Mercurial > repos > bjoern-gruening > trna_prediction
diff tRNAscan.xml @ 1:65d282ef088e draft
Uploaded
author | bjoern-gruening |
---|---|
date | Tue, 19 Mar 2013 16:56:25 -0400 |
parents | |
children | 0fef99b5f63f |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tRNAscan.xml Tue Mar 19 16:56:25 2013 -0400 @@ -0,0 +1,215 @@ +<tool id="trnascan" name="tRNAscan" version="0.2.1"> + <description>tRNA Scan</description> + <requirements> + <requirement type="package" version="1.3.1">tRNAscan-SE</requirement> + </requirements> + <command interpreter="python"> + tRNAscan.py $organism $mode $showPrimSecondOpt $disablePseudo $showCodons -o $tabular_output $inputfile $fasta_output + </command> + <inputs> + <param name="inputfile" type="data" format="fasta" label="Genome Sequence" help="Dataset missing? See TIP below"/> + <param name="organism" type="select" format="text"> + <label>Select Organsim</label> + <option value="-G">general tRNA model</option> + <option value="-B">Bacterial</option> + <option value="-A">Archaeal</option> + <option value="-O">Mitochondrial/Chloroplast</option> + </param> + <param name="mode" type="select" format="text"> + <label>Select Mode</label> + <option value=""> Default</option> + <option value="-C">Covariance model analysis only (slow)</option> + <option value="-T">tRNAscan only</option> + <option value="-E">EufindtRNA only</option> + <option value="--infernal">Infernal cm analysis (max sensitivity, very slow)</option> + <option value="--newscan">Infernal and new cm models</option> + </param> + <param name='disablePseudo' type='boolean' label='Disable pseudo gene checking' truevalue='-D' falsevalue='' > </param> + <param name='showPrimSecondOpt' type='boolean' label='Show primary and secondary structure components to Cove scores' truevalue="-H" falsevalue=''></param> + <param name='showCodons' type='boolean' label='Show codons instead of tRNA anticodons' truevalue='-N' falsevalue=''></param> + </inputs> + <outputs> + <data format="tabular" name="tabular_output"/> + <data format="fasta" name="fasta_output"/> + </outputs> + <tests> + <test> + </test> + </tests> + +<help> + +.. class:: warningmark + +**TIP** This tool requires *fasta* format. + +----- + +**What it does** + + tRNAscan-SE was designed to make rapid, sensitive searches of genomic + sequence feasible using the selectivity of the Cove analysis package. + We have optimized search sensitivity with eukaryote cytoplasmic and + eubacterial sequences, but it may be applied more broadly with a + slight reduction in sensitivity . + http://lowelab.ucsc.edu/tRNAscan-SE/ + +----- + +**Organisim** + +- use general tRNA model: + + This option selects the general tRNA covariance model that was trained + on tRNAs from all three phylogenetic domains (archaea, bacteria, and + eukarya). This mode can be used when analyzing a mixed collection of + sequences from more than one phylogenetic domain, with only slight + loss of sensitivity and selectivity. The original publication + describing this program and tRNAscan-SE version 1.0 used this general + tRNA model exclusively. If you wish to compare scores to those found + in the paper or scans using v1.0, use this option. Use of this option + is compatible with all other search mode options described in this + section. + +- search for bacterial tRNAs + + This option selects the bacterial covariace model for tRNA analysis, + and loosens the search parameters for EufindtRNA to improve detection + of bacterial tRNAs. Use of this mode with bacterial sequences + will also improve bounds prediction of the 3' end (the terminal CAA + triplet). + +- search for archaeal tRNAs + + This option selects an archaeal-specific covariance model for tRNA + analysis, as well as slightly loosening the EufindtRNA search + cutoffs. + +- search for organellar (mitochondrial/chloroplast) tRNAs + + This parameter bypasses the fast first-pass scanners that are poor at + detecting organellar tRNAs and runs Cove analysis only. Since true + organellar tRNAs have been found to have Cove scores between 15 and 20 + bits, the search cutoff is lowered from 20 to 15 bits. Also, + pseudogene checking is disabled since it is only applicable to + eukaryotic cytoplasmic tRNA pseudogenes. Since Cove-only mode is + used, searches will be very slow (see -C option below) relative to the + default mode. + +------ + +**Mode** + +- search using Cove analysis only (max sensitivity, slow) + + Directs tRNAscan-SE to analyze sequences using Cove analysis only. + This option allows a slightly more sensitive search than the default + tRNAscan + EufindtRNA -> Cove mode, but is much slower (by approx. 