annotate aragorn.xml @ 0:d34f31cbc9dd draft

Uploaded

<tool id="aragorn_trna" name="tRNA and tmRNA" version="0.3">
    <description>prediction (Aragon)</description>
    <requirements>
        <requirement type="package" version="1.2.36">aragorn</requirement>
    </requirements>
    <command>
        aragorn 
            $input 
            -gc$genbank_gencode
            $tmRNA
            $tRNA
            $mtRNA
            $mam_mtRNA
            $topology
            -o $output
            $secondary_structure
            $introns
    </command>
    <inputs>
        <param name="input" type="data" format="fasta" label="Genome Sequence"/>
        <param name="genbank_gencode" type="select" label="Genetic code">
            <option value="1" select="True">1. Standard</option>
            <option value="2">2. Vertebrate Mitochondrial</option>
            <option value="3">3. Yeast Mitochondrial</option>
            <option value="4">4. Mold, Protozoan, and Coelenterate Mitochondrial Code and the Mycoplasma/Spiroplasma Code</option>
            <option value="5">5. Invertebrate Mitochondrial</option>
            <option value="6">6. Ciliate, Dasycladacean and Hexamita Nuclear Code</option>
            <option value="9">9. Echinoderm Mitochondrial</option>
            <option value="10">10. Euplotid Nuclear</option>
            <option value="11">11. Bacteria and Archaea</option>
            <option value="12">12. Alternative Yeast Nuclear</option>
            <option value="13">13. Ascidian Mitochondrial</option>
            <option value="14">14. Flatworm Mitochondrial</option>
            <option value="15">15. Blepharisma Macronuclear</option>
            <option value="16">16. Chlorophycean Mitochondrial</option>
            <option value="21">21. Trematode Mitochondrial</option>
            <option value="22">22. Scenedesmus obliquus mitochondrial</option>
            <option value="23">23. Thraustochytrium Mitochondrial</option>
            <option value="24">24. Pterobranchia mitochondrial</option>
        </param>
        <param name="topology" type="select" label="Topology">
            <option value="-c">Assume that each sequence has a circular topology</option>
            <option value="-l">Assume that each sequence has a linear topology</option>
        </param>
        <param name='tmRNA' type='boolean' label='Search for tmRNA genes (-m)' truevalue='-m' falsevalue='' checked="true" help='' />
        <param name='tRNA' type='boolean' label='Search for tRNA genes (-t)' truevalue='-t' falsevalue='' checked="true" help='' />
        <param name='mtRNA' type='boolean' label='Search for Metazoan mitochondrial tRNA genes (-mt)' truevalue='-mt' falsevalue='' checked="false" help='-i switch ignored. Composite Metazoan mitochondrial genetic code used.' />
        <param name='mam_mtRNA' type='boolean' label='Search for Mammalian mitochondrial tRNA genes (-mtmam)' truevalue='-mtmam' falsevalue='' checked="false" help='-i switch ignored. -tv switch set. Mammalian mitochondrial genetic code used.' />
        <param name='introns' type='boolean' label='Search for tRNA genes with introns in anticodon loop ...' truevalue='-i' falsevalue='' checked="false" help='...with maximum length 3000 bases (-i).' />
        <param name='secondary_structure' type='boolean' label='Print out secondary structure (-fasta,-fon)' truevalue='-fasta' falsevalue='-fon' checked="false" help='' />
    </inputs>
    <outputs>
        <data name="output" format="fasta">
            <change_format>
               <when input="secondary_structure" value="true" format="text"/>
             </change_format>
        </data>
    </outputs>
    <tests>
        <test>
            <param name="input" value="trna_arabidopsis.fasta" ftype="fasta" />
            <param name="genbank_gencode" value="1" />
            <param name="topology" value="-c" />
            <param name="tmRNA" value="-m" />
            <param name="tRNA" value="-t" />
            <param name="mtRNA" value="" />
            <param name="mam_mtRNA" value="" />
            <param name="introns" value="" /> 
            <param name="secondary_structure" value="-fon" />
            <output name="output" file="aragorn_tansl-table-1_tmRNA_tRNA.fasta" ftype="fasta" />
        </test>
    </tests>
    <help>

**What it does**

Aragorn_ predicts tRNA (and tmRNA) in nucleotide sequences.

