diff aragorn.xml @ 0:d34f31cbc9dd draft

Uploaded

--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/aragorn.xml	Sat Jul 06 10:37:13 2013 -0400
@@ -0,0 +1,180 @@
+<tool id="aragorn_trna" name="tRNA and tmRNA" version="0.3">
+    <description>prediction (Aragon)</description>
+    <requirements>
+        <requirement type="package" version="1.2.36">aragorn</requirement>
+    </requirements>
+    <command>
+        aragorn 
+            $input 
+            -gc$genbank_gencode
+            $tmRNA
+            $tRNA
+            $mtRNA
+            $mam_mtRNA
+            $topology
+            -o $output
+            $secondary_structure
+            $introns
+    </command>
+    <inputs>
+        <param name="input" type="data" format="fasta" label="Genome Sequence"/>
+        <param name="genbank_gencode" type="select" label="Genetic code">
+            <option value="1" select="True">1. Standard</option>
+            <option value="2">2. Vertebrate Mitochondrial</option>
+            <option value="3">3. Yeast Mitochondrial</option>
+            <option value="4">4. Mold, Protozoan, and Coelenterate Mitochondrial Code and the Mycoplasma/Spiroplasma Code</option>
+            <option value="5">5. Invertebrate Mitochondrial</option>
+            <option value="6">6. Ciliate, Dasycladacean and Hexamita Nuclear Code</option>
+            <option value="9">9. Echinoderm Mitochondrial</option>
+            <option value="10">10. Euplotid Nuclear</option>
+            <option value="11">11. Bacteria and Archaea</option>
+            <option value="12">12. Alternative Yeast Nuclear</option>
+            <option value="13">13. Ascidian Mitochondrial</option>
+            <option value="14">14. Flatworm Mitochondrial</option>
+            <option value="15">15. Blepharisma Macronuclear</option>
+            <option value="16">16. Chlorophycean Mitochondrial</option>
+            <option value="21">21. Trematode Mitochondrial</option>
+            <option value="22">22. Scenedesmus obliquus mitochondrial</option>
+            <option value="23">23. Thraustochytrium Mitochondrial</option>
+            <option value="24">24. Pterobranchia mitochondrial</option>
+        </param>
+        <param name="topology" type="select" label="Topology">
+            <option value="-c">Assume that each sequence has a circular topology</option>
+            <option value="-l">Assume that each sequence has a linear topology</option>
+        </param>
+        <param name='tmRNA' type='boolean' label='Search for tmRNA genes (-m)' truevalue='-m' falsevalue='' checked="true" help='' />
+        <param name='tRNA' type='boolean' label='Search for tRNA genes (-t)' truevalue='-t' falsevalue='' checked="true" help='' />
+        <param name='mtRNA' type='boolean' label='Search for Metazoan mitochondrial tRNA genes (-mt)' truevalue='-mt' falsevalue='' checked="false" help='-i switch ignored. Composite Metazoan mitochondrial genetic code used.' />
+        <param name='mam_mtRNA' type='boolean' label='Search for Mammalian mitochondrial tRNA genes (-mtmam)' truevalue='-mtmam' falsevalue='' checked="false" help='-i switch ignored. -tv switch set. Mammalian mitochondrial genetic code used.' />
+        <param name='introns' type='boolean' label='Search for tRNA genes with introns in anticodon loop ...' truevalue='-i' falsevalue='' checked="false" help='...with maximum length 3000 bases (-i).' />
+        <param name='secondary_structure' type='boolean' label='Print out secondary structure (-fasta,-fon)' truevalue='-fasta' falsevalue='-fon' checked="false" help='' />
+    </inputs>
+    <outputs>
+        <data name="output" format="fasta">
+            <change_format>
+               <when input="secondary_structure" value="true" format="text"/>
+             </change_format>
+        </data>
+    </outputs>
+    <tests>
+        <test>
+            <param name="input" value="trna_arabidopsis.fasta" ftype="fasta" />
+            <param name="genbank_gencode" value="1" />
+            <param name="topology" value="-c" />
+            <param name="tmRNA" value="-m" />
+            <param name="tRNA" value="-t" />
+            <param name="mtRNA" value="" />
+            <param name="mam_mtRNA" value="" />
+            <param name="introns" value="" /> 
+            <param name="secondary_structure" value="-fon" />
+            <output name="output" file="aragorn_tansl-table-1_tmRNA_tRNA.fasta" ftype="fasta" />
+        </test>
+    </tests>
+    <help>
+
+**What it does**
+
+Aragorn_ predicts tRNA (and tmRNA) in nucleotide sequences.
