# HG changeset patch
# User bjoern-gruening
# Date 1363726585 14400
# Node ID 65d282ef088e16cd669340ec93bec30a0b007417
# Parent b46d3df3eb9ef396b6241f10cedeede6f9f8aae1
Uploaded
diff -r b46d3df3eb9e -r 65d282ef088e aragorn.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/aragorn.xml Tue Mar 19 16:56:25 2013 -0400
@@ -0,0 +1,173 @@
+
+ Prediction of tRNAs
+
+ aragorn
+
+
+ aragorn
+ $input
+ -gc$genbank_gencode
+ $tmRNA
+ $tRNA
+ $mtRNA
+ $mam_mtRNA
+ $topology
+ -o $output
+ $secondary_structure
+ $introns
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+**What it does**
+
+This tool predicts, tRNA (and tmRNA) detection in nucleotide sequences.
+http://130.235.46.10/ARAGORN/
+-----
+
+**Example**
+
+Suppose you have the following DNA formatted sequences::
+
+ >SQ Sequence 8667507 BP; 1203558 A; 3121252 C; 3129638 G; 1213059 T; 0 other;
+ cccgcggagcgggtaccacatcgctgcgcgatgtgcgagcgaacacccgggctgcgcccg
+ ggtgttgcgctcccgctccgcgggagcgctggcgggacgctgcgcgtcccgctcaccaag
+ cccgcttcgcgggcttggtgacgctccgtccgctgcgcttccggagttgcggggcttcgc
+ cccgctaaccctgggcctcgcttcgctccgccttgggcctgcggcgggtccgctgcgctc
+ ccccgcctcaagggcccttccggctgcgcctccaggacccaaccgcttgcgcgggcctgg
+
+Running this tool will produce this::
+ --snip--
+ 87.
+
+ c
+ c
+ a
+ g-c
+ g-c
+ g-c
+ c-g
+ g-c
+ a-t
+ t-a ca
+ t tgacc a
+ ga a !!!!! g
+ t ctcg actgg c
+ g !!!! c tt
+ g gagc t
+ aa g g
+ c-gag
+ t-a
+ t-a
+ c-g
+ g-c
+ t c
+ t a
+ cac
+
+
+
+ tRNA-Val(cac)
+ 74 bases, %GC = 58.1
+ Sequence [6669703,6669776]
+
+
+
+
+ tRNA Anticodon Frequency
+ AAA Phe GAA Phe 1 CAA Leu 1 TAA Leu 1
+ AGA Ser GGA Ser 1 CGA Ser 2 TGA Ser 1
+ ACA Cys GCA Cys 2 CCA Trp 2 TCA seC
+ ATA Tyr GTA Tyr 1 CTA Pyl TTA Stop
+ AAG Leu GAG Leu 3 CAG Leu 1 TAG Leu 2
+ AGG Pro GGG Pro 2 CGG Pro 2 TGG Pro 2
+ ACG Arg 1 GCG Arg 2 CCG Arg 1 TCG Arg
+ ATG His GTG His 2 CTG Gln 2 TTG Gln 1
+ AAC Val GAC Val 3 CAC Val 2 TAC Val 1
+ AGC Ala GGC Ala 2 CGC Ala 3 TGC Ala 1
+ ACC Gly GCC Gly 5 CCC Gly 1 TCC Gly 2
+ ATC Asp GTC Asp 3 CTC Glu 2 TTC Glu 2
+ AAT Ile GAT Ile 3 CAT Met 6 TAT Ile
+ AGT Thr GGT Thr 2 CGT Thr 1 TGT Thr 2
+ ACT Ser GCT Ser 1 CCT Arg 1 TCT Arg 1
+ ATT Asn GTT Asn 3 CTT Lys 3 TTT Lys 2
+ Ambiguous: 1
+
+ tRNA Codon Frequency
+ TTT Phe TTC Phe 1 TTG Leu 1 TTA Leu 1
+ TCT Ser TCC Ser 1 TCG Ser 2 TCA Ser 1
+ TGT Cys TGC Cys 2 TGG Trp 2 TGA seC
+ TAT Tyr TAC Tyr 1 TAG Pyl TAA Stop
+ CTT Leu CTC Leu 3 CTG Leu 1 CTA Leu 2
+ CCT Pro CCC Pro 2 CCG Pro 2 CCA Pro 2
+ CGT Arg 1 CGC Arg 2 CGG Arg 1 CGA Arg
+ CAT His CAC His 2 CAG Gln 2 CAA Gln 1
+ GTT Val GTC Val 3 GTG Val 2 GTA Val 1
+ GCT Ala GCC Ala 2 GCG Ala 3 GCA Ala 1
+ GGT Gly GGC Gly 5 GGG Gly 1 GGA Gly 2
+ GAT Asp GAC Asp 3 GAG Glu 2 GAA Glu 2
+ ATT Ile ATC Ile 3 ATG Met 6 ATA Ile
+ ACT Thr ACC Thr 2 ACG Thr 1 ACA Thr 2
+ AGT Ser AGC Ser 1 AGG Arg 1 AGA Arg 1
+ AAT Asn AAC Asn 3 AAG Lys 3 AAA Lys 2
+ Ambiguous: 1
+
+ Number of tRNA genes = 86
+ tRNA GC range = 50.0% to 85.1%
+ Number of tmRNA genes = 1
+
+-------
+
+**References**
+
+Dean Laslett and Bjorn Canback
