886489317684 0.12349185339738267 -0.1969991164078336 -0.6581133412107176 1.3030715383083207 -0.75956032947863 0.9259122791687571 -0.9894692799652777 -0.23623684340347365 -0.33462033041774003 -1.0 +1.2239577433935098 -1.5668432870856983 -1.2284893624389799 0.9163491791065601 1.2717942682817653 1.032383087760309 2.080616713517142 -0.6152062076493705 -2.453566205304855 -0.7083325520375795 1.0 +-0.4411144809679514 0.011948329498576622 -0.10013781078316666 -1.513449097786955 -1.201645144307701 1.1522960518447183 1.9563702519337351 0.25062104075411146 -1.2875486268574527 0.5440546781879965 1.0 +-0.9763357630885623 0.8571913894615482 1.292514294557284 1.4746662077841246 -0.2852483446709177 -1.1948064341746663 -1.9011197332287124 1.6671130760643076 0.20898972573566402 -0.03779952942285314 1.0 +-1.3929278878016753 0.3368981950450936 0.14776654174954432 -0.33299341718695374 1.7727142034705503 0.15009042371487316 1.1225588706459595 0.8413201943874591 -1.8428646722800086 -2.0092545625599945 1.0 +-0.707626055897175 0.6018839402809352 1.8151234313297455 -1.000028927927789 0.24491740363809167 -0.35688989769157836 -0.9680396565200954 0.8260713388575298 0.33884697913903755 1.582552494087487 1.0 +0.009866873473095257 0.9534203375812438 -0.5552469227740527 0.522770323556712 -1.0407069691024984 0.00048299060133975326 1.0035073370534753 -1.2488077336524008 0.07328162495380929 -1.3741109817047519 -1.0 +-0.5990784485961277 0.6727425360323672 0.5603262261902678 0.004763581710500002 0.18166179174550157 1.4210483234928641 0.744332710029289 0.6856419731430565 -0.6940719880280536 -0.47472800853181424 -1.0 +1.2582382206409954 0.4019588706831498 0.36203891387029025 1.7263963929112118 -0.902404423902606 -0.41323336649747644 -1.4456540943517122 -0.5244280259438602 -1.3446697374620908 -2.480287465554709 1.0 +-0.16309013666903965 -0.5147867370947123 -0.5304094280300458 -1.1586206703649367 2.7226579854933752 -0.2879126895937779 2.7638556426243883 0.10416628741063334 0.8928517443370074 0.7447134032980525 1.0 +0.5876388752337978 0.14460914761244043 -0.41229910610961773 -2.3136583121609977 0.33249526217871134 0.16931042803721305 -0.7937807781429668 0.6627323963423138 -0.3608878678231499 0.020711239627139746 -1.0 +-0.7941234753550339 0.8802363021932996 0.6419632576038624 -1.4213378394308855 0.597857713334496 -1.308906920021401 0.34472059018565304 -0.7604693781582598 -0.1406772722856227 -0.600455406863254 -1.0 +0.6077192689730406 0.5614393396589403 0.5758643380026099 2.3036455913612075 -1.3521850848224095 0.40210659978009916 0.8990413385545436 -0.41057612192261933 -0.9382963538204352 1.4500512216749324 1.0 +-0.846281540145089 2.403227849746885 0.9245445397828729 1.1326544341391687 -0.5931063550125552 1.5138219350025444 0.4411823253796442 1.7295916255415493 -0.13072742282138733 0.0705517775160157 1.0 +-0.8587971088986452 -0.08707681322173097 1.0218105803276376 1.7899511444030378 -0.4417120965359326 -0.08314082723386619 0.8204867606039337 -0.5370960901432748 0.2929855844016277 -0.053153311160889775 -1.0 +-0.954528203228581 -1.2962325529079044 0.28922996107465865 0.39412136243439416 0.9574408494931212 -0.8347735000559878 -0.7222573654548228 -0.5197899006366578 0.660610340697349 -0.3525074506460879 -1.0 +-0.512561938428032 1.7834974202272331 -0.032143872684150275 0.9964032938239826 0.2563608162224948 1.6755845193589909 -1.040844033605032 -0.9075141058327602 1.2415823204823428 0.2699774455987329 1.0 +0.7305726548737476 0.32892274884153416 0.387036936995438 1.2506267841469898 0.2595430091883984 0.8358459997033395 -2.554814050397111 -0.8754962876583221 -1.2595523882418678 0.568989816200262 1.0 +0.36295138311198694 -0.2449316579347589 -0.890627187960851 0.22746085677059893 -1.358874202170808 1.1208866152739076 -0.8122786693590682 -1.3654998780993912 -0.2010601851997522 -0.19413827519552213 -1.0 +0.7614609058505148 0.5222339347763687 0.4366211902141396 -0.4638213629129547 -0.4303966068454211 -0.43945835995993865 0.8445375760837507 -0.34661930103527633 -1.8550623188238975 1.3376655897119476 -1.0 +-0.7167619828597596 0.2939662108682466 1.5823697336020464 1.2777781023739858 -0.3190156850701858 -0.21472822782873424 1.5668464460560432 1.6474738430928832 0.40983883442266467 -0.0015227145401484246 1.0 +0.4034986202367133 -0.5206128104740666 -1.1247227521080672 -0.4160634652067836 0.4987641057674319 0.07212492808792567 -1.9213963222948693 1.3682078241753455 1.4363634524155202 1.1318256004478195 1.0 +0.6577079271066337 0.22260596043089323 0.3318763604869935 1.3096961973406098 0.04613231639449186 -0.873506752741301 -0.0557449266511973 -1.4931085495929537 0.00857057873711778 -0.5994988634208177 -1.0 +-0.0549125179026859 2.4107573315584117 0.3100602971798463 0.4942312319586998 -1.4030081704512587 -0.39683153307267155 0.9289217690714815 0.8966357429103212 0.32275553462582884 2.017397578340806 1.0 +-1.1809766307020855 0.6233966684726192 -1.0613220038807043 0.8386992187684233 -2.674814438512866 -0.9145892322203668 0.615393492901773 0.11702435033107478 1.0166544966244935 -0.3866112904938636 1.0 +0.3128491785442516 1.5463151302209646 0.2665188298474402 -1.773902379796769 -0.31496343501988133 -0.4955365061567787 -0.7344758558142588 0.10719287249680484 -0.919793628868033 1.5701749836726397 1.0 +0.10011845364190239 0.7045091995263103 0.43371435429525856 -0.6301649907495976 0.20479266970356375 -1.6923388444453182 0.3847395431932847 0.21755165324757852 1.8486585402635474 1.2451768851066742 -1.0 +-0.8842697497439428 -0.7485795086261474 1.5250972072860398 -1.050549240910125 -0.14049754781225188 0.2063607191440174 1.7050752199158172 -1.065889385275902 -0.8310556101158835 -0.16704848061303224 1.0 +-0.22516071659483092 -1.2664169895910844 0.1823342685288408 0.4757179729515804 -0.00624749909608451 -0.4286006895038369 0.09281635295594677 -0.1530993652222406 1.0816642101965943 -0.6296621402997927 -1.0 +-0.3876766335113583 1.5482059998936735 0.9319163634092831 -0.3668328388540765 -1.5327674513107599 -0.6325507885752846 -0.8605729723885422 0.6926734140423703 -1.3995135467888482 -0.03900084187523604 1.0 +0.6869376770616449 0.024610924354389847 0.619951602914075 -0.018432613234157926 -0.41866790047304714 -0.506437138633781 0.11816520887303691 0.2801935087625301 0.17609060654774036 0.8532425839939517 -1.0 +-0.20772226152839787 -0.4036369774289267 -0.6376266407920901 0.9815725775432228 -1.2094225514937764 2.453333085059053 1.5853204184544887 -0.20640389337347098 0.8014995302321771 -0.8992991285777349 1.0 +-0.18178378221098612 0.4562579201281703 -2.298244977524934 -0.7571996627483097 -0.5123494614427917 -1.5291176127709625 1.578710018765323 -0.29179516831965935 -2.891511480266465 1.5813434316140553 1.0 +1.6790709139375262 1.8429948292589102 -0.2410490433934643 -0.4719770498589021 -0.04472071656060325 1.2485175519153422 0.21077639827867464 -0.7236007880901926 0.11570072469252614 1.568495238469606 1.0 +1.995204914958134 -2.0473869177809916 1.0422508937478188 -0.04894159950049813 -0.9883241555598781 0.06264861100813558 1.1726310798401003 -2.145906490992007 -0.8175495463745879 0.3380181076719186 1.0 +-0.010027245263731388 -0.7650440765531352 0.11139191480130796 -1.0831436373754542 -0.7752892613239524 0.13709833236789584 0.3982485625926226 0.4715904875160344 0.2672589441714726 -0.08696044863427461 -1.0 +-0.23623063578079662 -0.1923738760159783 0.6355857670152736 1.3387524515407794 1.733914404378866 -0.2823033089990523 -0.06746988975377556 0.12769130229012166 0.13357971925722345 -1.0170469446175625 -1.0 +0.703370129532403 2.018173105408419 -2.1184436022043336 0.9340750865112839 -1.2065215329274852 1.0973968223176775 0.45649848502097917 1.6812252448367369 0.7947226037501349 -0.0799031455189001 1.0 +-1.341192092810752 0.1379875725041552 0.7800431541551157 0.48669587923112334 -0.6647352056770366 -1.204047524426513 0.17254732987558635 0.8059834326652149 1.279221063744146 -0.46393585695803224 -1.0 +-0.5364912567801339 1.02388871112381 -0.17773979821252014 0.7349322928680153 0.21762562625293622 -1.3454961307000246 -0.23246046381217153 1.2701984850473267 1.3061053422646105 -1.3303550582969932 -1.0 +-0.27240144950646744 0.3994450386798551 0.7221275341358864 0.8509706508402413 -0.1649762963450529 -2.828130839035651 -0.8525632915864112 0.9481930155134397 -0.8229046821037809 -0.1926273103751093 1.0 +-0.5828427350759314 -1.116670914632246 -1.1470305042127322 1.0123301291535707 -0.6033969466944596 0.1690265657500107 0.9967769868870562 0.3075686296840664 1.2471602380126536 -0.32451917971977035 -1.0 +-0.5324216153785134 -0.8706231866538897 -1.5584676326209697 -1.72518170846262 0.6192917812367374 1.1142304312209723 -2.1726880350973126 -0.014061719858579569 -0.9810467702986106 0.7744539177078257 1.0 +-1.5213902937719854 0.5835337711580395 0.43229829833763994 -0.5832435290683634 -0.5526203252585131 0.285659043697623 0.47105343515245557 0.05389801515569181 2.4287544917989123 -0.5378665459552227 1.0 +0.4434335991832058 -0.8411355742162048 0.6071172007963179 -1.118340365126854 0.911583508699734 0.4957066058729871 0.21620530529444812 0.6694230802233578 -0.9262024412366738 0.13713873110152852 -1.0 +0.8222401155337418 0.39523394757451724 -0.29933287109747625 0.08802660199277589 -0.2390432735446173 0.8195566836206314 0.32615014517430196 1.4846690084683545 0.6467529287837123 -0.3641414700016927 -1.0 +-0.7173229583954034 -0.21098957751191205 0.668591250238042 2.6760202376865165 0.9805012447562048 -0.7630629800481941 0.7172732938007931 0.25515027597795337 -0.7604503951132184 -1.9636521318942264 1.0 +-1.0133070573583023 0.6665456916000502 0.10344156347143192 2.0222291803829266 -1.6648000541693977 0.23212711401667116 1.9243468647447306 0.8079931240320541 0.03784392223651478 -0.8781434407720886 1.0 +-0.23076981760867543 0.09532380010913132 -0.32644361861668264 1.5230948548283574 -2.0400054253288675 -0.36663718340930185 -0.9601797244749867 -0.722875853215207 -1.1826934605270367 -0.39546458167579474 1.0 +-0.3638443703524025 -0.6092348200836429 -0.131311193084348 0.8283367901896841 0.22468694646702378 1.2404394323664851 -2.223349107587579 0.3793429402542866 0.054161384621966145 -0.16728168369342303 -1.0 +-0.9032537457005727 -0.9304157040470137 1.8258276580150956 1.8415243301212108 -1.1615542498827922 0.5442609117868926 -0.44885245631262605 -2.7089623509255185 -0.9052194697450736 0.374271430104076 1.0 +-0.26786058872576685 0.19515911022954738 -0.9439915077147799 -1.0306334854354435 0.7104985101364456 -1.5347150370125728 0.47920744733531906 -2.1184421474367023 -1.1875457756687378 -1.4435398156990535 1.0 +-1.6556617787331176 -0.13897571459459568 0.12927613208903513 -0.15283744229134358 -0.6379826172359941 1.168447470328504 -0.35437033568282295 -0.00853987247179895 -2.0846611248751277 2.724110499215777 1.0 +1.1100008687629395 -0.8706358725550741 -0.0440429878313537 -0.08674639175942468 0.7138518649577155 0.18900662205753851 1.4694775818174413 -0.682173504830947 -0.08280882147580615 -1.5839917555507281 -1.0 +-0.715022270743163 1.8625366481181644 -0.482018003658117 -1.7253622415937468 2.6529458804159876 0.5808831105927824 -1.3089659187235936 -1.3910032114472841 -1.7898343210000371 -2.200183083335388 1.0 +0.9652522152071658 -0.7655097808025378 -1.1895748665241923 -1.5557696896724853 -0.47834564938154406 -0.33978304961742956 -0.38074612241068456 0.6596950619222537 0.23479550988515677 -0.5709036842181517 -1.0 +0.2725427308241023 -0.26836813835056045 0.13687042883690692 -0.06638489106889214 0.6190531295702778 -0.23438252214542632 0.07043187851424784 0.2494942809185112 -0.8484058423525904 1.184210292744333 -1.0 +0.04104710872568246 0.13548793223522979 -1.6952806929032889 0.17812227233907466 -0.0452785625108321 2.0519984093494554 -0.5927021697786364 -0.16521378061409495 -0.20034307182725242 -0.7168753887911383 -1.0 +0.016677117941437506 -0.47336487400886057 1.118495904915875 0.48607320858205894 -1.027701575056674 -1.7626461453123483 0.1043675630233738 -0.8348484075227088 1.0463334271019895 -0.8959576800770115 -1.0 +-1.3589161331214041 1.3304175909504288 0.9293131092505473 -0.04460441452114735 0.9508983777841041 -0.6324254613406854 -1.0611504135468595 0.3716595214338401 0.0959623504816614 