Mercurial > repos > bgruening > trna_prediction
view aragorn.xml @ 0:d34f31cbc9dd draft
Uploaded
| author | bgruening |
|---|---|
| date | Sat, 06 Jul 2013 10:37:13 -0400 |
| parents | |
| children | d788d1abe238 |
line wrap: on
line source
<tool id="aragorn_trna" name="tRNA and tmRNA" version="0.3"> <description>prediction (Aragon)</description> <requirements> <requirement type="package" version="1.2.36">aragorn</requirement> </requirements> <command> aragorn $input -gc$genbank_gencode $tmRNA $tRNA $mtRNA $mam_mtRNA $topology -o $output $secondary_structure $introns </command> <inputs> <param name="input" type="data" format="fasta" label="Genome Sequence"/> <param name="genbank_gencode" type="select" label="Genetic code"> <option value="1" select="True">1. Standard</option> <option value="2">2. Vertebrate Mitochondrial</option> <option value="3">3. Yeast Mitochondrial</option> <option value="4">4. Mold, Protozoan, and Coelenterate Mitochondrial Code and the Mycoplasma/Spiroplasma Code</option> <option value="5">5. Invertebrate Mitochondrial</option> <option value="6">6. Ciliate, Dasycladacean and Hexamita Nuclear Code</option> <option value="9">9. Echinoderm Mitochondrial</option> <option value="10">10. Euplotid Nuclear</option> <option value="11">11. Bacteria and Archaea</option> <option value="12">12. Alternative Yeast Nuclear</option> <option value="13">13. Ascidian Mitochondrial</option> <option value="14">14. Flatworm Mitochondrial</option> <option value="15">15. Blepharisma Macronuclear</option> <option value="16">16. Chlorophycean Mitochondrial</option> <option value="21">21. Trematode Mitochondrial</option> <option value="22">22. Scenedesmus obliquus mitochondrial</option> <option value="23">23. Thraustochytrium Mitochondrial</option> <option value="24">24. Pterobranchia mitochondrial</option> </param> <param name="topology" type="select" label="Topology"> <option value="-c">Assume that each sequence has a circular topology</option> <option value="-l">Assume that each sequence has a linear topology</option> </param> <param name='tmRNA' type='boolean' label='Search for tmRNA genes (-m)' truevalue='-m' falsevalue='' checked="true" help='' /> <param name='tRNA' type='boolean' label='Search for tRNA genes (-t)' truevalue='-t' falsevalue='' checked="true" help='' /> <param name='mtRNA' type='boolean' label='Search for Metazoan mitochondrial tRNA genes (-mt)' truevalue='-mt' falsevalue='' checked="false" help='-i switch ignored. Composite Metazoan mitochondrial genetic code used.' /> <param name='mam_mtRNA' type='boolean' label='Search for Mammalian mitochondrial tRNA genes (-mtmam)' truevalue='-mtmam' falsevalue='' checked="false" help='-i switch ignored. -tv switch set. Mammalian mitochondrial genetic code used.' /> <param name='introns' type='boolean' label='Search for tRNA genes with introns in anticodon loop ...' truevalue='-i' falsevalue='' checked="false" help='...with maximum length 3000 bases (-i).' /> <param name='secondary_structure' type='boolean' label='Print out secondary structure (-fasta,-fon)' truevalue='-fasta' falsevalue='-fon' checked="false" help='' /> </inputs> <outputs> <data