+ARAGORN, a program to detect tRNA genes and tmRNA genes in nucleotide sequences Nucl. Acids Res. (2004) 32(1): 11-16
+doi:10.1093/nar/gkh152
+
+
+
+
+
diff -r b46d3df3eb9e -r 65d282ef088e readme.txt
--- a/readme.txt Wed Jan 11 05:57:32 2012 -0500
+++ b/readme.txt Tue Mar 19 16:56:25 2013 -0400
@@ -1,7 +1,7 @@
Galaxy wrapper for t-RNA prediction tools
=========================================
-This wrapper is copyright 2012 by Björn Grüning.
+This wrapper is copyright 2013 by Björn Grüning.
This prepository contains wrapper for the command line tools of tRNAscan-SE and Arogorn.
http://lowelab.ucsc.edu/tRNAscan-SE/
@@ -50,9 +50,12 @@
tRNAscan:
v0.1 - Initial public release
+v0.2 - add fasta output
+v0.2.1 - added tool-dependency
aragorn:
v0.1 - Initial public release
+v0.2 - added options, upgrade to 1.2.36, tool-dependency
diff -r b46d3df3eb9e -r 65d282ef088e tRNAscan.py
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tRNAscan.py Tue Mar 19 16:56:25 2013 -0400
@@ -0,0 +1,74 @@
+#!/usr/bin/env python
+
+"""
+
+ Converts tRNAScan output back to fasta-sequences.
+
+"""
+
+import sys
+from Bio import SeqIO
+from Bio.SeqRecord import SeqRecord
+import subprocess
+
+
+def main(args):
+ """
+ Call from galaxy:
+ tRNAscan.py $organism $mode $showPrimSecondOpt $disablePseudo $showCodons $tabular_output $inputfile $fasta_output
+
+ tRNAscan-SE $organism $mode $showPrimSecondOpt $disablePseudo $showCodons -d -Q -y -q -b -o $tabular_output $inputfile;
+ """
+ cmd = """tRNAscan-SE -Q -y -q -b %s""" % ' '.join( args[:-1] )
+ child = subprocess.Popen(cmd.split(),
+ stdout=subprocess.PIPE, stderr=subprocess.PIPE)
+ stdout, stderr = child.communicate()
+ return_code = child.returncode
+ if return_code:
+ sys.stdout.write(stdout)
+ sys.stderr.write(stderr)
+ sys.stderr.write("Return error code %i from command:\n" % return_code)
+ sys.stderr.write("%s\n" % cmd)
+ else:
+ sys.stdout.write(stdout)
+ sys.stdout.write(stderr)
+
+ outfile = args[-1]
+ sequence_file = args[-2]
+ tRNAScan_file = args[-3]
+
+ with open( sequence_file ) as sequences:
+ sequence_recs = SeqIO.to_dict(SeqIO.parse(sequences, "fasta"))
+
+ tRNAs = []
+ with open(tRNAScan_file) as tRNA_handle:
+ for line in tRNA_handle:
+ line = line.strip()
+ if not line or line.startswith('#'):
+ continue
+ cols = line.split()
+ iid = cols[0].strip()
+ start = int(cols[2])
+ end = int(cols[3])
+ aa = cols[4]
+ codon = cols[5]
+ rec = sequence_recs[ iid ]
+ if start > end:
+ new_rec = rec[end:start]
+ new_rec.seq = new_rec.seq.reverse_complement()
+ new_rec.description = "%s %s %s %s %s" % (rec.description, aa, codon, start, end)
+ new_rec.id = rec.id
+ new_rec.name = rec.name
+ tRNAs.append( new_rec )
+ else:
+ new_rec = rec[start:end]
+ new_rec.id = rec.id
+ new_rec.name = rec.name
+ new_rec.description = "%s %s %s %s %s" % (rec.description, aa, codon, start, end)
+ tRNAs.append( new_rec )
+
+ SeqIO.write(tRNAs, open(outfile, 'w+'), "fasta")
+
+
+if __name__ == '__main__':
+ main(sys.argv[1:])