1.3977308654404967 -1.0 +-2.062063795738857 0.8249172768005779 0.1179448395046468 0.4781326725715535 -0.5165213775997485 -0.5133155400958628 0.9491871040591117 0.7187735861356946 1.8614263032281273 0.025844223700076645 1.0 +1.3160200842685132 -0.6457011473164738 1.415124095979885 0.3970744553296857 -0.3611845021843006 -0.5299681009539092 0.9566637994975756 -1.4790002043608121 -1.3223021520659661 -2.6477887298406766 1.0 +-0.5344270753617962 -0.011301867936843329 -0.7563988536277235 -0.7569098478750196 1.159745068983059 0.7064061842456313 -0.6740797927549825 0.1060191820823213 0.74070365495494 -0.5585443102634757 -1.0 +-1.2039043726734797 -1.1586952897835594 -1.0953093674674277 -0.41196568854744897 0.26600487863011624 -0.8971418788703762 -2.0225411872111345 -0.3570371576956449 -2.193148276506922 -0.48781533994924786 1.0 +0.727043780090882 2.289768837338539 0.6849129271053535 0.02579473198903238 -2.235333221736388 -0.023779778236546614 -0.2429578662563032 -0.7796146033875059 1.3291709929064641 -0.9789337717895934 1.0 +-1.8452131337364401 0.652498417392727 0.9713885740592777 1.4513172664324696 1.9120131850731876 0.6150656941029948 -0.466844797182049 -1.7859331125727114 -1.3040788911790682 1.6317935693791248 1.0 +0.23692067333609343 -0.6556751111839084 -0.24275198853719682 -0.8883705780574261 -0.5740368981208421 0.013065526046470372 0.37728424085438655 -1.7204762305143522 -0.7190996352330463 0.6314445322823272 -1.0 +0.5928833846086298 0.9562377764353518 0.14160987398660052 0.10264288919982106 -0.377154304171655 0.5754897741159419 0.19854924559010725 1.1565484993871404 -0.544590937790256 -1.9279945408264916 -1.0 +0.8274128286361956 0.16397417435465422 0.3158578992291316 0.27490700974104015 -0.22900212736725978 -1.061829531326256 0.40996865462657905 -0.6493336048160309 0.7359422260973242 0.34947412980616427 -1.0 +-1.7820673133478881 1.3422476930833915 -0.8368802848084969 0.4844840213841734 2.021143213769883 -1.7886373970999514 -0.6100830677983373 -0.21359128937633137 1.3047792526370554 0.8637146477472304 1.0 +0.31611636397073506 -0.6855865825345617 0.6630525931066529 -1.296776393403824 1.2772191443082848 -0.25759205669569346 0.6140905894514174 1.325467379189292 2.1299625440970833 0.2561313626182929 1.0 +1.0255298390815415 -0.4891324449166501 0.01974972012542199 -0.658216554026494 0.5460547774001346 1.178632207660247 0.6440789949326535 0.4608463291053464 0.272215794616846 -0.5779019107698582 -1.0 +-1.5545166846266656 -0.622894695069416 0.37898274503459134 -0.021842146208187162 0.8842201885082102 -1.1330611818704395 -2.995659233063915 0.3831997976998351 -1.4203007583099139 0.08024791004508894 1.0 +-0.4804325339895928 -1.670011788423922 1.54015320346067 0.7026359395168148 -0.8216451961328126 -0.19949613625229912 1.818413133350673 0.6265407863780736 0.862952212302623 0.2517312752937742 1.0 +0.9583274046746033 2.477203941569252 -2.523263820164912 -1.0278475015154669 -0.9798282743626724 0.8851569078801869 1.3446426251461796 -0.14907056457726997 -0.751638492324697 -0.7941273269595929 1.0 +-0.32487923813193004 -0.8179547597426929 -0.6203946109376212 0.2756099526050954 -0.6036384776299004 1.1328562884910964 -0.6946370780006456 0.7919982792628879 1.7455242194304705 1.2046817049580716 -1.0 +-2.1364710128675486 -2.0741253704067573 -0.34752899289413064 -1.0620080413629769 -0.09626509905956808 -0.5402239128062823 0.8047997915349784 -0.582081898942726 1.355681829582407 0.33479222224752186 1.0 +-1.3237556203344953 0.05739620711732568 1.1725550563368747 -1.202268051991203 1.213198685931469 1.2387851442840487 0.8385173120430706 0.6262673312201238 -2.807021342875716 -0.9698023062124117 1.0 +1.0408148657380014 1.6366638716361075 0.8694104625859098 0.27995293275756494 0.7215168337402121 0.4847054917762712 -0.028968819246387372 0.29199124075082106 -0.15594119624565747 0.4384723609886291 -1.0 +-0.6649283544831086 0.6536491899457063 0.6427463354807537 -0.23061690629814352 0.8171204646905834 -0.305156288075076 -1.976294895730925 0.09135888719420779 -0.8813147145221318 -0.4866440867259624 -1.0 +-0.5355480466541341 0.07083612541005647 0.6202978159880296 -0.33602630838451275 0.26652334916816506 -0.01599908393883183 0.6102747482694508 0.3900756831914427 -0.5479595862037875 -1.7852286887467474 -1.0 +-0.9286541093425598 0.3544517990843895 0.2658154213566088 -0.5614622188822107 -0.32725492547191115 -0.8031505725783407 -0.006198233338073983 0.20317556111914978 -0.8306577383914422 1.0918468227292757 -1.0 +0.2772925172108457 1.2030187500810614 -0.05097909198986569 -0.6241849045203524 0.49735882101322426 -0.6984978222948512 -0.14904244468735744 -0.6449049680274449 -1.4176191308588217 -0.6137041991174018 -1.0 +0.3161693434777883 -0.17888572021406024 -1.0767850088217787 -1.1385197167177394 -0.13057675888246012 -0.3447938471613036 -0.6607359578802224 -0.049491009068181366 -0.37102435419105273 -0.13901760781044623 -1.0 +0.29921569652751856 -0.3831087417318337 1.070220492376271 -0.25735009443270523 -0.22877881799864538 -0.10011796387947308 -0.447602708006154 -0.5811961700590117 -1.0320348099520724 0.6388768159460956 -1.0 +-0.08985101768707786 1.0251448309701119 -0.019482394208877433 -0.7048056277502418 -0.19776492953636807 0.6609550877737689 -0.16572132238818135 -0.5269147362081124 0.8005240452151636 1.9901147977037512 -1.0 +1.5749611786648763 -1.2580102352752884 -0.6023871756911366 -2.343451103090524 1.1381667721605566 -1.4231365899858077 0.9142746604239324 0.22725393740230113 -0.4671491612940152 -0.9284070921758049 1.0 +0.004831809736324765 -0.025616676700960912 -2.657425895585784 1.7930252843222956 0.8763798704993517 -0.29509828981324193 -0.6402731797731381 0.18406998905191826 -1.395905535284401 -0.08307465728395254 1.0 +0.2217753462714224 -1.4841784339724746 0.834568090486547 0.7029284905459972 1.2773660132195808 2.376437138715728 0.009164431450487722 0.5754414984606511 -1.5121417472306429 0.8745738469370288 1.0 +3.209153971751537 0.5515188411550755 -0.0008089925731088823 -1.092256759834908 0.7514561773830121 -1.4484751316035767 1.174713707137013 0.41191998359893073 -1.5846094718497032 0.2659151424992497 1.0 +-1.9899921801787537 -1.0244698945624542 -0.7787312876838084 -2.4854216723645184 -1.0776544373364145 -1.420034018325001 1.5361952383822592 2.0905820190061566 -1.3773057955142256 1.0732452145615914 1.0 +0.13530051854730252 -0.07627348942622383 -0.26332748481914514 -1.1610723726428056 0.327619500886888 0.12936993315251655 -1.0031973795577793 0.5830776453738716 -0.2517110543744426 0.4716215616955218 -1.0 +2.6606277672419796 1.1377096548596732 0.317280727479626 -0.0944544297770226 1.0949187731553738 0.49889004555144395 0.1958029548889917 1.5673165762414485 0.6581687012466169 -1.2026720729140015 1.0 +1.509925098728897 1.6802391874113263 1.1856531865355087 0.1388636281468362 1.389119548125638 -0.47951423120958114 0.4701754284225408 -0.4947467625308443 0.3520113899978598 0.061606669970642645 -1.0 +-0.7800138708023232 -1.0507763770862628 -1.744835382031072 -0.4882288728853951 2.8644098213527793 1.289508891208988 -1.2851795042388277 -0.7840641593872114 0.25534181555395397 0.05408430234131625 1.0 +0.6363177555180423 1.6506105751542899 -1.8827391233856279 1.3157324260086198 -0.33750264324332296 -0.39040121423881363 1.1464879638124925 0.13277769142147758 -1.8981997649674243 1.01715782762861 1.0 +-2.4621493596535826 -1.0445261881952568 0.8227359851763542 0.9738577532852073 1.1604110866390398 -0.36022735174714365 -0.6176547883496321 0.2295764862428117 1.501734771150253 0.48126589816264936 1.0 +0.31785297189550127 0.04039473148272651 -1.6640717602594555 1.332101250904695 -0.8628948040503263 -0.03536832084080098 -1.7407288999988542 0.9258714554717684 -0.9972740478126174 0.20114044005615042 1.0 +0.6347269068525845 -1.7838370167658224 1.589866170365828 0.6198144899963995 -0.6289621412789438 -0.6879085319880399 1.8124164830502372 0.9615072025278373 -0.17457636669612384 0.636449258496893 1.0 +0.8036033261292801 1.7216841461861443 -0.8302571967859304 -1.1089279697958838 0.2583488604199059 0.21232513672500902 -0.7223573787112462 0.8883512147301251 0.3166691308233561 -0.46794493092435396 -1.0 +0.08029282816137749 -0.39312638369341096 -0.6142748814719917 1.7380527923726572 -0.05479647337548602 -0.6038787725190028 0.05189800571520062 0.9954806939718748 1.6465914074247279 -0.8520696055246548 -1.0 +1.2261930927092 -1.409652531811256 -0.9574978383458912 -0.1541851062716691 -0.6174128843489624 -0.11158158538996504 -1.2529628046745824 0.18017323736952684 0.13850840695623634 -0.5803456009038908 -1.0 +-0.7099434210201616 -0.05156342459302195 -0.13070247449713596 1.0122950638811103 0.8156845906793413 -0.3258448697514023 -0.2584707683063445 -0.890440463887327 -0.4581725076778308 3.4585968161148313 1.0 +-0.9704182178744319 2.6871612033392807 0.9312776144665534 -0.5331297226042839 -0.28529427255598 -0.9489437188256667 2.5099520677229528 -0.5465987844690795 -0.5904557741063047 0.04478654086972869 1.0 +-0.3501032412749507 -2.337417503090751 -0.39193394121557984 -1.4363442097827432 -0.7701440029913201 -0.751261832842014 -0.4729099359137562 -1.04884099046814 1.0984440899245669 -0.245925155686946 1.0 +0.8414256923875825 0.7408384241924824 -0.29871029318940123 0.1501840455008384 -0.09293132743622026 0.344470886220594 0.33251104369687506 0.3165900441554864 -0.22101348869903115 2.207083055966505 -1.0 +1.8243643293802945 -0.9480842974626666 -0.17907621643171537 0.6488732865451622 -2.415277929830738 0.5644460066626728 -1.2189514192824145 0.6491554919069787 -0.07814405455485418 1.712469914106728 1.0 +0.018121884498976865 1.2868566271279418 -0.9536770899957918 0.6249716158046588 -2.1079351824824952 1.2595831671666744 0.052295540824464054 -1.6935875397920435 0.7796546981181711 0.2515641406830677 1.0 +0.41680075873531786 -0.6575045305090914 1.4951196920790684 -0.2619036835541532 0.14332671267990338 0.40856170791345753 1.821563134570578 -0.6658197923569463 -1.029488426544686 -0.558484210951185 -1.0 +0.07169915686160251 0.3893148498230126 1.2381498220937583 0.5426349173834273 0.4176054720783757 -0.2490561286573809 1.7616558697903575 -0.7777266438374596 1.5845692748476627 0.24618496271496182 -1.0 +1.6197290353316953 -1.3890458396185827 -0.5136899421847392 0.6504889220137874 -0.686815870021942 0.15730681894997947 0.8258365757680074 0.9439084133192779 -0.32031813273183546 -0.130653139879242 -1.0 +1.1501890912387072 0.2904261887580579 1.160748238014778 0.9182095893938784 0.7519723402914408 0.5192382722793035 -1.605753253917022 -0.033091365718498744 -0.9964102453866795 1.4763015223058649 1.0 +-0.4425368790048132 1.3291162068337181 -1.385684240835405 -0.13919576433460026 -1.3723823577478322 0.002803519238126999 -0.2918292935710012 -1.8617821074490928 1.2818872727038764 0.7126490965775344 1.0 +-0.9245172984168462 0.40097526845531034 -1.20719783751236 0.6268169549322398 0.6811546164057318 1.2135602547880702 1.7332575914059876 -0.4947735292489333 0.6599942882559131 0.6714990303012663 -1.0 +-0.4141657753152125 0.013931884062029111 0.6418711256367103 2.2227303982634825 -0.3185297520381022 -0.7249530356667065 -0.4675991570875114 -0.47357745730860157 -0.07378020274486616 0.781370586381089 -1.0 +0.7934656446980911 -0.3971329454505919 0.09663161980912527 -1.6706243937903251 -0.4379895202325848 1.2577647190314776 -0.12603917503187925 2.271128614746993 -0.7626192245513409 -1.1627225171270834 1.0 +-1.2958611369121733 0.422911581084335 -0.13601396986120382 -1.398174609265351 -0.2803738374657816 2.2024455512226138 0.7787572061225748 -0.05927088042973824 -2.7470742895985643 0.1815634160148399 1.0 +0.29950210736329086 0.08361582073075834 1.857782860912462 0.5313699140284313 -0.09266556751861033 1.7685456712520204 1.1405056678571437 0.9961028356042567 -1.2375443219342774 -2.2097727877045124 1.0 +-0.20846892700574535 -0.35871014116976846 -0.6277248828430068 -0.5857047946451434 -0.7691722834512744 -0.7417231654487858 0.6940508344300708 -0.09522896898741048 0.37052873102232564 -1.070719442325414 -1.0 +-0.18979187817704551 -1.0725280734010154 0.6116726570430779 1.393065042332096 0.1953546483284296 1.0756236847005496 -0.4917823498818806 -0.9422425381459699 -0.14539920223680033 