.. _Aragorn: http://mbio-serv2.mbioekol.lu.se/ARAGORN/

-----

**Example**

Suppose you have the following nucleotide sequences::

    >SQ   Sequence 8667507 BP; 1203558 A; 3121252 C; 3129638 G; 1213059 T; 0 other;
    cccgcggagcgggtaccacatcgctgcgcgatgtgcgagcgaacacccgggctgcgcccg
    ggtgttgcgctcccgctccgcgggagcgctggcgggacgctgcgcgtcccgctcaccaag
    cccgcttcgcgggcttggtgacgctccgtccgctgcgcttccggagttgcggggcttcgc
    cccgctaaccctgggcctcgcttcgctccgccttgggcctgcggcgggtccgctgcgctc
    ccccgcctcaagggcccttccggctgcgcctccaggacccaaccgcttgcgcgggcctgg
    ....

Running this tool can produce a FASTA file with all detected RNAs or a more detailed text file like the following::

                 c
                c
               a
             g-c
             g-c
             g-c
             c-g
             g-c
             a-t
             t-a     ca
            t   tgacc  a
     ga    a    !!!!!  g
    t  ctcg     actgg  c
    g  !!!!    c     tt
    g  gagc     t
     aa    g     g
            c-gag
            t-a
            t-a
            c-g
            g-c
           t   c
           t   a
            cac

    tRNA-Val(cac)
    74 bases, %GC = 58.1
    Sequence [6669703,6669776]


    tRNA Anticodon Frequency
    AAA Phe       GAA Phe  1    CAA Leu  1    TAA Leu  1    
    AGA Ser       GGA Ser  1    CGA Ser  2    TGA Ser  1    
    ACA Cys       GCA Cys  2    CCA Trp  2    TCA seC       
    ATA Tyr       GTA Tyr  1    CTA Pyl       TTA Stop      
    AAG Leu       GAG Leu  3    CAG Leu  1    TAG Leu  2    
    AGG Pro       GGG Pro  2    CGG Pro  2    TGG Pro  2    
    ACG Arg  1    GCG Arg  2    CCG Arg  1    TCG Arg       
    ATG His       GTG His  2    CTG Gln  2    TTG Gln  1    
    AAC Val       GAC Val  3    CAC Val  2    TAC Val  1    
    AGC Ala       GGC Ala  2    CGC Ala  3    TGC Ala  1    
    ACC Gly       GCC Gly  5    CCC Gly  1    TCC Gly  2    
    ATC Asp       GTC Asp  3    CTC Glu  2    TTC Glu  2    
    AAT Ile       GAT Ile  3    CAT Met  6    TAT Ile       
    AGT Thr       GGT Thr  2    CGT Thr  1    TGT Thr  2    
    ACT Ser       GCT Ser  1    CCT Arg  1    TCT Arg  1    
    ATT Asn       GTT Asn  3    CTT Lys  3    TTT Lys  2    
    Ambiguous: 1

    tRNA Codon Frequency
    TTT Phe       TTC Phe  1    TTG Leu  1    TTA Leu  1    
    TCT Ser       TCC Ser  1    TCG Ser  2    TCA Ser  1    
    TGT Cys       TGC Cys  2    TGG Trp  2    TGA seC       
    TAT Tyr       TAC Tyr  1    TAG Pyl       TAA Stop      
    CTT Leu       CTC Leu  3    CTG Leu  1    CTA Leu  2    
    CCT Pro       CCC Pro  2    CCG Pro  2    CCA Pro  2    
    CGT Arg  1    CGC Arg  2    CGG Arg  1    CGA Arg       
    CAT His       CAC His  2    CAG Gln  2    CAA Gln  1    
    GTT Val       GTC Val  3    GTG Val  2    GTA Val  1    
    GCT Ala       GCC Ala  2    GCG Ala  3    GCA Ala  1    
    GGT Gly       GGC Gly  5    GGG Gly  1    GGA Gly  2    
    GAT Asp       GAC Asp  3    GAG Glu  2    GAA Glu  2    
    ATT Ile       ATC Ile  3    ATG Met  6    ATA Ile       
    ACT Thr       ACC Thr  2    ACG Thr  1    ACA Thr  2    
    AGT Ser       AGC Ser  1    AGG Arg  1    AGA Arg  1    
    AAT Asn       AAC Asn  3    AAG Lys  3    AAA Lys  2    
    Ambiguous: 1

    Number of tRNA genes = 86
    tRNA GC range = 50.0% to 85.1%
    Number of tmRNA genes = 1

-------

**References**

Dean Laslett and Bjorn Canback

ARAGORN, a program to detect tRNA genes and tmRNA genes in nucleotide sequences Nucl. Acids Res. (2004) 32(1): 11-16

doi:10.1093/nar/gkh152 

    </help>
</tool>