diff -r b46d3df3eb9e -r 65d282ef088e tRNAscan.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tRNAscan.xml Tue Mar 19 16:56:25 2013 -0400
@@ -0,0 +1,215 @@
+
+ tRNA Scan
+
+ tRNAscan-SE
+
+
+ tRNAscan.py $organism $mode $showPrimSecondOpt $disablePseudo $showCodons -o $tabular_output $inputfile $fasta_output
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+.. class:: warningmark
+
+**TIP** This tool requires *fasta* format.
+
+-----
+
+**What it does**
+
+ tRNAscan-SE was designed to make rapid, sensitive searches of genomic
+ sequence feasible using the selectivity of the Cove analysis package.
+ We have optimized search sensitivity with eukaryote cytoplasmic and
+ eubacterial sequences, but it may be applied more broadly with a
+ slight reduction in sensitivity .
+ http://lowelab.ucsc.edu/tRNAscan-SE/
+
+-----
+
+**Organisim**
+
+- use general tRNA model:
+
+ This option selects the general tRNA covariance model that was trained
+ on tRNAs from all three phylogenetic domains (archaea, bacteria, and
+ eukarya). This mode can be used when analyzing a mixed collection of
+ sequences from more than one phylogenetic domain, with only slight
+ loss of sensitivity and selectivity. The original publication
+ describing this program and tRNAscan-SE version 1.0 used this general
+ tRNA model exclusively. If you wish to compare scores to those found
+ in the paper or scans using v1.0, use this option. Use of this option
+ is compatible with all other search mode options described in this
+ section.
+
+- search for bacterial tRNAs
+
+ This option selects the bacterial covariace model for tRNA analysis,
+ and loosens the search parameters for EufindtRNA to improve detection
+ of bacterial tRNAs. Use of this mode with bacterial sequences
+ will also improve bounds prediction of the 3' end (the terminal CAA
+ triplet).
+
+- search for archaeal tRNAs
+
+ This option selects an archaeal-specific covariance model for tRNA
+ analysis, as well as slightly loosening the EufindtRNA search
+ cutoffs.
+
+- search for organellar (mitochondrial/chloroplast) tRNAs
+
+ This parameter bypasses the fast first-pass scanners that are poor at
+ detecting organellar tRNAs and runs Cove analysis only. Since true
+ organellar tRNAs have been found to have Cove scores between 15 and 20
+ bits, the search cutoff is lowered from 20 to 15 bits. Also,
+ pseudogene checking is disabled since it is only applicable to
+ eukaryotic cytoplasmic tRNA pseudogenes. Since Cove-only mode is
+ used, searches will be very slow (see -C option below) relative to the
+ default mode.
+
+------
+
+**Mode**
+
+- search using Cove analysis only (max sensitivity, slow)
+
+ Directs tRNAscan-SE to analyze sequences using Cove analysis only.
+ This option allows a slightly more sensitive search than the default
+ tRNAscan + EufindtRNA -> Cove mode, but is much slower (by approx. 250
+ to 3,000 fold). Output format and other program defaults are
+ otherwise identical to the normal analysis.