0.6362622660182599 -1.0 +0.04182810570369838 -0.21389287889052677 0.9221005619948534 -1.0145012312627588 1.8084032028340882 -0.8318502703849049 -0.7894887567609739 0.12701619644361684 -0.2387012305970065 1.9634211024617778 1.0 +0.10993177853936541 0.9685026229505048 -0.9683099812962441 -1.3241985366554574 0.05661601077254427 -2.041702766902053 -0.6492040463211859 -0.34881462586888945 -0.4965690407282463 0.8535335828323091 -1.0 +-0.643045183874729 -1.5882613451116485 0.2925567529725315 -0.05617111868065574 0.5317790146621224 -1.045246693166808 0.8774664641676921 -0.43158147314664974 -0.6642192227574251 2.2653967676368247 1.0 +-1.8769461514474393 0.8892307520480537 -0.3179449821771378 -0.4766879951427944 0.9604741760190169 3.4475126742848925 0.5304907477149375 0.8663997626708924 0.9246234205674352 0.7942625449144928 1.0 +0.8100030867232416 0.6141880273253673 2.2115273174497565 2.0201763881177 2.2299768416162977 -1.8889332764473823 -0.0457826600766222 -0.480478955880425 0.5145418501104667 -1.4761719350983622 1.0 +-0.42575171287638475 0.14058402603523037 -0.15851392021065866 -0.872302654977026 0.14648587809511712 -0.03357519221112542 -0.4080154539519419 0.08819553550108837 0.18335151677198827 0.6844372767706286 -1.0 +0.9458112722616882 -2.927304704348112 0.8014166734215404 -0.5663108224809246 1.0189672270394743 0.11324150930846172 0.5381268052348954 1.4988954072433454 1.1793068449570414 0.7155930932214164 1.0 +-1.080939823647883 -0.6179873072445213 -0.3516117183571954 -0.7443842297097287 -0.47508681280967346 0.8423678769062792 0.042190119056874774 -1.6199172256197443 -1.7230392999293536 0.33117003378724386 -1.0 +-0.8749915057800132 -1.4773998022894945 0.9256439164624767 0.029093660613648917 1.678392470149881 1.00620739655509 0.016557839903286888 0.15137696817955865 1.22020141180993 -1.1843477618121876 1.0 +0.3421770737151188 0.06430029220993591 -2.061498022104379 -0.38827991711771337 -0.13295242646086372 1.8307323417303063 -1.4732740619712523 1.0474075406899583 0.7556180978803672 0.15696581407372606 1.0 +0.8422578090621243 0.21319822408300687 0.6799541317450675 0.612648793673014 0.5952694519636597 -0.016001642670510897 0.2960826612014467 0.9049347694502661 -0.6010354787057175 0.5728107261751832 -1.0 +-0.6742405599653695 0.28133115394510155 -1.5547614876731002 -1.7393790793226862 -2.1605733664984617 -1.9595779545979073 1.5562981706347543 0.32728124011410537 0.486092600733593 -1.2414069599767943 1.0 +-0.5401858548179809 -0.10834784260106886 -0.8408623030902963 0.48073817168724686 -1.475534963196491 0.4171746410423148 1.5014811721094392 1.1179590978428897 -1.9376868674497207 -1.9697136001108857 1.0 +-1.017518838507636 1.1360786136783447 -2.0666179431033234 -1.4952775357482488 0.6728983149600875 -1.7646669442646186 -0.8516531247897089 -0.6053065628603461 -0.805287314139546 2.5335959087111886 1.0 +0.8332325727246073 -1.08700857434471 -0.032037029893050815 0.6695554604008281 -0.3575058700104287 -0.7368814695745995 -0.5966825940094563 -0.43947623292375165 0.21677041583681572 -1.2096548068912265 -1.0 +-0.9755548536722656 -0.125466779395108 -1.1430569955624306 -0.5396988359143291 -0.3674542417040041 0.5034836625654164 -1.7797751671497195 -1.4463339497228298 -0.5435201436060404 -0.4275059256463771 -1.0 +2.0631448749847663 -0.4111700191985071 -1.891606682178762 0.17977180277517338 -1.298540715115769 0.35551752752193405 0.09274956037327829 -1.3285237951341968 -1.2757732144524097 2.4438249851845635 1.0 +-0.38507447926985844 1.2989811339218187 -0.17385947328690715 -1.1684047852234463 -1.8219219743289388 1.1746905711623892 0.3906535323200916 0.9949376189760822 -0.5038829444383564 0.12121828145689056 1.0 +-1.3340145897738582 -0.40134564691807384 -1.035809984241503 0.07866249867006612 -0.1224765509407554 -0.5223796446578067 -0.8387447289475078 -1.2506844517244984 1.064831877984919 -1.734925892944343 1.0 +0.17238422867530945 0.10587185773538538 0.48087086224395265 -0.08869658792811017 -0.039457009161627275 -0.1525679565060907 0.20589152720837792 0.7867450333743096 -0.8199048542848791 0.41978802366657564 -1.0 +-0.9573067670235533 -1.017770320158939 -1.296034917766649 -0.85371799439649 1.2030979299837534 0.4138143760547242 -1.3451154438408859 0.27566056886642765 -0.730490758180352 -0.7898495137721478 -1.0 +2.898206192665544 1.581118423907682 0.2546897614656763 0.5845354927441562 1.2971464008101792 -0.5138276703707552 -0.7868486794299897 0.21748307116911922 -0.05584787328109693 0.7686846431581891 1.0 +0.7175283358464812 1.2965505381984608 -0.35458486574299486 0.30134810389252903 0.5087450441097501 1.6558199248490792 -0.6285283185235373 -0.865350802899046 0.9688869843141352 1.2843833844998855 -1.0 +0.7708144857819786 1.3687101235777408 0.6578142121716842 -0.9321575759441507 0.29475161885456724 0.10073964563304727 0.7910324771639785 -0.8278180302853848 -0.4999911205918866 0.9521361936816606 -1.0 +0.5855210670667337 0.3643353296774034 0.9244198448430797 0.12427879489590012 1.3065408647235515 -0.4274612752821048 -0.710357806772508 0.08673275328357181 1.6634750097378082 0.14836066686102148 -1.0 +-0.52337299276143 -0.6245437813002771 -0.8209808795705086 -1.0706569628754747 -0.961968164552676 -0.6152142476185017 0.25000879229760875 -0.6927355914290916 0.7906049831554218 0.9406114771862971 -1.0 +0.11067652064372907 0.0801603914440327 0.06735076268881417 0.14509497472688596 1.3105465081512713 -0.2889018186210855 -0.08386604949329904 1.5798217697783816 0.34897645936960003 0.9142473796752125 -1.0 +-0.25065505333995647 -1.7773567748390031 -0.8546117717920864 1.2984193443944538 1.508473699859843 0.13920799755829105 1.3627940878365463 0.8447186821681648 -0.7977028622292253 1.3456585334724918 1.0 +0.5258908184900898 -0.887097003955972 0.257253592463951 0.2150704430734008 0.4786940539255531 1.5852181114834052 -1.5521676208283357 1.7065717754284204 -1.0851290057726983 1.4561973801784378 1.0 +1.0646692406601606 0.6191278299003353 -0.09182482057904795 -0.6501220930835208 1.0181999243882647 -0.05887498161268372 1.5905341822728425 0.795679662631077 -1.818302165407141 