# HG changeset patch
# User brenninc
# Date 1462781281 14400
# Node ID 40c86e14b6749ca9d90e502b552b42057a9df520
Uploaded first version of tagdust
diff -r 000000000000 -r 40c86e14b674 architecture.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/architecture.xml Mon May 09 04:08:01 2016 -0400
@@ -0,0 +1,42 @@
+
+ Displays a tagdust Architecture file
+
+ macros.xml
+
+
+
+
+
+ cp $architecture.fields.path architecture.txt ;
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+@tagdust-documentation@
+
+
+
diff -r 000000000000 -r 40c86e14b674 macros.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/macros.xml Mon May 09 04:08:01 2016 -0400
@@ -0,0 +1,179 @@
+
+
+
+
+ tagdust
+
+
+
+ tagdust --version | head -n 1 | awk '{ print $2 }'
+
+
+
+
+
+
+
+ echo using architecture ;
+ cat $architecture.fields.path ;
+ echo ;
+
+
+ mkdir output ;
+ tagdust -t\${GALAXY_SLOTS:-4} -o output/data
+ -arch $architecture.fields.path
+ #if $reference_source.reference_source_selector=='history':
+ -ref $reference_source.ref_file
+ #end if
+ #if $reference_source.reference_source_selector=='cached':
+ -ref $reference_source.ref_path.fields.path
+ #end if
+
+
+ echo files in output folder ;
+ ls -al output ;
+ #if $include.barcode_files=="yes"
+ #if $architecture.fields.barcode=="yes"
+ cd output ;
+ ls *_BC_* > $barcode_files
+ #else
+ echo Selected architecture not expected to generate any barcode files > $barcode_files ;
+ echo To avoid this output set Choose to find the barcode files to No >> $barcode_files ;
+ #end if
+ #else
+ #if $architecture.fields.barcode=="yes"
+ echo ;
+ echo Tagdust not included in output at users request! ;
+ echo To get then set Choose to find the barcode files to Yes and run the tool again ;
+ #end if
+ #end if
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+ (include['barcode_files']=='yes')
+
+
+
+
+
+
+
+
+
+
+
+ @misc{
+ TagDust,
+ author = {Timo Lassmann},
+ title = {TagDust on sourceforge},
+ url = {http://tagdust.sourceforge.net/}
+ }
+
+ 10.1093/bioinformatics/btp527
+ 10.1186/s12859-015-0454-y
+
+
+
diff -r 000000000000 -r 40c86e14b674 paired.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/paired.xml Mon May 09 04:08:01 2016 -0400
@@ -0,0 +1,95 @@
+
+ Runs tagdust in paired end mode
+
+ macros.xml
+
+
+
+
+
+ @cat-archiecture@
+ cp $read1_file read1.fastq ;
+ cp $read2_file read2.fastq ;
+ @tagdust-call-minus-files@
+ read1.fastq read2.fastq ;
+ @ls_and_barcode@
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+@tool-documentation@
+
+@tagdust-documentation@
+
+
+
+
diff -r 000000000000 -r 40c86e14b674 single.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/single.xml Mon May 09 04:08:01 2016 -0400
@@ -0,0 +1,87 @@
+
+ Runs tagdust in single end mode
+
+ macros.xml
+
+
+
+
+
+ @cat-archiecture@
+ cp $fastq_file input.fastq ;
+ @tagdust-call-minus-files@
+ input.fastq ;
+ @ls_and_barcode@
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+@tool-documentation@
+
+@tagdust-documentation@
+
+
+
+
diff -r 000000000000 -r 40c86e14b674 test-data/paired_READ1.fq
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/paired_READ1.fq Mon May 09 04:08:01 2016 -0400
@@ -0,0 +1,216 @@
+@NB500968:8:H5CFGAFXX:1:11101:1121:1139___1:N:0:TCGTGAGC+TACTCCTT;FP:27828;RQ:34.83;RQ:-1.00
+GGAGCGTCAGATGTGTATAAGAGACAGGTATTCCCTATAGTCTACATC
++
+EEEEEEEEEEEEEEEAAEEEEAEEEAEEE/EEE/EE
+#
+#So, all_fasta.loc could look something like this:
+#
+#apiMel3 apiMel3 Honeybee (Apis mellifera): apiMel3 /path/to/genome/apiMel3/apiMel3.fa
+#hg19canon hg19 Human (Homo sapiens): hg19 Canonical /path/to/genome/hg19/hg19canon.fa
+#hg19full hg19 Human (Homo sapiens): hg19 Full /path/to/genome/hg19/hg19full.fa
+#
+#Your all_fasta.loc file should contain an entry for each individual
+#fasta file. So there will be multiple fasta files for each build,
+#such as with hg19 above.
+#
+
diff -r 000000000000 -r 40c86e14b674 tool-data/tagdust_architecture.loc.sample
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tool-data/tagdust_architecture.loc.sample Mon May 09 04:08:01 2016 -0400
@@ -0,0 +1,15 @@
+#This is a location file for tagdust reference fasta files
+
+#See tagdust reference manual for architecture recommendatons
+
+#If the architecure file include a barcode HMM (B:) set the nacode field to yes
+#Otherwise leave is as no
+
+#Planemo does not handle commas in value field well so avoid these if including the file in testing.
+
+#file has this format (white space characters are TAB characters):
+#
+#value dbkey name barcode path
+#
+
+
diff -r 000000000000 -r 40c86e14b674 tool_data_table_conf.xml.sample
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_data_table_conf.xml.sample Mon May 09 04:08:01 2016 -0400
@@ -0,0 +1,11 @@
+
+
+
+ value, dbkey, name, path
+
+
+
+ value, dbkey, name, barcode, path
+
+
+
diff -r 000000000000 -r 40c86e14b674 tool_dependencies.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_dependencies.xml Mon May 09 04:08:01 2016 -0400
@@ -0,0 +1,6 @@
+
+
+
+
+
+