+
+- search using Eukaryotic tRNA finder (EufindtRNA) only:
+
+ This option runs EufindtRNA alone to search for tRNAs. Since Cove is
+ not being used as a secondary filter to remove false positives, this
+ run mode defaults to "Normal" parameters which more closely
+ approximates the sensitivity and selectivity of the original algorithm
+ describe by Pavesi and colleagues.
+
+- search using tRNAscan only (defaults to strict search params)
+
+ Directs tRNAscan-SE to use only tRNAscan to analyze sequences. This
+ mode will cause tRNAscan to default to using "strict" parameters
+ (similar to tRNAscan version 1.3 operation). This mode of operation
+ is faster (about 3-5 times faster than default mode analysis), but
+ will result in approximately 0.2 to 0.6 false positive tRNAs per Mbp,
+ decreased sensitivity, and less reliable prediction of anticodons,
+ tRNA isotype, and introns.
+
+-----
+
+**disable pseudogene checking**
+
+ Manually disable checking tRNAs for poor primary or secondary
+ structure scores often indicative of eukaryotic pseudogenes. This
+ will slightly speed the program and may be necessary for non-eukaryotic
+ sequences that are flagged as possible pseudogenes but are known to be
+ functional tRNAs.
+
+-----
+
+**Show both primary and secondary structure score components to covariance model bit scores**
+
+ This option displays the breakdown of the two components of the
+ covariance model bit score. Since tRNA pseudogenes often have one
+ very low component (good secondary structure but poor primary sequence
+ similarity to the tRNA model, or vice versa), this information may be
+ useful in deciding whether a low-scoring tRNA is likely to be a
+ pseudogene. The heuristic pseudogene detection filter uses this
+ information to flag possible pseudogenes -- use this option to see why
+ a hit is marked as a possible pseudogene. The user may wish to
+ examine score breakdowns from known tRNAs in the organism of interest
+ to get a frame of reference.
+
+-----
+
+**Show codons instead of tRNA anticodons**
+
+ This option causes tRNAscan-SE to output a tRNA's corresponding codon
+ in place of its anticodon.
+
+-----
+
+**Example**
+
+* input::
+
+ -Genome Sequence
+
+ CELF22B7 C.aenorhabditis elegans (Bristol N2) cosmid F22B7
+ GATCCTTGTAGATTTTGAATTTGAAGTTTTTTCTCATTCCAAAACTCTGT
+ GATCTGAAATAAAATGTCTCAAAAAAATAGAAGAAAACATTGCTTTATAT
+ TTATCAGTTATGGTTTTCAAAATTTTCTGACATACCGTTTTGCTTCTTTT
+ TTTCTCATCTTCTTCAAATATCAATTGTGATAATCTGACTCCTAACAATC
+ GAATTTCTTTTCCTTTTTCTTTTTCCAACAACTCCAGTGAGAACTTTTGA
+ ATATCTTCAAGTGACTTCACCACATCAGAAGGTGTCAACGATCTTGTGAG
+ AACATCGAATGAAGATAATTTTAATTTTAGAGTTACAGTTTTTCCTCCGA
+ CAATTCCTGATTTACGAACATCTTCTTCAAGCATTCTACAGATTTCTTGA
+ TGCTCTTCTAGGAGGATGTTGAAATCCGAAGTTGGAGAAAAAGTTCTCTC
+ AACTGAAATGCTTTTTCTTCGTGGATCCGATTCAGATGGACGACCTGGCA
+ GTCCGAGAGCCGTTCGAAGGAAAGATTCTTGTGAGAGAGGCGTGAAACAC
+ AAAGGGTATAGGTTCTTCTTCAGATTCATATCACCAACAGTTTGAATATC
+ CATTGCTTTCAGTTGAGCTTCGCATACACGACCAATTCCTCCAACCTAAA
+ AAATTATCTAGGTAAAACTAGAAGGTTATGCTTTAATAGTCTCACCTTAC
+ GAATCGGTAAATCCTTCAAAAACTCCATAATCGCGTTTTTATCATTTTCT
+ .....
