diff tRNAscan.xml @ 1:65d282ef088e draft

Uploaded

--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tRNAscan.xml	Tue Mar 19 16:56:25 2013 -0400
@@ -0,0 +1,215 @@
+<tool id="trnascan" name="tRNAscan" version="0.2.1">
+    <description>tRNA Scan</description>
+    <requirements>
+        <requirement type="package" version="1.3.1">tRNAscan-SE</requirement>
+    </requirements>
+    <command interpreter="python">
+        tRNAscan.py $organism $mode $showPrimSecondOpt $disablePseudo $showCodons -o $tabular_output $inputfile $fasta_output
+    </command>
+    <inputs>
+        <param name="inputfile" type="data" format="fasta" label="Genome Sequence" help="Dataset missing? See TIP below"/>
+        <param name="organism" type="select" format="text">
+            <label>Select Organsim</label>
+            <option value="-G">general tRNA model</option>
+            <option value="-B">Bacterial</option>
+            <option value="-A">Archaeal</option>
+            <option value="-O">Mitochondrial/Chloroplast</option>
+        </param>
+        <param name="mode" type="select" format="text">
+            <label>Select Mode</label>		
+            <option value=""> Default</option>
+            <option value="-C">Covariance model analysis only (slow)</option>
+            <option value="-T">tRNAscan only</option>
+            <option value="-E">EufindtRNA only</option>
+            <option value="--infernal">Infernal cm analysis (max sensitivity, very slow)</option>
+            <option value="--newscan">Infernal and new cm models</option>
+        </param>
+        <param name='disablePseudo' type='boolean' label='Disable pseudo gene checking' truevalue='-D' falsevalue='' >	</param>
+        <param name='showPrimSecondOpt' type='boolean' label='Show primary and secondary structure components to Cove scores' truevalue="-H" falsevalue=''></param>
+        <param name='showCodons' type='boolean' label='Show codons instead of tRNA anticodons' truevalue='-N' falsevalue=''></param>
+    </inputs>
+    <outputs>
+        <data format="tabular" name="tabular_output"/>
+        <data format="fasta" name="fasta_output"/>
+    </outputs>
+    <tests>
+        <test>
+        </test>
+    </tests>
+
+<help>
+
+.. class:: warningmark
+
+**TIP** This tool requires *fasta* format.
+
+-----
+
+**What it does**
+
+	tRNAscan-SE was designed to make rapid, sensitive searches of genomic
+	sequence feasible using the selectivity of the Cove analysis package.
+	We have optimized search sensitivity with eukaryote cytoplasmic and
+	eubacterial sequences, but it may be applied more broadly with a
+	slight reduction in sensitivity .
+	http://lowelab.ucsc.edu/tRNAscan-SE/
+
+-----
+
+**Organisim**
+
+- use general tRNA model:
+
+	This option selects the general tRNA covariance model that was trained
+	on tRNAs from all three phylogenetic domains (archaea, bacteria, and
+	eukarya).  This mode can be used when analyzing a mixed collection of
+	sequences from more than one phylogenetic domain, with only slight
+	loss of sensitivity and selectivity.  The original publication
+	describing this program and tRNAscan-SE version 1.0 used this general
+	tRNA model exclusively.  If you wish to compare scores to those found
+	in the paper or scans using v1.0, use this option.  Use of this option
+	is compatible with all other search mode options described in this
+	section.
+
+- search for bacterial tRNAs
+
+	This option selects the bacterial covariace model for tRNA analysis,
+	and loosens the search parameters for EufindtRNA to improve detection
+	of bacterial tRNAs.  Use of this mode with bacterial sequences
+	will also improve bounds prediction of the 3' end (the terminal CAA
+	triplet).
+
+- search for archaeal tRNAs
+
+	This option selects an archaeal-specific covariance model for tRNA
+	analysis, as well as slightly loosening the EufindtRNA search
+	cutoffs.
+
+- search for organellar (mitochondrial/chloroplast) tRNAs
+
+	This parameter bypasses the fast first-pass scanners that are poor at
+	detecting organellar tRNAs and runs Cove analysis only.  Since true
+	organellar tRNAs have been found to have Cove scores between 15 and 20
+	bits, the search cutoff is lowered from 20 to 15 bits.  Also,
+	pseudogene checking is disabled since it is only applicable to
+	eukaryotic cytoplasmic tRNA pseudogenes.  Since Cove-only mode is
+	used, searches will be very slow (see -C option below) relative to the
+	default mode.
+
+------
+
+**Mode**
+
+- search using Cove analysis only (max sensitivity, slow)
+
+	Directs tRNAscan-SE to analyze sequences using Cove analysis only.
+	This option allows a slightly more sensitive search than the default
+	tRNAscan + EufindtRNA -> Cove mode, but is much slower (by approx. 250
+	to 3,000 fold).  Output format and other program defaults are
+	otherwise identical to the normal analysis.
+
+- search using Eukaryotic tRNA finder (EufindtRNA) only:
+
+	This option runs EufindtRNA alone to search for tRNAs.  Since Cove is
+	not being used as a secondary filter to remove false positives, this
+	run mode defaults to "Normal" parameters which more closely
+	approximates the sensitivity and selectivity of the original algorithm
+	describe by Pavesi and colleagues.