name="output" format="fasta"> <change_format> <when input="secondary_structure" value="true" format="text"/> </change_format> </data> </outputs> <tests> <test> <param name="input" value="trna_arabidopsis.fasta" ftype="fasta" /> <param name="genbank_gencode" value="1" /> <param name="topology" value="-c" /> <param name="tmRNA" value="-m" /> <param name="tRNA" value="-t" /> <param name="mtRNA" value="" /> <param name="mam_mtRNA" value="" /> <param name="introns" value="" /> <param name="secondary_structure" value="-fon" /> <output name="output" file="aragorn_tansl-table-1_tmRNA_tRNA.fasta" ftype="fasta" /> </test> </tests> <help> **What it does** Aragorn_ predicts tRNA (and tmRNA) in nucleotide sequences. .. _Aragorn: http://mbio-serv2.mbioekol.lu.se/ARAGORN/ ----- **Example** Suppose you have the following nucleotide sequences:: >SQ Sequence 8667507 BP; 1203558 A; 3121252 C; 3129638 G; 1213059 T; 0 other; cccgcggagcgggtaccacatcgctgcgcgatgtgcgagcgaacacccgggctgcgcccg ggtgttgcgctcccgctccgcgggagcgctggcgggacgctgcgcgtcccgctcaccaag cccgcttcgcgggcttggtgacgctccgtccgctgcgcttccggagttgcggggcttcgc cccgctaaccctgggcctcgcttcgctccgccttgggcctgcggcgggtccgctgcgctc ccccgcctcaagggcccttccggctgcgcctccaggacccaaccgcttgcgcgggcctgg .... Running this tool can produce a FASTA file with all detected RNAs or a more detailed text file like the following:: c c a g-c g-c g-c c-g g-c a-t t-a ca t tgacc a ga a !!!!! g t ctcg actgg c g !!!! c tt g gagc t aa g g c-gag t-a t-a c-g g-c t c t a cac tRNA-Val(cac) 74 bases, %GC = 58.1 Sequence [6669703,6669776] tRNA Anticodon Frequency AAA Phe GAA Phe 1 CAA Leu 1 TAA Leu 1 AGA Ser GGA Ser 1 CGA Ser 2 TGA Ser 1 ACA Cys GCA Cys 2 CCA Trp 2 TCA seC ATA Tyr GTA Tyr 1 CTA Pyl TTA Stop AAG Leu GAG Leu 3 CAG Leu 1 TAG Leu 2 AGG Pro GGG Pro 2 CGG Pro 2 TGG Pro 2 ACG Arg 1 GCG Arg 2 CCG Arg 1 TCG Arg ATG His GTG His 2 CTG Gln 2 TTG Gln 1 AAC Val GAC Val 3 CAC Val 2 TAC Val 1 AGC Ala GGC Ala 2 CGC Ala 3 TGC Ala 1 ACC Gly GCC Gly 5 CCC Gly 1 TCC Gly 2 ATC Asp GTC Asp 3 CTC Glu 2 TTC Glu 2 AAT Ile GAT Ile 3 CAT Met 6 TAT Ile AGT Thr GGT Thr 2 CGT Thr 1 TGT Thr 2 ACT Ser GCT Ser 1 CCT Arg 1 TCT Arg 1 ATT Asn GTT Asn 3 CTT Lys 3 TTT Lys 2 Ambiguous: 1 tRNA Codon Frequency TTT Phe TTC Phe 1 TTG Leu 1 TTA Leu 1 TCT Ser TCC Ser 1 TCG Ser 2 TCA Ser 1 TGT Cys TGC Cys 2 TGG Trp 2 TGA seC TAT Tyr TAC Tyr 1 TAG Pyl TAA Stop CTT Leu CTC Leu 3 CTG Leu 1 CTA Leu 2 CCT Pro CCC Pro 2 CCG Pro 2 CCA Pro 2 CGT Arg 1 CGC Arg 2 CGG Arg 1 CGA Arg CAT His CAC His 2 CAG Gln 2 CAA Gln 1 GTT Val GTC Val 3 GTG Val 2 GTA Val 1 GCT Ala GCC Ala 2 GCG Ala 3 GCA Ala 1 GGT Gly GGC Gly 5 GGG Gly 1 GGA Gly 2 GAT Asp GAC Asp 3 GAG Glu 2 GAA Glu 2 ATT Ile ATC Ile 3 ATG Met 6 ATA Ile ACT Thr ACC Thr 2 ACG Thr 1 ACA Thr 2 AGT Ser AGC Ser 1 AGG Arg 1 AGA Arg 1 AAT Asn AAC Asn 3 AAG Lys 3 AAA Lys 2 Ambiguous: 1 Number of tRNA genes = 86 tRNA GC range = 50.0% to 85.1% Number of tmRNA genes = 1 ------- **References** Dean Laslett and Bjorn Canback ARAGORN, a program to detect tRNA genes and tmRNA genes in nucleotide sequences Nucl. Acids Res. (2004) 32(1): 11-16 doi:10.1093/nar/gkh152 </help> </tool>