+ - organisim : Mixed (general tRNA model)
+ - mode : Default
+ - disable pseudogene checking : not checked
+ - Show both primary and secondary structure score components to covariance model bit scores : not checked
+ - Show codons instead of tRNA anticodons : not checked
+
+* output::
+
+ Sequence tRNA Bounds tRNA Anti Intron Bounds Cove Hit
+ Name tRNA # Begin End Type Codon Begin End Score Origin
+ -------- ------ ---- ------ ---- ----- ----- ---- ------ ------
+ CELF22B7 1 12619 12738 Leu CAA 12657 12692 55.12 Bo
+ CELF22B7 2 19480 19561 Ser AGA 0 0 66.90 Bo
+ CELF22B7 3 26367 26439 Phe GAA 0 0 73.88 Bo
+ CELF22B7 4 26992 26920 Phe GAA 0 0 73.88 Bo
+ CELF22B7 5 23765 23694 Pro CGG 0 0 60.58 Bo
+
+
+
+-------
+
+**References**
+
+Todd M. Lowe and Sean R. Eddy
+tRNAscan-SE: A Program for Improved Detection of Transfer RNA Genes in Genomic Sequence Nucl. Acids Res. (1997) 25(5): 0955-964
+doi:10.1093/nar/25.5.0955
+
+
+
+
diff -r b46d3df3eb9e -r 65d282ef088e tool_conf.xml
--- a/tool_conf.xml Wed Jan 11 05:57:32 2012 -0500
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000
@@ -1,7 +0,0 @@
-
-
-
-
-
-
-
diff -r b46d3df3eb9e -r 65d282ef088e tool_dependencies.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_dependencies.xml Tue Mar 19 16:56:25 2013 -0400
@@ -0,0 +1,44 @@
+
+
+
+
+ http://mbio-serv2.mbioekol.lu.se/ARAGORN/Downloads/aragorn1.2.36.tgz
+ $INSTALL_DIR/bin/
+ gcc -O3 -ffast-math -finline-functions -o aragorn aragorn1.2.36.c
+
+ aragorn
+ $INSTALL_DIR/bin
+
+
+ $INSTALL_DIR/bin
+
+
+
+ Compiling ARAGORN requires gcc.
+
+
+
+
+ http://lowelab.ucsc.edu/software/tRNAscan-SE.tar.gz
+ $INSTALL_DIR/bin/
+ $INSTALL_DIR/lib/tRNAscan-SE/
+ cd ./tRNAscan-SE-1.3.1 && make
+
+ sed -i 's%^our $lib_dir.*%our $lib_dir="$INSTALL_DIR/lib/tRNAscan-SE/";%' ./tRNAscan-SE-1.3.1/tRNAscan-SE
+ sed -i 's%^our $bindir.*%our $bindir="$INSTALL_DIR/bin/";%' ./tRNAscan-SE-1.3.1/tRNAscan-SE
+ cd ./tRNAscan-SE-1.3.1 && cp trnascan-1.4 covels-SE coves-SE eufindtRNA tRNAscan-SE $INSTALL_DIR/bin/
+ cd ./tRNAscan-SE-1.3.1 && cp -R tRNAscanSE $INSTALL_DIR/bin/
+ cd ./tRNAscan-SE-1.3.1 && cp TPCsignal Dsignal *.cm gcode.* $INSTALL_DIR/lib/tRNAscan-SE/
+
+ wget ftp://selab.janelia.org/pub/software/infernal/infernal-1.0.2.tar.gz
+ tar xfvz infernal-1.0.2.tar.gz
+ cd infernal-1.0.2 && ./configure --prefix=$INSTALL_DIR && make && make install
+
+ $INSTALL_DIR/bin
+ $INSTALL_DIR/bin/
+
+
+
+ Compiling and running tRNAScan-SE requires gcc a PERL environment.
+
+
diff -r b46d3df3eb9e -r 65d282ef088e tools/aragorn.xml
--- a/tools/aragorn.xml Wed Jan 11 05:57:32 2012 -0500
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000
@@ -1,124 +0,0 @@
-
- Prediction of tRNAs
- aragorn $input > $output
-
-
-
-
-
-
-
-
-
-
-
-
-**What it does**
-
-This tool predicts, tRNA (and tmRNA) detection in nucleotide sequences.