+
+.. _Aragorn: http://mbio-serv2.mbioekol.lu.se/ARAGORN/
+
+-----
+
+**Example**
+
+Suppose you have the following nucleotide sequences::
+
+    >SQ   Sequence 8667507 BP; 1203558 A; 3121252 C; 3129638 G; 1213059 T; 0 other;
+    cccgcggagcgggtaccacatcgctgcgcgatgtgcgagcgaacacccgggctgcgcccg
+    ggtgttgcgctcccgctccgcgggagcgctggcgggacgctgcgcgtcccgctcaccaag
+    cccgcttcgcgggcttggtgacgctccgtccgctgcgcttccggagttgcggggcttcgc
+    cccgctaaccctgggcctcgcttcgctccgccttgggcctgcggcgggtccgctgcgctc
+    ccccgcctcaagggcccttccggctgcgcctccaggacccaaccgcttgcgcgggcctgg
+    ....
+
+Running this tool can produce a FASTA file with all detected RNAs or a more detailed text file like the following::
+
+                 c
+                c
+               a
+             g-c
+             g-c
+             g-c
+             c-g
+             g-c
+             a-t
+             t-a     ca
+            t   tgacc  a
+     ga    a    !!!!!  g
+    t  ctcg     actgg  c
+    g  !!!!    c     tt
+    g  gagc     t
+     aa    g     g
+            c-gag
+            t-a
+            t-a
+            c-g
+            g-c
+           t   c
+           t   a
+            cac
+
+    tRNA-Val(cac)
+    74 bases, %GC = 58.1
+    Sequence [6669703,6669776]
+
+
+    tRNA Anticodon Frequency
+    AAA Phe       GAA Phe  1    CAA Leu  1    TAA Leu  1    
+    AGA Ser       GGA Ser  1    CGA Ser  2    TGA Ser  1    
+    ACA Cys       GCA Cys  2    CCA Trp  2    TCA seC       
+    ATA Tyr       GTA Tyr  1    CTA Pyl       TTA Stop      
+    AAG Leu       GAG Leu  3    CAG Leu  1    TAG Leu  2    
+    AGG Pro       GGG Pro  2    CGG Pro  2    TGG Pro  2    
+    ACG Arg  1    GCG Arg  2    CCG Arg  1    TCG Arg       
+    ATG His       GTG His  2    CTG Gln  2    TTG Gln  1    
+    AAC Val       GAC Val  3    CAC Val  2    TAC Val  1    
+    AGC Ala       GGC Ala  2    CGC Ala  3    TGC Ala  1    
+    ACC Gly       GCC Gly  5    CCC Gly  1    TCC Gly  2    
+    ATC Asp       GTC Asp  3    CTC Glu  2    TTC Glu  2    
+    AAT Ile       GAT Ile  3    CAT Met  6    TAT Ile       
+    AGT Thr       GGT Thr  2    CGT Thr  1    TGT Thr  2    
+    ACT Ser       GCT Ser  1    CCT Arg  1    TCT Arg  1    
+    ATT Asn       GTT Asn  3    CTT Lys  3    TTT Lys  2    
+    Ambiguous: 1
+
+    tRNA Codon Frequency
+    TTT Phe       TTC Phe  1    TTG Leu  1    TTA Leu  1    
+    TCT Ser       TCC Ser  1    TCG Ser  2    TCA Ser  1    
+    TGT Cys       TGC Cys  2    TGG Trp  2    TGA seC       
+    TAT Tyr       TAC Tyr  1    TAG Pyl       TAA Stop      
+    CTT Leu       CTC Leu  3    CTG Leu  1    CTA Leu  2    
+    CCT Pro       CCC Pro  2    CCG Pro  2    CCA Pro  2    
+    CGT Arg  1    CGC Arg  2    CGG Arg  1    CGA Arg       
+    CAT His       CAC His  2    CAG Gln  2    CAA Gln  1    
+    GTT Val       GTC Val  3    GTG Val  2    GTA Val  1    
+    GCT Ala       GCC Ala  2    GCG Ala  3    GCA Ala  1    
+    GGT Gly       GGC Gly  5    GGG Gly  1    GGA Gly  2    
+    GAT Asp       GAC Asp  3    GAG Glu  2    GAA Glu  2    
+    ATT Ile       ATC Ile  3    ATG Met  6    ATA Ile       
+    ACT Thr       ACC Thr  2    ACG Thr  1    ACA Thr  2    
+    AGT Ser       AGC Ser  1    AGG Arg  1    AGA Arg  1    
+    AAT Asn       AAC Asn  3    AAG Lys  3    AAA Lys  2    
+    Ambiguous: 1
+
+    Number of tRNA genes = 86
+    tRNA GC range = 50.0% to 85.1%
+    Number of tmRNA genes = 1
+
+-------
+
+**References**
+
+Dean Laslett and Bjorn Canback
+
+ARAGORN, a program to detect tRNA genes and tmRNA genes in nucleotide sequences Nucl. Acids Res. (2004) 32(1): 11-16
+
+doi:10.1093/nar/gkh152 
+
+    </help>
+</tool>