3.153392137029261 1.0 +1.8851430407733711 0.3404532894397577 -1.0967503791267734 -0.851345345316266 1.0322371335885347 1.0261789045654293 1.2865005944307286 0.3898433876752992 -2.2252985073520524 -0.5719236387247582 1.0 +-0.7419325993724647 0.5531114025200818 0.8178742376244224 -0.1116920135830844 -0.24281669250063037 0.5655107347667728 -1.191331334424713 -0.1603741315300629 0.001668724613004617 0.17729020131650955 -1.0 +0.25526965807017604 -0.884563515631581 -0.8061526759728308 -0.9269450087896995 0.13365491795789675 0.561275300784475 -0.737526289536093 -1.8950233424552287 1.358083620177934 -0.8350687266495506 1.0 +-1.3699336718805524 1.1014952102742372 -0.3635801608824118 -0.9692113409449963 0.4890848020614414 1.32302410307027 0.19733365034860645 -1.7512711417671418 -1.3725708055045365 0.3885851523804729 1.0 +0.19642833108711708 -0.5674900836700337 -0.458424439842189 -0.684362341481011 -0.3019656836452456 1.0335806682941213 -0.37794528332812827 -0.5340562744600054 0.4607755517480089 -0.5450185582941975 -1.0 +-0.06907959275270223 0.7255376902636066 -1.695273379717824 -1.0466208364833418 0.49381141397504025 -1.2288597226299407 -1.2613771781923562 -0.7693115141357956 -0.4020514738516932 -0.057367971048429334 -1.0 +-1.0168389600839627 0.22876689591944427 0.3882418037302158 1.4610953997424767 -1.0525221891725844 -0.9857821393509922 -1.2945483377184845 0.49174595538951915 0.20304460093894325 -0.13298594534832467 -1.0 +0.5726959425294189 0.8445469631221902 0.7059755569463898 -0.43195752420646355 0.4195285795214325 -0.3299014971091713 -0.18230481887726285 -1.793290605203908 -0.4822571349680733 -1.1032385989973417 -1.0 +-1.0010898000168718 -0.24047102860608743 0.25538526919954585 0.28297478883800176 0.050206292275700316 -0.8557345994178094 -0.3842851979162807 0.08023790280266023 -0.28621289990793 -0.2708672756631451 -1.0 +-1.0669804988360205 1.152235149361064 0.11356526903860069 -0.9588748715507545 -0.06338128352465013 0.976838885832656 -0.6815408469719823 1.8081054602769797 1.292620759177219 0.12144040286125649 1.0 +0.8847485723887643 2.7316574039070765 -0.4853456974491458 0.47743331367039116 -0.23737694521216424 0.19447986216594013 0.31853145199722527 -0.45436438842782406 -0.9267772011473071 -0.45957604931739243 1.0 +-1.0525009246066992 0.015828843130148314 -1.8813399134714743 -0.39914510372852396 0.8700739297582233 0.2831543918470395 0.4304975012420887 0.051890792275866834 0.711973506498264 0.11511101918419733 -1.0 +-0.5590820683847606 -1.513353110172908 0.15627796712173594 1.363542691987883 -1.1667620116463457 -0.5087076231368128 0.4937729367221049 -0.3155260300504874 -1.231323015876498 -0.9712489835043036 -1.0 +1.4462502312884664 0.7653204516039295 -1.5780592517243412 0.11798112486317815 -0.46956645480533066 -1.575968803077539 -0.03490254168294751 1.7321096607558997 -1.8943651110563904 -1.140522247306446 1.0 +-0.7022346151425515 0.1737338539431008 0.20909584705606815 -0.5490593919649565 0.39655180066882706 -0.029836985251240067 0.2668679695295085 0.4235083125113879 -0.7387878165693111 0.8076688206189461 -1.0 +-0.22152373597014857 -0.6934136691582945 -0.3383228630914107 -1.4916485021416168 -0.35164335030645694 1.6043510641677503 -1.3980473884145623 0.27904039053026175 -0.8693090649870361 1.3626516690835457 1.0 +-0.501457934800251 0.6929005851136917 0.5101341026517555 0.7888573752412777 -0.7771122970558095 0.07667421331538639 -0.5722897777894992 -0.6492259018103573 -1.3827257843374414 0.008068013136966852 -1.0 +0.37733703429563215 -0.7960390163736744 -0.1625126537204549 0.42441529869267336 0.09462589768641991 1.0163501680979188 1.5071095412392945 1.0092819296275308 0.3923402267507154 -1.6013882521762153 -1.0 +-1.502206373224432 0.027142551541903013 1.488772778723801 0.13659228198971632 -0.9041213180050307 -2.0063492438285104 -0.42711255321007346 0.3390673280549548 -0.45589031488384074 1.2624804467425172 1.0 +-0.17354717618796478 -1.3815349254342373 1.1180491462567999 0.5102169772653596 -1.4192022055526285 -1.3446029010376603 0.4032040976930982 1.0598535677041678 -1.2442190974180882 0.4807555726394024 1.0 +-0.8510510721791448 -0.03710148502631962 -0.17086543176171354 -0.472646398598504 -1.7647865896663189 -0.4415705981101829 0.6568689961570904 1.092256867325249 0.8449940577155167 0.29055481300773783 -1.0 +-1.1849135987965957 -1.4288891924092415 -0.9226478826311046 -0.3380435296612289 -0.3842474542969834 0.9395100024907842 2.941900104502089 -0.49341368458829266 -0.9297823749135317 0.9259247105235847 1.0 +-0.20657718796852254 -2.784125995216384 0.28615352847100206 -1.1128704358160082 -0.544720740670774 0.777825379448841 -0.33389718290509074 0.6439086901952461 -0.715293771938833 0.2975537530277765 1.0 +0.8265296723943621 -0.04413634824139941 -0.5689668302493093 0.47280270911403954 -0.46492410983922366 -1.5017116893005522 0.7503006889321506 0.15255593748468754 1.2035328639607124 -0.502194115569242 -1.0 +0.701678295980134 -0.3630556403735697 -0.6231969238703199 0.5040572692304238 -1.727188347128479 0.5836978826797948 0.30592251074770666 0.9138458836391721 -0.2958115144046823 1.129846517200627 -1.0 +0.39732769667234163 -0.7990210676628261 -1.3423807705018769 1.0763558283616315 1.3760851746810474 -0.8971753387306997 -0.21070237563237176 -1.1173330164751745 -1.0607753509469786 1.2477197402767033 1.0 +-1.449432461709627 0.10594780499085539 1.1542207079916804 -1.5463338541586973 1.2379465817259372 1.1121566258412166 0.16126931859840968 -1.5956732566417293 -0.09577341039165674 -1.9124476632324607 1.0 +1.567333591395548 1.5822817957159017 0.6430721114367125 0.09659492374072919 2.8519500114542304 -1.9565579199758307 0.41431769072388097 -0.08179619690235515 2.2970868580427397 -0.18678651803450105 1.0 +-1.2567896638494729 -1.3486357546775634 2.775382116426443 0.4999163578200975 0.01242424859437252 0.3895779064876255 -0.07623095716045457 0.5993131620889883 -0.5803185136365204 1.5003575788635892 1.0 +-1.0465976693424663 -0.610104035354375 0.9906770017655062 -0.4787728240063871 0.8327830239661242 -1.4314571815116384 -1.8595091654854756 1.1560935795867744 -0.7100595208514041 -0.020135375676426016 1.0 +-2.089781949794013 0.32082524058621376 0.06765280961513413 0.15324554328312198 -0.06983224710479279 0.6316582016588651 0.2663218453545183 0.40769453844322967 -0.31239115103111026 -1.0891996226396072 -1.0 +0.4442428644990985 1.047981138249204 0.7449751383676624 0.8482651663582593 -1.362272996752919 0.2928639194353181 -1.0581105967697861 -0.9814152659954689 0.37215376680088175 0.08190939862179951 -1.0 +-0.5750155928398145 0.3474065099561103 -0.38356840573813084 0.08567585935807126 0.9243166765178296 -0.41303701972736595 0.9360583420404895 -0.15048769700898015 -0.7204146015080869 0.5741167643946236 -1.0 +0.08997749833181144 0.2079298817136974 -0.7486011036085104 0.94932745017034 -0.8289357282021943 -0.19681459852310887 -0.7247466895798269 -0.6302720004061236 -0.4734376065537754 -0.7494823318357942 -1.0 +-0.5841827850151473 0.17603121588817747 1.7411976130876488 0.43469733219864604 -0.18032841398594782 -0.6186647582175671 -0.5532883784963428 -2.0150573279783663 0.5384305334458109 0.023740263110672254 -1.0 +0.7505748472240893 0.4520339894673094 -1.0138704208435065 1.1377186028797117 -0.1439432249240246 -1.69003162724298 -0.6657505044290386 0.5175192995768011 0.635878414998438 1.2835600227118114 -1.0 +0.5063944006142317 -2.145886797926322 -1.2164765422632617 0.3817537835356737 -1.0530339481204714 0.5633825171229135 0.22127375522211182 1.1111065417758506 -1.4404514336967367 1.55389897710243 1.0 +0.7638689341317615 1.8399496305574063 -0.12239760192074262 -1.1225959076401466 -0.5176751911592269 -0.07722387609603937 -1.4471843179934936 0.27349194096620183 0.4954651462980266 -0.9673176589117976 -1.0 +1.0311333720043023 0.7692704911755667 -0.9657098742166961 -1.9149281734948693 1.5131919871782225 1.8264840423763606 0.7567003661586531 -0.02095822991115248 -1.178975896658459 0.565624733052791 1.0 +1.2193532551041886 0.28262159055981007 -0.18766385053728113 -0.5931603309380917 0.22514518786077595 1.709284945735708 1.4732244673677761 -0.38130946655205095 -0.5706486803502027 1.8922686207919008 1.0 +-0.07025913864657889 -0.1984645793887397 0.8793549644413603 1.8423575600869702 0.4389061264157177 -0.5015072552366079 -1.1867017747214637 -0.8649518942401881 -1.2007065009009998 -0.6635511337281934 -1.0 +-1.4324201984621492 -0.7722035972384304 -0.8546919975363337 0.6882608903572297 0.20278896420106904 -1.0689290236401585 -0.8560972340044198 0.2433121996176251 0.7208648410099678 -0.14605438477883628 -1.0 +-0.6566615671481895 0.9803886396021556 1.3510365472527521 0.12826796931738418 -0.7030796224239717 -1.9397597079920255 -0.7904159167824517 0.07621536928306112 1.2094226114816977 1.0164517376884759 1.0 +1.9617740736444964 -0.6777760514001188 1.3072659643062923 -0.3209871197239447 -0.6303340866750349 -0.10216974805535212 -1.5439432364178383 0.14377439893094646 -1.0428030904150372 -0.18584614159460636 1.0 +-0.41231397008039317 0.9949707776250813 0.33310830572758227 0.864816298314554 -1.8103339203958246 -0.7409164972132832 -0.5559178721456955 0.6134614138179562 -0.2869226111473509 -0.6375144860454102 -1.0 +-0.5946796265841042 2.114005645345674 -1.181289996847335 0.15085282765730573 -2.883730438065622 -1.1192537222617476 -0.23979661136712116 1.05907848817747 -0.6876187989450228 0.34997218112817197 1.0 +-0.2724380405141381 -0.18151912940746895 1.4007536572250008 -0.5649151769300904 0.21905490740933414 -0.3691726071103826 -2.0921637637900363 -1.077804250737976 0.6317860891851022 -0.46675757953711144 -1.0 +-1.5458142887641484 -0.34720359315039184 0.054224861425900175 -2.338956467062469 0.3028922339136003 0.9646405729486569 0.4736993181874186 -0.5336459552515023 0.17565929597975372 1.5927494431570441 1.0 +-1.0451012166365874 -0.16057434224098666 0.10943621735141401 -1.1829168191064703 -1.8488067570730307 -1.0668611439289608 0.48162835049875424 -0.38585088908351173 0.7407983751780983 0.07047790903175123 -1.0 +-0.5220810314858474 -0.30137288266731044 -0.6666002674362971 -1.5607598684986397 0.897464528633541 0.49912316755687997 0.12054627724308109 0.47049261914201107 -0.48059449402327925 -1.19031733463992 -1.0 +0.7107651741007313 -0.5537962805296851 0.16346088438584067 0.10496050401054349 1.1501367433111191 0.5565616347521616 0.6090491700148777 -0.632513260808761 0.5803184139651022 -0.060656862955325866 -1.0 +1.0895413618467062 0.04122581703700495 0.6586131177687307 1.4414269837476597 -0.007376305333465803 0.9929573232032219 0.48410162661282996 -1.006348111134418 -2.51871608248123 0.7742923546357803 1.0 +-0.8713655567580202 1.0712884123405164 -0.7509932845900774 -1.402157939420626 0.9804550534591364 0.5512310102488605 -0.435619386413368 1.0253087267684435 0.13248571077964214 0.18606310012075197 -1.0 +-0.5293459119955041 0.8972135181135952 1.4873997087131292 0.7197888997690884 0.8676249657473085 -0.011529321983127718 -1.6848761983423606 -1.150148568120466 0.6757485324692472 0.7385683457758523 1.0 +0.0003106157775374468 0.4951590697382512 -0.4389592584599804 0.8158791712776551 0.18144010629405538 0.108037979209811 -1.5277372658206307 -0.8213668379669227 -0.5639496321368463 -0.514471388908676 -1.0 +-0.1710748394992894 0.9509898031798263 -0.3290106563710675 0.3491512258232621 -0.10531928574470358 0.4773039368933178 -0.4703445211779614 1.6533864089745263 0.08661627333883898 0.0015117862420517512 -1.0 +-1.126338619377965 0.7743079009252325 0.5876401455527239 -0.8078825163796293 0.07824444348494682 0.3684196239538122 -2.1173626393489178 -0.3925981653031241 1.623568119997932 -1.1680857440026324 1.0 +-0.6225878869714632 -0.2644382493445399 0.8916875678073257 -1.6887647307388758 0.08152067323403084 0.9566598086646207 -1.5827653593286648 -1.4591909268366934 1.0765289945021481 -0.45648915183613886 1.0 +-1.4586636248296623 -0.1948881577028968 0.012920265529686132 -0.632651296733968 0.07910798853031262 0.9664046241672667 2.3626992089649423 -0.06788278782022726 0.2226286358100225 0.21098015077189025 -1.0 +-1.3451734464748812 -0.5676447615749529 -1.3444516797714892 -0.8694594629234665 1.1743499349855289 -2.009681020416633 -0.09925735459980674 