diff preProcess.xml @ 0:87fe81de0931 draft default tip

Uploaded

--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/preProcess.xml	Sun Jan 04 02:47:25 2015 -0500
@@ -0,0 +1,155 @@
+<tool id="preprocess" name="preProcess" veision="1.0.0">
+  <description>Program for Raw data preprocess analysis, including 3' adapter triming, reads collaping, genome mapping and  rfam non-miRNA analysis </description>
+
+  <requirements>
+	<requirement type="package" version="0.0.13">fastx_toolkit </requirement>
+    <requirement type="package" version="0.12.7">bowtie</requirement>
+    <requirement type="set_environment">SCRIPT_PATH</requirement>
+    <!--requirement type="package" version="3.0.1">R</requirement!-->
+	<requirement type="package" version="1.96">threads</requirement>
+	<requirement type="package" version="2.59">SVG</requirement>
+	<requirement type="package" version="2.1.8">ViennaRNA</requirement>
+  </requirements>
+
+  <!--command interpreter="perl">miPlant.pl -i $input -format $format -gfa $gfa -idx $index -pre $pre -mat $mat -rfam $rfam -idx2 $idx2 -D $D -a $a -M $M -min $min -max $max -mis $mis -e $e -f $f -v $v -r $r -dis $dis -flank $flank -mfe $mfe -t $t -o $output</command-->
+
+   <command interpreter="perl">preProcess.pl 
+   ## Change this to accommodate the number of threads you have available.
+        -t \${GALAXY_SLOTS:-4}
+	-path \$SCRIPT_PATH
+
+    #for $j, $s in enumerate( $series )
+    ##rank_of_series=$j
+    -i ${s.input}
+    -tag ${s.tag}
+    #end for
+
+     ## Do or not annotate rfam non-miRNA RNAs
+    #if $nocoding.annotate_rfam == "yes":
+		  ## prepare Rfam bowtie index
+		  #set rfam_index_path = ''
+		  #if str($nocoding.reference_rfam.source) == "history":
+			  -rfam $nocoding.reference_rfam.own_file 
+		  #else:
+			  #set rfam_index_path = $nocoding.reference_rfam.index.fields.path
+		      -rfam ${rfam_index_path}.fa -idx2 $rfam_index_path
+		  #end if
+		 -v $nocoding.v
+	#end if
+
+        ## prepare bowtie index
+        #set index_path = ''
+        #if str($reference_genome.source) == "history":
+            #set index_path = 'genome'
+            -gfa $reference_genome.own_file
+		#else:
+            #set index_path = $reference_genome.index.fields.path
+		   -gfa ${index_path}.fa -idx $index_path
+		#end if
+
+    -format $format -phred $phred -a $a -M $mapnt -min $min -max $max -mis $mismatch  > run.log
+  </command>
+
+  <inputs>
+
+   <repeat name="series" title="Raw sequence data">
+     <param name="input" type="data" label="Raw data"/>
+     <param name="tag" type="text" data_ref="input" label="Sample name of raw data"/>
+   </repeat>
+
+	<!--param name="input" format="tabular"  type="data" label="input config file" /-->
+	
+	<param name="format" type="select" label="Raw data format" multiple="false">
+	  <option value="fastq">Raw data is fastq. format</option>
+	  <option value="fasta">Raw data is fasta. format</option>
+	</param>
+	<param name="phred" type="select" label="Input quals are Phred+64 or Phred+33" multiple="false">
+	  <option value="64">Phred+64</option>
+	  <option value="33" selected="true">Phred+33</option>
+	</param>
+
+	        <!-- reference genome -->
+        <conditional name="reference_genome">
+          <param name="source" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options">
+            <option value="indexed">Use a built-in index</option>
+            <option value="history">Use one from the history</option>
+          </param>
+          <when value="indexed">
+            <param name="index" type="select" label="Select a reference genome" help="If your genome of interest is not listed, contact the Galaxy team">
+              <options from_data_table="bowtie_indexes">
+                <filter type="sort_by" column="2"/>
+                <validator type="no_options" message="No indexes are available for the selected input dataset"/>