250 + to 3,000 fold). Output format and other program defaults are + otherwise identical to the normal analysis. + +- search using Eukaryotic tRNA finder (EufindtRNA) only: + + This option runs EufindtRNA alone to search for tRNAs. Since Cove is + not being used as a secondary filter to remove false positives, this + run mode defaults to "Normal" parameters which more closely + approximates the sensitivity and selectivity of the original algorithm + describe by Pavesi and colleagues. + +- search using tRNAscan only (defaults to strict search params) + + Directs tRNAscan-SE to use only tRNAscan to analyze sequences. This + mode will cause tRNAscan to default to using "strict" parameters + (similar to tRNAscan version 1.3 operation). This mode of operation + is faster (about 3-5 times faster than default mode analysis), but + will result in approximately 0.2 to 0.6 false positive tRNAs per Mbp, + decreased sensitivity, and less reliable prediction of anticodons, + tRNA isotype, and introns. + +----- + +**disable pseudogene checking** + + Manually disable checking tRNAs for poor primary or secondary + structure scores often indicative of eukaryotic pseudogenes. This + will slightly speed the program and may be necessary for non-eukaryotic + sequences that are flagged as possible pseudogenes but are known to be + functional tRNAs. + +----- + +**Show both primary and secondary structure score components to covariance model bit scores** + + This option displays the breakdown of the two components of the + covariance model bit score. Since tRNA pseudogenes often have one + very low component (good secondary structure but poor primary sequence + similarity to the tRNA model, or vice versa), this information may be + useful in deciding whether a low-scoring tRNA is likely to be a + pseudogene. The heuristic pseudogene detection filter uses this + information to flag possible pseudogenes -- use this option to see why + a hit is marked as a possible pseudogene. The user may wish to + examine score breakdowns from known tRNAs in the organism of interest + to get a frame of reference. + +----- + +**Show codons instead of tRNA anticodons** + + This option causes tRNAscan-SE to output a tRNA's corresponding codon + in place of its anticodon. + +----- + +**Example** + +* input:: + + -Genome Sequence + + CELF22B7 C.aenorhabditis elegans (Bristol N2) cosmid F22B7 + GATCCTTGTAGATTTTGAATTTGAAGTTTTTTCTCATTCCAAAACTCTGT + GATCTGAAATAAAATGTCTCAAAAAAATAGAAGAAAACATTGCTTTATAT + TTATCAGTTATGGTTTTCAAAATTTTCTGACATACCGTTTTGCTTCTTTT + TTTCTCATCTTCTTCAAATATCAATTGTGATAATCTGACTCCTAACAATC + GAATTTCTTTTCCTTTTTCTTTTTCCAACAACTCCAGTGAGAACTTTTGA + ATATCTTCAAGTGACTTCACCACATCAGAAGGTGTCAACGATCTTGTGAG + AACATCGAATGAAGATAATTTTAATTTTAGAGTTACAGTTTTTCCTCCGA + CAATTCCTGATTTACGAACATCTTCTTCAAGCATTCTACAGATTTCTTGA + TGCTCTTCTAGGAGGATGTTGAAATCCGAAGTTGGAGAAAAAGTTCTCTC + AACTGAAATGCTTTTTCTTCGTGGATCCGATTCAGATGGACGACCTGGCA + GTCCGAGAGCCGTTCGAAGGAAAGATTCTTGTGAGAGAGGCGTGAAACAC + AAAGGGTATAGGTTCTTCTTCAGATTCATATCACCAACAGTTTGAATATC + CATTGCTTTCAGTTGAGCTTCGCATACACGACCAATTCCTCCAACCTAAA + AAATTATCTAGGTAAAACTAGAAGGTTATGCTTTAATAGTCTCACCTTAC + GAATCGGTAAATCCTTCAAAAACTCCATAATCGCGTTTTTATCATTTTCT + ..... + - organisim : Mixed (general tRNA model) + - mode : Default + - disable pseudogene checking : not checked + - Show both primary and secondary structure score components to covariance model bit scores : not checked + - Show codons instead of tRNA anticodons : not checked + +* output:: + + Sequence tRNA Bounds tRNA Anti Intron Bounds Cove Hit + Name tRNA # Begin End Type Codon Begin End Score Origin + -------- ------ ---- ------ ---- ----- ----- ---- ------ ------ + CELF22B7 1 12619 12738 Leu CAA 12657 12692 55.12 Bo + CELF22B7 2 19480 19561 Ser AGA 0 0 66.90 Bo + CELF22B7 3 26367 26439 Phe GAA 0 0 73.88 Bo + CELF22B7 4 26992 26920 Phe GAA 0 0 73.88 Bo + CELF22B7 5 23765 23694 Pro CGG 0 0 60.58 Bo + + + +------- + +**References** + +Todd M. Lowe and Sean R. Eddy +tRNAscan-SE: A Program for Improved Detection of Transfer RNA Genes in Genomic Sequence Nucl. Acids Res. (1997) 25(5): 0955-964 +doi:10.1093/nar/25.5.0955 + + </help> + +</tool>