1.318216972611279 -0.29066794001208685 1.6943321980240114 1.0 +0.9552059326301523 0.6342568898343415 -0.31559724629122343 -0.005854066462559314 -0.7098931176766585 1.4264705820728683 0.9721971886885332 -0.2816908650556858 -0.3539731656039239 -0.2942107024743988 -1.0 +0.061340310505685544 -0.5818584104767531 0.8542356870588906 -0.49011057428257937 0.0019749163454156602 -0.6478885818679447 -0.016157495018359645 -1.036373861579367 1.7534621789309606 -1.0209336107741496 -1.0 +0.414010300358567 0.9538202262303096 3.8191921901752024 1.3517840163670587 -0.2210508317846135 -0.440128120093882 0.8165132932025637 -0.20531006812362246 2.2810937142497263 -0.6610263937269415 1.0 +2.261689392312619 -0.016700699928856123 -0.7751934366676673 0.7833392670532362 -2.5561738162662215 1.1269216053050466 -1.3815320121572354 1.355856337050229 1.2655334310787594 -0.04677204433257678 1.0 +-0.23395647038079428 2.373157238571454 -0.20673969695637698 1.4408305054561326 1.1456171255775651 -1.9432195116530286 -0.7776913934223052 1.9477244468908494 -1.146919631079917 0.5122040498313156 1.0 +-0.38515756062353546 -0.5004671163504015 -1.1377959030271023 0.1285025122313227 0.8432341164232815 -1.4029158094796281 0.017599927783791828 1.8539641911806322 0.6234016294038589 -0.5492257226675166 -1.0 +0.5934612796655057 0.18319432148914444 -0.046408511292052625 -0.6650404076362083 -0.5209179177227259 -0.7299363231416183 -0.7905264315789527 0.9016190328656732 0.300155128794571 0.7710961647356046 -1.0 +0.4026276143823328 1.0162748622592548 -1.1718814985310801 1.2045364390224977 0.06612758134607696 0.3238744803028134 -0.4453365180317241 -1.2727630154212888 1.1245012214199912 -1.5006085473298636 1.0 +1.0994384715996157 2.0420753202115476 0.3412945090937264 -1.2451284750748055 0.6042965897730619 1.5532168103591544 1.7976325384859286 0.10129882011110349 0.11272865538094472 -1.3875090799274032 1.0 +1.5889355270575416 0.8025596678070541 0.34971084067282443 1.0340860109433332 -0.990658000859943 -1.325888234279224 -1.236157192357061 -0.18751598407183157 0.05089796352466331 0.3926704240548042 -1.0 +0.043919715276932086 -0.9195411473156772 0.431380592347287 -0.07529992286534308 0.6708947014366068 -0.5587225234995357 -1.2753280988670765 1.553336689753659 -0.9131993274356129 -0.9007550649183834 -1.0 +0.34781783390270155 -0.3318743267333761 0.8680895045648126 -0.5879635546303504 1.5524011268417093 0.4083432700553488 0.1962630977782408 0.22614263862303996 0.2433405905942266 1.5681199855420251 -1.0 +0.045464818037079996 0.5403704315252325 1.3385152608307533 0.9445143269195884 -0.47931886366750953 -0.05941500240542288 1.1205015070795452 0.06346235424028387 -1.3312041355391173 0.6198035808926764 -1.0 +-1.446316001204991 -1.1448971209429855 1.9065964797307375 -0.4935143775781184 -2.646293296293553 -0.0582415057117433 0.8366452783370826 -0.3988459000205521 -0.17448841397392895 0.6855364862553506 1.0 +0.9789842607419063 -1.0596390892575 0.23852982942962941 -0.8053140950405908 0.7871040721446222 1.976677027556592 0.5995685095364299 1.125783615924232 1.4443462768884263 0.1845204000538479 1.0 +1.3973125791335586 -0.3062544898706742 -0.7976219502118782 -0.40151386976975134 1.2623072067070402 1.8207914876493103 -1.0418678041321559 -1.589665213428925 0.5307364716391962 -0.7922803547040447 1.0 +1.1017576064074774 -1.0678527622740026 -0.9445982960407311 -2.1011971049841307 -0.11413232110538522 -1.222003337203902 -2.4550466142310423 -1.1201845678212112 -0.7156252974248424 -0.025760816859393108 1.0 +-1.8058408019479073 0.7366186955374812 -0.32080614910166755 -0.4330613886387762 -1.4962992713815841 0.40508582774258556 0.4413887293067582 -0.5490831404626035 0.6100116286031322 -0.828851647296513 -1.0 +1.2375305062148136 -0.5192383517609591 1.2853732452582287 -1.567173603615006 0.028276392213320543 0.8139881757232938 0.5463410857422811 -0.06302357453906617 -0.05500426148539334 0.0006425951063431532 -1.0 +-0.07145737231420544 -1.395001107132957 0.28458137387342325 0.3867916033916995 -0.7267249384746718 -0.1849607732851202 -0.6748996601314392 -0.43674374808586897 0.674819738063599 -0.4055420715795304 -1.0 +-1.0069633092095855 -1.2688817610198302 -0.32042678881723646 1.0352039943343663 1.452287979486792 -0.9663420310866527 2.010059685469909 0.6382535885768728 -0.3721075714225364 0.10177233182573647 1.0 +1.1158189890375427 0.42214550402037104 -2.1823257723449716 -0.9066512150662098 -1.412316839028218 -0.3306263767151245 -0.7142440680403472 0.9231332509108808 0.40749776579756786 -0.5078891532344042 1.0 +0.8874790066565631 -1.4181696233434609 1.7326524695395533 1.400537549212823 -0.7765281127198043 -0.7750661967244074 -0.039442465091911745 -0.18435061102908676 2.34264998959277 0.24730882154569564 1.0 +1.1167623980241432 -1.1710167277951478 0.4840451626849294 0.6129896196691065 0.7861749091943397 -0.4567328276144244 1.196021773740542 0.6185824014903878 -0.8052420193164351 -0.17371537721976824 -1.0 +0.3886063354203737 -0.8519191815769896 0.777798430756629 -0.1956740246011355 -0.9818342986021706 -1.8082747202412792 0.09109665891070905 1.9720632551331263 1.3087050447054585 1.4745596839225859 1.0 +0.6743856996913792 0.5076045771539546 -1.3435344804535878 -0.6271086563292855 -0.06417465757776492 -1.5347653622790542 -0.2838814691027685 2.0122972992517996 -0.6978430052129182 0.32760478280433014 1.0 +0.9262670775239829 1.7736649633589774 -1.8016661117426578 0.8466908472824773 -0.02744135898987532 -0.07821244380148357 0.6842111309601743 0.23005842525377157 -0.27864006963781 -1.7847049893555713 1.0 +-0.5732207905423437 -1.7756735671858839 -2.7743429256349788 -0.203481067272865 0.05171883427541955 1.074577822721548 0.8425893427526947 -0.9783414180126836 -0.5662391541683488 -0.4246048158085039 1.0 +0.3350393042548078 1.7093797620922129 -0.6158464089070147 -0.5337698988511439 1.5648179056074947 -1.2008712526114405 -1.6140594516647768 -0.12634115842088806 -0.41067155295715857 0.3631710205554516 1.0 +-0.6255286845191469 -0.2807183222784557 0.9023232843483289 -0.19571829101336422 0.027557541194770604 -1.6592898530757696