-http://130.235.46.10/ARAGORN/
------
-
-**Example**
-
-Suppose you have the following DNA formatted sequences::
-
- >SQ Sequence 8667507 BP; 1203558 A; 3121252 C; 3129638 G; 1213059 T; 0 other;
- cccgcggagcgggtaccacatcgctgcgcgatgtgcgagcgaacacccgggctgcgcccg
- ggtgttgcgctcccgctccgcgggagcgctggcgggacgctgcgcgtcccgctcaccaag
- cccgcttcgcgggcttggtgacgctccgtccgctgcgcttccggagttgcggggcttcgc
- cccgctaaccctgggcctcgcttcgctccgccttgggcctgcggcgggtccgctgcgctc
- ccccgcctcaagggcccttccggctgcgcctccaggacccaaccgcttgcgcgggcctgg
-
-Running this tool will produce this::
- --snip--
- 87.
-
- c
- c
- a
- g-c
- g-c
- g-c
- c-g
- g-c
- a-t
- t-a ca
- t tgacc a
- ga a !!!!! g
- t ctcg actgg c
- g !!!! c tt
- g gagc t
- aa g g
- c-gag
- t-a
- t-a
- c-g
- g-c
- t c
- t a
- cac
-
-
-
- tRNA-Val(cac)
- 74 bases, %GC = 58.1
- Sequence [6669703,6669776]
-
-
-
-
- tRNA Anticodon Frequency
- AAA Phe GAA Phe 1 CAA Leu 1 TAA Leu 1
- AGA Ser GGA Ser 1 CGA Ser 2 TGA Ser 1
- ACA Cys GCA Cys 2 CCA Trp 2 TCA seC
- ATA Tyr GTA Tyr 1 CTA Pyl TTA Stop
- AAG Leu GAG Leu 3 CAG Leu 1 TAG Leu 2
- AGG Pro GGG Pro 2 CGG Pro 2 TGG Pro 2
- ACG Arg 1 GCG Arg 2 CCG Arg 1 TCG Arg
- ATG His GTG His 2 CTG Gln 2 TTG Gln 1
- AAC Val GAC Val 3 CAC Val 2 TAC Val 1
- AGC Ala GGC Ala 2 CGC Ala 3 TGC Ala 1
- ACC Gly GCC Gly 5 CCC Gly 1 TCC Gly 2
- ATC Asp GTC Asp 3 CTC Glu 2 TTC Glu 2
- AAT Ile GAT Ile 3 CAT Met 6 TAT Ile
- AGT Thr GGT Thr 2 CGT Thr 1 TGT Thr 2
- ACT Ser GCT Ser 1 CCT Arg 1 TCT Arg 1
- ATT Asn GTT Asn 3 CTT Lys 3 TTT Lys 2
- Ambiguous: 1
-
- tRNA Codon Frequency
- TTT Phe TTC Phe 1 TTG Leu 1 TTA Leu 1
- TCT Ser TCC Ser 1 TCG Ser 2 TCA Ser 1
- TGT Cys TGC Cys 2 TGG Trp 2 TGA seC
- TAT Tyr TAC Tyr 1 TAG Pyl TAA Stop
- CTT Leu CTC Leu 3 CTG Leu 1 CTA Leu 2
- CCT Pro CCC Pro 2 CCG Pro 2 CCA Pro 2
- CGT Arg 1 CGC Arg 2 CGG Arg 1 CGA Arg
- CAT His CAC His 2 CAG Gln 2 CAA Gln 1
- GTT Val GTC Val 3 GTG Val 2 GTA Val 1
- GCT Ala GCC Ala 2 GCG Ala 3 GCA Ala 1
- GGT Gly GGC Gly 5 GGG Gly 1 GGA Gly 2
- GAT Asp GAC Asp 3 GAG Glu 2 GAA Glu 2
- ATT Ile ATC Ile 3 ATG Met 6 ATA Ile
- ACT Thr ACC Thr 2 ACG Thr 1 ACA Thr 2
- AGT Ser AGC Ser 1 AGG Arg 1 AGA Arg 1
- AAT Asn AAC Asn 3 AAG Lys 3 AAA Lys 2
- Ambiguous: 1
-
- Number of tRNA genes = 86
- tRNA GC range = 50.0% to 85.1%
- Number of tmRNA genes = 1
-
--------
-
-**References**
-
-Dean Laslett and Bjorn Canback
-ARAGORN, a program to detect tRNA genes and tmRNA genes in nucleotide sequences Nucl. Acids Res. (2004) 32(1): 11-16
-doi:10.1093/nar/gkh152
-
-
-
-
-
diff -r b46d3df3eb9e -r 65d282ef088e tools/tRNAscan.xml
--- a/tools/tRNAscan.xml Wed Jan 11 05:57:32 2012 -0500
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000
@@ -1,214 +0,0 @@
-
- tRNA Scan
- tRNAscan-SE $organism $mode $showPrimSecondOpt $disablePseudo $showCodons -d -Q -y -q -b -o $output $inputfile > /dev/null
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-.. class:: warningmark
-
-**TIP** This tool requires *fasta* format.