+
+- search using tRNAscan only (defaults to strict search params)
+
+	Directs tRNAscan-SE to use only tRNAscan to analyze sequences.  This
+	mode will cause tRNAscan to default to using "strict" parameters
+	(similar to tRNAscan version 1.3 operation).  This mode of operation
+	is faster (about 3-5 times faster than default mode analysis), but
+	will result in approximately 0.2 to 0.6 false positive tRNAs per Mbp,
+	decreased sensitivity, and less reliable prediction of anticodons,
+	tRNA isotype, and introns.
+
+-----
+
+**disable pseudogene checking**
+
+	Manually disable checking tRNAs for poor primary or secondary
+	structure scores often indicative of eukaryotic pseudogenes.  This
+	will slightly speed the program and may be necessary for non-eukaryotic
+	sequences that are flagged as possible pseudogenes but are known to be
+	functional tRNAs.
+
+-----
+
+**Show both primary and secondary structure score components to covariance model bit scores**
+
+	This option displays the breakdown of the two components of the
+	covariance model bit score.  Since tRNA pseudogenes often have one
+	very low component (good secondary structure but poor primary sequence
+	similarity to the tRNA model, or vice versa), this information may be
+	useful in deciding whether a low-scoring tRNA is likely to be a
+	pseudogene.  The heuristic pseudogene detection filter uses this
+	information to flag possible pseudogenes -- use this option to see why
+	a hit is marked as a possible pseudogene.  The user may wish to
+	examine score breakdowns from known tRNAs in the organism of interest 
+	to get a frame of reference.
+
+-----
+
+**Show codons instead of tRNA anticodons**
+
+	This option causes tRNAscan-SE to output a tRNA's corresponding codon
+	in place of its anticodon.
+
+-----
+
+**Example**
+
+* input::
+
+	-Genome Sequence
+
+	CELF22B7  C.aenorhabditis elegans (Bristol N2) cosmid F22B7
+	GATCCTTGTAGATTTTGAATTTGAAGTTTTTTCTCATTCCAAAACTCTGT
+	GATCTGAAATAAAATGTCTCAAAAAAATAGAAGAAAACATTGCTTTATAT
+	TTATCAGTTATGGTTTTCAAAATTTTCTGACATACCGTTTTGCTTCTTTT
+	TTTCTCATCTTCTTCAAATATCAATTGTGATAATCTGACTCCTAACAATC
+	GAATTTCTTTTCCTTTTTCTTTTTCCAACAACTCCAGTGAGAACTTTTGA
+	ATATCTTCAAGTGACTTCACCACATCAGAAGGTGTCAACGATCTTGTGAG
+	AACATCGAATGAAGATAATTTTAATTTTAGAGTTACAGTTTTTCCTCCGA
+	CAATTCCTGATTTACGAACATCTTCTTCAAGCATTCTACAGATTTCTTGA
+	TGCTCTTCTAGGAGGATGTTGAAATCCGAAGTTGGAGAAAAAGTTCTCTC
+	AACTGAAATGCTTTTTCTTCGTGGATCCGATTCAGATGGACGACCTGGCA
+	GTCCGAGAGCCGTTCGAAGGAAAGATTCTTGTGAGAGAGGCGTGAAACAC
+	AAAGGGTATAGGTTCTTCTTCAGATTCATATCACCAACAGTTTGAATATC
+	CATTGCTTTCAGTTGAGCTTCGCATACACGACCAATTCCTCCAACCTAAA
+	AAATTATCTAGGTAAAACTAGAAGGTTATGCTTTAATAGTCTCACCTTAC
+	GAATCGGTAAATCCTTCAAAAACTCCATAATCGCGTTTTTATCATTTTCT
+	.....
+	- organisim : Mixed (general tRNA model)
+	- mode : Default
+	- disable pseudogene checking : not checked
+	- Show both primary and secondary structure score components to covariance model bit scores : not checked
+	- Show codons instead of tRNA anticodons : not checked
+
+* output::
+
+	Sequence 		tRNA 	Bounds	tRNA	Anti	Intron Bounds	Cove	Hit
+	Name     	tRNA #	Begin	End  	Type	Codon	Begin	End	Score	Origin
+	-------- 	------	---- 	------	----	-----	-----	----	------	------
+	CELF22B7 	1	12619	12738	Leu	CAA	12657	12692	55.12	Bo
+	CELF22B7 	2	19480	19561	Ser	AGA	0	0	66.90	Bo
+	CELF22B7 	3	26367	26439	Phe	GAA	0	0	73.88	Bo
+	CELF22B7 	4	26992	26920	Phe	GAA	0	0	73.88	Bo
+	CELF22B7 	5	23765	23694	Pro	CGG	0	0	60.58	Bo
+
+
+
+-------
+
+**References**
+
+Todd M. Lowe and Sean R. Eddy
+tRNAscan-SE: A Program for Improved Detection of Transfer RNA Genes in Genomic Sequence Nucl. Acids Res. (1997) 25(5): 0955-964
+doi:10.1093/nar/25.5.0955 
+
+ </help>
+
+</tool>