+              </options>
+            </param>
+          </when>
+          <when value="history">
+            <param name="own_file" type="data" format="fasta" metadata_name="dbkey" label="Select the reference genome" />
+          </when>
+        </conditional>
+
+	<!--param name="gfa"  type="data" label="genome sequence fasta file"/-->
+	<!--param type="data" name="index" label="genome sequence bowtie index"/-->
+	<param name="a" type="text" value="TGGAATTCTCGGGTGCCAAGG" label="3' adapter sequence" />
+	<param name="mapnt" type="integer" value="8" label="minimum adapter map nts" />
+	<param name="min" type="integer" value="19" label="Minimum microRNA length" />
+	<param name="max" type="integer" value="28" label="Maximum microRNA length" />
+	<param name="mismatch" type="integer" value="0" label="Number of allowed mismatches when mapping reads to genome" />
+
+	<conditional name="nocoding">
+		<param name="annotate_rfam" type="select" label="Annotate nocoding RNAs(excluding miRNA)">
+		  <option value="yes" selected="true">yes</option>
+		  <option value="no">no</option>
+		 </param>
+		 <when value="yes">
+			<!--param name="rfam" type="data" label="rfam sequence file" /-->
+			<conditional name="reference_rfam">
+			  <param name="source" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options">
+				<option value="indexed">Use a built-in index</option>
+				<option value="history">Use one from the history</option>
+			  </param>
+			  <when value="indexed">
+				<param name="index" type="select" label="Select a reference" help="If your reference of interest is not listed, contact the Galaxy team">
+				  <options from_data_table="rfam_bowtie_indexes">
+					<filter type="sort_by" column="2"/>
+					<validator type="no_options" message="No indexes are available for the selected input dataset"/>
+				  </options>
+				</param>
+			  </when>
+			  <when value="history">
+				<param name="own_file" type="data" format="fasta" metadata_name="dbkey" label="Select the reference" />
+			  </when>
+			</conditional>
+
+			<param name="v" type="integer" value="0" label="Report end-to-end hits less than v mismatches for non-coding RNA annotation"/>
+		 </when>
+    </conditional> 
+
+
+
+  </inputs>
+
+  <outputs>
+   <data format="html" name="preprocess result" from_work_dir="preProcess/preprocessResult.html" label="${tool.name} on ${on_string}: preprocess result"/>
+
+   <data format="txt" name="clean FASTA data" from_work_dir="preProcess/preProcess_clean/clean_data.fa" label="${tool.name} on ${on_string}: clean FASTA data"/>
+
+   <data format="txt" name="genome mapping result" from_work_dir="preProcess/genome_match/genome_mapped.bwt" label="${tool.name} on ${on_string}: genome mapping result"/>
+   <data format="txt" name="genome mapped FASTA reads" from_work_dir="preProcess/genome_match/genome_mapped.fa" label="${tool.name} on ${on_string}: genome mapped FASTA reads"/>
+
+   <data format="txt" name="Rfam mapping result" from_work_dir="preProcess/rfam_match/rfam_mapped.bwt" label="${tool.name} on ${on_string}: Rfam mapping result">
+   <filter>(nocoding['annotate_rfam'] == 'yes')</filter>
+   </data>
+   <data format="txt" name="Rfam mapped FASTA file" from_work_dir="preProcess/rfam_match/rfam_mapped.fa" label="${tool.name} on ${on_string}: Rfam mapped FASTA file">
+   <filter>(nocoding['annotate_rfam'] == 'yes')</filter>
+   </data>
+   <data format="txt" name="Rfam not mapped FASTA file" from_work_dir="preProcess/rfam_match/rfam_not_mapped.fa" label="${tool.name} on ${on_string}: Rfam not mapped FASTA file">
+   <filter>(nocoding['annotate_rfam'] == 'yes')</filter>
+   </data>
+   <data format="txt" name="input config" from_work_dir="preProcess/input_config" label="${tool.name} on ${on_string}: input config"/>
+
+  </outputs>
+
+ <help>
+
+ </help>
+ </tool>