-
------
-
-**What it does**
-
- tRNAscan-SE was designed to make rapid, sensitive searches of genomic
- sequence feasible using the selectivity of the Cove analysis package.
- We have optimized search sensitivity with eukaryote cytoplasmic and
- eubacterial sequences, but it may be applied more broadly with a
- slight reduction in sensitivity .
- http://lowelab.ucsc.edu/tRNAscan-SE/
-
------
-
-**Organisim**
-
-- use general tRNA model:
-
- This option selects the general tRNA covariance model that was trained
- on tRNAs from all three phylogenetic domains (archaea, bacteria, and
- eukarya). This mode can be used when analyzing a mixed collection of
- sequences from more than one phylogenetic domain, with only slight
- loss of sensitivity and selectivity. The original publication
- describing this program and tRNAscan-SE version 1.0 used this general
- tRNA model exclusively. If you wish to compare scores to those found
- in the paper or scans using v1.0, use this option. Use of this option
- is compatible with all other search mode options described in this
- section.
-
-- search for bacterial tRNAs
-
- This option selects the bacterial covariace model for tRNA analysis,
- and loosens the search parameters for EufindtRNA to improve detection
- of bacterial tRNAs. Use of this mode with bacterial sequences
- will also improve bounds prediction of the 3' end (the terminal CAA
- triplet).
-
-- search for archaeal tRNAs
-
- This option selects an archaeal-specific covariance model for tRNA
- analysis, as well as slightly loosening the EufindtRNA search
- cutoffs.
-
-- search for organellar (mitochondrial/chloroplast) tRNAs
-
- This parameter bypasses the fast first-pass scanners that are poor at
- detecting organellar tRNAs and runs Cove analysis only. Since true
- organellar tRNAs have been found to have Cove scores between 15 and 20
- bits, the search cutoff is lowered from 20 to 15 bits. Also,
- pseudogene checking is disabled since it is only applicable to
- eukaryotic cytoplasmic tRNA pseudogenes. Since Cove-only mode is
- used, searches will be very slow (see -C option below) relative to the
- default mode.
-
-------
-
-**Mode**
-
-- search using Cove analysis only (max sensitivity, slow)
-
- Directs tRNAscan-SE to analyze sequences using Cove analysis only.
- This option allows a slightly more sensitive search than the default
- tRNAscan + EufindtRNA -> Cove mode, but is much slower (by approx. 250
- to 3,000 fold). Output format and other program defaults are
- otherwise identical to the normal analysis.
-
-- search using Eukaryotic tRNA finder (EufindtRNA) only:
-
- This option runs EufindtRNA alone to search for tRNAs. Since Cove is
- not being used as a secondary filter to remove false positives, this
- run mode defaults to "Normal" parameters which more closely
- approximates the sensitivity and selectivity of the original algorithm
- describe by Pavesi and colleagues.
-
-- search using tRNAscan only (defaults to strict search params)
-
- Directs tRNAscan-SE to use only tRNAscan to analyze sequences. This
- mode will cause tRNAscan to default to using "strict" parameters
- (similar to tRNAscan version 1.3 operation). This mode of operation
- is faster (about 3-5 times faster than default mode analysis), but
- will result in approximately 0.2 to 0.6 false positive tRNAs per Mbp,
- decreased sensitivity, and less reliable prediction of anticodons,
- tRNA isotype, and introns.
-
------
-
-**disable pseudogene checking**
-
- Manually disable checking tRNAs for poor primary or secondary
- structure scores often indicative of eukaryotic pseudogenes. This
- will slightly speed the program and may be necessary for non-eukaryotic
- sequences that are flagged as possible pseudogenes but are known to be
- functional tRNAs.
-
------
-
-**Show both primary and secondary structure score components to covariance model bit scores**
-
- This option displays the breakdown of the two components of the
- covariance model bit score. Since tRNA pseudogenes often have one
- very low component (good secondary structure but poor primary sequence
- similarity to the tRNA model, or vice versa), this information may be
- useful in deciding whether a low-scoring tRNA is likely to be a
- pseudogene. The heuristic pseudogene detection filter uses this
- information to flag possible pseudogenes -- use this option to see why
- a hit is marked as a possible pseudogene. The user may wish to
- examine score breakdowns from known tRNAs in the organism of interest
- to get a frame of reference.
-
------
-
-**Show codons instead of tRNA anticodons**
-
- This option causes tRNAscan-SE to output a tRNA's corresponding codon
- in place of its anticodon.
-
------
-
-**Example**
-
-* input::
-
- -Genome Sequence
-
- CELF22B7 C.aenorhabditis elegans (Bristol N2) cosmid F22B7
- GATCCTTGTAGATTTTGAATTTGAAGTTTTTTCTCATTCCAAAACTCTGT
- GATCTGAAATAAAATGTCTCAAAAAAATAGAAGAAAACATTGCTTTATAT
- TTATCAGTTATGGTTTTCAAAATTTTCTGACATACCGTTTTGCTTCTTTT
- TTTCTCATCTTCTTCAAATATCAATTGTGATAATCTGACTCCTAACAATC
- GAATTTCTTTTCCTTTTTCTTTTTCCAACAACTCCAGTGAGAACTTTTGA
- ATATCTTCAAGTGACTTCACCACATCAGAAGGTGTCAACGATCTTGTGAG
- AACATCGAATGAAGATAATTTTAATTTTAGAGTTACAGTTTTTCCTCCGA
- CAATTCCTGATTTACGAACATCTTCTTCAAGCATTCTACAGATTTCTTGA
- TGCTCTTCTAGGAGGATGTTGAAATCCGAAGTTGGAGAAAAAGTTCTCTC
- AACTGAAATGCTTTTTCTTCGTGGATCCGATTCAGATGGACGACCTGGCA
- GTCCGAGAGCCGTTCGAAGGAAAGATTCTTGTGAGAGAGGCGTGAAACAC
- AAAGGGTATAGGTTCTTCTTCAGATTCATATCACCAACAGTTTGAATATC
- CATTGCTTTCAGTTGAGCTTCGCATACACGACCAATTCCTCCAACCTAAA
- AAATTATCTAGGTAAAACTAGAAGGTTATGCTTTAATAGTCTCACCTTAC
- GAATCGGTAAATCCTTCAAAAACTCCATAATCGCGTTTTTATCATTTTCT
- .....
- - organisim : Mixed (general tRNA model)
- - mode : Default
- - disable pseudogene checking : not checked
- - Show both primary and secondary structure score components to covariance model bit scores : not checked
- - Show codons instead of tRNA anticodons : not checked
-
-* output::
-
- Sequence tRNA Bounds tRNA Anti Intron Bounds Cove Hit
- Name tRNA # Begin End Type Codon Begin End Score Origin
- -------- ------ ---- ------ ---- ----- ----- ---- ------ ------
- CELF22B7 1 12619 12738 Leu CAA 12657 12692 55.12 Bo
- CELF22B7 2 19480 19561 Ser AGA 0 0 66.90 Bo
- CELF22B7 3 26367 26439 Phe GAA 0 0 73.88 Bo
- CELF22B7 4 26992 26920 Phe GAA 0 0 73.88 Bo
- CELF22B7 5 23765 23694 Pro CGG 0 0 60.58 Bo
-
-
-
--------
-
-**References**
-
-Todd M. Lowe and Sean R. Eddy
-tRNAscan-SE: A Program for Improved Detection of Transfer RNA Genes in Genomic Sequence Nucl. Acids Res. (1997) 25(5): 0955-964
-doi:10.1093/nar/25.5.0955
-
-
-
-